WorldWideScience

Sample records for intensivo primer estudio

  1. El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

    Directory of Open Access Journals (Sweden)

    Fernanda Martins Castro

    2015-06-01

    Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

  2. Epidemiología de la sepsis en unidades de cuidado intensivo en Colombia

    Directory of Open Access Journals (Sweden)

    Guillermo Ortíz

    2014-03-01

    Full Text Available Introducción. Actualmente no se cuenta con muchos datos disponibles sobre la sepsis en los países en desarrollo y especialmente en América Latina. Objetivo. Este estudio tuvo como objetivo determinar la frecuencia, las características clínicas y epidemiológicas y las consecuencias de la sepsis en una población de pacientes que requirieron ingreso en algunas unidades colombianas de cuidados intensivos. Materiales y métodos. Este fue un análisis secundario de un estudio prospectivo realizado en un período de seis meses contados a partir del 1° de septiembre de 2007 hasta el 28 de febrero del 2008 en diez unidades médico-quirúrgicas de cuidados intensivos de cuatro ciudades de Colombia. Los pacientes se consideraron elegibles si tenían un diagnóstico probable o confirmado de infección según los registros médicos. Se registraron las características demográficas, los diagnósticos de primer ingreso y las enfermedades concomitantes, el estado clínico y la sepsis, sepsis grave o choque séptico. Resultados. Durante el período de estudio, 826 pacientes fueron ingresados en las unidades de cuidados intensivos seleccionadas para el estudio. De estos pacientes, 421 (51 % desarrollaron sepsis en la comunidad, 361 (44 % en la unidad de cuidados intensivos y 44 (5 % durante la hospitalización en la sala general; 253 pacientes (30,6 % presentaron afectación de un órgano del sistema: 20 % tuvo problemas respiratorios, seguido por problemas en los riñones y el sistema nervioso central con 3,4 % y 2,7 %, respectivamente. Conclusiones. En la muestra de pacientes sépticos, la prevalencia de la sepsis, así como de la mortalidad global, en los pacientes tratados en la unidad de cuidados intensivos fue similar a la reportada en otros estudios.

  3. intensivo

    Directory of Open Access Journals (Sweden)

    Ángela María Salazar-Maya

    2008-01-01

    Full Text Available Objetivo: comprender cómo el equipo de salud valora, jerarquiza y prioriza la higiene de las manos en la unidad de cuidado intensivo de un hospital universitario. Materiales y métodos: metodología cualitativa con enfoque etnográfico. Los datos se construyeron por medio de la observación participante y entrevistas a médicos, enfermeras y auxiliares de enfermería participantes en el estudio, en la unidad de cuidado intensivo de un hospital universitario. Resultados: la higiene de las manos es una práctica contextualizada a condiciones tales como el paciente, el procedimiento y el mundo material, y lleva a los participantes a valorarla, ponderarla y priorizarla. Al profesional de enfermería se le ha delegado la tarea de supervisar el cumplimiento de dicha práctica, lo que le genera conflictos con los otros estamentos. Conclusiones: la higiene de las manos es considerada una práctica episódica, temporal, contextualizada, con restricciones e imperativa. Los participantes la ponderan y jerarquizan según el tipo de paciente, el tipo de procedimiento y el espacio físico donde se encuentre.

  4. Debilidad adquirida en la unidad de cuidados intensivos. Incidencia, factores de riesgo y su asociación con la debilidad inspiratoria. Estudio de cohorte observacional

    Directory of Open Access Journals (Sweden)

    Ladislao Pablo Diaz Ballve

    2017-12-01

    Full Text Available RESUMEN Objetivo: Conocer la incidencia acumulada y analizar los factores riesgo asociados al desarrollo de debilidad adquirida en la unidad de cuidados intensivos y su asociación con la debilidad inspiratoria. Métodos: Estudio de cohorte prospectivo en un solo centro, unidad de cuidados intensivos médico-quirúrgica polivalente. Se incluyeron pacientes adultos, que hayan requerido ventilación mecánica ≥ 24 horas entre julio de 2014 y enero de 2016. No hubo intervenciones. Se registraron datos demográficos, diagnóstico clínico y factores relacionados con el desarrollo de debilidad adquirida en la unidad de cuidados intensivos y Presión inspiratoria máxima. Resultados: Ciento once pacientes incluidos, 66 desarrollaron debilidad adquirida en la unidad de cuidados intensivos, con una incidencia acumulada del 40,5% en 18 meses. El grupo con debilidad adquirida en la unidad de cuidados intensivos presentó mayor edad (55,9 ± 17,6 versus 45.8 ± 16.7, además de más días con ventilación mecánica (7 [4 - 10] versus 4 [2 - 7,3], más días en unidad de cuidados intensivos (15,5 [9,2 - 22,8] versus 9 [6 - 14]. Hubo más pacientes con delirio (68% versus 39%, con hiperglucemia > 3 días (84% versus 59%; y con balance positivo > 3 días (73,3% versus 37%. Todas las comparaciones fueron significativas con p 5 días como predictores independientes para debilidad adquirida en la unidad de cuidados intensivos. La presión inspiratoria máxima baja se asoció a debilidad adquirida en la unidad de cuidados intensivos (p 5 días. La presión inspiratoria máxima ≥ 36cmH2O demostró un alto valor diagnóstico para descartar la presencia de debilidad adquirida en la unidad de cuidados intensivos.

  5. Impacto pronóstico del momento de ingreso y egreso de la unidad de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Héctor Eduardo Moreira

    Full Text Available RESUMEN Objetivo: Determinar el impacto en la mortalidad del día y horario de admisión y alta de la unidad de cuidados intensivos. Métodos: Estudio prospectivo observacional, que incluyó pacientes admitidos entre abril y noviembre de 2014 en la unidad de cuidados intensivos del Hospital Maciel de Montevideo. Resultados: Se analizaron 325 pacientes con una edad de 55 (36 - 71 años y un valor SAPS II de 43 (29 - 58 puntos. No se encontraron diferencias en la mortalidad en unidad de cuidados intensivos de los pacientes al comparar el momento de ingreso (35% el fin de semana versus 31% en los días laborales, p = ns ni el horario de ingreso (nocturnos 35% versus diurnos 31%, p = ns. El momento de egreso se asoció a mayor mortalidad en el hospital (57% en egresos del fin de semana versus 14% en días laborales, p = 0,000. Los factores independientemente asociados a mortalidad hospitalaria luego del alta de unidad de cuidados intensivos fueron la edad mayor de 50 años (OR 2,4; IC95%, 1,1 - 5,4 y el egreso durante el fin de semana (OR 7,7; IC95%, 3,8 - 15,6. Conclusión: Este estudio logró identificar al momento del alta de la unidad de cuidados intensivos como un factor independientemente asociado a mortalidad hospitalaria.

  6. Caracterización de los eventos adversos reportados por enfermería en unidades de cuidado intensivo en Bogotá (Colombia

    Directory of Open Access Journals (Sweden)

    Diana Achury Saldaña

    2017-01-01

    Full Text Available Objetivo:Identificar los eventos adversos (EA reportados por enfermería en algunas unidadesde cuidado intensivo (UCI en Bogotá (Colombia.Método:Se desarrolló un estudio descriptivo, prospectivo. El tamaño de la muestra correspondióa 525 pacientes, durante un periodo de 6 meses. El tipo de muestreo fue por criterio; participaronde forma voluntaria 3 instituciones de salud en Bogotá. Para recolectar información se utilizóun formulario digital on-line. Se realizó un análisis descriptivo con distribución de frecuenciasabsolutas y relativas, utilizando el programa estadísticoSPSSStatistics 23.0, versión 2014.Resultados:Se reportaron 594 eventos adversos presentados en 525 pacientes. Los relacionadoscon el cuidado enfermero ocuparon el primer lugar (38,7 %, seguido del manejo de la vía aérea yla ventilación mecánica (16,1 % y el manejo de accesos vasculares, sondas y drenajes (14,8 %y la infección asociada al cuidado (12,6 %.La ocurrencia de estos eventos adversos predominó en hombres con edad promedio de 64,5 años, enunidades de cuidado intensivo médicas, en el turno de la noche y con unTISS-28 de 20-39 puntos.Conclusiones:Los eventos adversos reportados en el estudio que presentan mayor prevalen-cia están relacionados en su mayoría con el cuidado directo al paciente y el de vía aérea; al serprevenibles indican que se presentaron por alteración en el cumplimiento de los estándaresdel cuidado.

  7. La infección nosocomial. Un reto en las unidades de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Edwin Javier Gordon Zamora

    2018-01-01

    Full Text Available El estudio de la infección nosocomial en las unidades de cuidados intensivos deviene eje central de la asistencia médica y, un pilar del control de su calidad. Estas unidades asumen un elevado número de pacientes críticamente enfermos con comorbilidad, compromiso inmunológico y en contacto con dispositivos invasivos, factores estos que condicionan la diseminación de bacterias multirresistentes, por lo cual se requiere vigilancia e implementación eficiente de las medidas de prevención y control. En este trabajo se intenta abrir el debate en torno a un reto en las unidades de cuidados intensivos: las infecciones nosocomiales.

  8. O cuidado intensivo oferecido ao paciente no ambiente de Unidade de Terapia Intensiva El cuidado intensivo ofrecido al paciente en el ambiente de la Unidad de Cuidados Intensivos Intensive care provided to patients in the environment of Intensive Care Units

    Directory of Open Access Journals (Sweden)

    Marli Terezinha Stein Backes

    2012-12-01

    Full Text Available Estudo qualitativo, partiu da questão: como se dá o cuidado intensivo oferecido ao paciente no ambiente de Unidade de Terapia Intensiva? Teve como objetivo compreender o cuidado intensivo oferecido ao paciente no ambiente de Unidade de Terapia Intensiva Adulto. O método utilizado foi a Grounded Theory. Realizou-se 39 entrevistas com 47 sujeitos diferenciados (pacientes, profissionais da saúde, gestores, profissionais dos serviços de apoio, familiares de três Unidades de Terapia Intensiva Adulto, em Florianópolis/SC, Santa Maria/RS e Pelotas/RS, Brasil, entre junho de 2009 a setembro de 2010. A teoria "Sustentando a vida no ambiente complexo de cuidados em Unidade de Terapia Intensiva", foi delimitada por oito categorias, das quais será focalizada neste artigo a categoria "Cuidando e monitorando o paciente continuamente". Conclui-se que o cuidado intensivo requer um cuidado integral com os pacientes, que vai além do cuidado técnico e inclui as dimensões física, emocional, espiritual e social do ser humano.Este estudio cualitativo se basó en la pregunta: ¿Cómo funciona el cuidado intensivo ofrecido al paciente en el ambiente de la Unidad de Cuidados Intensivos? El artículo tuvo como objetivo comprender el cuidado intensivo ofrecido al paciente en la Unidad de Cuidados Intensivos de Adultos. El método utilizado fue la Grounded Theory. Se llevó a cabo 39 entrevistas con 47 personas de tres diferentes unidades de cuidados intensivos para adultos en Florianópolis/SC, Santa Maria/RS y Pelotas/RS, desde junio 2009 a septiembre de 2010. La teoría "Sosteniendo la vida en el complejo ambiente de cuidados en la Unidad de Cuidados Intensivos", fue delimitada por ocho categorías. En este artículo se centrará la categoría "Asistir y monitorear el paciente continuamente". Se concluye que el cuidado intensivo requiere una atención integral a los pacientes, más allá de la atención técnica e incluye la dimensión física, emocional

  9. Resiliencia y engagement en trabajadores de una unidad de cuidado intensivo

    OpenAIRE

    Gil, Carolina; Fetecua, Marcela

    2017-01-01

    La resiliencia y el engagement son estados mentales que permiten tener una alta capacidad de sobreponerse a las situaciones estresantes, salir fortalecidos, comprometerse y dedicarse más a su labor. Esta Investigación analiza la relación entre estos estados mentales en el personal asistencial de una unidad de cuidado intensivo (UCI). Es un estudio cuantitativo, transeccional de alcance descriptivo-correlacional, con una muestra de 66 trabajadores de un hospital en Cundinamarca (Colombia), qu...

  10. Factores de riesgo asociados a infecciones en pacientes hospitalizados en la Unidad de Cuidados Intensivos (UCI

    Directory of Open Access Journals (Sweden)

    Ruby Elizabeth Vargas-Toloza

    2010-12-01

    Full Text Available Este estudio de abordaje Cuantitativo Descriptivo Transversal busca determinar los factores de riesgos intrínsecos y extrínsecos, medios diagnósticos e incidencia; asociados a Infecciones en los pacientes hospitalizados en la Unidad de Cuidados Intensivos (UCI de la Clínica San José en la ciudad de Cúcuta. La Edad, es un factor predisponente en el desarrollo de infecciones en los pacientes que ingresaron a la Unidad de Cuidados Intensivos (UCI de la Clínica San José durante el periodo evaluado, se observó que la infección fue más frecuente en los adultos mayores de 41 años con un 86.5%. Las enfermedades de base relacionadas con la aparición de infecciones (Diabetes, Enfermedad Pulmonar Obstructiva Crónica (EPOC, Hepatopatía e Insuficiencia Renal, en el estudio no evidenció un comportamiento estadísticamente significativo, sin embargo, el 34.3% de los pacientes que presentaron insuficiencia renal, seguido del 29.9% que presentaron Enfermedad Pulmonar Obstructiva Crónica (EPOC y Diabetes, tienen un mayor riesgo de desarrollar infecciones que los pacientes que carecen de este antecedente durante su tiempo de hospitalización en la Unidad de Cuidados Intensivos (UCI, siendo este un factor de riesgo predisponente en la aparición de las infecciones. Dentro de los procedimientos invasivos más usados están la sonda urinaria, la ventilación mecánica y el catéter venoso central. La incidencia de infección en la población objeto del presente estudio fue de 17,9%. Los agentes infecciosos que estuvieron presentes tanto en sangre, como en orina y secreción bronquial fueron Escherichia coli, Klebsiella y Staphylococcus Aureus, microorganismos altamente contagiosos y perjudiciales.

  11. Bacteriemia asociada a catéter epicutáneo en la unidad de cuidado intensivo neonatal de la Fundación Cardioinfantil

    OpenAIRE

    Pinilla Reyes, Darly Rocio

    2013-01-01

    La bacteriemia asociada a catéter afecta a pacientes en las unidades de cuidado intensivo con una alta morbilidad, mortalidad y aumento de los costos al sistema de salud. Los recién nacidos son la población de más alto riesgo por el mayor uso de catéteres centrales. Objetivo: Caracterizar factores de riesgo para bacteriemia asociada a catéter en la Unidad de Cuidado Intensivo Neonatal de la Fundación Cardioinfantil entre 2005 - 2010 Materiales y método: Estudio descriptivo de corte tra...

  12. Características de las infecciones nosocomiales en el servicio de cuidados intensivos pediátricos del Hospital Vicente Corral Moscoso, Cuenca 2014 -2015

    OpenAIRE

    Salcedo González, Rosa Karina

    2016-01-01

    Objetivo: Determinar las características de las infecciones nosocomiales en el servicio de Cuidados Intensivos Pediátricos del Hospital Vicente Corral Moscoso durante el año 2014 al 2015. Materiales y métodos: estudio descriptivo llevado a cabo en 32 pacientes diagnosticados de infección nosocomial en la Unidad de Cuidados Intensivos Pediátricos del Hospital Vicente Corral Moscoso; los datos fueron recogidos en un formulario; se tabularon en el programa SPSS versión 15 y para el análisis ...

  13. Evaluación del ruido en la unidad de cuidados intensivos neonatal

    Directory of Open Access Journals (Sweden)

    Alessandra Teixeira

    2011-12-01

    Full Text Available Introducción: Con los avances en la tecnología y la investigación llevada a cabo en neonatología, ya es posible ver más allá de lo que podamos para salvaguardar las vidas de recién nacidos (RN, proporcionando una calidad de vida. Para esto necesitamos tener una visión amplia que se ve más allá del individuo, el medio ambiente y el equipo que le rodea. Humanización debe impregnar todas las acciones tomadas en la Unidad de Cuidados Intensivos Neonatales (UCIN. Objetivo: En este contexto, el ruido ambiental emerge como un objeto de estudio de esta investigación tiene como objetivo identificar los niveles de ruido a que están expuestos los recién nacidos ingresados en una unidad específica de cuidados intensivos neonatales y discutirlos a la luz de las normas vigentes país. Materiales y Métodos: Teniendo en cuenta el tema de la parte delantera de esta investigación considera que es importante conocer la legislación que aborda este tema, específicamente el procedimiento estándar de Higiene Profesional Técnica (NHO 01 y la norma 15 (NR15. De acuerdo con la Norma 15 (NR 15 promulgado por el Ministerio de la Ordenanza N º 3214/1978 del Trabajo, actualizado por el Decreto 203/2011, el ruido que se clasifica como el impacto del ruido o el ruido continuo también llamado intermitente, que se caracteriza los picos de energía acústica de menos de 1 (un segundo a intervalos superiores a 1 (un segundo. Resultados: Comenzamos la presentación de los resultados que describen el campo de estudio, los resultados de la investigación discutidos a la luz de las normas vigentes en el país. Discusión y Conclusiones: La institución por área de estudio es un centro de referencia para cuidados intensivos neonatales de la micro-región de Barbacena recibe pacientes de varios lugares. De acuerdo con la Resolución del Directorio N º 7 (RDC 07 se clasifica como un nivel de unidad de cuidadosintensivos II(10. (Rev Cuid 2011; 2

  14. Cuidado humanizado al neonato prematuro y familia: una perspectiva de enfermería. Unidad de cuidado intensivo neonatal. Hospital San Bartolomé. 2015.

    OpenAIRE

    Broncano Vargas, Yrma Nilda

    2016-01-01

    El objeto de estudio es el cuidado humanizado de enfermería al neonato prematuro y familia, desde la perspectiva de enfermería en la Unidad de Cuidados Intensivos Neonatal (UCIN) del Hospital San Bartolomé, Lima Perú. Objetivos: Describir y caracterizar el cuidado humanizado que brinda la enfermera al neonato prematuro y familia en la UCIN, analizar las implicancias del cuidado humanizado al recién nacido prematuro y familia en la salud neonatal. Estudio de naturaleza cualitativa, método desc...

  15. Costos secundarios por infecciones nosocomiales en dos unidades pediátricas de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Navarrete-Navarro Susana

    1999-01-01

    Full Text Available OBJETIVO. Estimar los costos asociados a infecciones nosocomiales en niños tratados en dos unidades de terapia intensiva. MATERIAL Y MÉTODOS. Se realizó un estudio parcial de costos en la Unidad de Cuidados Intensivos Neonatales (UCIN y en la Unidad de Cuidados Intensivos Pediátricos (UTIP de un hospital infantil de tercer nivel de atención médica. Se investigaron los costos de las pruebas diagnósticas y de los recursos terapéuticos empleados, así como el exceso de estancia hospitalaria debida a la presencia de una infección nosocomial. RESULTADOS. Se detectaron 102 infecciones, 46 en UCIN y 56 en UTIP, en el lapso de un año, tiempo que duró el estudio. El costo promedio por infección fue de 91 698 pesos y el gasto global fue de 9.3 millones de pesos. Neumonía, flebitis y septicemia abarcaron 65% de los costos. En los niños infectados se registró una estancia hospitalaria extra de 9.6 días, 13.7 exámenes de laboratorio y 3.3 cultivos en promedio, debido a la presencia de una infección intrahospitalaria. La estancia hospitalaria representó 97% del gasto total. CONCLUSIONES. Esta evaluación representa una estimación de costos directos de infección. Los resultados justifican el establecimiento de programas preventivos agresivos para reducir las complicaciones dentro de los hospitales.

  16. Una tipología de empresas latinoamericanas exportadoras de servicios intensivos en conocimiento y los determinantes de su competitividad internacional

    Directory of Open Access Journals (Sweden)

    Andrés Niembro

    2017-01-01

    Full Text Available Este artículo persigue varios objetivos: por un lado, aportar una primera tipología de empresas latinoamericanas exportadoras de servicios intensivos en conocimiento, y por otro, contribuir al estudio de los determinantes de la competitividad internacional en estos sectores, con evidencia de América Latina, indagando además si la influencia de estos factores difiere entre los distintos tipos de empresas. Sobre la base de evidencia exploratoria de un conjunto de empresas latinoamericanas exportadoras de servicios intensivos en conocimiento se recurre al análisis clúster para identificar diferentes patrones empresariales. El reconocimiento de realidades empresariales heterogéneas y la identificación de impactos diferenciales de los determinantes de la competitividad pueden colaborar para un mejor diseño de medidas de política ajustadas a cada contexto.

  17. Efectividad de una intervención formativa en prevención de úlceras por presión en una unidad de cuidados intensivos quirúrgica: un estudio cuasi experimental Effectiveness of an educational intervention in pressure ulcer prevention in a surgical intensive care unit: a quasi experimental study

    Directory of Open Access Journals (Sweden)

    M.ª Jesús Wandosell Picatoste

    2012-09-01

    Full Text Available Uno de los indicadores más relevantes para evaluar la seguridad del paciente es la incidencia de eventos adversos (EA. Las úlceras por presión (UPP son un EA con una incidencia muy elevada en las unidades de cuidados intensivos. El objetivo de este estudio es valorar la efectividad de una intervención formativa en prevención de UPP a través de la valoración de la incidencia y la gravedad de las lesiones en una unidad de cuidados intensivos quirúrgicos. Se llevó a cabo un estudio cuasi experimental de controles antes-después. Los resultados muestran que la incidencia de UPP disminuye tras la intervención formativa.One of the most relevant indicators to assess patient safety is the incidence of adverse events (AE. Pressure Ulcers (PU are an AE with a high incidence in intensive care units. The aim of this study is to evaluate the effectiveness of a formative intervention on prevention of PU through the assessment of the incidence and the severity of PU in the pre and the post intervention periods, in an intensive care surgical unit. We have carried out a quasi experimental study of pre and post controls. The results show that the incidence of PU is lower after the formative intervention.

  18. Complicaciones de la Ventilación Mecánica. Unidad de Cuidados Intensivos Pediátricos Holguín

    OpenAIRE

    Carlos Alberto Córdova-Vega; Hèctor Pupo-Rodríguez; Andrés Andrés-Matos

    2013-01-01

    Se realizó un estudio prospectivo, descriptivo en pacientes ingresados en la Unidad de Cuidados Intensivos del Hospital Pediátrico de Holguín y que necesitaron ventilación mecánica por un tiempo mayor a las 24 horas, durante el año 2010, con el objetivo de conocer las complicaciones relacionadas con este proceder. Dentro de los resultados encontramos que las afecciones neurológicas (35,29%), las respiratorias y las malformaciones congénitas (17,64%) fueron las principales causas que llevaron ...

  19. Descripción de los sistemas intensivos de engorda de corderos en Yucatán, México

    Directory of Open Access Journals (Sweden)

    Germani Adrián Muñoz-Osorio

    2015-01-01

    Full Text Available El objetivo del estudio fue describir los sistemas intensivos de engorda de corderos en el Estado de Yucatán, México. El estudio se desarrolló de marzo a junio de 2013. Se aplicó una encuesta a productores o responsables de 34 granjas, seleccionadas por conveniencia. La información fue analizada a través de tablas de frecuencias, medidas de tendencia central y análisis de varianza obtenidos con el paquete estadístico STATGRAPHICS® Centurion XV. Los resultados mostraron que los sistemas intensivos de engorda de corderos se diferencian básicamente por dos tipos de alojamiento: a corrales a nivel del suelo (SICS y b corrales elevados con piso de rejilla (SICE. Los genotipos están formados por la cruza de razas Pelibuey, Dorper y Katahdin, principalmente (93.94 %. La alimentación se basa en la utilización de concentrados de marcas comerciales (47.06 %, elaborados en la granja (47.06 % y elaborados por proveedores informales (5.88 %. El manejo sanitario consiste en la vacunación (79.41 % y desparasitación de los animales (100 %. Se encontró, un mejor comportamiento productivo de los corderos de engorda en SICE comparado con aquellos de SICS. La venta de corderos en pie (91.18 % es la principal fuente de ingresos económicos, con un precio de $29.75/kg. La mayoría de los productores (67.65 % comercializan a sus animales en la unidad de producción. Es necesario hacer una evaluación prospectiva de los SICE y los SICS desde el punto de vista productivo y económico.

  20. Dificultades para ofrecer cuidados al final de la vida en las unidades de cuidados intensivos. La perspectiva de enfermería

    OpenAIRE

    Juan Francisco Velarde-García; Raquel Luengo-González; Raquel González-Hervías; Sergio González-Cervantes; Beatriz Álvarez-Embarba; Domingo Palacios-Ceña

    2017-01-01

    Objetivo: Describir las dificultades percibidas por el personal de enfermería para prestar cuidados al final de la vida al paciente grave dentro de la unidad de cuidados intensivos (UCI). Método: Estudio cualitativo fenomenológico descriptivo. Se aplicó un muestreo por propósito y de bola de nieve. Las enfermeras debían tener una experiencia mínima de 1 año en UCI. Se incluyeron 22 participantes. Los datos se recopilaron mediante entrevistas en profundidad (no estructuradas y semiestructur...

  1. Afrontamiento y adaptación en pacientes egresados de unidades de cuidado intensivo

    Directory of Open Access Journals (Sweden)

    Inna Elida Flórez-Torres

    2011-01-01

    Full Text Available Objetivo: describir la capacidad de afrontamiento y adaptación en pacientes egresados de unidades de cuidado intensivo de la ciudad de Cartagena, Colombia. Método: estudio descriptivo, realizado en 171 pacientes egresados de unidades de cuidados intensivos durante el segundo semestre de 2009. Se empleó la Escala de medición del proceso de afrontamiento y adaptación de Callista Roy. Para valorar los factores que miden las estrategias y los recursos de afrontamiento para la adaptación se utilizaron medidas de tendencia central y coeficiente de variación. Resultados: el 50,3 % de los participantes fueron mujeres y 49,7 % hombres. La capacidad de afrontamiento y adaptación fue del 63,2 %, el 19,9 % presentó mediana capacidad. La baja capacidad reportó 1,2 %. Por factores, el proceso de alerta presentó una mayor puntuación, con 46,2 %, en alta capacidad en las estrategias de afrontamiento, y en el procesamiento sistemático, el 45,0% se ubicó en muy alta capacidad en cuanto a los recursos utilizados para la adaptación. Conclusión: los pacientes reflejaron un estilo de afrontamiento activo con estrategias centradas en el problema tanto cognitivas como comportamentales, percibiendo la situación como controlable. El Modelo de Roy permite a las enfermeras identificar en los pacientes estrategias adecuadas o inefectivas y orientar el cuidado.

  2. Contratación de la mano de obra y desempeño en los servicios intensivos en conocimiento: Una visión del capital intelectual

    Directory of Open Access Journals (Sweden)

    Eva Rimbau-Gilabert

    2014-04-01

    Full Text Available Objeto: El desempeño de las actividades de servicios de las empresas manufactureras, de la misma forma que las de los servicios intensivos en conocimiento, puede verse afectada por las formas de contratación de la mano de obra utilizadas en ellas. Se estudia el impacto del uso de trabajo contingente (temporal y autónomo sobre la productividad del trabajo en las empresas de servicios intensivos en conocimiento. Para desarrollar las hipótesis, desde el punto de vista teórico se tiene en cuenta el impacto potencial del trabajo contingente sobre el capital intangible de la empresa, así como los resultados de la literatura empírica. Diseño/metodología: Se analizan los datos de una muestra de 279 empresas de servicios intensivos en conocimiento localizadas en Cataluña, mediante dos modelos de regresión lineal. Aportaciones y resultados: Los resultados muestran que el empleo de formas de trabajo no permanentes, como el trabajo temporal y los trabajadores autónomos, tiene un impacto negativo en la productividad del trabajo. No existe, en cambio, una relación cuadrática entre estas variables. Limitaciones: La muestra utilizada procede exclusivamente de Cataluña (España, no es perfectamente extrapolable al conjunto de empresas de servicios intensivos en conocimiento y se obtuvo en la fase alcista del ciclo económico. El diseño del estudio es transversal. La clasificación de las empresas como intensivas en conocimiento es dicotómica, en función del sector al que pertenecen. Implicaciones prácticas: Las decisiones sobre la contratación de mano de obra en actividades de servicios de alto valor añadido deberían minimizar las formas de trabajo contingentes, si quieren mejorar su productividad. Implicaciones sociales: Un modelo productivo que pretenda potenciar los servicios de mayor valor añadido no puede descansar sobre la base de un mercado laboral en el que las empresas utilizan una elevada proporción de trabajo contingente en su

  3. Causas de reintervenciones quirúrgicas por complicación postoperatoria en pacientes de una unidad de cuidados intensivos quirúrgicos sometidos a cirugía abdominal.

    Directory of Open Access Journals (Sweden)

    Andrea Mendiola

    2012-04-01

    Full Text Available Objetivos: Describir las causas de las reintervenciones luego de una cirugía abdominal en pacientes de una unidad de cuidados intensivos quirúrgicos de un hospital general. Material y métodos: Estudio prospectivo, tipo reporte de casos. Se incluyeron a los pacientes postoperados de cirugía abdominal, hospitalizados en la Unidad de Cuidados Intensivos Quirúrgicos del Hospital Nacional Cayetano Heredia y quienes requirieron de reintervención quirúrgica entre febrero de 2009 y enero de 2010 por una complicación postoperatoria. Resultados: El hallazgo más frecuente fue la perforación en 31,6%, seguido de absceso abdominal 21,1% y dehiscencias 21,1%. Conclusiones: Las perforaciones fueron los hallazgos más frecuentes, siendo su frecuencia mayor a lo reportado en la literatura. La incidencia de reintervención fue de 15%.

  4. Técnica de respiración Jacobson para reducir el estrés de enfermeras de unidades de cuidados intensivos

    OpenAIRE

    Téllez Sánchez, Anna María

    2013-01-01

    Problema del estudio: El sector de enfermería perteneciente a las Unidades de Cuidados Intensivos presentan estrés, y se ofrece la Técnica de respiración Jacobson como herramienta para disminuir los niveles y los problemas derivados del estrés. Objetivo general: Evaluar la eficacia de la técnica de respiración Jacobson sobre el estrés en los profesionales de enfermería de UCI. Objetivos específicos: Diseñar un taller de respiración de la técnica Jacobson, para enfermería de UCI; comparar l...

  5. Caracterización de pacientes con paludismo grave por Plasmodium falciparum en una unidad de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Alberto García Gómez

    2017-12-01

    Full Text Available Introducción: el paludismo es la enfermedad parasitaria más importante del ser humano, causa anualmente entre uno y tres millones de muertes. Objetivos: caracterizar a los pacientes con paludismo grave por Plasmodium falciparum ingresados en una unidad de cuidados intensivos. Métodos: se realizó un estudio observacional, descriptivo en una Unidad de Cuidados Intensivos en Angola, de julio de 2014 hasta julio de 2016. La serie quedó constituida por 485 pacientes. Resultados: la serie representó el 99,6 % de los ingresos. La edad media fue de 23,4 ± 11,2 años. Predominaron el sexo masculino (66,4 % y los grupos de edades de 30 años o menos (83,6 %. La proporción del sexo masculino/femenino fue de 1,97:1. La mortalidad fue de 43,1 %. El sexo femenino tuvo mayor proporción de fallecidos (61 %. Fue más alto el por ciento de fallecidos en los que presentaron parasitemia >= 50000 x mm3. La media del valor del Acute Physiology, Age, Chronic Health Evaluation II fue de 14,8 ± 5,4; en los fallecidos fue superior que en los vivos (17,6 vs 12,3. Las complicaciones más frecuentes fueron de tipo neurológicas (90,1 %, hematológicas (77 %, respiratorias (61,8 %, hepáticas (58,7 %, y renales (40,3 %. El 51,6 % de los pacientes recibieron ventilación mecánica. Conclusiones: los jóvenes representaron la mayor parte de los ingresos por malaria en la unidad de cuidados intensivos, un porcentaje alto requirió ventilación mecánica, la mortalidad en las mujeres fue mayor y la global elevada.

  6. Colonización por Staphylococcus aureus resistente a la meticilina en una unidad de cuidados intensivos de adultos de un hospital colombiano: caracterización fenotípica y molecular con detección de un clon de circulación en la comunidad

    Directory of Open Access Journals (Sweden)

    Narda María Olarte

    2010-09-01

    Conclusiones. El 7,2% de los pacientes que ingresaron a la unidad de cuidados intensivos estaban colonizados con SARM. Éste es el primer reporte de colonización por aislamientos de SARM-ST8-SCCmec IVc adquirido en la comunidad y relacionado genéticamente con el clon pandémico USA300-0114 en Colombia.

  7. Reconhecimento materno na Unidade de Cuidado Intensivo Neonatal

    Directory of Open Access Journals (Sweden)

    Monika Wernet

    2015-04-01

    Full Text Available RESUMO Objetivo: analisar experiências maternas em Unidade de Cuidado Intensivo Neonatal, com foco nas relações de reconhecimento. Método: estudo qualitativo, desenvolvido na perspectiva da hermenêutica gadameriana, fundamentado no conceito honnethiano de reconhecimento. Foram entrevistadas, em profundidade, dez mães de crianças internadas em Unidade de Cuidado Intensivo Neonatal. Resultados: há comprometimentos no processo de reconhecimento materno na unidade e, como desdobramento, surgem sentimentos de obrigação e insegurança para o cuidado do filho e fragilidades na autoestima. Conclusão: as interações com os profissionais de saúde e as normas e protocolos ali existentes promovem vulnerabilidades e comprometem o reconhecimento e a autonomia materna.

  8. Proyecto de explotación y construcción de un cebadero en sistema Intensivo para 216 terneros en Velilla de la Sierra (Soria)

    OpenAIRE

    Borjabad Arancón, Ana Isabel

    2017-01-01

    El presente documento corresponde al Trabajo Fin de Grado del alumno Ana Isabel Borjabad Arancón para la Titulación de GRADO EN INGENIERIAS AGRICOLA Y MEDIO RURAL. EL objeto del proyecto consiste en la realización de una explotación de ganado vacuno intensivo, denominado cebadero, incluyendo en dicha realización todas las construcciones necesarias así como el estudio y programa de manejo de la explotación. El promotor del proyecto es un agricultor de Velilla de la Sierra,...

  9. Aproximación a una escala de valoración de úlcera por presión en la unidad de cuidados intensivos del Complejo Hospitalario de Navarra - A

    OpenAIRE

    Saboya Saboya, Liz Amparo

    2013-01-01

    Las ulceras por Presión (UPP) son lesiones de rápida aparición y lenta curación, donde la frecuencia en pacientes críticos, en la Unidad de Cuidados Intensivos (UCI) representa hoy en día un grave problema. Los pacientes son más vulnerables a su aparición durante las primeras semanas de ingreso en la unidad, incrementándose cuando el paciente tiene mayor gravedad, pudiendo llegar incluso hasta la muerte. Para ello el primer paso en su prevención consistirá en la determinación de las UPP, a tr...

  10. Estudio económico de la infección nosocomial en una unidad de cuidados intensivos pediátricos

    Directory of Open Access Journals (Sweden)

    Francisco Felipe Martin

    2000-03-01

    Full Text Available Se realizó un estudio prospectivo-descriptivo de aquellos pacientes que adquirieron una infección nosocomial en los diferentes servicios del hospital y que por la gravedad de ella requirieron de su traslado a la Unidad de Cuidados Intensivos (UCI del Hospital Pediátrico Provincial Docente de Sancti Spíritus, durante un período de 2 años. Se valoró la repercusión económica que ocasionaron estos pacientes mediante diferentes variables, tal como el promedio de estadía que fue superior a los ingresados por otras causas en la UCI; se destaca cómo se incrementaron los costos por medicamentos, para ser menor en hemoderivados y complementarios. Se determinó el costo total que ocasionaron estos pacientes que fue de $ 30 392,60, lo que representó el 5,23 % de los gastos del servicio y que hubiesen sido suficientes para cubrir aproximadamente 40 días de funcionamiento de la UCI. La infección intrahospitalaria no sólo constituye una complicación generalmente grave y que pone en peligro la vida del paciente, sino también implica un gasto económico adicional por una afección que puede y debe ser evitada.A prospective-descriptive study was performed in those patients with acquired nosocomial infection in different hospital services, and because of its severity, was necessary its transfer to Intensive Care Unit (ICU of Teaching Provincial Hospital of Sancti Spíritus province, for a period of 2 years. We assessed financial burden produced by this situation through different variables, such as, stage average was higher to that of admitted in ICU by other causes. We emphasize how drug costs were increased, which were lower to hemoderivatives and complementary ones. Total cost incured by these patients was of $30 392,60, accounted for 5,23 % of service costs otherwise enough to cover almost 40 days of work in ICU. Intrahospital infection, not only is a generally severe complication that threaten life of patient but also involve a further

  11. Profilaxis para sangrado por ulceras de estrés en la unidad de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    J.M. Avendaño-Reyes

    2014-01-01

    Conclusiones: La hospitalización en la unidad de cuidados intensivos por sí sola no justifica la profilaxis. Los IBP son por lo menos tan efectivos como los H2RA. Debemos individualizar el tratamiento de cada paciente en la unidad de cuidados intensivos, determinando el riesgo y evaluando la necesidad de comenzar la profilaxis.

  12. Secuencia rápida de intubación en cuidados intensivos

    OpenAIRE

    Poveda Jaramillo, Ricardo; Dueñas Castell, Carmelo; Ortiz Ruiz, Guillermo

    2013-01-01

    Introducción: El médico que trabaja en cuidados intensivos debe tener la habilidad para enfrentarse con éxito a los pacientes que necesitan aislamiento de la vía aérea debido a su pobre condición ventilatoria. El objetivo del presente artículo es revisar el estado actual del conocimiento en torno a la intubación de secuencia rápida en pacientes de la unidad de cuidados intensivos (UCI) y resumir lo que se debe hacer para reducir al máximo los riesgos durante la intubación de un paciente críti...

  13. Factores que influyen sobre la aparición de infecciones hospitalarias en los pacientes de cuidados intensivos Factors influencing hospital infection in patients in the intensive care unit

    OpenAIRE

    Aurora Llanos-Méndez; Carmen Díaz-Molina; José Luis Barranco-Quintana; Visitación García-Ortúzar; Rafael Fernández-Crehuet

    2004-01-01

    Objetivo: La acumulación de factores de riesgo en los pacientes atendidos en el hospital es uno de los elementos que condicionan el aumento de la infección nosocomial y su mayor frecuencia en las unidades de cuidados intensivos (UCI). Nuestro objetivo es la identificación de los factores de riesgo de la infección nosocomial en la UCI de nuestro hospital. Métodos: Se efectuó un estudio de cohortes prospectivo sobre los 1.134 pacientes ingresados, al menos durante 24 h en dicha UCI durante el a...

  14. Valoración de la postura bípeda en futbolistas juveniles de élite, en período de tecnificación, antes y después del tratamiento quiropráctico

    OpenAIRE

    Olaru, Angela

    2009-01-01

    Se hizo un estudio de valoración de la postura bípida en futbolistas juveniles de élite, hombres y mujeres. Se crearon dos grupos asignados aleatoriamente, un grupo intervenido o grupo tratado y un grupo de comparación o grupo control. Se hicieron dos experimentos iguales con dos muestras de jugadores de futbol juveniles de alto rendimiento durante la temporada de entrenamiento intensivo, o tecnificación. La duración de cada experimento fue de 6 semanas cada uno. El primer experimento se hizo...

  15. Construcción de una identidad participativa: socialización en el primer año de estudios universitarios

    Directory of Open Access Journals (Sweden)

    José Luis Suárez Domínguez

    2017-01-01

    Full Text Available Este artículo explora la forma en cómo los estudiantes universitarios construyen una identidad de participación política mediante la socialización que ellos despliegan en el primer año de estudios dentro del área de humanidades en la Universidad Veracruzana. Esta socialización se condensa en la integración de diversos grupos que van complejizándose y cambiando su forma a lo largo del tiempo. Los grupos se articulan, a su vez, mediante un conjunto de prácticas que combinan tiempos, interacciones específicas y orientaciones diversas, generando con ello un sentido de pertenencia a la escuela al definirla bajo ciertos esquemas de legitimidad y reconocerla como un espacio válido desde el cual es posible formar parte de diversas actividades de protesta social.

  16. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  17. Inotrópicos en el postoperatorio de cirugía cardiovascular: estudio de corte transversal

    Directory of Open Access Journals (Sweden)

    Luis A. Muñoz

    2014-07-01

    Conclusión: En casi la mitad de los pacientes en postoperatorio de cirugía cardiovascular se utilizó un agente inotrópico, de los cuales la adrenalina fue la más frecuente, seguida de la norepinefrina; el inodilatador utilizado fue la dobutamina. No se utilizaron inotrópicos sensibilizadores del calcio y en baja frecuencia inhibidores de la fosfodiesterasa III con resultados similares en cuanto a estancia en la unidad de cuidados intensivos y mortalidad respecto a estudios en otras poblaciones.

  18. O ensino de cuidados críticos/intensivos na formação do enfermeiro: momento para reflexão La educación en cuidados críticos/intensivos en la formación de enfermeros: circunstancias para la reflexión Teaching critical/intensive care in nursing education: a moment of reflexion

    Directory of Open Access Journals (Sweden)

    Margarete Marques Lino

    2008-12-01

    Full Text Available Este estudo teve como objetivo re(pensar a disciplina de cuidados intensivos no currículo de graduação em enfermagem, pontuando aspectos relevantes de sua inserção, considerando a capacitação e a qualificação profissional, a necessidade do mercado de trabalho e uma formação reflexiva e crítica acerca das competências profissionais do enfermeiro, por meio de referencial teórico.Estudio que tuvo por objetivo repensar sobre la asignatura de cuidados intensivos en el programa de post-grado en enfermería, indicando aspectos relevantes sobre su introducción, considerando la capacitación y la calificación profesional, la necesidad del mercado de trabajo y la formación reflexiva y crítica sobre las competencias profesionales del enfermero, a través de su fundamento teórico.The aim of the present study was to rethink the Critical Care Course in the undergraduate nursing curriculum, analyzing relevant issues of its insertion, considering professional training and qualification, the demands of the job market and a critical reflection of the nurse's professional competences, according to a theoretical reference framework.

  19. Autonomía y ajuste académico: un estudio con estudiantes portugueses de primer año

    Directory of Open Access Journals (Sweden)

    Ana Paula Soares

    2007-01-01

    Full Text Available Los niveles de autonomía psicológica de los alumnos desempeñan un papel importante en su ajuste a las presiones y desafíos de la vida universitaria. En este sentido, el presente estudio descriptivo analiza las relaciones entre los niveles de autonomía de los estudiantes en su entrada en la Enseñanza Superior y la calidad de su ajuste académico al final del primer año. Se aplicó el Iowa Developing Autonomy Inventory (IDAI en el inicio del año lectivo y el Questionário de Vivências Académicas (QVA al final de ese año a una muestra de 420 alumnos de primer año de la Universidade do Minho. Los resultados revelan que los alumnos poseen percepciones bastante positivas en cuanto a sus niveles de autonomía en las áreas de Gestión del tiempo, Movilidad e Interdependencia, y niveles más bajos en la Gestión del dinero, observándose algunas oscilaciones en función del género. Por otro lado, los alumnos cuya entrada en la Enseñanza Superior no implicó su abandono del hogar familiar, especialmente los de sexo masculino, presentan niveles más elevados de ajuste académico. Finalmente, los resultados sugieren que el ajuste académico se encuentra asociado a los niveles de autonomía de los alumnos, en particular en lo que concierne a la Gestión del tiempo, Independencia emocional de sus compañeros e Interdependencia.

  20. Complicaciones del trauma craneoencefálico severo en la unidad de cuidados intensivos pediátricos

    Directory of Open Access Journals (Sweden)

    Andrés Andrés Matos

    2011-09-01

    Full Text Available Introducción: el trauma craneoencefálico severo es responsable de serias complicaciones médicas que exacerban la lesión cerebral secundaria, y frecuentemente son la causa de muerte. Ojetivo: conocer las particularidades de las complicaciones médicas en pacientes con trauma craneoencefálico severo en la unidad de cuidados intensivos del hospital pediátrico "Octavio de la Concepción y de la Pedraja" durante los años comprendidos entre 2007-2009. Métodos: estudio descriptivo en pacientes con trauma craneoencefálico, durante el período comprendido entre los años 2007-2009, para analizar las complicaciones que influyeron en su evolución clínica. Resultados: la edad más representada fue la comprendida entre los 11-15 años (56,90 %; los pacientes incluidos en el grupo de 1-5 años resultaron más vulnerables a las complicaciones médicas. Las fracturas inestables (62,96 %, la rotura de vísceras macizas (51,85 % y la insuficiencia respiratoria (44,44 % fueron las manifestaciones clínicas más evidentes al momento del ingreso. En la Unidad de Cuidados Intensivos las complicaciones médicas frecuentes resultaron ser los trastornos hidroelectrolíticos (94,28 % y la desnutrición (77,14 %. La hiperglicemia y el distrés respiratorio se relacionaron de manera significativa con la mortalidad. El 92,59 % de los fallecidos sumaron 3 puntos en la escala de Glasgow. La ventilación mecánica fue independiente de las complicaciones médicas. Conclusiones: los traumas de cráneo severos son la base para el desarrollo de varias y graves complicaciones que plantean muchos problemas en la práctica médica.

  1. Virus sincicial respiratorio: presentación, manejo y prevención de un brote intrahospitalario en una unidad de cuidados intensivos neonatales de Lima

    Directory of Open Access Journals (Sweden)

    T Paredes

    2012-01-01

    Full Text Available El virus sincicial respiratorio (VSR es el principal patógeno causante de infecciones del tracto respiratorio bajo durante el primer año de vida y ocasiona un elevado índice de hospitalización en niños menores de 12 meses; la presentación clínica severa y su aparición como brotes epidemiológicos en las unidades con recién nacidos prematuros representa un riesgo elevado de morbimortalidad. Se realiza la presentación de dos casos y el análisis sobre la importancia del diagnóstico precoz, el manejo individualizado y las medidas de control de infecciones como factores que reducen la morbimortalidad en estas situaciones y previenen la diseminación de los casos en una unidad de cuidados intensivos neonatales (UCIN.

  2. Lactancia materna, alimentación artificial y el primer contacto con azúcar

    Directory of Open Access Journals (Sweden)

    Fabian Calixto Fraiz

    2013-01-01

    Full Text Available Objetivo: Este estudio evaluó los cambios en el patrón de lactancia materna, alimentación artificial y en la introducción de azúcar en la dieta de niños de 0 a 36 meses, a través de dos estudios, con un intervalo de 13 años en la ciudad de Curitiba, Paraná, Brasil. Material y métodos: Poblaciones semejantes de una misma región geográfica fueron evaluadas a través de un cuestionario, en los años de 1993 y 2006, envolviendo, respectivamente, las madres de 180 y 94 niños. Introducción de azúcar en la dieta fue considerada precoz cuando ocurrió antes del 6º mes completo de vida. Los datos fueron analizados estadísticamente a través del test de qui-cuadrado y test exacto de Fisher (α= 0,05. Resultados: Hubo diferencias en la frecuencia del primer contacto con azúcar (p <0,001, que ocurrió en el primer mes de vida en 61,7% de los niños del primer estudio y en sólo 3,2% de los niños del segundo estudio. Hubo diferencias en el patrón de lactancia materna (p = 0,02, siendo la prevalencia de niños amamantados mayor en el segundo estudio. No fueron encontradas diferencias estadísticamente significativas en la prevalencia de uso de biberón, uso de biberón durante la noche y lactancia materna durante la noche, así como en el uso de biberón conteniendo azúcar. Conclusiones: Estos resultados indican que la lactancia materna puede, además de sus varias ventajas, también promover el aplazamiento de la introducción de azúcar en la dieta infantil. Nuevas investigaciones son necesarias para confirmar esta hipótesis.

  3. Características de emprendimiento social de los jóvenes en estudios previos a los universitarios

    OpenAIRE

    Lopez de Toro, Cristobal

    2014-01-01

    El presente Trabajo de Fin de Máster pretende indagar en las características del emprendimiento social en jóvenes en estudios previso a los universitarios. Para ellos en primer lugar se plantea el marco teórico general, mediante la revisión de varios estudios que profundizan en el concepto de emprendimiento social. En un primer apartado analizamos la conceptualización del emprendimiento social. Para ello comenzamos revisando las características del emprendimiento, con independencia de su v...

  4. Inventario de necesidades de los familiares de los pacientes egresados de la unidad de cuidado intensivo

    Directory of Open Access Journals (Sweden)

    Dianne Sofía González-Escobar

    2014-12-01

    Full Text Available Objetivo: Identificar las necesidades de los familiares de los pacientes hospitalizados en la unidad de cuidado intensivo de una institución de salud. Materiales y Métodos: Se realizó un estudio cuantitativo de tipo descriptivo de corte transversal. Se entrevistaron a 144 familiares que cumplieron los criterios de inclusión. Para la recolección de información se empleó el Inventario de Necesidades y Estresores de Familiares en Terapia Intensiva. Resultados: La necesidad de información fue catalogada por el 95.1% de los familiares como muy importante, y Al analizar el grado de satisfacción de las 43 necesidades, se constató que el 96.5% de los familiares señala todas las necesidades como muy importantes. Conclusiones El reconocimiento e inclusión de la familia de los pacientes en los procesos de atención demanda cambios fundamentales en la visión y en la organización de las instituciones de salud.

  5. Efectividad del modelo de cuidado de enfermería para la familia de paciente con infarto agudo al miocardio en la unidad de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    David Jahel Garcia Avendaño

    2015-05-01

    Full Text Available Introducción: Este protocolo de investigación tiene la finalidad de intervenir con la familia y determinar la efectividad del Modelo de Cuidado de Enfermería para la Familia de Paciente con Infarto Agudo al Miocardio (IAM en la Unidad de Cuidados Intensivos (UCI. Materiales y Métodos: Estudio descriptivo de intervención familiar. Resultados y Discusión: El 100% de las familias respondió afirmativamente que la enfermera familiar les informo sobre los cuidados a realizar en la familia según las necesidades detectadas, estableció un plan de intervención en la familia mismo que cumplió y se interesó para que dentro de lo posible la estancia en la familia sea agradable. Conclusiones: Los resultados de esta investigación de intervención a las familias de paciente con IAM en las UCI aporta resultados que apoyan la importancia de aplicar un Modelo de Cuidado de Enfermería Familiar en dichas unidades.Cómo citar este artículo: García DJ, Estrada MC, Gallegos M, Antuna AB. Efectividad del modelo de cuidado de enfermería para la familia de paciente con infarto agudo al miocardio en la unidad de cuidados intensivos. Rev Cuid. 2015; 6(1: 923-31. http://dx.doi.org/10.15649/cuidarte.v6i1.166

  6. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  7. Infección del tracto urinario por uso del catéter vesical en pacientes ingresados en cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Susana Virgen Fong Reyes

    2014-11-01

    Full Text Available Se realizó un estudio observacional, descriptivo y transversal de 37 pacientes con infección urinaria luego de la utilización de catéter vesical, ingresados en la sala de Cuidados Intensivos del Hospital Clinicoquirúrgico Docente "Saturnino Lora Torres" de Santiago de Cuba desde mayo de 2011 hasta abril de 2012, con vistas a identificar las causas principales que la ocasionaron. Se halló predominio de los hombres mayores de 60 años que permanecieron expuestos al proceder durante más de 15 días (56,7 %, dado principalmente por la existencia de microorganismos en las floras intestinal y ambiental exógena. Por otra parte, los factores que propiciaron la infección estuvieron asociados a la prolongación del cateterismo vesical, al grupo etario (tercera edad, a la presencia de bacteriuria, al sistema abierto de drenaje y a la administración de antibióticos previa aparición de cepas bacterianas multirresistentes

  8. Cuidado domiciliar intensivo: uma possível realidade do Sistema Único de Saúde? ¿Cuidado domiciliar intensivo: una posible realidad del Sistema Único de Salud? Intensive home-based care: is it a possible reality for the public health system?

    Directory of Open Access Journals (Sweden)

    Tatiane da Costa Lima

    2004-12-01

    Full Text Available Investigação de abordagem qualitativa que se enquadra como um estudo exploratório de caso individual. Cuja questão norteadora configurou-se em indagar como o Sistema Único de Saúde (SUS disponibiliza o cuidado domiciliar intensivo. Os objetivos do estudo foram: analisar como é disponibilizado este suporte de saúde: qual o tipo de assistência prestada e como é a manutenção e garantia dos equipamentos; visibilizar como o sujeito deste estudo obteve este serviço: como o mesmo chegou até ele e quanto tempo demora. Os resultados revelam que os caminhos para se obter um suporte à vida são cercados de obstáculos e que este trajeto percorrido em busca de uma assistência domiciliar pela dinâmica do SUS envolve burocracia, profissionais e equipamentos que em muitas situações dificultam o acesso da população.Investigación de abordaje cualitativa que se encuadra como un estudio exploratorio de caso individual. Cuya cuestión norteadora se configuró en indagar cómo el Sistema Único de Salud (SUS pone a disposición el cuidado domiciliar intensivo. Los objetivos del estudio fueron: analizar como se pone a disposición este soporte de salud: cuál es el tipo de asistencia prestada y cómo es el mantenimiento y la garantía de los equipos; ver cómo el sujeto de este estudio obtuvo este servicio: cómo el mismo llegó hasta él y cuánto tiempo tarda. Los resultados revelan que los caminos para obtenerse un soporte a la vida están cercados de obstáculos y que este trayecto recorrido en búsqueda de una asistencia domiciliar por la dinámica del SUS involucra burocracia, profesionales y equipos que en muchas situaciones dificultan el acceso de la población.A qualitative investigation characterized as an exploratory study of individual case. The guiding point was inquiring into how the Public Health System (SUS provides intensive home-based care. The study was aimed at analyzing how this health support is made available - that is

  9. Costos de neumonia nosocomial en una unidad de cuidados intensivos en Cartagena, Colombia

    Directory of Open Access Journals (Sweden)

    Arnaldo Sanmartin-Ávila

    Full Text Available Resumen Objetivo: Estimar el exceso de costos directos de atención atribuible a la neumonía asociada a ventilador mecánico en una unidad de cuidados intensivos de adultos en la ciudad de Cartagena durante los años 2009 al 2014. Material y Método: Se plantea un estudio de evaluación económica parcial centrado en el análisis de costos directos de atención contrastando los escenarios de neumonía asociada a ventilador mecánico versus los escenarios sin neumonía asociada a ventilador mecánico. La población de estudio la constituye 23 pacientes con neumonía asociada a ventilador mecánico. Del mismo modo, se tomaron 46 controles. La información correspondiente a los costos directos se obtuvo a través del departamento de costos de la institución hospitalaria. Se estimó la razón de costos que permite establecer el exceso de costo atribuible a la enfermedad nosocomial. Resultados: La estancia promedio en los casos fue de 47 días mientras que en los controles fue de 9 días. El costo promedio de un caso de neumonía asociada a ventilador mecánico fue de US$ 44.354 mientras que el de un control fue de US$ 5.037. Discusión: El exceso de costo promedio total así como el incurrido en antibióticos y en estancia resultan ser mucho más altos que los encontrados en otros estudios realizados. Conclusiones: Un caso de neumonía asociada a ventilador mecánico cuesta 10 veces más con respecto a los medicamentos y 8 veces más con relación a exámenes de laboratorio se insumos. La estancia resulta ser 6,6 veces más costosa que cuando no se presenta esta patología. El costo que se asume en antibióticos es 7,8 veces más alto. Los casos de neumonía asociada a ventilador mecánico cuestan en promedio 8,8 veces más que los controles.

  10. PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA

    OpenAIRE

    BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO

    2004-01-01

    Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.

  11. Evaluación de la Calidad del Cuidado de Enfermería en la Unidad de Cuidados Intensivos

    Directory of Open Access Journals (Sweden)

    Claudia Andrea Ramírez Perdomo

    2013-06-01

    Full Text Available El objetivo del estudio fue describir y correlacionar la calidad del cuidado de enfermería percibida por los pacientes en la Unidad de Cuidados Intensivos (UCI en una institución de IV nivel del municipio de Neiva. Estudio cuantitativo, descriptivo, correlacional y transversal. La muestra estuvo conformada por 119 usuarios hospitalizados en la UCI. El instrumento utilizado fue el EVACALEN (Evaluación de la Calidad en Enfermería elaborado por los autoras de la investigación. Para el análisis de datos se aplicaron estadísticos como: medidas de tendencia central, tablas de frecuencia, tablas generales y correlación de Pearson. Conclusiones: la categoría estructura logra una calificación mala en el 17,6% de los casos, regular en el 43,7% y buena en el 38,7%; la categoría procesos adquiere una calificación de mala en el 5% y regular en el 95%; la categoría resultados registra una calificación de mala en el 17,6%, regular en el 63% y buena en el 19,3%. La versión del cuestionario para evaluar la calidad del cuidado de enfermería consta de 44 ítems; mediante la determinación del Alfa de Cronbach del instrumento, con un valor de 0,848, confirmando así la validez y confiabilidad para medir la calidad del cuidado de enfermería.

  12. Competitividad del comercio internacional de servicios intensivos en conocimiento de México, Chile, Colombia, Costa Rica y Brasil

    Directory of Open Access Journals (Sweden)

    Andrea Samanta Méndez Maya

    2018-01-01

    Full Text Available El sector servicios ha tenido un acelerado crecimiento en los últimos años, particularmente, los intensivos en conocimiento, por lo que, el objetivo de esta investigación consiste en identificar a los sectores más competitivos en el comercio internacional de servicios intensivos en conocimiento de México, Chile, Colombia, Costa Rica y Brasil, durante el periodo 2006-2016, a través del Índice de la Ventaja Comparativa Revelada (VCR y el Índice de la Ventaja Relativa de Intercambio (VRI.  Los hallazgos demuestran que los seguros, las telecomunicaciones, servicios de informática y de información, y otros servicios a negocios fueron los sectores más competitivos. Se concluye que América Latina comienza a ser una de las regiones más atractivas para el offshoring de servicios en el comercio internacional de servicios intensivos en conocimiento.

  13. Secuelas del neurodesarrollo de recién nacidos prematuros de extremadamente bajo peso y de muy bajo peso a los dos años de edad, egresados de la Unidad de Cuidados Intensivos Neonatales del Hospital Nacional Edgardo Rebagliati Martins 2009-2014

    OpenAIRE

    Fernández Sierra, Carmen; Matzumura Kasano, Juan; Gutiérrez Crespo, Hugo; Zamudio Eslava, Luisa; Melgarejo García, Giannina

    2017-01-01

    Objetivo: Describir las secuelas del neurodesarrollo de los recién nacidos prematuros de extremadamente bajo peso y de muy bajo peso a los dos años de edad, egresados de la Unidad de Cuidados Intensivos Neonatales del Hospital Nacional Edgardo Rebagliati Martins. Materiales y métodos: Estudio descriptivo, retrospectivo, transversal en una población de 190 prematuros de extremadamente bajo peso y de muy bajo peso que nacieron durante enero 2009 a junio del 2014, egresados de la Unidad de Cuida...

  14. Deserción escolar en el primer año de la carrera de Medicina

    OpenAIRE

    López Gutiérrez, Indira; Marín Fontela, Grettel; García Rodríguez, Miguel Emilio

    2012-01-01

    Se realizó un estudio descriptivo cualitativo en el campo de la educación médica de pregrado. Objetivo: caracterizar la deserción escolar en el primer año del nuevo programa de formación de médicos en el periodo 2007-2009 en Nuevitas. Métodos: para su realización se emplearon métodos empíricos, estadísticos y teóricos, el estudio se centró en los 18 estudiantes que abandonaron los estudios en este periodo de tiempo. Los datos se recogieron mediante una encuesta aplicada a los estudiantes y un...

  15. ¿Qué esperan encontrar los alumnos en los estudios de Psicología?: metas y motivos personales de los estudiantes en su primer año en la universidad

    Directory of Open Access Journals (Sweden)

    Elena Gámez

    2015-05-01

    Full Text Available Numerosas investigaciones se han interesado por el perfil motivacional de ingreso de los universitarios. Sin embargo, se ha prestado menos atención al estudio de las metas que los estudiantes pretenden satisfacer cuando llegan a la universidad. En este trabajo presentamos un primer estudio con 610 alumnos de Psicología, de cuatro cursos consecutivos. En él se analiza la estructura factorial de una escala que evalúa la identificación de los estudiantes con diferentes tipos de motivos. En un segundo estudio, con otros 140 estudiantes, se relacionan las metas interpersonales con otras metas vitales, la satisfacción de necesidades psicológicas, el bienestar subjetivo y la presencia de pensamientos perfeccionistas. Los datos muestran la importancia de las metas de logro, de poder, de afiliación y de superación de problemas personales. Estas últimas presentan, además, una relación negativa con el bienestar y la satisfacción de necesidades psicológicas, y una relación positiva con el perfeccionismo. Nuestros resultados aportan un mayor conocimiento de los perfiles de los estudiantes de nuevo ingreso y las consecuencias que de ellos se derivan para su orientación académica.

  16. Eventos adversos derivados del cuidado brindado en la Unidad de Cuidados Intensivos Adultos del Hospital Universidad del Norte. Barranquilla (Colombia

    Directory of Open Access Journals (Sweden)

    Elizabeth Villarreal Cantillo

    2014-01-01

    Full Text Available Objetivo: Determinar los eventos adversos derivados del cuidado brindado en la Unidad de Cuidados Intensivos del Hospital Universidad del Norte (en Barranquilla en el periodo enero-diciembre de 2012. Materiales y métodos: Estudio descriptivo transversal retrospectivo. La muestra se obtuvo mediante un muestreo sistemático, a partir de un listado ordenado de todas las personas ingresadas al Hospital Universidad del Norte (HUN en los servicios de Urgencias, Hospitalización, Cirugía, UCI Adultos, UCI Neonatal, Gineco-Obstetricia, Consulta Externa, Radiología y Laboratorio que hubieran sufrido algún evento adverso ocurrido entre enero a diciembre de 2012. La información se obtuvo mediante la base de datos del Hospital Universidad del Norte. Para el análisis se utilizó Microsoft Excel 2010. Resultados: Durante 2012 se presentaron 130 (25 % casos de eventos adversos; siendo el segundo servicio con mayor número de eventos, después de Hospitalización. Las tres primeras causas de eventos adversos fueron: la infección nosocomial, con un 25 %; las úlceras por presión, con en un 18 %, y la neumonía asociada a ventilación mecánica, con un 16 %. Conclusiones: Los eventos adversos que más son reportados en las unidades de cuidados intensivos adultos son aquellos que ocurren cuando hay una mayor intervención en el paciente. Condiciona la aparición de eventos adversos un personal sanitario con déficit de conocimientos y falta de preparación. La ocurrencia de estos eventos adversos pone en peligro la vida de los seres humanos, debido a que empeoran su condición, produce sobrecosto y al profesional le genera sobrecarga laboral y afectiva.

  17. Estado Confusional Agudo nas Unidades de Cuidados Intensivos

    OpenAIRE

    Santos, L; Alcântara, J

    1996-01-01

    As alterações do comportamento frequentemente observadas em doentes internados nas unidades de cuidados intensivos (UCI), podem ser adequadamente designadas, na maioria das vezes, por estado confusional agudo, o qual se caracteriza por: flutuação do estado de vigília, distúrbio do ciclo vigília-sono, défice de atenção e concentração, desorganização do pensamento, manifestado entre outras formas por discurso incoerente, distúrbios da percepção sob a forma de ilusões e/ou alucinações, desorient...

  18. Perfil de ingreso de alumnos con buen desempeño académico en el primer año de estudios. El caso de la Escuela de Diseño de la Universidad De La Salle Bajío

    Directory of Open Access Journals (Sweden)

    María Daniela Esparza Olmos

    2011-01-01

    Full Text Available Introducción: El sistema educativo universitario se ha enfrentado a varios retos en los últimos tiempos, lo que ha implicado establecer políticas de admisión que permitan seleccionar a los estudiantes que cumplan con el perfil de ingreso, permitiendo generar estrategias para mejorar su desempeño académico a lo largo de sus estudios, y con ello elevar las cifras de la eficiencia terminal. Es así como el objetivo de esta investigación fue caracterizar el perfil de ingreso de los alumnos que mostraron un buen desempeño académico en el primer año de la licenciatura de diseño industrial, diseño de modas y calzado, diseño gráfico y diseño ambiental de la Universidad De La Salle Bajío. Método: La distribución final de la muestra estuvo formada por 256 alumnos de ambos sexos al analizarse estadísticamente los resultados de sus pruebas en el proceso de admisión de las cohortes del 2005 al 2008, para posteriormente correlacionarlas con el promedio del primer año de sus estudios. Resultados: Los resultados permitieron observar las semejanzas y diferencias entre las cuatro licenciaturas con respecto al perfil general de ingreso en la Escuela de Diseño. Asimismo, se encontró que los alumnos que presentaron en periodo de excelencia, obtuvieron mejor desempeño académico en el primer año de estudios. Conclusión: Conocer el perfil de ingreso servirá de parámetro en los siguientes procesos de admisión, además permitirá diseñar estrategias que fortalezcan las capacidades y habilidades de los alumnos al ingresar a la educación superior, de tal manera que se eleven los índices de eficiencia terminal y con ello mejorar la calidad en los programas académicos de licenciatura en la Escuela de Diseño.

  19. La unidad de cuidado intensivo, un lugar para quedarse solo The Intensive Care Unit, a place to be alone

    Directory of Open Access Journals (Sweden)

    Óscar Alberto Beltrán Salazar

    2009-03-01

    Full Text Available Objetivo: describir el significado que tiene la experiencia de estar hospitalizado en una Unidad de Cuidado Intensivo. Metodología: estudio con enfoque fenomenológico, realizado en Medellín, Colombia, entre los meses de abril y octubre de 2006. Incluyó 9 personas adultas entre 24 y 80 años de edad que estuvieron críticamente enfermas y hospitalizadas. La entrevista en profundidad y la observación no participante fueron las técnicas de recolección de la información. Los datos se analizaron según el esquema propuesto por Cohen, Kahan y Steeves. Resultados y discusión: la Unidad de Cuidados Intensivos es un lugar de soledad, frialdad, olores especiales y silencio, donde las palabras eran "ausentes", "no entendidos", "no deben oírse", "no pronunciadas" y "agradables". La comunicación no siempre era adecuada y la compañía la brindaban otras personas enfermas; además, los pacientes tenían un papel secundario frente a la tecnología y era necesario ser "buen paciente". Conclusión: la hospitalización en la Unidad de Cuidados Intensivos significa estar solo, aislado de la familia y rodeado de otros pacientes y del equipo de salud, cuya compañía, a veces, no es suficiente y en ocasiones contribuye al sufrimiento.Objective: to describe the patients meaning of the experience of being hospitalized in an ICU. Methodology: research study with phenomenological focus of nine mature people between 24 and 80 years of age who were critically sick and hospitalized in an ICU. The in- depth interview and non participant observation were the techniques for gathering information. The data were analyzed according to the outline proposed by Cohen, Kahan and Steeves. The study was carried out in Medellín, Colombia from April to October, 2006. Results and discussion: the ICU is a place for loneliness, cold, special odor and silence where words were "absent", "incomprehensible", "not for hearing", "not pronounced" and "agreeable". The communication was

  20. Factores relacionados con la deserción en el primer y segundo año de estudio en la carrera de Enseñanza de la Matemática de la Universidad Nacional de Costa Rica

    Directory of Open Access Journals (Sweden)

    Paola Michelle Pascua-Cantarero

    2016-01-01

    Full Text Available Recibido 21 de mayo de 2014 • Corregido 15 de setiembre de 2015 • Aceptado 3 de noviembre de 2015El presente artículo da a conocer detalles sobresalientes obtenidos al realizar una investigación que tuvo entre sus objetivos determinar los factores relacionados con deserción de estudiantes, quienes ingresaron en los años 2007, 2008, 2009, durante el primer y segundo año del Bachillerato y Licenciatura en Enseñanza de la Matemática (carrera de Enseñanza de la Matemática de la Universidad Nacional de Costa Rica. La citada investigación respondió a un estudio mixto, con una fase cuantitativa de carácter descriptivo y una parte cualitativa con un diseño fenomenológico; su fundamentación teórica se basó en investigaciones sobre deserción universitaria en distintas regiones y la teoría de personas expertas como Tinto y Spady con respecto a las causas de esta problemática. Para  el  análisis de la información se empleó una base de datos proporcionada por el Departamento de Registro de la UNA y una entrevista telefónica semi-estructurada aplicada a estudiantes que desertaron de la carrera en forma definitiva. La población en la fase cuantitativa estuvo constituida por la totalidad de participantes que ingresaron en los años 2007, 2008 y 2009 y que desertaron en el primer y segundo año de la carrera. El grupo en estudio para la etapa cualitativa estuvo compuesto por quince informantes pertenecientes a las diferentes cohortes 2007, 2008 y 2009 y quienes desertaron en el primer y segundo año de la carrera. Los resultados mostraron que el fenómeno de  deserción en el primer año tuvo factores similares a la que se produjo en el segundo año de la carrera de Enseñanza de la Matemática. Las conclusiones indican que entre los diversos factores relacionados con la deserción en el primer y segundo año de las cohortes 2007, 2008 y 2009 sobresalieron las expectativas no satisfechas y la falta de integración académica y

  1. Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

    Directory of Open Access Journals (Sweden)

    Julio J. Masquijo

    2014-10-01

    Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

  2. Factores influyentes en el rendimiento académico de estudiantes del primer año de medicina

    Directory of Open Access Journals (Sweden)

    Delia Jara

    2008-09-01

    Full Text Available Introducción: El rendimiento académico dentro de la universidad es el producto de la influencia de múltiples factores, los cuales se ponen de manifiesto desde los primeros años de estudio. Objetivos: Identificar los factores que afectarían el rendimiento académico en los estudiantes de medicina del primer año de estudios. Diseño: Estudio observacional longitudinal. El tipo de muestreo utilizado fue no probabilístico por cuotas. Lugar: Facultad de Medicina de San Fernando, Universidad Nacional Mayor de San Marcos (UNMSM, Lima-Perú. Participantes: Estudiantes de medicina durante el primer año de estudios. Intervenciones: Un cuestionario aplicado a los participantes, examen físico, psicológico y análisis de laboratorio. Principales medidas de resultados: Factores que influyen en el rendimiento académico bajo. Resultados: Se evaluó 40 estudiantes de ambos sexos (14 mujeres y 26 varones, con edades comprendidas entre 18 y 30 años. Procedían de colegio estatal 31 (78% y de colegio privado 9 (23%; en cuanto a hábitos de estudio, 27 (67% refirieron leer las materias propias de la profesión, por lo menos una vez al día, mientras que 13 (33% lo hacía de manera semanal. El número de horas de estudio al día consistió en 1 a 2 horas al día en 10 (25%, 3 a 4 horas de estudio en 18 (45%, 5 a 6 horas de estudio em 10 (25% y 2 de ellos (5% refirieron estudiar solo en fechas de exámenes; 25 alumnos (62% tuvieron como estrategia de estudio solo el uso de la memoria, 7 (18% utilizaron la memoria más los apuntes de clase, 4 de ellos (10%, apuntes más esquemas, y 4 (10%, apuntes más esquemas y textos. El carácter predominante de los alumnos fue alegre en 22 (55% y no alegre en 18 (45%. La autoestima fue considerada alta en 15 de los participantes (37,5%, autoestima moderada en 21 (52,5% y autoestima baja en 4 (10%. El aspecto socioeconómico de los participantes reveló que en 17 de ellos (42,5% el ingreso familiar era igual o menor de

  3. Insuficiencia renal aguda en pacientes de la Unidad de Cuidados Intensivos, Hospital Regional de Cuilapa, Santa Rosa, Guatemala

    Directory of Open Access Journals (Sweden)

    Ronald J. Ajcalon

    2017-03-01

    Full Text Available La insuficiencia renal aguda, es una condición común en la Unidad de Cuidados Intensivos de Adultos (UCIA y probablemente una consecuencia de la enfermedad crítica que se asocia a resultados clínicos adversos, altos costos y una mortalidad de más del 50%, sobre todo si se requiere tratamiento de reemplazo renal. El objetivo fue determinar la incidencia de insuficiencia renal aguda en pacientes ingresados a la UCIA. El estudio fue prospectivo, longitudinal, observacional, en 101 pacientes ingresados en la UCIA del Hospital Regional de Cuilapa. Se diagnosticaron 101 pacientes durante el periodo de estudio con insuficiencia renal aguda represento el 27.4% del total de pacientes internados (368 en el servicio en un año. La incidencia de mortalidad en pacientes que requieren terapia de reemplazo renal y se encuentran en ventilación mecánica es del 100%. Del total de pacientes estudiados, según la escala Akin, se encontró que el 49.5% de los pacientes correspondían a grado II, aunque el grado I también fue frecuente (29%, y que el 22 % de los pacientes correspondían a grado III. La patología que mayormente se asoció al desarrollo de insuficiencia renal aguda fue sepsis grave con un 31%, seguido de pacientes sometidos a cirugía mayor e hipovolemia con el 21 y 18% respectivamente. Se halló una incidencia aumentada de insuficiencia renal aguda comparado con estadísticas internacionales, cuya etiología fue mayormente causada por procesos sépticos.

  4. Infecciones intrahospitalarias asociadas a dispositivos invasivos en unidades de cuidados intensivos de un hospital nacional de Lima, Perú

    Directory of Open Access Journals (Sweden)

    Omayra Chincha

    2013-12-01

    Full Text Available Con el objetivo de describir la incidencia de infecciones intrahospitalarias asociadas a dispositivos invasivos en unidades de cuidados intensivos (UCI del Hospital Nacional Cayetano Heredia se realizó un estudio observacional retrospectivo utilizando datos de la Oficina de Epidemiología y Salud Ambiental durante los años 2010 al 2012. Se notificó un total de 222 infecciones intrahospitalarias, la UCI de Medicina tuvo la incidencia por 1000 días de uso del dispositivo más alta para neumonía asociada a ventilador mecánico (28,6; infección del torrente sanguíneo asociado a catéter venoso central (11,9, e infección del tracto urinario asociado a catéter (8,1. Los principales agentes infecciosos aislados fueron Pseudomona sp. (32,3% en la UCI de emergencia, Staphylococcus coagulasa negativo(36% en la UCI de medicina y Candida sp (69,2% en la UCI de cirugía. Las tasas de infecciones asociadas a dispositivos invasivos se reportaron altas semejantes a otros hospitales nacionales con limitados recursos e infraestructura

  5. Infecciones intrahospitalarias asociadas a dispositivos invasivos en unidades de cuidados intensivos de un hospital nacional de Lima, Perú

    Directory of Open Access Journals (Sweden)

    Omayra Chincha

    Full Text Available Con el objetivo de describir la incidencia de infecciones intrahospitalarias asociadas a dispositivos invasivos en unidades de cuidados intensivos (UCI del Hospital Nacional Cayetano Heredia se realizó un estudio observacional retrospectivo utilizando datos de la Oficina de Epidemiología y Salud Ambiental durante los años 2010 al 2012. Se notificó un total de 222 infecciones intrahospitalarias, la UCI de Medicina tuvo la incidencia por 1000 días de uso del dispositivo más alta para neumonía asociada a ventilador mecánico (28,6; infección del torrente sanguíneo asociado a catéter venoso central (11,9, e infección del tracto urinario asociado a catéter (8,1. Los principales agentes infecciosos aislados fueron Pseudomona sp. (32,3% en la UCI de emergencia, Staphylococcus coagulasa negativo(36% en la UCI de medicina y Candida sp (69,2% en la UCI de cirugía. Las tasas de infecciones asociadas a dispositivos invasivos se reportaron altas semejantes a otros hospitales nacionales con limitados recursos e infraestructura

  6. Efecto de un tratamiento intensivo con insulina sobre la reactividad plaquetaria en pacientes con hiperglucemia que ingresan con un síndrome coronario agudo

    OpenAIRE

    Vivas Balcones, Luis David

    2011-01-01

    El objetivo primario de este trabajo ha sido la valoración del efecto que produce el control estricto de la glucemia mediante un tratamiento intensivo y precoz con insulina sobre la reactividad plaquetaria durante la fase hospitalaria en pacientes que ingresan en una unidad de cuidados intensivos cardiológicos con un síndrome coronario agudo e hiperglucemia, respecto a un tratamiento convencional.

  7. Mediastinite Aguda: Estudo Retrospetivo de 8 Anos de Abordagem em Cuidados Intensivos

    Directory of Open Access Journals (Sweden)

    Ana Bastos Furtado

    2018-02-01

    Conclusão: A nossa série difere do reportado na literatura relativamente aos dados demográficos (mulheres, com idade média superior e à etiologia das mediastinites (perfuração do esófago e mediastinites descendentes. Para o sucesso do tratamento é fundamental o diagnóstico e abordagem atempada em ambiente de cuidados intensivos pela gravidade, complexidade e multiplicidade das técnicas aplicadas.

  8. Evaluación del desempeño pronóstico de dos puntajes de predicción de mortalidad a siete días en pacientes adultos oncológicos críticamente enfermos admitidos a una unidad de cuidados intensivos en Bogotá

    OpenAIRE

    Rojas Ruiz, Ingrid Tatiana

    2016-01-01

    Introducción Los sistemas de puntuación para predicción se han desarrollado para medir la severidad de la enfermedad y el pronóstico de los pacientes en la unidad de cuidados intensivos. Estas medidas son útiles para la toma de decisiones clínicas, la estandarización de la investigación, y la comparación de la calidad de la atención al paciente crítico. Materiales y métodos Estudio de tipo observacional analítico de cohorte en el que reviso las historias clínicas de 283 pacientes o...

  9. Suspiro de vida: vivencias de los pacientes de la Unidad de Cuidados Intensivos sometidos a soporte ventilatorio

    Directory of Open Access Journals (Sweden)

    Alix Bohórquez

    2011-12-01

    Full Text Available El presente estudio pretende analizar y comprender las emociones y sentimientos experimentados por el paciente sometido a vetilacion mecanica que han estado hospitalizados en la Unidad de Cuidados Intensivos (UCI, basándose en las experiencias relatadas por 3 pacientes egresados que tuvieron soporte ventilatorio invasivo. Teniendo en cuenta que el soporte ventilatorio conlleva una pérdida de independencia y control sobre la más vital de las actividades para el mantenimiento de la vida "respirar” y que al igual los tubos endotraqueales y la intubación nasal a menudo producen traumas lo cual se manifiesta en la falta de habilidad para la comunicación y la inmovilización derivada de la intubación, siendo factores estresantes para los pacientes manifestando la necesidad de redes de apoyo o mecanismos de afrontamiento que les ayudara y los acompañara a superar la crisis vivenciada; por lo que la familia y la religiosidad-espiritualidad fueron vitales. En conclusión el presente estudio mostró que los pacientes experimentaron situaciones difíciles y estresantes que les generaba tristeza, depresión, angustia, dolor e incomodidad con los procedimientos que se les realizaba o por los equipos que debían tener para suplir sus funciones vitales, pero es importante recalcar que pese a su incomodidad los pacientes expresaban la resignación como una manera de aceptación y superación frente a su situación; también expresaron la dificultad para comunicarse con las demás personas; y que gracias al apoyo de su familia y a su fe en Dios pudieron afrontar y superar la situación.

  10. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  11. La práctica de los deportes de lucha. Un estudio preliminar sobre la experiencia previa de los estudiantes de la Licenciatura en Ciencias del Deporte

    OpenAIRE

    Villamón Herrera, Miguel; Gutiérrez García, Carlos; Espartero Casado, Julián; Molina Alventosa, J. Pere

    2005-01-01

    En este trabajo se presenta un primer estudio sobre la experiencia previa en la práctica de deportes de lucha que tienen los estudiantes de la Licenciatura en Ciencias de la Actividad Física y el Deporte. El estudio se basó en la recogida y análisis de datos procedente de un cuestionario administrado a los estudiantes de primer ciclo de dicha licenciatura, de las universidades de Valencia y León, al inicio de los cursos académicos 2001-2002 y 2002-2003. Los resultados muestran que cerca del 5...

  12. Sepsis procedente de la comunidad en cuidados intensivos: Factores de riesgo

    Directory of Open Access Journals (Sweden)

    Pilar Legón Blasco

    2000-03-01

    Full Text Available Se realizó un estudio prospectivo y transversal en pacientes sépticos ingresados en la Unidad de Cuidados Intensivos del hospital "Dr. Ángel Arturo Aballí" con los criterios de sepsis procedente de la comunidad en un período de 18 meses, comprendido desde septiembre de 1996 hasta marzo de 1998, con el objetivo de analizar la frecuencia de factores de riesgo asociados con la infección. Se evaluaron 70 pacientes que cumplían los criterios antes mencionados. Se tomó en la comunidad un grupo control de niños sanos. En los resultados se encontró que los factores asociados con la sepsis fueron: el sexo masculino (p=0,002, RR=2,7, la no lactancia materna (p=0,01, RR=3,3, la malnutrición por defecto (p=0,04, RR=2,1, el hacinamiento (p=0,0008, RR=2,4, el hábito de fumar (p=0,02, RR=2,4 y la mala higiene (p=0,01, RR=1,5.A prospective and crossover study was carried out in patients admitted in Intensive Care Unit (ICU of "Dr. Angel Arturo Aballí" Hospital where criteria of sepsis came from community for a period of 18 months, September 1996 to March 1998, to analyze frequency of risk factors associated with infection. We assessed 70 patients who fulfiled criteria above mentioned. Healthy children were control group. By findings, we found that factors associated with sepsis included: male sex (p=0.002, RR=2.7, non-breast feeding (p=0.01, RR=3.3, malnutrition by defect (p=0.04, RR=2.1, crowding (p=0.0008, RR= 2.4, smoking (p=0.02, RR=2.4, and a poor hygiene (p=0.01, RR=1.5.

  13. Análisis de los factores ambientales y ocupacionales en la concentración de aerobacterias en unidades de cuidado intensivo del Hospital Universitario Fernando Troconis, 2009 Santa Marta - Colombia

    Directory of Open Access Journals (Sweden)

    Andrés M. Vélez-Pereira

    2014-06-01

    Full Text Available Introducción: La evaluación de la calidad biológica del aire de ambientes hospitalarios resulta de especial interés debido a que los pacientes puedan servir como una fuente de bacterias patógenas para el personal del hospital, los visitantes y otros pacientes, siendo relevante en unidades de asistencia especializadas en atención de patologías crónicas como cáncer, SIDA y pacientes con trasplante de órganos o con complicaciones severas en su estado de salud, y que requieren una intervención masiva para su tratamiento en salas de cirugía y/o unidades de cuidado intensivo. Evaluar la influencia de factores ambientales y de ocupación de la unidad en la concentración de aerobacterias de unidades de cuidado intensivo del Hospital Universitario Fernando Troconis. Materiales y Métodos: Se colectaron muestras triplicadas con agar selectivo para Staphylococcus spp. y Pseudomonas spp., en dos estaciones de cada una de las tres UCI, mediante impactador de 2 etapas ubicado a altura de1.5m y caudal constante (28.3l/min durante 5min, incubándolas a 37°C por 48h. Los factores ambientales se registraron con anemómetro Kestrel 4500 y ocupación de la unidad mediante registro manual del número de pacientes y personal asistencial de la unidad. Resultados: La máxima concentración fue 979.9±31.3UFC/m3 y el máximo promedio, 315.6±59.7UFC/m3. Staphylococcus spp. Superaron la concentración de Pseudomonas spp. La máxima ocupación fue en UCI Adulto, mayor temperatura en UCI Pediátrica y humedad más baja en UCI Adulto. Discusión y Conclusiones: La concentración de aerobacterias superó valores reportados por estudios  aerobiológicos hospitalarios, y presenta relaciones leves con temperatura y escasa o nula con ocupación de la unidad.Palabras clave: Partículas Viables en el Aire, Ambiente, Infección Hospitalaria, Ocupación de Camas, Cuidados Intensivos, Viabilidad Microbiana. (Fuente: DeCS BIREME.Cómo citar este artículo: V

  14. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  15. Controlo intensivo da glicémia em doentes críticos

    OpenAIRE

    Ferreira, AR

    2007-01-01

    Trabalho realizado no contexto do estágio de Cuidados Intensivos do Internato Médico Complementar A evolução da medicina intensiva durante as últimas três a quatro décadas trouxe um aumento tremendo na sobrevivência imediata dos doentes críticos, com patologias previamente letais. É por isso frequente na actualidade que os doentes entrem numa fase crónica de doença crítica, durante a qual permanecem dependentes do suporte de orgãos vitais por um ...

  16. Estudio nacional exploratorio descriptivo sobre el fenómeno de trata de personas en Colombia.

    OpenAIRE

    2009-01-01

    Para el Ministerio del Interior y de Justicia como Secretaría Técnica del Comité Interinstitucional para la lucha contra la Trata de Personas y para la Oficina de Naciones Unidas contra la Droga y el Delito en Colombia UNODC, es un honor presentar a ustedes en esta oportunidad el primer Estudio Nacional Exploratorio Descriptivo sobre el Fenómeno de la Trata de Personas en Colombia, desarrollado por unequipo de Investigadoras e Investigadores de la Escuela de Estudios de Género de la Universid...

  17. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  18. Estudio unidimensional del síndrome de burnout en estudiantes de medicina de Holguín

    OpenAIRE

    Rosales Ricardo, Yury

    2012-01-01

    Se realizó un estudio descriptivo transversal entre octubre y noviembre de 2010. Objetivos: Determinar la presencia del Síndrome de Burnout en su enfoque unidimensional en estudiantes de primer año de medicina de la Universidad de Ciencias Médicas de Holguín (UCMH). Métodos: Se escogieron aleatoriamente 70 estudiantes de primer año, 35 de cada sexo (85 % de la población), a los que se les aplicó el instrumento Escala Unidimensional de Burnout Estudiantil. Resultados: El sexo femenino (sin Bur...

  19. Estudio bibliométrico de la Revista CorSalud

    Directory of Open Access Journals (Sweden)

    Grenedys Teresa López Tápanes

    2013-10-01

    Full Text Available Objetivos: Se hizo un estudio bibliométrico de algunos indicadores en los primeros 199 artículos publicados en CorSalud, con el objetivo de conocer el estado actual y la evolución de sus contenidos. Método: Se realizó de un estudio descriptivo y transversal de forma retrospectiva, analizando los artículos publicados en la Revista CorSalud entre el primer trimestre del año 2009 y el primer trimestre del año 2013 ambos inclusive, por origen de procedencia del primer autor, tema de publicación, composición y actualización de las fuentes de referencia y número de autores firmantes. Resultados: Se analizaron un total de 199 artículos, el 73,36% de los mismos provenían de Villa Clara, la Cardiología predominó con un 50,25% de la temática, las fuentes de referencias más utilizadas fueron las revistas impresas 79,96% y la actualización de las mismas tuvo una tendencia decreciente anual del 7,78% aunque se mantuvo con una media del 47,05% y el Índice de Colaboración entre los autores alcanzó una media de 3,75%. Conclusiones: La mayoría de los artículos provenían la región central, los artículos originales, breves, de revisión y especiales fueron la generalidad. Preponderaron los temas de Cardiología, las fuentes de referencias utilizadas mayormente fueron las revistas impresas, la actualización de las mismas se mantiene en niveles comparables internacionalmente, al igual del Índice de Colaboración entre los autores que mostró además, una tendencia creciente.

  20. Costos secundarios por infecciones nosocomiales en dos unidades pediátricas de cuidados intensivos Secondary costs due to nosocomial infections in two pediatric intensive care units

    Directory of Open Access Journals (Sweden)

    Susana Navarrete-Navarro

    1999-01-01

    Full Text Available OBJETIVO. Estimar los costos asociados a infecciones nosocomiales en niños tratados en dos unidades de terapia intensiva. MATERIAL Y MÉTODOS. Se realizó un estudio parcial de costos en la Unidad de Cuidados Intensivos Neonatales (UCIN y en la Unidad de Cuidados Intensivos Pediátricos (UTIP de un hospital infantil de tercer nivel de atención médica. Se investigaron los costos de las pruebas diagnósticas y de los recursos terapéuticos empleados, así como el exceso de estancia hospitalaria debida a la presencia de una infección nosocomial. RESULTADOS. Se detectaron 102 infecciones, 46 en UCIN y 56 en UTIP, en el lapso de un año, tiempo que duró el estudio. El costo promedio por infección fue de 91 698 pesos y el gasto global fue de 9.3 millones de pesos. Neumonía, flebitis y septicemia abarcaron 65% de los costos. En los niños infectados se registró una estancia hospitalaria extra de 9.6 días, 13.7 exámenes de laboratorio y 3.3 cultivos en promedio, debido a la presencia de una infección intrahospitalaria. La estancia hospitalaria representó 97% del gasto total. CONCLUSIONES. Esta evaluación representa una estimación de costos directos de infección. Los resultados justifican el establecimiento de programas preventivos agresivos para reducir las complicaciones dentro de los hospitales.OBJECTIVES. We estimated associated costs to nosocomial infections in two pediatric intensive care units in Mexico City. MATERIAL AND METHODS. A transversal study in the neonatal (NICU and pediatric (PICU intensive care units, was done. We reviewed use and cost of diagnostic procedures, medications, and excess of hospital stay. RESULTS. There were 102 infections, 46 in the NICU and 56 in the PICU. The average cost per infection was $11,682 USD and the overall expense was 1,184.71 USD. Infected children had an excess of hospital stay of 9.6 days, 13.7 more laboratory tests and 3.3 more cultures. Hospital stay represented 97% of the overall cost

  1. LOS ESTUDIOS DE MERCADO Y PERFILES DE SECTOR COMO HERRAMIENTAS ÚTILES PARA LA TOMA DE DECISIONES

    Directory of Open Access Journals (Sweden)

    Yolanda Morejón-Bravo

    2016-01-01

    Full Text Available En primer lugar, se ofrece una breve explicación de los fundamentos teóricos de la inteligencia empresarial y sus productos, haciendo énfasis en los perfiles estratégicos, y dentro de ellos, en los perfiles de sector. También, se hace énfasis en los estudios de mercado y sus características. En segundo lugar, se presentan dos casos de estudio (un perfil de sector y un estudio de mercado, que demuestran la importancia de estos productos y servicios de inteligencia competitiva, para la toma de decisiones lo más acertada posible, en las organizaciones.

  2. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  3. Seguimento dos enfermeiros egressos dos cursos de especialização em enfermagem em cuidados intensivos Seguimiento de los enfermeros egresos de los cursos de especialización en enfermería en cuidados intensivos Following up nurses that finished the specialization course on nursing in intensive care

    Directory of Open Access Journals (Sweden)

    Verlaine Andrade

    1998-07-01

    Full Text Available O presente estudo busca analisar a contribuição trazida pelos Cursos de Especialização em Cuidados Intensivos realizados na Escola de Enfermagem da USP, cujos objetivos foram: 1 caracterizar a trajetória dos enfermeiros quanto à continuidade do trabalho em UTI; 2 avaliar a contribuição oferecida pelo curso. A população foi composta por 38 enfermeiros egressos, sendo que, destes, 60,5% não mais atuavam na UTI, devido ao fato de assumirem outro cargo na instituição e apresentarem problemas pessoais diversos. Quanto à contribuição oferecida pelo curso, a principal avaliação recaiu na aquisição de conhecimentos (91,7%. No entanto, 74,2% dos enfermeiros afirmaram que o curso não contribuiu para o aumento salarial, o que não os têm impedido de investir no seu aperfeiçoamento profissional.Este estudio busca analizar la contribución de los Cursos de Especialización en Cuidados Intensivos ofrecidos por la Escuela de Enfermería de la Universidad de São Paulo. Los objetivos fueron: 1 caracterizar la trayectoria de los enfermeros en cuanto a la continuidad del trabajo en Unidade de Tratamiento Intensivo (UTI; 2 evaluar la contribución ofrecida por el Curso. La población fue de 38 enfermeros egresados de los Cursos, el 60,5% no estaban trabajando en UTI por estar ejerciendo otro cargo y también por problemas personales. En cuanto a la contribución ofrecida por el Curso, el principal resultado de la evaluación apunta para la aquisición de conocimientos (91,7%, el 74,2% de los enfermeros dijeron que el Curso no contribuyó para la mejoría de la remuneración; sin embargo, eso no constituyó motivo para que esos enfermeros dejaran de invertir en el progreso profesional.The purpose of this study was to analyse the contribution of the Extension Courses in the Intensive Care held at the Nursing School from USP, with the aim to: 1 Follow up nurses in their work at the ICU. 2 Evaluate the contribution offered by the course. The

  4. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  5. Nivel de Lectura y Escritura Creativa de los Estudiantes del Primer Año de Pregrado de la Universidad La Salle, Arequipa. 2016

    OpenAIRE

    Mazeyra Guillén, Orlando Alonso

    2017-01-01

    El presente estudio tuvo como objetivo investigar el nivel de lectura y de escritura creativa de los estudiantes del primer año de pregrado de la Universidad La Salle; y establecer la relación que existe entre los niveles de lectura y escritura creativa de los estudiantes. La población estuvo conformada por 120 estudiantes de pregrado del primer año de la Universidad La Salle, que corresponde a los 3 programas profesionales con que cuenta la universidad: Derecho, Administración y Negocios Int...

  6. Modificacion de conductas de riesgo biologico y profesional para la neumonia nosocomial en las unidades de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Rhina Maria Ramos Mejía

    2013-12-01

    Full Text Available Uno de los problemas que actualmente se está presentando en el ámbito hospitalario, especialmente en las Unidades de Cuidados Intensivos (UCI es la neumonía nosocomial, entendida como una infección aguda del tracto respiratorio bajo, que aparece en los enfermos que ingresan al hospital. Una de las causas de estas infecciones es atribuida a conductas inadecuadas que realiza el personal de salud al atender pacientes infectados sin los elementos adecuados. Estudios epidemiológicos realizados en las UCI indican que uno de los principales mecanismos de transmisión de los agentes patógenos es el contacto, ya sea a través de las manos o de gotitas que se forman en el aire al comunicarse, por estornudo o por la tos; otro mecanismo es a través del aire, el cual tiene especial importancia en la contaminación de elementos y aparatos de uso exclusivo para pacientes. En los programas de prevención de infecciones nosocomiales se hace necesaria la intervención del psicólogo especializado en salud, cuyo objetivo primordial es la promoción de conductas tendientes a disminuir el riesgo de infección intrahospitalaria, por medio de la modificación comportamental de los profesionales de la salud y del paciente mismo. 

  7. Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

    Directory of Open Access Journals (Sweden)

    Rodríguez Rebollo, Ángel

    2004-03-01

    Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

  8. Los residentes en las unidades de cuidados intensivos: ¿cuál es su percepción de la formación que reciben?

    Directory of Open Access Journals (Sweden)

    Guillermo Vázquez-Mata

    Full Text Available Objetivo. Este trabajo intenta responder a la pregunta de cuál es la visión que tienen los residentes de su formación en las unidades de cuidados intensivos (UCI. Sujetos y métodos. Hemos realizado un estudio cualitativo tipo grounded theory. Los participantes son residentes de cualquier especialidad que estuviesen trabajando en las UCI durante el estudio. El diseño tiene tres partes: percepción subjetiva de los residentes de aquellos aspectos que ellos consideran más útiles para su formación, priorización de las actividades regulares más características de las UCI y entrevistas semiestructuradas con informadores claves. Resultados. Nuestro trabajo identifica que los residentes consideran como eje de su formación la práctica clínica a 'pie de cama' desarrollada con autonomía y apoyada en una buena tutorización. Paralelamente, otras competencias nucleares como la investigación, la comunicación en situaciones complejas, el trabajo en equipo o la gestión de recursos están infravaloradas, mientras que otras como la seguridad del paciente o la bioética no se han detectado en las respuestas de los residentes. Conclusión. La percepción de los residentes sobre formación durante su estancia en las UCI adolece de algunas carencias, dado que ciertos aspectos claves de la medicina actual no se percibien como prioridades en dicha formación.

  9. Infección neonatal: comportamiento en una unidad de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    Osmany Franco Argote

    2010-12-01

    Full Text Available INTRODUCCIÓN. El objetivo de este estudio fue caracterizar a los recién nacidos con sepsis atendidos en cuidados intensivos neonatales del Hospital «América Arias» en un período de 2 años. MÉTODOS. Se realizó una investigación cuantitativa, observacional, descriptiva y retrospectiva. El universo estuvo constituido por 214 neonatos. Las variables estudiadas fueron condiciones neonatales, manifestaciones clínicas de sepsis, gravedad, alteraciones humorales y antecedentes de procedimientos intervencionistas. Se hicieron combinaciones de algunas variables y se halló el valor de p para compararlas en neonatos con sepsis no grave o con sepsis grave. RESULTADOS. En el grupo estudiado la prematuridad, el bajo peso y el crecimiento intrauterino retardado alcanzaron cifras del 49,1 %, 42,1 % y 18,7 % respectivamente. El 72,9 % de los pacientes tuvo sepsis grave. Las manifestaciones clínicas más comunes fueron taquipnea (69,2 % y llenado capilar lento (57,9 %. La alteración humoral más frecuente fue la acidosis metabólica (63,6 % y el cateterismo umbilical fue el procedimiento intervencionista más frecuente (53,7 %. Predominaron las combinaciones de prematuridad y bajo peso (21,5 %, acidosis metabólica y neutrofilia (22 %, y asistencia respiratoria con cateterismo umbilical (21 % o epicutáneo (20,6 %. El valor de p fue de 0,001 entre pacientes con sepsis no grave y pacientes con sepsis grave en todas las combinaciones de intervencionismo, y no significativo en la combinación prematuro-bajo peso-crecimiento intrauterino retardado (CIUR. CONCLUSIONES. Hubo predominio de prematuridad, sepsis grave, taquipnea, cateterismo umbilical y acidosis metabólica. Las diferencias entre pacientes con sepsis no grave y con sepsis grave fueron significativas en todas las combinaciones de intervencionismo y de condición neonatal, pero no en la combinación prematuro-bajo peso-CIUR.

  10. Estudio teórico de moléculas de interés en Astrofísica: compuestos binarios policarbonados

    Science.gov (United States)

    Largo-Cabrerizo, A.

    Se han detectado en el espacio distintos compuestos binarios policarbonados (que se pueden formular como CnX), algunos de ellos con elementos de la primera fila del sistema periódico, pero también existen otros que contienen elementos de la segunda fila, como azufre o silicio. La información experimental sobre estos últimos compuestos es escasa, por lo que los estudios teóricos son especialmente valiosos en este campo. En esta comunicación presentaremos los avances mas recientes que sobre el tema ha realizado nuestro grupo. Incidiremos particularmente en dos aspectos. En primer lugar resumiremos los estudios en los que hemos intentado proporcionar información estructural sobre carburos metálicos formados por sodio, magnesio, aluminio o calcio, que pueda ser de ayuda a la hora de caracterizar estas moléculas en laboratorio como paso previo a su eventual detección en el espacio. Un aspecto importante dentro de este primer apartado es el análisis de las propiedades moleculares en función del tamaño del sistema (cuantificado en el numero de átomos de carbono) con el objeto de intentar sistematizar su estudio. En segundo lugar comentaremos brevemente algunos de los estudios realizados sobre posibles reacciones que pueden ser vías de síntesis de este tipo de compuestos en el medio interestelar.

  11. Aspergilosis invasiva en unidad de cuidado intensivo

    Directory of Open Access Journals (Sweden)

    Mónica M. Toro-Lezcano

    Full Text Available La aspergilosis invasiva (AI es causada por la inhalación de conidias del moho Aspergillus spp. , el cual tiene como hábitat el suelo. Ha sido descrita en pacientes con trasplante de médula ósea y neutropenia grave (<500 neutrófilos/mm 3 . Los pacientes que ingresan a la unidad de cuidado intensivo (UCI también pueden ser susceptibles a la AI, con otros factores de riesgo tales como: enfermedad pulmonar obstructiva crónica (EPOC, cirrosis hepática, enfermedades autoinmunes en manejo inmunosupresor y trasplante de órgano sólido, en donde la mortalidad puede llegar al 80%. Se describe el caso de un hombre de 56 años con antecedente de tabaquismo, sin confirmación espirométrica de EPOC, que presentó AI pulmonar durante su estancia en UCI. El diagnóstico fue confirmado por histopatología de úlcera en carina, cultivo de aspirado traqueal y galactomanan en lavado broncoalveolar. Voriconazol fue su tratamiento, con buena respuesta clínica.

  12. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  13. FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO

    Directory of Open Access Journals (Sweden)

    Marco Suárez

    2006-05-01

    Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

  14. Estudio de cultivos celulares primarios de Psorophora confinnis (Díptera: Culicidae)

    OpenAIRE

    Felio J. Bello; Jaime A. Rodríguez; Alberto Morales; Víctor A. Olano

    1999-01-01

    Con el propósito de obtener una línea celular de Psorophora confinnis (Arribalzaga, 1891) para estudios de susceptibilidad a infecciones con arbovirus, se iniciaron los cultivos primarios de esta especie, vectora del virus de la encefalitis equina venezolana, tipo epidemo-epizoótico. A partir de huevos embrionados, larvas de primer estadio recién eclosionadas y ovarios de hembras adultas, se realizaron explantes por separado de tejidos embrionarios en diversos medios de cultivos, suplementado...

  15. Lupus eritematoso sistémico en la Unidad de cuidados intensivos de medicina del Hospital Nacional Cayetano Heredia.

    Directory of Open Access Journals (Sweden)

    Sergio Vásquez Kunze

    2007-10-01

    Full Text Available Objetivos: Describir las características clínicas y factores pronósticos del Lupus Eritematoso Sistémico (LES en la Unidad de Cuidados Intensivos (UCI de Medicina del Hospital Nacional Cayetano Heredia (HNCH. Material y métodos: Colección retrospectiva de hallazgos clínicos y de laboratorio de historias clínicas de pacientes con LES en la UCI del HNCH en el periodo 1999-2004. Se hizo estudio estadístico descriptivo y análisis univariado para variables continuas y discretas. Se calculó el score APACHE II y se evaluó su significado pronóstico. Resultados: Hubo 26 pacientes con LES de los cuales se encontraron historias clínicas de 21 de ellos. La frecuencia de LES en la UCI del HNCH es de 1,49%, es la patología reumática más frecuente en UCI. La mortalidad fue de 57,69%. El motivo de admisión más frecuente fue insuficiencia respiratoria (52,4%, mayormente debido a causa infecciosa.Las variables que se asociaron significativamente a mortalidad fueron: velocidad de sedimentación globular (VSG alta, anemia severa, hipoalbuminemia severa, la relación presión arterial de oxígeno entre la fracción inspirada de oxígeno (PaFi < 200 al ingreso. El score APACHE II en el grupo de fallecidos fue significativamente más alto (19,9 (p < 0,01. La insuficiencia renal aguda que requirió hemodiálisis y la necesidad de ventilación mecánica se asociaron significativamente a mayor mortalidad. Conclusiones: El LES en la UCI del HNCH tiene una alta mortalidad, mayor que la reportada en estudios previos. Los factores de mal pronóstico fueron VSG alta, anemia severa, hipoalbuminemia severa, PaFi<200, score APACHE II alto, necesidad de hemodiálisis y de ventilación mecánica. (Rev Med Hered 2007;18: 192-199.

  16. Evolución de la resistencia antimicrobiana de bacilos Gram negativos en unidades de cuidados intensivos en Colombia

    Directory of Open Access Journals (Sweden)

    Cristhian Hernández-Gómez

    2014-04-01

    Full Text Available Introducción. La evolución de la resistencia bacteriana constituye una amenaza para la salud pública mundial. Los sistemas de vigilancia epidemiológica han integrado técnicas de biología molecular para mejorar las estrategias de control. Objetivo. Describir los perfiles moleculares y fenotípicos de los bacilos Gram negativos en unidades de cuidados intensivos de 23 hospitales de Colombia entre 2009 y 2012. Materiales y métodos. Se diseñó un estudio descriptivo en 23 hospitales del Grupo para el Estudio de la Resistencia Nosocomial (sic. en Colombia. Se analizaron 38.048 aislamientos usando WHONET durante el periodo descrito. Se describieron perfiles de resistencia para Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa y Acinetobacter baumannii. En 1.248 cepas se realizó reacción en cadena de la polimerasa (PCR para detectar las carbapenemasas clínicamente más relevantes. Resultados. Escherichia coli fue el microorganismo más frecuente (promedio=14,8 %; la frecuencia de aislamientos de K. pneumoniae aumentó de 11 % en 2009 a 15 % en 2012 (p<0,001. La tendencia de los perfiles de multirresistencia aumentó en todas las especies estudiadas. De los aislamientos de K. pneumoniae evaluados, 68,4 % fue positivo para KPC (Klebsiella pneumoniae Carbapenemase, mientras que la VIM (Verona Integron-encoded Metallo-betalactamase en P. aeruginosa se observó en 46,5 %. Conclusiones. Se observó un incremento en la tendencia de los microorganismos hacia la multirresistencia y una amplia distribución de las carbapenemasas. La articulación de la biología molecular con los sistemas de vigilancia permitió integrar el análisis del fenotipo con los mecanismos de resistencia involucrados en las bacterias estudiadas. Este análisis permitirá la elaboración de guías para el uso adecuado de antimicrobianos y contribuirá a la contención de estas bacterias multirresistentes en Colombia.

  17. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  18. Estudio de Mercado de la Microencapsulación de Fluidos

    OpenAIRE

    de Batlle Mercadé, Juan Batlle

    2016-01-01

    El TFG desarrollado a continuación trata sobre un estudio de mercado de la microencapsulación de fluidos llevado a cabo por petición de una empresa especializada en este producto. Los objetivos de este proyecto son: en primer lugar, dimensionar el mercado de las micropartículas para las zonas geográficas de Europa (EU) y Estados Unidos (EEUU) en cuatro sectores (Pharma, Functional Food, Personal Care y Home Care); en segundo lugar, identificar la demanda no cubierta mediante las necesidades d...

  19. Estudio preliminar. Patologías digitales más frecuentes en el pie de la bailaora de flamencoe

    OpenAIRE

    José Manuel Castillo López; Joaquín Pérez Rendón; Cristina Algaba Guisado

    2010-01-01

    Este estudio tiene como objetivos, en primer lugar, dar a conocer las principales deformidades digitales de los pies, asociadas -por su alta incidencia- a la práctica profesional del baile flamenco femenino. Así como, poner de manifiesto la necesidad de llevar a cabo estudios de mayor magnitud para determinar si existe una relación estadísticamente significativa entre la práctica del baile flamenco con las deformidades y patologías podológicas descritas, y la importancia de la investigación e...

  20. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  1. PROBLEMAS ÉTICOS DEL RETIRO O LIMITACIÓN DE TRATAMIENTO VITAL EN UNIDADES DE CUIDADOS INTENSIVOS

    Directory of Open Access Journals (Sweden)

    Mónica Rincón Roncancio

    2015-01-01

    Full Text Available La medicina crítica atraviesa sus mejores momentos. Como afirma Gracia, "los cuidados intensivos han alcanzado su mayoría de edad". Nadie cuestiona dichos adelantos para pacientes que eran considerados hace relativamente poco como desahuciados. Sin embargo, también da algo de vértigo el cambio que se ha logrado en el manejo de la muerte de dichos pacientes: el tránsito de una muerte "natural" a una muerte "gobernada por el hombre". En este contexto cobran nuevo sentido conceptos como eutanasia, distanasia, futilidad, calidad de vida, muerte digna y, de manera especial, el concepto de retiro o limitación de tratamiento vital (LET. El presente artículo de reflexión analiza los problemas éticos que se generan al implementar los protocolos de LET en las unidades de cuidados intensivos (UCI. El artículo está dividido en cuatro partes: 1. Distinciones terminológicas; 2. formas de aplicación de la LET; 3. LET en casos especiales: pediatría y personas con discapacidad, y 4. los problemas éticos específicos de la LET.

  2. Máquina para a colheita contínua de azeitona em olivais intensivos

    OpenAIRE

    Dias, António Bento; Cardoso, V.; Reynolds de Souza, D.; Falcão, J.M.; Pinheiro, Anacleto; Peça, J.O.

    2012-01-01

    A diminuição dos custos de colheita nos olivais intensivos (200 a 550 árvores por hectare) terá de ser encarada como tarefa urgente para que estes olivais possam ser competitivos. Nestes olivais, a técnica tradicional de colheita com vibradores de tronco encontra limitações, como a falta de espaço para o desempenho de equipamentos de recolha associados aos vibradores; mas é sobretudo, devido a ser uma técnica descontínua, baseada numa repetição de ciclos de manobras, que origina enorme fa...

  3. Engorde de bagres (Rhamdia quelen) en sistema de cultivo intensivo por sexos separados

    OpenAIRE

    Comolli, J; Roux, J.P; Sánchez, S; Hernández, D

    2013-01-01

    El bagre sudamericano (ramdiá o jundiá) se caracteriza por rápido crecimiento en los primeros meses de vida e importante diferencia de desarrollo entre ambos sexos. La madurez sexual del macho es precoz, por lo cual la hembra alcanza un peso vivo 30% mayor que el del macho. El presente trabajo tuvo por objetivo analizar el engorde de especimenes de Rhamdia quelen separados por sexos en un sistema intensivo. Se llevaron a cabo tres tratamientos: TA- hembra, TB- mixto y TC- macho. El engorde se...

  4. Herramienta para el cálculo de personal de cuidado intensivo neonatal

    Directory of Open Access Journals (Sweden)

    Juan Guillermo Rojas

    2011-01-01

    Full Text Available La gestión del cuidado de enfermería supone la utilización de métodos y herramientas que de manera práctica permitan una aproximación a las necesidades de cuidado de los pacientes y ayuden a planear los requerimientos humanos y técnicos para tal fin. Objetivo: identificar la utilidad del Neonatal Therapeutic Intervention Scoring System (NTISS en el cálculo de personal de enfermería en la unidad de cuidado intensivo (UCIN e intermedio neonatal (UCEN de la Clínica Universitaria Bolivariana (CUB en Medellín, Colombia. Método: estudio descriptivo, transversal, realizado durante el mes de abril de 2007. La población estuvo conformada por los neonatos ingresados y hospitalizados en la UCIN y UCEN, para lo que fue necesario aplicar el instrumento al final de cada turno. Se calculó una muestra de 384 instrumentos (proporción desconocida y un intervalo de confianza de 0,5. La consistencia interna del instrumento se determinó con el alfa de Cronbach (0,8. Resultados: se recolectaron 425 instrumentos diligenciados de 22 neonatos. Las patologías más frecuentes fueron las de tipo respiratorio. El puntaje total de los NTISS analizados fue de 5.200 puntos, con un promedio de 12,3, equivalentes a 123 minutos de trabajo de enfermería por turno de 6 horas. Del total de intervenciones el 62% están asignadas a las enfermeras, el 22% a las auxiliares de enfermería y el 16% a terapia respiratoria. Se calculó el requerimiento de 4 enfermeras por turno en la UCIN y UCEN. Conclusiones: el NTISS es útil para la asignación y el cálculo del personal de enfermería y contribuye a mejorar los procesos de gestión del cuidado.

  5. El abandono en las etapas iniciales de los estudios superiores

    OpenAIRE

    Norma Zandomeni; Sandra Canale; Andrea Pacifico; Fernanda Pagura

    2016-01-01

    En este artículo se presenta una investigación sobre abandono de los estudios superiores realizada en una universidad argentina. Con un abordaje metodológico cuanti-cualitativo, se analizan datos secundarios y se recupera la perspectiva de distintos actores mediante talleres, encuestas y entrevistas. Se aborda el abandono que se produce en el proceso del ingreso y el generado en los dos primeros años, tanto en su cuantificación como en los factores que operan en el mismo. En el primer caso el...

  6. Un estudio sobre el rendimiento universitario

    Directory of Open Access Journals (Sweden)

    Albaladejo Pina, I. P.

    1999-01-01

    Full Text Available El objetivo del presente trabajo es contrastar los rendimientos académicos de alumnos de dos cursos de la Facultad de Ciencias Económicas y Empresariales de la Universidad de Murcia, uno con el antiguo plan de estudios y otro con el actualmente en vigor. Analizamos el éxito y el fracaso para los estudiantes de cada uno de estos cursos, así como las variables socioeconómicas y educacionales que pueden influir en su rendimiento. Comprobamos, mediante unas estimaciones logit, que tanto unas como otras variables son factores condicionantes de este rendimiento. En particular, destacamos la influencia de haber cursado la opción C de COU en cuanto a fracasar o no en su primer curso universitario.

  7. Traqueobronquitis y neumonía asociadas a ventilación mecánica en unidades de cuidado intensivo de Latinoamérica: epidemiología, curso clínico y desenlaces (Estudio LATINAVE

    Directory of Open Access Journals (Sweden)

    Fabio Andrés Varón-Vega

    Full Text Available Resumen Introducción: Las infecciones asociadas a ventilación mecánica son causa importante de morbimortalidad en el paciente crítico. La diferenciación entre traqueobronquitis y neumonía no es siempre fácil, y es controvertida. Algunos trabajos describen aumento de mortalidad, mayor estancia en Unidades de Cuidado Intensivo (UCI, mayor requerimiento de ventilación mecánica e incremento de costos en pacientes con traqueobronquitis asociada a ventilador (TAV, sin diferencias significativas en pacientes con neumonía asociada a ventilador (NAV. Estos estudios no describen el comportamiento clínico y epidemiológico de la TAV y la NAV como 2 entidades independientes, por lo que es necesario describirlo. Métodos: Estudio multicéntrico de cohorte prospectiva, de pacientes adultos que desarrollaron TAV o NAV durante su estancia en UCI, entre noviembre de 2013 y octubre de 2014. A cada una de las variables demográficas, clínicas, de laboratorio y de desenlace, como tiempo de ventilación mecánica, estancia hospitalaria y muerte, se le realizó análisis descriptivo; para evaluar las diferencias entre los grupos se utilizó test de chi cuadrado, t de Student o U de Mann Whitney. Resultados: Se incluyó a 143 pacientes, con edad promedio de 55 años, 57% eran hombres, de 6 países en Latinoamérica; 63% con NAV y 37% con TAV. Las comorbilidades más frecuentes fueron cardiovascular (44% y neurológica (30%; esta última fue más frecuente en TAV (41,5 vs. 23%; p = 0,02. No se encontró diferencia en APACHE II de ingreso. El índice SOFA fue mayor en NAV (8 vs. 5; p = 0,02. No hubo diferencias en el aislamiento microbiológico, ni en los patrones de resistencia bacteriana entre las 2 entidades. Se observó mayor número de complicaciones cardiovasculares y SDRA en pacientes con NAV. No se encontró diferencia entre los 2 grupos en estancia en UCI, los días de ventilación mecánica ni en mortalidad. Conclusiones: La prevalencia de TAV fue

  8. Aportes para una vida saludable. Proceso socioeducativo con estudiantes de primer ingreso, Universidad Nacional

    OpenAIRE

    Gonzalez-Soto, L.; Orozco-Morales, A.R.

    2017-01-01

    Propósito: Exponer la experiencia de medir en algún grado el impacto social de un proceso socioeducativo anual, desarrollado con 800 estudiantes de primer ingreso provenientes de diversos lugares del país, con limitadas condiciones socioeconómica y quienes son beneficiarios de beca para sus estudios. El proceso consistió en establecer 4 o 5 eventos anuales y trabajar con metodologías lúdicas temas alusivos a estilos de vida saludables. Material y método: Se aplicó la técnica de grupo focal al...

  9. Galactosemia: Diagnóstico precoz mediante estudio enzimático

    Directory of Open Access Journals (Sweden)

    Úrsula Carrillo Estrada

    2003-09-01

    Full Text Available Se presentan los resultados obtenidos del estudio realizado a un paciente masculino de 45 días de nacido, cuyo motivo de ingreso fue pérdida de peso, decaimiento, retraso psicomotor y crisis de hipoglucemia. Los síntomas comenzaron en el período neonatal y coincidieron con la introducción de la lactancia materna. En estudios realizados se constató en la orina la presencia de lactosa y galactosa. Se confirma el diagnóstico por estudio enzimático. La evolución clínica ha sido satisfactoria. El tratamiento dietético que excluía a los alimentos que contienen galactosa y lactosa fue de mucha importancia. Es el primer caso diagnosticado en Cuba mediante estudio enzimático.This paper presents the results of a study performed on a 45-day old male patient who was admitted to the hospital for weight loss, tiredness, psychomotor retardation and hypoglicemic crisis. The symptoms had begun in the neonatal period and had coincided with the introduction of breast feeding. The studies detected lactose and galactose in urine. The enzymatic study confirmed the diagnosis. The clinical recovery was satisfactory. The dietary treatment that excluded foods containing galactose and lactose was important and successful. He is the first case diagnosed on enzymatic study in Cuba.

  10. Ansiedad, depresión y malestar emocional en los profesionales sanitarios de las Unidades de Cuidados Intensivos

    Directory of Open Access Journals (Sweden)

    Sandra Gómez-Martínez

    2015-05-01

    Full Text Available Los profesionales sanitarios (PS de las Unidades de Cuidados Intensivos (UCI no son inmunes a los efectos emocionales que supone enfrentarse diariamente a situaciones de sufrimiento y muerte. Los estudios sobre afectación emocional en PS se han centrado en el síndrome burnout y han presentado ansiedad y depresión como consecuencias de éste. Nuestro objetivo es evaluar los problemas de ansiedad, depresión y percepción subjetiva del estado de ánimo en profesionales de las UCIs. Los participantes fueron 117 PS de la UCI de un Hospital de la Comunidad Valenciana (España. Los análisis descriptivos muestran que entre 14.6%-20% y un 4-7% de los participantes presentan síntomas de ansiedad y de depresión respectivamente. Los análisis diferenciales, muestran diferencias en función del género en ansiedad y en función del puesto laboral en depresión. La edad y la experiencia mostraron relación con depresión y ansiedad. Además, se realizaron análisis de regresión para conocer qué variables juegan un papel más importante en la presencia de síntomas de ansiedad y depresión, Los resultados muestran que trabajar a diario en contacto con el sufrimiento y la muerte, en un ambiente con numerosas demandas, puede tener consecuencias sobre la salud mental de los profesionales.

  11. Probabilidad de retención de segundos molares permanentes mandibulares (Estudio piloto

    Directory of Open Access Journals (Sweden)

    Paulo Sandoval Vidal

    Full Text Available Objetivos: Determinar la frecuencia del segundo molar mandibular permanente (MM2 con probabilidad de impactación, en un grupo de pacientes de Ortodoncia de Temuco, Chile. Método: Estudio de corte transversal, con muestra por conveniencia. Se revisaron 2095 fichas de individuos de ambos sexos, con ausencia de patología sindrómica. Los datos recolectados se obtuvieron de radiografías panorámicas. Se midió el ángulo del segundo molar con respecto al plano oclusal, la invasión distal del primer molar y la distancia entre distal del primer molar y el borde anterior de la rama mandibular. Resultados: El promedio de edad de los pacientes relevados fue de 10 años. Se observó un 1,43% de probabilidad de retención de MM2 (n=30; en promedio y el plano el ángulo MM2 resultó de 27° el izquierdo y 26° el derecho; la invasión de MM2 en distal del primer molar resultó de 1,5 mm; el ángulo entre MM2 y el planos oclusal es de 123°; la distancia entre la cara distal del primer molar y el borde anterior de la rama mandibular fue 13 mm. Conclusiones: Existe una baja prevalencia de segundos molares mandibulares permanentes con probabilidad de impactación. La invasión a la cara distal del primer molar fue mayor en pacientes con riesgo de impactación

  12. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  13. Heterogeneidad empresarial, dinámica de la productividad y flujos de empleo : cuatro estudios sobre la empresa española

    OpenAIRE

    Ruano Pardo, Sonia

    2003-01-01

    Esta tesis reúne cuatro estudios realizados a partir de la información que proporciona la Encuesta sobre Estrategias Empresariales (ESEE) relativa a una muestra representativa de empresas manufactureras españolas encuestadas a lo largo del período 1990-98. El primer ensayo cuantifica la contribución de la rotación empresarial y de la evolución de la productividad de las empresas instaladas al crecimiento de la productividad agregada. Este estudio propone una metodología no paramétrica, altern...

  14. Morbimortalidad de pacientes mayores de 60 años en el servicio de cuidados intensivos de un hospital general

    Directory of Open Access Journals (Sweden)

    Jaquelyn Poma

    2012-03-01

    Full Text Available Objetivo: Determinar la morbimortalidad de los pacientes mayores de 60 años que ingresan a la unidad de cuidados intensivos (UCI de un hospital general. Material y métodos: Estudio descriptivo transversal. Se incluyeron pacientes que ingresaron a la UCI del Hospital Nacional Cayetano Heredia entre julio 2006 a diciembre 2009. Se recopilaron datos del archivo existente conformado por las hojas de epicrisis y las hojas de monitoreo ventilatorio y hemodinámico de la unidad. Resultados: La ocupación de camas por mayores de 60 años en UCI fue 38% comparado con 62% en menores de 60 (p=0,0001. La principal causa de ingreso a la unidad fue la insuficiencia respiratoria en 30,5%, las diez principales causas de ingreso y la intensidad del manejo fueron similares en ambos grupos. Existió más comorbilidad en adultos mayores [78,6%] que en jóvenes [54,5%] (p=0,071. La mortalidad en > 60 años fue 29%, en 80 años 31,4% (p=0,04. Conclusiones: El 38% de pacientes en UCI son mayores de 60 años y éste porcentaje disminuye a medida que aumenta la edad. Las principales causas de ingreso son similares a los del grupo menor de 60 años, pero existe mayor mortalidad en los pacientes mayores especialmente en el grupo que ingresó con enfermedad más severa

  15. Los estudios longitudinales en la prevención de las enfermedades cardiovasculares

    Directory of Open Access Journals (Sweden)

    Ignacio Balaguer Vintró

    2004-01-01

    Full Text Available Los estudios longitudinales de cohortes bien definidas han contribuido a la identificación de los factores de riesgo de la cardiopatía coronaria y otras complicaciones clínicas de la aterosclerosis. Después de comentar las conclusiones de los estudios de la aterosclerosis experimental y los factores de riesgo sugeridos por el estudio de una serie de infartos de miocardio en adultos jóvenes en comparación con controles apareados, se expone la metodología, el desarrollo y los resultados de los estudios longitudinales realizados en Estados Unidos desde 1949: Twin Cities, Framingham, Pooling Project, Western Collaborative, Puerto Rico, Evans County, NI-HONSAN, San Francisco, Harvard, Bogalusa y CARDIA. Se presta especial atención a las hipótesis propuestas al inicio del estudio de Framingham y a los obstáculos y cambios para continuar el proyecto después de los primeros veinticuatro años. A continuación se expone el Seven Countries Study, ideado y dirigido por Ancel Keys y primer estudio realizado con metodología centralizada en varios países, y los estudios longitudinales realizados en diversos países de Europa: Whitehall, Manresa, París, British Regional, Northwick Park, Caerphilly, Speedwell, PROCAM. Se analiza el papel de los estudios longitudinales en la metodología de los estudios posteriores: hijos e hijas de los participantes en Framingham, estudios longitudinales basados en cuestionarios, estudios de otros posibles factores de riesgo, prevalencia de factores de riesgo en estudios retrospectivos, ensayos de intervención primaria (MRFT, WHO European Collaborative Trial y el de Goteburgo y la participación de los equipos entrenados en el Proyecto MONICA. Se señalan los temas todavía en debate en relación con la metodología y los resultados de los estudios longitudinales: exámenes periódicos de los participantes en las cohortes de los estudios epidemiológicos, cambios en la definición de nuevos casos de accidentes

  16. Estudio de la viabilidad para la explotación de yacimientos

    OpenAIRE

    Peón, A.

    1980-01-01

    RESUMEN: Los estudios de viabilidad tienen por objeto hacer un análisis económico teórico de un hipotético negocio minero que se establece en virtud de la existencia de un yacimiento. Prestaremos atención a un primer paso que podríamos denominar prefactibilidad, teniendo en cuenta que en una primera etapa no se deben emplear demasiados esfuerzos en el tema de los costes, donde las desviaciones, aunque pueden ser considerables son más o menos análogas a otros tipos de empresa.

  17. La deserción universitaria en primer año : Análisis de la situación de los ingresantes de la Facultad de Ciencias Naturales y Museo de La Plata a través del estudio de caso Introducción a la Botánica

    OpenAIRE

    Cristina, Inés

    2010-01-01

    Objetivo general: Indagar los motivos que pueden generar la alta deserción de alumnos ingresantes en la Facultad de Ciencias Naturales y Museo de la UNLP, tomando como caso de estudio la materia Introducción a la Botánica. Objetivos específicos  Identificar situaciones recurrentes que puedan orientar sobre las posibles causas de deserción de alumnos en el primer año de la carrera de Licenciatura en Biología de la Facultad de Ciencias Naturales y Museo, tomando ...

  18. Música y expresión corporal estudio en niños/as de primer año de educación básica del centro educativo comunitaria intercultural bilingüe “Àngel Erminio Silva Olivo”. Llactapamba – matriz – alausi. 2016.

    OpenAIRE

    Mullo Valente, David

    2017-01-01

    La presente investigación denominada “Música y Expresión Corporal estudio en niños/as de Primer año de Educación Básica del Centro Educativo Comunitaria Intercultural Bilingüe “Ángel Erminio Silva Olivo” Llactapamba – Matriz – Alausi 2016. El propósito determinar el problema ¿Cómo influye la música en el desarrollo de la expresión corporal?, por lo cual se planteó como Objetivo general. Determinar la influencia de la música en el desarrollo de la expresión corporal. Para fundamentar se revisó...

  19. Estudio EPIFARM

    Directory of Open Access Journals (Sweden)

    Martín Morales A

    2010-12-01

    Full Text Available INTRODUCCIÓN Los farmacéuticos comunitarios pueden ser un importante primer punto de contacto con los pacientes con disfunción eréctil (DE, pero hasta la fecha no hay ningún estudio sobre las características de los hombres que acuden a un farmacéutico solicitando consejo o tratamiento para la DE. OBJETIVO Caracterizar los perfiles de los hombres que solicitan tratamiento para la DE en la farmacia, con o sin receta de inhibidores de la fosfodiesterasa tipo 5 (iPDE5. MÉTODOS Entre septiembre y noviembre de 2008 se realizó un estudio observacional, transversal y multicéntrico en farmacias comunitarias de España. De aquellos hombres que solicitaban consejo o tratamiento para la DE, cada investigador reclutó un paciente que tenía receta médica de iPDE5 y otro que acudía sin receta médica. Los farmacéuticos del estudio completaron un cuestionario de datos demográficos, clínicos y conductuales del paciente, incluido el Cuestionario de salud sexual para varones (Sexual Health Inventory for Men. VARIABLES PRINCIPALES Características demográficas y respuestas a los cuestionarios. RESULTADOS 574 farmacéuticos seleccionaron a 1.147 pacientes, de los cuales 1.113 fueron incluidos en el análisis. No se observaron diferencias estadísticas entre los grupos en cuanto al peso, la hipertensión, la diabetes mellitus, la hipercolesterolemia, la dislipidemia, la depresión o el estrés. Tampoco se observaron diferencias estadísticas respecto a la gravedad de la DE (p = 0,7892 ni a la proporción de hombres sin DE en cada grupo (p = 0,5755. En ambos grupos, los pacientes habían presentado síntomas de DE durante una media de veintiséis meses antes de la primera consulta a un profesional sanitario. Para el 60,2% de los pacientes incluidos en el grupo sin receta, la visita a la farmacia fue la primera ocasión en la que habían hablado de su DE con un profesional sanitario, y el 50% de aquellos que habían hablado previamente de la DE lo hab

  20. Consecuencias ambientales de la producción de carne bovina en sistemas intensivos confinados (Feedlots)

    OpenAIRE

    Maisonnave, Roberto Carlos

    2002-01-01

    Se estudiaron variables fisicas y químicas de importancia ambiental en un Establecimiento dedicado al Engorde Bovino Intensivo en Confinamiento, comúnmente llamado feedlot, con el objetivo de determinar si esta actividad generó contaminación ambiental tras diez años de existencia. Se determinaron las concentraciones de distintas especies químicas utilizando métodos estandarizados de recolección y acondicionamiento de muestras, como así también métodos quimicos y fisicos normalizados de determ...

  1. cuidados intensivos neonatales

    Directory of Open Access Journals (Sweden)

    Mónica C. Mercado U.

    2005-01-01

    Full Text Available La frecuencia de resistencias a diversas bacterias mediadas por beta lactamasas de espectro extendido, varía ampliamente entre países, hospitales, tipo de unidad y tipo de paciente. Como medida de control para brotes de KPN, se estudió la sustitución de cefalosporinas de tercera generación en una UCI de población adulta con antibióticos β-lactámicos/inhibidores de β-lactamasas, entre ellos piperacilina/tazobactam. Se ha demostrado que al eliminar la presión ejercida por cefalosporinas de tercera generación, en la resistencia bacteriana, se logra desplazar las cepas de KPN productoras de BLEE por bacterias no productoras de BLEE. Por medio de un estudio longitudinal, prospectivo, secuencial y autocontrolado en una UCI neonatal, sustituimos el uso de cefalosporinas de tercera generación, durante dos periodos de tiempo comparando las tasas de infección por KPN y los porcentajes de resistencia a ceftazidima. Encontramos una disminución de una tasa de incidencia de infección nosocomial por KPN de 6.4 a 2.9 x 100; χi 2 25.615 (p = 0.000 Asimismo, una reducción de la resistencia de KPN a ceftazidima 83.3 % durante el uso de cefalosporinas, a 6.3% al final del estudio; χi 2 33.961 (p= 0.000, I.C. 0.08 – 0.49 Aunque no se obtenga una disminución franca en la tasa de infección nosocomial, ya instalada la medida de sustitución de cefalosporinas, sí se pudo incidir en la disminución y control de las resistencias bacterianas. Por sí misma, esta medida favorece las estancias hospitalarias cortas, la posibilidad de una mejoría en los costos de antibióticos

  2. Estudio de factibilidad para la creación de una empresa xtremesoftware dedicada al diseño, comercialización y soporte de software administrativo – financiero en la ciudad de Quito.

    OpenAIRE

    Cobo Martinez, Cyntia Estefania

    2011-01-01

    RESUMEN EJECUTIVO El presente proyecto de factibilidad se compone básicamente de cinco partes que constituyen la esencia de la investigación: El software en la actualidad. Ingeniería de software, Estudio de mercado. Estudio técnico. Estudio financiero. El primer capítulo constituye el análisis de la industria de software, representa estadísticamente la evolución a nivel mundial, de Latinoamérica y nacional del sector, determinando el desarrollo que representa par...

  3. Medicación potencialmente inapropiada en ancianos en un hospital de primer nivel, bogotá 2007

    OpenAIRE

    Holguín-Hernández, Esperanza; Orozco-Díaz, José G.

    2012-01-01

    Objetivo Describir la medicación potencialmente inapropiada en ancianos (MPIA) atendidos en consulta ambulatoria en primer nivel en Bogotá en 2007. Metodología Se realizó un estudio de corte transversal, como criterios de MPIA se utilizaron los propuestos por Beers actualizados en 2002. La información se obtuvo de una muestra aleatoria de 423 pacientes mayores de 65 años que asistieron a 16 unidades de atención primaria, se revisó la última consulta registrada en el año en la historia clínic...

  4. Primer estudio de la epigenética como un biomarcador en la estenosis pieloureteral

    OpenAIRE

    García Palacios, María

    2013-01-01

    El objetivo de nuestro trabajo es estudiar la relación entre la metilación y la fibrosis fisiopatológica que se produce en la estenosis pieloureteral. Si existe esta relación, es nuestro propósito analizar si la epigenética puede convertirse en un biomarcador en el estudio de la estenosis pieloureteral y en caso de que existiera, definir una "huella epigenética" que nos permita identificar a pacientes con estenosis pieloureteral con una evolución clínica determinada, pudiendo ...

  5. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  6. Indicações da Broncofibroscopia em Unidade de Cuidados Intensivos

    Directory of Open Access Journals (Sweden)

    Ema Sacadura Leite

    1997-05-01

    Full Text Available RESUMO: A deterioração respiratória é um problema comum em U.C.I., para a qual a broncofibroscopia constitui um método auxiliar diagnóstico e terapêutico importante. Trata-se contudo de um método invasivo, pelo que é importante avaliar as vantagens da sua utilização. Este trabalho de revisão pretende estudar algumas das situações correntes em U.C. I. onde a broncofibroscopia poderá ser útil. SUMMARY: Respiratory failure is a common problem in I.C.U., for which fiberoptic bronchoscopy is an important auxiliar diagnostic and therapeutic method. This is however an agressive method, so it is important to assess the advantage of its use. The purpose of this work is to study various current problems in I.C.U. where fiberoptic bronchoscopy may be useful. Palavras-chave: Unidade de Cuidados Intensivos, Broncofibroscopia, Key-words: Intensive Care Unit, Fiberoptic bronchoscopy

  7. Informe científico de Beca de Estudio: Osuna, María Florencia (2014-2015)

    OpenAIRE

    Osuna, María Florencia

    2015-01-01

    Mis actividades como becaria de Estudio en este primer año y medio de beca abarcaron diversos aspectos: 1. Trabajo en hemerotecas para recabar los documentos históricos necesarios para el abordaje de mi problema de investigación 2. Búsqueda, lectura y sistematización de la bibliografía necesaria para enmarcar teórica e historiográficamente el recorte realizado 3. Escritura y sistematización de los primeros resultados, con la defin...

  8. PRIORITY SETTING IN AN ACUTE CARE HOSPITAL IN ARGENTINA: A QUALITATIVE CASE STUDY DISTRIBUCIÓN PRIORITARIA EN UN HOSPITAL DE CUIDADOS INTENSIVOS EN ARGENTINA: ESTUDIO CUALITATIVO DE UN CASO DISTRIBUIÇÃO PRIORITÁRIA EM UM HOSPITAL DE CUIDADOS INTENSIVOS NA ARGENTINA: ESTUDO QUALITATIVO DE UM CASO

    Directory of Open Access Journals (Sweden)

    Heather Gordon

    2009-11-01

    Full Text Available Purpose: To describe and evaluate priority setting in an Acute Care hospital in Argentina, using Accountability for Reasonableness, an ethical framework for fair priority setting. Methods: Case Study involving key informant interviews and document review. Thirty respondents were identified using a snowball sampling strategy. A modified thematic approach was used in analyzing the data. Results: Priorities are primarily determined at the Department of Health. The committee which is supposed to set priorities within the hospital was thought not to have much influence. Decisions were based on government policies and objectives, personal relationships, economic, political, historical and arbitrary reasons. Decisions at the DOH were publicized through internet; however, apart from the tenders and a general budget, details of hospital decisions were not publicized. CATA provided an accessible but ineffective forum for appeals. There were no clear mechanisms for appeals and leadership to ensure adherence to a fair process. Conclusions: In spite of their efforts to ensure fairness, Priority setting in the study hospital did not meet all the four conditions of a fair process. Policy discussions on improving legitimacy and fairness provided an opportunity for improving fairness in the hospital and Accountability for Reasonableness might be a useful framework for analysis and for identifying and improving strategies.Propósito: Describir y evaluar el establecimiento de prioridades en un hospital de cuidados intensivos en Argentina, empleando la Administración Razonable como marco ético para una justa asignación. Métodos: Estudio de un Caso que incluía entrevistas a un informante y revisión de documentos. Se identificó a treinta participantes empleando la estrategia de muestras tipo "bola de nieve". Al analizar los datos, se empleó un enfoque temático modificado. Resultados: Las prioridades se determinan principalmente en el Departamento de Salud

  9. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz

    2016-01-01

    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  10. Análisis del clima familiar y resiliencia en una muestra de estudiantes universitarios de primer curso

    OpenAIRE

    Caamaño Fandiño, Alba María

    2016-01-01

    Traballo Fin de Grao en Educación Social. Curso 2015-2016 [ES] La modalidad elegida para desarrollar este Trabajo de Fin de Grado es la de iniciación a la investigación de campo. Así, este estudio se plantea con el objetivo general de analizar la resiliencia y el clima familiar en una muestra del alumnado universitario de primer año, en esta ocasión, perteneciente a la Universidad de Santiago de Compostela. La sociedad cambia constantemente y, con ella, las necesidades de los individuos...

  11. Una aproximación al estudio del auxilio social en la capital almeriense (1939-1958

    Directory of Open Access Journals (Sweden)

    María del Carmen Giménez Muñoz

    2011-10-01

    Full Text Available Aunque desde hace ya tiempo la época franquista está recibiendo una creciente atención por parte de la historiografía, el estudio de las políticas sociales franquistas presenta importantes claroscuros, con lagunas de gran relevancia. Auxilio Social se convertía en una institución oficial del régimen franquista con la misión de cumplir, bajo el protectorado del Estado, unas funciones benéficas y político-sociales determinadas. A nivel local, en Almería, el trabajo que aquí se presenta tiene como objetivo aproximarse al estudio de dicha institución como parte de un elemento perfectamente integrado y hasta necesario dentro del sistema totalitario que construye el primer franquismo.

  12. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  13. Pseudomonas aeruginosa multiresistente em unidade de cuidados intensivos: desafios que procedem? Pseudomonas aeruginosa multiresistente en una unidad de cuidados intensivos: desafíos que proceden? Multi-resistant pseudomonas aeruginosa among patients from an intensive care unit: persistent challenge?

    Directory of Open Access Journals (Sweden)

    Maria Verônica Guilherme Ferrareze

    2007-03-01

    Full Text Available OBJETIVOS: Avaliar a ocorrência de infecção hospitalar por Pseudomonas aeruginosa multiresistente em pacientes hospitalizados em uma unidade de cuidados intensivos. MÉTODO: estudo retrospectivo realizado de outubro de 2003 a setembro de 2004 em um hospital de emergências. RESULTADOS: Totalizou-se 68 portadores de bactérias multiresistentes sendo 10 (14,7% de P. aeruginosa. Destes, 8 pacientes eram do sexo masculino, as médias de idade e de internação foram respectivamente de 57 anos a média de idade, 43,7 a média de dias de internação e 7 pacientes morreram. Isolaram-se 8 cepas no sangue, cinco na urina, duas em cateteres venosos e uma no líquor, das quais sete sensíveis somente a polimixina e três ao imipenem. CONCLUSÃO: O perfil microbiológico deve ser avaliado periodicamente visto que é específico de uma unidade ou instituição, e demanda ações correlatas.OBJETIVOS: Evaluar la ocurrencia de infección hospitalaria por Pseudomonas aeruginosa multiresistente en pacientes hospitalizados en una unidad de cuidados intensivos. MÉTODO: estudio retrospectivo realizado de octubre del 2003 a setiembre del 2004 en un hospital de emergencias. RESULTADOS: Se tuvo un total de 68 portadores de bacterias multiresistentes de las cuales 10 (14,7% de P. aeruginosa. De éstos, 8 pacientes eran del sexo masculino, los promedios de edad y de internamiento fueron respectivamente de 57 años y 43,7 de días de internamiento y 7 pacientes murieron. Se aislaron 8 cepas en la sangre, cinco en la orina, dos en catéteres venosos y una en el licor, de ellas siete eran sensibles sólo a la polimixina y tres al imipenem. CONCLUSIÓN: El perfil microbiológico debe ser evaluado periódicamente dado que es específico de una unidad o institución, y demanda acciones correlatas.OBJECTIVES: To evaluate the occurrence of multi-resistant Pseudomonas Aeruginosa infection among patients from an Intensive Care Unit. METHODS: This retrospective study was

  14. Estudio transversal de leptospirosis y muerte fetal en Yucatán, México

    OpenAIRE

    María Fidelia Cárdenas-Marrufo; Ignacio Vado-Solis; Gaspar Fernando Peniche-Lara; Carlos Perez-Osorio; José Correa-Segura

    2016-01-01

    Introducción: Leptospirosis es una enfermedad zoonótica que afecta principalmente la población humana de bajos recursos. Infección aguda por leptospirosis durante el embarazo se ha asociado con aborto espontáneo y muerte fetal durante el primer trimestre del embarazo.Objetivo: Estimar la frecuencia de infección por Leptospira interrogans en mujeres con aborto espontáneo en el estado de Yucatán, México.Métodos: Se efectuó un estudio trasversal en 81 mujeres con aborto espontáneo. La prueba de ...

  15. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  16. Demandas y control del trabajo: implicaciones en las unidades de tratamiento intensivo pediatrico y neonatal

    OpenAIRE

    Fogaça, Monalisa de Cássia [UNIFESP; Carvalho, Werther Brunow de [UNIFESP; Nogueira-Martins, Luiz Antonio [UNIFESP

    2010-01-01

    Comparar a demanda e o controle sobre trabalho de médicos e enfermeiros que trabalham em unidades de tratamento intensivo pediátrica e neonatal. Estudo transversal com 37 médicos e 20 enfermeiros. Utilizou-se o Job Content Questionnarie. Médicos da UTI Neonatal diferem em suporte social recebido do supervisor (p=0,01) em relação aos da UTI Pediátrica. Enfermeiros da UTI Neonatal apresentam insegurança no trabalho (p=0,05). Médicos e enfermeiros da UTI Pediátrica diferem em controle sobre o tr...

  17. Construcción de competencias interculturales para el desarrollo de una propuesta de experiencias de aprendizaje para alumnos de primer año de medicina

    Directory of Open Access Journals (Sweden)

    Juan Pablo Murillo

    2015-01-01

    Full Text Available El presente ensayo tiene como objetivo plantear las bases conceptuales y metodológicas que permitieron el diseño de un conjunto de contenidos y experiencias de aprendizaje orientadas al logro de competencias interculturales de base en la formación del estudiante del primer año de estudios en la Escuela de Medicina de la Facultad de Medicina de San Fernando, para el periodo de estudios 2010-2013. Se describe el desarrollo de un conjunto de experiencias de aprendizaje orientadas a lo que denominamos ‘Gestión de la Otredad orientadas a introducir una base general de competencias interculturales. Se analizan las posibilidades y limitaciones de la propuesta en el marco del contexto cultural e institucional actualmente existente y se plantean elementos para un desarrollo futuro de estas competencias en el plan de estudios de medicina.

  18. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  19. La voz de los estudiantes de primer año en seis países: evaluación de sus experiencias en estudios superiores científico-técnicos

    Directory of Open Access Journals (Sweden)

    Ángel Vázquez-Alonso

    2016-06-01

    Full Text Available Resumen Este estudio analiza la valoración de los estudiantes de seis países latinos sobre sus experiencias de primer año en educación superior de ciencias, tecnologías, ingenierías y matemáticas (CTIM. El objetivo es ofrecer pruebas empíricas sobre la importancia de distintos factores determinantes de la permanencia en los cursos universitarios de CTIM. Los estudiantes respondieron el cuestionario del proyecto Interés y Reclutamiento en Ciencia (IRIS; se presentan las respuestas relativas a las percepciones de los estudiantes sobre experiencias, expectativas cumplidas y valoración de resultados académicos. Se identifican los factores más y menos importantes, los perfiles nacionales de los seis países y las diferencias entre hombres y mujeres; aparecen muchas diferencias significativas entre países y algunas diferencias entre hombres y mujeres . Se discuten las implicaciones de los resultados para orientar las políticas institucionales que mejoren el reclutamiento, la retención (evitación del abandono y la equidad de género en los cursos CTIM.

  20. La influencia del crimen organizado transnacional en el proceso de formulación de políticas públicas. Estudio de caso: Argentina 2001-2013

    OpenAIRE

    Marín Osorio, Iván Felipe

    2016-01-01

    Este estudio de caso analiza la influencia del Crimen Organizado Transnacional en la formulación de Políticas Públicas de seguridad en Argentina entre 2001 y 2013. En contraste con otros estudios, se considera que la relación de estos dos fenómenos debe recoger aspectos fundamentales de un enfoque de seguridad integral y multidimensional. En el caso de Argentina, durante 2001 el Crimen Organizado Transnacional ocupó el primer lugar en la agenda pública, lo cual derivó en una serie de acciones...

  1. La Evaluación Del Alumnado Normalista Cordobés En El Primer Tercio Del Siglo Xx. Investigación Basada En Una Metodología Cuantitativa

    Directory of Open Access Journals (Sweden)

    Antonia Ramírez García

    2014-01-01

    Full Text Available Este trabajo ofrece los resultados de la evaluación del alumnado de las Escuelas Normales de Córdoba durante los tres planes de estudio existentes en el primer tercio del siglo XX en función del sexo, plan de estudios cursado, procedencia geográfica, extracción social y modalidad de enseñanza cursada. La metodología seguida ha sido predominantemente cuantitativa, los datos se han obtenido de una muestra estratificada de 618 sujetos y para el análisis de los mismos se ha recurrido a la estadística descriptiva e inferencial. Los resultados muestran que la evaluación del alumnado estuvo condicionada por el plan de estudios, el sexo y la modalidad de estudios cursada. No obstante, la procedencia geográfica y la extracción social del alumnado no determinaron los resultados alcanzados por estos alumnos. La evaluación del alumnado encuentra en la Historia un referente para evitar errores del pasado o para incorporar aspectos positivos a los actuales planes de estudio.

  2. Estudio clínico y de resonancia magnética orientado al conocimiento del sustrato patológico de la discapacidad en la esclerosis múltiple primariamente progresiva

    OpenAIRE

    Tur Gómez, Carmen

    2015-01-01

    Con el objetivo de contribuir al estudio de los mecanismos que subyacen al aumento de la discapacidad en la esclerosis múltiple primariamente progresiva (EMPP), fijamos tres objetivos principales. Asimismo, nos propusimos hacer una revisión de la literatura sobre EMPP publicada hasta el momento actual, utilizando la web www.pubmed.com como herramienta de trabajo, que sirviera como introducción a los estudios de la tesis. El primer objetivo consistió en investigar el grado de correlación entre...

  3. Nivel de consumo diario de frutas y verduras en escolares con sobrepeso y obesidad del primer y segundo grado de primaria de la Institución Educativa Particular San Andrés. Lima. Mayo 2011

    OpenAIRE

    Alfaro, katherine

    2013-01-01

    Objetivos: Determinar el nivel de consumo diario de frutas y verduras en escolares con sobrepeso y obesidad de primer y segundo grado de nivel primario de la IEP San Andrés. Diseño: Estudio descriptivo, transversal, observacional y prospectivo. Institución: Institución Educativa Particular San Andrés. Participantes: Veintisiete escolares con sobrepeso y 33 con obesidad, de primer y segundo grado de nivel primaria. Intervenciones: Aplicación de formato de frecuencia de consumo de frutas y verd...

  4. Estudio in vitro de la anatomía interna del primer molar superior mediante el proceso de diafanización

    OpenAIRE

    Montesinos Rivera, Mayra Vanessa

    2013-01-01

    Diferentes estudios corroboran la complejidad anatómica del sistema de conductos radiculares por la presencia de múltiples foránemes, deltas apicales, conductos accesorios y más variaciones. El propósito de este estudio in vitro fue identificar la anatomía interna del sistema de conductos radiculares de 84 primeros molares superiores permanentes, determinando el número de conductos por raíz y el tipo de conducto según la clasificación de Vertucci, así como la prevalencia del conducto mesioves...

  5. El abandono en las etapas iniciales de los estudios superiores

    Directory of Open Access Journals (Sweden)

    Norma Zandomeni

    2016-01-01

    Full Text Available En este artículo se presenta una investigación sobre abandono de los estudios superiores realizada en una universidad argentina. Con un abordaje metodológico cuanti-cualitativo, se analizan datos secundarios y se recupera la perspectiva de distintos actores mediante talleres, encuestas y entrevistas. Se aborda el abandono que se produce en el proceso del ingreso y el generado en los dos primeros años, tanto en su cuantificación como en los factores que operan en el mismo. En el primer caso el abandono se asocia principalmente a factores exógenos a la institución mientras que en el segundo toman fuerza factores internos a la universidad.

  6. Compressibilidade de um solo sob sistemas de pastejo rotacionado intensivo irrigado e não irrigado Soil compressibility under non-irrigated and irrigated short duration grazing systems

    Directory of Open Access Journals (Sweden)

    C. L. R. Lima

    2004-12-01

    Full Text Available O incremento da produtividade das pastagens tem sido associado ao comportamento à compressão dos solos. Os objetivos deste trabalho foram: quantificar as curvas de compressão e a pressão de preconsolidação em sistemas de pastejo intensivo rotacionado irrigado e não irrigado. Foram coletadas 96 amostras indeformadas de solo em quatro ciclos sucessivos de pastejo instalado com capim Tanzânia (Panicum maximum Jacq. em um Argissolo Vermelho. Após saturadas com água e equilibradas no potencial (psi: -10 kPa, as amostras foram pesadas e submetidas ao ensaio de compressão uniaxial com a aplicação sucessiva e contínua de pressões de 25, 50, 100, 200, 400, 600, 800, 1.000, 1.300 e 1.600 kPa. Os resultados comprovaram a hipótese de que houve diferença na compressibilidade do solo sob os sistemas de pastejo rotacionado intensivo irrigado e não irrigado. A maior compactação inicial verificada no sistema de pastejo rotacionado intensivo irrigado favoreceu o deslocamento das curvas de compressão uniaxial para valores superiores de densidade do solo. A pressão de preconsolidação foi significativamente superior no quarto ciclo de pastejo no sistema de pastejo rotacionado intensivo irrigado em relação ao sistema pastejo rotacionado intensivo não irrigado.Increment in pasture productivity has been associated with the understanding of the soil behavior under compression. The objective of this research was to quantify (a the compression curves and (b the preconsolidation pressure of the soils under non-irrigated and irrigated short duration grazing systems. Ninety-six undisturbed soil samples were taken from the four successive pasture cycles of Tanzania grass (Panicum maximum Jacq. in a Hapludalf. The samples were saturated in water and equilibrated at the matrix potential (psi: -10 kPa and then were weighed and submitted to an uniaxial compression test, applying the following pressures: 25, 50, 100, 200, 400, 600, 800, 1,000, 1,300, and

  7. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  8. Ventilación mecánica asistida en el Hospital San Rafael de Alajuela

    OpenAIRE

    Salas Segura, Donato A.

    1999-01-01

    Se trata de un estudio observacional sobre el empleo de la ventilación mecánica en un hospital de 2do nivel sin unidad de cuidados intensivos. UCR::Docencia::Salud::Facultad de Medicina::Escuela de Medicina

  9. Los padres y la familia como parte del cuidado en cuidados intensivos de pediatría The parents and family as part of care in pediatric intensive care

    Directory of Open Access Journals (Sweden)

    Purificación González Villanueva

    2011-09-01

    Full Text Available El propósito del estudio ha sido acercarnos a la experiencia y el significado que puede tener para un niño o niña entre 6 y 12 años, la hospitalización en una unidad de cuidados intensivos pediátrica (UCIP. La metodología utilizada ha sido el estudio de casos múltiples desde un enfoque etnográfico. La recogida de datos se ha hecho en un hospital de nivel cuatro de la comunidad de Madrid y en el domicilio de los niños, utilizando la observación participante y entrevistas semiestructuradas a dos niñas y un niño, sus familias y profesionales de la UCIP y planta de hospitalización pediátrica. Una de las conclusiones más relevantes es que los niños están solos la mayor parte del tiempo, sin embargo una de sus necesidades más importantes es la presencia de los padres/familia.The purpose of this study is to make an approach to the experience and meaning that the hospitalization in a paediatric intensive care unit (PICU may have for 6 to 12 years old children. The methodology used has been the study of multiple cases from an ethnographic point of view. Data has been collected in a four level hospital of Madrid and at the children homes, using participating witnessing and semi structured interviews to two girls and a boy, their families and PICU and paediatric ward professionals. One of the most outstanding conclusions is that children are alone most of the time, although one of their most important needs is the presence of their parents and families.

  10. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  11. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  12. Primer aislamiento de Escherichia coli O157:H7 Enterohemorrágica en el Perú

    Directory of Open Access Journals (Sweden)

    Blanca Huapaya C

    2001-01-01

    Full Text Available En Febrero del año 2001 como parte del "Estudio transversal de los agentes etiológicos de diarrea aguda" en la Macrorregión Sur del país, el Laboratorio Referencial de Tacna aisló una cepa procedente de una muestra de heces de un lactante de 11 meses de edad con un cuadro de diarrea disentérica, identificándola como Escherichia coli O157. Esta cepa fue confirmada y caracterizada en el Instituto Nacional de Salud como E. coli O157:H7 toxina shiga tipo II, siendo el primer aislamiento reportado de Escherichia coli enterohemorrágica en el Perú.

  13. Aplicaciones de los modelos multinivel al análisis de medidas repetidas en estudios longitudinales

    OpenAIRE

    María Victoria Zunzunegui; María Jesús García de Yébenes; Mathieu Forster; María Dolores Aguilar Conesa; Angel Rodríguez Laso; Ángel Otero

    2004-01-01

    Este trabajo es una introducción al análisis de medidas repetidas en estudios longitudinales. Se utiliza un marco analítico con dos etapas, ajustando modelos jerárquicos lineales con dos niveles. El primer nivel corresponde a la ocasión (tiempo) de medida y el segundo al individuo. Estos modelos estadísticos proceden de las ciencias sociales, en las que se han utilizado durante más de 25 años para analizar datos en organizaciones con múltiples niveles. Su aplicación permi...

  14. Viabilidad del estudio de la respuesta biológica en muestras opacas, utilizando microscopia correlativa

    OpenAIRE

    Torrent Camarero, Sergi

    2014-01-01

    La implantología para la sustitución ósea es un sector industrial en auge como resultado del envejecimiento de la población en el primer mundo. La mayoría de los implantes para la sustitución de tejido duro se fabrican con titanio comercialmente puro y presentan tratamientos superficiales que aumentan la rugosidad superficial para mejorar la osteointegración. El efecto de la rugosidad en la respuesta celular es un tema que ha sido ampliamente estudiado en una gran cantidad de estudios cien...

  15. Escuela Inclusiva: estudio de caso sobre la inclusión del Trastorno de Espectro Autista

    OpenAIRE

    Ortuñez Vegas, Sonia

    2016-01-01

    La educación inclusiva sigue siendo hoy una asignatura pendiente. Este trabajo plantea, un estudio de casos en dos colegios de Zaragoza, respecto a las dificultades y las necesidades que tienen los docentes a la hora de trabajar con niños autistas y de qué manera podría ser posible la inclusión de este alumnado en centros ordinarios. En primer lugar realizamos un breve resumen del trastorno del espectro autista y la evolución de la educación inclusiva. En segundo lugar, se pres...

  16. Estudio de la comunicación verbal y no verbal y aplicación al discurso político

    OpenAIRE

    Ruano Flores, María de las Mercedes

    2014-01-01

    El trabajo está estructurado en dos apartados teóricos y un apartado práctico. El primer apartado teórico se centra en el estudio de la comunicación verbal y en el proceso de comunicación, y el segundo apartado se centra en la comunicación no verbal. En el apartado práctico encontramos la aplicación de los conocimientos al discurso político

  17. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  18. Estudio sobre la Implantación de un Sistema de Gestión Integral del Mantenimiento

    OpenAIRE

    Sánchez Serrano, Enrique

    2011-01-01

    Los objetivos básicos de este proyecto son la mejora de la gestión de un departamento de mantenimiento de una planta industrial. Para conseguir este objetivo se ha recurrido a un sistema integral de la gestión del mantenimiento, dotando de diferentes herramientas para conseguir dicha mejora. El proyecto esta divido en dos partes muy diferenciadas: En primer lugar está el estudio de la teoría sobre la gestión del mantenimiento y como estas herramientas pueden mejorar la gesti...

  19. Estudio de los microsatélites y miniSTRs del cromosoma X de aplicación forense

    OpenAIRE

    Castañeda Fernández, María

    2013-01-01

    Este trabajo se ha centrado en el estudio de microsatélites del cromosoma X, que se encuentran lo suficientemente próximos para ser analizados conjuntamente como haplotipos, con el objetivo de obtener los recursos necesarios para reconstruir pedigríes familiares que permitan resolver casos complejos de parentesco. Además, se ha focalizado en el desarrollo de nuevas herramientas moleculares para aumentar la eficacia del análisis de muestras de ADN altamente degradado y/o escaso. En primer...

  20. Proceso de alta de una unidad de cuidados intensivos. Medición de la ansiedad y factores relacionados

    OpenAIRE

    Ricart Basagaña, Mª Teresa

    2015-01-01

    La ansiedad es un diagnóstico que frecuentemente se relaciona con los enfermos de las unidades de cuidados intensivos (UCI). Aunque la literatura aporta evidencias suficientes para tener en cuenta el problema de la ansiedad y las complicaciones derivadas, aún desconocemos hasta qué punto la ansiedad tiene impacto en nuestro contexto cultural y cuáles son los factores que condicionan que algunas personas presenten niveles de ansiedad más altos que otras cuando son dados de alta de nuestras UC...

  1. Bienestar espiritual de enfermeras y enfermeros en unidades de cuidado intensivo Bem-estar espiritual de enfermeiras e enfermeiros em unidades de cuidado intensivo Spiritual wellness of nurses in intensive care units

    Directory of Open Access Journals (Sweden)

    Luis Sierra Leguía

    2012-01-01

    Full Text Available Objetivo: determinar el nivel de bienestar espiritual de enfermeros y enfermeras que laboran en Unidades de Cuidados Intensivos, Cartagena. Metodología: estudio descriptivo, muestra aleatoria de 101 enfermeras y enfermeros, con más de seis meses en el sitio de trabajo. Firmado el consentimiento informado, el grupo se caracterizó socio-demográficamente, se utilizó la Escala de Perspectiva Espiritual de Pamela Reed para medir creencias y prácticas espirituales. Los datos se presentan en frecuencias y porcentajes. Resultados: el 94,1 % son mujeres, con un promedio de 33,2 años y 5 años de trabajo; el 66,3 % pertenecen a un grupo religioso. La puntuación total de la escala es 60 puntos, el 98 % de los participantes presentó un bienestar espiritual alto (46-60 puntos y las prácticas que realizan son rezar (69,3 % o meditar (57,4 %. Para el 69,3 %, las creencias espirituales son importantes y el 60,4 % frecuentemente se siente cerca a Dios. Conclusiones: se evidenció un bienestar espiritual alto, demostrado por las prácticas y creencias espirituales. Para enfermería la espiritualidad es una dimensión importante en el cuidado porque permite crecer en la relación de la experiencia de cuidado.Objetivo: determinar o nível de bem-estar espiritual de enfermeiros e enfermeiras que trabalham em Unidades de Cuidados Intensivos, Cartagena. Metodologia: estudo descritivo, amostra aleatória de 101 enfermeiras e enfermeiros, com mais de seis meses no local de trabalho. Uma vez assinado o consentimento informado, foi realizada a caracterização demográfica do grupo. Utilizou-se a Escala de Perspectiva Espiritual de Pamela Reed para medir crenças e práticas espirituais. Os dados são apresentados em frequências e porcentagens. Resultados: 94,1 % são mulheres, com uma média de 33,2 anos e 5 anos de trabalho; 66,3% pertencem a um grupo religioso. A pontuação total da escala é de 60 pontos, 98% dos participantes exibiu um bem

  2. Aportes de los estudios de género a las ciencias sociales

    Directory of Open Access Journals (Sweden)

    Loreto Rebolledo

    2014-06-01

    Full Text Available Este artículo presenta un recorrido de los aportes y trayectorias de los estudios de género para el caso chileno, a partir de la revisión de las principales transformaciones en este campo a nivel mundial y su influencia sobre América Latina. A partir de la década de 1970, las ciencias sociales entran en una crisis donde no solo se ponen en entredicho los grandes paradigmas explicativos, sino también los modos de acceso y construcción del conocimiento. Las visiones universalistas comienzan a ser cuestionadas ante la aparición de las políticas de la identidad tras el debate generado por los movimientos sociales y sus reivindicaciones específicas, entre ellos, el movimiento feminista de los países del primer mundo, cuyas críticas a la influencia de la variable de género en la construcción del conocimiento dan origen a los estudios de la mujer, antecedente directo de lo que conocemos hoy como estudios de género. Estos estudios, construidos a partir de la permanente crítica y revisión por parte de las/os investigadoras/es del campo, han aportado nuevas miradas, temas y formas de abordaje interdisciplinario, contribuyendo así a la revitalización de las ciencias sociales en el mundo, pero, sobre todo en el contexto latinoamericano. En este artículo se da cuenta de estos aportes, mostrando el desarrollo de los estudios de mujer y género en Chile y, revisando el contexto general en que surgieron; su instalación en el país; sus principales aportes y los desafíos que enfrentan en la actualidad.

  3. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  4. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  5. Estudio climático y bioclimático del Parque Natural Sierra de Grazalema

    OpenAIRE

    Naranjo Barea, Alfonso Jesús

    2016-01-01

    El Parque Natural Sierra de Grazalema, uno de los ámbitos más interesantes desde el punto de vista climático y bioclimático de la península, no está lo suficientemente estudiado. Por ello, en primer lugar, afrontamos un estudio climático de detalle, donde se analizan en profundidad las dos variables climáticas más relevantes (temperatura y precipitación). En vista de que la cartografía climática pública es muy general, hemos elaborado, con los valores térmicos y pluviométricos anuales disponi...

  6. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña

    2010-01-01

    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  7. Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

    OpenAIRE

    Bedmar Carretero, Cristina

    2012-01-01

    El objetivo de este estudio fue valorar el desarrollo del niño durante el primer año de vida en función del tipo de lactancia realizada durante el primer semestre y de la dosis de hierro administrada durante el segundo semestre. El 75,5% realizan lactancia materna exclusiva al nacer y el 16,5% la mantienen hasta los 6 meses. El 39,5%tienen alguna mutación en el gen HFE. La prevalencia de déficit de hierroy anemia ferropénicaes del 4,5% y 2,5% a los 6 meses y del 9,2% y 1,2% a los 12 meses.La ...

  8. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  9. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  10. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  11. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  12. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  13. Evaluación de la adherencia primaria a medicamentos en pacientes con enfermedades crónicas afiliados al Seguro de Salud del Hospital Italiano de Buenos Aires: estudio de cohorte retrospectiva

    Directory of Open Access Journals (Sweden)

    Francisco Emiliano Peper

    2018-02-01

    Conclusiones: Este es el primer estudio que evaluó la adherencia primaria en Argentina y, según los resultados de nuestra búsqueda, el primero en el mundo para tamoxifeno. La adherencia primaria documentada en nuestra investigación fue algo mayor que la informada en la bibliografía.

  14. Expectativas de laborar en el primer nivel de atención de salud de los estudiantes de una facultad de medicina de Lima, Perú

    Directory of Open Access Journals (Sweden)

    Carolina B Tarqui-Mamani

    2015-01-01

    Full Text Available Introducción: La situación sanitaria del Perú requiere que más profesionales de la salud brinden atención en los establecimientos de salud del primer nivel de atención, ubicados principalmente en las zonas periféricas, rurales o más pobres del país. Objetivo: Identificar expectativas laborales y personales de los futuros profesionales de la salud que son formados en una facultad de medicina de Lima, particularmente trabajar en el primer nivel de atención de salud. Diseño: Estudio observacional, descriptivo y exploratorio. Lugar: Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Estudiantes pre internado de las Escuelas Académico Profesionales. Intervenciones: El muestreo fue por conveniencia y se incluyó a 278 estudiantes de las 5 escuelas que conforman la facultad de medicina. Se aplicó un cuestionario ad hoc donde se preguntó aspectos relativos a las expectativas laborales, económicas y visión de los estudiantes como futuros profesionales. Se calculó promedios, desviación estándar, distribución de frecuencias, los intervalos de confianza al 95% con la prueba de Poissón y chi cuadrado. Principales medidas de resultados: Expectativa de laborar en el primer nivel de atención de salud. Resultados: El 50% de los estudiantes manifestó que les gustaría desarrollarse en el área asistencial; solo 14,5% expresó su intención de trabajar en el primer nivel de atención de salud (puestos y centros de salud, 87,1% consideró que estudiar en una universidad emblemática es una fortaleza que favorece su vida profesional y 57,6% que seguirá estudios de posgrado; 58,6% de los estudiantes señaló la intención de trabajar en Lima, 21,9% en provincias y 16,2% en el extranjero. El promedio de expectativa económica mensual fue el equivalente a 1 577 nuevos soles o poco más de 2 sueldos mínimos vitales previstos para el 2012. Conclusiones: La expectativa de los futuros profesionales de la

  15. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  16. Medición de la cultura de seguridad del paciente en un hospital público de primer nivel en el municipio de Villeta

    OpenAIRE

    Lopez Pinzon, Vicente; Puentes Vega, Milton Augusto; Ramirez, Ana Lucia

    2016-01-01

    Esta investigación midió la percepción del personal asistencial sobre la cultura de seguridad de los pacientes en un hospital de primer nivel de complejidad por medio de un estudio descriptivo de corte transversal. Se utilizó como herramienta de medición la encuesta ‘Hospital Survey on Patient Safety Cultura’ (HSOPSC) de la Agency of Healthcare Research and Quality (AHRQ) versión en español, la cual evalúa doce dimensiones. Los resultados mostraron fortalezas como el aprendizaje organizaciona...

  17. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  18. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  19. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  20. El sentido de vida de las madres de niños prematuros internados en unidad de Cuidados intensivos neonatales (UCIN

    Directory of Open Access Journals (Sweden)

    María Celeste Gómez

    2016-01-01

    Full Text Available La prematuridad es una problemática que se encuentra en aumento a nivel mundial. En Argentina 8 de cada 100 bebés nacen antes de tiempo, de ahí la importancia de sensibilizar a la población sobre este tema. Para la logoterapia la motivación básica y propia del ser humano es su orientación fundamental hacia el sentido, es de- cir, el encontrar y descubrir un porqué y para qué. Tener en cuenta la dimensión existencial de la persona es una forma de acercarnos al problema. Por tal motivo el objetivo del trabajo que se in forma fue relacionar el sentido de vida develado por las madres de niños que se encuentran internados en Unidad de Cuidados Intensivos Neona- tales (UCIN debido a su nacimiento prematuro con dos factores; por un lado con la capacidad que ellas mismas refieren para informarse adecuadamente acerca de la situación de su hijo y por el otro, con su vinculación con situaciones límite vividas durante el embarazo. Se realizó un estudio experimental con 30 madres de niños prematuros que han pasado por una internación en UCIN en tres instituciones hospitalarias. Se construyó un instrumento con formato de entrevista semidirigida llamado Vivencia de Madres de Niños Nacidos Prematuramente. Los resultados demuestran que las madres con mayor capacidad para solicitar información sobre la situación de sus hijos son las que pudieron dar respuestas acerca de la pregunta sobre el sentido que esta situación les permitía descubrir. En un porcentaje menor pudieron relacionarse las respuestas con situaciones límites vividas con anterioridad.

  1. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  2. Estudio comparativo sobre los estilos de aprendizaje de estudiantes universitarios argentinos de diferentes disciplinas

    Directory of Open Access Journals (Sweden)

    Ana Clara Ventura

    2012-01-01

    Full Text Available La alfabetización académica exige el dominio progresivo de las formas textuales y discursivas propias de cada disciplina. El objetivo de este estudio es indagar los estilos de aprendizaje de estudiantes universitarios, estableciendo comparaciones según el tipo de episteme (Ciencias HumanasCiencias Exactas. Se realizó un estudio descriptivocorrelacional de corte transversal. Se aplicó el Inventario de Estilos de Aprendizaje de Felder y Soloman (1998 a 62 estudiantes de Ingeniería y 71 de Psicología de primer año de una universidad pública argentina. Los estudiantes inician su formación académica con distintos estilos de aprendizaje. Las discrepancias encontradas se acentuaron según el tipo de disciplina, y se obtuvieron diferencias estadísticamente significativas en los estilos de percepción (sensorial-intuitivo, representación (visualverbal y comprensión (secuencial-global. Los estudiantes de Ingeniería se definieron como sensoriales y visuales; en cambio, las orientaciones en Psicología son intuitivas, verbales y secuenciales. Implicancias educativas son discutidas.

  3. El Programa Intensivo Erasmus “Towards a Scientific Career: an Introductory Course for Research in Biomedicine and Biotechnology - BIOMED-TECH”

    OpenAIRE

    Llamas Company, Inmaculada; Departamento de Bioquímica y Biología molecular, Universidad de Alcalá de Henares, Madrid; Girón González, María Dolores; Departamento de Bioquímica y Biología Molecular II, Facultad de Farmacia, Universidad de Granada, Granada; Hernández-Mateo, Fernando; Departamento de Química Orgánica, Facultad de Ciencias, Universidad de Granada, Granada; Salto González, Rafael; Departamento de Bioquímica y Biología Molecular II, Facultad de Farmacia, Universidad de Granada, Granada

    2013-01-01

    Dentro del Programa Erasmus Intensivo, y con el objetivo de dirigir alumnos hacia una carrera profesional en el ámbito de la investigación en Biomedicina y Biotecnología aprovechando la fortaleza que aporta el Campus de Excelencia Internacional de la Universidad de Granada (CEI-BioTic) como Institución Coordinadora y las universidades de Nottingham (Reino Unido) y Bayreuth (Alemania) se ha organizado un Workshop destinado a 15 alumnos de másteres relacionados de una manera no excluyente con l...

  4. Evaluación del estado nutricional según compartimentos somático, graso y proteico-visceral al ingreso en una unidad de cuidados intensivos

    Directory of Open Access Journals (Sweden)

    María Esther Rodríguez Delgado

    2014-12-01

    Full Text Available La alta prevalencia de malnutrición en el ámbito hospitalario continúa siendo un problema de especial relevancia en España en la actualidad debido al impacto negativo sobre la evolución clínica del paciente hospitalizado. Numerosos estudios evidencian tasas de desnutrición hospitalaria cercanas a un 33-50% de la población hospitalizada. Este impacto es mucho más importante y de mayor trascendencia cuando hablamos de pacientes críticos dentro de la unidad de Cuidados Intensivos. Estados nutricionales y metabólicos deficitarios tienen una repercusión directa sobre el enfermo, entorpeciendo la evolución clínica del enfermo e incrementando las tasas de morbimortalidad y de complicaciones hospitalarias así como los costes sanitarios derivados de ello. Desarrollar un adecuado abordaje nutricional mediante soportes nutricionales es un objetivo fundamental y un pilar básico para un óptimo manejo del paciente críticamente enfermo, pudiéndose ver obstaculizado en numerosas ocasiones, especialmente en pacientes que cursan con hipercatabolismo e hipermetabolismo con un consumo energético importante secundario al proceso patológico que motivó el ingreso. A todo ello hay que sumar la gran dificultad que supone una valoración integral y completa de su estado nutricional donde muchos de estos parámetros, encuestas nutricionales y pruebas funcionales puede resultar complicadas de realizar, poco fidedignos, o pueden aportan datos incorrectos, incompletos o con imposibilidad de su realización.

  5. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  6. La Construcción de Políticas Turísticas Orientadas a los Sectores Medios Durante el Primer Peronismo: Argentina 1946-1955

    OpenAIRE

    Piglia, Melina; Pastoriza, Elisa

    2017-01-01

    En el marco general de los estudios de las políticas públicas durante el primer peronismo (Argentina 1946-1955), el presente trabajo pretende abordar aspectos descuidados de las políticas turísticas, desde una perspectiva de historia social. El artículo sostiene que, junto a las más conocidas transformaciones producidas en el campo del turismo obrero y el turismo social, se puede advertir durante el período peronista la puesta en marcha de políticas turísticas orientadas al turismo de los sec...

  7. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  8. Relações e interações no ambiente de cuidados em Unidade de Terapia Intensiva Relaciones e interacciones en el ambiente de cuidados en una Unidad de Cuidados Intensivos Relationships and interactions in the Intensive Care Unit environment of care

    Directory of Open Access Journals (Sweden)

    Marli Terezinha Stein Backes

    2012-01-01

    Full Text Available OBJETIVO: Discutir as relações e interações do ambiente de cuidados em Unidade de Terapia Intensiva (UTI. MÉTODOS: Estudo de abordagem qualitativa foi fundamentado na "Grounded Theory". Foram entrevistados 47 sujeitos diferenciados de três UTIs Adulto, localizadas em Florianópolis/SC, Santa Maria/RS e Pelotas/RS, entre junho de 2009 e setembro de 2010. RESULTADOS: Neste estudo, são apresentadas e discutidas duas categorias: "A rede de apoio, a ordem/desordem e perturbações no ambiente de UTI"; "Convivendo com certezas, incertezas e contradições no ambiente de UTI". CONCLUSÃO: Considera-se necessário compreender o ambiente de UTI a partir de uma visão sistêmica. E isso significa acolher a circularidade e dinamicidade de ordem-desordem-organização que continuamente (re alimentam as relações e interações humanas e profissionais nesse ambiente.OBJETIVO: Discutir las relaciones e interacciones del ambiente de cuidados en una Unidad de Cuidados Intensivos (UTI. MÉTODOS: Estudio de abordaje cualitativo fundamentado en la "Grounded Theory". Entrevistamos a 47 personas en tres unidades de cuidados intensivos de adultos diferente, localizadas en Florianópolis/SC, Santa Maria/RS y Pelotas/RS, entre junio de 2009 y setiembre de 2010. RESULTADOS: En este estudio, se presentan y discuten dos categorías: "La red de apoyo, el orden/desorden y perturbaciones en el ambiente de UCI" y "Conviviendo con certezas, incertidumbres y contradicciones en el ambiente de UCI". CONCLUSIÓN: Se considera necesario comprender el ambiente de UCI a partir de una visión sistémica. Y eso significa acoger la circularidad y dinamicidad de orden-desorden-organización que continuamente (re alimentan las relaciones e interacciones humanas y profesionales en ese ambiente.OBJECTIVE: To discuss relationships and interactions in the Intensive Care Unit's (ICU environment of care. METHODS: A qualitative study that was based on grounded theory. We interviewed 47

  9. Caries dental aguda del primer molar permanente en niños de 12 años

    Directory of Open Access Journals (Sweden)

    Daniel Enrique Reyes Romagosa

    Full Text Available Introducción: el primer molar permanente es considerado la llave de la oclusión dentaria, la presencia de caries en éste es elevada, lo que dificulta el logro de las metas trazadas por organizaciones de salud a nivel mundial en este grupo de edad. Objetivo: determinar el comportamiento de la caries dental aguda en primer molar permanente en una población de 12 años de edad atendida en la Clínica Estomatológica Santa Cruz de la Parroquia Goaigoaza. Métodos: se realizó un estudio descriptivo transversal en la Clínica Estomatológica Santa Cruz. Parroquia Goaigoaza, municipio Puerto Cabello, estado Carabobo, en el período comprendido entre abril del 2009 a abril 2010. Se seleccionaron 97 pacientes de 12 años de edad los que constituyeron el universo y la muestra. Acudieron a la consulta por dolor debido a la presencia de caries dental aguda. Se registraron las variables: edad, sexo, grado clínico de la caries dental, estímulos externos que provocaron dolor, la cara dental y la arcada dentaria más afectadas. La información fue recogida mediante interrogatorio y examen clínico. Resultados: el sexo masculino representó el 63,9 %. La caries dental de 3er grado estuvo presente en un 68 %. Los estímulos externos que provocaron dolor fueron: el frío presente en 75,2 % y los alimentos dulces en 69,1 % en ambos sexos. El primer molar inferior derecho resultó más afectado (46,4 % que el izquierdo (36,1 %, así como la arcada dentaria inferior (25,8 % y la cara oclusal (64,9 %. Conclusiones: predominaron el sexo masculino y la caries dental aguda de 3er grado. El frío y los alimentos dulces fueron los estímulos externos más frecuentes. Los más afectados resultaron el primer molar inferior derecho, la cara oclusal y la arcada dentaria inferior.

  10. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  11. Prácticas de destete ventilatorio en las unidades de cuidado intensivo de la ciudad de Cali

    Directory of Open Access Journals (Sweden)

    Vilma Muñoz

    2014-04-01

    Full Text Available Objetivo: El destete temprano de la ventilación mecánica es uno de los objetivos primordiales en el manejo del paciente crítico. Existen diversas técnicas y parámetros de medida para realizarlo. El objetivo de esta investigación fue describir las prácticas del destete ventilatorio en unidades de cuidado intensivo adulto en la ciudad de Cali. Métodos: Una encuesta de 32 preguntas; algunas de múltiple escogencia, que evaluaron las prácticas del destete, fue distribuida entre los fisioterapeutas y terapeutas respiratorios que trabajaban en unidades de cuidado intensivo, para ser respondida de forma anónima. Resultados: La estrategia más frecuente para el registro de parámetros fue la combinación de presión positiva continua con presión de soporte (78%, con gran variabilidad en los niveles de presión, siendo el rango más frecuente de 6 a 8cmH2O. Los parámetros de destete más registrados fueron: el volumen corriente (92,6%, la frecuencia respiratoria (93,3% y la saturación de oxígeno (90,4%. El tiempo de espera más frecuente para el registro de los parámetros fue >15 minutos (40%. Las medidas se realizaron preferentemente con el display del ventilador. Conclusion: Existe una gran variabilidad sobre los métodos y la medición de los parámetros de destete ventilatorio. El método más utilizado fue presión positiva continua en la vía aérea más presión de soporte y los parámetros de destete más usados fueron la medición del volumen corriente y la frecuencia respiratoria.

  12. ¿Qué textos leen en primer año los estudiantes de Psicología?

    Directory of Open Access Journals (Sweden)

    María Micaela Villalonga Penna

    2016-11-01

    Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

  13. ¿Qué textos leen en primer año los estudiantes de Psicología?

    Directory of Open Access Journals (Sweden)

    María Micaela Villalonga Penna

    Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

  14. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  15. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  16. Desarrollo de una Aplicación Informática para el Diseño y Estudio del circuito Steinmetz

    OpenAIRE

    Caro Huertas, Eduardo

    2007-01-01

    El circuito Steinmetz consiste en la conexión de dos reactancias (normalmente una bobina y un condensador) en triángulo con una carga monofásica, con el objeto de simetrizar las intensidades consumidas por el conjunto. El actual proyecto desarrolla una aplicación informática para estudiar diversos aspectos relacionados con este circuito y su interacción con el sistema eléctrico en presencia de armónicos. En primer lugar, el estudio se centra en el diseño del circuito Steinmetz, es decir, en l...

  17. Efectos de una metodología integral en el aprendizaje de la geometría en alumnos de primer semestre de ingenierías

    OpenAIRE

    Rojas, Carlos

    2007-01-01

    El presente estudio tuvo como objetivo determinar el efecto de una metodología, que se denominó integral, sobre el aprendizaje de la geometría en dos grupos de alumnos de primer semestre de ingenierías de la Universidad del Norte. Dicha metodología consistió en: los sistemas de representación de Bruner, como estrategia en el aprendizaje de conceptos y teoremas; los mentefactos, como instrumento en el aprendizaje conceptual; la argumentación deductiva en la respuesta a preguntas, y un heurísti...

  18. Monitorização do sistema nervoso autônomo em ambiente de cuidados intensivos como ferramenta de prognóstico. Revisão sistemática

    Directory of Open Access Journals (Sweden)

    Luis Bento

    Full Text Available RESUMO Objetivo: Apresentar uma revisão sistemática do uso da monitorização do sistema nervoso autônomo como ferramenta de prognóstico, verificando a variabilidade da frequência cardíaca nas unidades de cuidados intensivos. Métodos: Revisão de literatura publicada até julho de 2016 na PubMed/MEDLINE de estudos realizados em unidades de cuidados intensivos, sobre a monitorização do sistema nervoso autônomo, por meio da análise da variabilidade da frequência cardíaca, como ferramenta de prognóstico - estudo da mortalidade. Foram utilizados os seguintes termos em inglês no campo de pesquisa: ("autonomic nervous system" OR "heart rate variability" AND ("intensive care" OR "critical care" OR "emergency care" OR "ICU" AND ("prognosis" OR "prognoses" OR "mortality". Resultados: A probabilidade de morte nos doentes aumentou com a diminuição da variabilidade da frequência cardíaca, estudada por meio da variância da frequência cardíaca, desacoplamento cardíaco, volatilidade da frequência cardíaca, integer heart rate variability, desvio padrão de todos os intervalos RR normais, raiz quadrada da média do quadrado das diferenças entre intervalos RR adjacentes, poder total, componente de baixa frequência, componente de muito baixa frequência, razão entre o componente de baixa frequência e o componente de alta frequência, razão entre expoentes fractais de curto e longo prazo, entropia de Shannon, entropia multiescalar e entropia aproximada. Conclusão: Nos doentes internados em unidades de cuidados intensivos, independentemente da patologia que motivou o internamento, a variabilidade da frequência cardíaca varia de forma inversa com a gravidade clínica e com o prognóstico.

  19. Crenças que permeiam a humanização da assistência em unidade de terapia intensiva pediátrica Creencias que rondan la humanización de la atención en la unidad de cuidados intensivos Beliefs about humanized care in a pediatric intensive care unit

    Directory of Open Access Journals (Sweden)

    Maria Cristina Pauli

    2003-06-01

    Full Text Available O presente estudo teve como objetivo conhecer as crenças das enfermeiras, em relação à assistência humanizada na Unidade de Terapia Intensiva pediátrica (UTIp. A coleta de dados foi realizada com entrevistas abertas com cinco enfermeiras, depois gravadas e transcritas em sua íntegra. O conteúdo foi analisado, tendo, como referencial teórico, o interacionismo simbólico e, como referencial metodológico, a Teoria Fundamentada em Dados. Com este estudo, foi possível entender que a enfermeira, mesmo encontrando dificuldades para prestar uma assistência humanizada, parece estar abandonando a crença de que UTI é uma unidade tecnicista, passando a buscar estratégias para prestar uma assistência mais humanizada.El estudio tuvo como objetivo conocer las creencias de las enfermeras respecto a la asistencia humanizada en la Unidad de Cuidados Intensivos pediátrica (UCIp. La recolección de datos fue realizada por medio de entrevistas, con preguntas abiertas a cinco enfermeras y después grabadas y transcritas íntegramente. El contenido verbalizado por las enfermeras fue codificado y analizado teniendo como referencial teórico, el Interaccionismo Simbólico y como referencial metodológico, la Teoría Fundamentada en los Datos. Con este estudio fue posible entender que, aunque la enfermera encuentre dificultad para brindar atención humanizada, parece estar abandonando la creencia de que la Unidad de Cuidados Intensivos es una unidad tecnicista, hecho que le está permitiendo ir en la búsqueda de estrategias para el ofrecimiento de una atención más humanizada que considere la presencia frecuente de la familia en la UCI, como forma de aproximación con la familia.This study aimed to understand the nurses' beliefs about humanized care in the Pediatric Intensive Care Unit (PICU. Data collection was accomplished through open interviews with five nurses, which were then taped and fully transcribed. The content analyzed was realized in the

  20. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  1. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  2. Evolución del peso en pacientes durante el primer año del trasplante renal

    Directory of Open Access Journals (Sweden)

    Pilar López Garrigós

    Full Text Available Durante el primer año de trasplante renal es frecuente una ganancia de peso, debido, entre otros a la dieta, sedentarismo, e inmunosupresores, pudiendo aumentar los factores de riesgo del síndrome metabólico. Objetivos: Conocer la evolución del peso de nuestros pacientes durante el primer año del trasplante, y analizar la influencia con las distintas variables asociadas al paciente, sexo, edad, IMC, tratamiento inmunosupresor entre otras. Determinar la asociación entre la ganancia de peso y la aparición de factores de riesgo, como hipertensión arterial, diabetes y dislipidemia. Material y Método: Estudio retrospectivo y analítico. Se estudiaron 100 pacientes con un año de evolución en el trasplante, del Hospital Virgen de la Salud de Toledo. Sé analizaron datos antropométricos, demográficos y clínicos. La ganancia de peso se distribuyo según a las variables del estudio. Resultados: La ganancia de peso al año del trasplante afecto a 93 pacientes, con una media de 7,21 kg ±5,87. El 44,1% aumento su peso por encima de la media, y el 23,7% gano > 10 kg. La prevalencia de sobrepeso y obesidad antes del trasplante fue 57% y 76% después del trasplante. Los hombres ganaron ligeramente más peso que las mujeres. Los más jóvenes < 49 años ganaron más peso, media 9,3 kg. Mayor incidencia de diabetes, hipertensión y dislipemias en los pacientes con sobrepeso y obesidad. Conclusiones: La mayoría de los pacientes aumentaron significativamente de peso al año del trasplante, asociándose con varios de los factores del síndrome metabólico. - Importante la educación, por parte de la enfermería, del paciente para fomentar hábitos de vida saludable.

  3. Incremento de la competencia comunicativa en dos adultos con Parálisis Cerebral mediante el dispositivo Makey-Makey. Un estudio de caso

    OpenAIRE

    Calleja, Marina; Luque, María Luisa; Rodríguez, José Miguel; Liranzo, Ana

    2015-01-01

    En este trabajo se presentan dos casos de parálisis cerebral (PC) de componente espástico y con graves problemas de comunicación como resultado de una fuerte disartria. Esta disartria les produce una baja inteligibilidad de habla, lo que les crea grandes dificultades en los procesos de interacción comunicativa y social. El objetivo de este estudio fue doble. En primer lugar, comprobar si era posible convertir el dispositivo conocido como Makey-Makey (Mk-Mk), inicialmente concebido...

  4. El paradigma del ZMOT como modelo de negocio aplicado al sector turístico en el año 2013 : estudio sobre el comportamiento del consumidor turístico de la Ciudad Autónoma de Buenos Aires en los medios online

    OpenAIRE

    Costas Chillemi, Martín

    2014-01-01

    Costas Chillemi, M. (2014). El paradigma del ZMOT como modelo de negocio aplicado al sector Turístico en el año 2013. Estudio sobre el comportamiento del consumidor turístico de la Ciudad Autónoma de Buenos Aires en los medios online (Tesis de posgrado). Universidad Nacional de Quilmes, Bernal, Argentina. El presente estudio es de finalidad aplicada, alcance temporal transversal y grado de conocimiento Exploratorio, fundamentalmente porque se realiza un primer acercamiento al fenómeno del ...

  5. Necessidade de cuidados intensivos em maternidade pública terciária Necessity of intensive care in a tertiary public maternity hospital

    OpenAIRE

    Marcello Braga Viggiano; Mauricio Guilherme Campos Viggiano; Eduardo de Souza; Luiz Camano

    2004-01-01

    OBJETIVOS: avaliar os aspectos epidemiológicos e os relacionados ao parto de gestantes e puérperas transferidas para unidades de terapia intensiva (UTI's) e a freqüência com que estas pacientes necessitam de cuidados intensivos. MÉTODOS: estudo observacional e descritivo das transferências obstétricas para UTI's, entre janeiro de 1999 e dezembro de 2001. A análise incluiu as seguintes variáveis: idade materna, paridade, indicações obstétricas e não-obstétricas para as transferências, momento ...

  6. Respuesta productiva de una pastura de gramas nativas bajo pastoreo rotacional intensivo en clima cálido húmedo

    Directory of Open Access Journals (Sweden)

    M. A. Alonso-Díaz

    2007-01-01

    Full Text Available En el trópico húmedo de Veracruz se estimó la respuesta productiva de una pastura de gramas nativas bajo pastoreo rotacional intensivo, con ganado Cebú Brahman, de junio de 1994 a mayo de 1997, con periodos variables de ocupación (1-3 días y recuperación (10-151 días. Se muestrearon seis divisiones (3.0 ± 0.5 ha/división. La MS presente, antes y después del pastoreo en sequía (marzo-junio; 2,135 y 1,402 kg/ ha, fue inferior a “nortes” (noviembre-febrero; 2,846 y 1,909 kg/ha y lluvias (julio-octubre; 2,844 y 1,864 kg/ha, sin diferencia entre sí. Se encontraron diferencias para peso vivo del becerro en sequía, lluvias y “nortes” (71, 142 y 161 kg/cabeza. La carga animal en sequía (2.0 unidades animal [UA = 450 kg de peso vivo]/ha fue inferior a la de “nortes” (2.4 UA/ha y lluvias (2.3 UA/ha que no difirieron entre sí. La época no afectó el contenido de: proteína cruda de la MS presente antes del pastoreo (9.3 ± 1.7%, los días de recuperación (50 ± 26, el peso vivo de la vaca (397 ± 11 kg/cabeza, la tasa absoluta de crecimiento (41 ± 33 kg MS/ ha/día, la disponibilidad de MS (5.8 ± 2.6 kg MS/100 kg PV, el consumo de materia seca (2.3 ± 1.5 kg MS/100 kg PV y grado de uso de la MS disponible (40 ± 22%. La carga animal media del presente estudio duplicó la tradicional de 1.0 UA/ha para gramas nativas, lo que sugiere un potencial productivo mayor de estas pasturas en la región.

  7. Estrategia Metacognitiva y la Competencia de aprender a aprender en estudiantes del primer grado de secundaria de la I.E. “Mercedes Cabello de Carbonera” – Lima, 2014

    OpenAIRE

    Reategui De Souza, Rosa Guillermina

    2014-01-01

    El presente trabajo de investigación, tuvo por objetivo Determinar la relación entre la Estrategia metacognitiva y la Competencia de Aprender a aprender en Estudiantes del primer grado de secundaria de la I.E. “Mercedes Cabello de Carbonera”. Lima - 201 4. La investigación es cuantitativa no experimental, se realizó un estudio transeccional descriptivo correlacional. La muestra es probabilística aleatoria simple, con una población de 245 estudiantes, quedando finalmente una ...

  8. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  9. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  10. El "estudio de la enseñanza y del aprendizaje": una forma globalizadora de investigación del profesorado

    Directory of Open Access Journals (Sweden)

    John Elliott

    2010-01-01

    valioso cambio pedagógico y en los planes de estudio. En este contexto se transformó en una teoría pedagógica que se prueba mediante la investigación-acción realizada por los docentes, en lugar de mediante experimentos de diseño. La transformación del Estudio de la enseñanza en Estudio del aprendizaje en Hong Kong puso en cuestión el supuesto generalizado de que la investigación-acción se lleva a cabo sobre el desarrollo de la práctica, y no sobre la teoría. Sin embargo, introducirla como parte del Estudio de la enseñanza puede limitar su utilidad como objeto de análisis para la investigación profesional. La participación de los docentes en el estudio de la enseñanza de Kong orientada al aprendizaje depende, por lo tanto, en gran medida del compromiso de los equipos directivos en los centros y de su capacidad para gestionar los escasos recursos, en términos de tiempo y personal, para este tipo de investigación profesional. Y teniendo en cuenta estas condiciones muchos se cuestionan si se puede integrar en la práctica profesional de los docentes de manera continuada. Sin embargo, inclusive si esto es así, todavía se pueden hacer preguntas sobre el impacto a largo plazo de esta investigación docente intensiva y de procedimiento inflexible en las prácticas pedagógicas de los docentes implicados, y compararla con el impacto de otros tipos de investigación docente menos intensivos y más flexibles.

  11. Estudio de la actividad antimicrobiana del fango termal de Copahue (Neuquén, Argentina

    Directory of Open Access Journals (Sweden)

    Juan A. Basualdo

    2011-01-01

    Full Text Available Se investigó la actividad antimicrobiana del fango termal (Complejo Termal Copahue, Argentina sobre microorganismos de la microbiota autóctona del hombre, agentes infecciosos de la comunidad, hospitalarios y cepas AT CC. Las cepas correspondieron a cocos Gram positivos, bacilos Gram negativos, levaduras y cepas AT CC. El fango se obtuvo de la Laguna Sulfurosa. La actividad inhibitoria se demostró utilizando fase líquida (FL mediante la prueba de difusión en agar y por estudios de cinética bactericida. Con la primera se observó halo inhibitorio frente a Staphylococcus aureus y Cándida albicans, no visualizándose inhibición para el resto de los microorganismos. El estudio dinámico a través del tiempo sobre S. aureus, Enterococcus faecalis, Staphylococcus epidermis y C. albicans demostró acción inhibitoria antes de las 6 hs de incubación, mientras que no se observó inhibición frente a los bacilos Gram negativos. Es el primer trabajo que demuestra la actividad antimicrobiana de la FL sobre las cepas ensayadas.

  12. O saber e a tecnologia: mitos de um centro de tratamento intensivo

    Directory of Open Access Journals (Sweden)

    Bastos Marisa Antonini Ribeiro

    2002-01-01

    Full Text Available O presente artigo apresenta os resultados de um estudo etnográfico que teve como objetivo descrever a cultura dos enfermeiros de um centro de tratamento intensivo. Acreditando que o CTI é uma subcultura do hospital e que os enfermeiros intensivistas compartilham de símbolos e significados que foram desenvolvidos através das interações sociais no contexto da Terapia Intensiva, fui buscar no interacionismo simbólico e na descrição etnográfica a fundamentação teórico-metodológica para o presente estudo. Para compreender o processo de interiorização dos universos simbólicos no CTI, busquei descrever os sistemas temáticos de significados subjacentes às atividades dos enfermeiros intensivistas, através da observação participante, da entrevista etnográfica e da análise documental. Dentre os elementos culturais descritos, foi identificado o mito do saber e da tecnologia. Concluí que os mitos da tecnologia e do saber foram socialmente estabelecidos como estratégia de sobrevivência no cotidiano da terapia intensiva, repleto de riscos e incertezas.

  13. O saber e a tecnologia: mitos de um centro de tratamento intensivo

    Directory of Open Access Journals (Sweden)

    Marisa Antonini Ribeiro Bastos

    Full Text Available O presente artigo apresenta os resultados de um estudo etnográfico que teve como objetivo descrever a cultura dos enfermeiros de um centro de tratamento intensivo. Acreditando que o CTI é uma subcultura do hospital e que os enfermeiros intensivistas compartilham de símbolos e significados que foram desenvolvidos através das interações sociais no contexto da Terapia Intensiva, fui buscar no interacionismo simbólico e na descrição etnográfica a fundamentação teórico-metodológica para o presente estudo. Para compreender o processo de interiorização dos universos simbólicos no CTI, busquei descrever os sistemas temáticos de significados subjacentes às atividades dos enfermeiros intensivistas, através da observação participante, da entrevista etnográfica e da análise documental. Dentre os elementos culturais descritos, foi identificado o mito do saber e da tecnologia. Concluí que os mitos da tecnologia e do saber foram socialmente estabelecidos como estratégia de sobrevivência no cotidiano da terapia intensiva, repleto de riscos e incertezas.

  14. Caracterización molecular de Klebsiella pneumoniae y Enterobacter cloacae productoras de ß-lactamasas de espectro extendido tipo SHV-5 en una unidad de cuidados intensivos neonatal de Lima

    Directory of Open Access Journals (Sweden)

    Róger Calderón E

    2003-07-01

    Full Text Available Objetivo: Determinar los mecanismos implicados en la transmisión y resistencia antimicrobiana de aislamientos hospitalarios de Klebsiella pneumoniae y Enterobacter cloacae. Materiales y métodos: Se determinó la diversidad genética de 10 aislamientos bacterianos provenientes de pacientes hospitalizados y muestras ambientales procedentes de una unidad de cuidados intensivos de neonatos de un hospital de Lima utilizando el patrón de banda de ADN ribosomal y plasmídico. Posteriormente, se caracterizó la resistencia antimicrobiana y sus principales factores utilizando electroforesis de punto isoeléctrico, Southern Blotting y PCR. Finalmente se evaluó la capacidad de transferencia de la resistencia mediante ensayos de conjugación bacteriana. Resultados: Todos los aislamientos de K. pneumoniae y E. cloacae presentaron el mismo perfil plasmídico. Los aislamientos de E. cloacae presentaron un mismo patrón genético, por el contrario se encontraron cuatro genotipos distintos de K. pneumoniae altamente relacionados. Todos los aislamientos produjeron ß-lactamasa de especto extendido Tipo SHV-5 transferible a otras especies. Conclusiones: El estudio sugiere que la diseminación de estas bacterias en los neonatos pudo haber sido favorecida por un inadecuado manejo asistencial, una defectuosa conservación de leche para el consumo neonatal y el indiscriminado uso de antibióticos, el cual generó una activa transmisión de genes responsables de la resistencia antimicrobiana.

  15. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  16. Estudio sobre la construcción autorregulada del portafolio en el grado de Enfermería

    Directory of Open Access Journals (Sweden)

    Bernat C. Serdà-Ferrer

    Full Text Available Introducción: Este estudio presenta el proceso de implementación del portafolio en el transcurso de cuatro cursos académicos consecutivos (2006-2010. La planificación incluye tres fases (iniciación, desarrollo y consolidación. La muestra es de 480 estudiantes del primer curso de Enfermería de la Universitat de Girona. El objetivo consiste en evaluar la eficacia del instrumento y construirlo de una forma autorregulada. Sujetos y métodos: La propuesta metodológica se basa en la triangulación secuencial entre métodos, en que para el estudio de una misma unidad empírica se combinan dos estrategias de investigación, una cuantitativa y otra cualitativa. Estudio 1: cuantitativo, descriptivo, longitudinal y prospectivo. Para el análisis estadístico de los datos apareados en las variables continuas que siguen una distribución normal, se utiliza el test t de Student. Para el estudio de la correlación entre dos variables numéricas se ha calculado el índice de correlación P de Pearson. Estudio 2: cualitativo, utiliza grupos de discusión a partir de tópicos. Para el análisis de datos textuales se usa el programa informático Atlas.ti. Resultados: La nota final de los estudiantes que elaboran el portafolio (7,78 es superior a la nota de los estudiantes que no lo realizan (7 (p ≤ 0,001. Se identifica una correlación significativa entre la nota portafolio y la nota final (p ≤ 0,001. El estudio de la tendencia muestra una mayor sensibilidad del instrumento en la evaluación. Conclusión: El diseño final del portafolio se caracteriza por ser mixto, flexible y fomenta la reflexión, empoderando al estudiante en el continuo de aprendizaje.

  17. BALANÇO HÍDRICO NA PRÁTICA CLÍNICA DE ENFERMAGEM EM UNIDADE CORONARIANA

    OpenAIRE

    Sherida Karanini Paz de Oliveira; Maria Vilaní Cavalcante Guedes; Francisca Elisângela Teixeira Lima

    2010-01-01

    Para llevar a cabo y registrar datos sobre el balance hídrico, el enfermero necesita estar atento a los resultados para interferir cuando sea necesario. Los objetivos del estudio fueron: identificar el significado del balance hídrico para las enfermeras que trabajan en una unidad de cuidado intensivo coronario y verificar el uso de los resultados del balance hídrico en la asistencia de enfermería. Es un estudio descriptivo, realizado en un hospital público de gran notabilidad, situado en Fort...

  18. Estudio Clínico de la Retinopatía de la prematuridad en la provincia de Sancti-Spíritus 2005-2006.

    Directory of Open Access Journals (Sweden)

    Yamilet Viciedo Rojas

    2007-10-01

    Full Text Available Se realizó un estudio descriptivo, de tipo retroprospectivo de proyección longitudinal sobre el estudio clínico–epidemiológico de la Retinopatía de la Prematuridad en la provincia de Sancti- Spirítus en el período comprendido entre el año 2005 a junio del 2006, que incluyó a los 42 pacientes prematuros que fueron atendidos en la Unidad de Cuidados Intensivos Neonatales del Hospital Ginecobstétrico Provincial “Isabel María de Valdivia” y que cumplieron los parámetros establecidos para el tamizaje de la retinopatía de la prematuridad en Cuba. Se utilizó como fuente recolectora de datos una encuesta que cumplió con los requisitos muestrales. Se realizó la distribución de frecuencias absoluta y relativa según variables seleccionadas, determinándose el comportamiento de sus factores de riesgo. Los datos fueron recogidos de las historias clínicas y de encuestas de los pacientes, y fueron procesados. Todos los resultados se tabularon y fueron comparados con los precedentes bibliográficos existentes, para lograr una mirada más cercana a la retinopatía de la prematuridad. Se concluyó que la edad gestacional frecuente es la de (29 a 31.6 sem, el peso (1000 a 1499 grs., edad de diagnóstico (35 a 38.6 sem, predominó el bajo peso, y la clasificación de retina inmadura, sigue siendo el láser el tratamiento de elección.

  19. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  20. Un análisis trasnacional del surgimiento e institucionalización de los planes académicos de los Estudios de las Mujeres.

    Directory of Open Access Journals (Sweden)

    Capitolina Díaz Martínez

    2007-01-01

    Full Text Available El presente proyecto se sirve de un enfoque cuantitativo para facilitar un análisis comparativo y longitudinal de la expansión de los Estudios de las Mujeres. Definidos éstos a partir del primer curso que una universidad, entre 1970 y 2000, oferta un curso oficial de Estudios de las Mujeres. Nuestra muestra se compone de 22 países miembros de la Organización para la Cooperación y el Desarrollo Económico (OCDE. Utilizando modelos de estimación de acontecimientos históricos, evaluamos varias explicaciones a nivel nacional y universitario: nivel económico nacional y de desarrollo de la educación, grado de derechos políticos, alcance del elitismo del sistema de educación superior y variables del estatus de las mujeres. Desde la perspectiva de sociedad global, también examinamos la influencia que los vínculos internacionales ejercen sobre los modelos de derechos humanos y derechos de las mujeres. Estas variables consisten en indicadores de la tendencia a ratificar tratados sobre derechos humanos y de las mujeres. Nuestros hallazgos sugieren que la oferta de un primer curso de Estudios de las Mujeres está influida de manera positiva por el nivel de desarrollo educativo de un país medido en términos de la proporción de niños y niñas que asisten a la escuela secundaria, por la medida en la que el sistema de enseñanza superior es menos elitista y, finalmente, por el número de tratados sobre derechos humanos ratificados por un país. Ofrecemos nuestras interpretaciones de estos hallazgos y sugerencias para abrir posibles vías de futuras investigaciones.

  1. Estudio de la hematología y la bioquímica sanguínea de las rapaces nocturnas ibéricas

    OpenAIRE

    Agustí Montolío, Susana

    2015-01-01

    La importancia de la hematología y la bioquímica sanguínea en medicina aviar se refleja en el incremento de estudios destinados a la obtención de los intervalos de referencia en muchas especies de aves en general y en las Estrigiformesen particular. Para interpretar correctamente sus valores se requiere conocer la influencia que los factores ambientales, fisiológicos y metodológicos ejercen sobre los mismos. La edad es un factor muy relevante, especialmente en el primer periodo de vidalas ave...

  2. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  3. NUEVO ESTUDIO SOBRE EL PERFIL DE LOS ALUMNOS DE PRIMER CURSO DE LA ESCUELA DE INGENIERIA TECNICA INDUSTRIAL

    Directory of Open Access Journals (Sweden)

    Angel Valea

    2014-01-01

    Full Text Available El trabajo estudia la valoración de las respuestas a un cuestionario respondido por los alumnos que cursan la asignatura de Quí mica del primer curso universitario , mater ia obligatoria de la Ingeniería Industrial, y que pertenecen a las especialidades de Mecánica y de Qu í mica Industrial. El cuestionario está configurado en base a 30 preguntas de selección múltiple, y que pertenecen a 4 áreas significativas (contenidos de l a asignatura, metodología, profesorado y alumnado. Con los resultados se ha realizado una agrupación seleccionando 12 bloques significativos sobre los que se aportan resultados estadísticos y/o interpretación de los resultados. Se pretende conocer desde l a perspectiva de los alumnos, las costumbres y las debilidades como estudiantes.

  4. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  5. Motivos De Deserción De Estudiantes De Licenciatura Durante Su Primer Año Cursado, En El Instituto Tecnológico Superior De Irapuato.

    OpenAIRE

    Fernández Santoyo, María Karla; Soto Patiño, Juan Carlos

    2017-01-01

    La deserción de los alumnos en México es un fenómeno que se da en gran medida, y con un mayor nivel de abandono en el primer año de estudios en las Instituciones de Nivel Superior. Por tanto, es fundamental conocer los motivos que llevan a los jóvenes a no concluir una carrera universitaria, para encontrar las mejores estrategias para afrontar de la mejor manera este fenómeno. Bajo este contexto el siguiente trabajo tiene como objetivo analizar las tendencias de los motivos de deserción en lo...

  6. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  7. Estudio de las publicaciones sobre contabilidad de gestión en Brasil y España

    Directory of Open Access Journals (Sweden)

    Rogério João Lunkes

    2013-04-01

    Full Text Available En las últimas décadas, se han producido cambios importantes en la contabilidad de gestión con la inclusión de nuevos temas y métodos de investigación, revistas exclusivas y, en especial, estudios con perspectivas multidisciplinarias. Estos cambios se han detectado con estudios divulgados en publicaciones de revistas importantes. En este contexto surge la siguiente pregunta de investigación: ¿Cuál es el perfil de las investigaciones a respecto de la contabilidad de gestión en España y Brasil? Así, el objetivo del presente trabajo es identificar y analizar los temas y métodos de investigación aplicados en los estudios de contabilidad de gestión en España y Brasil, presentar cómo esas investigaciones son importantes para el desarrollo del área de contabilidad de gestión y compararlas con los estudios realizados en revistas anglosajonas por Hesford, Lee, Van Der Stede, e Young (2007. Con este fin se seleccionaron, entre 2001 y 2010, en primer lugar, siete revistas contables españolas que figuran en la base de datos IN-RECS (Índice de Impacto de Revistas Españolas de Ciencias Sociales en donde hemos encontrado 421 artículos. En segundo lugar se han seleccionado veintinueve revistas brasileñas de contabilidad, administración, gestión, finanzas y negocios evaluadas por CAPES (Coordinación de Perfeccionamiento de la Educación Superior, en donde se han encontrado 321 artículos. Los resultados muestran que los trabajos en contabilidad de gestión no han ocupado un lugar destacado en las publicaciones analizadas. Entre los temas más relevantes se encuentran el de planificación y control con énfasis en el elemento de medición y evaluación del desempeño. El desarrollo de los estudios se produce, en gran medida, mediante la aplicación de estudios de caso y survey en Brasil y revisión y estudio de caso en España.

  8. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  9. O processo de socialização dos enfermeiros em um Centro de Tratamento Intensivo El proceso de socialización de los enfermeros en um Centro de Tratamiento Intensivo The process of socialization an Intensive Care Unit

    Directory of Open Access Journals (Sweden)

    Marisa Antonini Ribeiro Bastos

    2001-09-01

    Full Text Available O objetivo deste trabalho foi compreender o processo de socialização dos enfermeiros integrantes da subcultura de um Centro de Tratamento Intensivo (CTI. Acreditando que o CTI é uma subcultura do hospital e que os enfermeiros intensivistas compartilham de símbolos e significados que foram desenvolvidos através das interações sociais no contexto da Terapia Intensiva, fui buscar no interacionismo simbólico e na descrição etnográfica a fundamentação teórico - metodológica para o presente estudo. Para compreender o processo de interiorização dos universos simbólicos no CTI busquei descrever os sistemas temáticos de significados subjacentes às atividades dos enfermeiros intensivistas, através da observação participante, da entrevista etnográfica e da análise documental. Os resultados mostraram que o processo de socialização é permeado de sentimentos de insegurança, ansiedade, angústia, de incompetência e de medo, As causas destes sentimentos têm um forte componente na não vivência anterior e na lacuna da formação profissional. Este processo se dá formal e informalmente, mas é sempre referido como árduo, penoso; muitas vezes solitário; algumas vezes compartilhado.El trabajo tiene como objetivo compreender el proceso de socialización de los enfermeros integrantes de la subcultura de un Centro de Tratamiento Intensivo (CTI. Reconociendo que el CTI es una subcultura del hospital y que los enfermeros intensivistas comparten de los simbolos y significados, que fuerón desarrollados a través de las interaciones sociales en el contexto de la Terapia Intensiva, fué utilizado el interacionismo simbolico y en la descrición etnografica la fundamentación teorica teorico-metodologica para el estudio. Para la comprensión del proceso del interiorización de los universos simbolicos en el CTI fuerón descritos los sistemas tematicos de significados subjacentes a las actividades de los enfermeros que trabajan en el CTI, a

  10. Aplicación del proceso de atención de enfermería en cuidados intensivos Aplicação do processo de atendimento de enfermaría em cuidados intensivos Intensive care unit nursing care process application

    Directory of Open Access Journals (Sweden)

    Juan Guillermo Rojas

    2010-11-01

    Full Text Available Objetivo. Describir los factores relacionados con la aplicación del proceso de atención de enfermería (PAE y las taxonomías de diagnósticos, intervenciones y resultados esperados, en Unidades de Cuidado Intensivo -UCI- de Medellín. Metodología. Estudio descriptivo de corte transversal realizado en una muestra de 65 profesionales de enfermería de 12 UCI entre abril y junio de 2007. Se exploraron variables sociodemográficas y laborales, metodologías para el cuidado, aplicación del PAE y nivel de aptitud clínica; además del tipo de institución y existencia de registros de enfermería estructurados según la metodología. Resultados. Los profesionales son mujeres jóvenes con poca experiencia que cuidan realizando la valoración, planean con base en el diagnóstico médico y siguen los protocolos establecidos en las UCI. Manifiestan no aplicar el PAE - sin embargo, valoran, planean e intervienen y en menor medida formulan diagnósticos y evalúa-, tienen bajo nivel de aptitud clínica. Conclusión. Los profesionales de enfermería otorgan importancia al PAE como elemento que da identidad profesional, no obstante, no lo incorporan como metodología para el cuidado.Objetivo. Descrever os fatores relacionados com a aplicação do processo de atendimento de enfermagem (PAE e as taxonomias de diagnósticos, intervenções e resultados esperados, em Unidades de Cuidado Intensivo -UCI- de Medellín. Metodologia. Estudo de corte transversal realizado numa mostra de 65 profissionais de enfermagem de 12 UCI entre abril e junho de 2007. Exploraram-se variáveis sócio-demográficas e trabalhistas, metodologias para o cuidado, aplicação do PAE e nível de aptidão clínica; além do tipo de instituição e existência de registros de enfermaria estruturados segundo a metodologia. Resultados. Os profissionais são mulheres jovens com pouca experiência que cuidam realizando a valoração, planejam com base no diagnóstico médico e seguem os

  11. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  12. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  13. Un estudio de la evolución del pensamiento matemático : el ejemplo de la conceptualización del conjunto de los números reales y de la noción de completitud en la enseñanza universitaria

    OpenAIRE

    Bergé, Analía

    2004-01-01

    En esta tesis, enmarcada dentro del campo de Didáctica de la Matemática, se estudia la evolución en la conceptualización del conjunto de los números reales por parte de los estudiantes de nivel universitario. Se toma como referencia las carreras de Licenciatura y Profesorado en Matemática de la Universidad de Buenos Aires. ¿Qué se quiere expresar con “el estudio de la evolución..."? Los alumnos establecen un primer contacto con los números reales temprano en su escolaridad. En un primer momen...

  14. Estudio de comunidades bacterianas naturales: diferenciación de las actinobacterias mediante electroforesis en doble gel en gradiente de desnaturalización (DDGGE)

    OpenAIRE

    Ortiz Martínez, Alberto

    2005-01-01

    El primer objetivo, en esta Tesis, es la optimización de las condiciones a emplear para el estudio de comunidades bacterianas naturales. Esto se conseguirá mejorando los gradientes empleados en los geles en condiciones desnaturalizantes. En lo referente a la optimización de los gradientes, hay que tener en cuenta que en las muestras naturales las comunidades presentes son heterogéneas, lo que hace necesaria una optimización de los gradientes de desnaturalización, con el fin de mejorar la sepa...

  15. Desarrollo de un nuevo modelo de Aspergilosis Pulmonar en rata consideraciones previas, estudio comparativo y aplicaciones al diagnóstico de la enfermedad

    OpenAIRE

    Caballero de Toro, Jesús

    2005-01-01

    Aspergilosis incluye una gran cantidad de enfermedades, incluida la Aspergilosis Invasora. El objetivo de esta tesis es el estudio de la Aspergilosis invasora en humanos. En primer lugar se evalúan los perfiles proteicos de A. fumigatus crecidos en diferentes medios y su capacidad antigénica. Posteriormente se realiza una evaluación de la capacidad de infección de A. fumigatus en modelos animales en ratones y ratas. Se desarrolla un nuevo modelo de infección transtorácia con hifas. Finalmente...

  16. PARATIROIDECTOMIA ENDOSCOPICA. ESTUDIO EXPERIMENTAL EN EL PERRO

    Directory of Open Access Journals (Sweden)

    Jorge Ramón Lucena Olavarrieta

    2008-01-01

    Full Text Available La primera paratiroidectomía exitosa fue realizada en Viena, Austria, en 1925. Los procedimientos laparoscópicos estuvieron inicialmente limitadas a las zonas corporales con cavidades preexistentes, recientemente, el acceso a espacios anatómicos potenciales ha extendido las indicaciones de la cirugía endoscópica minimamnete invasiva.Desde el primer reporte sobre la paratiroidectomía endoscópica en 1996, las técnicas video-asistidas han comenzado a utilizarse en la cirugía del cuello, y en varias series se han documentado la factibilidad y seguridad de este tipo de abordaje. La finalidad de esta investigación fue el determinar la factibilidad, seguridad y eficacia de la paratiroidectomía endoscopia en el modelo canino.Entre el 25 de noviembre del 2005 y 15 de octubre del 2007, se intervinieron en el Instituto de Cirugía Experimental de la Universidad Central de Venezuela 31 perros, mestizos sanos desparasitados,asignándose a dos grupos: homogéneos "A" 16, a cirugía convencional, "B" 15 a cirugía video-asistida. Se midieron las siguientes variables; sexo, peso, exámenes de laboratorio, laringoscopia pre y postoperatoria, posición, dirección de la incisión, longitud, localización, valores pre y postoperatorios de calcio, fósforo, proteína C reactiva, hemoglobina, hematocrito, tipo de disección, número y posición de las paratiroides, identificación de los nervios recurrentes y rama externa del nervio laríngeo superior, sangramiento, dificultades intraoperatorias, tiempo, resultado del estudio histopatológico.Las deducciones de este estudio experimental proporcionan evidencias de que la paratiroidectomía endoscópica es factible y segura. El abordaje mínimo tiene mejores resultados cosméticos y el potencial de disminuir la morbi-mortalidad.

  17. Conseqüências dos erros de medicação em unidades de terapia intensiva e semi-intensiva Consecuencias de los errores de medicaciòn en unidades de cuidados intensivos - semi intensivos Consequences of medical errors in intensive and semi-intensive care units

    Directory of Open Access Journals (Sweden)

    Maria Cecília Toffoletto

    2006-06-01

    Full Text Available O estudo objetivou caracterizar erros de medicação e avaliar conseqüências na gravidade dos pacientes e carga de trabalho de enfermagem em duas Unidades de Terapia Intensiva (UTI e duas Semi-Intensiva (USI de duas instituições hospitalares do município de São Paulo. A amostra foi constituída por 50 pacientes e os dados obtidos por meio do registro de ocorrências e prontuários, retrospectivamente. A gravidade e carga de trabalho de enfermagem foram avaliadas antes e após o erro. Do total de 52 erros, 12 (23,08% ocorreram por omissão de dose, 11 (21,15% e 9 (17,31% por medicamento e dose erradas, respectivamente. Não houve mudança na gravidade dos pacientes (p=0,316, porém houve aumento na carga de trabalho de enfermagem (p=0,009. Quanto ao grupo de medicamentos envolvidos, potencialmente perigosos e não potencialmente perigosos, não houve diferenças estatisticamente significantes na gravidade (p=0,456 e na carga de trabalho de enfermagem (p=0,264, após o erro de medicação.En el presente estudio se tuvo como objetivo caracterizar errores de medicación y evaluar consecuencias en la gravedad de los pacientes y carga de trabajo de enfermería en dos Unidades de cuidados Intensivos (UCI y dos Semi-Intensivos (USI de dos instituciones hospitalarias del municipio de Sao Paulo. La muestra constituida por 50 pacientes fueron obtenidos por medio del registro de ocurrencias e historias clínicas, retrospectivamente. La gravedad y carga de trabajo de enfermería fueron evaluadas antes y después del error. Del total de 52 errores, 12 (23,08% ocurrieron por omisión de la dosis, 11 (21,15% y 9 (17,31% por medicamento y dosis erradas, respectivamente. No se observó cambio en la gravedad de los pacientes (p=0,316, no obstante hubo aumento en la carga de trabajo de enfermería (p=0,009. En cuanto al grupo de medicamentos involucrados, potencial y no potencialmente peligrosos, no existieron diferencias estadísticamente significativas en

  18. Antropología del parentesco en Babilonia. Estudio de los grupos consanguíneos y residenciales en el periodo paleobabilónico.

    OpenAIRE

    González Moratinos, Sara

    2017-01-01

    [spa] El objeto de este trabajo es la familia. Dado que la palabra “familia” abarca una gran cantidad de tipologías, hemos de decir que la familia que estudiaremos es la que compone el primer nivel de la tipología familiar, es decir, la consanguínea y corresidente. El resto de niveles familiares (grupos consanguíneos, grupo de parentesco de compromiso o clan, y tribu o comunidad) no serán tratados en este trabajo, a pesar de presentar un amplio e interesante campo de estudio. En el parent...

  19. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  20. Reproductive periods in birds near the equator

    OpenAIRE

    Miller, Alden H.

    2012-01-01

    Para el estudio de los ciclos reproductivos de las aves cerca al ecuador se seleccionó el Gorrión (Zonotrichia capensis) teniendo en cuenta que se han realizado estudios intensivos en especies próximas que habitan el hemisferio norte. Se escogió como estación de trabajo, el sitio denominado Mares localizado en la cima de la Cordillera Occidental sobre la carretera que conduce de Cali a Buenaventura.  Mediante trabajos de anillado, instalación de trampas para captura de las aves, realización d...

  1. La práctica del reciclaje. Estudio de caso de La Asociación Colombiana de Recicladores Independientes, UPZ Engativá-Bogotá D.C.

    OpenAIRE

    Meléndez Álvarez, Nicolás

    2014-01-01

    El interés de este estudio de caso es analizar los procesos de reciclaje que lideran la Asociación Colombiana de Recicladores Independientes (ACOREIN) en la Unidad de Planeamiento Zonal (UPZ) 74- Engativá, relacionándolos con las perspectivas de ciudad sostenible. Por tal motivo en el primer apartado, se describe y analiza el concepto de sostenibilidad, desarrollo sostenible, y ciudad sostenible, la cual se encuentra ejemplificada. En el segundo capítulo se describe la labor de reciclaje gest...

  2. Infección hospitalaria en recién nacidos ingresados en un servicio de cuidados intensivos neonatales Nosocomial infection in newborns admitted in a neonatal intensive care service

    Directory of Open Access Journals (Sweden)

    Luis Ricardo Manet Lahera

    2010-09-01

    Full Text Available Se efectuó un estudio descriptivo y transversal de los 48 recién nacidos ingresados por infecciones hospitalarias en el Servicio de Cuidados Intensivos Neonatales del Hospital General Docente "Dr. Juan Bruno Zayas Alfonso " de Santiago de Cuba durante el 2005. La mayoría de los pacientes (85,5 % presentó sepsis connatal y la infección más común fue la bacteriemia, seguida de las bronconeumonías. El cultivo de secreciones endotraqueales constituyó la muestra de mayor positividad y entre los microorganismos aislados con mayor frecuencia figuraron las klebsiellas y los estafilococos coagulasa positiva. Quedó confirmado que los antibióticos menos efectivos contra los gérmenes grampositivos resultaron ser la penicilina y la ceftriaxona; y contra los gramnegativos, los aminoglucósidos.A descriptive and cross-sectional study of 48 newborns admitted due to nosocomial infections in the Neonatal Intensive Care Service of "Dr. Juan Bruno Zayas Alfonso" Teaching General Hospital in Santiago de Cuba during 2005 was carried out. Most of the patients (85,5% presented sepsis at birth and the most common infection was bacteriemia, followed by bronchopneumonias. The culture of endotracheal secretions constituted the sample of more positivity and among the isolated microorganisms with more frequency there were the Klebsiella and the positive coagulasa estaphylococcus. It was confirmed that the less effective antibiotics against the Gram-positive germs turned out to be penicillin and ceftriaxone; and against the Gram-negative, the aminoglycoside.

  3. Relación del desempeño académico de estudiantes de primer año de universidad en Chile y los instrumentos de selección para su ingreso

    Directory of Open Access Journals (Sweden)

    Gastón Vergara-Díaz

    2017-01-01

    Full Text Available Si bien el rendimiento académico del estudiantado que ingresa a las universidades chilenas ha sido objeto de múltiples estudios, pocas investigaciones han analizado la relación que tienen los instrumentos de selección de ingreso y el rendimiento académico posterior. En una muestra de 440 estudiantes de Ingeniería Comercial de la Universidad Austral de Chile, pertenecientes a cinco promociones de primer año, se estudiaron los instrumentos de admisión a la carrera, y se determinó cuáles explican mejor el rendimiento académico. Para ello se utilizaron los resultados de las pruebas de selección universitaria (PSU y las notas de enseñanza media (NEM obtenidos por el estudiantado, en relación con el promedio semestral ponderado (PSP del primer año universitario. Se determinó que el promedio de NEM explica mejor el rendimiento académico estudiantil, al presentar la mejor correlación con el rendimiento académico del primer semestre y de manera más fuerte en el segundo.

  4. ENFOQUE TEÓRICO Y CONCEPTUAL PARA EL ESTUDIO DE LAS URBANIZACIONES CERRADAS

    Directory of Open Access Journals (Sweden)

    Matilde Malizia

    2011-01-01

    Full Text Available Este trabajo presenta un enfoque teórico-conceptual para el estudio de las urbanizaciones cerradas en ciudades intermedias. En América Latina la investigación urbana fue, en primer lugar, investigación sobre la gr ciudad y los fenómenos resultantes del actual proceso de urbanización. Por lo tanto es escasa la información disponible para el estudio de estos emprendimientos en ciudades de menor tamaño. A través de la bibliografía se puede observar que las ur ciones cerradas adquieren una especificidad propia en las ciudades intermedias. ubican en la periferia de las ciudades, cercanas a espacios verdes con buenas condiciones ambientales y paisajísticas. Impulsan el desarrollo y/o mejora de l infraestructura de servicios. Modifican los procesos de segregación social y fragmentación espacial, acorde a los actuales procesos urbanos. Las barreras físicas se convierten en barreras sociales y marcan profundas diferencias entre quienes viven adent y quienes viven afuera. Finalmente, estas urbanizaciones ocupan superficies pe ueñas en comparación con las extensiones ocupadas por los emprendimientos construidos en las grandes ciudades, situación que, a su vez, limita el tamaño de los espacios ofrecidos.

  5. Comentarios a la nueva Ley Nº 14.867 que regula el engorde intensivo a corral de bovinos y bubalinos en la provincia de Buenos Aires

    OpenAIRE

    Noseda, Paula

    2017-01-01

    A fines de enero de este año 2017, entró en vigencia la Ley N° 14.867 que regula la actividad de engorde intensivo a corral de bovinos y bubalinos en la Provincia de Buenos Aires. Con este comentario se pretende evaluar las ventajas y desventajas de contar con éste nuevo régimen, considerando la normativa agroambiental marco, la posición de la doctrina y la jurisprudencia bonaerense vigente en la materia.

  6. Diagnóstico de conocimiento, actitudes y estrategias de equidad de género en servidoras y servidores públicos de primer nivel en Baja California

    Directory of Open Access Journals (Sweden)

    Elizabeth Maier

    2011-01-01

    Full Text Available El presente artículo se basa en el Diagnóstico de conocimientos, actitudes y estrategias de equidad de género de funcionarias y funcionarios de primer nivel en Baja California, estudio cuyo objetivo fue evaluar los conocimientos y las receptividades o resistencias de servidoras y servidores públicos bajacalifornianos sobre la equidad de género; así mismo, se aprecia la transversalidad de la aplicación de la perspectiva de género como guía metodológica de su ejercicio de políticas públicas. La hipótesis implícita al estudio insiste en la necesidad de contar con estrategias de progresiva capacitación en la temática para promover la creciente desautorización del complejo enjambre cultural de inequidad de género que todavía define el acceso diferencial a las oportunidades y beneficios económicos, sociales y políticos en el estado.

  7. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  8. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  9. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  10. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  11. La feminización de los estudios de Periodismo: análisis del caso español 

    Directory of Open Access Journals (Sweden)

    D Rivero Santamarina

    2015-10-01

    Full Text Available Introducción: En los últimos años se ha extendido la idea de que se ha producido una feminización de la profesión periodística, basándose en la paulatina incorporación de las mujeres al mercado laboral mediático y, sobre todo, debido al mayor número de mujeres que se gradúan en Periodismo al año en España. Por ello, desde esta investigación nos hemos propuesto conocer el alcance real de la feminización de los estudios de Periodismo. Metodología: En un primer estadio hemos realizado un corpus teórico que fundamente la idea de la feminización y que nos ayuda a conocer las implicaciones que un mayor número de mujeres periodistas pueden tener en la profesión, en los contenidos y en el ámbito privado y familiar. Posteriormente, se ha realizado el estudio cuantitativo diferenciando también si se trata de universidades públicas o privadas, para establecer así una comparativa. Conclusiones: El análisis del alumnado egresado de las titulaciones de Periodismo impartidas por las universidades españolas permite constatar que la feminización de estos estudios es una realidad plenamente asentada.

  12. Estado dental y periodontal de población en tratamiento por consumo de drogas: Estudio piloto

    Directory of Open Access Journals (Sweden)

    Enrique Rotemberg

    Full Text Available El uso problemático de drogas puede afectar la salud oral de los consumidores. El presente estudio pretendió detectar la prevalencia de patología dentaria y periodontal en una población adolescente y adulta joven en tratamiento por drogo-dependencia. Se diseñó un estudio transversal, observacional y descriptivo, incluyendo a 72 individuos que se asisten por su adicción en el Portal Amarillo, centro de referencia nacional. La media del índice CPOD fue de 8,04. Al discriminar por franja etaria, la comprendida entre 15 y 24 años tuvo un CPOD de 5,31, mientras que la comprendida entre 25 y 35 años tuvo un valor de 11,27. El relevamiento paradencial mostró que el 65% de los participantes presentaron gingivitis y el 18% cuadros de periodontitis. Los resultados obtenidos mostraron que existe una mayor prevalencia de enfermedad oral en pacientes drogo-dependientes que la población general. Los servicios de salud del primer nivel deberían desarrollar acciones especiales de prevención y detección precoz en pacientes drogo-dependientes

  13. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  14. Mortalidad por Acinetobacter baumannii en unidades de cuidados intensivos en Colombia Acinetobacter baumannii - related mortality in intensive care units in Colombia

    Directory of Open Access Journals (Sweden)

    Elkin V Lemos

    2011-10-01

    Full Text Available OBJETIVO: Comparar la mortalidad en pacientes infectados por Acinetobacter baumannii multisensibles con pacientes infectados por A. baumannii multirresistentes hospitalizados en unidades de cuidados intensivos (UCI de Colombia. MÉTODOS: Estudio prospectivo, observacional y multicéntrico. Se incluyó a 165 pacientes ingresados en las UCIs participantes entre abril de 2006 y abril de 2010. Se comparó la mortalidad de los pacientes con aislamientos clínicos de A. baumannii multirresistentes frente a aquellos multisensibles al día 14 y 30 de hospitalización. RESULTADOS: De los 165 pacientes adultos que presentaron infecciones asociadas al cuidado en salud (IACS por A. baumannii, en 62 se encontraron bacterias multisensibles y en 103, multirresistentes. No se hallaron diferencias estadísticamente significativas en la mortalidad al día 14 de hospitalización en UCI. Sí se observaron en cambio diferencias significativas (P OBJECTIVE: Compare mortality in multidrug-susceptible Acinetobacter baumannii infected patients and multidrug-resistant A. baumannii-infected patients hospitalized in intensive care units (ICUs in Colombia. METHODS: A prospective, observational, and multicenter study. A total of 165 patients admitted to the participating ICUs from April 2006 to April 2010 were included. On day 14 and day 30 of hospitalization, mortality in multidrug-resistant patients with clinical isolates of A. baumannii was compared with that in multidrug-susceptible patients. RESULTS: Of the 165 adult patients who had health care-associated infections (HAI caused by A. baumannii, multidrug-susceptible bacteria were found in 62 patients and multidrug-resistant bacteria in 103. Statistically significant differences in mortality on day 14 of hospitalization in the ICU were not found. On the other hand, significant differences (P < 0.05 in mortality on day 30 of hospitalization were observed between patients with multidrug-resistant isolates and those with

  15. Estudios Experimentales 2 Parte: Estudios Cuasi-Experimentales

    OpenAIRE

    Manterola, Carlos; Otzen, Tamara

    2015-01-01

    Los estudios experimentales, se caracterizan por la valoración del efecto de una o más intervenciones, habitualmente de forma comparativa con otra intervención, o un placebo; y el carácter prospectivo, de la recolección de datos y seguimiento. Agrupados bajo esta denominación, existe una diversidad de diseños, entre los que se encuentran los estudios cuasi-experimentales (ECE), que se caracterizan especialmente por la ausencia de asignación aleatoria. El objetivo de este manuscrito, es report...

  16. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  17. ¿Pluralismo o colonialidad médica? Un estudio alrededor del cáncer en diferentes sistemas médicos colombianos

    OpenAIRE

    Giraldo Aristizabal, Jessica

    2014-01-01

    En esta investigación se realiza un análisis del tipo de relaciones que se establecen entre la medicina alopática y la medicina indígena yagecera en el escenario urbano de Bogotá. Para ello, toma distancia de los estudios ya realizados sobre este tema en el campo de la antropología a partir de dos aspectos: en primer lugar, busca acercarse a esta relación a partir de las trayectorias profesionales de un conjunto de médicos (tanto indígenas como alopáticos); en segundo lugar, se aproxima a es...

  18. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  19. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  20. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  1. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Organizational Studies: A Complement to the Study of Social Management Los estudios organizacionales: un complemento para el estudio de la gestión social

    Directory of Open Access Journals (Sweden)

    María Edith Morales Mosquera

    2012-12-01

    organizaciones de la sociedad civil organizada. Para dar cuenta de ello, en primer lugar se explica qué es la gestión social, luego se exponen algunos de los principales aportes de las teorías organizacionales, haciendo énfasis en los aspectos que dan origen a los estudios organizacionales. Posteriormente se presentan los aportes de los estudios organizacionales a la investigación en gestión social, y por último se plantean las conclusiones.

  3. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  4. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  5. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  6. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  7. Motricidad y cognición. Un estudio empírico

    Directory of Open Access Journals (Sweden)

    Josep Morales Aznar

    2006-12-01

    Full Text Available Esta tesis es un intento de clarificar diversos aspectos sobre las dimensiones que abarca la Educación. La motricidad y la cognición son dos de estas dimensiones educativas sobre las cuales existe un amplio debate, tanto en su definición como en su posible interdependencia. Este trabajo no se centra en debates teóricos, sino que intenta aportar datos empíricos sobre dicha realidad. Dichos datos se aportan a partir de 3 estudios sobre población escolar, en cada uno de ellos la muestra se segmenta a partir del tipo de actividad física desarrollada: En el primer estudio se aplican un total de 6 pruebas a 487 sujetos de entre 9 y 16 años. Los ámbitos a los que pertenecen las pruebas son: perceptivo-motor, expresión gráfica y rendimiento académico. La segmentación de la muestra más interesante que se realiza en este estudio es la distinción entre los individuos que realizan actividades extraescolares y los que no. El segundo estudio se realiza también con población escolar, pero en este caso son 241 individuos que practican deporte de alto rendimiento. Las pruebas aplicadas son las mismas que en el estudio anterior pero añadiendo dos pruebas del ámbito técnico-táctico. El tercer estudio es un trabajo meramente estadístico, ya que la muestra corresponde a los dos anteriores, en el que se realiza una comparación sobre los datos más relevantes. Posteriormente, en el apartado de conclusiones y discusión, se ofrecen aportaciones que giran alrededor de los vínculos que se pueden establecer entre los di­ferentes ámbitos y la implicación que tiene el tipo de práctica física desarrollada en relación con las pruebas analizadas. En concreto, se confirma una evolución de los resultados de todas las pruebas en consonancia con el aumento de la edad de los sujetos. No queda definida la relación entre la operatividad en tareas que implican a la motricidad global y las que implican a la motricidad fina. El ámbito de la motricidad

  8. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  9. Papel de la enfermería en la valoración y estudios oftalmológicos en pediatría en atención primaria

    OpenAIRE

    Pérez Andrés, Irene

    2013-01-01

    La oftalmología pediátrica tiene gran importancia ya que cualquier problema ocular si es detectado precozmente puede curarse y ó evitar su progresión en esta edad. Por ello, resulta fundamental realizar una valoración y estudios oftalmológicos de forma adecuada en atenció primaria, ya que suele ser el primer lugar donde se detectan patologías oculares.También es necesario conocer las nfermedades oftalmológicas más frecuentes y saber actuar correctamente en las urgencias oftalmológicas. Enf...

  10. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  11. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  12. Nível de ruídos em uma unidade de cuidados intensivos pediátricos Noise level in a pediatric intensive care unit

    Directory of Open Access Journals (Sweden)

    Werther B. Carvalho

    2005-12-01

    Full Text Available OBJETIVO: Verificar o nível de ruídos em uma unidade de cuidados intensivos pediátricos. MÉTODOS: Estudo observacional e prospectivo realizado em uma unidade de cuidados intensivos pediátricos de 10 leitos de um hospital universitário da cidade de São Paulo, Brasil. Os níveis de ruídos foram medidos por meio de equipamento instalado no corredor de acesso à unidade de cuidados intensivos pediátricos, posto de enfermagem, duas salas com três e cinco leitos, bem como nas unidades de isolamento. O equipamento utilizado foi calibrado para registrar a pressão do som em dBA, durante 24 horas, por 6 dias. Os dados foram analisados de acordo com as curvas gráficas registradas pelo equipamento. RESULTADOS: Foi identificado um nível basal de ruídos de 60 a 70 dBA, com pico de 120 dBA. Os níveis mais elevados foram identificados no período diurno, decorrentes da atividade e comunicação dos profissionais. CONCLUSÃO: Os níveis de ruídos identificados excederam as recomendações do International Noise Council, da Organização Mundial da Saúde. A educação sobre os efeitos prejudiciais de ruídos na audição humana e sua relação com o estresse constituem as bases para a implementação de programas de redução de ruídos.OBJECTIVE: The purpose of this study was to verify the noise level at a PICU. METHODS: This prospective observational study was performed in a 10 bed PICU at a teaching hospital located in a densely populated district within the city of São Paulo, Brazil. Sound pressure levels (dBA were measured 24 hours during a 6-day period. Noise recording equipment was placed in the PICU access corridor, nursing station, two open wards with three and five beds, and in isolation rooms. The resulting curves were analyzed. RESULTS: A basal noise level variation between 60 and 70 dBA was identified, with a maximum level of 120 dBA. The most significant noise levels were recorded during the day and were produced by the staff

  13. Diversidad de la herpetofauna en huertos de aguacate y hábitats conservados en Michoacán, México

    OpenAIRE

    Marroquín-Páramo, Jorge Alejandro; Suazo-Ortuño, Ireri; Mendoza, Eduardo; Alvarado-Díaz, Javier; Siliceo-Cantero, Héctor Hugo

    2017-01-01

    Resumen: La conversión de los hábitats naturales en monocultivos es un fenómeno que se presenta cada vez con mayor frecuencia, por lo que es necesario el estudio de su impacto sobre la diversidad, por ejemplo, de la herpetofauna. En el presente estudio se realizó un muestreo intensivo de anfibios y reptiles en 3 sitios en huertas de aguacate, 3 en bosque de coníferas (vegetación de la que derivan las huertas de aguacate) y 3 en bosque tropical caducifolio (usado como punto de referencia al es...

  14. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  15. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  16. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  17. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  18. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  19. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  20. Producción de semilla de guinea (Panicum maximum Jacq. en un sistema intensivo de ceba de ganado vacuno Seed production of Guinea grass (Panicum maximum Jacq. in an intensive cattle fattening system

    Directory of Open Access Journals (Sweden)

    G Oquend

    2008-09-01

    Full Text Available En un suelo Pardo sialítico del subtipo Cambisol cálcico, localizado en la Empresa Pecuaria «Calixto García», en la provincia de Holguín, se estudio la producción de semilla de guinea (Panicum maximum Jacq. en un sistema intensivo de ceba de ganado vacuno, en condiciones de riego. Los tratamientos fueron cinco varieda­des del pasto guinea: A Común; B Likoni; C Mombasa; D Tanzania; y E Tobiatá. Los siguientes métodos se consideraron a su vez como subtratamientos: 1 Siembra con semilla gámica; 2 Plantación por macollas; y 3 Por vía de trasplante. La carga se mantuvo ajustada a 2 UGM/ha. En la producción de semillas existieron interacciones favorables entre los métodos de siembra y las variedades: semilla gámica-guinea Likoni; maco­lla-guinea Mombasa, Tanzania y Tobiatá; trasplante-guinea Común. En todo el sistema de explotación se obtuvo un aporte adicional superior a los $1 000/ha por concepto de producción de semilla, sin afectar la producción animal, en la que se obtuvieron ganancias superiores a los 800 g/animal/día y producciones pro­medio de 46 212 t de carne en pie por ciclo de ceba. Se considera factible la producción de semilla del pasto guinea en sistemas intensivos de ceba de ganado vacuno.On a sialitic Brown soil of the calcic Cambisol subtype, located at the «Calixto García» Livestock Production Enterprise, in the Holguín province, the production of Guinea grass (Panicum maximum Jacq. was studied in an intensive cattle fattening system, with irrigation. The treatments were five varieties of Guinea grass: A Common; B Likoni; C Mombasa; D Tanzania; and E Tobiatá. The following methods were considered, in turn, sub-treatments: 1 Seeding with gamic seed; 2 Planting with tillers; and 3 Transplanting. The stocking rate remained adjusted at 2 animals/ha. In seed production there were favorable interactions between the planting methods and the varieties: gamic seed-Guinea grass Likoni; tiller-Guinea grass

  1. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  2. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  3. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  4. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  5. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  6. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  7. Evaluación del impacto de la intervención educativa-motivacional "Como Jugando" para prevenir la obesidad en escolares del Cercado de Lima: resultados al primer año

    Directory of Open Access Journals (Sweden)

    Juan Pablo Aparco

    Full Text Available RESUMEN Objetivo. Determinar el impacto, al primer año, de la intervención educativa-motivacional "Como Jugando" sobre el índice de masa corporal (IMC, conocimientos en alimentación, niveles de actividad física y patrones de consumo alimentario en escolares del 1.° al 4.° grado de primaria, de cuatro instituciones educativas (IE del Cercado de Lima. Materiales y métodos. Estudio cuasiexperimental, controlado. Se evaluó el IMC, conocimientos en nutrición, frecuencia de consumo de alimentos y nivel de actividad física. "Como Jugando" incluyó actividades lúdicas y vivenciales para escolares e involucró a docentes y padres. El impacto se estimó aplicando la prueba de McNemar para muestras relacionadas y modelos de regresión de diferencias en diferencias ajustados por variables relativas al escolar y la madre. Resultados. El estudio incluyó a 696 escolares de 2 IE de intervención y 2 IE de control, el puntaje Z de IMC y las prevalencias de obesidad no variaron durante el periodo de estudio. La intervención mostró impacto en mejorar los conocimientos en nutrición (OR: 1,46; IC95%: 1,17-1,81 redujo el riesgo de tener un nivel malo de actividad física (OR: 0,63; IC95%: 0,46-0,87 y mejoró los patrones de consumo de todos los alimentos, salvo verduras (grupo intervención. Conclusiones. La intervención "Como Jugando", al primer año de implementación, no redujo el Puntaje Z del IMC, sin embargo, tuvo impacto sobre los conocimientos en nutrición, redujo la probabilidad de tener un nivel malo de actividad física y mantuvo o aumentó la frecuencia adecuada del consumo de frutas, agua sin azúcar, jugos envasados y galletas dulces y saladas. Es necesario continuar evaluando la intervención "Como Jugando" para estimar el impacto sobre indicadores biológicos.

  8. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  9. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  10. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  11. Caracterización de los recién nacidos extremadamente bajo peso en el hospital “Ernesto Guevara de la Serna”, 2007- 2010

    Directory of Open Access Journals (Sweden)

    Martha Pequeño Rondón

    2015-11-01

    Full Text Available Se realizó un estudio  de tipo descriptivo, longitudinal, con el objetivo de caracterizar clínico-epidemiológicamente  a los recién nacidos extremadamente bajo peso al nacer, en la Unidad de Cuidados Intensivos Neonatales del Hospital General Docente “Dr. Ernesto Guevara de la Serna”, en el periodo comprendido desde enero 2007hasta diciembre 2010. El universo estuvo constituido por 17517 nacidos vivos, tomándose como muestra 36 recién nacidos prematuros extremos. La información se obtuvo de los expedientes clínicos de los recién nacidos pretérminos y del libro de morbilidad de la Unidad de Cuidados Intensivos Neonatales. Se concluyó que el índice de extremos bajo peso en nuestra maternidad estuvo en 0,2%, la causa más frecuente de ingreso en la unidad de Cuidados Intensivos Neonatales fue el síndrome de dificultad respiratoria, el peso que predominó fue entre 900 y 999 gramos, prevaleció el recién nacido prematuro extremo de 27 semanas y más, predominó el sexo masculino. Se hicieron recomendaciones al respecto.

  12. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  13. LA ADAPTACIÓN METODOLÓGICA DE LA ENSEÑANZA DE LENGUAS AL EEES: UN ESTUDIO EUROPEO LA ADAPTACIÓN METODOLÓGICA DE LA ENSEÑANZA DE LENGUAS AL EEES: UN ESTUDIO EUROPEO

    Directory of Open Access Journals (Sweden)

    María Luisa Pérez Cañado

    2010-10-01

    Full Text Available Este artículo presenta los resultados del primer estudio llevado a cabo en Europa acerca del proceso de adaptación de la enseñanza de lenguas al Espacio Europeo de Educación (Proyecto ADELEEES1, Programa de Estudios y Análisis, Ministerio de Ciencia e Innovación. Concretamente, se centra en los cambios metodológicos que está conllevando el nuevo sistema europeo de créditos, según el profesorado y alumnado de todas las universidades europeas que están pilotando el ECTS en titulaciones lingüísticas. Tras contextualizar el estudio en el seno del Proyecto global y detallar sus objetivos, procedimiento, participantes y metodología estadística, se describen los resultados obtenidos para el profesorado y el alumnado y se comparan ambos colectivos. Se concluye extrayendo interesantes conclusiones y proponiendo futuras líneas de actuación que pueden resultar de gran utilidad en el proceso de implantación de los nuevos planes de estudio en la universidad española y europea. La fi nalidad de todo ello es mejorar el funcionamiento del sistema ECTS y garantizar que las decisiones tomadas en relación con las nuevas enseñanzas universitarias oficiales se basen en estudios como el nuestro y en referentes tanto nacionales como internacionales.This article presents the results of the first study carried out in Europe on the adaptation of language teaching to the European Higher Education Area (ADELEEES Project, Ministry of Science and Innovation. It specifically focuses on the methodological changes which the new credit system is bringing about in all those European universities which are piloting the ECTS in language studies. After contextualizing the study within the broader framework of the Project and specifying its objectives, procedure, sample, and statistical methodology, the article goes on to describe the main outcomes of the investigation for teachers and students. It concludes by foregrounding the main conclusions and suggesting

  14. ESTUDIO DE LA VARIACIÓN MORFOLÓGICA DEL GONOPODO DE STRENGERIANA MANIFORMIS (BRACHYURA: PSEUDOTHELPHUSIDAE) MEDIANTE APLICACIÓN DE MORFOMETRÍA GEOMÉTRICA

    OpenAIRE

    PEDRAZA, MANUEL; R. CAMPOS, MARTHA

    2007-01-01

    Se utiliza la morfometría geométrica para determinar la variación morfológica del primer gonopodo del macho en especímenes de Strengeriana maniformis. Se examinaron 35 machos de la colección de Crustáceos del Instituto de Ciencias Naturales y 9 machos de la colección del Museo de la Salle. El estudio morfométrico se centró en el ápice y el proceso mesial del gonopodo izquierdo; en su desarrollo se utilizaron algunos de los programas de la serie TPS: tpsUtil, tpsDig, tpsRelw, tpsRegr y el Pala...

  15. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  16. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  17. Cerrando la brecha entre los cuidados paliativos y los cuidados intensivos Bringing the GAP between palliative care and intensive care

    Directory of Open Access Journals (Sweden)

    María Gálvez González

    2010-09-01

    Full Text Available El envejecimiento de la población ha traído consigo un cambio en el tipo de enfermedades subyacentes que padecen los usuarios de los servicios sanitarios, y ha elevado sustancialmente la tasa de mortalidad de los servicios de medicina intensiva de los países desarrollados. Esta circunstancia ha incentivado la inclusión de herramientas típicas de la medicina paliativa (centrada en el confort del paciente en las unidades de cuidados intensivos (centradas en la curación. La inclusión de estas herramientas no está resultando tarea fácil, puesto que al imperativo tecnológico dominante en este tipo de unidades, se le suman los condicionamientos sociales y culturales de la época moderna. En este artículo se presenta la perspectiva fenomenológica de la muerte en la unidad de cuidados intensivos, vista por una enfermera con experiencia en el campo de la medicina paliativa. En su narración se entrecruzan las creencias, vivencias y sentimientos que estas dos disciplinas han suscitado en la informante.The ageing of the population has introduced a change in the type of underlying diseases of the clients of the health services, and has increased substantially the mortality rate in the units of intensive care in the developed countries. This event has increased the need of including tools and specific care of palliative medicine (cantered in providing patient comfort in the intensive care units (which were aimed to heal. The incorporation of these tools is not turning out to be an easy as this area has been very technological, and now a days has to take into account the modern, cultural and social changes. This article presents the phenomenological perspective of death in the intensive care units, as seen by a nurse with experience in palliative care. In her story we can see the beliefs, feelings and experiences that these two disciplines have awoken in this informer.

  18. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  19. Sensibilidad antimicrobiana de la microbiota ambiental de las unidades de cuidados intensivos de un hospital peruano

    Directory of Open Access Journals (Sweden)

    José Díaz-Tello

    Full Text Available Con el objetivo de detectar y determinar la sensibilidad antimicrobiana de bacilos Gram negativos y cocos Gram positivos aislados de la microbiota ambiental de los servicios de la Unidad de Cuidados Intensivos (UCI de Neonatología, de Pediatría y de la Unidad de trasplantes (renal, hepático y general en un hospital de Lima; se tomaron 80 muestras de superficies inanimadas usando hisopado húmedo. Se identificaron 61 cepas bacterianas que correspondieron a Staphylococcus epidermidis (46,0%, Alcaligenes sp. (21,3%, Pseudomonas aeruginosa (16,4%, Acinetobacter sp. (13,1% Staphylococcus aureus (1,6% y Staphylococcus haemolyticcus (1,6%. Acinetobacter y Pseudomonas aeruginosa mostraron una elevada sensibilidad a los antibióticos evaluados, en contraste Alcaligenes sp. y Staphylococcus epidermidis presentaron la mayor resistencia antimicrobiana. Staphylococcus epidermidis y Alcaligenes sp. fueron las bacterias que presentaron mayor resistencia a los antibióticos y las que mayormente se aislaron. Se recomienda recurrir a métodos de asepsia y monitoreo sostenidos en las UCI.

  20. El papel moderador de la asertividad y la ansiedad social en el acoso psicológico en el trabajo: dos estudios empíricos

    Directory of Open Access Journals (Sweden)

    BERNARDO MORENO-JIMÉNEZ

    2006-01-01

    Full Text Available Tradicionalmente, la investigación sobre el acoso psicológico se ha focalizado en los estresores laborales y los factores contextuales como factores antecedentes. Sin embargo, la asociación entre los antecedentes organizacionales y el acoso es compleja y son varias las características de personalidad y factores individuales que pueden actuar como moderadores de esta relación (Einarsen, 2000. Para contrastarlo, se llevaron a cabo dos estudios empíricos para examinar el papel moderador de la personalidad en el proceso del acoso psicológico en el trabajo. En el primer estudio la muestra estuvo formada por 120 inmigrantes latinoamericanos. De acuerdo con la hipótesis inicial, los resultados de los análisis de regresión múltiple jerárquica mostraron que la asertividad moderaba la relación entre el antecedente organizacional inequidad laboral y el acoso psicológico. El segundo estudio se realizó en 183 víctimas de acoso. Los resultados mostraron que la ansiedad social y la asertividad moderaban la relación entre el acoso y sus efectos sobre la salud. Además, se encontraron diferencias de género en las quejas de salud derivadas del acoso.

  1. Concepções educativas morais de professores

    Directory of Open Access Journals (Sweden)

    Lucia Maria Caetano

    2017-01-01

    Full Text Available El objetivo de este artículo es presentar, comparando dos estudios, un mapeo de las concepciones morales de la formación del profesorado, cuanto a cuatro factores: obediencia, respeto, justicia y autonomía, con base en la Teoría de Jean Piaget. Par - ticiparon en el primer estudio 164 padres/madres profesionales de la educación y en el segundo 18 profesoras. En ambos estudios se utilizó un conjunto de 11 afirmacio - nes inspiradas en la Escala de Concepciones Educativas Morales, pero en la segunda escala fue adaptada a la relación profesor-alumno y respuestas justificadas. Los resultados del primer estudio mostraron una diferencia significativa entre el juicio y la acción moral de los educadores. En el segundo estudio, las respuestas fueron más mesuradas que las que se encuentran en el primer estudio. Basándose en los resulta - dos es importante seguir investigando comparativamente la familia y la escuela como contextos de desarrollo y educación moral.

  2. Análisis económico de sistemas productivos ovinos de Córdoba, Argentina: Estudio de casos

    Directory of Open Access Journals (Sweden)

    V Freire

    2013-06-01

    Full Text Available En un contexto de gran heterogeneidad organizativa y de recursos se estimaron los resultados económicos de la producción ovina de Córdoba, Argentina, con el propósito de generar referencias para la toma de decisiones relacionadas con el desarrollo del sector. Mediante estudio de casos se recogió información en seis agro-regiones, a través de encuestas semiestructuradas y entrevistas en profundidad. La venta de cordero fue el rubro de mayor participación entre los ingresos (83% de los casos; mano de obra (41% y suplementos (17%, los principales componentes en el promedio de costos totales. La actividad ovina logró márgenes brutos positivos en pequeños y medianos establecimientos serranos y de llanura, extensivos y semi-intensivos, especializados o diversifcados. Estrategias técnicas, comerciales y de gestión, permitieron alcanzar márgenes brutos similares o superiores a los de ganadería vacuna. Factores climáticos, técnicos y estructurales generaron márgenes netos negativos en establecimientos del noroeste y centro-oeste de Córdoba. Se concluye que si bien la producción ovina acrecentó el beneficio económico en la mitad de los sistemas analizados, de no mediar cambios de estrategias productivas y de políticas públicas vinculadas al sector, la viabilidad a mediano plazo se verá afectada en los sistemas más vulnerables.

  3. Descripción de los parámetros productivos, reproductivos y de las tecnologías de producción en sistemas intensivos de ganadería bovina en el sur del Valle geográfico del río Cauca

    Directory of Open Access Journals (Sweden)

    Sánchez Clara Inés

    1995-06-01

    Full Text Available

    En la zona plana del Sur del Valle del Cauca, Colombia, se estudiaron nueve (9 fincas, clasificadas como sistemas intensivos de producción bovina. Los resultados (medias e intervalos de confianza fueron: a Parámetros de producción: UGGI/ha: 2.7 (2.5-2.8; animales/ha; 3.2 (3.0-3.4; Duración de lactancia; días: 320 (292-349; Producción de leche /vaca/día, 1: 8.1 (6.4-9.8; Vacas en producción, %: 74.3 (64.2-84.4; Leche/vaca/año, 1:2850 (2231-3370; Leche vaca/día/hato, 1:5.75 (4.2-7.3; b Parámetros de reproducción: Natalidad, %: 80.5 (71.6-89.5; intervalo entre partos, meses: 14.7 (13.5-15.9; intervalo parto-concepción, días: 166 (129-202; servicios por concepción (IA: 1.7 (1.3-2.1; edad al primer servicio, meses: 23 (20.6-25.3. Los resultados fueron superiores a los descritos para sistemas intensivos en Colombia. Se comprobó el grado de intensificación por la utilización de tecnología como razas mejoradas, fertilizantes químicos, agrotóxicos, riego, pastoreo intensivo rotacional, alimentos concentrados, conservación de forrajes, planes sanitarios de vacunación y control de parásitos, crianza e inseminación artificial, ordeño mecanizado. No se encontró común el uso de tecnologías como el aprovechamiento de residuos de cosecha, subproductos agroindustriales, leguminosas asociadas con gramíneas y leguminosas arbóreas en la alimentación del ganado.

    The study was carried out in the plain zone of the south of Cauca Valley, Colombia. The main productive and reproductive parameters and the more representative technological characteristics were estimated and analized comparatively for nine (9 farms, classified as intensive cattle production systems. The results were (means and confidence intervals: a Production parameters: Cattle units/ha: 2.7 (2.5-2.8; animal/ha: 3.2 (3.0-3.4; lactation length, days: 320 (292-349; daily milk production per cow, 1:8.1 (6.4-9.8; productive cows, % 74.3: 64.2-84.4 Yearly milk

  4. ¿Qué explica la evolución del rendimiento académico universitario? Un estudio de caso en la Universidad del Pacífico

    OpenAIRE

    Arlette Beltrán; Karlos La Serna

    2009-01-01

    "Utilizando un modelo de “panel data” para el caso de los alumnos de la Universidad del Pacífico que ingresaron en el año 2006, el presente trabajo busca determinar si el rendimiento escolar y las características académicas del colegio de procedencia explican el desempeño en la universidad, más allá del primer año de estudios universitarios. Además, se identifican otros factores dan cuenta de dicho desempeño. Los resultados indican que el rendimiento académico en el colegio es uno de los prin...

  5. A Coprodução de Serviços Intensivos em Conhecimento e Criação de Valor: Uma Análise em Relações entre Empresas

    Directory of Open Access Journals (Sweden)

    Joselia Oliveira Rabelo

    2017-06-01

    Full Text Available O objetivo desta pesquisa foi identificar e descrever como as expertises técnica e de negócio do cliente e fornecedor influenciam na coprodução e, seus resultados na criação de valor econômico e relacional em serviços intensivos em conhecimento. Para entender melhor o relacionamento dessas variáveis, adotou-se pesquisa qualitativa, devido sua natureza exploratória e também por analisar o fenômeno por diferentes perspectivas - clientes, fornecedores e interação entre eles. Foram conduzidas entrevistas com gestores de diferentes tipos de serviços intensivos em conhecimento. As entrevistas basearam-se na teoria de coprodução, seus antecedentes e impacto na criação de valor. Nove entrevistas foram realizadas com gestores de diferentes tipos de serviços intensivos em conhecimento - Consultoria de RH, Software e Arquitetura e Engenharia.  ­­­Os entrevistados foram estimulados a trazerem explicações e exemplos sobre os temas para aprofundar o entendimento dos construtos pesquisados. Os resultados revelam que complexidade, customização e relevância estratégica da solução motivam o cliente a participar da coprodução. Os resultados da coprodução são otimizados quando clientes e fornecedores interagem e compartilham expertise nas fases de diagnóstico e execução da solução, o que influencia positivamente a percepção de valor do cliente. A interação e troca de expertise técnica e de negócios entre fornecedor e cliente favorece a coprodução. A participação do cliente na coprodução e a troca de expertise com o fornecedor têm impacto positivo tanto para o valor econômico como de relacionamento. Por fim, observou-se que clientes percebem a solução amplamente, considerando tanto os benefícios funcionais quanto o relacionamento com seus fornecedores.

  6. Análisis de los efectos de intervenciones públicas en la recuperación de centros urbanos : caso de estudio barrio las Cruces, Bogotá 2002-2014

    OpenAIRE

    Rosillo Herrera, María Daniela

    2015-01-01

    En el presente estudio de caso se hace un análisis de los principales efectos socio-espaciales y económicos que tuvieron intervenciones públicas dirigidas a recuperar el centro de Bogotá, en el territorio específico del Barrio Las Cruces, durante los años 2002-2014. Para lograrlo, en un primer momento se hace un análisis conceptual de las relaciones existentes entre intervenciones urbanas y los efectos que estas producen en lo urbano y lo local; en un segundo se identifican los antecedentes q...

  7. El Centro de Estudios sobre Deporte Inclusivo (CEDI): investigación aplicada, formación y promoción deportiva para personas con discapacidad en acción

    OpenAIRE

    Pérez Tejero, Javier; Soto Rey, Javier; Ocete Calvo, Carmen; Alonso, Javier; García Hernández, Juan José; Blanco Fernández, Juan José; Coteron Lopez, Francisco Javier; Irureta-Goyena Sánchez, Pilar; Sampedro Molinuevo, Javier

    2012-01-01

    La Universidad Politécnica de Madrid y la Fundación Sanitas firmaron un convenio en octubre de 2009 para la creación del primer Centro de Estudios sobre Deporte Inclusivo (CEDI) en España, con sede en la Facultad de Ciencias de la Actividad Física y del Deporte (INEF). Su objetivo principal es investigar, generar conocimiento y divulgar la información pertinente relativa al fenómeno de la inclusión de las personas con discapacidad en el deporte, difundiendo los beneficios que las actividades ...

  8. ESTUDIOS TRANSCULTURALES DEL BURNOUT: LOS ESTUDIOS TRANSCULTURALES BRASIL-ESPAÑA

    Directory of Open Access Journals (Sweden)

    Macarena Gálvez Herrer

    2003-07-01

    Full Text Available Los estudios transculturales no son un ejercicio secundario y complementario en el estudio de la psicología; un modelo antropológico de la conducta humana obliga a plantear que las variables culturales no son secundarias sino primarias. Por estas razones el estudio del “burnout†o desgaste profesional puede profundizarse mediante la utilización de los métodos transculturales. No es suficiente con la simple comparación de resultados, sino que es necesario buscar instrumentos propios de cada cultura y establecer la comparación no sólo del síndrome de desgaste profesional sino de todos los diferentes elementos del proceso. El trabajo presentado establece las bases teóricas de este planteamiento, y expone, mediante un ejemplo, algunas de las vías posibles para una psicología transcultural del burnout.

  9. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  10. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  11. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  12. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  13. Relación de la asignación de personal de enfermería con indicadores de resultado de la calidad de la atención en unidades de cuidados intensivos de adultos

    Directory of Open Access Journals (Sweden)

    Gloria L. Arango

    2015-01-01

    Full Text Available Objetivo: determinar la relación de la asignación de personal de enfermería con indicadores de resultado de la calidad de la atención en unidades de cuidados intensivos. Materiales y métodos: se hizo un estudio descriptivo con un componente correlacional, en el que se observaron 4006 turnos y se analizaron las variables de asignación de personal (estructura y de resultado, en términos de casos de shock o paro, infecciones asociadas a la atención en salud, número de muertes y totalidad de eventos negativos en salud. Resultados: los resultados muestran que las enfermeras desarrollan un número reducido de actividades de cuidado directo al paciente, que se concentran en la administración de medicamentos y la supervisión de transfusiones, y otras tareas administrativas, mientras que el personal auxiliar se hace cargo del cuidado directo al paciente, incluidas las actividades complejas. La razón paciente/profesional de enfermería promedio fue de 5,4 pacientes por cada enfermera disponible en la unidad, y la razón paciente/auxiliar de enfermería promedio fue de 2,4. Las correlaciones no son concluyentes. Conclusiones: se sugiere estudiar con mayor profundidad el skill mix como una medida más sensible de asignación de personal, a la vez que se plantean recomendaciones en torno a la diferenciación de actividades entre profesionales y auxiliares de enfermería, y algunas consideraciones relativas a la asignación de personal.

  14. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  15. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  16. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  17. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  18. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  19. Cost of antimicrobial treatment in patients infected with multidrug-resistant organisms in the Intensive Care Unit Costo de la terapia antimicrobiana en pacientes infectados con microorganismos multirresistentes en la Unidad de Cuidados Intensivos

    Directory of Open Access Journals (Sweden)

    Fabiana Xavier Cartaxo Salgado

    2011-12-01

    Full Text Available This study aims to compare the costs of antimicrobial drugs used in the treatment of patients infected with multidrug-resistant organisms (MDRO or those not infected with this type of organisms in an intensive care unit (ICU. It is a retrospective comparative case-control study, performed in a public hospital in the capital city of Brazil, comprising the years 2007, 2008 and 2009. Information on age, sex, length of hospitalization, clinical outcome, antimicrobial drugs, microorganisms and microbial sensitivity to antibiotics was collected. Spearman and Mann-Whitney tests were used for statistical analysis. The level of significance was set at p El presente estudio tuvo como objetivo comparar los costos del tratamiento con fármacos antimicrobianos para las infecciones debidas a organismos multirresistentes (OMDR versus aquellas debidas a gérmenes no multirresistentes, en la Unidad de Cuidados Intensivos (UCI de un hospital público de Brasilia, Distrito Federal. Fue un estudio retrospectivo, de casos y controles y abarcó un período de tres años (2007, 2008, 2009. Se recolectó información sobre edad, sexo, tiempo de internación, resultados clínicos, antimicrobianos usados, microorganismos aislados y su sensibilidad a los antibióticos. Se utilizaron en el análisis estadístico las pruebas de Spearman y de Mann-Whitney, con p < 0.05. La muestra consistió en 401 pacientes con media de edad de 51.36 años (± 19.68, siendo 226 varones (56.4%. En cuanto al tiempo de internación, un 32.9% de los pacientes permanecieron más de 20 días, con 195 altas y 206 óbitos. El tratamiento antimicrobiano costó US$ 1113 221.55 en los tres años, siendo éste mayor para los que presentaron OMDR que para los que no los presentaron (p = 0.01. Se comprobó la presencia de, por lo menos, un microorganismo multirresistente en el 54.6% de los pacientes. La infección intrahospitalaria con OMDR y el elevado costo del tratamiento de los pacientes infectados

  20. Estudios sobre postmodernidad y estudios culturales: ¿sinónimos?

    Directory of Open Access Journals (Sweden)

    Dr. Roberto A. Follari

    2000-01-01

    Full Text Available La postmodernidad exige para ser comprendida una dimensión sociohistórica y otra filosófica que le resulta irrenunciables. También hay una serie de fenómenos propiamente culturales, que son los que los denominados "estudios culturales" (G. Canclini. M. Barbero, etc. han asumido en Latinoamérica. Tales estudios han aportado una descripción de fenómenos nuevos, que no son analizados por ningún otro discurso teórico (tribus urbanas, identidades lábiles, influencia de los medios en los nuevos estilos de consumo, etc.. Con ello se da cuenta de parte de la cuestión postmodernidad, pero sin dudase deja fuera otras: lo filosófico y aún lo social y lo político quedan fuera de esa especie de antropología del presente. Por lo tanto, un enfoque integral de lo postmoderno incluye los estudios culturales, pero está lejos de limitarse a ellos.

  1. Aumento de peso después de soporte nutricional en una unidad de cuidado intensivo neonatal

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Velasco Benítez

    2014-09-01

    Full Text Available Introducción: El ayuno provoca en el recién nacido (RN, deterioro de su estado nutricional y crecimiento a corto y largo plazo. Objetivo: Determinar la ganancia de peso en RN críticamente enfermos (CE luego de nutrición parenteral (NP. Materiales  y  métodos: Estudio descriptivo observacional de tipo transversal, en 110 RNCE de ambos sexos, a término (RNAT y pretérmino (RNPreT, del Seguro Social de Bucaramanga, Colombia, que recibieron NP central o periférica. Se obtuvieron datos como sexo, edad gestacional, peso, gramos/kg/día de carbohidratos, proteínas y grasas, kcal/kg/día basales y finales, días de NP y patología subyacente. El análisis estadístico incluyó medidas de tendencia central y de posición, frecuencias, análisis uni y bivariado, pruebas de comparación de promedios y medianas, Chi cuadrado y Fisher, siendo el nivel de significancia de 0,05.Resultados: Fueron incluidos 63 RNPreT y 47 RNAT, con principal diagnóstico enterocolitis necrosante en 40 (36,4%. El promedio al final de la NP de proteínas y grasas fue 1,3 g/kg/día y 2,5 g/kg/día, respectivamente. Hubo incremento del peso basal y final de 14,2 g/día y diferencias significativas en cuanto a la progresión del peso basal y final, en los RNAT (p=0.015 y RNPreT (p=0.000, incluso con peso Conclusiones: Todos los RNCE que recibieron NP desde el primer día de vida, a dosis más bajas que las actualmente recomendadas, presentaron mejoría nutricional medible con la variación de peso diario

  2. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  3. Atención farmacéutica en personas que han sufrido episodios coronarios agudos (estudio TOMCOR

    Directory of Open Access Journals (Sweden)

    Álvarez de Toledo Flor

    2001-01-01

    Full Text Available Fundamento: Este estudio valora los efectos de un nuevo modelo de trabajo en las farmacias, denominado Atención Farmacéutica, frente al modelo tradicional. Se pretende conocer su factibilidad y las diferencias, potencialmente debidas a la Atención Farmacéutica, respecto de los resultados de salud de la farmacoterapia usada, en una muestra de pacientes que han sufrido episodios coronarios agudos. Métodos: Es un estudio prospectivo con un grupo de intervención (330 personas y un grupo control (405 personas, realizado en 83 farmacias de Asturias, Barcelona, Madrid y Vizcaya, en las que se hizo seguimiento durante un año del uso de medicamentos en 735 personas, de las cuales finalizaron el estudio 600. Resultados: Hubo diferencias favorables al grupo intervención, respecto de: a uso de servicios sanitarios indicativos de mayor morbilidad, tales como la frecuencia de consultas hospitalarias urgentes por paciente 1,27Interv. (IC95 %:1,10 a 1,44 y 1,63Contr.(IC95 %:1,36 a 1,90 o los días promedio de UCI por paciente hospitalizado: 2,46Interv.(IC95 %:1,56 a 3,36 y 5,87Contr.(IC95 %: 3,57 a 8,17, por causa cardiológica; b calidad de vida con diferencia de 4,7 (p < 0,05 en la dimensión de función física; c conocimiento de factores de riesgo de enfermedad coronaria, promedio de +10 % (p < 0,02 - 0,07, según dimensión; d identificación nominal de los medicamentos usados +10 % (p < 0,01; importancia subjetiva otorgada a los antiagregantes + 12 % (p < 0,009, los beta-bloqueantes, así como sus efectos +25 % (p < 0,02; y e satisfacción con la AF y percepción de la competencia profesional, promedio de + 12 % (p < 0,000 - 0,05, según dimensión. Conclusiones: Los valores menores de: demanda individual urgente coronaria, frecuencia de hospitalizaciones y número de días de Unidad de Cuidados Intensivos coronaria por hospitalización, sugerirían que los pacientes que tras un episodio coronario agudo reciben Atención Farmacéutica tienden a

  4. Atención farmacéutica en personas que han sufrido episodios coronarios agudos (estudio tomcor

    Directory of Open Access Journals (Sweden)

    Flor Álvarez de Toledo

    2001-01-01

    Full Text Available Fundamento: Este estudio valora los efectos de un nuevo modelo de trabajo en las farmacias, denominado Atención Farmacéutica, frente al modelo tradicional. Se pretende conocer su factibilidad y las diferencias, potencialmente debidas a la Atención Farmacéutica, respecto de los resultados de salud de la farmacoterapia usada, en una muestra de pacientes que han sufrido episodios coronarios agudos. Métodos: Es un estudio prospectivo con un grupo de intervención (330 personas y un grupo control (405 personas, realizado en 83 farmacias de Asturias, Barcelona, Madrid y Vizcaya, en las que se hizo seguimiento durante un año del uso de medicamentos en 735 personas, de las cuales finalizaron el estudio 600. Resultados: Hubo diferencias favorables al grupo intervención, respecto de: a uso de servicios sanitarios indicativos de mayor morbilidad, tales como la frecuencia de consultas hospitalarias urgentes por paciente 1,27Interv. (IC95 %:1,10 a 1,44 y 1,63Contr.(IC95 %:1,36 a 1,90 o los días promedio de UCI por paciente hospitalizado: 2,46Interv.(IC95 %:1,56 a 3,36 y 5,87Contr.(IC95 %: 3,57 a 8,17, por causa cardiológica; b calidad de vida con diferencia de 4,7 (p < 0,05 en la dimensión de función física; c conocimiento de factores de riesgo de enfermedad coronaria, promedio de +10 % (p < 0,02 - 0,07, según dimensión; d identificación nominal de los medicamentos usados +10 % (p < 0,01; importancia subjetiva otorgada a los antiagregantes + 12 % (p < 0,009, los beta-bloqueantes, así como sus efectos +25 % (p < 0,02; y e satisfacción con la AF y percepción de la competencia profesional, promedio de + 12 % (p < 0,000 – 0,05, según dimensión. Conclusiones: Los valores menores de: demanda individual urgente coronaria, frecuencia de hospitalizaciones y número de días de Unidad de Cuidados Intensivos coronaria por hospitalización, sugerirían que los pacientes que tras un episodio coronario agudo reciben Atención Farmacéutica tienden a

  5. Intervenções não farmacológicas no controlo da dor em cuidados intensivos neonatais Intervenciones no farmacológicas en el control del dolor en cuidados intensivos neonatales Non-pharmacological interventions in pain management in neonatal intensive care

    Directory of Open Access Journals (Sweden)

    Luís Manuel Cunha Batalha

    2010-12-01

    Full Text Available Introdução: Apesar de se reconhecer que a maior parte da dor experimentada pelo recém-nascido (RN pode ser prevenida ou substancialmente aliviada, inúmeros estudos continuam a revelar um tratamento insuficiente. Objectivos: Determinar a prevalência e gravidade da dor sentida pelo RN submetido a cuidados intensivos e a efectividade das medidas terapêuticas não farmacológicas. Metodologia: Numa UCIN de um Hospital Universitário estudaram-se 170 RN, ao longo de um ano, de que resultaram 844 observações. Os dados foram colhidos através da observação do RN, entrevista a pais e enfermeiros prestadores de cuidados e análise retrospectiva seriada dos registos intermitentes efectuados no processo clínico. A Intensidade da dor foi medida através da escala Echelle Douleur et d’Inconfort du Nouveau-Né (EDIN. Resultados: Em oito horas de observação, as 844 observações realizadas mostraram uma alta prevalência de dor (94,8%, com predomínio para a dor ligeira (72,7%. As intervenções não farmacológicas foram utilizadas em 88,7% das observações, com evidência para os posicionamentos, massagens e técnicas de conforto. Conclusões: Os enfermeiros usam com frequência e eficácia as medidas não farmacológicas de conforto, massagem e posicionamentos, mas outras técnicas deveriam ser incrementadas como o uso de sacarose, glicose ou aleitamento materno.Introducción: A pesar de reconocerse que la mayor parte del dolor experimentado por el recién nacido (RN puede ser prevenido o sustancialmente aliviado, innúmeros estudios revelan todavía un tratamiento insuficiente. Objetivos: Determinar la prevalencia y gravedad del dolor sentido por el RN sometido a cuidados intensivos y la afectividad de las medidas terapéuticas no farmacológicas. Metodología: En una UCIN de un Hospital Universitario, se estudiaron 170 RN a lo largo de un año, de donde resultaron 844 observaciones. Los datos fueron recopilados a través de la observaci

  6. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  7. Valoración del síndrome de burnout en la salud de las enfermeras de cuidados intensivos del Hospital Eugenio Espejo Julio – Septiembre de 2014

    OpenAIRE

    Acurio Acurio, Hilda Petrona; Córdoba Benavides, María Eugenia

    2015-01-01

    Contexto: El síndrome de Burnout ha sido definido como una respuesta al estrés laboral crónico, se desarrolla entre los profesionales que prestan sus servicios a través de una relación directa y mantenida con las personas, entre los que se encuentran todos los profesionales de la salud. El objetivo de este trabajo fue Identificar la presencia del Síndrome de Burnout en la salud de las enfermeras de la Unidad de Cuidados Intensivos del Hospital Eugenio Espejo de la ciudad de Quito. Diseño: Es...

  8. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  9. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  10. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  11. Costo-beneficio en una unidad de cuidados intensivos neonatales

    OpenAIRE

    Rafael Amador Morán; Alberto Labrada Despaigne; Ana Campo González; Rosa Díaz Aguilar

    2011-01-01

    INTRODUCCIÓN. El Sistema Nacional de Salud de Cuba ha desarrollado un conjunto de reformas encaminadas a lograr una mayor eficiencia en la prestación de servicios, para preservar logros como la efectividad y la accesibilidad. El objetivo de esta investigación fue identificar los costos en la Unidad de Terapia Intensiva Neonatal del Hospital Ginecoobstétrico de Guanabacoa en el período de un año. MÉTODOS. Se realizó un estudio descriptivo prospectivo del período de enero a diciembre del 2009. ...

  12. Herramientas para la investigación en Tecnologías de la Información y la Comunicación. Casos de estudio

    Directory of Open Access Journals (Sweden)

    Julio Ruiz Palmero

    2011-01-01

    Full Text Available En este artículo se pretende mostrar las posibilidades de algunas herramientas de recogida de información para el estudio cualitativo y cuantitativo en casos concretos de investigación y evaluación del impacto de las TIC en la enseñanza. Se mostrarán las técnicas seguidas en diferentes casos así como su metodología seguida. Los casos de estudio se corresponden con investigaciones desarrolladas dentro del Grupo de Investigación de Nuevas Tecnologías (Gtea de la Universidad de Málaga. En primer lugar abordaremos dos investigaciones sobre la evaluación de e-portafolios y análisis de diarios del Practicum desarrolladas durante 5 cursos académicos, en tercer lugar nos centraremos en la investigación que se está llevando a cabo dentro del Proyecto Estudio comparativo sobre la utilización y opinión del alumnado universitario sobre las TIC contrastando competencias requeridas como futuros profesionales (Ref. A/023024/09, financiado por la Agencia Española de Cooperación Internacional y en el que participan universidades de 5 países (España, México, Argentina, Perú y Chile y que se encuentra en su última fase de desarrollo.

  13. Una propuesta para el estudio dirigido de la programación lineal en el marco del Espacio Europeo de Educación Superior

    Directory of Open Access Journals (Sweden)

    Isabel Mª Manzano Pérez

    2005-01-01

    Full Text Available El objetivo del presente trabajo consiste en suscitar el debate en torno a algunos de los cambios en la práctica docente que conllevará la aproximación a la filosofía de la convergencia europea. En concreto, expondremos una propuesta de elaboración de una Guía Aprendizaje Orientado para el estudio de la Programación Lineal, tema de la asignatura troncal del segundo curso de la Licenciatura en Administración y Dirección de Empresas: Métodos Matemáticos para la Administración y Dirección de Empresas. La Guía de Aprendizaje Orientado propuesta dirigirá al alumno en la profundización y ampliación de los contenidos planteados en las clases presenciales incentivándole en la realización de diversas actividades prácticas relacionadas con la materia objeto de estudio. Para ello la Guía debería en primer lugar, permitir al alumno conocer con detalle cuáles son los objetivos de conocimiento y cuáles son las competencias que se espera adquiera cursando el tema objeto de estudio. Por último, pero no por ello menos importante, la Guía debe facilitar al alumno el control del grado de adquisición de conocimientos a lo largo del tema.

  14. Desenvolvimento e validação de teoria fundamentada em dados sobre o ambiente de unidade de terapia intensiva Desarrollo y validación de la teoría fundamentada sobre el medio ambiente de la unidad de cuidado intensivo Development and validation of the theory based on data about the environment of the intensive care unit

    Directory of Open Access Journals (Sweden)

    Marli Terezinha Stein Backes

    2011-12-01

    Full Text Available Estudo qualitativo que partiu da questão: como vêm sendo construídas as teorias e modelos de cuidado de enfermagem, focalizando o processo de construção da teoria substantiva, referente à Tese que teve como objetivos compreender o significado do ambiente de cuidados em Unidade de Terapia Intensiva e construir um modelo teórico sobre ele. O método utilizado foi a Grounded Theory. Realizaram-se 39 entrevistas com 47 sujeitos diferenciados de três Unidades de Terapia Intensiva Adulto, em Florianópolis/SC, Santa Maria/RS e Pelotas/RS, entre junho de 2009 a setembro de 2010. A teoria "Sustentando a vida no ambiente complexo de cuidados em Unidade de Terapia Intensiva" foi delimitada por oito categorias. Conclui-se que sustentar a vida no ambiente de Unidade de Terapia Intensiva significa investir intensivamente no cuidado de pacientes instáveis, com auxílio de tecnologias diferenciadas e profissionais capacitados, trabalhando em equipe, onde se convive com estresse/conflitos e dificuldades para lidar com a morte.Estudio cualitativo, empieza con la pregunta: ¿cómo se construyen las teorías y modelos de atención de enfermería, centrándose en el proceso de construcción de la teoría sustantiva de la Tesis cuyo objetivo fue comprender el significado del entorno de la atención en la Unidad de Cuidados Intensivos y construir un modelo teórico sobre el mismo. Se utilizó la Teoría Fundamentada. Se realizaron 39 entrevistas a 47 sujetos de 3 Unidades de Cuidado Intensivo Adulto, en Florianópolis/SC, Santa Maria/RS y Pelotas/RS, entre junio de 2009 y septiembre de 2010. Se construyó una teoría de "mantenimiento de la vida en el complejo entorno de la atención en la unidad de cuidados intensivos", definida por 8 categorías. Sostener la vida en el entorno de la Unidad de Cuidados Intensivos significa invertir intensamente en el cuidado de los pacientes ingresados y que no se encuentran en una situación estable, con la ayuda de

  15. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  16. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  17. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  18. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  19. Definición de los sectores económicos intensivos en conocimiento a partir de la clasificación que hace la OCDE y el análisis del nivel de cualificación de los trabajadores: análisis para Catalunya

    OpenAIRE

    Chica Mejía, Juan Eduardo

    2011-01-01

    Definición de los sectores económicos intensivos en conocimiento a partir de la clasificación que hace la OCDE y el análisis del nivel de cualificación de los trabajadores. Análisis para Catalunya

  20. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  1. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  2. MODELADO DE PROCESOS DE TRABAJO INTENSIVOS EN CONOCIMIENTO. UNA APLICACIÓN EN LA INDUSTRIA DEL SOFTWARE CUBANA

    Directory of Open Access Journals (Sweden)

    Carlos Rolando Macías Gelabert

    2009-09-01

    Full Text Available

    En este documento se propone un método general para el modelado de procesos de trabajo intensivos en conocimiento, donde se establece la necesidad de integrar los esfuerzos de mejoramiento de flujos de trabajo y del conocimiento. Se plantean criterios para la selección del proceso utilizando enfoques cualitativos, su análisis a través de la matriz de la estructura de diseño y el modelado genérico de actividades, que contribuyen a determinar la dependencia y estructuración del conocimiento en las actividades, respectivamente. Estas herramientas permiten identificar factores a considerar para la toma de decisiones de mejoramiento en dichos procesos de trabajo. El método fue aplicado en una organización cubana de la industria del software.

  3. Estudios transculturales del burnout: Los estudios transculturales Brasil-España

    Directory of Open Access Journals (Sweden)

    Bernardo Moreno Jiménez

    2003-01-01

    Full Text Available Los estudios transculturales no son un ejercicio secundario y complementario en el estudio de la psicología; un modelo antropológico de la conducta humana obliga a plantear que las variables culturales no son secundarias sino primarias. Por estas razones el estudio del “burnout” o desgaste profesional puede profundizarse mediante la utilización de los métodos transculturales. No es suficiente con la simple comparación de resultados, sino que es necesario buscar instrumentos propios de cada cultura y establecer la comparación no sólo del síndrome de desgaste profesional sino de todos los diferentes elementos del proceso. El trabajo presentado establece las bases teóricas de este planteamiento, y expone, mediante un ejemplo, algunas de las vías posibles para una psicología transcultural del burnout

  4. Presentación del estudio "Links" de hombres que tienes sexo con hombres en Buenos Aires, Argentina.

    Science.gov (United States)

    Carballo-Diéguez, Alex; Avila, María M; Balán, Iván C; Marone, Rubén; Pando, María A; Barreda, Victoria

    2011-03-01

    Estudios previos en Buenos Aires reportaron altas prevalencias de HIV entre HSH, con valores que oscilan entre 9 y 14% durante casi 10 años de continuo testeo. El objetivo principal de este estudio fue la evaluación de factores relacionados al comportamiento de alto riesgo para transmisión del HIV entre HSH entre los que se incluyen el conocimiento y factores emocionales, socioculturales y ambientales. Por otro lado se realizó la estimación de prevalencia e incidencia de HIV utilizando RDS (Respondent Driven Sampling), así como la presencia de otras infecciones de transmisión sexual. Por último se evaluaron los hábitos de testeo para HIV indagando que factores facilitan o impiden su realización. El estudio constó de dos fases, en primer lugar una fase cualitativa y posteriormente una fase cuantitativa con una duración total de 4 años y medio. Durante la fase cualitativa se realizaron 44 entrevistas individuales en profundidad, 8 grupos focales y 10 observaciones etnográficas (hoteles, baños públicos ("teteras"), cines pornográficos, fiestas privadas, dark rooms y discotecas). Durante la fase cuantitativa del estudio se realizó el reclutamiento de 500 participantes que provinieron de la Ciudad Autónoma de Buenos Aires, así como del Gran Buenos Aires. El reclutamiento se comenzó con 16 participantes llamados semillas. Se realizó el diagnóstico de infección por HIV, hepatitis B y C (HBV y HCV), Treponema pallidum, Virus Papiloma Humano (HPV) y Chlamidias. La colaboración establecida entre los grupos de trabajo enfocados en áreas diversas posibilitó el abordaje conjunto de nuevas estrategias de investigación antes no exploradas en nuestro país. Los resultados más relevantes de esta investigación serán progresivamente publicados en sucesivos números de Actualizaciones en SIDA.

  5. La periferia: voz y sentido en los estudios urbanos

    Directory of Open Access Journals (Sweden)

    Daniel Hiernaux

    2004-01-01

    Full Text Available En este trabajo exploramos la voz ‘periferia’ el contexto latinoamericano: cómo cambia tiempo que el fenómeno denotado se transforma y cómo agrega nuevos componentes en el diálogo entre la palabra y el fenómeno. Por ser una voz reciente, también revisamos otras voces emparentadas (‘arrabal’ y ‘suburbio’, reconstruyendo el uso y sentido cada una de ellas y la sustitución de unas otras hasta que aparece la palabra ‘periferia’. La expansión de las metrópolis y la constitución de amplios espacios periféricos sido de mucho interés en los estudios urbanos. No obstante, hay numerosos aspectos poco analizados. En el primer apartado revisamos voces antecedentes. Luego reconstruimos contexto en el que se comienza a referir territorio de expansión de la ciudad con palabra ‘periferia’, así como sus implicaciones en cuanto al sentido de la voz. En el apartado siguiente analizamos las dimensiones que incorporó la voz ‘periferia’ en relación procesos urbanos; para terminar con los desafíos actuales en torno a ese territorio las formas de nombrarlo

  6. Dificuldades vivenciadas pela equipe multiprofissional na unidade de terapia intensiva Dificultades vividas por el grupo de atención al paciente en la unidad de tratamiento intensivo Difficulties experienced by the patient care team at the intensive care unit

    Directory of Open Access Journals (Sweden)

    Maria Abadia Leite

    2005-04-01

    Full Text Available Trata-se de um estudo de caso com uma abordagem interpretativa, cujo objetivo foi identificar as dificuldades vivenciadas pela equipe multiprofissional que atua na Unidade de Terapia Intensiva. Os dados foram coletados por meio de observações participantes e entrevistas semi-estruturadas com médicos, enfermeiros e auxiliares de enfermagem. Por meio da análise de dados, foram identificadas as categorias: cuidar em terapia intensiva - "é difícil lidar com a morte e informar a família", e cuidar em terapia intensiva - "a falta de recursos materiais e o difícil trabalho em equipe". As dificuldades relatadas estão relacionadas ao contato com os familiares, com o lidar com a morte, com a falta de recursos materiais e, especialmente, com o relacionamento entre os membros da equipe. Os resultados evidenciaram a necessidade de que a equipe promova momentos para reflexão e discussão acerca dos aspectos técnicos, científicos e éticos referentes ao cuidado tanto dos pacientes críticos quanto de seus familiares, tendo em vista a melhoria da qualidade do atendimento e do relacionamento interpessoal.La finalidad de este estudio de caso interpretativo fue identificar las dificultades vividas por un equipo de profesionales que actúa en una Unidad de Tratamiento Intensivo. La compilación de datos fue realizada a través de observación participante y entrevistas semi-estructuradas llevadas a cabo con médicos, enfermeros y auxiliares de enfermería. El análisis reveló las siguientes categorías: cuidar en el tratamiento intensivo: "la ardua tarea de lidiar con la muerte y informar a la familia del paciente" y cuidar en el tratamiento intensivo: "la escasez de recursos materiales y la dificultad de trabajar en equipo". Las dificultades mencionadas se refieren al contacto con la familia, al afrontamiento de la muerte, a la falta de recursos materiales y especialmente a la relación entre los integrantes del equipo. Por consiguiente, el equipo

  7. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  8. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  9. Dosis ideal de relajación neuromuscular: evitar desacondicionamiento físico en niños críticamente enfermos

    OpenAIRE

    Olier Serra, Tatiana María

    2010-01-01

    El desacondicionamiento muscular que frecuentemente se observa en las unidades de cuidado intensivo pediátrico (UCIP) en pacientes relajados por más de 7 días, se debe en gran parte al relajante neuromuscular utilizado para facilitar la ventilación mecánica del niño crítico. El desconocimiento de las dosis óptimas es el incentivo principal para la realización de este estudio.

  10. Caracterización de la fibrosis quística en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Gladys Fuentes Fernández

    Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.

  11. Professional competences of nurse to work in Intensive Care Units: an integrative review Competencias profesionales de los enfermeros para trabajar en Unidades de Cuidados Intensivos: una revisión integradora Competência profissional do enfermeiro para atuar em Unidades de Terapia Intensiva: uma revisão integrativa

    Directory of Open Access Journals (Sweden)

    Silvia Helena Henriques Camelo

    2012-02-01

    Full Text Available This study aimed to identify and analyze nurses' competences to work at Intensive Care Units-ICU. An integrative review method was used, and data were collected in LILACS, SciELO and BDENF, from August to October 2010. Ten articles were identified, published in the last 12 years. Data grouping permitted the construction of thematic units related to nurses' competences: nursing care management, high-complexity nursing care delivery, decision making, leadership, communication, continuing/permanent education, human resource management, material resource management. The professional competences identified can support the outline of guidelines to constitute the profile of nursing working in intensive care units and drive/mobilize the improvement of nursing care practices.Este estudio tuvo como objetivo identificar y analizar las competencias de las enfermeras para actuar en Unidades de Cuidados Intensivos-UCI. Se utilizó el método de revisión integradora, y la recolección de datos se realizó a través de la base de datos LILACS, SciELO BDENF, entre agosto y octubre de 2010. Se identificaron 10 artículos, y el cotejo de los datos permitió la construcción de las siguientes unidades temáticas relacionadas con las habilidades de las enfermeras: gestionar los cuidados de enfermería, realizar los cuidados de enfermería más complejos, la toma de decisiones, el liderazgo, la comunicación, la educación continua y permanente y la gestión de recursos humanos y materiales. Las habilidades identificadas en este estudio sirven como una guía para formar el perfil de la enfermera que trabaja en unidades de cuidados intensivos-UCI y por lo tanto representan la línea de orientación que puede aumentar/movilizar la mejoría de las prácticas de atención recibidas por este profesional.Este estudo teve como objetivo analisar as competências profissionais dos enfermeiros em Unidades de Terapia Intensiva (UTI. Utilizou-se o método de revis

  12. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  13. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  14. Anatomía Humana: estudio de las reacciones de los estudiantes de primero de medicina ante la sala de disección

    Directory of Open Access Journals (Sweden)

    Maribel Miguel Pérez

    Full Text Available Introducción: El objetivo de este estudio es reflejar las reacciones físicas y emocionales de los estudiantes de primer curso de Medicina de la Universidad de Barcelona (Campus de Bellvitge ante la sala de disección. Material y métodos: Los estudiantes responden a tres cuestionarios que valoran la intensidad del miedo, las reacciones físicas y psicológicas frente la sala de disección y los métodos de afrontamiento, en dos momentos del curso: al inicio y al final del curso académico. Resultados: Las reacciones más frecuentes fueron la sensación de disgusto, la pérdida del apetito, las imágenes visuales recurrentes de los cadáveres, el insomnio y las pesadillas. Respecto a los métodos de afrontamiento más usados por los estudiantes para contrarrestar las reacciones adversas correspondieron en juntarse y hacer broma con los amigos, estudiar anatomía y pedir consejo a compañeros y profesores. Conclusiones: La sala de disección representa, para los estudiantes del primer curso de medicina, el primer encuentro relacionado con la muerte y ésta, a la vez, implica el desarrollo de mecanismos de adaptación en su futuro profesional. Los profesores de anatomía no solo tienen una mera función docente como transmisores de contenidos, sino que también deberían dar apoyo a la adaptación progresiva de los alumnos a la sala de disección.

  15. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  16. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  17. Disposiciones generales sobre la compraventa de mercaderías en la Convención de Viena: su estudio a la luz del derecho interno colombiano

    Directory of Open Access Journals (Sweden)

    Jeannette Namén Baquero

    2004-12-01

    Full Text Available Continuando con la investigación adelantada en el Departamento de Derecho Comercial sobre la Convención de Viena, en el presente artículo se realiza un análisis detallado del primer capitulo de la tercera parte de este instrumento armonizador, titulada Compraventa de Mercaderías. En particular, se tratan temas de vital importancia como el incumplimiento esencial, la exigencia de cumplimiento, resolución, modificación y extinción del contrato, haciendo un estudio comparativo a nivel doctrinal y jurisprudencial con lo preceptuado en la legislación interna nacional, respecto a la compraventa doméstica.

  18. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  19. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  20. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  1. In vivo effect of a self-etching primer on dentin.

    Science.gov (United States)

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  2. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  3. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  4. Percepción de los comportamientos del cuidado de enfermería en la unidad de cuidados intensivos Percepção dos comportamentos do cuidado de enfermagem na unidade de cuidados intensivos Perception of nursing care behaviors in the intensive care unit

    Directory of Open Access Journals (Sweden)

    Claudia Andrea Ramírez Perdomo

    2011-07-01

    Full Text Available El objetivo es describir y correlacionar la percepción de los comportamientos del cuidado de enfermería que tienen los pacientes y el personal de enfermería en la unidad de cuidados intensivos (UCI del Hospital Universitario Hernando Moncaleano Perdomo, de Neiva. Es un estudio de enfoque cuantitativo, descriptivo, correlacional y transversal. La muestra estuvo conformada por 122 usuarios hospitalizados, 13 enfermeros profesionales y 13 auxiliares de enfermería. Se utilizó el instrumento de Patricia Larson, CARE-Q, traducido y adaptado en 1998 por Nubia Rocío Cuervo en su investigación Percepción de los comportamientos de cuidado que tiene el personal de enfermería y la que tienen los pacientes del servicio de urgencias del Hospital la Victoria de Santafé de Bogotá; se graficó el instrumento para facilitar el diligenciamiento por los participantes. Para el análisis se aplicaron estadísticos como: medidas de tendencia central, tablas de frecuencia, tablas generales y correlación de Pearson. Las conclusiones permiten establecer la existencia de una correlación positiva en las categorías de: ser accesible, monitorea y hace seguimiento, y mantiene relación de confianza; se observó una correlación negativa en dos categorías: explica y facilita y se anticipa, lo cual permite establecer que existen cuatro categorías en las que se encontró que existía coincidencia entre los pacientes y el personal de enfermería; y dos de ellas mostraron diferencia.Este estudo objetiva descrever e corelacionar a percepção dos comportamentos do cuidado de enfermagem que os pacientes e o pessoal têm na unidade de cuidados intensivos (UCI do Hospital UniversitárioHernandoMoncaleanoPerdomo,de Neiva. O estudo tem uma abordagem quantitativa, descritiva, corelacional e transversal. Aamostra incluiu 122 usuários hospitalizados, 13 enfermeiros profissionais e 13 auxiliares de enfermagem. Utilizouse o instrumento de Patricia Larson, CARE-Q, traduzido e

  5. LA ADAPTACIÓN METODOLÓGICA DE LA ENSEÑANZA DE LENGUAS AL EEES: UN ESTUDIO EUROPEO

    Directory of Open Access Journals (Sweden)

    María Luisa Pérez Cañado

    2010-10-01

    Full Text Available This article presents the results of the first study carried out in Europe on the adaptation of language teaching to the European Higher Education Area (ADELEEES Project, Ministry of Science and Innovation. It specifically focuses on the methodological changes which the new credit system is bringing about in all those European universities which are piloting the ECTS in language studies. After contextualizing the study within the broader framework of the Project and specifying its objectives, procedure, sample, and statistical methodology, the article goes on to describe the main outcomes of the investigation for teachers and students. It concludes by foregrounding the main conclusions and suggesting future lines of action which are especially valuable for the implementation of new language degree programs across Europe. The ultimate goal is to improve the functioning of the ECTS system with a view to guaranteeing that the decisions taken in relation to the new official university studies are based on empirical data and national and international referents.Este artículo presenta los resultados del primer estudio llevado a cabo en Europa acerca del proceso de adaptación de la enseñanza de lenguas al Espacio Europeo de Educación (Proyecto ADELEEES1, Programa de Estudios y Análisis, Ministerio de Ciencia e Innovación. Concretamente, se centra en los cambios metodológicos que está conllevando el nuevo sistema europeo de créditos, según el profesorado y alumnado de todas las universidades europeas que están pilotando el ECTS en titulaciones lingüísticas. Tras contextualizar el estudio en el seno del Proyecto global y detallar sus objetivos, procedimiento, participantes y metodología estadística, se describen los resultados obtenidos para el profesorado y el alumnado y se comparan ambos colectivos. Se concluye extrayendo interesantes conclusiones y proponiendo futuras líneas de actuación que pueden resultar de gran utilidad en el

  6. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  7. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  8. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  9. Propiedades psicométricas del Cuestionario de Percepciones Académicas para la evaluación de las expectativas de los estudiantes de primer año en Enseñanza Superior

    Directory of Open Access Journals (Sweden)

    Manuel Deaño

    2015-01-01

    Full Text Available Desde una concepción multidimensional de las expectativas, este artículo pretende analizar la validez y precisión psicométrica de una escala para su medida en los estudiantes universitarios de primer año. La muestra (N = 759 estaba compuesta por alumnado de primer año, de diversas titulaciones académicas de la Universidad de Vigo-Campus de Ourense y de la Universidad de Minho. El valor de la Mdn de edad fue de 19, siendo sólo el 5.3% mayor de 23 años. A los participantes se les aplicó un conjunto de 56 ítems agrupados en siete dimensiones diferentes de expectativas. Los resultados del análisis factorial confirmatorio, se obtuvieron con el LISREL. Se garantizó la validez factorial, tanto convergente como discriminante de los factores. Ésta junto con su fiabilidad sugieren que el Cuestionario de Percepciones Académicas quedaría finalmente con 42 ítems distribuidos en siete dimensiones de expectativas: Formación para el empleo/carrera, Desarrollo personal y social, Movilidad estudiantil, Implicación política/ciudadanía, Presión social, Calidad de formación e Interacción social. Se comprobó la equivalencia del modelo de medida del instrumento en los dos idiomas y en dos grupos resultantes de la bipartición aleatoria de la muestra. Los resultados de la validez estructural de este estudio avalan la utilización del cuestionario para la medida de las expectativas de los estudiantes que inician por primera vez sus estudios en la Enseñanza Superior.

  10. Estudio preliminar. Patologías digitales más frecuentes en el pie de la bailaora de flamencoe

    Directory of Open Access Journals (Sweden)

    José Manuel Castillo López

    2010-05-01

    Full Text Available Este estudio tiene como objetivos, en primer lugar, dar a conocer las principales deformidades digitales de los pies, asociadas -por su alta incidencia- a la práctica profesional del baile flamenco femenino. Así como, poner de manifiesto la necesidad de llevar a cabo estudios de mayor magnitud para determinar si existe una relación estadísticamente significativa entre la práctica del baile flamenco con las deformidades y patologías podológicas descritas, y la importancia de la investigación en el campo de la medicina del deporte, y de la ortopodología y biomecánica en pos de hallar tratamientos preventivos y/o paliativos en su caso.En este estudio epidemiológico preliminar, llevado a cabo con la colaboración de la Universidad de Sevilla-Área Clínica de Podología y Departamento de Podología- Agencia Andaluza para el Desarrollo del Flamenco, Fundación Cristina Heeren de Arte Flamenco, Centro de Baile Flamenco Ana Moya, y el Centro de Investigación de Flamenco Telethusa, se han evaluado a 28 bailaoras profesionales activas en la provincia de Sevilla, con una actividad mínima de 20h semanales. En dicha muestra se han determinado las patologías podológicas presentes, sintomatología, hábitos de uso de calzado específico, y hábitos podológicos. Los resultados muestran una alta incidencia de patologías digitales como el H.A.V. (juanetes, dedos en garra, y onicopatías.

  11. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  12. Necesidades en salud del diabético usuario del primer nivel de atención

    Directory of Open Access Journals (Sweden)

    Salinas-Martínez Ana M.

    2001-01-01

    Full Text Available Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron cinco áreas y cuatro determinantes de salud, con base en estándares de la Norma Oficial Mexicana y la Asociación Americana de Diabetes. El plan de análisis consistió en estadística descriptiva y estimación de puntajes z. Resultados. Se registró una media de satisfacción global de necesidades de salud de 48.8%. En la zona rural la media de satisfacción fue menor que en la urbana (36.8% vs 53.3%, phttp://www.insp.mx/salud/index.html

  13. Titulación académica y posibilidades de acceso al primer empleo

    Directory of Open Access Journals (Sweden)

    ET. OTROS

    2009-11-01

    Full Text Available RESUMEN: El presente artículo realiza una revisión sobre el estado de la cuestión de la temática focalizada y recoge una investigación de carácter cualitativo. La técnica de recogida de información utilizada ha sido la entrevista. La investigación abordada versa sobre un estudio de caso, acerca de la titulación académica de los empleados de una empresa del sector del comercio en España y sus posibilidades de acceso al primer empleo.De la investigación se desprende que existe una estrecha relación entre la formación y el empleo llegando a convertirse en uno de los mayores condicionantes para la consecución y mantenimiento de éste. Los titulados medios y universitarios no encuentran dificultades para optar al primer empleo en el sector del comercio en España, debido a que todos presentan un nivel de estudios superior al solicitado para el trabajo que realizan en los primeros años de su vida laboral. A pesar de que el nivel de estudios no asegura la obtención del primer empleo coloca a las personas en una situación privilegiada para lograrlo, así la formación ofrece una predisposición para conseguirlo. Con todo, es recomendable desarrollar procedimientos para ofrecer una educación inicial más adaptada al contexto laboral de cada titulación académica que propicien un grado de exigencia coherente con la capacitación profesional.ABSTRACT: The present article is a review on the state of art of the topic starting from a qualitative approach. The technique Lised to collect data was the interview. This is a case study about the academic degrees of the employees of a company in the business sector in Spain and their possibilities of obtaining their first job.One conclusión is the cióse relationship between training and employment and how the former is one of the greatest conditioners in attaining and maintaining the latter. Persons with secondary diplomas and university degrees have no difficulties in gaining their first job

  14. Algunas variables biológicas relacionadas con trastornos del sueño en estudiantes de primer año de medicina

    Directory of Open Access Journals (Sweden)

    Ángel García Gascón

    2015-08-01

    Full Text Available Se realizó un estudio descriptivo de 110 estudiantes de primer año de la carrera de medicina en la Facultad de Ciencias Médicas No. 2 de Santiago de Cuba, desde enero hasta julio del 2014, con el objetivo de determinar algunas variables biológicas que pudieran estar relacionadas con los principales trastornos del sueño. La información fue procesada estadísticamente, con el empleo del porcentaje como medida de resumen y la aplicación de la prueba de la Χ² para valorar la posible asociación entre variables. En la serie se obtuvo que los trastornos del sueño más frecuentes fueran el insomnio, los ronquidos y las pesadillas, con predominio en las féminas; no obstante, en la mayoría de los alumnos el electroencefalograma resultó normal

  15. Presentación del estudio “Links” de hombres que tienes sexo con hombres en Buenos Aires, Argentina

    Science.gov (United States)

    Carballo-Diéguez, Alex; Ávila, María M; Balán, Iván C.; Marone, Rubén; Pando, María A.; Barreda, Victoria

    2011-01-01

    Resumen Estudios previos en Buenos Aires reportaron altas prevalencias de HIV entre HSH, con valores que oscilan entre 9 y 14% durante casi 10 años de continuo testeo. El objetivo principal de este estudio fue la evaluación de factores relacionados al comportamiento de alto riesgo para transmisión del HIV entre HSH entre los que se incluyen el conocimiento y factores emocionales, socioculturales y ambientales. Por otro lado se realizó la estimación de prevalencia e incidencia de HIV utilizando RDS (Respondent Driven Sampling), así como la presencia de otras infecciones de transmisión sexual. Por último se evaluaron los hábitos de testeo para HIV indagando que factores facilitan o impiden su realización. El estudio constó de dos fases, en primer lugar una fase cualitativa y posteriormente una fase cuantitativa con una duración total de 4 años y medio. Durante la fase cualitativa se realizaron 44 entrevistas individuales en profundidad, 8 grupos focales y 10 observaciones etnográficas (hoteles, baños públicos (“teteras”), cines pornográficos, fiestas privadas, dark rooms y discotecas). Durante la fase cuantitativa del estudio se realizó el reclutamiento de 500 participantes que provinieron de la Ciudad Autónoma de Buenos Aires, así como del Gran Buenos Aires. El reclutamiento se comenzó con 16 participantes llamados semillas. Se realizó el diagnóstico de infección por HIV, hepatitis B y C (HBV y HCV), Treponema pallidum, Virus Papiloma Humano (HPV) y Chlamidias. La colaboración establecida entre los grupos de trabajo enfocados en áreas diversas posibilitó el abordaje conjunto de nuevas estrategias de investigación antes no exploradas en nuestro país. Los resultados más relevantes de esta investigación serán progresivamente publicados en sucesivos números de Actualizaciones en SIDA. PMID:25264397

  16. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  17. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  18. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  19. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  20. Fuentes de Conocimiento en Empresas Biotecnológicas

    Directory of Open Access Journals (Sweden)

    Viridiana Núñez

    2015-10-01

    Full Text Available Los resultados empíricos respecto a cómo las empresas obtienen el conocimiento externo, sobre todo en sectores intensivos en conocimiento, no han sido concluyentes. Mientras que la mayoría de los estudios previos considera para el análisis un mecanismo de acceso al conocimiento, el presente estudio considera tres mecanismos: relaciones formales e informales y movilidad laboral. El estudio es cualitativo, exploratorio, aplicado a la industria biotecnológica de la región occidente de México. Los resultados muestran que más de la mitad de los vínculos para obtener el conocimiento se establecen a nivel regional, predominando las relaciones formales. Sin embargo, los resultados sugieren que es el conocimiento adquirido a nivel internacional el que confiere a la empresa una competitividad de clase mundial.

  1. Estudios geométricos y constructivos de una bóveda tabicada de yeso en la Comunidad de Madrid: determinación de su autoría por Juan Guas

    Directory of Open Access Journals (Sweden)

    Rocío Maira Vidal

    2012-12-01

    Full Text Available Este trabajo presenta los resultados del estudio geométrico y constructivo de la bóveda de crucería del presbiterio de la iglesia parroquial de Nuestra Señora de las Nieves, en Manzanares El Real, al norte de la Comunidad de Madrid. Las obras de restauración que la Dirección General de Patrimonio Histórico de la Comunidad de Madrid junto con el Arzobispado de Madrid están llevando a cabo sobre el edificio, han permitido realizar diversas investigaciones entre las que se encuentra este trabajo. En primer lugar se llevó a cabo una toma de datos precisa con herramientas topográficas. Sobre estas mediciones se abordó el análisis de la traza de la bóveda, su montea y su proceso constructivo. Este estudio, apoyado en los demás trabajos de investigación, ha permitido determinar su autoría.

  2. Estudio de la enseñanza y el aprendizaje de las funciones y empleo de las herramientas del taller de tecnología en 1º y 3º de E.S.O.

    OpenAIRE

    Jiménez-Rodríguez, Guillermo

    2013-01-01

    El presente Trabajo Fin de Máster constituye una breve investigación sobre la enseñanza, el aprendizaje y los conocimientos que poseen los alumnos de primer y tercer curso de Educación Secundaria Obligatoria acerca de las funciones y el empleo de las herramientas propias del taller de tecnología. La materia objeto de estudio merece una especial consideración en cuanto a la realidad existente en las aulas. Este Trabajo Fin de Máster pretende mejorar el proceso de enseñanza-aprendizaje en el...

  3. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  4. Necessidades de familiares de pacientes internados em unidade de cuidados intensivos Necesidades de los familiares de pacientes internados en unidad de cuidados intensivos Needs of family members of patients admitted to an intensive care unit

    Directory of Open Access Journals (Sweden)

    Marina Rumiko Maruiti

    2007-03-01

    Full Text Available OBJETIVO: Identificar as necessidades de familiares de pacientes internados em uma unidade de cuidados intensivos. MÉTODOS: Fizerem parte da amostra 39 familiares de pacientes em estado crítico de saúde. Para a coleta de dados foi utilizada uma adaptação do Critical Care Family Need Inventory. RESULTADOS: a necessidade de conhecimento/informação identificada com maior freqüência foi saber fatos concretos sobre o progresso do paciente (84,6%; a necessidade de conforto identificada com maior freqüência foi ter um toalete e um telefone próximo à sala de espera (56,4%; a necessidade de segurança identificada com maior freqüência foi ter a certeza que o paciente está recebendo o melhor tratamento (89,7%; e a necessidade de acesso ao paciente e aos profissionais da unidade com maior freqüência foi conversar com o médico todos os dias (79,5%. CONCLUSÃO: Os profissionais de enfermagem devem se preocupar em atender não apenas as necessidades dos pacientes, mas também de seus familiares.OBJETIVO: Identificar las necesidades de los familiares de pacientes internados en una unidad de cuidados intensivos. MÉTODOS: Formaron parte de la muestra 39 familiares de pacientes en estado crítico de salud. Para la recolección de datos fue utilizada una adaptación del Critical Care Family Need Inventory. RESULTADOS: La necesidad de conocimiento/información identificada con mayor frecuencia fue saber hechos concretos sobre el progreso de paciente (84,6%; la necesidad de comodidad identificada con mayor frecuencia fue tener un baño y teléfono próximo a la sala de espera (56,4%; la necesidad de seguridad registrada con mayor frecuencia fue tener la certeza de que lo patiente está recibiendo el mejor tratamiento (89,7% y la necesidad de acceso al paciente y a los profesionales de la unidad detectada con mayor frecuencia fue hablar con el médico todos los días (79,5%. CONCLUSÍON: La enfermería no debe preocuparse solamente con las

  5. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  6. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  7. Literatura infantil y juvenil en internet: de la Cervantes Virtual a la LIJ 2.0. Herramientas para su estudio y difusión

    Directory of Open Access Journals (Sweden)

    José Rovira Collado

    2011-01-01

    Full Text Available Ante las constantes innovaciones que nos ofrece internet y las transformaciones que estas suponen en el proceso de lectura, el siguiente estudio describe la situación actual de la Literatura Infantil y Juvenil (LIJ en español en la red, a través de dos modelos, no opuestos sino complementarios. En primer lugar, los grandes portales y proyectos institucionales, como la sección de LIJ de la Biblioteca Virtual Miguel de Cervantes, que nos ofrece textos clásicos, bibliotecas de autor y un importante aparato teórico. En segundo lugar, y bajo la definición de LIJ 2.0, todas las manifestaciones de la LIJ que podemos encontrar a través de las distintas opciones que nos ofrece la web social, más conocida como Web 2.0, donde la participación de los usuarios individuales y la interacción entre estos serán las características fundamentales. Blogs, Wikis o Redes Sociales serán los ejes de nuestro estudio para conocer la presencia de la LIJ y las posibles aplicaciones que nos ofrecen. Nuestro enfoque, desde la didáctica de la lengua y literatura, busca describir ambas realidades y las posibilidades específicas de cada herramienta para integrar el uso de la red con la difusión y el estudio de la LIJ.

  8. Estudio clínico y epidemiológico de un brote de beriberi húmedo en Cartagena de Indias, Colombia, 1992-1993

    Directory of Open Access Journals (Sweden)

    M. Martínez

    1996-01-01

    Full Text Available La presente investigación ha tenido como objetivo primordial aclarar la etiología de un cuadro clínico caracterizado por edema de las piernas, disestesias con déficit motor en miembros inferiores que, en dos casos, incluyó una cardiopatía que llevó a insuficiencia cardiaca irreversible. Este brote ocurrió entre julio de 1991 y junio de 1993; afectó selectivamente infantes de marina de la Escuela Naval Almirante Padilla en Cartagena de Indias. La metodología se centró en un estudio de casos y controles en el cual se sometió a cada grupo a un cuidadoso interrogatorio, examen clínico, medición por el laboratorio de metales pesados en sangre y orina de 24 horas y estudio de niveles de tiamina en muestras de suero; se analizaron cuatro biopsias de nervio sural y en el estudio postmortem de los fallecidos se puso especial atención a las alteraciones de miocardio. En muestras ambientales y biológicas, se analizó mercurio, plomo, arsénico y talio. Los resultados totalizan un grupo de 22 infantes de marina con un cuadro muy uniforme sobre todo por las manifestaciones de una neuropatía periférica nutricional, lo cual sumado a la cardiopatía fatal en dos pacientes, cuyo estudio tanto en microscopia de luz como electrónica, demostró cambios en todo compatibles con lo observado en beriberi, permiten que se considere que el problema de fondo reune las características del beriberi húmedo. Después de concluir que el problema tenía como fondo un origen nutricional basado, en primer lugar, en una falla de tiamina, se hicieron las recomendaciones y ajustes dietéticos indicados para estos casos con una respuesta inmediata y enteramente satisfactoria.

  9. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  10. Vivências paternas durante a hospitalização do recém-nascido prematuro na Unidade de Terapia Intensiva Neonatal Experiencias paternas durante la hospitalización del recién nacido prematuro en la Unidad de Cuidados Intensivos Neonatal Fathers' experiences during the hospitalization of the premature newborn in the Neonatal Intensive Care Unit

    Directory of Open Access Journals (Sweden)

    Luciano Marques dos Santos

    2012-10-01

    Full Text Available Este estudo objetivou compreender as vivências paternas durante a hospitalização do recém-nascido prematuro na Unidade de Terapia Intensiva Neonatal de um hospital público de Feira de Santana, Bahia. Trata-se de um estudo descritivo, exploratório e qualitativo, aprovado por Comitê de Ética em Pesquisa e realizado com nove pais, na Unidade de Terapia Intensiva Neonatal de um hospital público. Os dados foram analisados através da Análise de Conteúdo, os quais apontaram que os partos prematuros causam sentimentos de surpresa, angústia e medo nos pais. É preciso repensar como ocorre a inserção dos pais do prematuro no processo de hospitalização, bem como mudanças nas rotinas estabelecidas para a visita e participação paterna no contexto do cuidado ao prematuro.Este estudio tuvo como objetivo comprender la experiencia de los padres durante la hospitalización de los bebés prematuros en la Unidad Neonatal de Cuidados Intensivos de un hospital público en Feira de Santana, Bahia. Se trata de un estudio descriptivo y cuantitativo, aprobado por el Comité de Ética en Investigación y actuó en la Unidad de Cuidados Intensivos Neonatales de un hospital público de Bahia, con nueve padres. Los datos fueron analizados utilizando el análisis de contenido que muestran que los nacimientos prematuros causan sentimientos de sorpresa en los padres, de dolor y de miedo. Tenemos que repensar cómo se está insertando a los padres de bebés prematuros en las cuestiones de la hospitalización y los cambios en las rutinas establecidas para la visita y la participación del padre en el contexto de la atención precoz.This study aimed to understand the fathers' experiences during the hospitalization of premature newborn in the Neonatal Intensive Care Unit at a public hospital in Feira de Santana, Bahia. This is a qualitative descriptive exploratory study that was approved by the Ethics Committee of the Faculty of Technology and Sciences, and

  11. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  12. Intradisciplinariedad e Interdisciplinariedad en la adquisición de competencias: estudio de una experiencia de aprendizaje cooperativo

    Directory of Open Access Journals (Sweden)

    Pere Lavega

    2013-01-01

    Full Text Available Los objetivos planteados en este estudio fueron: analizar el nivel de adquisición de las competencias, estudiar el desarrollo del trabajo en equipo y el proceso de interacción profesor – alumno desde ambas perspectivas, así como desvelar el grado de satisfacción expresado por discentes y docentes en una experiencia pedagógica intradisciplinar e interdisciplinar. Esta experiencia se realizó con 130 estudiantes del grado en ciencias de la actividad física y del deporte (INEFC, Universidad de Lleida, con la implicación de seis profesores de tres asignaturas de primer curso que compartían competencias específicas y transversales. Los alumnos debían resolver un problema mediante el aprendizaje cooperativo. Los resultados muestran que esta experiencia merece una valoración positiva en la adquisición de competencias específicas y transversales.

  13. Factores que impactan los resultados empresariales: un estudio comparativo entre empresas chilenas y españolas

    Directory of Open Access Journals (Sweden)

    Patricia Carolina Huerta Riveros

    2015-04-01

    Full Text Available Los resultados empresariales representan un tema que sigue concentrando el interés de los investigadores y que aún no está resuelto. Es por ello que el presente estudio persigue dos objetivos: en primer lugar, realizar una revisión bibliográfica de los factores que impactan sobre los resultados empresariales; en segundo lugar, contrastar los planteamientos anteriores para aportar evidencia empírica al respecto, a través de un análisis comparativo entre dos países. Metodológicamente se realiza un contraste sobre paneles completos de empresas industriales chilenas y españolas, utilizando dos bases de datos: (i la Encuesta Nacional Industrial Anual (ENIA y (ii la base de datos de la Encuesta Sobre Estrategias Empresariales (ESEE, respectivamente, para el periodo 2000-2007. Utilizando análisis de componentes de varianza se identifican los factores que explican más del 90% de los resultados empresariales y, empleando técnicas para datos de panel, se descubre que estos factores también influyen en los resultados obtenidos. De este modo, el presente artículo avanza en la discusión del tema, a través de su aplicación a empresas de un país en vías de desarrollo como Chile, además de analizar un aspecto descuidado en la literatura como es el estudio de la influencia de los factores, sin concentrarse únicamente en el análisis del porcentaje de explicación de los factores identificados sobre los resultados empresariales; de igual manera, este trabajo actualiza el periodo tradicionalmente investigado e incorpora un factor relevante pero menos analizado en este tipo de estudios, como es la localización geográfica, factor que contribuye a explicar significativamente el modelo propuesto. Dentro de las repercusiones que implican el estudio, es evidente que sus resultados permitirán a los directivos y dueños de empresas comprender los elementos que influyen en los resultados organizacionales, los cuales son la base de su existencia y

  14. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  15. La junta de obras de los puertos: aspectos económicos, financieros y contables de su normativa reguladora. Una aplicación a la junta de obras del Puerto de la Luz y Las Palmas (Islas Canarias a través del estudio del libro diario, 1907-1908

    Directory of Open Access Journals (Sweden)

    Candelaria Castro Pérez

    2008-07-01

    Para la aplicación empírica de este estudio se ha tomado como fuente primaria la contabilidad desarrollada por la Junta de Obras de los Puertos de La Luz y Las Palmas para los años 1907-1908, reflejada en su primer Libro Diario, en el cual se registran todas las operaciones y por tanto constituye el fiel reflejo de la realidad económica del puerto. Dicho análisis nos permite mostrar la diversidad de operaciones económicas realizadas por la Junta en el intervalo temporal objeto de estudio, así como los movimientos de capitales que constituyeron su financiación y la posterior inversión de los mismos. Este estudio será la base para contrastar la realidad económica con las obligaciones impuestas por la normativa vigente en el período analizado.

  16. VIOLENCIAS PATRIARCALES EN LOS ENTORNOS VIRTUALES. UN ESTUDIO CON ADOLESCENTES

    Directory of Open Access Journals (Sweden)

    Trinidad Donoso-Vázquez

    2016-05-01

    Full Text Available En este estudio se analizan las violencias patriarcales que tienen lugar en los entornos virtuales. La muestra está formada por 155 adolescentes de primer curso de educación segundaria obligatoria (12 años y cuarto de educación secundaria obligatoria (16 años de la ciudad de Barcelona (España. Un 51,4% eran chicas y un 48,6% chicos. Se aplicó una escala tipo Likert de tres alternativas de respuesta. La escala constaba de 23 ítems que describían agresiones realizadas en los entornos virtuales (nunca, algunas veces, muchas veces. La escala muestra una fiabilidad alta en relación al índice de Alpha de Cronbach, (0,887 lo que indica una adecuada consistencia interna de sus ítems. Los resultados demuestran que internet es un espacio generizado, donde los ataques se realizan por no cumplir los impuestos normativos asignados a los géneros. Es preocupante que en todos los indicadores los chicos puntúen más alto que las chicas menos en los ítems que tienen que ver con el control y posesión de la pareja y en estereotipos sexistas femeninos.

  17. Estudio de viabilidad económica de una central termosolar de 50 MW con y sin almacenamiento térmico = Economic feasibility study in a cylindrical-parabolic solar thermal plant of 50 MW with and without thermal storage

    Directory of Open Access Journals (Sweden)

    Pedro José Soto Piedehierro

    2016-06-01

    Full Text Available Este articulo trata sobre el estudio de viabilidad económica de una central termosolar cilíndrico-parabólica de 50 MW en el término municipal de Badajoz. Para ver las diferentes alternativas en el diseño y estudio económico de la instalación se han tenido en cuenta dos casos, un primer caso de la central sin almacenamiento térmico y un segundo caso de la central con almacenamiento térmico. La finalidad con la que se presenta este estudio es analizar los diferentes casos y presentar conclusiones al respecto. The aim of this study is to do an economic feasibility study in a cylindrical-parabolic solar thermal plant of 50 MW in Badajoz. Two different cases have been studied, first case the solar thermal plant without thermal storage and the other case, the solar thermal plant with thermal storage (salt tanks. The advantages and disadvantages of the use of each element have also been analyzed.

  18. Analizando la invisibilización del ambiente. La danza y el movimiento como abordaje metodológico en estudios de sensibilidad y percepción ambiental

    Directory of Open Access Journals (Sweden)

    Victoria D'hers

    2012-10-01

    Full Text Available Partiendo de lo observado en un estudio previo, referido como procesos de "invisibilización/silenciamiento" de las condiciones ambientales en las cuales los sujetos construyen cotidianamente sus vidas, se propone un estudio exploratorio de las posibilidades de aplicación de metodología cualitativa ligada a expresiones creativas y el movimiento.En primer término, se recorren las conclusiones previas, argumentando que en la población habitante de asentamientos precarios se da una superposición de sufrimientos fuertemente marcados por la necesidad, donde se ocluyen las referidas condiciones ambientales adversas presentes en barrios asentados sobre lo que fueran basurales a cielo abierto.Luego, se propone la aplicación de metodologías basadas en la expresividad y la creatividad en el movimiento, tanto en la generación de datos como en la apertura para ex-presar aquello invisibilizado −poniendo en juego el sentido práctico de los sujetos−, como en su posterior análisis e interpretación hacia la comprensión de las sensibilidades sociales. En esta línea se presentan las primeras indagaciones a nivel de las preguntas básicas planteadas por estos objetivos, un breve estado del arte en estudios de este tipo y los desafíos que se plantean

  19. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  20. Barreras para el cuidado y la comunicación en cuidados intensivos de pediatría Barriers for the care and communication in pediatrics intensive care

    Directory of Open Access Journals (Sweden)

    Purificación González Villanueva

    2009-12-01

    Full Text Available El propósito de esta investigación ha sido describir, comprender e interpretar las experiencias y los saberes de los niños y niñas entre 6 y 12 años, en una Unidad de Cuidados Intensivos Pediátrica (UCIP. La metodología cualitativa utilizada ha sido el estudio de casos desde un enfoque etnográfico. La recogida de datos se ha hecho en un hospital de nivel cuatro de la comunidad de Madrid y en el domicilio de los niños utilizando la observación participante y entrevistas semiestructuradas a dos niñas y un niño, sus familias, profesionales de la UCIP y una enfermera de una planta de hospitalización pediátrica. Entre los resultados, las barreras para el cuidado y la comunicación es uno de los temas que aparece relacionado con el tema principal del estudio: el sufrimiento físico y emocional de los niños. Parte de las conclusiones muestran que se tiende a considerar a las niñas y niños como sujetos pasivos. No se valora ni se aprovecha su capacidad para entender lo que les pasa, expresarlo; para intercambiar ideas u opiniones sobre su bienestar, situación de salud y participación en su cuidado. Los padres y las familias se mantienen en un plano secundario.The purpose of this investigation was to describe, understand and interpret the knowledge and experiences of children between 6 and 12 years old in a pediatric intensive care unit (PICU. The quantitative methodology used has been to study the cases from an ethnographic point of view. Data has been collected in a four level* hospital of Madrid and in the homes of the children by using participating witnessing and semistructured interviews with two girls and a child, their families, PICU professionals and a nurse of the pediatrics section of the hospital. Among the results, the barriers for the care and communication is one of the topics that have turn out related to the main subject of the study: the physical and emotional suffering of children. Part of the conclusions show us

  1. Tecnologia e humanização em ambientes intensivos Tecnología y humanización en ambientes intensivos Technology and humanization in critical care environments

    Directory of Open Access Journals (Sweden)

    Isaac Rosa Marques

    2010-02-01

    Full Text Available Devido aos avanços obtidos com a revolução industrial através de descobertas em maquinário tecnológico, a relação profissional-paciente tem se tornado cada vez mais automatizada, deixando a humanização em segundo plano. O objetivo deste trabalho foi realizar uma reflexão o processo de humanização em ambientes intensivos e sua relação com a inserção da tecnologia. A tecnologia contribui de maneira efetiva no tratamento de pacientes que exigem cuidados extremos. Entretanto, se estiver associada a humanização pode alcançar resultados satisfatórios, melhorando assim o acolhimento do cliente que recebe cuidados providenciados pela tecnologia.Debido a los avances logrados con la revolución industrial a través de descubrimientos tecnológicos en maquinaria, la relación profesional-paciente se ha convertido cada vez más automatizada, lo que deja la humanización en el fondo. El objetivo de este trabajo fue reflexionar acerca del proceso de humanización y su relación con la inserción de la tecnología. La tecnología contribuye de manera eficaz en el tratamiento de pacientes que requieren atención extrema. Sin embargo, si se asocia con la humanización puede lograr resultados satisfactorios, mejorando así la acogida al cliente que recibe la atención promovida por la tecnología.Because of the advances made with the industrial revolution through technological discoveries in machinery, professional-patient relationship has become increasingly automated, leaving the humanization in the background. The purpose of this paper was to reflect about the humanization process in intensive environments and its relation with the technology insertion. Technology contributes as an effective way to treat patients who require extreme care. However, if it is associated with humanization can achieves satisfactory results, improving the host of customer who receives the care provided by technology.

  2. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  3. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  4. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  5. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  6. Demandas do trabalho e controle: implicações em unidades de terapia intensiva pediátrica e neonatal Demandas y control del trabajo: implicaciones en las unidades de tratamiento intensivo pediatrico y neonatal Demands and control of work: implications in pediatric and neonatal intensive care units

    Directory of Open Access Journals (Sweden)

    Monalisa de Cássia Fogaça

    2010-08-01

    Full Text Available Comparar a demanda e o controle sobre trabalho de médicos e enfermeiros que trabalham em unidades de tratamento intensivo pediátrica e neonatal. Estudo transversal com 37 médicos e 20 enfermeiros. Utilizou-se o Job Content Questionnarie. Médicos da UTI Neonatal diferem em suporte social recebido do supervisor (p=0,01 em relação aos da UTI Pediátrica. Enfermeiros da UTI Neonatal apresentam insegurança no trabalho (p=0,05. Médicos e enfermeiros da UTI Pediátrica diferem em controle sobre o trabalho; demanda psicológica do trabalho; esforço físico e suporte do supervisor (pComparación de la demanda y control sobre el trabajo de los médicos y enfermeras que trabajan en las unidades de tratamiento intensivo pediátrico y neonatal. Estudio transversal con 37 médicos y 20 enfermeras. Se utilizó el Job Content Questionnarie. Los médicos de la UCI Neonatal difieren en el apoyo social recibido desde el supervisor (p= 0,01 en comparacion com la UCI Pediátrica. Enfermeras de la UCI Neonatal actualmente la inseguridad en el empleo (p = 0,05. Los médicos y enfermeras de la UCI Pediátrica difieren em el control sobre el trabajo, las exigencias psicológicas del trabajo, esfuerzo físico y el apoyo del supervisor (pTo compare the demand and control over work of physicians and nurses working in pediatric and neonatal critical care units. Cross-sectional study with 37 doctors and 20 nurses. We used the Job Content Questionnarie. Physicians from the ICU Neonatal differ in social support received from the supervisor (p= 0.01 compared to the ICU Pediatric. ICU nurses of the Neonatal present job insecurity (p= 0.05. Physicians and nurses from the ICU Pediatric differ in control over the work, psychological demands of work, physical effort and support of the supervisor (p <0.05. Physicians and nurses from the ICU Neonatal show statistical differences in control over the work, physical effort and support of the supervisor (p<0.05. The work

  7. USO DE CADENAS DE MARKOV PARA LA PREDICCIÓN DE LA DINÁMICA DEL COMPORTAMIENTO DE PACIENTES EN UNA UNIDAD DE CUIDADO INTENSIVO CARDIOLÓGICA USE OF MARKOV CHAINS IN PREDICTION OF THE DYNAMICS OF PATIENT BEHAVIOR IN A CARDIOLOGIC INTENSIVE CARE UNIT

    Directory of Open Access Journals (Sweden)

    Víctor Albornoz

    2006-08-01

    Full Text Available En este trabajo presentamos un modelo probabilístico que contribuye al estudio de la dinámica en el comportamiento y permanencia de pacientes en una unidad de cuidados intensivos cardiológica. El modelo utilizado corresponde a una Cadena de Markov en tiempo discreto, que mediante la definición de determinados niveles de gravedad de un paciente (estados y la obtención de las correspondientes probabilidades de transición entre un nivel de gravedad y otro, permite predecir los tiempos de permanencia. Los diferentes estados empleados se basan en la construcción de un nuevo score creado para este propósito. Se muestran los detalles de la metodología adoptada y los principales resultados alcanzados en la aplicación del modelo empleado.In this paper we present a probabilistic model that contributes to the study of dynamics in the behavior and permanence of patients in a cardiovascular intensive care unit. The model corresponds to a discrete Markov Chain, that allows to predict the time that a patient remains in the system through the time, by means of certain severity of illness states and the corresponding transition probabilities between those states. The different states are based on the construction of a new score created for this study. We summarize the details of the adopted methodology and the main results reached in the application of the model.

  8. O seguimento da saúde da criança pré-termo e de baixo peso egressa da terapia intensiva neonatal

    Directory of Open Access Journals (Sweden)

    Cláudia Silveira Viera

    2009-01-01

    Full Text Available El objetivo de este estudio es describir cómo ocurre el cuidado del niño prematuro y de bajo peso después de ser dado de alta de la unidad de cuidados intensivos neonatal, en lo que se refiere a su seguimiento y el de su familia en el hogar. Es un estudio descriptivo, con abordaje hermenéutico y comprensión de los datos a partir del análisis temático. La investigación se realizó en la ciudad de Cascavel-PR, con seis familias cuyos hijos fueron dados de alta de la unidad de cuidados intensivos neonatal, siendo acompañados por medio de visitas domiciliarias en los tres primeros meses después de haber sido dados de alta. Los relatos señalan aspectos del cuidado del niño en el hogar y las experiencias con los servicios de salud en la atención basica y especializada. Las familias mostraron su itinerario en los servicios de salud disponibles, en busca de la continuidad del cuidado del niño después de ser dado de alta. Ese itinerario se caracterizó por barreras de acceso, vínculo frágil y vulnerabilidad institucional, produciendo inseguridad, insatisfacción y falta de afecto en el seguimiento del niño.

  9. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  10. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  11. Anatomía Cerebral del mono araña Ateles geoffroyi estudiada utilizando imágenes de resonancia magnética. Primer reporte: estudio comparativo con el cerebro humano Homo Sapiens

    OpenAIRE

    Chico-Ponce de León, Fernando; Platas-Neri, Diana; Muñoz-Delgado, Jairo; Santillán-Doherty, Ana-María; Arenas-Rosas, Rita; Trejo, David; Conde, Rubén; Ojeda-Flores, Rafael; Campos-Romo, Aurelio; Castro-Sierra, Eduardo; Cervantes, Juan José; Braun, Marc

    2010-01-01

    El objetivo del presente estudio cualitativo fue analizar los aspectos morfológicos de la anatomía cerebral interna utilizando imágenes de resonancia magnética (IRM) en dos especies de primates, El mono Araña (A. geoffroyi) y el humano (H. sapiens), tomando como base un estudio comparativo de las estructuras cerebrales de las dos especies, concentrándose primordialmente en el sistema límbico del cerebro del mono araña. Aunque es una especie común en el hemisferio occidental, es interesante pa...

  12. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  13. Autogestión en educación física. Un estudio de caso en secundaria

    Directory of Open Access Journals (Sweden)

    Eloísa Lorente Catalán

    2006-06-01

    Full Text Available El objeto de estudio de la tesis es la autogestión, una propuesta para la práctica pedagógica y el aprendizaje de la Educación Física que intenta implicar al máximo al alumnado en el proceso de enseñanza-aprendizaje. Los alumnos eligen, diseñan y llevan a cabo las sesiones adoptando el rol de profesor de sus propios compañeros. Esta tarea forma parte de un planteamiento más global que busca la autonomía del alumno en la gestión de su propio aprendizaje. El propósito del estudio es extraer conocimiento acerca de cómo se lleva a cabo la autogestión de la clase por parte del alumnado y de cómo perciben la experiencia los participantes, así como conocer qué aprenden y que utilidad le proporcionan para su vida cotidiana. La tesis está estructurada en dos partes. La primera trata de la fundamentación y del diseño del estudio, intentando, por una parte, ubicar la autogestión en el marco general de la enseñanza de la EF y por otra justificar el diseño de la investigación partiendo de la idea de que toda situación educativa es única y que por tanto, debe estudiarse en el lugar que ocurre. Por ello, la fundamentación epistemológica de la investigación se basa en el paradigma naturalista y la metodología que mejor se adecua a las pretensiones del estudio es la etnografía educativa interaccionista. La estrategia de diseño de la investigación es el estudio de caso, de modo que la segunda parte de la tesis se ha destinado a la reconstrucción del mismo. El caso estudiado está configurado por dos grupos de estudiantes de 8º de la antigua Educación General Básica y un profesor de EF con una ideología muy próxima a la pedagogía crítica. El estudio se centra especialmente en el primer año de la experiencia pero se continuó en contacto con el mismo grupo durante toda la secundaria, recogiendo información de los cuatro años, lo que permitió hacer una triangulación temporal. Posteriormente y después de tres a

  14. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  15. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  16. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. EDAD AL PRIMER PARTO EN VACAS HOLSTEIN DE LECHERÍA ESPECIALIZADA EN COSTA RICA

    Directory of Open Access Journals (Sweden)

    Mauren Salazar-Carranza

    2013-01-01

    Full Text Available El objetivo de este trabajo fue determinar la edad al primer parto (EPP en vacas Holstein pu- ras en lecherías especializadas de Costa Rica. Se realizó un es- tudio longitudinal prospectivo histórico con 46 029 animales de raza Holstein pura de lechería especializada de Costa Rica, durante el periodo comprendido entre los años 2000 y 2010. Se incluyeron los datos de vacas que contaban con registros completos para todas las variables del estudio, registrados en el programa VAMPP Bovino 3.0. Se calculó la EPP por las variables de zona ecológica, la época de nacimiento, el año de parto, el índice de endogamia, el número de lactancias de la madre y el tipo de parto que dio origen al animal en estudio. Los datos fueron analizados por medio de estadística descrip- tiva (porcentajes, promedios, desviación estándar [DE] y el cálculo de intervalos de confianza (IC95%. La EPP prome- dio fue 30,7 meses (D.E: 6,8; IC 95%: 30,6 – 30,8. Durante el periodo, el promedio de la EPP varió entre los 30 y 31 meses; sin embargo, en los años 2006 y 2007 mostró una tendencia a disminuir. La EPP presentó diferencias significativas entre estratos según la época de nacimiento, el número de lactancia de la madre, la zona ecológica, el año de nacimiento, el tipo de parto de la madre y el coeficiente de endogamia de la vaca. Al igual que las tendencias mundiales, mostró tendencia a decrecer en Costa Rica; y las variables de animal, tiempo y ambiente mostraron un efecto sobre la EPP. Excepto el coefi- ciente de endogamia (a mediano y largo plazo, esos factores no son modificables en condiciones de pastoreo, que son los imperantes en la gran mayoría de fincas estudiadas.

  18. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  19. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  20. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  1. DETECCIÓN DE Escherichia coli O157: H7 y Salmonella spp., EN CERDOS DEL DEPARTAMENTO DE CORDOBA

    Directory of Open Access Journals (Sweden)

    Jaime Vargas

    2004-07-01

    Full Text Available E. coli O157:H7 y Salmonella spp., son bacterias de distribución mundial causantes de enfermedades intestinales queafectan tanto al hombre como a LOS animales. ESTE estudio tuvo como objetivo determinar la presencia y frecuenciade aparición de E. coli O157:H7 y Salmonella spp., en los diferentes sistemas de producción porcina que se empleanen el departamento de Córdoba. Se realizó un estudio de corte descriptivo prospectivo, con un muestreo al azar enlos sistemas de explotación porcina intensiva y extensiva. Se procesaron 500 muestras de materia fecal de porcinos,250 provenientes del sistema extensivo y 250 del sistema intensivo. Para la detección E. coli y Salmonella spp., sellevaron a cabo procedimientos estándares microbiológicos. Los resultados mostraron una frecuencia de aparición deSalmonella spp., del 1%, el 0.2% en el sistema intensivo y el 0.8% en el sistema extensivo; no se aisló Escherichia coliO157:H7. Los resultados de resistencia y sensibilidad a los antibióticos en las cepas aisladas de Salmonella spp.,mostraron una sensibilidad del 100% al trimetoprim sulfametozasol, a la amikacina, al ceftriaxona, a la ciprofloxacina,a la gentamicina y al aztreonam y un 20% a la ampicilina y al sulbactam. Se concluye que la frecuencia de apariciónde Salmonella spp., en muestras coprológicas porcinas es baja, y nula para E. coli O157:H7, sin embargo, se debemantener la vigilancia sobre estos patógenos, por lo que se recomienda continuar los estudios epidemiológicos.

  2. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  3. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  4. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  5. IDENTIFICACIÓN Y ANÁLISIS DE LOS CRITERIOS DE CAMBIOS DEL SISTEMA DE DISTRIBUCIÓN TURÍSTICO ASOCIADOS AL USO INTENSIVO DE LAS TECNOLOGÍAS DE LA INFORMACIÓN Y DE LA COMUNICACIÓN

    Directory of Open Access Journals (Sweden)

    Berné Manero, Carmen

    2013-05-01

    Full Text Available La literatura asigna unánimemente a las tecnologías de la información y de la comunicación (TIC la facultad de incrementar la eficacia de la cooperación entre los operadores turísticos y la de favorecer el desarrollo de la industria turística. Sin embargo, no existe una síntesis de la investigación teórica que permita abordar un análisis empírico dirigido a reducir la incertidumbre que se cierne sobre el futuro de la estructura del sistema de distribución turístico como consecuencia de un uso intensivo de las TIC. Así, el propósito de este trabajo es cubrir esta falta. Para ello, primero se identifican en la literatura los posibles cambios en el sistema que teóricamente pueden estar siendo generados por las TIC; segundo, se aplica este marco teórico a una base de datos que recoge información proporcionada por los intermediarios turísticos. El análisis factorial exploratorio encuentra que el uso intensivo de las TIC fomenta 4 tipos de cambios estructurales. La evolución del sector parece ligada a un incremento de canales directos así como al reposicionamiento de los proveedores, de los intermediarios (tanto tradicionales como virtuales y de los consumidores.

  6. Revelação da ocorrência de erro de medicação em unidade de cuidados intensivos pediátricos Disclosure of medication error in a pediatric intensive care unit

    Directory of Open Access Journals (Sweden)

    Aline Santa Cruz Belela

    2010-09-01

    Full Text Available OBJETIVO: Descrever a ocorrência de comunicação do erro de medicação à equipe e família em uma unidade de cuidados intensivos pediátricos para atendimento de pacientes oncológicos. MÉTODOS: Estudo descritivo e exploratório, realizado no período de 1º de março a 31 de maio de 2008. Foi elaborada e implantada na unidade de cuidados intensivos pediátricos uma ficha de notificação de erros de medicação. A ficha deveria ser preenchida pelos profissionais envolvidos no sistema de medicação da unidade no período definido para coleta de dados. . RESULTADOS: A amostra foi composta por 71 fichas coletadas no período de estudo. Após a detecção do erro de medicação, a ocorrência não foi comunicada à equipe em 34 (47,9% situações. Nos 37 casos nos quais os eventos foram comunicados, o médico (48,7% foi aquele que mais recebeu a informação. Em 95,8% dos relatos a ocorrência não foi informada ao paciente e família. CONCLUSÃO: Embora a literatura atual preconize a revelação do erro, tal prática não constitui atividade freqüente na unidade de cuidados intensivos pediátricos estudada.OBJECTIVE: To describe the frequency medication error disclosure to the team and to the family in an oncology pediatric patients' intensive care unit. METHODS: This was a descriptive and exploratory study performed between March 1 and May 31, 2008. A medication error report form was developed and implemented, to be completed by the professionals involved in the unit's medication process. RESULTS: The sample consisted of 71 forms collected over the 92 collection days. After medication error detection, the event was not reported to the pediatric intensive care unit's team in 34 (47.9% cases. In the 37 reported to the team cases, for most of them (48.7% the physician was the professional communicated. The event was not disclosed to the patient/family in 95.8% of medication error reports. CONCLUSIONS: Although the literature recommends

  7. Diseño, desarrollo y realización de una leche fermentada sin lactosa. Definición de producto, análisis de mercado, estudio de alternativas, test de producto y diseño de producto final

    OpenAIRE

    Baztarrika Olaskoaga, Leire

    2012-01-01

    En el presente proyecto se ha llevado a cabo el diseño, desarrollo y realización de una leche fermentada sin lactosa. Para ello, el primer paso ha sido realizar un estudio de la intolerancia a la lactosa, los procesos de deslactosado existentes actualmente y un análisis de mercado. Posteriormente, se han estudiado diferentes alternativas de producción de leches fermentadas sin lactosa y se han comparado los procesos de fabricación de: un yogur con lactosa a partir de la ferm...

  8. La enseñanza-aprendizaje del inglés como lengua extranjera mediante la interacción oral: estudio de caso con niños y adultos en el ámbito no formal

    OpenAIRE

    Vejo Sainz, Rocío

    2016-01-01

    RESUMEN En este Trabajo Fin de Grado se presenta un estudio sobre la didáctica de la interacción oral en el área de inglés cuando este idioma se aborda como lengua extranjera (EFL). En primer lugar se realiza una revisión teórica sobre la importancia de estudiar este idioma en la actualidad y se plantean diversas cuestiones relativas a la didáctica de dicho campo. Se presta especial interés a la expresión oral, dada su relevancia fundamental para dominar la lengua y, sobre todo, para alcanzar...

  9. Diseño de un sistema de gestión de calidad ISO 9001:2008 para las áreas de emergencia, cuidados intensivos y quirófano de la clínica del pacífico.

    OpenAIRE

    Vera Parra, Kary Estefanía; Peña Triviño, Israel Guillermo

    2015-01-01

    Diseño de un sistema de gestión de calidad ISO 9001:2008 para las áreas de emergencia, cuidados intensivos y quirófano de la clínica del pacífico. The design of a quality management system based on ISO 9001: 2008 in the Pacific Hospital aims to identify and develop the necessary documentation for compliance with the requirements of the standard, for continuous improvement of the organization.

  10. Introducción a la Matemática Económico-Empresarial: balance de una materia de libre elección

    Directory of Open Access Journals (Sweden)

    R. Sala Garrido

    2000-01-01

    Full Text Available Desde el curso 1997/98, y debido a la diferente formación matemática con la que los estudiantes acceden a las licenciaturas de Economía y Administración y Dirección de Empresas y a la diplomatura en Ciencias Empresariales según sus estudios previos, la Universitat de València ofrece un módulo teórico-práctico de libre elección llamado Introducción a las Matemáticas Económico-Empresariales. La génesis, objetivos y estructura de dicho módulo fueron presentados por los autores en las VI Jornadas de ASEPUMA (Santiago, 1998, junto con unos primeros resultados basados en los datos disponibles en aquellos momentos: tan sólo los de la primera convocatoria. Este primer estudio sobre datos cruzados apuntaba ya la efectividad del módulo sobre el resto de asignaturas troncales de matemáticas y, en consecuencia, sobre el resto de las materias que apoyan su desarrollo y resultados sobre las matemáticas. En la actualidad, con datos históricos suficientes, presentamos la ratificación de los resultados anteriores. Su efectividad ha sido tal que en la "contrarreforma" emprendida por la Universidad el módulo ha pasado de ser un módulo de libre elección a tener carácter optativo y de ser intensivo a tener una duración semestral. Este hecho precisa una reflexión acerca de su tamaño y enfoque. Sin embargo, este módulo ha seguido la dinámica del resto y el porcentaje de aprobados ha descendido en cada convocatoria. En este trabajo analizamos las posibles causas de este hecho y planteamos algunas modificaciones en el temario debidas a los cambios introducidos.

  11. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  12. The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

    2011-01-15

    Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

  13. The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

    International Nuclear Information System (INIS)

    Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

    2011-01-01

    Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

  14. Adoecimento e finitude: considerações sobre a abordagem interdisciplinar no Centro de Tratamento Intensivo oncológico

    Directory of Open Access Journals (Sweden)

    Luciana da Silva Alcantara

    2013-09-01

    Full Text Available O adoecimento por câncer, que envolve sobremaneira tratamento invasivo e mutilador, traz repercussões na vida dos sujeitos, remontando a um imaginário de associação à dor, limitações e receio da morte, o que demanda a participação do familiar ou responsável pelo paciente durante o tratamento. O atendimento aos familiares ou responsáveis pelo paciente é um importante conteúdo da avaliação do cuidado nas instituições de saúde, enquanto aspecto integrante do processo de humanização da assistência e que requer dos profissionais a capacitação para identificar e atender suas necessidades. Diante do exposto, o presente estudo tem como objetivo trazer à tona algumas considerações sobre o trabalho interdisciplinar no acolhimento à família dos pacientes do Centro de Tratamento Intensivo adulto do Hospital do Câncer I, enquanto proposta eficiente no que tange ao atendimento de tais necessidades de informação clínica, orientação e suporte social, clínico e/ou psicológico.

  15. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Imunidade passiva, ingestão de colostro e mortalidade em cabritos Moxotó criados em sistemas extensivo e intensivo Passive immunity, colostrum ingestion, and mortality of Moxotó kids raised under extensive and intensive breeding systems

    Directory of Open Access Journals (Sweden)

    C.M. Soares

    2010-06-01

    Full Text Available Dosou-se a proteína sérica total para avaliar a aquisição de imunidade passiva em cabritos Moxotó. Para tal, formaram-se quatro grupos experimentais, sendo dois sistemas de criação, extensivo e intensivo, e dois manejos de colostro, ingestão natural e artificial. Tanto no sistema intensivo quanto no extensivo, os teores de proteína no soro foram significativamente mais altos nos animais com ingestão natural de colostro, 7,11±0,2g/dL, do que nos com ingestão artificial, 6,35±0,17g/dL. Independentemente da forma de ingestão de colostro, os cabritos do sistema intensivo tiveram teores de proteína sérica total, 7,21±0,19g/dL, mais elevados que os do sistema extensivo, 6,25±0,18g/dL, no entanto a imunidade passiva foi satisfatória nos dois grupos de animais. Ocorreu alta mortalidade de crias no sistema extensivo, 37%, devido ao complexo hipotermia/inanição em decorrência dos baixos níveis de colostro ingeridos. No sistema intensivo de criação não ocorreu mortalidade de cabritos. A produção de colostro das cabras criadas intensivamente, 163,5±14,71mL, foi mais alta que das cabras criadas extensivamente, 53,75±19,12mL. O peso total dos cabritos foi semelhante nos dois sistemas de criação, 2881±252,78g no sistema extensivo, e 2297±194,59g no sistema intensivo. Conclui-se que a ingestão de colostro nos dois sistemas de produção permitiu adequada aquisição de imunidade em cabritos, porém o sistema extensivo determinou severa deficiência nutricional nas mães, com baixa produção de colostro e graves perdas de neonatos.The acquisition of passive immunity in Moxotó kids was determined by dosages of total serum proteins. Four experimental groups were formed in two breeding systems - extensive and intensive - and two managements of colostrum intake - suckling from the mother or supplying in bottles. In both breeding systems, the serum protein levels were significantly higher in kids with natural ingestion of

  17. Estudio epidemiológico de sucesos traumáticos, trastorno de estrés post-traumático y otros trastornos psiquiátricos en una muestra representativa de Chile

    Science.gov (United States)

    Pérez Benítez, Carlos I.; Vicente, Benjamin; Zlotnick, Caron; Kohn, Robert; Johnson, Jennifer; Valdivia, Sandra; Rioseco, Pedro

    2010-01-01

    RESUMEN Durante la década de 1990 en los Estados Unidos (EU), el conocimiento sobre el trastorno de estrés post-traumático (TEPT) evolucionó de estudios específicos en un principio, sobre veteranos de guerra y sobre víctimas de desastres, a estudios epidemiológicos más tarde, sin embargo, la epidemiología del TEPT en países en desarrollo ha sido un área poco estudiada hasta ahora. Los expertos en el área de trauma han propuesto que los sucesos traumáticos que ocurren en la niñez son más perjudiciales para la salud mental que aquellos que ocurren más tarde en la vida. Este trabajo revisa los resultados de un estudio epidemiológico llevado a cabo en Chile. Específicamente, se revisan los resultados sobre las tasas de prevalencia del TEPT, traumas asociados más frecuentemente con él, así como la comorbilidad de este trastorno con otros trastornos psiquiátricos a lo largo de la vida. Igualmente se analizaron las diferencias del TEPT en cada sexo, así como la exposición a traumas en una muestra representativa de chilenos. Además se comparó la prevalencia de trastornos psiquiátricos en personas que sufrieron su primer trauma durante la niñez, durante la edad adulta, o que no reportaron traumas durante su vida. En estos estudios epidemiológicos se usaron módulos del TEPT y trastorno de personalidad antisocial (TPA) de la entrevista diagnóstica siguiendo los criterios del DSM-III-R (DIS–III-R). Para evaluar el resto de los trastornos psiquiátricos se usó la Entrevista Diagnóstica Internacional Compuesta (CIDI). Estos instrumentos fueron administrados en tres ciudades chilenas a 2390 personas mayores de 15 años. Para estimar los errores estándares (EE) debido al diseño de la muestra y a la necesidad de ajuste se usó el método Taylor de linearización seriada. También se usó un análisis de regresión logística para examinar la relación entre el TEPT, los factores demográficos de riesgo y el tipo de trauma. Además se utilizó la

  18. Análisis de Procrustes y el estudio de la variación morfológica

    Directory of Open Access Journals (Sweden)

    Torcida, Sebastián

    2012-01-01

    Full Text Available El estudio de la variación morfológica ha ocupado un lugar central en la antropología, así como en el resto de las ciencias naturales, a partir de su surgimiento en el siglo XVIII. Desde un punto de vista cuantitativo, el estudio de la variación morfológica busca obtener información acerca del tamaño y la forma de una estructura. Tradicionalmente, estas propiedades han sido estudiadas a través de variables lineales tales como "ancho", "longitud", "altura" y empleando métodos estadísticos multivariados. En las décadas del 1980 y 1990 las técnicas cuantitativas de análisis de la variación morfológica fueron revolucionadas por el desarrollo y la aplicación de un método para estudiar coordenadas cartesianas de puntos anatómicos: el análisis de Procrustes. Desde entonces, este método ha ganado relevancia en el campo de la antropología biológica. El objetivo de este artículo es revisar los principios del análisis de Procrustes aplicado a coordenadas de puntos anatómicos y discutir el empleo de diferentes versiones del mismo en bioantropología. El texto está ordenado como sigue: en primer lugar revisamos diversas nociones básicas involucradas en los estudios morfométricos; entre ellos, los conceptos de tamaño y forma. En segundo lugar discutimos los principios del análisis de Procrustes y señalamos las diferencias entre sus dos versiones más importantes: la superposición por cuadrados mínimos y la superposición robusta por medianas repetidas. Finalmente, mostramos y discutimos algunos ejemplos de la aplicación de estos métodos en el campo de la antropología biológica.

  19. Análisis de Procrustes y el estudio de la variación morfológica

    Directory of Open Access Journals (Sweden)

    Torcida, Sebastián

    2012-01-01

    Full Text Available El estudio de la variación morfológica ha ocupado un lugar central en la antropología, así como en el resto de las ciencias naturales, a partir de su surgimiento en el siglo XVIII. Desde un punto de vista cuantitativo, el estudio de la variación morfológica busca obtener información acerca del tamaño y la forma de una estructura. Tradicionalmente, estas propiedades han sido estudiadas a través de variables lineales tales como “ancho”, “longitud”, “altura” y empleando métodos estadísticos multivariados. En las décadas del 1980 y 1990 las técnicas cuantitativas de análisis de la variación morfológica fueron revolucionadas por el desarrollo y la aplicación de un método para estudiar coordenadas cartesianas de puntos anatómicos: el Análisis de Procrustes. Desde entonces, este método ha ganado relevancia en el campo de la antropología biológica. El objetivo de este artículo es revisar los principios del Análisis de Procrustes aplicado a coordenadas de puntos anatómicos y discutir el empleo de diferentes versiones del mismo en bioantropología. El texto está ordenado como sigue: en primer lugar revisamos diversas nociones básicas involucradas en los estudios morfométricos; entre ellos, los conceptos de tamaño y forma. En segundo lugar discutimos los principios del Análisis de Procrustes y señalamos las diferencias entre sus dos versiones más importantes: la superposición por cuadrados mínimos y la superposición robusta por medianas repetidas. Finalmente, mostramos y discutimos algunos ejemplos de la aplicación de estos métodos en el campo de la antropología biológica.

  20. Propuesta de contenidos de danza para la Educación Física en el primer ciclo de la Enseñanza Primaria

    Directory of Open Access Journals (Sweden)

    Marilys Mesa Fonseca

    2007-12-01

    Full Text Available En el presente estudio se pretende exponer una propuesta de contenidos específicos de expresión corporal (danza, para el primer ciclo de la enseñaza primaria, con una adecuada base teórica que sustente la propuesta y los resultados de esta investigación sobre la expresión corporal en el ámbito educativo que, a partir, de sus contenidos posibilitará trabajar el movimiento en función de potenciar las habilidades comunicativas en edades tempranas, dirigiendo tareas hacia el desarrollo armónico de la personalidad, permitiendo una equilibrada existencia física y mental y posibilitando además una salida a la imaginación, creatividad, expresividad y originalidad individual La propuesta que se presenta es la visión o el enfoque particular de un trabajo concreto que se desarrolla en la formación integral de la infancia en el primer ciclo de la Educación Física en la enseñanza primaria. Como contenidos específicos se contemplaran: las actividades de interacción, de familiarización con el ritmo, de adaptación a las cualidades del sonido y a los elementos de la música, así como las posibles técnicas de danza apropiadas para esta etapa educativa. Todo ello desde un objetivo muy claro: contribuir a la formación integral del alumno a través de los contenidos de la danza.

  1. El desarrollo del niño desnutrido : un estudio experimental sobre alimentación temprana

    Directory of Open Access Journals (Sweden)

    Ernesto Pollitt

    2000-12-01

    Full Text Available El estudio fue un ensayo clínico aleatorio en el que participaron dos cohortes de niños (12 y 18 meses indonesios en riesgo nutricional; hubo tres suplementos dietéticos: energía alta y micronutrientes; leche descremada y micronutrientes; y leche descremada. Se puso a prueba la hipótesis de que un suplemento de energía y micronutrientes administrado tempranamente, previene el retardo en el crecimiento físico y el desarrollo mental. Se obtuvo que el efecto de la suplementación con energía y micronutrientes en los bebés de 12 meses fue superior al efecto producido por la suplementación con micronutrientes y leche descremada. Los efectos en el grupo que comenzó a los 18 meses fueron menores. Hubo una interacción entre los efectos. Los resultados sugieren que este tipo de intervención en niños desnutridos debe iniciarse durante el primer año de vida.

  2. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  3. Factores de risco de displasia broncopulmonar em cinco unidades portuguesas de cuidados intensivos neonatais

    Directory of Open Access Journals (Sweden)

    Hercília Guimarães

    2010-05-01

    Full Text Available Resumo: A displasia broncopulmonar (DBP é multifactorial. Prematuridade, doença da membrana hialina, oxigénio, ventilação mecânica, inflamação e canal arterial são alguns dos factores na sua patogénese Objectivo: Avaliar a prevalência da DBP e seus factores de risco em cinco unidades portuguesas, para implementar boas práticas no tratamento deste doentes. Material e métodos: 256 recém-nascidos (RN com idade gestacional (IG  0,30 (85 vs 5 dias, respectivamente nos doentes com e sem DBP, p  0.30 (85 vs 5 days, respectively in BPD and no BPD patients, p < 0.001. Comments: The most relevant risk factors were low birth weight, severe hyaline membrane disease, duration of respiratory support and oxygen therapy, and nosocomial sepsis. The implementation of potentially better practices to reduce lung injury in neonates must be addressed to improve practices to decrease these risk factors. Palavras chave: Displasia broncopulmonar, recém-nascidos pré-termo, unidades de cuidados intensivos neonatais, doença da membrana hialina, ventilação mecânica, oxigenoterapia, factores de risco, boas práticas, Key words: Bronchopulmonary dysplasia, preterm infants, neonatal intensive care, prematurity, hyaline membrane disease, mechanical ventilation, oxygen therapy, risk factors, better practices

  4. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  5. Determinación de enfermedades parasitarias en población infantil de primer a cuarto grado de educación primaria en un ejido del sur de sonora

    Directory of Open Access Journals (Sweden)

    Gabriela de Los Ángeles Díaz Reyes

    2014-06-01

    Full Text Available La parasitosis intestinal constituye un problema de salud pública en México, siendo la población infantil la más afectada (9. En el estado de Sonora, se han realizado estudios que ubican la prevalencia de infecciones por microorganismos como Giardia lamblia, Endolimax nana y Entamoeba coli en 20, 10 y 19% respectivamente, con una situación de poliparasitismo en 18% de los casos (6. El hacinamiento, la escasez del agua potable y la carencia de drenaje, constituyen los mayores factores de riesgo para contraer este tipo de enfermedad (1. Como parte de un proyecto de Servicio Social de la Carrera de Químico Biólogo de la Universidad de Sonora, Unidad Regional Sur, se realizó un muestreo coproparasitoscópico en 52 niños de entre Primer y Cuarto grado de educación Primaria, en una población ejidal del sur del estado, con el fin de detectar casos positivos y canalizarlos para su atención. Se registraron 40 casos positivos para parasitosis, representando un 76.9% de la muestra, los principales microorganismos detectados durante el estudio fueron G. lamblia, E. histolityca, E. coli y E. nana, encontrándolos de manera aislada o en algunas muestras en asociaciones multiparasitarias.

  6. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  7. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  8. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  9. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  10. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  11. Los estudios culturales en Centroamérica.

    OpenAIRE

    Fumero, Patricia

    2012-01-01

    En el presente artículo se considerará el inicio de los estudios culturales en Centroamérica y las diversas corrientes que influyeron en este cambio. Posteriormente, se analizará la problemática que supone el estudio del istmo, en términos de su diversidad y del desarrollo de adecuadas perspectivas comparativas. Por último, se revisarán los avances logrados por los estudios literarios y los desafíos planteados en el futuro inmediato.

  12. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  13. Los intercambios virtuales lingüísticos y culturales en educación superior: un estudio de caso

    Directory of Open Access Journals (Sweden)

    María Victoria Guadamillas Gómez

    2017-03-01

    Full Text Available El estudio describe una intervención docente llevada a cabo en el campo de la telecolaboración interinstitucional y con el doble objetivo de incrementar el tiempo de práctica oral para la mejora lingüística (inglés/español y favorecer la toma de conciencia intercultural entre estudiantes universitarios en los contextos español y británico. La metodología aplicada da cuenta de las percepciones de estos participantes de manera cualitativa y del grado de implicación y participación de los discentes. En primer lugar, en este estudio de caso abordamos el término telecolaboración y recogemos aportaciones recientes en este ámbito; en segundo lugar, presentamos el proyecto y sus tres fases principales: toma de decisiones, desarrollo y evaluación. A continuación, analizamos los resultados de participación y los comentarios positivos y negativos obtenidos de los universitarios, según se refieran a los aspectos lingüísticos o culturales o a otros más generales relacionados con la experiencia de participación. Por último, en la discusión y las conclusiones hablamos del éxito de esta experiencia, el cual reside en la planificación y el diseño de tareas que han originado una alta participación.

  14. Significado do processo de enfermagem para enfermeiros de uma unidade de terapia intensiva: uma abordagem interacionista Significado del proceso de enfermería para enfermeros de una unidad de cuidados intensivos: un enfoque interactivo The meaning of the nursing process for nurses of intensive therapy units: an interactionist approach

    Directory of Open Access Journals (Sweden)

    Albertisa Rodrigues Alves

    2008-12-01

    Full Text Available O estudo teve como objetivo compreender o significado da prática do Processo de Enfermagem para enfermeiros de uma unidade de terapia intensiva. Utilizamos o interacionismo simbólico e análise temática como referencial teórico-metodológico. Fizeram parte do estudo sete enfermeiros de unidade de terapia intensiva que vivenciam esta prática em um hospital público da cidade de Fortaleza, Ceará. A coleta de dados foi realizada no período de 01 de maio a 30 de agosto de 2006, por meio da observação participante e entrevista semi-estruturada. Os resultados mostraram a interação social dos enfermeiros com os demais profissionais, os significados do processo de enfermagem e opiniões para a melhoria na UTI. A compreensão da experiência dos enfermeiros possibilitou reconhecer que as vivências são contraditórias e os significados são manifestados e expressos através da auto-interação e interação com outras pessoas.El estudio tuvo como objetivo comprender el significado de la práctica del Proceso de Enfermería según enfermeros de una unidad de cuidados intensivos. Utilizamos la interacción simbólica y el análisis temático como referencial teórico metodológico. Fueron parte del estudio siete enfermeros de la unidad de cuidados intensivos, quienes son parte de esta práctica en un hospital público de la ciudad de Fortaleza, Ceará. La recolección fue realizada durante el 01 de mayo al 30 de agosto del 2006, a través de la observación participativa y la entrevista semiestructurada. Los resultados mostraron la interacción social de los enfermeros con los demás profesionales, los significados del proceso de enfermería y las opiniones para mejorar la atención en la UCI. Comprender la experiencia de los enfermeros permitió reconocer que las vivencias son contradictorias y los significados son manifestados y expresados a través de la auto-interacción e interacción con otras personas.The study aimed at comprehending the

  15. Mortalidad en crías de Aotus sp. (Primates: Cebidae en cautiverio: una limitante para estudios biomédicos con modelos animales

    Directory of Open Access Journals (Sweden)

    Nofre Sánchez

    2006-07-01

    Full Text Available Aotus es un primate neotropical nocturno usado como modelo experimental en investigaciones biomédicas. En 1979 el Centro de Reproducción y Conservación de Primates del Proyecto Peruano de Primatologia (CRCP-PPP Iquitos- Perú, inició la cría en cautiverio del Aotus nancymae y el A. vociferans, siendo un objetivo de la crianza, la alta supervivencia de las crías. El presente estudio clasifica y describe la mortalidad en crías de un día a siete meses de edad, en el periodo 1988-2002 ocurridos en el CRCP. La información se obtuvo de los protocolos de necropsia realizados en A. nancymae (92=9% y A. vociferans (67=16%, sobre un total de 1453 nacimientos (1033 A. nancymae y 420 A. vociferans. Las causas de mortalidad son neumonías (37%, ocurridos desde la primera semana hasta un mes de edad en ambas especies; procesos gastrointestinales (26%, que afectó a crías de ambas especies de uno a cuatro meses; rechazos de los padres (18%, cuadros asociados con traumas múltiples observado en crías de un día hasta el primer mes en ambas especies; desnutrición (15%, registrado en ejemplares de ambas especies a partir del primer mes; las causas no determinadas (10% y trastornos de otros sistemas(3%.

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  18. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  19. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  20. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  1. ELEMENTOS METODOLÓGICOS QUE INCIDEN EN LA ENSEÑANZA –APRENDIZAJE DEL ESPAÑOL EN ESTUDIANTES DE PRIMER GRADO, BILWI, RAAN

    Directory of Open Access Journals (Sweden)

    Petronila Bello Fenly

    2012-10-01

    Full Text Available Este estudio se realizó en la escuela de Educación Especial “Hermana Maureen Courtney”, año 2010, Bilwi, RAAN, Nicaragua. Aporta información respecto a los elementos metodológicos  que inciden en la enseñanza del español en los estudiantes del primer grado de la Escuela de Educación Especial. Se utilizó la metodología descriptivo- cualitativa, de corte transversal porque es un estudio sincrónico.  Se observó el desarrollo de algunas clases de español,  se aplicaron entrevistas abiertas a estudiantes, docentes y subdirectora. Entre los resultado se observó que la docente utilizó una metodología tradicional basada en el método silábico y parte del método fonético-analítico-sintético (FAS, incluyendo la tradicionalidad en la organización del aula, es decir una formación de estudiantes sentados en hileras. Además es poca la utilización de medios y materiales didácticos y casi ausencia en la motivación. Consideramos de importancia esta investigación para el fortalecimiento de la enseñanza del español en Educación Especial.  Por esta razón se recomienda profundizar en esta temática en futuras investigaciones, lo que ayudará a una mayor sensibilización y mejora de la calidad en la docencia.

  2. Comportamiento del infarto agudo del miocardio en personas con diabetes mellitus de la provincia Granma Situation of the acute myocardial infarction in persons with diabetes mellitus in Granma province

    OpenAIRE

    Eduardo René Valdés Ramos; Marjoris Rivera Chávez; Niurka Bencosme Rodríguez

    2012-01-01

    Antecedentes: la diabetes mellitus, además de ser un factor de riesgo para el infarto agudo del miocardio, parece conferir per se un peor pronóstico en los pacientes con esta entidad. Objetivo: evaluar el comportamiento del infarto agudo del miocardio en personas con diabetes mellitus de la provincia de Granma. Métodos: se realizó un estudio transversal y descriptivo con 159 pacientes que ingresaron en la Unidad de Cuidados Intensivos Coronarios del Hospital "Carlos Manuel de Céspedes", de Ba...

  3. Conocimiento y cumplimiento de medidas de bioseguridad en personal de enfermería. Hospital Nacional Almanzor Aguinaga. Chiclayo 2002

    OpenAIRE

    Víctor Soto; Enrique Olano

    2004-01-01

    Objetivo: Determinar el nivel de conocimientos y cumplimiento de las medidas de bioseguridad del personal profesional y técnico de enfermería que labora en áreas de alto riesgo. Material y Métodos: Estudio transversal, descriptivo, siendo la población el personal profesional y técnico de enfermería que laboraba en Emergencia, Unidad de Cuidados Intensivos (UCI), Unidad de Cuidados Intermedios (UCEMIN), Cirugía General, Centro Quirúrgico, Neonatología y Hemodiálisis del Hospital Nacional Alman...

  4. Neurodevelopmental sequelae in premature newborns with extremely low weight and with very low weight at two years of age who left the Neonatal Intensive Care Unit of the Hospital Nacional Edgardo Rebagliati Martins 2009-2014

    OpenAIRE

    Carmen Fernández Sierra; Juan Matzumura Kasano; Hugo Gutiérrez Crespo; Luisa Zamudio Eslava; Giannina Melgarejo García

    2017-01-01

    Objetivo: Describir las secuelas del neurodesarrollo de los recién nacidos prematuros de extremadamente bajo peso y de muy bajo peso a los dos años de edad, egresados de la Unidad de Cuidados Intensivos Neonatales del Hospital Nacional Edgardo Rebagliati Martins.Materiales y métodos: Estudio descriptivo, retrospectivo, transversal en una población de 190 prematuros de extremadamente bajo peso y de muy bajo peso que nacieron durante enero 2009 a junio del 2014, egresados de la Unidad de Cuidad...

  5. Análisis y modelado del comportamiento de lixiviación de metales de sedimentos contaminados en contacto con fugas de CO2 procedentes de sistemas de captura y almacenamiento de carbono (CAC)

    OpenAIRE

    Payán Fraile, María de la Cruz

    2013-01-01

    RESUMEN: La Captura y Almacenamiento de Carbono (CAC)es una técnica objeto de intensivo estudio por la comunidad investigadora internacional debido a su potencial para reducir los gases de efecto invernadero. Es importante evaluar las consecuencias de las potenciales fugas de CO2 de sistemas CAC en sedimentos y en el fondo marino. Los metales y contaminantes orgánicos se liberarían de sedimentos contaminados debido a la acidificación del agua de mar. El objetivo de esta tesis es generar conoc...

  6. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  7. La investigación Biográfico-Narrativo, una alternativa para el estudio de los docentes

    Directory of Open Access Journals (Sweden)

    Huchim Aguilar, Donaldo

    2013-09-01

    Full Text Available En el presente ensayo, hacemos un recuento de la investigación biográfico-narrativa como metodología en el campo educativo y, específicamente, para el estudio de los docentes. En primer lugar, se describen de sus orígenes, la terminología más utilizada en este campo, los ámbitos de aplicación en educación, los medios sociales, los objetos teóricos estudiados y los instrumentos para la recolección de datos biográficos. Así mismo cómo se ha desarrollado esta metodología en diferentes países. También se hace una reseña del enfoque biográfico-narrativa: cómo ha sido utilizada en diversas investigaciones en el estudio del desarrollo de la carrera docente en los diferentes niveles educativos. Se enfatizará en los países que han tenido una larga tradición en la utilización de este enfoque: en Estados Unidos, Canadá y los países europeos, ya que, en el caso mexicano, esta metodología no ha tenido mucha presencia en el ámbito educativo y menos en el estudio de los docentes; por lo que, el propósito de este documento es presentar el desarrollo de este método: las fuentes, los campos de aplicación e instrumentos para realizar estudios en educación.This essay discusses the narrative-biographic approach as a methodology in the educational field, specifically for the study of the teachers. First, its origins, the terminology in the field, the application for education, the social media, the theoretically studied objects and instruments for gathering biographical data are described. Also how this methodology has been developed in different countries. Additionally, a description of the narrative-biographic approach is presented: how it has been used in various researches in the study of the development of the teaching career at different educational levels. Emphasis on the countries that have had a long tradition in using this approach: United States, Canada and European countries, this because the methodology exposed has not

  8. Escala de Metas de Estudio para Estudiantes Universitarios

    Directory of Open Access Journals (Sweden)

    María Victoria Pérez Villalobos

    2009-01-01

    Full Text Available Actualmente disponemos de gran cantidad de trabajos que muestran la implicación de las metas de estudio en la motivación por estudiar y aprender. Este trabajo analiza la motivación académica y, especialmente, la variable "metas de estudio". El principal propósito de esta investigación es conocer las características psicométricas de la adaptación de la Escala de Metas de Estudio a la población universitaria chilena. Los participantes son 542 estudiantes chilenos, de distintas facultades universitarias. Los resultados del análisis factorial y de consistencia interna son aceptables en las tres subescalas. Estos resultados fundamentan el uso de la Escala de Metas de Estudio para evaluar la motivación al estudio de alumnas y alumnos universitarios en Chile (CL.

  9. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  10. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  11. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  12. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  13. Nuevas perspectivas en los estudios sobre la democratización. El papel de los actores internacionales. La internacional socialista en américa latina (1974-1992

    Directory of Open Access Journals (Sweden)

    Fernando PEDROSA

    2011-05-01

    Full Text Available El artículo busca revitalizar la discusión sobre el papel de las dimensiones internacionales en los procesos de democratización reciente en América Latina. En primer lugar se presenta una serie de argumentos teóricos para ampliar las metodologías de estudio poniendo énfasis en la interacción de los actores de distintas nacionalidades. En segundo se avanzará en los resultados de una investigación sobre la importancia de la red construida en torno a la Internacional Socialista y la forma en que impactaron en la política de la época. Finalmente se presenta una agenda de investigación sobre las posibilidades de una historia reciente de las transiciones.

  14. Percepção do estresse entre enfermeiros que atuam em Terapia Intensiva Percepción del estrés entre enfermeros que actúan en Cuidados Intensivos Perception of stress among critical care nurses

    Directory of Open Access Journals (Sweden)

    Maria Verônica Guilherme Ferrareze

    2006-09-01

    Full Text Available OBJETIVO: o estudo investigou a ocorrência de estresse entre enfermeiros que atuam na assistência a pacientes críticos de uma Unidade de Cuidados Intensivos em um hospital universitário. MÉTODOS: utilizou-se um instrumento para descrição sociodemográfica da amostra e um inventário para identificar o estresse e a fase em que se encontra. RESULTADOS: a amostra foi composta por 12 enfermeiros, 91,7% do sexo feminino; 75% com carga horária de trabalho entre 10-12 horas diárias; 33,4% com tempo de formação universitária entre 5 e 10 anos. DISCUSSÃO: mais da metade dos trabalhadores (66,7%, que assiste pacientes críticos, mostrou sinais de sofrimento físico e/ou psicológico característicos da fase de resistência ao estresse. CONCLUSÃO: tais achados sugerem a necessidade de atenção a esses profissionais para que seus sintomas não evoluam para a fase de exaustão.OBJETIVO: el estudio investigó la ocurrencia de estrés entre enfermeros que actúan en la asistencia a pacientes críticos de una Unidad de Cuidados Intensivos en un hospital universitario. MÉTODOS: fue utilizado un instrumento para la descripción sociodemográfica de la muestra y un inventario para identificar el estrés y la fase en que se encuentra. RESULTADOS: la muestra estuvo constituida por 12 enfermeros, 91,7% del sexo femenino; 75% con carga horaria de trabajo entre 10 a 12 horas diarias; 33,4% con tiempo de formación universitaria entre 5 y 10 años. DISCUSIÓN: más de la mitad de los trabajadores (66,7%, que asiste a pacientes críticos, mostró señales de sufrimiento físico y/o psicológico característicos de la fase de resistencia al estrés. CONCLUSIÓN: tales hallazgos sugieren la necesidad de atención a esos profesionales para que sus síntomas no evolucionen hacia la fase de agotamiento.OBJECTIVE: to examine the perception of stress among critical care nurses in critical from a Brazilian university hospital. METHODS: a demographic questionnaire

  15. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  16. Propuestas de incorporación de contenidos matemáticos de nivel superior en la educación básica: un estudio de los trabajos finales de curso del Máster Profesional en Matemáticas en la Red Nacional

    OpenAIRE

    Breda, Adriana; Font, Vicenç; Lima, Valderez Marina do Rosário

    2015-01-01

    Este trabajo tiene como objetivo comprender qué papel tiene, en las propuestas de innovación para la enseñanza básica – presentadas en los trabajos de conclusión del curso (TCC) realizados en Máster Profesional en Matemáticas en la Red Nacional, Brasil −, la incorporación de contenidos matemáticos de nivel superior. Para ello, se realizó un estudio cualitativo de veintinueve trabajos, publicados durante el primer semestre de 2013 y segundo semestre de 2014. El análisis realizado permite concl...

  17. Nível de ruído em unidade de terapia intensiva neonatal Nivel de ruido en una unidad de cuidados intensivos neonatal Noise level in neonatal intensive care unit

    Directory of Open Access Journals (Sweden)

    Tereza Yoshiko Kakehashi

    2007-12-01

    Full Text Available OBJETIVO: Verificar o nível de ruído da Unidade de Terapia Intensiva Neonatal e identificar suas fontes. MÉTODOS: Estudo quantitativo, descritivo e exploratório, conduzido em uma Unidade de Terapia Intensiva Neonatal de São Paulo. A coleta de dados ocorreu de abril a maio de 2005, utilizando um dosímetro para 96 horas de registro do nível de pressão sonora e 9 horas de observação, para identificar as fontes de ruído. RESULTADOS: Registrou-se Leq entre 61,3 a 66,6 dBA, sendo maior nos dias do final de semana. Os valores dos picos variaram de 90,8 a 123,4 dBC, sendo mais elevados no período noturno. As principais fontes foram: alarme dos ventiladores, dos oxímetros, conversa entre profissionais e pais e outros. CONCLUSÃO: Considerando os efeitos deletérios do nível elevado de ruído sobre neonatos e equipe de saúde, os resultados demonstram a necessidade de intervenções em algumas rotinas e na conduta dos profissionais e familiares.OBJETIVO: Verificar el nivel de ruido de la Unidad de cuidados Intensivos Neonatal (UCIN e identificar sus fuentes. MÉTODOS: Fue conducido en una Unidade de Cuidados Intensivos Neonatal de Sao Paulo. Se trata de un estudio cuantitativo, descriptivo y exploratorio. La recolección de datos ocurrió de abril a mayo del 2005, utilizando un dosímetro para 96 horas de registro del nivel de presión sonora y 9 horas de observación, para identificar las fuentes del ruido. RESULTADOS: Se registró Leq entre 61.3 a 66,6 dBA, siendo mayor en los días del final de semana. Los valores de los picos variaron de 90,8 a 123,4 dBC, siendo más elevados en el período nocturno. Las principales fuentes fueron: alarma de los ventiladores, de los oxímetros, conversación entre profesionales y padres y otros. CONCLUSIÓN: Considerando los efectos deletérios del nivel elevado de ruído sobre neonatos y el equipo de salud, los resultados demuestran la necesidad de intervenciones en algunas rutinas y en la conducta de

  18. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  19. Survival at nine neonatal intensive care units in São Paulo, Brazil La supervivencia en nueve unidades de cuidados intensivos neonatales en São Paulo, Brasil

    Directory of Open Access Journals (Sweden)

    Maria Teresa Zullini

    1997-01-01

    Full Text Available A collaborative effort to assess factors affecting newborn survival at neonatal intensive care units (NICUs was made by studying 1948 newborns admitted to nine NICUs in the city of São Paulo between 1 June and 30 November 1991. Data on the study subjects were obtained using a standardized form. This was the first activity undertaken by a network of neonatologists (the Paulista Collaborative Group on Neonatal Care dedicated to jointly evaluating and improving neonatal care in that city. The study results showed an overall mortality of 59 deaths per 1000 neonates, with survival improving as gestational age and birthweight rose. Other variables significantly affecting survival were a poor maternal obstetric history (a previous stillbirth or neonatal death, or two or more spontaneous abortions; birth asphyxia (Apgar at 5 minutes Una iniciativa colectiva para evaluar los factores que inciden en la supervivencia de los recién nacidos en unidades de cuidados intensivos neonatales (UCIN se llevó a cabo mediante el estudio de 1948 neonatos ingresados en nueve UCIN de la ciudad de São Paulo entre el 1 de junio y el 30 de noviembre de 1991. Se usó un formulario estandarizado para recoger información sobre los niños estudiados. Fue la primera actividad emprendida por una red de neonatólogos (Grupo Colaborador Paulista para la Atención Neonatal dedicada a evaluar y mejorar, mediante un esfuerzo colectivo, la atención neonatal en la ciudad. Los resultados del estudio revelaron una mortalidad general de 59 defunciones por 1000 recién nacidos y una mayor supervivencia mientras mayores fueran la edad gestacional y el peso al nacer. Otras variables que tuvieron un efecto significativo en la supervivencia fueron la presencia de antecedentes obstétricos maternos desfavorables (hijos mortinatos o muertes neonatales previas, o dos o más abortos espontáneos; asfixia al nacer (Apgar <7 a los 5 minutos; síndrome de insuficiencia respiratoria; infecciones

  20. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  2. Aplicación de la teoría de sistemas dinámicos al estudio cualitativo y cuantitativo de la evolución del ozono estratosférico y troposférico

    OpenAIRE

    Luque Jiménez, Alejandro

    2004-01-01

    El presente trabajo consiste en el estudio de la evolución de los niveles de ozono en la estratosfera y en la troposfera mediante una metodología basada en la teoría de sistema dinámicos. Se elaboran las herramientas informáticas necesarias, prestando especial atención a las soluciones periódicas de los modelos matemáticos que describen el fenómeno. El primer capítulo formal de la memoria (capítulo 3) introduce el contexto de la química atmosférica y en él se discute el papel que juega ...

  3. Los estudios de farmacia en Cuba desde 1833 hasta 1863 Synercidâ: a combination of streptogramins A and B for the treatment of grampositive multiresistant pathogens

    Directory of Open Access Journals (Sweden)

    Pilar Marchante Castellanos

    2007-04-01

    Full Text Available Se exponen los aspectos esenciales sobre la enseñanza de la Farmacia que asumió y puso en práctica en Cuba la Real Junta Superior Gubernativa de la Facultad de Farmacia en la etapa comprendida entre la desaparición del Real Tribunal del Protomedicato, en 1833, hasta la incorporación de los estudios de esa especialidad en el Plan Estudios de la Real Universidad de La Habana, en 1842. Los conceptos aplicados en la enseñanza de la Farmacia durante esta etapa pueden considerarse como precursores de lo que constituyó el primer plan de estudios de la carrera de Farmacia en Cuba. Se presenta este primer plan, así como los requisitos para la obtención de los diferentes grados universitarios de la especialidad y los datos de algunas tesis presentadas en opción del grado de Doctor en Farmacia. Aunque formando parte de la Facultad de Medicina, y bajo la dirección del mismo decano, la carrera de Farmacia estuvo asociada con el nombre de Facultad y dirigida por un Consiliario hasta la reforma general de la enseñanza que tuvo lugar en la Isla en 1863, mediante la cual nace con identidad propia la Facultad de Farmacia en la Real Universidad de La Habana.The essential aspects about Pharmacy teaching, adopted and implemented by the Royal Higher Board of Directors of the Faculty of Pharmacy in Cuba since the Royal Board of the Protomedicate disappeared in 1833, until the studies of this specialty were included in the Curriculum of the Royal University of Havana, in 1842, are exposed. The concepts about the teaching of Pharmacy applied during this stage could be considered as predecessors of the first curriculum of Pharmacy in Cuba. This first curriculum, as well as the requirements to obtain the various university degrees of this specialty and the data on some theses submitted to obtain the Doctor in Pharmacy degree, are presented. As part of the Faculty of Medicine, and under the direction of the same Dean, the Pharmacy course was associated with the

  4. Estudio exploratorio sobre el fenómeno del “Bullying” en la ciudad de Cali, Colombia

    Directory of Open Access Journals (Sweden)

    María Teresa Paredes

    2008-05-01

    Full Text Available Este es el primer estudio sobre el fenómeno del hostigamiento entre pares o “bullying” que se realiza en la ciudad de Cali, Colombia. Se efectuaron 2.542 encuestas a estudiantes de sexto, séptimo y octavo grados de catorce colegios de la ciudad, con el fin de identificar la presencia del problema y –en caso de existir– de establecer las formas específicas de manifestación, teniendo en cuenta edad, género y estrato socioeconómico.Los resultados demostraron la presencia de “bullying” en el 24.7% de los encuestados y encuestadas, expresado en comportamientos de intimidación o agresión verbal, física y psicológica en estudiantes de ambos géneros de todos los estratos socioeconómicos. Se estableció que la forma de agresión de mayor frecuencia es la verbal y que ésta sucede también en presencia de otros compañeros, compañeras, profesoras y profesores en el aula de clase.

  5. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  7. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  8. Rasgos de personalidad (ZKPQ en pacientes con fibromialgia: un estudio de casos y controles

    Directory of Open Access Journals (Sweden)

    Silvia Albiol

    2014-10-01

    Full Text Available Este es el primer estudio llevado a cabo para determinar la relación entre la fibromialgia y el Zuckerman-Kuhlman Personality Questionnaire (ZKPQ, y uno de los pocos que tratan de establecer la relación entre dicha entidad diagnóstica y la personalidad normal. Una muestra de mujeres adultas diagnosticadas de fibromialgia (n = 47 fue emparejada por edad y sexo con un grupo control (n = 94. La comparación de ambos grupos nos describe un perfil de personalidad caracterizado por elevadas puntuaciones en Neuroticismo y bajas en Sociabilidad. Un análisis multivariante muestra que puntuaciones elevadas en Neuroticismo y bajas en Intolerancia al Aislamiento son factores predictores de alta probabilidad de ser diagnosticado de fibromialgia. El ZKPQ con sus subescalas específicas y una escala de control proporciona una descripción de la personalidad normal más pormenorizada. Se concluye que médicos y psicólogos trabajen conjuntamente en la construcción de un paradigma donde la perspectiva médica y la psicológica sean ambas consideradas para una mejor conceptualización de la fibromialgia.

  9. Percepción de los alumnos sobre su primer año de universidad: Facultad de medicina Universidad de Chile

    Directory of Open Access Journals (Sweden)

    Ilse M. López Bravo

    Full Text Available Se diseñó un estudio que permitiera describir la percepción de los estudiantes de las ocho escuelas de la Facultad de Medicina de la Universidad de Chile, al terminar su primer año académico, relacionada con adaptación a la vida universitaria; ambiente afectivo, calidad de la docencia, ambiente físico y cumplimiento de expectativas. Material y método: Se diseñó un instrumento, que fue validado por expertos, con 66 aseveraciones tipo Likert. Se dio puntaje a cada respuesta. Para el análisis, la escala total se dividió en cuatro categorías. Resultados: Respondieron 496 estudiantes. Sólo 23% logró "adaptación a la vida universitaria" Entre los factores que la afectan: cantidad de contenidos de las asignaturas; carga horaria y falta de orientaciones prácticas de cómo estudiar. El "ambiente afectivo" 80% lo considera "bueno". 75% percibe "regular calidad de la docencia"; Alta proporción percibe "docentes que sólo se interesan en pasar la materia" y otros "desmotivados por la docencia". Se encontró preferencia por clases expositivas y participativas; por los trabajos de grupo en aula, no fuera de ella; el aprendizaje a través de los trabajos de laboratorio y las guías de estudio. Las preguntas de las evaluaciones son percibidas como desconectadas de los contenidos de las clases. Se requiere revisar actitudes de docentes que hacen que el alumno sienta que "debe caerle bien", que con frecuencia "son descalificados", que son percibidos " muy lejanos" y "menos humanos" que lo esperado.

  10. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  11. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  12. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  13. Casos de Estudio de Distribuciones de Probabilidad para Turismo

    OpenAIRE

    Fernández Morales, Antonio

    2016-01-01

    Este trabajo propone diversos casos de estudio para el estudio de las distribuciones de probabilidad aplicadas a la investigación y la práctica profesional en el ámbito del turismo. Se afronta el estudio de distribuciones de probabilidad, tanto de variables aleatorias discretas como continuas.

  14. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  15. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  16. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  17. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  18. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  19. LAS GIRAS: UNA PRÁCTICA PEDAGÓGICA EN EL REPERTORIO PROBLEMAS ECOLÓGICOS, ESCUELA DE ESTUDIOS GENERALES, EN LA UNIVERSIDAD DE COSTA RICA

    Directory of Open Access Journals (Sweden)

    Ana Patricia Jiménez Morales

    2009-01-01

    Full Text Available Durante el primer semestre del 2007, se realizó un estudio para evaluar la opinión de los estudiantes del Repertorio de Problemas Ecológicos, de la Escuela de Estudios Generales de la Universidad de Costa Rica, 155 estudiantes fueron entrevistados después de participar en una gira de estudio como una actividad del curso. El objetivo de la investigación fue indagar la importancia de las giras al campo como apoyo a su formación profesional, así como promotora de un cambio de concepción de mundo en su relación con el ambiente. Además, era de interés evaluar la presencia del curso en el ámbito universitario debido a que es un curso de repertorio dirigido a estudiante de carreras diferentes a las ciencias básicas. Como resultado de la investigación se obtuvo que la mayoría de los entrevistados (70.97% ve la gira importante en su formación profesional, pues les permite una educación integral. Además, esta práctica le permitió al 65.8% de los participantes cambiar su concepción de mundo en relación con el ambiente y a un 19.35% reafirmar sus creencias, permitiéndoles observar personalmente lo que ya conocían en forma teórica. A nivel Universitario se comprobó que el curso tiene una presencia importante, los estudiantes que participaron como informantes pertenecían a 44 carreras de 12 facultades distintas.

  20. Estudio de la legislación ambiental en licencias de dragados de puertos en Brasil y España. Estudio de caso

    OpenAIRE

    VIÑES BERNARDO, MARGARITA

    2011-01-01

    Este TFC consistirá en la realización de un estudio de la legislación ambiental existente en relación al dragado de puertos en Brasil y en España, en el análisis de los procesos de licenciamiento y de la metodología de la monitorización del dragado aplicada en un estudio de caso. Viñes Bernardo, M. (2011). Estudio de la legislación ambiental en licencias de dragados de puertos en Brasil y España. Estudio de caso. http://hdl.handle.net/10251/10344. Archivo delegado