WorldWideScience

Sample records for integrated specificity hypothesis

  1. Economic Integration and the Civilizing Commerce Hypothesis

    OpenAIRE

    James E. Anderson

    2005-01-01

    Economic integration lowers one form of trade costs, tariffs, and stimulates changes in other trade costs. This paper offers a model in which integration may raise or lower the important trade cost associated with insecurity. The model can help to explain the varied experience with integration and it points to the usefulness of combining enforcement policy integration with trade policy integration.

  2. A test of the domain-specific acculturation strategy hypothesis.

    Science.gov (United States)

    Miller, Matthew J; Yang, Minji; Lim, Robert H; Hui, Kayi; Choi, Na-Yeun; Fan, Xiaoyan; Lin, Li-Ling; Grome, Rebekah E; Farrell, Jerome A; Blackmon, Sha'kema

    2013-01-01

    Acculturation literature has evolved over the past several decades and has highlighted the dynamic ways in which individuals negotiate experiences in multiple cultural contexts. The present study extends this literature by testing M. J. Miller and R. H. Lim's (2010) domain-specific acculturation strategy hypothesis-that individuals might use different acculturation strategies (i.e., assimilated, bicultural, separated, and marginalized strategies; J. W. Berry, 2003) across behavioral and values domains-in 3 independent cluster analyses with Asian American participants. Present findings supported the domain-specific acculturation strategy hypothesis as 67% to 72% of participants from 3 independent samples using different strategies across behavioral and values domains. Consistent with theory, a number of acculturation strategy cluster group differences emerged across generational status, acculturative stress, mental health symptoms, and attitudes toward seeking professional psychological help. Study limitations and future directions for research are discussed.

  3. Mismatch or cumulative stress : Toward an integrated hypothesis of programming effects

    NARCIS (Netherlands)

    Nederhof, Esther; Schmidt, Mathias V.

    2012-01-01

    This paper integrates the cumulative stress hypothesis with the mismatch hypothesis, taking into account individual differences in sensitivity to programming. According to the cumulative stress hypothesis, individuals are more likely to suffer from disease as adversity accumulates. According to the

  4. An Integrated Hypothesis on the Domestication of Bactris gasipaes.

    Science.gov (United States)

    Galluzzi, Gea; Dufour, Dominique; Thomas, Evert; van Zonneveld, Maarten; Escobar Salamanca, Andrés Felipe; Giraldo Toro, Andrés; Rivera, Andrés; Salazar Duque, Hector; Suárez Baron, Harold; Gallego, Gerardo; Scheldeman, Xavier; Gonzalez Mejia, Alonso

    2015-01-01

    Peach palm (Bactris gasipaes Kunth) has had a central place in the livelihoods of people in the Americas since pre-Columbian times, notably for its edible fruits and multi-purpose wood. The botanical taxon includes both domesticated and wild varieties. Domesticated var gasipaes is believed to derive from one or more of the three wild types of var. chichagui identified today, although the exact dynamics and location of the domestication are still uncertain. Drawing on a combination of molecular and phenotypic diversity data, modeling of past climate suitability and existing literature, we present an integrated hypothesis about peach palm's domestication. We support a single initial domestication event in south western Amazonia, giving rise to var. chichagui type 3, the putative incipient domesticate. We argue that subsequent dispersal by humans across western Amazonia, and possibly into Central America allowed for secondary domestication events through hybridization with resident wild populations, and differential human selection pressures, resulting in the diversity of present-day landraces. The high phenotypic diversity in the Ecuadorian and northern Peruvian Amazon suggest that human selection of different traits was particularly intense there. While acknowledging the need for further data collection, we believe that our results contribute new insights and tools to understand domestication and dispersal patterns of this important native staple, as well as to plan for its conservation.

  5. Oncology In Vivo Data Integration for Hypothesis Generation

    Directory of Open Access Journals (Sweden)

    Wei Jia

    2012-06-01

    Full Text Available AstraZeneca’s Oncology in vivo data integration platform brings multidimensional data from animal model efficacy, pharmacokinetic and pharmacodynamic data to animal model profiling data and public in vivo studies. Using this platform, scientists can cluster model efficacy and model profiling data together, quickly identify responder profiles and correlate molecular characteristics to pharmacological response. Through meta-analysis, scientists can compare pharmacology between single and combination treatments, between different drug scheduling and administration routes.

  6. Development of an Online and Offline Integration Hypothesis for Healthy Internet Use: Theory and Preliminary Evidence.

    Science.gov (United States)

    Lin, Xiaoyan; Su, Wenliang; Potenza, Marc N

    2018-01-01

    The Internet has become an integral part of our daily life, and how to make the best use of the Internet is important to both individuals and the society. Based on previous studies, an Online and Offline Integration Hypothesis is proposed to suggest a framework for considering harmonious and balanced Internet use. The Integration Hypothesis proposes that healthier patterns of Internet usage may be achieved through harmonious integration of people's online and offline worlds. An online/offline integration is proposed to unite self-identity, interpersonal relationships, and social functioning with both cognitive and behavioral aspects by following the principles of communication, transfer, consistency, and "offline-first" priorities. To begin to test the hypothesis regarding the relationship between integration level and psychological outcomes, data for the present study were collected from 626 undergraduate students (41.5% males). Participants completed scales for online and offline integration, Internet addiction, pros and cons of Internet use, loneliness, extraversion, and life satisfaction. The findings revealed that subjects with higher level of online/offline integration have higher life satisfaction, greater extraversion, and more positive perceptions of the Internet and less loneliness, lower Internet addiction, and fewer negative perceptions of the Internet. Integration mediates the link between extraversion and psychological outcomes, and it may be the mechanism underlying the difference between the "rich get richer" and social compensation hypotheses. The implications of the online and offline integration hypothesis are discussed.

  7. Development of an Online and Offline Integration Hypothesis for Healthy Internet Use: Theory and Preliminary Evidence

    Directory of Open Access Journals (Sweden)

    Xiaoyan Lin

    2018-04-01

    Full Text Available The Internet has become an integral part of our daily life, and how to make the best use of the Internet is important to both individuals and the society. Based on previous studies, an Online and Offline Integration Hypothesis is proposed to suggest a framework for considering harmonious and balanced Internet use. The Integration Hypothesis proposes that healthier patterns of Internet usage may be achieved through harmonious integration of people’s online and offline worlds. An online/offline integration is proposed to unite self-identity, interpersonal relationships, and social functioning with both cognitive and behavioral aspects by following the principles of communication, transfer, consistency, and “offline-first” priorities. To begin to test the hypothesis regarding the relationship between integration level and psychological outcomes, data for the present study were collected from 626 undergraduate students (41.5% males. Participants completed scales for online and offline integration, Internet addiction, pros and cons of Internet use, loneliness, extraversion, and life satisfaction. The findings revealed that subjects with higher level of online/offline integration have higher life satisfaction, greater extraversion, and more positive perceptions of the Internet and less loneliness, lower Internet addiction, and fewer negative perceptions of the Internet. Integration mediates the link between extraversion and psychological outcomes, and it may be the mechanism underlying the difference between the “rich get richer” and social compensation hypotheses. The implications of the online and offline integration hypothesis are discussed.

  8. Development of an Online and Offline Integration Hypothesis for Healthy Internet Use: Theory and Preliminary Evidence

    Science.gov (United States)

    Lin, Xiaoyan; Su, Wenliang; Potenza, Marc N.

    2018-01-01

    The Internet has become an integral part of our daily life, and how to make the best use of the Internet is important to both individuals and the society. Based on previous studies, an Online and Offline Integration Hypothesis is proposed to suggest a framework for considering harmonious and balanced Internet use. The Integration Hypothesis proposes that healthier patterns of Internet usage may be achieved through harmonious integration of people’s online and offline worlds. An online/offline integration is proposed to unite self-identity, interpersonal relationships, and social functioning with both cognitive and behavioral aspects by following the principles of communication, transfer, consistency, and “offline-first” priorities. To begin to test the hypothesis regarding the relationship between integration level and psychological outcomes, data for the present study were collected from 626 undergraduate students (41.5% males). Participants completed scales for online and offline integration, Internet addiction, pros and cons of Internet use, loneliness, extraversion, and life satisfaction. The findings revealed that subjects with higher level of online/offline integration have higher life satisfaction, greater extraversion, and more positive perceptions of the Internet and less loneliness, lower Internet addiction, and fewer negative perceptions of the Internet. Integration mediates the link between extraversion and psychological outcomes, and it may be the mechanism underlying the difference between the “rich get richer” and social compensation hypotheses. The implications of the online and offline integration hypothesis are discussed. PMID:29706910

  9. The Integration Hypothesis of Human Language Evolution and the Nature of Contemporary Languages

    Directory of Open Access Journals (Sweden)

    Shigeru eMiyagawa

    2014-06-01

    Full Text Available How human language arose is a mystery in the evolution of Homo sapiens. Miyagawa, Berwick, & Okanoya (Frontiers 2013 put forward a proposal, which we will call the Integration Hypothesis of human language evolution, which holds that human language is composed of two components, E for expressive, and L for lexical. Each component has an antecedent in nature: E as found, for example, in birdsong, and L in, for example, the alarm calls of monkeys. E and L integrated uniquely in humans to give rise to language. A challenge to the Integration Hypothesis is that while these non-human systems are finite-state in nature, human language is known to require characterization by a non-finite state grammar. Our claim is that E and L, taken separately, are finite-state; when a grammatical process crosses the boundary between E and L, it gives rise to the non-finite state character of human language. We provide empirical evidence for the Integration Hypothesis by showing that certain processes found in contemporary languages that have been characterized as non-finite state in nature can in fact be shown to be finite-state. We also speculate on how human language actually arose in evolution through the lens of the Integration Hypothesis.

  10. Predictive capabilities of the specific activity hypothesis for Cs and Zn in freshwater systems

    International Nuclear Information System (INIS)

    Seelye, J.G.

    1975-01-01

    Predictions of radioisotope concentrations in components of aquatic systems have been attempted using the specific activity concept, an approach that seems theoretically sound. A comprehensive examination of the specific activities of 134 Cs and 65 Zn in the components of a freshwater system, over a 10 month period, was conducted to evaluate the specific activity hypothesis under applied conditions. This study was designed to provide comparisons of predicted and observed specific activities and to test the equivalence of specific activities between all components of the system. One dose of radioisotopes was added to the system in this study and even after 10 months these radioisotopes were not distributed similarly to the stable isotopes. This suggests that the time necessary to reach a specific activity equilibrium might be a matter of years rather than months. More importantly, in natural systems, where the radioisotope addition is continuous a specific activity equilibrium may never be achieved. These things plus the non-conservative nature of the 134 Cs and 65 Zn predicted concentrations indicates that the use of the specific activity concept for predicting radioisotope concentrations of Cs and Zn in freshwater systems is questionable. A more rigorous approach must be used, considering isotope transfer rates between components and the complexity of the system. Problems with statistical comparisons of derived variables, such as specific activities, are discussed and were considered in interpreting the results of this study

  11. [Specificity hypothesis of a theory of mind deficit in early childhood autism].

    Science.gov (United States)

    Kissgen, R; Schleiffer, R

    2002-02-01

    In order to test the hypothesis that a theory of mind deficit is specific for autism, the present study presents the first replication of the Sally-Anne test (Baron-Cohen, Leslie & Frith, 1985) in the German-speaking countries. The Sally-Anne test was administered to 16 autistic, 24 probands with Down's syndrome and 20 normal preschool prosands. The intelligence of the autistic group and that with Down's syndrome was measured by the CPM/SPM. In addition, the ADI-R was used with the principal caregivers of the autistic and Down's syndrome subjects. With regard to the clinical diagnosis, theory of mind deficit turned out to be not specific for autism. Six of 16 (37.5%) autistic subjects passed the theory of mind tasks. Thus performance in the autistic group surpassed that of both control groups. Out of 16 autistic subjects, autism could be confirmed in only 8 on the basis of the ADI-R diagnostic criteria, only one of whom showed a theory of mind. The autistic individuals with a theory of mind differed significantly in their mean IQ from those without this ability. Spectrum and specificity of a theory of mind deficit in autism remain controversial. For further research it seems important to administer the ADI-R during the diagnostic process. The findings suggest that the clinical diagnosis of autism is not precise enough to distinguish between autism and nonautistic mental handicap.

  12. A double-integration hypothesis to explain ocean ecosystem response to climate forcing

    Science.gov (United States)

    Di Lorenzo, Emanuele; Ohman, Mark D.

    2013-01-01

    Long-term time series of marine ecological indicators often are characterized by large-amplitude state transitions that can persist for decades. Understanding the significance of these variations depends critically on the underlying hypotheses characterizing expected natural variability. Using a linear autoregressive model in combination with long-term zooplankton observations off the California coast, we show that cumulative integrations of white-noise atmospheric forcing can generate marine population responses that are characterized by strong transitions and prolonged apparent state changes. This model provides a baseline hypothesis for explaining ecosystem variability and for interpreting the significance of abrupt responses and climate change signatures in marine ecosystems. PMID:23341628

  13. Testing Fiscal Dominance Hypothesis in a Structural VAR Specification for Pakistan

    Directory of Open Access Journals (Sweden)

    Shaheen Rozina

    2018-03-01

    Full Text Available This research aims to test the fiscal dominance hypothesis for Pakistan through a bivariate structural vector auto regression (SVAR specification, covering time period 1977 – 2016. This study employs real primary deficit (non interest government expenditures minus total revenues and real primary liabilities (sum of monetary base and domestic public debt as indicators of fiscal measures and monetary policy respectively. A structural VAR is retrieved both for entire sample period and four sub periods (1977 – 1986, 1987 – 1997, 1998 – 2008, and 2009 – 2016. This study identifies the presence of fiscal dominance for the entire sample period and the sub period from 1987 – 2008. The estimates reveal an interesting phenomenon that fiscal dominance is significant in the elected regimes and weaker in the presence of military regimes in Pakistan. From a policy perspective, this research suggests increased autonomy of central bank to achieve long term price stability and reduced administration costs to ensure efficient democratic regime in Pakistan.

  14. Multi-Hypothesis Modelling Capabilities for Robust Data-Model Integration

    Science.gov (United States)

    Walker, A. P.; De Kauwe, M. G.; Lu, D.; Medlyn, B.; Norby, R. J.; Ricciuto, D. M.; Rogers, A.; Serbin, S.; Weston, D. J.; Ye, M.; Zaehle, S.

    2017-12-01

    Large uncertainty is often inherent in model predictions due to imperfect knowledge of how to describe the mechanistic processes (hypotheses) that a model is intended to represent. Yet this model hypothesis uncertainty (MHU) is often overlooked or informally evaluated, as methods to quantify and evaluate MHU are limited. MHU is increased as models become more complex because each additional processes added to a model comes with inherent MHU as well as parametric unceratinty. With the current trend of adding more processes to Earth System Models (ESMs), we are adding uncertainty, which can be quantified for parameters but not MHU. Model inter-comparison projects do allow for some consideration of hypothesis uncertainty but in an ad hoc and non-independent fashion. This has stymied efforts to evaluate ecosystem models against data and intepret the results mechanistically because it is not simple to interpret exactly why a model is producing the results it does and identify which model assumptions are key as they combine models of many sub-systems and processes, each of which may be conceptualised and represented mathematically in various ways. We present a novel modelling framework—the multi-assumption architecture and testbed (MAAT)—that automates the combination, generation, and execution of a model ensemble built with different representations of process. We will present the argument that multi-hypothesis modelling needs to be considered in conjunction with other capabilities (e.g. the Predictive Ecosystem Analyser; PecAn) and statistical methods (e.g. sensitivity anaylsis, data assimilation) to aid efforts in robust data model integration to enhance our predictive understanding of biological systems.

  15. The evaluation-mediation hypothesis: does the specification of potential side effects influence the perceived risk of medication?

    International Nuclear Information System (INIS)

    Reimer, T.

    1998-01-01

    Full text of publication follows: starting from the assumptions of support theory, this project analyzed the extent to which the specification of potential side effects influences the perceived risk associated, with a particular medication. Respondents were presented with an instruction leaflet for a medication which indicated (a) the overall probability that a side effect will occur or (b) the probability of occurrence of several specific side effects. Support theory predicts that the cognitive availability of potential side effects and therefore the perceived risk increases as a function of the specificity with which the side effects are presented. In contrast the evaluation-mediation hypothesis predicts that a more detailed presentation of potential side effects enhances the perceived quality of the information leaflet and thereby leads to a reduction of perceived risk. Support for the evaluation-mediation hypothesis was found in a series of studies which included the editing hypothesis and the elaboration likelihood model as additional explanations: the more detailed the information about potential side effects, the lower the estimated risk of suffering a side effect on taking the medication. As predicted, the influence of presentation specificity on perceived risk was mediated almost exclusively by the perceived quality of the information leaflet. A current series of studies seeks to support the evaluation-mediation hypothesis in a completely different domain, the perceived risk of environmental pollution by motor vehicles. (author)

  16. RD53A Integrated Circuit Specifications

    OpenAIRE

    Garcia-Sciveres, Mauricio

    2015-01-01

    Specifications for the RD53 collaboration’s first engineering wafer run of an integrated circuit (IC) for hybrid pixel detector readout, called RD53A. RD53A is intended to demonstrate in a large format IC the suitability of the technology (including radiation tolerance), the stable low threshold operation, and the high hit and trigger rate capabilities, required for HL-LHC upgrades of ATLAS and CMS. The wafer scale production will permit the experiments to prototype bump bonding assembly with...

  17. In Search of Integrated Specificity: Comment on Denson, Spanovic, and Miller (2009)

    Science.gov (United States)

    Miller, Gregory E.

    2009-01-01

    Psychologists have long been interested in the integrated specificity hypothesis, which maintains that stressors elicit fairly distinct behavioral, emotional, and biological responses that are molded by selective pressures to meet specific demands from the environment. This issue of "Psychological Bulletin" features a meta-analytic review of the…

  18. UV-radiation-induced electron emission by hormones. Hypothesis for specific communication mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Getoff, Nikola [University of Vienna, Department of Nutritional Sciences, Section Radiation Biology, Althanstr. 14, UZAII, A-1090 Vienna (Austria)], E-mail: nikola.getoff@univie.ac.at

    2009-11-15

    The highlights of recently observed electron emission from electronically excited sexual hormones (17{beta}-estradiol, progesterone, testosterone) and the phytohormone genistein in polar media are briefly reviewed. The electron yield, Q(e{sub aq}{sup -}), dependence from substrate concentration, hormone structure, polarity of solvent, absorbed energy and temperature are discussed. The hormones reactivity with e{sub aq}{sup -} and efficiency in electron transfer ensure them the ability to communicate with other biological systems in an organism. A hypothesis is presented for the explanation of the mechanisms of the distinct recognition of signals transmitted by electrons, originating from different types of hormones to receiving centres. Biological consequences of the electron emission in respect to cancer are mentioned.

  19. Executable specifications for hypothesis-based reasoning with Prolog and Constraint Handling Rules

    DEFF Research Database (Denmark)

    Christiansen, Henning

    2009-01-01

    Constraint Handling Rules (CHR) is an extension to Prolog which opens up a  spectrum of hypotheses-based reasoning in logic programs without additional interpretation overhead. Abduction with integrity constraints is one example of hypotheses-based reasoning which can be implemented directly...... in Prolog and CHR with a straightforward use of available and efficiently implemented facilities The present paper clarifies the semantic foundations for this way of doing abduction in CHR and Prolog as well as other examples  of hypotheses-based reasoning that is possible, including assumptive logic...

  20. RD53A Integrated Circuit Specifications

    CERN Document Server

    Garcia-Sciveres, Mauricio

    2015-01-01

    Specifications for the RD53 collaboration’s first engineering wafer run of an integrated circuit (IC) for hybrid pixel detector readout, called RD53A. RD53A is intended to demonstrate in a large format IC the suitability of the technology (including radiation tolerance), the stable low threshold operation, and the high hit and trigger rate capabilities, required for HL-LHC upgrades of ATLAS and CMS. The wafer scale production will permit the experiments to prototype bump bonding assembly with realistic sensors in this new technology and to measure the performance of hybrid assemblies. RD53A is not intended to be a final production IC for use in an experiment, and will contain design variations for testing purposes, making the pixel matrix non-uniform.

  1. Mild anastomotic stenosis in patient-specific CABG model may enhance graft patency: a new hypothesis.

    Directory of Open Access Journals (Sweden)

    Yunlong Huo

    Full Text Available It is well known that flow patterns at the anastomosis of coronary artery bypass graft (CABG are complex and may affect the long-term patency. Various attempts at optimal designs of anastomosis have not improved long-term patency. Here, we hypothesize that mild anastomotic stenosis (area stenosis of about 40-60% may be adaptive to enhance the hemodynamic conditions, which may contribute to slower progression of atherosclerosis. We further hypothesize that proximal/distal sites to the stenosis have converse changes that may be a risk factor for the diffuse expansion of atherosclerosis from the site of stenosis. Twelve (12 patient-specific models with various stenotic degrees were extracted from computed tomography images using a validated segmentation software package. A 3-D finite element model was used to compute flow patterns including wall shear stress (WSS and its spatial and temporal gradients (WSS gradient, WSSG, and oscillatory shear index, OSI. The flow simulations showed that mild anastomotic stenosis significantly increased WSS (>15 dynes · cm(-2 and decreased OSI (<0.02 to result in a more uniform distribution of hemodynamic parameters inside anastomosis albeit proximal/distal sites to the stenosis have a decrease of WSS (<4 dynes · cm(-2. These findings have significant implications for graft adaptation and long-term patency.

  2. Mild anastomotic stenosis in patient-specific CABG model may enhance graft patency: a new hypothesis.

    Science.gov (United States)

    Huo, Yunlong; Luo, Tong; Guccione, Julius M; Teague, Shawn D; Tan, Wenchang; Navia, José A; Kassab, Ghassan S

    2013-01-01

    It is well known that flow patterns at the anastomosis of coronary artery bypass graft (CABG) are complex and may affect the long-term patency. Various attempts at optimal designs of anastomosis have not improved long-term patency. Here, we hypothesize that mild anastomotic stenosis (area stenosis of about 40-60%) may be adaptive to enhance the hemodynamic conditions, which may contribute to slower progression of atherosclerosis. We further hypothesize that proximal/distal sites to the stenosis have converse changes that may be a risk factor for the diffuse expansion of atherosclerosis from the site of stenosis. Twelve (12) patient-specific models with various stenotic degrees were extracted from computed tomography images using a validated segmentation software package. A 3-D finite element model was used to compute flow patterns including wall shear stress (WSS) and its spatial and temporal gradients (WSS gradient, WSSG, and oscillatory shear index, OSI). The flow simulations showed that mild anastomotic stenosis significantly increased WSS (>15 dynes · cm(-2)) and decreased OSI (<0.02) to result in a more uniform distribution of hemodynamic parameters inside anastomosis albeit proximal/distal sites to the stenosis have a decrease of WSS (<4 dynes · cm(-2)). These findings have significant implications for graft adaptation and long-term patency.

  3. Testing the environmental Kuznets curve hypothesis with bird populations as habitat-specific environmental indicators: evidence from Canada.

    Science.gov (United States)

    Lantz, Van; Martínez-Espiñeira, Roberto

    2008-04-01

    The traditional environmental Kuznets curve (EKC) hypothesis postulates that environmental degradation follows an inverted U-shaped relationship with gross domestic product (GDP) per capita. We tested the EKC hypothesis with bird populations in 5 different habitats as environmental quality indicators. Because birds are considered environmental goods, for them the EKC hypothesis would instead be associated with a U-shaped relationship between bird populations and GDP per capita. In keeping with the literature, we included other variables in the analysis-namely, human population density and time index variables (the latter variable captured the impact of persistent and exogenous climate and/or policy changes on bird populations over time). Using data from 9 Canadian provinces gathered over 37 years, we used a generalized least-squares regression for each bird habitat type, which accounted for the panel structure of the data, the cross-sectional dependence across provinces in the residuals, heteroskedasticity, and fixed- or random-effect specifications of the models. We found evidence that supports the EKC hypothesis for 3 of the 5 bird population habitat types. In addition, the relationship between human population density and the different bird populations varied, which emphasizes the complex nature of the impact that human populations have on the environment. The relationship between the time-index variable and the different bird populations also varied, which indicates there are other persistent and significant influences on bird populations over time. Overall our EKC results were consistent with those found for threatened bird species, indicating that economic prosperity does indeed act to benefit some bird populations.

  4. A CNN-Specific Integrated Processor

    Directory of Open Access Journals (Sweden)

    Suleyman Malki

    2009-01-01

    Full Text Available Integrated Processors (IP are algorithm-specific cores that either by programming or by configuration can be re-used within many microelectronic systems. This paper looks at Cellular Neural Networks (CNN to become realized as IP. First current digital implementations are reviewed, and the memoryprocessor bandwidth issues are analyzed. Then a generic view is taken on the structure of the network, and a new intra-communication protocol based on rotating wheels is proposed. It is shown that this provides for guaranteed high-performance with a minimal network interface. The resulting node is small and supports multi-level CNN designs, giving the system a 30-fold increase in capacity compared to classical designs. As it facilitates multiple operations on a single image, and single operations on multiple images, with minimal access to the external image memory, balancing the internal and external data transfer requirements optimizes the system operation. In conventional digital CNN designs, the treatment of boundary nodes requires additional logic to handle the CNN value propagation scheme. In the new architecture, only a slight modification of the existing cells is necessary to model the boundary effect. A typical prototype for visual pattern recognition will house 4096 CNN cells with a 2% overhead for making it an IP.

  5. The status-legitimacy hypothesis revisited: Ethnic-group differences in general and dimension-specific legitimacy.

    Science.gov (United States)

    Sengupta, Nikhil K; Osborne, Danny; Sibley, Chris G

    2015-06-01

    The status-legitimacy hypothesis, which predicts that low-status groups will legitimize inequality more than high-status groups, has received inconsistent empirical support. To resolve this inconsistency, we hypothesized that low-status groups would display enhanced legitimation only when evaluating the fairness of the specific hierarchy responsible for their disadvantage. In a New Zealand-based probability sample (N = 6,162), we found that low-status ethnic groups (Asians and Pacific Islanders) perceived ethnic-group relations to be fairer than the high-status group (Europeans). However, these groups did not justify the overall political system more than the high-status group. In fact, Māori showed the least support for the political system. These findings clarify when the controversial status-legitimacy effects predicted by System Justification Theory will - and will not - emerge. © 2014 The British Psychological Society.

  6. Dynamic heterogeneity: a framework to promote ecological integration and hypothesis generation in urban systems

    Science.gov (United States)

    S. T. A. Pickett; M. L. Cadenasso; E. J. Rosi-Marshall; Ken Belt; P. M. Groffman; Morgan Grove; E. G. Irwin; S. S. Kaushal; S. L. LaDeau; C. H. Nilon; C. M. Swan; P. S. Warren

    2016-01-01

    Urban areas are understood to be extraordinarily spatially heterogeneous. Spatial heterogeneity, and its causes, consequences, and changes, are central to ecological science. The social sciences and urban design and planning professions also include spatial heterogeneity as a key concern. However, urban ecology, as a pursuit that integrates across these disciplines,...

  7. The Vitamin D–Folate Hypothesis as an Evolutionary Model for Skin Pigmentation: An Update and Integration of Current Ideas

    Directory of Open Access Journals (Sweden)

    Patrice Jones

    2018-04-01

    Full Text Available Vitamin D is unique in being generated in our skin following ultraviolet radiation (UVR exposure. Ongoing research into vitamin D must therefore always consider the influence of UVR on vitamin D processes. The close relationship between vitamin D and UVR forms the basis of the “vitamin D–folate hypothesis”, a popular theory for why human skin colour has evolved as an apparent adaption to UVR environments. Vitamin D and folate have disparate sensitivities to UVR; whilst vitamin D may be synthesised following UVR exposure, folate may be degraded. The vitamin D–folate hypothesis proposes that skin pigmentation has evolved as a balancing mechanism, maintaining levels of these vitamins. There are several alternative theories that counter the vitamin D–folate hypothesis. However, there is significant overlap between these theories and the now known actions of vitamin D and folate in the skin. The focus of this review is to present an update on the vitamin D–folate hypothesis by integrating these current theories and discussing new evidence that supports associations between vitamin D and folate genetics, UVR, and skin pigmentation. In light of recent human migrations and seasonality in disease, the need for ongoing research into potential UVR-responsive processes within the body is also discussed.

  8. In search of integrated specificity: comment on Denson, Spanovic, and Miller (2009).

    Science.gov (United States)

    Miller, Gregory E

    2009-11-01

    Psychologists have long been interested in the integrated specificity hypothesis, which maintains that stressors elicit fairly distinct behavioral, emotional, and biological responses that are molded by selective pressures to meet specific demands from the environment. This issue of Psychological Bulletin features a meta-analytic review of the evidence for this proposition by T. F. Denson, M. Spanovic, and N. Miller. Their review concluded that the meta-analytic findings support the "core concept behind the integrated specificity model" (p. 845) and reveal that "within the context of a stressful event, organisms produce an integrated and coordinated response at multiple levels (i.e., cognitive, emotional, physiological)" (p. 845). I argue that conclusions such as this are unwarranted, given the data. Aside from some effects for cortisol, little evidence of specificity was presented, and most of the significant findings reported would be expected by chance alone. I also contend that Denson et al. failed to consider some important sources of evidence bearing on the specificity hypothesis, particularly how appraisals and emotions couple with autonomic nervous system endpoints and functional indices of immune response. If selective pressures did give rise to an integrated stress response, such pathways almost certainly would have been involved. By omitting such outcomes from the meta-analysis, Denson et al. overlooked what are probably the most definitive tests of the specificity hypothesis. As a result, the field is back where it started: with a lot of affection for the concept of integrated specificity but little in the way of definitive evidence to refute or accept it.

  9. Context-specific effects of musical expertise on audiovisual integration

    Science.gov (United States)

    Bishop, Laura; Goebl, Werner

    2014-01-01

    Ensemble musicians exchange auditory and visual signals that can facilitate interpersonal synchronization. Musical expertise improves how precisely auditory and visual signals are perceptually integrated and increases sensitivity to asynchrony between them. Whether expertise improves sensitivity to audiovisual asynchrony in all instrumental contexts or only in those using sound-producing gestures that are within an observer's own motor repertoire is unclear. This study tested the hypothesis that musicians are more sensitive to audiovisual asynchrony in performances featuring their own instrument than in performances featuring other instruments. Short clips were extracted from audio-video recordings of clarinet, piano, and violin performances and presented to highly-skilled clarinetists, pianists, and violinists. Clips either maintained the audiovisual synchrony present in the original recording or were modified so that the video led or lagged behind the audio. Participants indicated whether the audio and video channels in each clip were synchronized. The range of asynchronies most often endorsed as synchronized was assessed as a measure of participants' sensitivities to audiovisual asynchrony. A positive relationship was observed between musical training and sensitivity, with data pooled across stimuli. While participants across expertise groups detected asynchronies most readily in piano stimuli and least readily in violin stimuli, pianists showed significantly better performance for piano stimuli than for either clarinet or violin. These findings suggest that, to an extent, the effects of expertise on audiovisual integration can be instrument-specific; however, the nature of the sound-producing gestures that are observed has a substantial effect on how readily asynchrony is detected as well. PMID:25324819

  10. Recognition of facial expressions of emotion by adults with intellectual disability: Is there evidence for the emotion specificity hypothesis?

    Science.gov (United States)

    Scotland, Jennifer L; McKenzie, Karen; Cossar, Jill; Murray, Aja; Michie, Amanda

    2016-01-01

    This study aimed to evaluate the emotion recognition abilities of adults (n=23) with an intellectual disability (ID) compared with a control group of children (n=23) without ID matched for estimated cognitive ability. The study examined the impact of: task paradigm, stimulus type and preferred processing style (global/local) on accuracy. We found that, after controlling for estimated cognitive ability, the control group performed significantly better than the individuals with ID. This provides some support for the emotion specificity hypothesis. Having a more local processing style did not significantly mediate the relation between having ID and emotion recognition, but did significantly predict emotion recognition ability after controlling for group. This suggests that processing style is related to emotion recognition independently of having ID. The availability of contextual information improved emotion recognition for people with ID when compared with line drawing stimuli, and identifying a target emotion from a choice of two was relatively easier for individuals with ID, compared with the other task paradigms. The results of the study are considered in the context of current theories of emotion recognition deficits in individuals with ID. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Action observation and motor imagery for rehabilitation in Parkinson's disease: A systematic review and an integrative hypothesis.

    Science.gov (United States)

    Caligiore, Daniele; Mustile, Magda; Spalletta, Gianfranco; Baldassarre, Gianluca

    2017-01-01

    This article discusses recent evidence supporting the use of action observation therapy and motor imagery practice for rehabilitation of Parkinson's disease. A main question that emerges from the review regards the different effectiveness of these approaches and the possibility of integrating them into a single method to enhance motor behaviour in subjects with Parkinson's disease. In particular, the reviewed studies suggest that action observation therapy can have a positive effect on motor facilitation of patients and that a long-term rehabilitation program based on action observation therapy or motor imagery practice can bring some benefit on their motor recovery. Moreover, the paper discusses how the research on the combined use of action observation and motor imagery for motor improvements in healthy subjects may encourage the combined use of action observation therapy and motor imagery practice for therapeutic aims in Parkinson's disease. To date, this hypothesis has never been experimented. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Examination of integration and central market hypothesis for saffron market in khorasan razavi, northern khorasan and southern khorasan

    Directory of Open Access Journals (Sweden)

    Alireza Karbasi

    2014-10-01

    Full Text Available Saffron is one of the important agricultural product and North Khorasan, Razavi and South is considered as the major producers in Iran. In this study Central Market Hypothesis or price leadership has been examined. For this purpose Johanson Co-integration test for monthly price data since 2006 to 2011 for these provinces has been used. Main results indicated that South Khorasan is a price leader between these provinces. In addition, saffron market is unit in South Khorasan and Khorasan Razavi and the law of one price is indefeasible. Moreover, North Khorasan has a separate market and in long run saffron market in this province is not an impressible market. The adoption of a policy on each of the three provinces, affects the other two the product market provinces.

  13. Electrophysiological evidence for speech-specific audiovisual integration

    NARCIS (Netherlands)

    Baart, M.; Stekelenburg, J.J.; Vroomen, J.

    2014-01-01

    Lip-read speech is integrated with heard speech at various neural levels. Here, we investigated the extent to which lip-read induced modulations of the auditory N1 and P2 (measured with EEG) are indicative of speech-specific audiovisual integration, and we explored to what extent the ERPs were

  14. Speech-specificity of two audiovisual integration effects

    DEFF Research Database (Denmark)

    Eskelund, Kasper; Tuomainen, Jyrki; Andersen, Tobias

    2010-01-01

    Seeing the talker’s articulatory mouth movements can influence the auditory speech percept both in speech identification and detection tasks. Here we show that these audiovisual integration effects also occur for sine wave speech (SWS), which is an impoverished speech signal that naïve observers...... often fail to perceive as speech. While audiovisual integration in the identification task only occurred when observers were informed of the speech-like nature of SWS, integration occurred in the detection task both for informed and naïve observers. This shows that both speech-specific and general...... mechanisms underlie audiovisual integration of speech....

  15. An Integrated Framework to Specify Domain-Specific Modeling Languages

    DEFF Research Database (Denmark)

    Zarrin, Bahram; Baumeister, Hubert

    2018-01-01

    , a logic-based specification language. The drawback of MS DSL Tools is it does not provide a formal and rigorous approach for semantics specifications. In this framework, we use Microsoft DSL Tools to define the metamodel and graphical notations of DSLs, and an extended version of ForSpec as a formal......In this paper, we propose an integrated framework that can be used by DSL designers to implement their desired graphical domain-specific languages. This framework relies on Microsoft DSL Tools, a meta-modeling framework to build graphical domain-specific languages, and an extension of ForSpec...... language to define their semantics. Integrating these technologies under the umbrella of Microsoft Visual Studio IDE allows DSL designers to utilize a single development environment for developing their desired domain-specific languages....

  16. Integrated flight/propulsion control - Subsystem specifications for performance

    Science.gov (United States)

    Neighbors, W. K.; Rock, Stephen M.

    1993-01-01

    A procedure is presented for calculating multiple subsystem specifications given a number of performance requirements on the integrated system. This procedure applies to problems where the control design must be performed in a partitioned manner. It is based on a structured singular value analysis, and generates specifications as magnitude bounds on subsystem uncertainties. The performance requirements should be provided in the form of bounds on transfer functions of the integrated system. This form allows the expression of model following, command tracking, and disturbance rejection requirements. The procedure is demonstrated on a STOVL aircraft design.

  17. Neutrophil glycoprotein Mo1 is an integral membrane protein of plasma membranes and specific granules

    International Nuclear Information System (INIS)

    Stevenson, K.B.; Nauseef, W.M.; Clark, R.A.

    1987-01-01

    The glucoprotein Mo1 has previously been demonstrated to be on the cell surface and in the specific granule fraction of neutrophils and to be translocated to the cell surface during degranulation. It is not known, however, whether Mo1 is an integral membrane protein or a soluble, intragranular constituent loosely associated with the specific granule membrane. Purified neutrophils were disrupted by nitrogen cavitation and separated on Percoll density gradients into four fractions enriched for azurophilic granules, specific granules, plasma membrane, and cytosol, respectively. The glycoproteins in these fractions were labeled with 3 H-borohydride reduction, extracted with Triton X-114, and immunoprecipitated with 60.3, an anti-Mo1 monoclonal antibody. Mo1 was detected only in the specific granule and plasma membrane fractions and partitioned exclusively into the detergent-rich fraction consistent with Mo1 being an integral membrane protein. In addition, treatment of specific granule membranes with a high salt, high urea buffer to remove adsorbed or peripheral proteins failed to dissociate Mo1. These data support the hypothesis that Mo1 is an integral membrane protein of plasma and specific granule membranes in human neutrophils

  18. System specification for the integrated monitoring and surveillance system

    International Nuclear Information System (INIS)

    1997-09-01

    This System Specification establishes the requirements for the Plutonium Focus Area (PFA) Integrated Monitoring and Surveillance System (IMSS). In this document, ''Integrated Monitoring and Surveillance System'' is used to describe the concept of integrated sensors, computers, personnel, and systems that perform the functions of sensing conditions, acquiring data, monitoring environmental safety and health, controlling and accounting for materials, monitoring material stability, monitoring container integrity, transferring data, and analyzing, reporting, and storing data. This concept encompasses systems (e.g. sensors, personnel, databases, etc.) that are already in place at the sites but may require modifications or additions to meet all identified surveillance requirements. The purpose of this System Specification is to provide Department of Energy (DOE) sites that store plutonium materials with a consolidation of all known requirements for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides. This compilation may be used (1) as a baseline for surveillance system design specifications where 3013 packages of stabilized plutonium metals and oxides will be stored and monitored; (2) as a checklist for evaluating existing surveillance systems to ensure that all requirements are met for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides; and (3) as a baseline for preparing procurement specifications tailored for site specific storage and surveillance of 3013 packages of stabilized plutonium metals and oxides

  19. Comparing the response modulation hypothesis and the integrated emotions system theory : The role of top-down attention in psychopathy

    NARCIS (Netherlands)

    Munneke, Jaap; Hoppenbrouwers, Sylco S.; Little, Bethany; Kooiman, Karen; van der Burg, Erik; Theeuwes, Jan

    2018-01-01

    Objective Two major etiological theories on psychopathy propose different mechanisms as to how emotional facial expressions are processed by individuals with elevated psychopathic traits. The Response Modulation Hypothesis (RMH) proposes that psychopathic individuals show emotional deficits as a

  20. A Direct Comparison of Local-Global Integration in Autism and other Developmental Disorders: Implications for the Central Coherence Hypothesis

    OpenAIRE

    Bernardiono, I; Mouga, S; Almeida, J; van Asselen, M; Oliveira, G

    2012-01-01

    The weak central coherence hypothesis represents one of the current explanatory models in Autism Spectrum Disorders (ASD). Several experimental paradigms based on hierarchical figures have been used to test this controversial account. We addressed this hypothesis by testing central coherence in ASD (n = 19 with intellectual disability and n = 20 without intellectual disability), Williams syndrome (WS, n = 18), matched controls with intellectual disability (n = 20) and chronological age-matche...

  1. Multiloop Integral System Test (MIST): MIST Facility Functional Specification

    International Nuclear Information System (INIS)

    Habib, T.F.; Koksal, C.G.; Moskal, T.E.; Rush, G.C.; Gloudemans, J.R.

    1991-04-01

    The Multiloop Integral System Test (MIST) is part of a multiphase program started in 1983 to address small-break loss-of-coolant accidents (SBLOCAs) specific to Babcock and Wilcox designed plants. MIST is sponsored by the US Nuclear Regulatory Commission, the Babcock ampersand Wilcox Owners Group, the Electric Power Research Institute, and Babcock and Wilcox. The unique features of the Babcock and Wilcox design, specifically the hot leg U-bends and steam generators, prevented the use of existing integral system data or existing integral facilities to address the thermal-hydraulic SBLOCA questions. MIST was specifically designed and constructed for this program, and an existing facility -- the Once Through Integral System (OTIS) -- was also used. Data from MIST and OTIS are used to benchmark the adequacy of system codes, such as RELAP5 and TRAC, for predicting abnormal plant transients. The MIST Functional Specification documents as-built design features, dimensions, instrumentation, and test approach. It also presents the scaling basis for the facility and serves to define the scope of work for the facility design and construction. 13 refs., 112 figs., 38 tabs

  2. Exploration of a "Double-Jeopardy" Hypothesis within Working Memory Profiles for Children with Specific Language Impairment

    Science.gov (United States)

    Briscoe, J.; Rankin, P. M.

    2009-01-01

    Background: Children with specific language impairment (SLI) often experience difficulties in the recall and repetition of verbal information. Archibald and Gathercole (2006) suggested that children with SLI are vulnerable across two separate components of a tripartite model of working memory (Baddeley and Hitch 1974). However, the hierarchical…

  3. The beneficial effect of donor-specific transfusions: a review of existing explanations and a new hypothesis based on a relatively unapplied theory of T cell immunoregulation. A regulatory hypothesis in progress...

    Science.gov (United States)

    Wendel, T D

    2000-06-01

    The mechanism by which donor specific transfusions protect a graft from the recipient's immune system is unknown. It is likely that this beneficial mechanism is a subset or distinct exhibition of the general rules governing the regulation of the immune system. This phenomenon provides a strong framework for investigation of immune regulation, considering its potential consanguinity to immune regulation, that it is a paradox representing a manifestation of regulatory rules, and that it provides a wealth of clinical experience and experimentation from which to make inferences. Vital in any exploration of immune regulation, is the promise held in reducing the immune system to its chief elemental regulatory mechanisms and interactions. Strangely, the majority of this consequential work may have already been accomplished by Gershon, Green and colleagues with their elegant demarcation of T cell regulation into suppressor and contrasuppressor pathways. The practical and theoretical implications of this discovery seem to be, for the most part, ignored by mainstream immunology. It is doubtful, based on the quality and quantity of their work, or confirming work by other laboratories that they were inaccurate in their findings. It remains a horrible waste that their discoveries are not in immunology's pantheon of hallowed discoveries and are little used. With all this kept in mind, a comprehensive hypothesis of regulation was put together based mainly on Gershon's portrait of the suppressor and contrasuppressor pathways' contributions to immune regulation and experimentation surrounding the unsolved paradox of donor specific transfusions.

  4. Evolution of specific 3'-5'-linkages in RNA in pre-biotic soup: a new hypothesis.

    Science.gov (United States)

    Kumar, Vaijayanti A

    2016-11-02

    This article reviews the different possibilities towards progression of the formation of DNA/RNA in the chemical world, before life, in enzyme-free conditions. The advent of deoxyribo- and ribopentose-sugars, nucleosides, nucleotides and oligonucleotides in the prebiotic soup is briefly discussed. Further, the formation of early single stranded oligomers, base-pairing possibilities and information transfer based on the stability parameters of the derived duplexes is reviewed. Each theory has its own merits and demerits which we have elaborated upon. Lastly, using clues from this literature, a possible explanation for the specific 3'-5'-linkages in RNA is proposed.

  5. Specific and Complete Local Integration of Patterns in Bayesian Networks

    Directory of Open Access Journals (Sweden)

    Martin Biehl

    2017-05-01

    Full Text Available We present a first formal analysis of specific and complete local integration. Complete local integration was previously proposed as a criterion for detecting entities or wholes in distributed dynamical systems. Such entities in turn were conceived to form the basis of a theory of emergence of agents within dynamical systems. Here, we give a more thorough account of the underlying formal measures. The main contribution is the disintegration theorem which reveals a special role of completely locally integrated patterns (what we call ι-entities within the trajectories they occur in. Apart from proving this theorem we introduce the disintegration hierarchy and its refinement-free version as a way to structure the patterns in a trajectory. Furthermore, we construct the least upper bound and provide a candidate for the greatest lower bound of specific local integration. Finally, we calculate the ι -entities in small example systems as a first sanity check and find that ι -entities largely fulfil simple expectations.

  6. USER SPECIFICATIONS FOR PRESSURE VESSELS AND TECHNICAL INTEGRITY

    Directory of Open Access Journals (Sweden)

    K.S. Johnston

    2012-01-01

    Full Text Available

    ENGLISH ABSTRACT: Specifications translated from user requirements are prescribed in an attempt to capture and incorporate best practices with regards to the design, fabrication, testing, and operation of pressure vessels. The question as to whether these requirements affect the technical integrity of pressure vessels is often a subjective matter. This paper examines typical user requirement specifications against technical integrity of pressure vessels.
    The paper draws on a survey of a convenience sample of practising engineers in a diversified petrochemical company. When compared with failures on selected pressure vessels recorded by Phillips and Warwick, the respondent feedback confirms the user specifications that have the highest impact on technical integrity.

    AFRIKAANSE OPSOMMING: Gebruikersbehoeftes word saamgevat in spesifikasies wat lei tot goeie praktyk vir ontwerp, vervaarding, toetsing en bedryf van drukvate. Subjektiwiteit van die gebruikersbehoeftes mag soms die tegniese integriteit van ‘n drukvat beinvloed.
    Die navorsing maak by wyse van monsterneming gebruik van die kennis van ingenieurs wat werk in ‘n gediversifiseerde petrochemiese bedryf. Die terugvoering bevestig dat bogenoemde spesifikasies inderdaad die grootste invloed het op tegniese integriteit.

  7. Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

    Science.gov (United States)

    Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

    2014-12-01

    Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Electrophysiological evidence for speech-specific audiovisual integration.

    Science.gov (United States)

    Baart, Martijn; Stekelenburg, Jeroen J; Vroomen, Jean

    2014-01-01

    Lip-read speech is integrated with heard speech at various neural levels. Here, we investigated the extent to which lip-read induced modulations of the auditory N1 and P2 (measured with EEG) are indicative of speech-specific audiovisual integration, and we explored to what extent the ERPs were modulated by phonetic audiovisual congruency. In order to disentangle speech-specific (phonetic) integration from non-speech integration, we used Sine-Wave Speech (SWS) that was perceived as speech by half of the participants (they were in speech-mode), while the other half was in non-speech mode. Results showed that the N1 obtained with audiovisual stimuli peaked earlier than the N1 evoked by auditory-only stimuli. This lip-read induced speeding up of the N1 occurred for listeners in speech and non-speech mode. In contrast, if listeners were in speech-mode, lip-read speech also modulated the auditory P2, but not if listeners were in non-speech mode, thus revealing speech-specific audiovisual binding. Comparing ERPs for phonetically congruent audiovisual stimuli with ERPs for incongruent stimuli revealed an effect of phonetic stimulus congruency that started at ~200 ms after (in)congruence became apparent. Critically, akin to the P2 suppression, congruency effects were only observed if listeners were in speech mode, and not if they were in non-speech mode. Using identical stimuli, we thus confirm that audiovisual binding involves (partially) different neural mechanisms for sound processing in speech and non-speech mode. © 2013 Published by Elsevier Ltd.

  9. Integrating Occupational Therapy Specific Assessments in Practice: Exploring Practitioner Experiences

    Directory of Open Access Journals (Sweden)

    Eric Asaba

    2017-01-01

    Full Text Available Background. Occupational therapists sometimes find it challenging to integrate client-centered and occupational therapy specific assessments in practice. The aim of this study was to explore the use of occupational therapy specific assessments such as the Assessment of Motor and Process Skills (AMPS among occupational therapists in Sweden and Japan. Methods. Interviews and qualitative thematic analyses were utilized. Findings. Four themes are reported: (1 use it or lose it, (2 simply no space until after hours, (3 biggest barriers can be colleagues, and (4 being more specific: communication. Conclusion. In keeping with previous studies, occupational therapists often find it challenging to implement client-centered and occupation-based assessment tools into practice. However, more work is needed to understand how best practices can be incorporated into a changing occupational therapy daily practice.

  10. Exploration of a 'double-jeopardy' hypothesis within working memory profiles for children with specific language impairment.

    Science.gov (United States)

    Briscoe, J; Rankin, P M

    2009-01-01

    Children with specific language impairment (SLI) often experience difficulties in the recall and repetition of verbal information. Archibald and Gathercole (2006) suggested that children with SLI are vulnerable across two separate components of a tripartite model of working memory (Baddeley and Hitch 1974). However, the hierarchical relationship between the 'slave' systems (temporary storage) and the central executive components places a particular challenge for interpreting working memory profiles within a tripartite model. This study aimed to examine whether a 'double-jeopardy' assumption is compatible with a hierarchical relationship between the phonological loop and central executive components of the working memory model in children with SLI. If a strong double-jeopardy assumption is valid for children with SLI, it was predicted that raw scores of working memory tests thought to tap phonological loop and central executive components of tripartite working memory would be lower than the scores of children matched for chronological age and those of children matched for language level, according to independent sources of constraint. In contrast, a hierarchical relationship would imply that a weakness in a slave component of working memory (the phonological loop) would also constrain performance on tests tapping a super-ordinate component (central executive). This locus of constraint would predict that scores of children with SLI on working memory tests that tap the central executive would be weaker relative to the scores of chronological age-matched controls only. Seven subtests of the Working Memory Test Battery for Children (Digit recall, Word recall, Non-word recall, Word matching, Listening recall, Backwards digit recall and Block recall; Pickering and Gathercole 2001) were administered to 14 children with SLI recruited via language resource bases and specialist schools, as well as two control groups matched on chronological age and vocabulary level

  11. Integrating Cloud-Computing-Specific Model into Aircraft Design

    Science.gov (United States)

    Zhimin, Tian; Qi, Lin; Guangwen, Yang

    Cloud Computing is becoming increasingly relevant, as it will enable companies involved in spreading this technology to open the door to Web 3.0. In the paper, the new categories of services introduced will slowly replace many types of computational resources currently used. In this perspective, grid computing, the basic element for the large scale supply of cloud services, will play a fundamental role in defining how those services will be provided. The paper tries to integrate cloud computing specific model into aircraft design. This work has acquired good results in sharing licenses of large scale and expensive software, such as CFD (Computational Fluid Dynamics), UG, CATIA, and so on.

  12. Failure cause and failure rate evaluation on pumps of BWR plants in PSA. Hypothesis testing for typical or plant specific failure rate of pumps

    International Nuclear Information System (INIS)

    Sanada, Takahiro; Nakamura, Makoto

    2009-01-01

    In support of domestic nuclear industry effort to gather and analyze failure data of components concerning nuclear power plants, Nuclear Information Archives (NUCIA) are published for useful information to help PSA. This report focuses on NUCIA pertaining to pumps in domestic nuclear power plants, and provides the reliable estimation on failure rate of pumps resulting from failure cause analysis and hypothesis testing of classified and plant specific failure rate of pumps for improving quality in PSA. The classified and plant specific failure rate of pumps are estimated by analyzing individual domestic nuclear power plant's data of 26 Boiling Water Reactors (BWRs) concerning functionally structurally classified pump failures reported from beginning of commercial operation to March 31, 2007. (author)

  13. A direct comparison of local-global integration in autism and other developmental disorders: implications for the central coherence hypothesis.

    Science.gov (United States)

    Bernardino, Inês; Mouga, Susana; Almeida, Joana; van Asselen, Marieke; Oliveira, Guiomar; Castelo-Branco, Miguel

    2012-01-01

    The weak central coherence hypothesis represents one of the current explanatory models in Autism Spectrum Disorders (ASD). Several experimental paradigms based on hierarchical figures have been used to test this controversial account. We addressed this hypothesis by testing central coherence in ASD (n = 19 with intellectual disability and n = 20 without intellectual disability), Williams syndrome (WS, n = 18), matched controls with intellectual disability (n = 20) and chronological age-matched controls (n = 20). We predicted that central coherence should be most impaired in ASD for the weak central coherence account to hold true. An alternative account includes dorsal stream dysfunction which dominates in WS. Central coherence was first measured by requiring subjects to perform local/global preference judgments using hierarchical figures under 6 different experimental settings (memory and perception tasks with 3 distinct geometries with and without local/global manipulations). We replicated these experiments under 4 additional conditions (memory/perception*local/global) in which subjects reported the correct local or global configurations. Finally, we used a visuoconstructive task to measure local/global perceptual interference. WS participants were the most impaired in central coherence whereas ASD participants showed a pattern of coherence loss found in other studies only in four task conditions favoring local analysis but it tended to disappear when matching for intellectual disability. We conclude that abnormal central coherence does not provide a comprehensive explanation of ASD deficits and is more prominent in populations, namely WS, characterized by strongly impaired dorsal stream functioning and other phenotypic traits that contrast with the autistic phenotype. Taken together these findings suggest that other mechanisms such as dorsal stream deficits (largest in WS) may underlie impaired central coherence.

  14. A direct comparison of local-global integration in autism and other developmental disorders: implications for the central coherence hypothesis.

    Directory of Open Access Journals (Sweden)

    Inês Bernardino

    Full Text Available The weak central coherence hypothesis represents one of the current explanatory models in Autism Spectrum Disorders (ASD. Several experimental paradigms based on hierarchical figures have been used to test this controversial account. We addressed this hypothesis by testing central coherence in ASD (n = 19 with intellectual disability and n = 20 without intellectual disability, Williams syndrome (WS, n = 18, matched controls with intellectual disability (n = 20 and chronological age-matched controls (n = 20. We predicted that central coherence should be most impaired in ASD for the weak central coherence account to hold true. An alternative account includes dorsal stream dysfunction which dominates in WS. Central coherence was first measured by requiring subjects to perform local/global preference judgments using hierarchical figures under 6 different experimental settings (memory and perception tasks with 3 distinct geometries with and without local/global manipulations. We replicated these experiments under 4 additional conditions (memory/perception*local/global in which subjects reported the correct local or global configurations. Finally, we used a visuoconstructive task to measure local/global perceptual interference. WS participants were the most impaired in central coherence whereas ASD participants showed a pattern of coherence loss found in other studies only in four task conditions favoring local analysis but it tended to disappear when matching for intellectual disability. We conclude that abnormal central coherence does not provide a comprehensive explanation of ASD deficits and is more prominent in populations, namely WS, characterized by strongly impaired dorsal stream functioning and other phenotypic traits that contrast with the autistic phenotype. Taken together these findings suggest that other mechanisms such as dorsal stream deficits (largest in WS may underlie impaired central coherence.

  15. The perceived familiarity gap hypothesis: examining how media attention and reflective integration relate to perceived familiarity with nanotechnology in Singapore

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Edmund W. J., E-mail: leew0124@e.ntu.edu.sg; Ho, Shirley S. [Nanyang Technological University, Wee Kim Wee School of Communication and Information (Singapore)

    2015-05-15

    Public level of familiarity with nanotechnology partly determines their acceptance or rejection of the technology. This study examines the differential influence of public attention to science news in the media and reflective integration on perceived familiarity with nanotechnology among people in the higher and lower socioeconomic status (SES) groups in Singapore. Significant three-way interactions among education, science news attention, and reflective integration variables were found. Attention to television science news narrowed the level of perceived familiarity with nanotechnology between the higher and lower SES groups for those who engaged in high elaborative processing. Science newspaper attention, on the other hand, widened the familiarity gap between the higher and lower SES groups among those who engaged in high elaborative processing. Two-way interaction among education and elaborative processing were found—elaborative processing closed the familiarity gap between higher and lower SES groups. Theoretical and practical implications were discussed.

  16. The perceived familiarity gap hypothesis: examining how media attention and reflective integration relate to perceived familiarity with nanotechnology in Singapore

    International Nuclear Information System (INIS)

    Lee, Edmund W. J.; Ho, Shirley S.

    2015-01-01

    Public level of familiarity with nanotechnology partly determines their acceptance or rejection of the technology. This study examines the differential influence of public attention to science news in the media and reflective integration on perceived familiarity with nanotechnology among people in the higher and lower socioeconomic status (SES) groups in Singapore. Significant three-way interactions among education, science news attention, and reflective integration variables were found. Attention to television science news narrowed the level of perceived familiarity with nanotechnology between the higher and lower SES groups for those who engaged in high elaborative processing. Science newspaper attention, on the other hand, widened the familiarity gap between the higher and lower SES groups among those who engaged in high elaborative processing. Two-way interaction among education and elaborative processing were found—elaborative processing closed the familiarity gap between higher and lower SES groups. Theoretical and practical implications were discussed

  17. The perceived familiarity gap hypothesis: examining how media attention and reflective integration relate to perceived familiarity with nanotechnology in Singapore

    Science.gov (United States)

    Lee, Edmund W. J.; Ho, Shirley S.

    2015-05-01

    Public level of familiarity with nanotechnology partly determines their acceptance or rejection of the technology. This study examines the differential influence of public attention to science news in the media and reflective integration on perceived familiarity with nanotechnology among people in the higher and lower socioeconomic status (SES) groups in Singapore. Significant three-way interactions among education, science news attention, and reflective integration variables were found. Attention to television science news narrowed the level of perceived familiarity with nanotechnology between the higher and lower SES groups for those who engaged in high elaborative processing. Science newspaper attention, on the other hand, widened the familiarity gap between the higher and lower SES groups among those who engaged in high elaborative processing. Two-way interaction among education and elaborative processing were found—elaborative processing closed the familiarity gap between higher and lower SES groups. Theoretical and practical implications were discussed.

  18. Integration of mtDNA pseudogenes into the nuclear genome coincides with speciation of the human genus. A hypothesis.

    Science.gov (United States)

    Gunbin, Konstantin; Peshkin, Leonid; Popadin, Konstantin; Annis, Sofia; Ackermann, Rebecca R; Khrapko, Konstantin

    2017-05-01

    Fragments of mitochondrial DNA are known to get inserted into nuclear DNA to form NUMTs, i.e. nuclear pseudogenes of the mtDNA. The insertion of a NUMT is a rare event. Hundreds of pseudogenes have been cataloged in the human genome. NUMTs are, in essence, a special type of mutation with their own internal timer, which is synchronized with an established molecular clock, the mtDNA. Thus insertion of NUMTs can be timed with respect to evolution milestones such as the emergence of new species. We asked whether NUMTs were inserted uniformly over time or preferentially during certain periods of evolution, as implied by the "punctuated evolution" model. To our surprise, the NUMT insertion times do appear nonrandom with at least one cluster positioned at around 2.8 million years ago (Ma). Interestingly, 2.8Ma closely corresponds to the time of emergence of the genus Homo, and to a well-documented period of major climate change ca. 2.9-2.5Ma. It is tempting to hypothesize that the insertion of NUMTs is related to the speciation process. NUMTs could be either "riders", i.e., their insertion could be facilitated by the overall higher genome rearrangement activity during speciation, or "drivers", i.e. they may more readily get fixed in the population due to positive selection associated with speciation. If correct, the hypothesis would support the idea that evolution of our genus may have happened in a rapid, punctuated manner. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  19. Reactor protection system design using application specific integrated circuits

    International Nuclear Information System (INIS)

    Battle, R.E.; Bryan, W.L.; Kisner, R.A.; Wilson, T.L. Jr.

    1992-01-01

    Implementing reactor protection systems (RPS) or other engineering safeguard systems with application specific integrated circuits (ASICs) offers significant advantages over conventional analog or software based RPSs. Conventional analog RPSs suffer from setpoints drifts and large numbers of discrete analog electronics, hardware logic, and relays which reduce reliability because of the large number of potential failures of components or interconnections. To resolve problems associated with conventional discrete RPSs and proposed software based RPS systems, a hybrid analog and digital RPS system implemented with custom ASICs is proposed. The actual design of the ASIC RPS resembles a software based RPS but the programmable software portion of each channel is implemented in a fixed digital logic design including any input variable computations. Set point drifts are zero as in proposed software systems, but the verification and validation of the computations is made easier since the computational logic an be exhaustively tested. The functionality is assured fixed because there can be no future changes to the ASIC without redesign and fabrication. Subtle error conditions caused by out of order evaluation or time dependent evaluation of system variables against protection criteria are eliminated by implementing all evaluation computations in parallel for simultaneous results. On- chip redundancy within each RPS channel and continuous self-testing of all channels provided enhanced assurance that a particular channel is available and faults are identified as soon as possible for corrective actions. The use of highly integrated ASICs to implement channel electronics rather than the use of discrete electronics greatly reduces the total number of components and interconnections in the RPS to further increase system reliability. A prototype ASIC RPS channel design and the design environment used for ASIC RPS systems design is discussed

  20. The Alu neurodegeneration hypothesis: A primate-specific mechanism for neuronal transcription noise, mitochondrial dysfunction, and manifestation of neurodegenerative disease.

    Science.gov (United States)

    Larsen, Peter A; Lutz, Michael W; Hunnicutt, Kelsie E; Mihovilovic, Mirta; Saunders, Ann M; Yoder, Anne D; Roses, Allen D

    2017-07-01

    It is hypothesized that retrotransposons have played a fundamental role in primate evolution and that enhanced neurologic retrotransposon activity in humans may underlie the origin of higher cognitive function. As a potential consequence of this enhanced activity, it is likely that neurons are susceptible to deleterious retrotransposon pathways that can disrupt mitochondrial function. An example is observed in the TOMM40 gene, encoding a β-barrel protein critical for mitochondrial preprotein transport. Primate-specific Alu retrotransposons have repeatedly inserted into TOMM40 introns, and at least one variant associated with late-onset Alzheimer's disease originated from an Alu insertion event. We provide evidence of enriched Alu content in mitochondrial genes and postulate that Alus can disrupt mitochondrial populations in neurons, thereby setting the stage for progressive neurologic dysfunction. This Alu neurodegeneration hypothesis is compatible with decades of research and offers a plausible mechanism for the disruption of neuronal mitochondrial homeostasis, ultimately cascading into neurodegenerative disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. An integrated in silico approach to design specific inhibitors targeting human poly(a-specific ribonuclease.

    Directory of Open Access Journals (Sweden)

    Dimitrios Vlachakis

    Full Text Available Poly(A-specific ribonuclease (PARN is an exoribonuclease/deadenylase that degrades 3'-end poly(A tails in almost all eukaryotic organisms. Much of the biochemical and structural information on PARN comes from the human enzyme. However, the existence of PARN all along the eukaryotic evolutionary ladder requires further and thorough investigation. Although the complete structure of the full-length human PARN, as well as several aspects of the catalytic mechanism still remain elusive, many previous studies indicate that PARN can be used as potent and promising anti-cancer target. In the present study, we attempt to complement the existing structural information on PARN with in-depth bioinformatics analyses, in order to get a hologram of the molecular evolution of PARNs active site. In an effort to draw an outline, which allows specific drug design targeting PARN, an unequivocally specific platform was designed for the development of selective modulators focusing on the unique structural and catalytic features of the enzyme. Extensive phylogenetic analysis based on all the publicly available genomes indicated a broad distribution for PARN across eukaryotic species and revealed structurally important amino acids which could be assigned as potentially strong contributors to the regulation of the catalytic mechanism of PARN. Based on the above, we propose a comprehensive in silico model for the PARN's catalytic mechanism and moreover, we developed a 3D pharmacophore model, which was subsequently used for the introduction of DNP-poly(A amphipathic substrate analog as a potential inhibitor of PARN. Indeed, biochemical analysis revealed that DNP-poly(A inhibits PARN competitively. Our approach provides an efficient integrated platform for the rational design of pharmacophore models as well as novel modulators of PARN with therapeutic potential.

  2. The Qualitative Expectations Hypothesis

    DEFF Research Database (Denmark)

    Frydman, Roman; Johansen, Søren; Rahbek, Anders

    2017-01-01

    We introduce the Qualitative Expectations Hypothesis (QEH) as a new approach to modeling macroeconomic and financial outcomes. Building on John Muth's seminal insight underpinning the Rational Expectations Hypothesis (REH), QEH represents the market's forecasts to be consistent with the predictions...... of an economistís model. However, by assuming that outcomes lie within stochastic intervals, QEH, unlike REH, recognizes the ambiguity faced by an economist and market participants alike. Moreover, QEH leaves the model open to ambiguity by not specifying a mechanism determining specific values that outcomes take...

  3. The Qualitative Expectations Hypothesis

    DEFF Research Database (Denmark)

    Frydman, Roman; Johansen, Søren; Rahbek, Anders

    We introduce the Qualitative Expectations Hypothesis (QEH) as a new approach to modeling macroeconomic and financial outcomes. Building on John Muth's seminal insight underpinning the Rational Expectations Hypothesis (REH), QEH represents the market's forecasts to be consistent with the predictions...... of an economist's model. However, by assuming that outcomes lie within stochastic intervals, QEH, unlike REH, recognizes the ambiguity faced by an economist and market participants alike. Moreover, QEH leaves the model open to ambiguity by not specifying a mechanism determining specific values that outcomes take...

  4. Gesture-speech integration in children with specific language impairment.

    Science.gov (United States)

    Mainela-Arnold, Elina; Alibali, Martha W; Hostetter, Autumn B; Evans, Julia L

    2014-11-01

    Previous research suggests that speakers are especially likely to produce manual communicative gestures when they have relative ease in thinking about the spatial elements of what they are describing, paired with relative difficulty organizing those elements into appropriate spoken language. Children with specific language impairment (SLI) exhibit poor expressive language abilities together with within-normal-range nonverbal IQs. This study investigated whether weak spoken language abilities in children with SLI influence their reliance on gestures to express information. We hypothesized that these children would rely on communicative gestures to express information more often than their age-matched typically developing (TD) peers, and that they would sometimes express information in gestures that they do not express in the accompanying speech. Participants were 15 children with SLI (aged 5;6-10;0) and 18 age-matched TD controls. Children viewed a wordless cartoon and retold the story to a listener unfamiliar with the story. Children's gestures were identified and coded for meaning using a previously established system. Speech-gesture combinations were coded as redundant if the information conveyed in speech and gesture was the same, and non-redundant if the information conveyed in speech was different from the information conveyed in gesture. Children with SLI produced more gestures than children in the TD group; however, the likelihood that speech-gesture combinations were non-redundant did not differ significantly across the SLI and TD groups. In both groups, younger children were significantly more likely to produce non-redundant speech-gesture combinations than older children. The gesture-speech integration system functions similarly in children with SLI and TD, but children with SLI rely more on gesture to help formulate, conceptualize or express the messages they want to convey. This provides motivation for future research examining whether interventions

  5. Specification and Generation of Adapters for System Integration

    NARCIS (Netherlands)

    Mooij, A.J.; Voorhoeve, M.

    2013-01-01

    Large systems-of-systems are developed by integrating several smaller systems that have been developed independently. System integration often requires adaptation mechanisms for bridging any technical incompatibilities between the systems. In order to develop adapters in a faster way, we study ways

  6. Closed expressions for specific massive multiloop self-energy integrals

    International Nuclear Information System (INIS)

    Berends, F.A.; Boehm, M.; Buza, M.; Scharf, R.

    1994-01-01

    In this paper the class of N loop massive scalar self-energy diagrams with N + 1 propagators is studied in an arbitrary number of dimensions. As it is known these integrals cannot be expressed in terms of polylogarithms. Here it is shown, however, that they can be described by generalized hypergeometric functions of several variables, namely Laricella functions. These results represent previous small and large momentum expansions in closed form. Numerical comparisons for the finite part in four dimensions with a two-dimensional integral representation show good agreement. (orig.)

  7. Application specific integrated circuit for high temperature oil well applications

    Energy Technology Data Exchange (ETDEWEB)

    Fallet, T.; Gakkestad, J.; Forre, G.

    1994-12-31

    This paper describes the design of an integrated BiCMOS circuit for high temperature applications. The circuit contains Pierce oscillators with automatic gain control, and measurements show that it is operating up to 266{sup o}C. The relative frequency variation up to 200 {sup o}C is less than 60 ppm caused mainly by the crystal element itself. 4 refs., 7 figs.

  8. Selective pressures to maintain attachment site specificity of integrative and conjugative elements.

    Directory of Open Access Journals (Sweden)

    Kayla L Menard

    Full Text Available Integrative and conjugative elements (ICEs are widespread mobile genetic elements that are usually found integrated in bacterial chromosomes. They are important agents of evolution and contribute to the acquisition of new traits, including antibiotic resistances. ICEs can excise from the chromosome and transfer to recipients by conjugation. Many ICEs are site-specific in that they integrate preferentially into a primary attachment site in the bacterial genome. Site-specific ICEs can also integrate into secondary locations, particularly if the primary site is absent. However, little is known about the consequences of integration of ICEs into alternative attachment sites or what drives the apparent maintenance and prevalence of the many ICEs that use a single attachment site. Using ICEBs1, a site-specific ICE from Bacillus subtilis that integrates into a tRNA gene, we found that integration into secondary sites was detrimental to both ICEBs1 and the host cell. Excision of ICEBs1 from secondary sites was impaired either partially or completely, limiting the spread of ICEBs1. Furthermore, induction of ICEBs1 gene expression caused a substantial drop in proliferation and cell viability within three hours. This drop was dependent on rolling circle replication of ICEBs1 that was unable to excise from the chromosome. Together, these detrimental effects provide selective pressure against the survival and dissemination of ICEs that have integrated into alternative sites and may explain the maintenance of site-specific integration for many ICEs.

  9. Calcium Hypothesis of Alzheimer's disease and brain aging: A framework for integrating new evidence into a comprehensive theory of pathogenesis.

    Science.gov (United States)

    2017-02-01

    This article updates the Calcium Hypothesis of Alzheimer's disease and brain aging on the basis of emerging evidence since 1994 (The present article, with the subtitle "New evidence for a central role of Ca 2+ in neurodegeneration," includes three appendices that provide context and further explanations for the rationale for the revisions in the updated hypothesis-the three appendices are as follows: Appendix I "Emerging concepts on potential pathogenic roles of [Ca 2+ ]," Appendix II "Future studies to validate the central role of dysregulated [Ca 2+ ] in neurodegeneration," and Appendix III "Epilogue: towards a comprehensive hypothesis.") (Marx J. Fresh evidence points to an old suspect: calcium. Science 2007; 318:384-385). The aim is not only to re-evaluate the original key claims of the hypothesis with a critical eye but also to identify gaps in knowledge required to validate relevant claims and delineate additional studies and/or data that are needed. Some of the key challenges for this effort included examination of questions regarding (1) the temporal and spatial relationships of molecular mechanisms that regulate neuronal calcium ion (Ca 2+ ), (2) the role of changes in concentration of calcium ion [Ca 2+ ] in various subcellular compartments of neurons, (3) how alterations in Ca 2+ signaling affect the performance of neurons under various conditions, ranging from optimal functioning in a healthy state to conditions of decline and deterioration in performance during aging and in disease, and (4) new ideas about the contributions of aging, genetic, and environmental factors to the causal relationships between dysregulation of [Ca 2+ ] and the functioning of neurons (see Appendices I and II). The updated Calcium Hypothesis also includes revised postulates that are intended to promote further crucial experiments to confirm or reject the various predictions of the hypothesis (see Appendix III). Copyright © 2016 the Alzheimer's Association. All rights reserved.

  10. THE FRACTAL MARKET HYPOTHESIS

    OpenAIRE

    FELICIA RAMONA BIRAU

    2012-01-01

    In this article, the concept of capital market is analysed using Fractal Market Hypothesis which is a modern, complex and unconventional alternative to classical finance methods. Fractal Market Hypothesis is in sharp opposition to Efficient Market Hypothesis and it explores the application of chaos theory and fractal geometry to finance. Fractal Market Hypothesis is based on certain assumption. Thus, it is emphasized that investors did not react immediately to the information they receive and...

  11. Variability: A Pernicious Hypothesis.

    Science.gov (United States)

    Noddings, Nel

    1992-01-01

    The hypothesis of greater male variability in test results is discussed in its historical context, and reasons feminists have objected to the hypothesis are considered. The hypothesis acquires political importance if it is considered that variability results from biological, rather than cultural, differences. (SLD)

  12. THE FRACTAL MARKET HYPOTHESIS

    Directory of Open Access Journals (Sweden)

    FELICIA RAMONA BIRAU

    2012-05-01

    Full Text Available In this article, the concept of capital market is analysed using Fractal Market Hypothesis which is a modern, complex and unconventional alternative to classical finance methods. Fractal Market Hypothesis is in sharp opposition to Efficient Market Hypothesis and it explores the application of chaos theory and fractal geometry to finance. Fractal Market Hypothesis is based on certain assumption. Thus, it is emphasized that investors did not react immediately to the information they receive and of course, the manner in which they interpret that information may be different. Also, Fractal Market Hypothesis refers to the way that liquidity and investment horizons influence the behaviour of financial investors.

  13. Sound specificity effects in spoken word recognition: The effect of integrality between words and sounds.

    Science.gov (United States)

    Strori, Dorina; Zaar, Johannes; Cooke, Martin; Mattys, Sven L

    2018-01-01

    Recent evidence has shown that nonlinguistic sounds co-occurring with spoken words may be retained in memory and affect later retrieval of the words. This sound-specificity effect shares many characteristics with the classic voice-specificity effect. In this study, we argue that the sound-specificity effect is conditional upon the context in which the word and sound coexist. Specifically, we argue that, besides co-occurrence, integrality between words and sounds is a crucial factor in the emergence of the effect. In two recognition-memory experiments, we compared the emergence of voice and sound specificity effects. In Experiment 1 , we examined two conditions where integrality is high. Namely, the classic voice-specificity effect (Exp. 1a) was compared with a condition in which the intensity envelope of a background sound was modulated along the intensity envelope of the accompanying spoken word (Exp. 1b). Results revealed a robust voice-specificity effect and, critically, a comparable sound-specificity effect: A change in the paired sound from exposure to test led to a decrease in word-recognition performance. In the second experiment, we sought to disentangle the contribution of integrality from a mere co-occurrence context effect by removing the intensity modulation. The absence of integrality led to the disappearance of the sound-specificity effect. Taken together, the results suggest that the assimilation of background sounds into memory cannot be reduced to a simple context effect. Rather, it is conditioned by the extent to which words and sounds are perceived as integral as opposed to distinct auditory objects.

  14. Sound specificity effects in spoken word recognition: The effect of integrality between words and sounds

    DEFF Research Database (Denmark)

    Strori, Dorina; Zaar, Johannes; Cooke, Martin

    2017-01-01

    Recent evidence has shown that nonlinguistic sounds co-occurring with spoken words may be retained in memory and affect later retrieval of the words. This sound-specificity effect shares many characteristics with the classic voice-specificity effect. In this study, we argue that the sound......-specificity effect is conditional upon the context in which the word and sound coexist. Specifically, we argue that, besides co-occurrence, integrality between words and sounds is a crucial factor in the emergence of the effect. In two recognition-memory experiments, we compared the emergence of voice and sound...... from a mere co-occurrence context effect by removing the intensity modulation. The absence of integrality led to the disappearance of the sound-specificity effect. Taken together, the results suggest that the assimilation of background sounds into memory cannot be reduced to a simple context effect...

  15. Testing the hypothesis that diphtheria-tetanus-pertussis vaccine has negative non-specific and sex-differential effects on child survival in high-mortality countries.

    Science.gov (United States)

    Aaby, Peter; Benn, Christine; Nielsen, Jens; Lisse, Ida Maria; Rodrigues, Amabelia; Ravn, Henrik

    2012-01-01

    Measles vaccines (MV) have sex-differential effects on mortality not explained by protection against measles infection. The authors examined whether whole-cell diphtheria-tetanus-pertussis (DTP) vaccine has sex-differential and non-specific effects. Following previous reviews and a new search, the effect of DTP on mortality up to the next vaccination was assessed in all studies where DTP was given after BCG or DTP was given after MV and there was prospective follow-up after ascertainment of vaccination status. High-mortality countries in Africa and Asia. The initial observation of negative effect of DTP generated six hypotheses, which were examined in all available studies and two randomised trials reducing the time of exposure to DTP. Consistency between studies. In the first study, DTP had negative effects on survival in contrast to the beneficial effects of BCG and MV. This pattern was repeated in the six other studies available. Second, the two 'natural experiments' found significantly higher mortality for DTP-vaccinated compared with DTP-unvaccinated children. Third, the female-male mortality ratio was increased after DTP in all nine studies; in contrast, the ratio was decreased after BCG and MV in all studies. Fourth, the increased female mortality associated with high-titre measles vaccine was found only among children who had received DTP after high-titre measles vaccine. Fifth, in six randomised trials of early MV, female but not male mortality was increased if DTP was likely to be given after MV. Sixth, the mortality rate declined markedly for girls but not for boys when DTP-vaccinated children received MV. The authors reduced exposure to DTP as most recent vaccination by administering a live vaccine (MV and BCG) shortly after DTP. Both trials reduced child mortality. These observations are incompatible with DTP merely protecting against the targeted diseases. With herd immunity to whooping cough, DTP is associated with higher mortality for girls

  16. Physiopathological Hypothesis of Cellulite

    Science.gov (United States)

    de Godoy, José Maria Pereira; de Godoy, Maria de Fátima Guerreiro

    2009-01-01

    A series of questions are asked concerning this condition including as regards to its name, the consensus about the histopathological findings, physiological hypothesis and treatment of the disease. We established a hypothesis for cellulite and confirmed that the clinical response is compatible with this hypothesis. Hence this novel approach brings a modern physiological concept with physiopathologic basis and clinical proof of the hypothesis. We emphasize that the choice of patient, correct diagnosis of cellulite and the technique employed are fundamental to success. PMID:19756187

  17. Life Origination Hydrate Hypothesis (LOH-Hypothesis

    Directory of Open Access Journals (Sweden)

    Victor Ostrovskii

    2012-01-01

    Full Text Available The paper develops the Life Origination Hydrate Hypothesis (LOH-hypothesis, according to which living-matter simplest elements (LMSEs, which are N-bases, riboses, nucleosides, nucleotides, DNA- and RNA-like molecules, amino-acids, and proto-cells repeatedly originated on the basis of thermodynamically controlled, natural, and inevitable processes governed by universal physical and chemical laws from CH4, niters, and phosphates under the Earth's surface or seabed within the crystal cavities of the honeycomb methane-hydrate structure at low temperatures; the chemical processes passed slowly through all successive chemical steps in the direction that is determined by a gradual decrease in the Gibbs free energy of reacting systems. The hypothesis formulation method is based on the thermodynamic directedness of natural movement and consists ofan attempt to mentally backtrack on the progression of nature and thus reveal principal milestones alongits route. The changes in Gibbs free energy are estimated for different steps of the living-matter origination process; special attention is paid to the processes of proto-cell formation. Just the occurrence of the gas-hydrate periodic honeycomb matrix filled with LMSEs almost completely in its final state accounts for size limitation in the DNA functional groups and the nonrandom location of N-bases in the DNA chains. The slowness of the low-temperature chemical transformations and their “thermodynamic front” guide the gross process of living matter origination and its successive steps. It is shown that the hypothesis is thermodynamically justified and testable and that many observed natural phenomena count in its favor.

  18. Multiple sclerosis: a geographical hypothesis.

    Science.gov (United States)

    Carlyle, I P

    1997-12-01

    Multiple sclerosis remains a rare neurological disease of unknown aetiology, with a unique distribution, both geographically and historically. Rare in equatorial regions, it becomes increasingly common in higher latitudes; historically, it was first clinically recognized in the early nineteenth century. A hypothesis, based on geographical reasoning, is here proposed: that the disease is the result of a specific vitamin deficiency. Different individuals suffer the deficiency in separate and often unique ways. Evidence to support the hypothesis exists in cultural considerations, in the global distribution of the disease, and in its historical prevalence.

  19. Database specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)

    Energy Technology Data Exchange (ETDEWEB)

    Faby, E.Z.; Fluker, J.; Hancock, B.R.; Grubb, J.W.; Russell, D.L. [Univ. of Tennessee, Knoxville, TN (United States); Loftis, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States)

    1994-03-01

    This Database Specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB) describes the database organization and storage allocation, provides the detailed data model of the logical and physical designs, and provides information for the construction of parts of the database such as tables, data elements, and associated dictionaries and diagrams.

  20. Integration of aerial imaging and variable-rate technology for site-specific aerial herbicide application

    Science.gov (United States)

    As remote sensing and variable rate technology are becoming more available for aerial applicators, practical methodologies on effective integration of these technologies are needed for site-specific aerial applications of crop production and protection materials. The objectives of this study were to...

  1. Application specific integrated circuits and hybrid micro circuits for nuclear instrumentation

    International Nuclear Information System (INIS)

    Chandratre, V.B.; Sukhwani, Menka; Mukhopadhyay, P.K.; Shastrakar, R.S.; Sudheer, M.; Shedam, V.; Keni, Anubha

    2009-01-01

    Rapid development in semiconductor technology, sensors, detectors and requirements of high energy physics experiments as well as advances in commercially available nuclear instruments have lead to challenges for instrumentation. These challenges are met with development of Application Specific Integrated Circuits and Hybrid Micro Circuits. This paper discusses various activities in ASIC and HMC development in Bhabha Atomic Research Centre. (author)

  2. SELECTED REQUIREMENTS OF INTEGRATED MANAGEMENT SYSTEMS BASED ON PAS 99 SPECIFICATION

    Directory of Open Access Journals (Sweden)

    Paweł Nowicki

    2013-03-01

    Full Text Available The aim this research was to analyze the ways of integration of management systems in food sector. The study involved the documentation, audits, corrective and preventive actions and management's review phases described in the specification PAS 99, which is one of common elements of integrated management systems. Four organizations were selected for the study. The organizations had introduced and certified at least two standardized management systems. It was assumed that the investigated organizations should have implemented the HACCP system. Studies were conducted as a case study. The employees responsible for the functioning of management systems were interviewed in all four organizations. The study was conducted in the form of in-depth interviews based on pre-prepared script. The scenario was developed based on the PAS 99 guideline. The process of integration of management systems implemented in the studied companies reveals the full compliance of an integrated management system with PASS 99 in the policy area.

  3. Chemical Entity Semantic Specification: Knowledge representation for efficient semantic cheminformatics and facile data integration

    Science.gov (United States)

    2011-01-01

    Background Over the past several centuries, chemistry has permeated virtually every facet of human lifestyle, enriching fields as diverse as medicine, agriculture, manufacturing, warfare, and electronics, among numerous others. Unfortunately, application-specific, incompatible chemical information formats and representation strategies have emerged as a result of such diverse adoption of chemistry. Although a number of efforts have been dedicated to unifying the computational representation of chemical information, disparities between the various chemical databases still persist and stand in the way of cross-domain, interdisciplinary investigations. Through a common syntax and formal semantics, Semantic Web technology offers the ability to accurately represent, integrate, reason about and query across diverse chemical information. Results Here we specify and implement the Chemical Entity Semantic Specification (CHESS) for the representation of polyatomic chemical entities, their substructures, bonds, atoms, and reactions using Semantic Web technologies. CHESS provides means to capture aspects of their corresponding chemical descriptors, connectivity, functional composition, and geometric structure while specifying mechanisms for data provenance. We demonstrate that using our readily extensible specification, it is possible to efficiently integrate multiple disparate chemical data sources, while retaining appropriate correspondence of chemical descriptors, with very little additional effort. We demonstrate the impact of some of our representational decisions on the performance of chemically-aware knowledgebase searching and rudimentary reaction candidate selection. Finally, we provide access to the tools necessary to carry out chemical entity encoding in CHESS, along with a sample knowledgebase. Conclusions By harnessing the power of Semantic Web technologies with CHESS, it is possible to provide a means of facile cross-domain chemical knowledge integration with full

  4. Hypothesis analysis methods, hypothesis analysis devices, and articles of manufacture

    Science.gov (United States)

    Sanfilippo, Antonio P [Richland, WA; Cowell, Andrew J [Kennewick, WA; Gregory, Michelle L [Richland, WA; Baddeley, Robert L [Richland, WA; Paulson, Patrick R [Pasco, WA; Tratz, Stephen C [Richland, WA; Hohimer, Ryan E [West Richland, WA

    2012-03-20

    Hypothesis analysis methods, hypothesis analysis devices, and articles of manufacture are described according to some aspects. In one aspect, a hypothesis analysis method includes providing a hypothesis, providing an indicator which at least one of supports and refutes the hypothesis, using the indicator, associating evidence with the hypothesis, weighting the association of the evidence with the hypothesis, and using the weighting, providing information regarding the accuracy of the hypothesis.

  5. On the Keyhole Hypothesis

    DEFF Research Database (Denmark)

    Mikkelsen, Kaare B.; Kidmose, Preben; Hansen, Lars Kai

    2017-01-01

    simultaneously recorded scalp EEG. A cross-validation procedure was employed to ensure unbiased estimates. We present several pieces of evidence in support of the keyhole hypothesis: There is a high mutual information between data acquired at scalp electrodes and through the ear-EEG "keyhole," furthermore we......We propose and test the keyhole hypothesis that measurements from low dimensional EEG, such as ear-EEG reflect a broadly distributed set of neural processes. We formulate the keyhole hypothesis in information theoretical terms. The experimental investigation is based on legacy data consisting of 10...

  6. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    Directory of Open Access Journals (Sweden)

    Atsuo Kawahara

    2016-05-01

    Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  7. An Exploratory Study into Perceived Task Complexity, Topic Specificity and Usefulness for Integrated Search

    DEFF Research Database (Denmark)

    Ingwersen, Peter; Lioma, Christina; Larsen, Birger

    2012-01-01

    We investigate the relations between user perceptions of work task complexity, topic specificity, and usefulness of retrieved results. 23 academic researchers submitted detailed descriptions of 65 real-life work tasks in the physics domain, and assessed documents retrieved from an integrated...... collection consisting of full text research articles in PDF, abstracts, and bibliographic records [6]. Bibliographic records were found to be more precise than full text PDFs, regardless of task complexity and topic specificity. PDFs were found to be more useful. Overall, for higher task complexity and topic...

  8. Application-specific integrated circuit design for a typical pressurized water reactor pressure channel trip

    International Nuclear Information System (INIS)

    Battle, R.E.; Manges, W.W.; Emery, M.S.; Vendermolen, R.I.; Bhatt, S.

    1994-01-01

    This article discusses the use of application-specific integrated circuits (ASICs) in nuclear plant safety systems. ASICs have certain advantages over software-based systems because they can be simple enough to be thoroughly tested, and they can be tailored to replace existing equipment. An architecture to replace a pressurized water reactor pressure channel trip is presented. Methods of implementing digital algorithms are also discussed

  9. Development of Integral Effect Test Facility P and ID and Technical Specification for SMART Fluid System

    International Nuclear Information System (INIS)

    Lee, Sang Il; Jung, Y. H.; Yang, H. J.; Song, S. Y.; Han, O. J.; Lee, B. J.; Kim, Y. A.; Lim, J. H.; Park, K. W.; Kim, N. G.

    2010-01-01

    SMART integral test loop is the thermal hydraulic test facility with a high pressure and temperature for simulating the major systems of the prototype reactor, SMART-330. The objective of this project is to conduct the basic design for constructing SMART ITL. The major results of this project include a series of design documents, technical specifications and P and ID. The results can be used as the fundamental materials for making the detailed design which is essential for manufacturing and installing SMART ITL

  10. Prespacer processing and specific integration in a Type I-A CRISPR system

    Science.gov (United States)

    Rollie, Clare; Graham, Shirley; Rouillon, Christophe

    2018-01-01

    Abstract The CRISPR–Cas system for prokaryotic adaptive immunity provides RNA-mediated protection from viruses and mobile genetic elements. Adaptation is dependent on the Cas1 and Cas2 proteins along with varying accessory proteins. Here we analyse the process in Sulfolobus solfataricus, showing that while Cas1 and Cas2 catalyze spacer integration in vitro, host factors are required for specificity. Specific integration also requires at least 400 bp of the leader sequence, and is dependent on the presence of hydrolysable ATP, suggestive of an active process that may involve DNA remodelling. Specific spacer integration is associated with processing of prespacer 3′ ends in a PAM-dependent manner. This is reflected in PAM-dependent processing of prespacer 3′ ends in vitro in the presence of cell lysate or the Cas4 nuclease, in a reaction consistent with PAM-directed binding and protection of prespacer DNA. These results highlight the diverse interplay between CRISPR–Cas elements and host proteins across CRISPR types. PMID:29228332

  11. Efficient site-specific integration in Plasmodium falciparum chromosomes mediated by mycobacteriophage Bxb1 integrase.

    Science.gov (United States)

    Nkrumah, Louis J; Muhle, Rebecca A; Moura, Pedro A; Ghosh, Pallavi; Hatfull, Graham F; Jacobs, William R; Fidock, David A

    2006-08-01

    Here we report an efficient, site-specific system of genetic integration into Plasmodium falciparum malaria parasite chromosomes. This is mediated by mycobacteriophage Bxb1 integrase, which catalyzes recombination between an incoming attP and a chromosomal attB site. We developed P. falciparum lines with the attB site integrated into the glutaredoxin-like cg6 gene. Transfection of these attB(+) lines with a dual-plasmid system, expressing a transgene on an attP-containing plasmid together with a drug resistance gene and the integrase on a separate plasmid, produced recombinant parasites within 2 to 4 weeks that were genetically uniform for single-copy plasmid integration. Integrase-mediated recombination resulted in proper targeting of parasite proteins to intra-erythrocytic compartments, including the apicoplast, a plastid-like organelle. Recombinant attB x attP parasites were genetically stable in the absence of drug and were phenotypically homogeneous. This system can be exploited for rapid genetic integration and complementation analyses at any stage of the P. falciparum life cycle, and it illustrates the utility of Bxb1-based integrative recombination for genetic studies of intracellular eukaryotic organisms.

  12. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    International Nuclear Information System (INIS)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon; Hunsberger, Carol

    2013-01-01

    Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods that these models do not consider. Maintaining and enhancing robust livelihoods upon bioenergy deployment is an equally important sustainability goal that warrants greater attention. The social implications of biofuel production are complex, varied and place-specific, difficult to model, operationalize and quantify. However, a rapidly developing body of social science literature is advancing the understanding of these interactions. In this letter we link human geography research on the interaction between biofuel crops and livelihoods in developing countries to integrated assessments on biofuels. We review case-study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences are a crucial complement to aggregate outcomes; this has not been given enough weight in comprehensive assessments to date. By narrowing the gap between place-specific case studies and global models, our discussion offers a route towards integrating livelihood and equity considerations into scenarios of future bioenergy deployment, thus contributing to a key challenge in sustainability sciences. (letter)

  13. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    Science.gov (United States)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon; Hunsberger, Carol

    2013-09-01

    Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods that these models do not consider. Maintaining and enhancing robust livelihoods upon bioenergy deployment is an equally important sustainability goal that warrants greater attention. The social implications of biofuel production are complex, varied and place-specific, difficult to model, operationalize and quantify. However, a rapidly developing body of social science literature is advancing the understanding of these interactions. In this letter we link human geography research on the interaction between biofuel crops and livelihoods in developing countries to integrated assessments on biofuels. We review case-study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences are a crucial complement to aggregate outcomes; this has not been given enough weight in comprehensive assessments to date. By narrowing the gap between place-specific case studies and global models, our discussion offers a route towards integrating livelihood and equity considerations into scenarios of future bioenergy deployment, thus contributing to a key challenge in sustainability sciences.

  14. Safe genetic modification of cardiac stem cells using a site-specific integration technique.

    Science.gov (United States)

    Lan, Feng; Liu, Junwei; Narsinh, Kazim H; Hu, Shijun; Han, Leng; Lee, Andrew S; Karow, Marisa; Nguyen, Patricia K; Nag, Divya; Calos, Michele P; Robbins, Robert C; Wu, Joseph C

    2012-09-11

    Human cardiac progenitor cells (hCPCs) are a promising cell source for regenerative repair after myocardial infarction. Exploitation of their full therapeutic potential may require stable genetic modification of the cells ex vivo. Safe genetic engineering of stem cells, using facile methods for site-specific integration of transgenes into known genomic contexts, would significantly enhance the overall safety and efficacy of cellular therapy in a variety of clinical contexts. We used the phiC31 site-specific recombinase to achieve targeted integration of a triple fusion reporter gene into a known chromosomal context in hCPCs and human endothelial cells. Stable expression of the reporter gene from its unique chromosomal integration site resulted in no discernible genomic instability or adverse changes in cell phenotype. Namely, phiC31-modified hCPCs were unchanged in their differentiation propensity, cellular proliferative rate, and global gene expression profile when compared with unaltered control hCPCs. Expression of the triple fusion reporter gene enabled multimodal assessment of cell fate in vitro and in vivo using fluorescence microscopy, bioluminescence imaging, and positron emission tomography. Intramyocardial transplantation of genetically modified hCPCs resulted in significant improvement in myocardial function 2 weeks after cell delivery, as assessed by echocardiography (P=0.002) and MRI (P=0.001). We also demonstrated the feasibility and therapeutic efficacy of genetically modifying differentiated human endothelial cells, which enhanced hind limb perfusion (Pmodification system is a safe, efficient tool to enable site-specific integration of reporter transgenes in progenitor and differentiated cell types.

  15. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    DEFF Research Database (Denmark)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon

    2013-01-01

    -study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across......Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods...... these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences...

  16. Integrating Hypnosis with Other Therapies for Treating Specific Phobias: A Case Series.

    Science.gov (United States)

    Hirsch, Joseph A

    2018-04-01

    There is a high prevalence of anxiety disorders including specific phobias and panic disorder in the United States and Europe. A variety of therapeutic modalities including pharmacotherapy, cognitive behavioral therapy, systematic desensitization, hypnosis, in vivo exposure, and virtual reality exposure therapy have been applied. No one modality has been entirely successful. There has been only a limited attempt to combine psychological therapies in the treatment of specific phobias and panic disorder and what has been done has been primarily with systematic desensitization or cognitive behavioral therapy along with hypnotherapy. I present two cases of multiple specific phobias that were successfully treated with hypnotherapy combined with virtual reality exposure therapy or in vivo exposure therapy. The rationale for this integrative therapy and the neurobiological constructs are considered.

  17. INTEGRATING COUNTRY-SPECIFIC CULTURE IN THE BRANDING STRATEGY FOR BUILDING GLOBAL SUCCESS

    Directory of Open Access Journals (Sweden)

    Alexandra IOANID

    2014-11-01

    Full Text Available A strong brand is the one that integrates its cultural origins and values with the cultural values of the countries where it operates, building relationships based on trust with the local consumers. The chances for a company to gain share market when starting operations in a new country grows a lot if the management allows enough regional flexibility on how the brands are marketed, according to the cultural characteristics of the potential local customers. In the actual globalized business environment, the brand marketer has the choice to adopt a global or a local approach in the marketing strategy, that most of the times determines the success or the failure of the business in a specific country. An important challenge for any marketer is the integration of the brand-culture with the country-culture and in this context, the paper analyses different cultures and offers some branding strategies valid for both products and services. This paper aims to demonstrate the importance of the country-specific culture integration in the marketing strategy of a company for growing the effectiveness of all its operations. The ideas mentioned in this paper are based on literature research and also on authors’ experience with multicultural environments.

  18. Questioning the social intelligence hypothesis.

    Science.gov (United States)

    Holekamp, Kay E

    2007-02-01

    The social intelligence hypothesis posits that complex cognition and enlarged "executive brains" evolved in response to challenges that are associated with social complexity. This hypothesis has been well supported, but some recent data are inconsistent with its predictions. It is becoming increasingly clear that multiple selective agents, and non-selective constraints, must have acted to shape cognitive abilities in humans and other animals. The task now is to develop a larger theoretical framework that takes into account both inter-specific differences and similarities in cognition. This new framework should facilitate consideration of how selection pressures that are associated with sociality interact with those that are imposed by non-social forms of environmental complexity, and how both types of functional demands interact with phylogenetic and developmental constraints.

  19. Revisiting the Dutch hypothesis

    NARCIS (Netherlands)

    Postma, Dirkje S.; Weiss, Scott T.; van den Berge, Maarten; Kerstjens, Huib A. M.; Koppelman, Gerard H.

    The Dutch hypothesis was first articulated in 1961, when many novel and advanced scientific techniques were not available, such as genomics techniques for pinpointing genes, gene expression, lipid and protein profiles, and the microbiome. In addition, computed tomographic scans and advanced analysis

  20. The Lehman Sisters Hypothesis

    NARCIS (Netherlands)

    I.P. van Staveren (Irene)

    2014-01-01

    markdownabstract__Abstract__ This article explores the Lehman Sisters Hypothesis. It reviews empirical literature about gender differences in behavioral, experimental, and neuro-economics as well as in other fields of behavioral research. It discusses gender differences along three dimensions of

  1. Whiplash and the compensation hypothesis.

    Science.gov (United States)

    Spearing, Natalie M; Connelly, Luke B

    2011-12-01

    Review article. To explain why the evidence that compensation-related factors lead to worse health outcomes is not compelling, either in general, or in the specific case of whiplash. There is a common view that compensation-related factors lead to worse health outcomes ("the compensation hypothesis"), despite the presence of important, and unresolved sources of bias. The empirical evidence on this question has ramifications for the design of compensation schemes. Using studies on whiplash, this article outlines the methodological problems that impede attempts to confirm or refute the compensation hypothesis. Compensation studies are prone to measurement bias, reverse causation bias, and selection bias. Errors in measurement are largely due to the latent nature of whiplash injuries and health itself, a lack of clarity over the unit of measurement (specific factors, or "compensation"), and a lack of appreciation for the heterogeneous qualities of compensation-related factors and schemes. There has been a failure to acknowledge and empirically address reverse causation bias, or the likelihood that poor health influences the decision to pursue compensation: it is unclear if compensation is a cause or a consequence of poor health, or both. Finally, unresolved selection bias (and hence, confounding) is evident in longitudinal studies and natural experiments. In both cases, between-group differences have not been addressed convincingly. The nature of the relationship between compensation-related factors and health is unclear. Current approaches to testing the compensation hypothesis are prone to several important sources of bias, which compromise the validity of their results. Methods that explicitly test the hypothesis and establish whether or not a causal relationship exists between compensation factors and prolonged whiplash symptoms are needed in future studies.

  2. Operational Excellence through Schedule Optimization and Production Simulation of Application Specific Integrated Circuits.

    Energy Technology Data Exchange (ETDEWEB)

    Flory, John Andrew [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Padilla, Denise D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Gauthier, John H. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Zwerneman, April Marie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Miller, Steven P [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-05-01

    Upcoming weapon programs require an aggressive increase in Application Specific Integrated Circuit (ASIC) production at Sandia National Laboratories (SNL). SNL has developed unique modeling and optimization tools that have been instrumental in improving ASIC production productivity and efficiency, identifying optimal operational and tactical execution plans under resource constraints, and providing confidence in successful mission execution. With ten products and unprecedented levels of demand, a single set of shared resources, highly variable processes, and the need for external supplier task synchronization, scheduling is an integral part of successful manufacturing. The scheduler uses an iterative multi-objective genetic algorithm and a multi-dimensional performance evaluator. Schedule feasibility is assessed using a discrete event simulation (DES) that incorporates operational uncertainty, variability, and resource availability. The tools provide rapid scenario assessments and responses to variances in the operational environment, and have been used to inform major equipment investments and workforce planning decisions in multiple SNL facilities.

  3. Integrating Iris and Signature Traits for Personal Authentication Using User-SpecificWeighting

    Directory of Open Access Journals (Sweden)

    Serestina Viriri

    2012-03-01

    Full Text Available Biometric systems based on uni-modal traits are characterized by noisy sensor data, restricted degrees of freedom, non-universality and are susceptible to spoof attacks. Multi-modal biometric systems seek to alleviate some of these drawbacks by providing multiple evidences of the same identity. In this paper, a user-score-based weighting technique for integrating the iris and signature traits is presented. This user-specific weighting technique has proved to be an efficient and effective fusion scheme which increases the authentication accuracy rate of multi-modal biometric systems. The weights are used to indicate the importance of matching scores output by each biometrics trait. The experimental results show that our biometric system based on the integration of iris and signature traits achieve a false rejection rate (FRR of 0.08% and a false acceptance rate (FAR of 0.01%.

  4. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  5. Integration of Descending Command Systems for the Generation of Context-Specific Locomotor Behaviors

    Directory of Open Access Journals (Sweden)

    Linda H. Kim

    2017-10-01

    Full Text Available Over the past decade there has been a renaissance in our understanding of spinal cord circuits; new technologies are beginning to provide key insights into descending circuits which project onto spinal cord central pattern generators. By integrating work from both the locomotor and animal behavioral fields, we can now examine context-specific control of locomotion, with an emphasis on descending modulation arising from various regions of the brainstem. Here we examine approach and avoidance behaviors and the circuits that lead to the production and arrest of locomotion.

  6. Design and Verification of Application Specific Integrated Circuits in a Network of Online Labs

    Directory of Open Access Journals (Sweden)

    A.Y. Al-Zoubi

    2009-08-01

    Full Text Available A solution to implement a remote laboratory for testing and designing analog Application-Specific Integrated Circuits of the type (ispPAC10 is presented. The application allows electrical engineering students to access and perform measurements and conduct analog electronics experiments over the internet. PAC-Designer software, running on a Citrix server, is used in the circuit design in which the signals are generated and the responses are acquired by a data acquisition board controlled by LabVIEW. Three interconnected remote labs located in three different continents will be implementing the proposed system.

  7. A Domain Specific Embedded Language in C++ for Automatic Differentiation, Projection, Integration and Variational Formulations

    Directory of Open Access Journals (Sweden)

    Christophe Prud'homme

    2006-01-01

    Full Text Available In this article, we present a domain specific embedded language in C++ that can be used in various contexts such as numerical projection onto a functional space, numerical integration, variational formulations and automatic differentiation. Albeit these tools operate in different ways, the language overcomes this difficulty by decoupling expression constructions from evaluation. The language is implemented using expression templates and meta-programming techniques and uses various Boost libraries. The language is exercised on a number of non-trivial examples and a benchmark presents the performance behavior on a few test problems.

  8. CEO Appointments and the Loss of Firm-specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren

    2008-01-01

    the last thirty years. Assuming that general managerial skills are becoming more important relative to firm-specific skills, the authors conclude that competition in the managerial labor market establishes optimal contracts. In our model and our empirical analysis we question this explanation by assuming...... that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest...

  9. CEO Appointments and the Loss of Firm-Specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren; Osterloh, Margit

    2008-01-01

    the last thirty years. Assuming that general managerial skills are becoming more important relative to firm-specific skills, the authors conclude that competition in the managerial labor market establishes optimal contracts. In our model and our empirical analysis we question this explanation by assuming...... that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest...

  10. Field Assessment and Specification Review for Roller-Integrated Compaction Monitoring Technologies

    Directory of Open Access Journals (Sweden)

    David J. White

    2011-01-01

    Full Text Available Roller-integrated compaction monitoring (RICM technologies provide virtually 100-percent coverage of compacted areas with real-time display of the compaction measurement values. Although a few countries have developed quality control (QC and quality assurance (QA specifications, broader implementation of these technologies into earthwork construction operations still requires a thorough understanding of relationships between RICM values and traditional in situ point test measurements. The purpose of this paper is to provide: (a an overview of two technologies, namely, compaction meter value (CMV and machine drive power (MDP; (b a comprehensive review of field assessment studies, (c an overview of factors influencing statistical correlations, (d modeling for visualization and characterization of spatial nonuniformity; and (e a brief review of the current specifications.

  11. Testing Requirements to Manage Data Exchange Specifications in Enterprise Integration - A Schema Design Quality Focus.

    Energy Technology Data Exchange (ETDEWEB)

    Kulvatunyou, Boonserm [ORNL; Ivezic, Nenad [ORNL; Buhwan, Jeong [POSTECH University, South Korea

    2004-07-01

    In this paper, we describe the requirements to test W3C XML Schema usage when defining message schemas for data exchange in any large and evolving enterprise integration project. We then decompose the XML Schema testing into four (4) aspects including the message schema conformance to the XML Schema specification grammar, the message schema conformance to the XML Schema specification semantics, the message schema conformance to design quality testing, and canonical semantics testing of the message schema. We describe these four testing aspects in some detail and point to other related efforts. We further focus to provide some technical details for the message schema design quality testing. As a future work, we describe the requirements for canonical semantics testing and potential solution approaches. Finally, we describe an implementation architecture for the message schema design quality testing.

  12. Issues of verification and validation of application-specific integrated circuits in reactor trip systems

    International Nuclear Information System (INIS)

    Battle, R.E.; Alley, G.T.

    1993-01-01

    Concepts of using application-specific integrated circuits (ASICs) in nuclear reactor safety systems are evaluated. The motivation for this evaluation stems from the difficulty of proving that software-based protection systems are adequately reliable. Important issues concerning the reliability of computers and software are identified and used to evaluate features of ASICS. These concepts indicate that ASICs have several advantages over software for simple systems. The primary advantage of ASICs over software is that verification and validation (V ampersand V) of ASICs can be done with much higher confidence than can be done with software. A method of performing this V ampersand V on ASICS is being developed at Oak Ridge National Laboratory. The purpose of the method's being developed is to help eliminate design and fabrication errors. It will not solve problems with incorrect requirements or specifications

  13. [Integrity].

    Science.gov (United States)

    Gómez Rodríguez, Rafael Ángel

    2014-01-01

    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  14. Bayesian Hypothesis Testing

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, Stephen A. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sigeti, David E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-11-15

    These are a set of slides about Bayesian hypothesis testing, where many hypotheses are tested. The conclusions are the following: The value of the Bayes factor obtained when using the median of the posterior marginal is almost the minimum value of the Bayes factor. The value of τ2 which minimizes the Bayes factor is a reasonable choice for this parameter. This allows a likelihood ratio to be computed with is the least favorable to H0.

  15. The Drift Burst Hypothesis

    OpenAIRE

    Christensen, Kim; Oomen, Roel; Renò, Roberto

    2016-01-01

    The Drift Burst Hypothesis postulates the existence of short-lived locally explosive trends in the price paths of financial assets. The recent US equity and Treasury flash crashes can be viewed as two high profile manifestations of such dynamics, but we argue that drift bursts of varying magnitude are an expected and regular occurrence in financial markets that can arise through established mechanisms such as feedback trading. At a theoretical level, we show how to build drift bursts into the...

  16. Hypothesis in research

    Directory of Open Access Journals (Sweden)

    Eudaldo Enrique Espinoza Freire

    2018-01-01

    Full Text Available It is intended with this work to have a material with the fundamental contents, which enable the university professor to formulate the hypothesis, for the development of an investigation, taking into account the problem to be solved. For its elaboration, the search of information in primary documents was carried out, such as thesis of degree and reports of research results, selected on the basis of its relevance with the analyzed subject, current and reliability, secondary documents, as scientific articles published in journals of recognized prestige, the selection was made with the same terms as in the previous documents. It presents a conceptualization of the updated hypothesis, its characterization and an analysis of the structure of the hypothesis in which the determination of the variables is deepened. The involvement of the university professor in the teaching-research process currently faces some difficulties, which are manifested, among other aspects, in an unstable balance between teaching and research, which leads to a separation between them.

  17. Systematic identification and integrative analysis of novel genes expressed specifically or predominantly in mouse epididymis

    Directory of Open Access Journals (Sweden)

    Lee Hoyong

    2006-12-01

    Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.

  18. Test and verification of a reactor protection system application-specific integrated circuit

    International Nuclear Information System (INIS)

    Battle, R.E.; Turner, G.W.; Vandermolen, R.I.; Vitalbo, C.

    1997-01-01

    Application-specific integrated circuits (ASICs) were utilized in the design of nuclear plant safety systems because they have certain advantages over software-based systems and analog-based systems. An advantage they have over software-based systems is that an ASIC design can be simple enough to not include branch statements and also can be thoroughly tested. A circuit card on which an ASIC is mounted can be configured to replace various versions of older analog equipment with fewer design types required. The approach to design and testing of ASICs for safety system applications is discussed in this paper. Included are discussions of the ASIC architecture, how it is structured to assist testing, and of the functional and enhanced circuit testing

  19. Differential and Integral Calculus in careers of technical sciences. Specificities of their teaching

    Directory of Open Access Journals (Sweden)

    Iván Javier Villamar-Alvarado

    2017-12-01

    Full Text Available The Differential and Integral Calculus has great relevance for the professionals of the technical sciences since it provides them with a solid theoretical-conceptual body to process information, to use models that simulate real processes, to solve technical problems, to work in multidisciplinary projects and to communicate with precision. In spite of this relevance, there are numerous international dissatisfactions related to their learning by training engineers. The objective was to unveil the specificities of the teaching-learning process of this discipline that favor a successful appropriation of its content by the future engineers. The result was to unveil the didactic need to resolve the dialectical contradiction that manifests itself between the systematization of the engineering functionality of the aforementioned content and its contextualized interdisciplinary generalization. As a consequence, the need arises to create new didactic proposals that overcome this contradiction, as a way to perfect the teaching-learning process of this discipline in the engineering careers.

  20. An application specific integrated circuit and data acquisition system for digital X-ray imaging

    International Nuclear Information System (INIS)

    Beuville, E.; Cederstroem, B.; Danielsson, M.; Luo, L.; Nygren, D.; Oltman, E.; Vestlund, J.

    1998-01-01

    We have developed an application specific integrated circuit (ASIC) and data acquisition system for digital X-ray imaging. The chip consists of 16 parallel channels, each containing preamplifier, shaper, comparator and a 16 bit counter. We have demonstrated noiseless single-photon counting over a threshold of 7.2 keV using Silicon detectors and are presently capable of maximum counting rates of 2 MHz per channel. The ASIC is controlled by a personal computer through a commercial PCI card, which is also used for data acquisition. The content of the 16 bit counters are loaded into a shift register and transferred to the PC at any time at a rate of 20 MHz. The system is non-complicated, low cost and high performance and is optimised for digital X-ray imaging applications. (orig.)

  1. Application specific integrated circuit (ASIC) readout technologies for future ion beam analytical instruments

    Energy Technology Data Exchange (ETDEWEB)

    Whitlow, Harry J. E-mail: harry_j.whitlow@nuclear.lu.se

    2000-03-01

    New possibilities for ion beam analysis (IBA) are afforded by recent developments in detector technology which facilitate the parallel collection of data from a large number of channels. Application specific integrated circuit (ASIC) technologies, which have been widely employed for multi-channel readout systems in nuclear and particle physics, are more net-cost effective (160/channel for 1000 channels) and a more rational solution for readout of a large number of channels than afforded by conventional electronics. Based on results from existing and on-going chip designs, the possibilities and issues of ASIC readout technology are considered from the IBA viewpoint. Consideration is given to readout chip architecture and how the stringent resolution, linearity and stability requirements for IBA may be met. In addition the implications of the restrictions imposed by ASIC technology are discussed.

  2. An application specific integrated circuit and data acquisition system for digital X-ray imaging

    Energy Technology Data Exchange (ETDEWEB)

    Beuville, E.; Cederstroem, B.; Danielsson, M.; Luo, L.; Nygren, D.; Oltman, E.; Vestlund, J. [Lawrence Berkeley National Lab., CA (United States)

    1998-04-01

    We have developed an application specific integrated circuit (ASIC) and data acquisition system for digital X-ray imaging. The chip consists of 16 parallel channels, each containing preamplifier, shaper, comparator and a 16 bit counter. We have demonstrated noiseless single-photon counting over a threshold of 7.2 keV using Silicon detectors and are presently capable of maximum counting rates of 2 MHz per channel. The ASIC is controlled by a personal computer through a commercial PCI card, which is also used for data acquisition. The content of the 16 bit counters are loaded into a shift register and transferred to the PC at any time at a rate of 20 MHz. The system is non-complicated, low cost and high performance and is optimised for digital X-ray imaging applications. (orig.). 11 refs.

  3. Sport Skill-Specific Expertise Biases Sensory Integration for Spatial Referencing and Postural Control.

    Science.gov (United States)

    Thalassinos, Michalis; Fotiadis, Giorgos; Arabatzi, Fotini; Isableu, Brice; Hatzitaki, Vassilia

    2017-09-15

    The authors asked how sport expertise modulates visual field dependence and sensory reweighting for controlling posture. Experienced soccer athletes, ballet dancers, and nonathletes performed (a) a Rod and Frame test and (b) a 100-s bipedal stance task during which vision and proprioception were successively or concurrently disrupted in 20-s blocks. Postural adaptation was assessed in the mean center of pressure displacement, root mean square of center of pressure velocity and ankle muscles integrated electromyography activity. Soccer athletes were more field dependent than were nonathletes. During standing, dancers were more destabilized by vibration and required more time to reweigh sensory information compared with the other 2 groups. These findings reveal a sport skill-specific bias in the reweighing of sensory inputs for spatial orientation and postural control.

  4. Direct effects of ionizing radiation on integral membrane proteins. Noncovalent energy transfer requires specific interpeptide interactions

    International Nuclear Information System (INIS)

    Jhun, E.; Jhun, B.H.; Jones, L.R.; Jung, C.Y.

    1991-01-01

    The 12 transmembrane alpha helices (TMHs) of human erythrocyte glucose transporter were individually cut by pepsin digestion as membrane-bound 2.5-3.5-kDa peptide fragments. Radiation-induced chemical degradation of these fragments showed an average target size of 34 kDa. This is 10-12 x larger than the average size of an individual TMH, demonstrating that a significant energy transfer occurs among these TMHs in the absence of covalent linkage. Heating this TMH preparation at 100 degree C for 15 min reduced the target size to 5 kDa or less, suggesting that the noncovalent energy transfer requires specific helix-helix interactions. Purified phospholamban, a small (6-kDa) integral membrane protein containing a single TMH, formed a pentameric assembly in sodium dodecyl sulfate. The chemical degradation target size of this phospholamban pentamer was 5-6 kDa, illustrating that not all integral membrane protein assemblies permit intersubunit energy transfer. These findings together with other published observations suggest strongly that significant noncovalent energy transfer can occur within the tertiary and quaternary structure of membrane proteins and that as yet undefined proper molecular interactions are required for such covalent energy transfer. Our results with pepsin-digested glucose transporter also illustrate the importance of the interhelical interaction as a predominating force in maintaining the tertiary structure of a transmembrane protein

  5. Hanford Integrated Planning Process: 1993 Hanford Site-specific science and technology plan

    International Nuclear Information System (INIS)

    1993-12-01

    This document is the FY 1993 report on Hanford Site-specific science and technology (S ampersand T) needs for cleanup of the Site as developed via the Hanford Integrated Planning Process (HIPP). It identifies cleanup problems that lack demonstrated technology solutions and technologies that require additional development. Recommendations are provided regarding allocation of funding to address Hanford's highest-priority technology improvement needs, technology development needs, and scientific research needs, all compiled from a Sitewide perspective. In the past, the S ampersand T agenda for Hanford Site cleanup was sometimes driven by scientists and technologists, with minimal input from the ''problem owners'' (i.e., Westinghouse Hanford Company [WHC] staff who are responsible for cleanup activities). At other times, the problem-owners made decisions to proceed with cleanup without adequate scientific and technological inputs. Under both of these scenarios, there was no significant stakeholder involvement in the decision-making process. One of the key objectives of HIPP is to develop an understanding of the integrated S ampersand T requirements to support the cleanup mission, (a) as defined by the needs of the problem owners, the values of the stakeholders, and the technology development expertise that exists at Hanford and elsewhere. This requires a periodic, systematic assessment of these needs and values to appropriately define a comprehensive technology development program and a complementary scientific research program. Basic to our success is a methodology that is defensible from a technical perspective and acceptable to the stakeholders

  6. System/subsystem specifications for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)

    Energy Technology Data Exchange (ETDEWEB)

    Rollow, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States); Faby, E.Z.; Fluker, J.; Grubb, J.; Hancock, B.R. [Univ. of Tennessee, Knoxville, TN (United States); Ferguson, R.A. [Science Applications International Corp., Oak Ridge, TN (United States)

    1995-11-20

    A system is being developed by the Military Traffic Management Command (MTMC) to provide data integration and worldwide management and tracking of surface cargo movements. The Integrated Cargo Database (ICDB) will be a data repository for the WPS terminal-level system, will be a primary source of queries and cargo traffic reports, will receive data from and provide data to other MTMC and non-MTMC systems, will provide capabilities for processing Advance Transportation Control and Movement Documents (ATCMDs), and will process and distribute manifests. This System/Subsystem Specifications for the Worldwide Port System Regional ICDB documents the system/subsystem functions, provides details of the system/subsystem analysis in order to provide a communication link between developers and operational personnel, and identifies interfaces with other systems and subsystems. It must be noted that this report is being produced near the end of the initial development phase of ICDB, while formal software testing is being done. Following the initial implementation of the ICDB system, maintenance contractors will be in charge of making changes and enhancing software modules. Formal testing and user reviews may indicate the need for additional software units or changes to existing ones. This report describes the software units that are components of this ICDB system as of August 1995.

  7. A High-Performance Application Specific Integrated Circuit for Electrical and Neurochemical Traumatic Brain Injury Monitoring.

    Science.gov (United States)

    Pagkalos, Ilias; Rogers, Michelle L; Boutelle, Martyn G; Drakakis, Emmanuel M

    2018-05-22

    This paper presents the first application specific integrated chip (ASIC) for the monitoring of patients who have suffered a Traumatic Brain Injury (TBI). By monitoring the neurophysiological (ECoG) and neurochemical (glucose, lactate and potassium) signals of the injured human brain tissue, it is possible to detect spreading depolarisations, which have been shown to be associated with poor TBI patient outcome. This paper describes the testing of a new 7.5 mm 2 ASIC fabricated in the commercially available AMS 0.35 μm CMOS technology. The ASIC has been designed to meet the demands of processing the injured brain tissue's ECoG signals, recorded by means of depth or brain surface electrodes, and neurochemical signals, recorded using microdialysis coupled to microfluidics-based electrochemical biosensors. The potentiostats use switchedcapacitor charge integration to record currents with 100 fA resolution, and allow automatic gain changing to track the falling sensitivity of a biosensor. This work supports the idea of a "behind the ear" wireless microplatform modality, which could enable the monitoring of currently non-monitored mobile TBI patients for the onset of secondary brain injury. ©2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  8. An integrated domain specific language for post-processing and visualizing electrophysiological signals in Java.

    Science.gov (United States)

    Strasser, T; Peters, T; Jagle, H; Zrenner, E; Wilke, R

    2010-01-01

    Electrophysiology of vision - especially the electroretinogram (ERG) - is used as a non-invasive way for functional testing of the visual system. The ERG is a combined electrical response generated by neural and non-neuronal cells in the retina in response to light stimulation. This response can be recorded and used for diagnosis of numerous disorders. For both clinical practice and clinical trials it is important to process those signals in an accurate and fast way and to provide the results as structured, consistent reports. Therefore, we developed a freely available and open-source framework in Java (http://www.eye.uni-tuebingen.de/project/idsI4sigproc). The framework is focused on an easy integration with existing applications. By leveraging well-established software patterns like pipes-and-filters and fluent interfaces as well as by designing the application programming interfaces (API) as an integrated domain specific language (DSL) the overall framework provides a smooth learning curve. Additionally, it already contains several processing methods and visualization features and can be extended easily by implementing the provided interfaces. In this way, not only can new processing methods be added but the framework can also be adopted for other areas of signal processing. This article describes in detail the structure and implementation of the framework and demonstrate its application through the software package used in clinical practice and clinical trials at the University Eye Hospital Tuebingen one of the largest departments in the field of visual electrophysiology in Europe.

  9. Integrating English for Specific Purposes Courseware into Task-Based Learning in a Context of Preparing for International Trade Fairs

    Science.gov (United States)

    Tsai, Shu-Chiao

    2013-01-01

    This study reports on integrating courseware for participating in international trade fairs into English for specific purposes (ESP) instruction at a technical university in Taiwan. An Information and Communication Technology (ICT) approach combining courseware integration with Task Based Learning (TBL), was adopted. Evaluation of implementing…

  10. [Dilemma of null hypothesis in ecological hypothesis's experiment test.

    Science.gov (United States)

    Li, Ji

    2016-06-01

    Experimental test is one of the major test methods of ecological hypothesis, though there are many arguments due to null hypothesis. Quinn and Dunham (1983) analyzed the hypothesis deduction model from Platt (1964) and thus stated that there is no null hypothesis in ecology that can be strictly tested by experiments. Fisher's falsificationism and Neyman-Pearson (N-P)'s non-decisivity inhibit statistical null hypothesis from being strictly tested. Moreover, since the null hypothesis H 0 (α=1, β=0) and alternative hypothesis H 1 '(α'=1, β'=0) in ecological progresses are diffe-rent from classic physics, the ecological null hypothesis can neither be strictly tested experimentally. These dilemmas of null hypothesis could be relieved via the reduction of P value, careful selection of null hypothesis, non-centralization of non-null hypothesis, and two-tailed test. However, the statistical null hypothesis significance testing (NHST) should not to be equivalent to the causality logistical test in ecological hypothesis. Hence, the findings and conclusions about methodological studies and experimental tests based on NHST are not always logically reliable.

  11. Autonomous Integrated Receive System (AIRS) requirements definition. Volume 4: Functional specification for the prototype Automated Integrated Receive System (AIRS)

    Science.gov (United States)

    Chie, C. M.

    1984-01-01

    The functional requirements for the performance, design, and testing for the prototype Automated Integrated Receive System (AIRS) to be demonstrated for the TDRSS S-Band Single Access Return Link are presented.

  12. The Bergschrund Hypothesis Revisited

    Science.gov (United States)

    Sanders, J. W.; Cuffey, K. M.; MacGregor, K. R.

    2009-12-01

    After Willard Johnson descended into the Lyell Glacier bergschrund nearly 140 years ago, he proposed that the presence of the bergschrund modulated daily air temperature fluctuations and enhanced freeze-thaw processes. He posited that glaciers, through their ability to birth bergschrunds, are thus able to induce rapid cirque headwall retreat. In subsequent years, many researchers challenged the bergschrund hypothesis on grounds that freeze-thaw events did not occur at depth in bergschrunds. We propose a modified version of Johnson’s original hypothesis: that bergschrunds maintain subfreezing temperatures at values that encourage rock fracture via ice lensing because they act as a cold air trap in areas that would otherwise be held near zero by temperate glacial ice. In support of this claim we investigated three sections of the bergschrund at the West Washmawapta Glacier, British Columbia, Canada, which sits in an east-facing cirque. During our bergschrund reconnaissance we installed temperature sensors at multiple elevations, light sensors at depth in 2 of the 3 locations and painted two 1 m2 sections of the headwall. We first emphasize bergschrunds are not wanting for ice: verglas covers significant fractions of the headwall and icicles dangle from the base of bödens or overhanging rocks. If temperature, rather than water availability, is the limiting factor governing ice-lensing rates, our temperature records demonstrate that the bergschrund provides a suitable environment for considerable rock fracture. At the three sites (north, west, and south walls), the average temperature at depth from 9/3/2006 to 8/6/2007 was -3.6, -3.6, and -2.0 °C, respectively. During spring, when we observed vast amounts of snow melt trickle in to the bergschrund, temperatures averaged -3.7, -3.8, and -2.2 °C, respectively. Winter temperatures are even lower: -8.5, -7.3, and -2.4 °C, respectively. Values during the following year were similar. During the fall, diurnal

  13. Region-specific role for Pten in maintenance of epithelial phenotype and integrity

    Science.gov (United States)

    Flodby, Per; Sunohara, Mitsuhiro; Castillo, Dan R.; McConnell, Alicia M.; Krishnaveni, Manda S.; Banfalvi, Agnes; Li, Min; Stripp, Barry; Zhou, Beiyun; Crandall, Edward D.; Minoo, Parviz

    2017-01-01

    Previous studies have demonstrated resistance to naphthalene-induced injury in proximal airways of mice with lung epithelial-specific deletion of the tumor-suppressor gene Pten, attributed to increased proliferation of airway progenitors. We tested effects of Pten loss following bleomycin injury, a model typically used to study distal lung epithelial injury, in conditional PtenSFTPC-cre knockout mice. Pten-deficient airway epithelium exhibited marked hyperplasia, particularly in small bronchioles and at bronchoalveolar duct junctions, with reduced E-cadherin and β-catenin expression between cells toward the luminal aspect of the hyperplastic epithelium. Bronchiolar epithelial and alveolar epithelial type II (AT2) cells in PtenSFTPC-cre mice showed decreased expression of epithelial markers and increased expression of mesenchymal markers, suggesting at least partial epithelial-mesenchymal transition at baseline. Surprisingly, and in contrast to previous studies, mutant mice were exquisitely sensitive to bleomycin, manifesting rapid weight loss, respiratory distress, increased early mortality (by day 5), and reduced dynamic lung compliance. This was accompanied by sloughing of the hyperplastic airway epithelium with occlusion of small bronchioles by cellular debris, without evidence of increased parenchymal lung injury. Increased airway epithelial cell apoptosis due to loss of antioxidant defenses, reflected by decreased expression of superoxide dismutase 3, in combination with deficient intercellular adhesion, likely predisposed to airway sloughing in knockout mice. These findings demonstrate an important role for Pten in maintenance of airway epithelial phenotype integrity and indicate that responses to Pten deletion in respiratory epithelium following acute lung injury are highly context-dependent and region-specific. PMID:27864284

  14. Growth specificity of vertical ZnO nanorods on patterned seeded substrates through integrated chemical process

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, P. Suresh [Thin Film and Nanomaterials Laboratory, Department of Physics, Bharathiar University, Coimbatore 641 046 (India); Maniam, S.M. [Centre for Quantum Technologies, National University of Singapore (Singapore); Sundaramurthy, J. [Department of Chemical and Biomolecular Engineering, National University of Singapore (NUS) (Singapore); Arokiaraj, J. [3M R and D Center (Singapore); Mangalaraj, D., E-mail: dmraj800@yahoo.com [Department of Nanoscience and Technology, Bharathiar University, Coimbatore 641046 (India); Rajarathnam, D. [CERAR, University of South Australia, Mawson Lakes, SA-5095 (Australia); Srinivasan, M.P. [Department of Chemical and Biomolecular Engineering, National University of Singapore (NUS) (Singapore); Jian, L.K. [Singapore Synchrotron Light Source (SSLS), National University of Singapore (NUS) (Singapore)

    2012-03-15

    Highlights: Black-Right-Pointing-Pointer Simple integrated chemical process was adopted for specific ZnO nanorod growth. Black-Right-Pointing-Pointer Size and orientation of nanorods are well controlled by optimum reaction time and temperature. Black-Right-Pointing-Pointer Different site-selective ZnO nanorod growths are demonstrated. - Abstract: A simple and cost effective method has been employed for the random growth and oriented ZnO nanorod arrays over as-prepared and patterned seeded glass substrates by low temperature two step growth process and growth specificity by direct laser writing (DLW) process. Scanning electron microscopy (SEM) images and X-ray diffraction analysis confirm the growth of vertical ZnO nanorods with perfect (0 0 2) orientation along c-axis which is in conjunction with optimizing the parameters at different reaction times and temperatures. Transmission electron microscopy (TEM) images show the formation of vertical ZnO nanorods with diameter and length of {approx}120 nm and {approx}400 nm respectively. Photoluminescence (PL) spectroscopic studies show a narrow emission at {approx}385 nm and a broad visible emission from 450 to 600 nm. Further, site-selective ZnO nanorod growth is demonstrated for its high degree of control over size, orientation, uniformity, and periodicity on a positive photoresist ZnO seed layer by simple geometrical (line, circle and ring) patterns of 10 {mu}m and 5 {mu}m dimensions. The demonstrated control over size, orientation and periodicity of ZnO nanorods process opens up an opportunity to develop multifunctional properties which promises their potential applications in sensor, piezoelectric, and optoelectronic devices.

  15. Linux OS integrated modular avionics application development framework with apex API of ARINC653 specification

    Directory of Open Access Journals (Sweden)

    Anna V. Korneenkova

    2017-01-01

    Full Text Available The framework is made to provide tools to develop the integrated modular avionics (IMA applications, which could be launched on the target platform LynxOs-178 without modifying their source code. The framework usage helps students to form skills for developing modern modules of the avionics. In addition, students obtain deeper knowledge for the development of competencies in the field of technical creativity by using of the framework.The article describes the architecture and implementation of the Linux OS framework for ARINC653 compliant OS application development.The proposed approach reduces ARINC-653 application development costs and gives a unified tool to implement OS vendor independent code that meets specification. To achieve import substitution free and open-source Linux OS is used as an environment for developing IMA applications.The proposed framework is applicable for using as the tool to develop IMA applications and as the tool for development of the following competencies: the ability to master techniques of using software to solve practical problems, the ability to develop components of hardware and software systems and databases, using modern tools and programming techniques, the ability to match hardware and software tools in the information and automated systems, the readiness to apply the fundamentals of informatics and programming to designing, constructing and testing of software products, the readiness to apply basic methods and tools of software development, knowledge of various technologies of software development.

  16. Applying an Integrative Framework of Executive Function to Preschoolers With Specific Language Impairment.

    Science.gov (United States)

    Kapa, Leah L; Plante, Elena; Doubleday, Kevin

    2017-08-16

    The first goal of this research was to compare verbal and nonverbal executive function abilities between preschoolers with and without specific language impairment (SLI). The second goal was to assess the group differences on 4 executive function components in order to determine if the components may be hierarchically related as suggested within a developmental integrative framework of executive function. This study included 26 4- and 5-year-olds diagnosed with SLI and 26 typically developing age- and sex-matched peers. Participants were tested on verbal and nonverbal measures of sustained selective attention, working memory, inhibition, and shifting. The SLI group performed worse compared with typically developing children on both verbal and nonverbal measures of sustained selective attention and working memory, the verbal inhibition task, and the nonverbal shifting task. Comparisons of standardized group differences between executive function measures revealed a linear increase with the following order: working memory, inhibition, shifting, and sustained selective attention. The pattern of results suggests that preschoolers with SLI have deficits in executive functioning compared with typical peers, and deficits are not limited to verbal tasks. A significant linear relationship between group differences across executive function components supports the possibility of a hierarchical relationship between executive function skills.

  17. Applying an Integrative Framework of Executive Function to Preschoolers With Specific Language Impairment

    Science.gov (United States)

    Plante, Elena; Doubleday, Kevin

    2017-01-01

    Purpose The first goal of this research was to compare verbal and nonverbal executive function abilities between preschoolers with and without specific language impairment (SLI). The second goal was to assess the group differences on 4 executive function components in order to determine if the components may be hierarchically related as suggested within a developmental integrative framework of executive function. Method This study included 26 4- and 5-year-olds diagnosed with SLI and 26 typically developing age- and sex-matched peers. Participants were tested on verbal and nonverbal measures of sustained selective attention, working memory, inhibition, and shifting. Results The SLI group performed worse compared with typically developing children on both verbal and nonverbal measures of sustained selective attention and working memory, the verbal inhibition task, and the nonverbal shifting task. Comparisons of standardized group differences between executive function measures revealed a linear increase with the following order: working memory, inhibition, shifting, and sustained selective attention. Conclusion The pattern of results suggests that preschoolers with SLI have deficits in executive functioning compared with typical peers, and deficits are not limited to verbal tasks. A significant linear relationship between group differences across executive function components supports the possibility of a hierarchical relationship between executive function skills. PMID:28724132

  18. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  19. Integrative proteomics, genomics, and translational immunology approaches reveal mutated forms of Proteolipid Protein 1 (PLP1) and mutant-specific immune response in multiple sclerosis.

    Science.gov (United States)

    Qendro, Veneta; Bugos, Grace A; Lundgren, Debbie H; Glynn, John; Han, May H; Han, David K

    2017-03-01

    In order to gain mechanistic insights into multiple sclerosis (MS) pathogenesis, we utilized a multi-dimensional approach to test the hypothesis that mutations in myelin proteins lead to immune activation and central nervous system autoimmunity in MS. Mass spectrometry-based proteomic analysis of human MS brain lesions revealed seven unique mutations of PLP1; a key myelin protein that is known to be destroyed in MS. Surprisingly, in-depth genomic analysis of two MS patients at the genomic DNA and mRNA confirmed mutated PLP1 in RNA, but not in the genomic DNA. Quantification of wild type and mutant PLP RNA levels by qPCR further validated the presence of mutant PLP RNA in the MS patients. To seek evidence linking mutations in abundant myelin proteins and immune-mediated destruction of myelin, specific immune response against mutant PLP1 in MS patients was examined. Thus, we have designed paired, wild type and mutant peptide microarrays, and examined antibody response to multiple mutated PLP1 in sera from MS patients. Consistent with the idea of different patients exhibiting unique mutation profiles, we found that 13 out of 20 MS patients showed antibody responses against specific but not against all the mutant-PLP1 peptides. Interestingly, we found mutant PLP-directed antibody response against specific mutant peptides in the sera of pre-MS controls. The results from integrative proteomic, genomic, and immune analyses reveal a possible mechanism of mutation-driven pathogenesis in human MS. The study also highlights the need for integrative genomic and proteomic analyses for uncovering pathogenic mechanisms of human diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Simultaneous and Sequential Integration by Cre/loxP Site-Specific Recombination in Saccharomyces cerevisiae.

    Science.gov (United States)

    Choi, Ho-Jung; Kim, Yeon-Hee

    2018-05-28

    A Cre/ loxP -δ-integration system was developed to allow sequential and simultaneous integration of a multiple gene expression cassette in Saccharomyces cerevisiae . To allow repeated integrations, the reusable Candida glabrata MARKER ( CgMARKER ) carrying loxP sequences was used, and the integrated CgMARKER was efficiently removed by inducing Cre recombinase. The XYLP and XYLB genes encoding endoxylanase and β-xylosidase, respectively, were used as model genes for xylan metabolism in this system, and the copy number of these genes was increased to 15.8 and 16.9 copies/cell, respectively, by repeated integration. This integration system is a promising approach for the easy construction of yeast strains with enhanced metabolic pathways through multicopy gene expression.

  1. SPECIFICS AND WAYS OF DEVELOPMENT OF ENTERPRISE INTEGRATION IN THE FORMER SOVIET UNION

    Directory of Open Access Journals (Sweden)

    Еlena А. Hudorenko

    2014-01-01

    Full Text Available The article is focused on problems and futuredevelopment of integration processes in thepost-Soviet space. The author highlightssome of the key factors contributing to thedevelopment of centripetal and centrifugaltrends of the region. Special attention isgiven to the industrial policy of countriesinvolved in integration processes. The paper analyzes the role and importance of corporate integration as well as discovers ways ofits development.

  2. Visual-motor integration performance in children with severe specific language impairment.

    Science.gov (United States)

    Nicola, K; Watter, P

    2016-09-01

    This study investigated (1) the visual-motor integration (VMI) performance of children with severe specific language impairment (SLI), and any effect of age, gender, socio-economic status and concomitant speech impairment; and (2) the relationship between language and VMI performance. It is hypothesized that children with severe SLI would present with VMI problems irrespective of gender and socio-economic status; however, VMI deficits will be more pronounced in younger children and those with concomitant speech impairment. Furthermore, it is hypothesized that there will be a relationship between VMI and language performance, particularly in receptive scores. Children enrolled between 2000 and 2008 in a school dedicated to children with severe speech-language impairments were included, if they met the criteria for severe SLI with or without concomitant speech impairment which was verified by a government organization. Results from all initial standardized language and VMI assessments found during a retrospective review of chart files were included. The final study group included 100 children (males = 76), from 4 to 14 years of age with mean language scores at least 2SD below the mean. For VMI performance, 52% of the children scored below -1SD, with 25% of the total group scoring more than 1.5SD below the mean. Age, gender and the addition of a speech impairment did not impact on VMI performance; however, children living in disadvantaged suburbs scored significantly better than children residing in advantaged suburbs. Receptive language scores of the Clinical Evaluation of Language Fundamentals was the only score associated with and able to predict VMI performance. A small subgroup of children with severe SLI will also have poor VMI skills. The best predictor of poor VMI is receptive language scores on the Clinical Evaluation of Language Fundamentals. Children with poor receptive language performance may benefit from VMI assessment and multidisciplinary

  3. Integrating UML, the Q-model and a Multi-Agent Approach in Process Specifications and Behavioural Models of Organisations

    Directory of Open Access Journals (Sweden)

    Raul Savimaa

    2005-08-01

    Full Text Available Efficient estimation and representation of an organisation's behaviour requires specification of business processes and modelling of actors' behaviour. Therefore the existing classical approaches that concentrate only on planned processes are not suitable and an approach that integrates process specifications with behavioural models of actors should be used instead. The present research indicates that a suitable approach should be based on interactive computing. This paper examines the integration of UML diagrams for process specifications, the Q-model specifications for modelling timing criteria of existing and planned processes and a multi-agent approach for simulating non-deterministic behaviour of human actors in an organisation. The corresponding original methodology is introduced and some of its applications as case studies are reviewed.

  4. Is the Aluminum Hypothesis Dead?

    Science.gov (United States)

    2014-01-01

    The Aluminum Hypothesis, the idea that aluminum exposure is involved in the etiology of Alzheimer disease, dates back to a 1965 demonstration that aluminum causes neurofibrillary tangles in the brains of rabbits. Initially the focus of intensive research, the Aluminum Hypothesis has gradually been abandoned by most researchers. Yet, despite this current indifference, the Aluminum Hypothesis continues to attract the attention of a small group of scientists and aluminum continues to be viewed with concern by some of the public. This review article discusses reasons that mainstream science has largely abandoned the Aluminum Hypothesis and explores a possible reason for some in the general public continuing to view aluminum with mistrust. PMID:24806729

  5. Specification of an integrated information architecture for a mobile teleoperated robot for home telecare.

    Science.gov (United States)

    Iannuzzi, David; Grant, Andrew; Corriveau, Hélène; Boissy, Patrick; Michaud, Francois

    2016-12-01

    The objective of this study was to design effectively integrated information architecture for a mobile teleoperated robot in remote assistance to the delivery of home health care. Three role classes were identified related to the deployment of a telerobot, namely, engineer, technology integrator, and health professional. Patients and natural caregivers were indirectly considered, this being a component of future field studies. Interviewing representatives of each class provided the functions, and information content and flows for each function. Interview transcripts enabled the formulation of UML (Universal Modeling Language) diagrams for feedback from participants. The proposed information architecture was validated with a use-case scenario. The integrated information architecture incorporates progressive design, ergonomic integration, and the home care needs from medical specialist, nursing, physiotherapy, occupational therapy, and social worker care perspectives. The integrated architecture iterative process promoted insight among participants. The use-case scenario evaluation showed the design's robustness. Complex innovation such as a telerobot must coherently mesh with health-care service delivery needs. The deployment of integrated information architecture bridging development, with specialist and home care applications, is necessary for home care technology innovation. It enables continuing evolution of robot and novel health information design in the same integrated architecture, while accounting for patient ecological need.

  6. Grid connected integrated community energy system. Phase II: final stage 2 report. Outline specifications of cogeneration plant; continued

    Energy Technology Data Exchange (ETDEWEB)

    1978-03-22

    Specifications are presented for the electrical equipment, site preparation, building construction and mechanical systems for a dual-purpose power plant to be located on the University of Minnesota campus. This power plant will supply steam and electrical power to a grid-connected Integrated Community Energy System. (LCL)

  7. Site-specific integration in CHO cells mediated by CRISPR/Cas9 and homology-directed DNA repair pathway

    DEFF Research Database (Denmark)

    Lee, Jae Seong; Beuchert Kallehauge, Thomas; Pedersen, Lasse Ebdrup

    2015-01-01

    gene integration into site-specific loci in CHO cells using CRISPR/Cas9 genome editing system and compatible donor plasmid harboring a gene of interest (GOI) and short homology arms. This strategy has enabled precise insertion of a 3.7-kb gene expression cassette at defined loci in CHO cells following...

  8. NuSEE: an integrated environment of software specification and V and V for PLC based safety-critical systems

    International Nuclear Information System (INIS)

    Koo, Seo Ryong; Seong, Poong Hyun; Yoo, Jun Beom; Cha, Sung Deok; Youn, Cheong; Han, Hyun Chul

    2006-01-01

    As the use of digital systems becomes more prevalent, adequate techniques for software specification and analysis have become increasingly important in Nuclear Power Plant (NPP) safety-critical systems. Additionally, the importance of software Verification and Validation (V and V) based on adequate specification has received greater emphasis in view of improving software quality. For thorough V and V of safety-critical systems, V and V should be performed throughout the software lifecycle. However, systematic V and V is difficult as it involves many manual-oriented tasks. Tool support is needed in order to more conveniently perform software V and V. In response, we developed four kinds of Computer Aided Software Engineering (CASE) tools to support system specification for a formal-based analysis according to the software lifecycle. In this work, we achieved optimized integration of each tool. The toolset, NuSEE, is an integrated environment for software specification and V and V for PLC based safety-critical systems. In accordance with the software lifecycle, NuSEE consists of NuSISRT for the concept phase, NuSRS for the requirements phase, NuSDS for the design phase and NuSCM for configuration management. It is believed that after further development our integrated environment will be a unique and promising software specification and analysis toolset that will support the entire software lifecycle for the development of PLC based NPP safety-critical systems

  9. Angular distributions of plasma edge velocity and integrated intensity: Update on specific impulse for Ablative Laser Propulsion

    Science.gov (United States)

    Lin, Jun; Pakhomov, Andrew V.

    2005-04-01

    This work concludes our discussion of the image processing technique developed earlier for determination of specific impulse (Isp) for Ablative Laser Propulsion (ALP). The plasma plumes are recorded with a time-resolved intensified charge-coupled device (ICCD) camera. The plasma was formed in vacuum (˜ 3×10-3 Torr) by focusing output pulses of a laser system (100-ps pulsewidth at 532 nm wavelength and ˜35 mJ energy) on surfaces of C (graphite), Al, Si, Fe, Cu, Zn, Sn, and Pb elements. Angular profiles for integrated intensity and plasma expansion velocity were determined for the tested elements. Such profiles were used further for assessment of specific impulse. Specific impulses derived from angular distributions of plasma expansion velocity and integral intensity appeared in excellent agreement with the data derived earlier from force measurements.

  10. Angular distributions of plasma edge velocity and integrated intensity: Update on specific impulse for Ablative Laser Propulsion

    International Nuclear Information System (INIS)

    Lin Jun; Pakhomov, Andrew V.

    2005-01-01

    This work concludes our discussion of the image processing technique developed earlier for determination of specific impulse (Isp) for Ablative Laser Propulsion (ALP). The plasma plumes are recorded with a time-resolved intensified charge-coupled device (ICCD) camera. The plasma was formed in vacuum (∼ 3x10-3 Torr) by focusing output pulses of a laser system (100-ps pulsewidth at 532 nm wavelength and ∼35 mJ energy) on surfaces of C (graphite), Al, Si, Fe, Cu, Zn, Sn, and Pb elements. Angular profiles for integrated intensity and plasma expansion velocity were determined for the tested elements. Such profiles were used further for assessment of specific impulse. Specific impulses derived from angular distributions of plasma expansion velocity and integral intensity appeared in excellent agreement with the data derived earlier from force measurements

  11. Multiple hypothesis tracking for the cyber domain

    Science.gov (United States)

    Schwoegler, Stefan; Blackman, Sam; Holsopple, Jared; Hirsch, Michael J.

    2011-09-01

    This paper discusses how methods used for conventional multiple hypothesis tracking (MHT) can be extended to domain-agnostic tracking of entities from non-kinematic constraints such as those imposed by cyber attacks in a potentially dense false alarm background. MHT is widely recognized as the premier method to avoid corrupting tracks with spurious data in the kinematic domain but it has not been extensively applied to other problem domains. The traditional approach is to tightly couple track maintenance (prediction, gating, filtering, probabilistic pruning, and target confirmation) with hypothesis management (clustering, incompatibility maintenance, hypothesis formation, and Nassociation pruning). However, by separating the domain specific track maintenance portion from the domain agnostic hypothesis management piece, we can begin to apply the wealth of knowledge gained from ground and air tracking solutions to the cyber (and other) domains. These realizations led to the creation of Raytheon's Multiple Hypothesis Extensible Tracking Architecture (MHETA). In this paper, we showcase MHETA for the cyber domain, plugging in a well established method, CUBRC's INFormation Engine for Real-time Decision making, (INFERD), for the association portion of the MHT. The result is a CyberMHT. We demonstrate the power of MHETA-INFERD using simulated data. Using metrics from both the tracking and cyber domains, we show that while no tracker is perfect, by applying MHETA-INFERD, advanced nonkinematic tracks can be captured in an automated way, perform better than non-MHT approaches, and decrease analyst response time to cyber threats.

  12. Detecting Specific Health-Related Events Using an Integrated Sensor System for Vital Sign Monitoring

    Directory of Open Access Journals (Sweden)

    Mourad Adnane

    2009-09-01

    Full Text Available In this paper, a new method for the detection of apnea/hypopnea periods in physiological data is presented. The method is based on the intelligent combination of an integrated sensor system for long-time cardiorespiratory signal monitoring and dedicated signal-processing packages. Integrated sensors are a PVDF film and conductive fabric sheets. The signal processing package includes dedicated respiratory cycle (RC and QRS complex detection algorithms and a new method using the respiratory cycle variability (RCV for detecting apnea/hypopnea periods in physiological data. Results show that our method is suitable for online analysis of long time series data.

  13. Hypothesis Designs for Three-Hypothesis Test Problems

    OpenAIRE

    Yan Li; Xiaolong Pu

    2010-01-01

    As a helpful guide for applications, the alternative hypotheses of the three-hypothesis test problems are designed under the required error probabilities and average sample number in this paper. The asymptotic formulas and the proposed numerical quadrature formulas are adopted, respectively, to obtain the hypothesis designs and the corresponding sequential test schemes under the Koopman-Darmois distributions. The example of the normal mean test shows that our methods are qu...

  14. The Reviewing of Object Files: Object-Specific Integration of Information.

    Science.gov (United States)

    Kahneman, Daniel; And Others

    1992-01-01

    Seven experiments involving a total of 203 college students explored a form of object-specific priming and established a robust object-specific benefit that indicates that a new stimulus will be named faster if it physically matches a previous stimulus seen as part of the same perceptual object. (SLD)

  15. Patient-specific cardiovascular progenitor cells derived from integration-free induced pluripotent stem cells for vascular tissue regeneration.

    Science.gov (United States)

    Hu, Jiang; Wang, Yongyu; Jiao, Jiao; Liu, Zhongning; Zhao, Chao; Zhou, Zhou; Zhang, Zhanpeng; Forde, Kaitlynn; Wang, Lunchang; Wang, Jiangang; Baylink, David J; Zhang, Xiao-Bing; Gao, Shaorong; Yang, Bo; Chen, Y Eugene; Ma, Peter X

    2015-12-01

    Tissue-engineered blood vessels (TEBVs) are promising in regenerating a live vascular replacement. However, the vascular cell source is limited, and it is crucial to develop a scaffold that accommodates new type of vascular progenitor cells and facilitates in vivo lineage specification of the cells into functional vascular smooth muscle cells (VSMCs) to regenerate vascular tissue. In the present study, integration-free human induced pluripotent stem cells (hiPSCs) were established from patient peripheral blood mononuclear cells through episomal vector nucleofection of reprogramming factors. The established hiPSCs were then induced into mesoderm-originated cardiovascular progenitor cells (CVPCs) with a highly efficient directed lineage specification method. The derived CVPCs were demonstrated to be able to differentiate into functional VSMCs. Subcutaneous implantation of CVPCs seeded on macroporous nanofibrous poly(l-lactide) scaffolds led to in vivo VSMC lineage specification and matrix deposition inside the scaffolds. In summary, we established integration-free patient-specific hiPSCs from peripheral blood mononuclear cells, derived CVPCs through directed lineage specification, and developed an advanced scaffold for these progenitor cells to further differentiate in vivo into VSMCs and regenerate vascular tissue in a subcutaneous implantation model. This study has established an efficient patient-specific approach towards in vivo regeneration of vascular tissue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Tests of the lunar hypothesis

    Science.gov (United States)

    Taylor, S. R.

    1984-01-01

    The concept that the Moon was fissioned from the Earth after core separation is the most readily testable hypothesis of lunar origin, since direct comparisons of lunar and terrestrial compositions can be made. Differences found in such comparisons introduce so many ad hoc adjustments to the fission hypothesis that it becomes untestable. Further constraints may be obtained from attempting to date the volatile-refractory element fractionation. The combination of chemical and isotopic problems suggests that the fission hypothesis is no longer viable, and separate terrestrial and lunar accretion from a population of fractionated precursor planetesimals provides a more reasonable explanation.

  17. Evaluating the Stage Learning Hypothesis.

    Science.gov (United States)

    Thomas, Hoben

    1980-01-01

    A procedure for evaluating the Genevan stage learning hypothesis is illustrated by analyzing Inhelder, Sinclair, and Bovet's guided learning experiments (in "Learning and the Development of Cognition." Cambridge: Harvard University Press, 1974). (Author/MP)

  18. The Purchasing Power Parity Hypothesis:

    African Journals Online (AJOL)

    2011-10-02

    Oct 2, 2011 ... reject the unit root hypothesis in real exchange rates may simply be due to the shortness ..... Violations of Purchasing Power Parity and Their Implications for Efficient ... Official Intervention in the Foreign Exchange Market:.

  19. Design and integration of components for site specific control of fertilizer application

    NARCIS (Netherlands)

    Bergeijk, van J.

    2001-01-01

    Keywords: Precision Agriculture, Site Specific Agriculture, Global Positioning System, GPS, Fertilizer Application, Information System.

    Spatial and temporal variability in soil, crop and climate characteristics results in non optimal use of fertilizers when the application

  20. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    International Nuclear Information System (INIS)

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-01-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence

  1. Integrative functional genomic analyses implicate specific molecular pathways and circuits in autism

    OpenAIRE

    Parikshak, Neelroop N.; Luo, Rui; Zhang, Alice; Won, Hyejung; Lowe, Jennifer K.; Chandran, Vijayendran; Horvath, Steve; Geschwind, Daniel H.

    2013-01-01

    Genetic studies have identified dozens of autism spectrum disorder (ASD) susceptibility genes, raising two critical questions: 1) do these genetic loci converge on specific biological processes, and 2) where does the phenotypic specificity of ASD arise, given its genetic overlap with intellectual disability (ID)? To address this, we mapped ASD and ID risk genes onto co-expression networks representing developmental trajectories and transcriptional profiles representing fetal and adult cortica...

  2. Incorporating and evaluating an integrated gender-specific medicine curriculum: a survey study in Dutch GP training

    Science.gov (United States)

    Dielissen, Patrick W; Bottema, Ben JAM; Verdonk, Petra; Lagro-Janssen, Toine LM

    2009-01-01

    Background We recently set standards for gender-specific medicine training as an integrated part of the GP training curriculum. This paper describes the programme and evaluation of this training. Methods The programme is designed for GP registrars throughout the 3-year GP training. The modules emphasize interaction, application, and clinically integrated learning and teaching methods in peer groups. In 2005 - 2008, after completion of each tutorial, GP registrars were asked to fill in a questionnaire on a 5-point Likert scale to assess the programme's methods and content. GP registrars were also asked to identify two learning points related to the programme. Results The teaching programme consists of five 3-hour modules that include gender themes related to and frequently seen by GPs such as in doctor-patient communication and cardiovascular disease. GP registrars evaluated the training course positively. The written learning points suggest that GP registrars have increased their awareness of why attention to gender-specific information is relevant. Conclusion In summary, gender-specific medicine training has been successfully integrated into an existing GP training curriculum. The modules and teaching methods are transferable to other training institutes for postgraduate training. The evaluation of the teaching programme shows a positive impact on GP registrars' gender awareness. PMID:19737396

  3. Incorporating and evaluating an integrated gender-specific medicine curriculum: a survey study in Dutch GP training

    Directory of Open Access Journals (Sweden)

    Lagro-Janssen Toine LM

    2009-09-01

    Full Text Available Abstract Background We recently set standards for gender-specific medicine training as an integrated part of the GP training curriculum. This paper describes the programme and evaluation of this training. Methods The programme is designed for GP registrars throughout the 3-year GP training. The modules emphasize interaction, application, and clinically integrated learning and teaching methods in peer groups. In 2005 - 2008, after completion of each tutorial, GP registrars were asked to fill in a questionnaire on a 5-point Likert scale to assess the programme's methods and content. GP registrars were also asked to identify two learning points related to the programme. Results The teaching programme consists of five 3-hour modules that include gender themes related to and frequently seen by GPs such as in doctor-patient communication and cardiovascular disease. GP registrars evaluated the training course positively. The written learning points suggest that GP registrars have increased their awareness of why attention to gender-specific information is relevant. Conclusion In summary, gender-specific medicine training has been successfully integrated into an existing GP training curriculum. The modules and teaching methods are transferable to other training institutes for postgraduate training. The evaluation of the teaching programme shows a positive impact on GP registrars' gender awareness.

  4. CEO Appointments and the Loss of Firm-specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren

    2008-01-01

    that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest......A rarely studied trend in corporate governance is the increasing tendency to fill CEO openings through external hires rather than through internal promotions: Kevin J. Murphy and Ján Zábojník (2004) show that the proportion of outside hires has doubled and their pay premium almost quadrupled over...

  5. Site-specific landslide assessment in Alpine area using a reliable integrated monitoring system

    Science.gov (United States)

    Romeo, Saverio; Di Matteo, Lucio; Kieffer, Daniel Scott

    2016-04-01

    Rockfalls are one of major cause of landslide fatalities around the world. The present work discusses the reliability of integrated monitoring of displacements in a rockfall within the Alpine region (Salzburg Land - Austria), taking into account also the effect of the ongoing climate change. Due to the unpredictability of the frequency and magnitude, that threatens human lives and infrastructure, frequently it is necessary to implement an efficient monitoring system. For this reason, during the last decades, integrated monitoring systems of unstable slopes were widely developed and used (e.g., extensometers, cameras, remote sensing, etc.). In this framework, Remote Sensing techniques, such as GBInSAR technique (Groung-Based Interferometric Synthetic Aperture Radar), have emerged as efficient and powerful tools for deformation monitoring. GBInSAR measurements can be useful to achieve an early warning system using surface deformation parameters as ground displacement or inverse velocity (for semi-empirical forecasting methods). In order to check the reliability of GBInSAR and to monitor the evolution of landslide, it is very important to integrate different techniques. Indeed, a multi-instrumental approach is essential to investigate movements both in surface and in depth and the use of different monitoring techniques allows to perform a cross analysis of the data and to minimize errors, to check the data quality and to improve the monitoring system. During 2013, an intense and complete monitoring campaign has been conducted on the Ingelsberg landslide. By analyzing both historical temperature series (HISTALP) recorded during the last century and those from local weather stations, temperature values (Autumn-Winter, Winter and Spring) are clearly increased in Bad Hofgastein area as well as in Alpine region. As consequence, in the last decades the rockfall events have been shifted from spring to summer due to warmer winters. It is interesting to point out that

  6. Specific features of the temperature dependence of the exciton absorption integral in CdS crystals

    International Nuclear Information System (INIS)

    Novikov, A.B.; Solov'ev, L.E.; Talalaev, V.G.

    1986-01-01

    Cadmium sulfide crystals 0.4-2 μm thick in the 4.2-120 K temperature range are investigated experimentally. The shape of the first exciton absorption line in CdS and dependence of integral exciton absorption factor (IEAF) on the quenching constant j are calculated. Rapid growth of the absorption factor in the maximum of the absorption line and decrease of halfwidth of the factor are shown to take place with j increase. The calculation has disclosed that the Bouguer law is observed excluding negligible IEAF oscillations at variation of crystal thickness. Non-monotonous temperature dependence of IEAF is disclosed in some investigated samples; it, obviously, testifies to non-monotonous temperature dependence of j. Depolarization of the absorption line of high-energy exciton states with n=2 and n=3 is discovered in some samples for the first time

  7. All-organic microelectromechanical systems integrating specific molecular recognition--a new generation of chemical sensors.

    Science.gov (United States)

    Ayela, Cédric; Dubourg, Georges; Pellet, Claude; Haupt, Karsten

    2014-09-03

    Cantilever-type all-organic microelectromechanical systems based on molecularly imprinted polymers for specific analyte recognition are used as chemical sensors. They are produced by a simple spray-coating-shadow-masking process. Analyte binding to the cantilever generates a measurable change in its resonance frequency. This allows label-free detection by direct mass sensing of low-molecular-weight analytes at nanomolar concentrations. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The atomic hypothesis: physical consequences

    International Nuclear Information System (INIS)

    Rivas, Martin

    2008-01-01

    The hypothesis that matter is made of some ultimate and indivisible objects, together with the restricted relativity principle, establishes a constraint on the kind of variables we are allowed to use for the variational description of elementary particles. We consider that the atomic hypothesis not only states the indivisibility of elementary particles, but also that these ultimate objects, if not annihilated, cannot be modified by any interaction so that all allowed states of an elementary particle are only kinematical modifications of any one of them. Therefore, an elementary particle cannot have excited states. In this way, the kinematical group of spacetime symmetries not only defines the symmetries of the system, but also the variables in terms of which the mathematical description of the elementary particles can be expressed in either the classical or the quantum mechanical description. When considering the interaction of two Dirac particles, the atomic hypothesis restricts the interaction Lagrangian to a kind of minimal coupling interaction

  9. MUSI: an integrated system for identifying multiple specificity from very large peptide or nucleic acid data sets.

    Science.gov (United States)

    Kim, Taehyung; Tyndel, Marc S; Huang, Haiming; Sidhu, Sachdev S; Bader, Gary D; Gfeller, David; Kim, Philip M

    2012-03-01

    Peptide recognition domains and transcription factors play crucial roles in cellular signaling. They bind linear stretches of amino acids or nucleotides, respectively, with high specificity. Experimental techniques that assess the binding specificity of these domains, such as microarrays or phage display, can retrieve thousands of distinct ligands, providing detailed insight into binding specificity. In particular, the advent of next-generation sequencing has recently increased the throughput of such methods by several orders of magnitude. These advances have helped reveal the presence of distinct binding specificity classes that co-exist within a set of ligands interacting with the same target. Here, we introduce a software system called MUSI that can rapidly analyze very large data sets of binding sequences to determine the relevant binding specificity patterns. Our pipeline provides two major advances. First, it can detect previously unrecognized multiple specificity patterns in any data set. Second, it offers integrated processing of very large data sets from next-generation sequencing machines. The results are visualized as multiple sequence logos describing the different binding preferences of the protein under investigation. We demonstrate the performance of MUSI by analyzing recent phage display data for human SH3 domains as well as microarray data for mouse transcription factors.

  10. Discussion of the Porter hypothesis

    International Nuclear Information System (INIS)

    1999-11-01

    In the reaction to the long-range vision of RMNO, published in 1996, The Dutch government posed the question whether a far-going and progressive modernization policy will lead to competitive advantages of high-quality products on partly new markets. Such a question is connected to the so-called Porter hypothesis: 'By stimulating innovation, strict environmental regulations can actually enhance competitiveness', from which statement it can be concluded that environment and economy can work together quite well. A literature study has been carried out in order to determine under which conditions that hypothesis is endorsed in the scientific literature and policy documents. Recommendations are given for further studies. refs

  11. The thrifty phenotype hypothesis revisited

    DEFF Research Database (Denmark)

    Vaag, A A; Grunnet, L G; Arora, G P

    2012-01-01

    Twenty years ago, Hales and Barker along with their co-workers published some of their pioneering papers proposing the 'thrifty phenotype hypothesis' in Diabetologia (4;35:595-601 and 3;36:62-67). Their postulate that fetal programming could represent an important player in the origin of type 2...... of the underlying molecular mechanisms. Type 2 diabetes is a multiple-organ disease, and developmental programming, with its idea of organ plasticity, is a plausible hypothesis for a common basis for the widespread organ dysfunctions in type 2 diabetes and the metabolic syndrome. Only two among the 45 known type 2...

  12. Medical Image Processing for Fully Integrated Subject Specific Whole Brain Mesh Generation

    Directory of Open Access Journals (Sweden)

    Chih-Yang Hsu

    2015-05-01

    Full Text Available Currently, anatomically consistent segmentation of vascular trees acquired with magnetic resonance imaging requires the use of multiple image processing steps, which, in turn, depend on manual intervention. In effect, segmentation of vascular trees from medical images is time consuming and error prone due to the tortuous geometry and weak signal in small blood vessels. To overcome errors and accelerate the image processing time, we introduce an automatic image processing pipeline for constructing subject specific computational meshes for entire cerebral vasculature, including segmentation of ancillary structures; the grey and white matter, cerebrospinal fluid space, skull, and scalp. To demonstrate the validity of the new pipeline, we segmented the entire intracranial compartment with special attention of the angioarchitecture from magnetic resonance imaging acquired for two healthy volunteers. The raw images were processed through our pipeline for automatic segmentation and mesh generation. Due to partial volume effect and finite resolution, the computational meshes intersect with each other at respective interfaces. To eliminate anatomically inconsistent overlap, we utilized morphological operations to separate the structures with a physiologically sound gap spaces. The resulting meshes exhibit anatomically correct spatial extent and relative positions without intersections. For validation, we computed critical biometrics of the angioarchitecture, the cortical surfaces, ventricular system, and cerebrospinal fluid (CSF spaces and compared against literature values. Volumina and surface areas of the computational mesh were found to be in physiological ranges. In conclusion, we present an automatic image processing pipeline to automate the segmentation of the main intracranial compartments including a subject-specific vascular trees. These computational meshes can be used in 3D immersive visualization for diagnosis, surgery planning with haptics

  13. Brain systems for probabilistic and dynamic prediction: computational specificity and integration.

    Directory of Open Access Journals (Sweden)

    Jill X O'Reilly

    2013-09-01

    Full Text Available A computational approach to functional specialization suggests that brain systems can be characterized in terms of the types of computations they perform, rather than their sensory or behavioral domains. We contrasted the neural systems associated with two computationally distinct forms of predictive model: a reinforcement-learning model of the environment obtained through experience with discrete events, and continuous dynamic forward modeling. By manipulating the precision with which each type of prediction could be used, we caused participants to shift computational strategies within a single spatial prediction task. Hence (using fMRI we showed that activity in two brain systems (typically associated with reward learning and motor control could be dissociated in terms of the forms of computations that were performed there, even when both systems were used to make parallel predictions of the same event. A region in parietal cortex, which was sensitive to the divergence between the predictions of the models and anatomically connected to both computational networks, is proposed to mediate integration of the two predictive modes to produce a single behavioral output.

  14. Experiences from the formal specification of the integration platform and the synthesis of SDT with the software bus

    International Nuclear Information System (INIS)

    Thunem, Harald; Mohn, Peter; Sandmark, Haakon; Stoelen, Ketil

    1999-04-01

    The three year programme 1997-1999 for the OECD Halden Reactor Project (HRP) identifies the need to gain experience from applying formal techniques in real-life system developments. This motivated the initiation of the HRP research activity Integration of Formal Specification in the Development of HAMMLAB 2000 (INT-FS). The principal objective was to experiment with formal techniques in system developments at the HRP; in particular, system developments connected to HAMMLAB 2000 - the computerised laboratory for man-machine-interaction experiments currently under construction. It was hoped that this experimentation with formal techniques should result in a better understanding of how such techniques should be utilised in a more industrial setting. To obtain more knowledge with respect to the practical effects and consequences of an increased level of formalization was another objective. This report summarises experiences, results and conclusions from a pre-study addressing INT-FS related issues connected to the development of the HAMMLAB 2000 Integration Platform (IP). The report starts by giving a brief overview of the IP. Then it describes and summarises experiences from the formalization of a top-level requirements specification for the IP. Finally, it discusses various approaches for the integration of applications generated automatically through the CASE-tool SDT and the Software Bus on which the communication within HAMMLAB 2000 will be based. The report concludes that the selected formalisms and tools are well-suited to describe IP-like systems. The report also concludes that the integration of SDT applications with the Software Bus will not be a major obstacle, and finally that a monitoring component for the IP is well-suited for development within INT-FS (author) (ml)

  15. MOLIERE: Automatic Biomedical Hypothesis Generation System.

    Science.gov (United States)

    Sybrandt, Justin; Shtutman, Michael; Safro, Ilya

    2017-08-01

    Hypothesis generation is becoming a crucial time-saving technique which allows biomedical researchers to quickly discover implicit connections between important concepts. Typically, these systems operate on domain-specific fractions of public medical data. MOLIERE, in contrast, utilizes information from over 24.5 million documents. At the heart of our approach lies a multi-modal and multi-relational network of biomedical objects extracted from several heterogeneous datasets from the National Center for Biotechnology Information (NCBI). These objects include but are not limited to scientific papers, keywords, genes, proteins, diseases, and diagnoses. We model hypotheses using Latent Dirichlet Allocation applied on abstracts found near shortest paths discovered within this network, and demonstrate the effectiveness of MOLIERE by performing hypothesis generation on historical data. Our network, implementation, and resulting data are all publicly available for the broad scientific community.

  16. Hierarchical mesosilicalite nanoformulation integrated with cisplatin exhibits target-specific efficient anticancer activity

    Science.gov (United States)

    Jermy, B. Rabindran; Acharya, Sadananda; Ravinayagam, Vijaya; Alghamdi, Hajer Saleh; Akhtar, Sultan; Basuwaidan, Rehab S.

    2018-04-01

    Hierarchically structured zeolitic ZSM-5 and meso MCM-41 interlinked domain had an impeccable use as catalysis in many applications. The aim of the study was to develop a new drug delivery nanoformulation, specifically, cisplatin/mesosilicalite using top-down approach for cancer therapy. Hierarchical mesosilicalite with variable porosity was synthesized using alkaline molar solution (0.2 and 0.7 M NaOH) and was loaded with cisplatin through equilibrium adsorption technique. Physico-chemical properties of the nanoformulation (IAUM-56—Imam Abdulrahman Bin Faisal University Mesosilicalite-56) were characterized using X-ray diffraction, surface area analysis (BET), Fourier transformed infrared spectroscopy (FT-IR), diffuse reflectance UV-Vis spectroscopy, and transmission electron microscopy. Drug release study and anticancer activity were assayed on HeLa and MCF7 cancer cells using MTT assay. X-ray diffraction pattern showed interrelated meso- and microphases, while BET analysis revealed considerable mesoporosity formation with a remodulation of isotherm hysteresis indicating the presence of hierarchical pores. FT-IR showed the presence of nanozeolitic subunits into mesostructure with a band at about 550 cm-1. IAUM-56 demonstrated high cytotoxic activity against HeLa cancer cells with an LC50 of 0.02 mg/ml, MCF7 cancer cells with an LC50 of 0.05 mg/ml, and less toxic to normal fibroblast cells with an LC50 of approximately ten times higher at 0.5 mg/ml. Overall, IAUM-56 showed a high rate of sustained release of cisplatin imparting target specific cytotoxic effect against tumor cells with at least tenfold lower toxicity on normal fibroblast cells. Our nanoformulation has the potential use in cancer therapy as a targeted drug delivery system.

  17. Thermal Radiometer Signal Processing Using Radiation Hard CMOS Application Specific Integrated Circuits for Use in Harsh Planetary Environments

    Science.gov (United States)

    Quilligan, G.; DuMonthier, J.; Aslam, S.; Lakew, B.; Kleyner, I.; Katz, R.

    2015-01-01

    Thermal radiometers such as proposed for the Europa Clipper flyby mission require low noise signal processing for thermal imaging with immunity to Total Ionizing Dose (TID) and Single Event Latchup (SEL). Described is a second generation Multi- Channel Digitizer (MCD2G) Application Specific Integrated Circuit (ASIC) that accurately digitizes up to 40 thermopile pixels with greater than 50 Mrad (Si) immunity TID and 174 MeV-sq cm/mg SEL. The MCD2G ASIC uses Radiation Hardened By Design (RHBD) techniques with a 180 nm CMOS process node.

  18. Integration

    DEFF Research Database (Denmark)

    Emerek, Ruth

    2004-01-01

    Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration......Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration...

  19. Integrative Analysis of Sex-Specific microRNA Networks Following Stress in Mouse Nucleus Accumbens.

    Science.gov (United States)

    Pfau, Madeline L; Purushothaman, Immanuel; Feng, Jian; Golden, Sam A; Aleyasin, Hossein; Lorsch, Zachary S; Cates, Hannah M; Flanigan, Meghan E; Menard, Caroline; Heshmati, Mitra; Wang, Zichen; Ma'ayan, Avi; Shen, Li; Hodes, Georgia E; Russo, Scott J

    2016-01-01

    Adult women are twice as likely as men to suffer from affective and anxiety disorders, although the mechanisms underlying heightened female stress susceptibility are incompletely understood. Recent findings in mouse Nucleus Accumbens (NAc) suggest a role for DNA methylation-driven sex differences in genome-wide transcriptional profiles. However, the role of another epigenetic process-microRNA (miR) regulation-has yet to be explored. We exposed male and female mice to Subchronic Variable Stress (SCVS), a stress paradigm that produces depression-like behavior in female, but not male, mice, and performed next generation mRNA and miR sequencing on NAc tissue. We applied a combination of differential expression, miR-mRNA network and functional enrichment analyses to characterize the transcriptional and post-transcriptional landscape of sex differences in NAc stress response. We find that male and female mice exhibit largely non-overlapping miR and mRNA profiles following SCVS. The two sexes also show enrichment of different molecular pathways and functions. Collectively, our results suggest that males and females mount fundamentally different transcriptional and post-transcriptional responses to SCVS and engage sex-specific molecular processes following stress. These findings have implications for the pathophysiology and treatment of stress-related disorders in women.

  20. B827 Chemical Synthhesis Project - Industrial Control System Integration - Statement of Work & Specification with Attachments 1-14

    Energy Technology Data Exchange (ETDEWEB)

    Wade, F. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-04-21

    The Chemical Synthesis Pilot Process at the Lawrence Livermore National Laboratory (LLNL) Site 300 827 Complex will be used to synthesize small quantities of material to support research and development. The project will modernize and increase current capabilities for chemical synthesis at LLNL. The primary objective of this project is the conversion of a non-automated hands-on process to a remoteoperation process, while providing enhanced batch process step control, stored recipe-specific parameter sets, process variable visibility, monitoring, alarm and warning handling, and comprehensive batch record data logging. This Statement of Work and Specification provides the industrial-grade process control requirements for the chemical synthesis batching control system, hereafter referred to as the “Control System” to be delivered by the System Integrator.

  1. Auditory-visual integration modulates location-specific repetition suppression of auditory responses.

    Science.gov (United States)

    Shrem, Talia; Murray, Micah M; Deouell, Leon Y

    2017-11-01

    Space is a dimension shared by different modalities, but at what stage spatial encoding is affected by multisensory processes is unclear. Early studies observed attenuation of N1/P2 auditory evoked responses following repetition of sounds from the same location. Here, we asked whether this effect is modulated by audiovisual interactions. In two experiments, using a repetition-suppression paradigm, we presented pairs of tones in free field, where the test stimulus was a tone presented at a fixed lateral location. Experiment 1 established a neural index of auditory spatial sensitivity, by comparing the degree of attenuation of the response to test stimuli when they were preceded by an adapter sound at the same location versus 30° or 60° away. We found that the degree of attenuation at the P2 latency was inversely related to the spatial distance between the test stimulus and the adapter stimulus. In Experiment 2, the adapter stimulus was a tone presented from the same location or a more medial location than the test stimulus. The adapter stimulus was accompanied by a simultaneous flash displayed orthogonally from one of the two locations. Sound-flash incongruence reduced accuracy in a same-different location discrimination task (i.e., the ventriloquism effect) and reduced the location-specific repetition-suppression at the P2 latency. Importantly, this multisensory effect included topographic modulations, indicative of changes in the relative contribution of underlying sources across conditions. Our findings suggest that the auditory response at the P2 latency is affected by spatially selective brain activity, which is affected crossmodally by visual information. © 2017 Society for Psychophysiological Research.

  2. S3QL: A distributed domain specific language for controlled semantic integration of life sciences data

    Directory of Open Access Journals (Sweden)

    de Lencastre Hermínia

    2011-07-01

    Full Text Available Abstract Background The value and usefulness of data increases when it is explicitly interlinked with related data. This is the core principle of Linked Data. For life sciences researchers, harnessing the power of Linked Data to improve biological discovery is still challenged by a need to keep pace with rapidly evolving domains and requirements for collaboration and control as well as with the reference semantic web ontologies and standards. Knowledge organization systems (KOSs can provide an abstraction for publishing biological discoveries as Linked Data without complicating transactions with contextual minutia such as provenance and access control. We have previously described the Simple Sloppy Semantic Database (S3DB as an efficient model for creating knowledge organization systems using Linked Data best practices with explicit distinction between domain and instantiation and support for a permission control mechanism that automatically migrates between the two. In this report we present a domain specific language, the S3DB query language (S3QL, to operate on its underlying core model and facilitate management of Linked Data. Results Reflecting the data driven nature of our approach, S3QL has been implemented as an application programming interface for S3DB systems hosting biomedical data, and its syntax was subsequently generalized beyond the S3DB core model. This achievement is illustrated with the assembly of an S3QL query to manage entities from the Simple Knowledge Organization System. The illustrative use cases include gastrointestinal clinical trials, genomic characterization of cancer by The Cancer Genome Atlas (TCGA and molecular epidemiology of infectious diseases. Conclusions S3QL was found to provide a convenient mechanism to represent context for interoperation between public and private datasets hosted at biomedical research institutions and linked data formalisms.

  3. Statistical inference an integrated approach

    CERN Document Server

    Migon, Helio S; Louzada, Francisco

    2014-01-01

    Introduction Information The concept of probability Assessing subjective probabilities An example Linear algebra and probability Notation Outline of the bookElements of Inference Common statistical modelsLikelihood-based functions Bayes theorem Exchangeability Sufficiency and exponential family Parameter elimination Prior Distribution Entirely subjective specification Specification through functional forms Conjugacy with the exponential family Non-informative priors Hierarchical priors Estimation Introduction to decision theoryBayesian point estimation Classical point estimation Empirical Bayes estimation Comparison of estimators Interval estimation Estimation in the Normal model Approximating Methods The general problem of inference Optimization techniquesAsymptotic theory Other analytical approximations Numerical integration methods Simulation methods Hypothesis Testing Introduction Classical hypothesis testingBayesian hypothesis testing Hypothesis testing and confidence intervalsAsymptotic tests Prediction...

  4. Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.

    Science.gov (United States)

    Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J

    2015-10-01

    FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental

  5. EFFECTIVENESS OF INTEGRATED NEUROMUSCULAR INHIBITORY TECHNIQUE (INIT WITH SPECIFIC STRENGTH TRAINING EXERCISES IN SUBJECTS WITH UPPER TRAPEZIUS TRIGGER POINTS

    Directory of Open Access Journals (Sweden)

    B. Jyothirmai

    2015-10-01

    Full Text Available Background: Upper trapezius trigger points is a common cause for neck pain, decreased cervical range of motion and functional activities. The purpose of the study was to evaluate the effectiveness of integrated neuromuscular inhibitory technique (INIT along with specific strength training exercises in reducing pain, improving ROM and functional activities in subjects with upper trapezius trigger point. Methods: Thirty subjects were diagnosed with upper trapezius trigger points were included in the study. These patients were randomly allocated to intervention group (n=15, which underwent a 4- weeks training program of INIT along with specific strength training & control group (n=15 that received INIT alone. The outcome measures were taken before and after treatment. Outcomes were measured by visual analogue scale, cervical range of motion and neck disability index. Within the groups VAS, NDI, and cervical lateral flexion and rotation showed significant change in the mean value. The comparison of pre and post VAS in experimental group and control group showed a significant change in the experimental group .Paired sample t- test was used to analyze changes from before and after intervention programmed. Results: There is a statistically significant (p<0.00 improvement in both variables from baseline to 4th week in experimental group and control group but compared to control group, experimental group shows highly significant values in all parameters. Conclusion: INIT along with specific strength training is proved to be effective in reducing pain, decreasing disability and improving range of motion in individuals with upper trapezius trigger points.

  6. A Molecular–Structure Hypothesis

    Directory of Open Access Journals (Sweden)

    Jan C. A. Boeyens

    2010-11-01

    Full Text Available The self-similar symmetry that occurs between atomic nuclei, biological growth structures, the solar system, globular clusters and spiral galaxies suggests that a similar pattern should characterize atomic and molecular structures. This possibility is explored in terms of the current molecular structure-hypothesis and its extension into four-dimensional space-time. It is concluded that a quantum molecule only has structure in four dimensions and that classical (Newtonian structure, which occurs in three dimensions, cannot be simulated by quantum-chemical computation.

  7. Antiaging therapy: a prospective hypothesis

    Directory of Open Access Journals (Sweden)

    Shahidi Bonjar MR

    2015-01-01

    Full Text Available Mohammad Rashid Shahidi Bonjar,1 Leyla Shahidi Bonjar2 1School of Dentistry, Kerman University of Medical Sciences, Kerman Iran; 2Department of Pharmacology, College of Pharmacy, Kerman University of Medical Sciences, Kerman, Iran Abstract: This hypothesis proposes a new prospective approach to slow the aging process in older humans. The hypothesis could lead to developing new treatments for age-related illnesses and help humans to live longer. This hypothesis has no previous documentation in scientific media and has no protocol. Scientists have presented evidence that systemic aging is influenced by peculiar molecules in the blood. Researchers at Albert Einstein College of Medicine, New York, and Harvard University in Cambridge discovered elevated titer of aging-related molecules (ARMs in blood, which trigger cascade of aging process in mice; they also indicated that the process can be reduced or even reversed. By inhibiting the production of ARMs, they could reduce age-related cognitive and physical declines. The present hypothesis offers a new approach to translate these findings into medical treatment: extracorporeal adjustment of ARMs would lead to slower rates of aging. A prospective “antiaging blood filtration column” (AABFC is a nanotechnological device that would fulfill the central role in this approach. An AABFC would set a near-youth homeostatic titer of ARMs in the blood. In this regard, the AABFC immobilizes ARMs from the blood while blood passes through the column. The AABFC harbors antibodies against ARMs. ARM antibodies would be conjugated irreversibly to ARMs on contact surfaces of the reaction platforms inside the AABFC till near-youth homeostasis is attained. The treatment is performed with the aid of a blood-circulating pump. Similar to a renal dialysis machine, blood would circulate from the body to the AABFC and from there back to the body in a closed circuit until ARMs were sufficiently depleted from the blood. The

  8. Evolution of Motor Control: From Reflexes and Motor Programs to the Equilibrium-Point Hypothesis.

    Science.gov (United States)

    Latash, Mark L

    2008-01-01

    This brief review analyzes the evolution of motor control theories along two lines that emphasize active (motor programs) and reactive (reflexes) features of voluntary movements. It suggests that the only contemporary hypothesis that integrates both approaches in a fruitful way is the equilibrium-point hypothesis. Physical, physiological, and behavioral foundations of the EP-hypothesis are considered as well as relations between the EP-hypothesis and the recent developments of the notion of motor synergies. The paper ends with a brief review of the criticisms of the EP-hypothesis and challenges that the hypothesis faces at this time.

  9. Is PMI the Hypothesis or the Null Hypothesis?

    Science.gov (United States)

    Tarone, Aaron M; Sanford, Michelle R

    2017-09-01

    Over the past several decades, there have been several strident exchanges regarding whether forensic entomologists estimate the postmortem interval (PMI), minimum PMI, or something else. During that time, there has been a proliferation of terminology reflecting this concern regarding "what we do." This has been a frustrating conversation for some in the community because much of this debate appears to be centered on what assumptions are acknowledged directly and which are embedded within a list of assumptions (or ignored altogether) in the literature and in case reports. An additional component of the conversation centers on a concern that moving away from the use of certain terminology like PMI acknowledges limitations and problems that would make the application of entomology appear less useful in court-a problem for lawyers, but one that should not be problematic for scientists in the forensic entomology community, as uncertainty is part of science that should and can be presented effectively in the courtroom (e.g., population genetic concepts in forensics). Unfortunately, a consequence of the way this conversation is conducted is that even as all involved in the debate acknowledge the concerns of their colleagues, parties continue to talk past one another advocating their preferred terminology. Progress will not be made until the community recognizes that all of the terms under consideration take the form of null hypothesis statements and that thinking about "what we do" as a null hypothesis has useful legal and scientific ramifications that transcend arguments over the usage of preferred terminology. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. The Stoichiometric Divisome: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Waldemar eVollmer

    2015-05-01

    Full Text Available Dividing Escherichia coli cells simultaneously constrict the inner membrane, peptidoglycan layer and outer membrane to synthesize the new poles of the daughter cells. For this, more than 30 proteins localize to mid-cell where they form a large, ring-like assembly, the divisome, facilitating division. Although the precise function of most divisome proteins is unknown, it became apparent in recent years that dynamic protein-protein interactions are essential for divisome assembly and function. However, little is known about the nature of the interactions involved and the stoichiometry of the proteins within the divisome. A recent study (Li et al., 2014 used ribosome profiling to measure the absolute protein synthesis rates in E. coli. Interestingly, they observed that most proteins which participate in known multiprotein complexes are synthesized proportional to their stoichiometry. Based on this principle we present a hypothesis for the stoichiometry of the core of the divisome, taking into account known protein-protein interactions. From this hypothesis we infer a possible mechanism for PG synthesis during division.

  11. Evolution of Motor Control: From Reflexes and Motor Programs to the Equilibrium-Point Hypothesis

    OpenAIRE

    Latash, Mark L.

    2008-01-01

    This brief review analyzes the evolution of motor control theories along two lines that emphasize active (motor programs) and reactive (reflexes) features of voluntary movements. It suggests that the only contemporary hypothesis that integrates both approaches in a fruitful way is the equilibrium-point hypothesis. Physical, physiological, and behavioral foundations of the EP-hypothesis are considered as well as relations between the EP-hypothesis and the recent developments of the notion of m...

  12. An Energy efficient application specific integrated circuit for electrocardiogram feature detection and its potential for ambulatory cardiovascular disease detection.

    Science.gov (United States)

    Jain, Sanjeev Kumar; Bhaumik, Basabi

    2016-03-01

    A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm(2). The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system.

  13. A resolvase-like protein is requered for the site-specific integration of the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Christiansen, Bettina; Brøndsted, Lone; Vogensen, Finn K.

    1996-01-01

    upstream of attP. The N-terminal 150 to 1180 amino acids of Orf1 showed 38 to 44% similarity to the resolvase group of site-specific integrases, while no similarity to know proteins was found in the C-terminal end. Bacteriophage 'TP901-1 therefore contains a unique integration system that does not resemble...... the Int class of site-specific integrases usually found in temperate bacteriophages. The constructed integration vector, pBC170, integrates into the chromosomal attachment site very efficiently and forms stable transformants with a frequency corresponding to 20% of the transformation efficiency....

  14. Integrated imaging using MRI and 123I metaiodobenzylguanidine scintigraphy to improve sensitivity and specificity in the diagnosis of pediatric neuroblastoma.

    Science.gov (United States)

    Pfluger, Thomas; Schmied, Christoph; Porn, Ute; Leinsinger, Gerda; Vollmar, Christian; Dresel, Stefan; Schmid, Irene; Hahn, Klaus

    2003-10-01

    The objectives of this study were to compare MRI and iodine-123 ((123)I) metaiodobenzylguanidine (MIBG) scintigraphy in the detection of neuroblastoma lesions in pediatric patients and to assess the additional value of combined imaging. Fifty MRI and 50 (123)I MIBG examinations (mean interval, 6.4 days) were analyzed retrospectively with regard to suspected or proven neuroblastoma lesions (n = 193) in 28 patients. MRI and MIBG scans were reviewed by two independent observers each. Separate and combined analyses of MRI and MIBG scintigraphy were compared with clinical and histologic findings. With regard to the diagnosis of neuroblastoma lesion, MIBG scintigraphy, MRI, and combined analysis showed a sensitivity of 69%, 86%, and 99% and a specificity of 85%, 77%, and 95%, respectively. On MRI, 15 false-positive findings were recorded: posttherapeutic reactive changes (n = 10), benign adrenal tumors (n = 3), and enlarged lymph nodes (n = 2). On MIBG scintigraphy, 10 false-positive findings occurred: ganglioneuromas (n = 2), benign liver tumors (n = 2), and physiologic uptake (n = 6). Thirteen neuroblastoma metastases and two residual masses under treatment with chemotherapy were judged to be false-negative findings on MRI. Two primary or residual neuroblastomas and one orbital metastasis were misinterpreted as Wilms' tumor, reactive changes after surgery, and rhabdomyosarcoma on MRI. Thirty-two bone metastases, six other neuroblastoma metastases, and one adrenal neuroblastoma showed no MIBG uptake. On combined imaging, one false-negative (bone metastasis) and three false-positive (two ganglioneuromas and one pheochromocytoma) findings remained. In the assessment of neuroblastoma lesions in pediatric patients, MRI showed a higher sensitivity and MIBG scintigraphy a higher specificity. However, integrated imaging showed an increase in both sensitivity and specificity.

  15. Energy storage technologies and hybrid architectures for specific diesel-driven rail duty cycles: Design and system integration aspects

    International Nuclear Information System (INIS)

    Meinert, M.; Prenleloup, P.; Schmid, S.; Palacin, R.

    2015-01-01

    Highlights: • We assessed integration of energy storage systems into hybrid system architectures. • We considered mechanical and electrical energy storage systems. • Potential of different combinations has been analyzed by standardized duty cycles. • Most promising are diesel-driven suburban, regional and shunting operations. • Double-layer capacitors and Lithium-ion batteries have the highest potential. - Abstract: The use of diesel-driven traction is an intrinsic part of the functioning of railway systems and it is expected to continue being so for the foreseeable future. The recent introduction of more restrictive greenhouse gas emission levels and other legislation aiming at the improvement of the environmental performance of railway systems has led to the need of exploring alternatives for cleaner diesel rolling stock. This paper focuses on assessing energy storage systems and the design of hybrid system architectures to determine their potential use in specific diesel-driven rail duty cycles. Hydrostatic accumulators, flywheels, Lithium-ion batteries and double-layer capacitors have been assessed and used to design hybrid system architectures. The potential of the different technology combinations has been analyzed using standardized duty cycles enhanced with gradient profiles related to suburban, regional and shunting operations. The results show that double-layer capacitors and Lithium-ion batteries have the highest potential to be successfully integrated into the system architecture of diesel-driven rail vehicles. Furthermore, the results also suggest that combining these two energy storage technologies into a single hybridisation package is a highly promising design that draws on their strengthens without any significant drawbacks.

  16. Hypothesis-driven physical examination curriculum.

    Science.gov (United States)

    Allen, Sharon; Olson, Andrew; Menk, Jeremiah; Nixon, James

    2017-12-01

    Medical students traditionally learn physical examination skills as a rote list of manoeuvres. Alternatives like hypothesis-driven physical examination (HDPE) may promote students' understanding of the contribution of physical examination to diagnostic reasoning. We sought to determine whether first-year medical students can effectively learn to perform a physical examination using an HDPE approach, and then tailor the examination to specific clinical scenarios. Medical students traditionally learn physical examination skills as a rote list of manoeuvres CONTEXT: First-year medical students at the University of Minnesota were taught both traditional and HDPE approaches during a required 17-week clinical skills course in their first semester. The end-of-course evaluation assessed HDPE skills: students were assigned one of two cardiopulmonary cases. Each case included two diagnostic hypotheses. During an interaction with a standardised patient, students were asked to select physical examination manoeuvres in order to make a final diagnosis. Items were weighted and selection order was recorded. First-year students with minimal pathophysiology performed well. All students selected the correct diagnosis. Importantly, students varied the order when selecting examination manoeuvres depending on the diagnoses under consideration, demonstrating early clinical decision-making skills. An early introduction to HDPE may reinforce physical examination skills for hypothesis generation and testing, and can foster early clinical decision-making skills. This has important implications for further research in physical examination instruction. © 2016 John Wiley & Sons Ltd and The Association for the Study of Medical Education.

  17. The Debt Overhang Hypothesis: Evidence from Pakistan

    Directory of Open Access Journals (Sweden)

    Shah Muhammad Imran

    2016-04-01

    Full Text Available This study investigates the debt overhang hypothesis for Pakistan in the period 1960-2007. The study examines empirically the dynamic behaviour of GDP, debt services, the employed labour force and investment using the time series concepts of unit roots, cointegration, error correlation and causality. Our findings suggest that debt-servicing has a negative impact on the productivity of both labour and capital, and that in turn has adversely affected economic growth. By severely constraining the ability of the country to service debt, this lends support to the debt-overhang hypothesis in Pakistan. The long run relation between debt services and economic growth implies that future increases in output will drain away in form of high debt service payments to lender country as external debt acts like a tax on output. More specifically, foreign creditors will benefit more from the rise in productivity than will domestic producers and labour. This suggests that domestic labour and capital are the ultimate losers from this heavy debt burden.

  18. Cell-laden hydrogel/titanium microhybrids: Site-specific cell delivery to metallic implants for improved integration.

    Science.gov (United States)

    Koenig, Geraldine; Ozcelik, Hayriye; Haesler, Lisa; Cihova, Martina; Ciftci, Sait; Dupret-Bories, Agnes; Debry, Christian; Stelzle, Martin; Lavalle, Philippe; Vrana, Nihal Engin

    2016-03-01

    Porous titanium implants are widely used in dental, orthopaedic and otorhinolaryngology fields to improve implant integration to host tissue. A possible step further to improve the integration with the host is the incorporation of autologous cells in porous titanium structures via cell-laden hydrogels. Fast gelling hydrogels have advantageous properties for in situ applications such as localisation of specific cells and growth factors at a target area without dispersion. The ability to control the cell types in different regions of an implant is important in applications where the target tissue (i) has structural heterogeneity (multiple cell types with a defined spatial configuration with respect to each other); (ii) has physical property gradients essential for its function (such as in the case of osteochondral tissue transition). Due to their near immediate gelation, such gels can also be used for site-specific modification of porous titanium structures, particularly for implants which would face different tissues at different locations. Herein, we describe a step by step design of a model system: the model cell-laden gel-containing porous titanium implants in the form of titanium microbead/hydrogel (maleimide-dextran or maleimide-PVA based) microhybrids. These systems enable the determination of the effect of titanium presence on gel properties and encapsulated cell behaviour as a miniaturized version of full-scale implants, providing a system compatible with conventional analysis methods. We used a fibroblast/vascular endothelial cell co-cultures as our model system and by utilising single microbeads we have quantified the effect of gel microenvironment (degradability, presence of RGD peptides within gel formulation) on cell behaviour and the effect of the titanium presence on cell behaviour and gel formation. Titanium presence slightly changed gel properties without hindering gel formation or affecting cell viability. Cells showed a preference to move towards

  19. Electromechanical modeling of a honeycomb core integrated vibration energy converter with increased specific power for energy harvesting applications

    Science.gov (United States)

    Chandrasekharan, Nataraj

    Innovation in integrated circuit technology along with improved manufacturing processes has resulted in considerable reduction in power consumption of electromechanical devices. Majority of these devices are currently powered by batteries. However, the issues posed by batteries, including the need for frequent battery recharge/replacement has resulted in a compelling need for alternate energy to achieve self-sufficient device operation or to supplement battery power. Vibration based energy harvesting methods through piezoelectric transduction provides with a promising potential towards replacing or supplementing battery power source. However, current piezoelectric energy harvesters generate low specific power (power-to-weight ratio) when compared to batteries that the harvesters seek to replace or supplement. In this study, the potential of integrating lightweight cellular honeycomb structures with existing piezoelectric device configurations (bimorph) to achieve higher specific power is investigated. It is shown in this study that at low excitation frequency ranges, replacing the solid continuous substrate of a conventional piezoelectric bimorph with honeycomb structures of the same material results in a significant increase in power-to-weight ratio of the piezoelectric harvester. In order to maximize the electrical response of vibration based power harvesters, the natural frequency of these harvesters is designed to match the input driving frequency. The commonly used technique of adding a tip mass is employed to lower the natural frequency (to match driving frequency) of both, solid and honeycomb substrate bimorphs. At higher excitation frequency, the natural frequency of the traditional solid substrate bimorph can only be altered (to match driving frequency) through a change in global geometric design parameters, typically achieved by increasing the thickness of the harvester. As a result, the size of the harvester is increased and can be disadvantageous

  20. Microfluidic-integrated patterned ITO immunosensor for rapid detection of prostate-specific membrane antigen biomarker in prostate cancer.

    Science.gov (United States)

    Seenivasan, Rajesh; Singh, Chandra K; Warrick, Jay W; Ahmad, Nihal; Gunasekaran, Sundaram

    2017-09-15

    An optically transparent patterned indium tin oxide (ITO) three-electrode sensor integrated with a microfluidic channel was designed for label-free immunosensing of prostate-specific membrane antigen (PSMA), a prostate cancer (PCa) biomarker, expressed on prostate tissue and circulating tumor cells but also found in serum. The sensor relies on cysteamine capped gold nanoparticles (N-AuNPs) covalently linked with anti-PSMA antibody (Ab) for target specificity. A polydimethylsiloxane (PDMS) microfluidic channel is used to efficiently and reproducibly introduce sample containing soluble proteins/cells to the sensor. The PSMA is detected and quantified by measuring the change in differential pulse voltammetry signal of a redox probe ([Fe(CN) 6 ] 3- /[Fe(CN) 6 ] 4- ) that is altered upon binding of PSMA with PSMA-Ab immobilized on N-AuNPs/ITO. Detection of PSMA expressing cells and soluble PSMA was tested. The limit of detection (LOD) of the sensor for PSMA-based PCa cells is 6/40µL (i.e., 150 cells/mL) (n=3) with a linear range of 15-400 cells/40µL (i.e., 375-10,000 cells/mL), and for the soluble PSMA is 0.499ng/40µL (i.e., 12.5ng/mL) (n=3) with the linear range of 0.75-250ng/40µL (i.e., 19-6250ng/mL), both with an incubation time of 10min. The results indicate that the sensor has a suitable sensitivity and dynamic range for routine detection of PCa circulating tumor cells and can be adapted to detect other biomarkers/cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Memory in astrocytes: a hypothesis

    Directory of Open Access Journals (Sweden)

    Caudle Robert M

    2006-01-01

    Full Text Available Abstract Background Recent work has indicated an increasingly complex role for astrocytes in the central nervous system. Astrocytes are now known to exchange information with neurons at synaptic junctions and to alter the information processing capabilities of the neurons. As an extension of this trend a hypothesis was proposed that astrocytes function to store information. To explore this idea the ion channels in biological membranes were compared to models known as cellular automata. These comparisons were made to test the hypothesis that ion channels in the membranes of astrocytes form a dynamic information storage device. Results Two dimensional cellular automata were found to behave similarly to ion channels in a membrane when they function at the boundary between order and chaos. The length of time information is stored in this class of cellular automata is exponentially related to the number of units. Therefore the length of time biological ion channels store information was plotted versus the estimated number of ion channels in the tissue. This analysis indicates that there is an exponential relationship between memory and the number of ion channels. Extrapolation of this relationship to the estimated number of ion channels in the astrocytes of a human brain indicates that memory can be stored in this system for an entire life span. Interestingly, this information is not affixed to any physical structure, but is stored as an organization of the activity of the ion channels. Further analysis of two dimensional cellular automata also demonstrates that these systems have both associative and temporal memory capabilities. Conclusion It is concluded that astrocytes may serve as a dynamic information sink for neurons. The memory in the astrocytes is stored by organizing the activity of ion channels and is not associated with a physical location such as a synapse. In order for this form of memory to be of significant duration it is necessary

  2. Global transcription regulation of RK2 plasmids: a case study in the combined use of dynamical mathematical models and statistical inference for integration of experimental data and hypothesis exploration

    Directory of Open Access Journals (Sweden)

    Thomas Christopher M

    2011-07-01

    Full Text Available Abstract Background IncP-1 plasmids are broad host range plasmids that have been found in clinical and environmental bacteria. They often carry genes for antibiotic resistance or catabolic pathways. The archetypal IncP-1 plasmid RK2 is a well-characterized biological system, with a fully sequenced and annotated genome and wide range of experimental measurements. Its central control operon, encoding two global regulators KorA and KorB, is a natural example of a negatively self-regulated operon. To increase our understanding of the regulation of this operon, we have constructed a dynamical mathematical model using Ordinary Differential Equations, and employed a Bayesian inference scheme, Markov Chain Monte Carlo (MCMC using the Metropolis-Hastings algorithm, as a way of integrating experimental measurements and a priori knowledge. We also compared MCMC and Metabolic Control Analysis (MCA as approaches for determining the sensitivity of model parameters. Results We identified two distinct sets of parameter values, with different biological interpretations, that fit and explain the experimental data. This allowed us to highlight the proportion of repressor protein as dimers as a key experimental measurement defining the dynamics of the system. Analysis of joint posterior distributions led to the identification of correlations between parameters for protein synthesis and partial repression by KorA or KorB dimers, indicating the necessary use of joint posteriors for correct parameter estimation. Using MCA, we demonstrated that the system is highly sensitive to the growth rate but insensitive to repressor monomerization rates in their selected value regions; the latter outcome was also confirmed by MCMC. Finally, by examining a series of different model refinements for partial repression by KorA or KorB dimers alone, we showed that a model including partial repression by KorA and KorB was most compatible with existing experimental data. Conclusions We

  3. A Sol-gel Integrated Dual-readout Microarray Platform for Quantification and Identification of Prostate-specific Antigen.

    Science.gov (United States)

    Lee, SangWook; Lee, Jong Hyun; Kwon, Hyuck Gi; Laurell, Thomas; Jeong, Ok Chan; Kim, Soyoun

    2018-01-01

    Here, we report a sol-gel integrated affinity microarray for on-chip matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) that enables capture and identification of prostate?specific antigen (PSA) in samples. An anti-PSA antibody (H117) was mixed with a sol?gel, and the mixture was spotted onto a porous silicon (pSi) surface without additional surface modifications. The antibody easily penetrates the sol-gel macropore fluidic network structure, making possible high affinities. To assess the capture affinity of the platform, we performed a direct assay using fluorescein isothiocyanate-labeled PSA. Pure PSA was subjected to on-chip MALDI-TOF-MS analysis, yielding three clear mass peptide peaks (m/z = 1272, 1407, and 1872). The sol-gel microarray platform enables dual readout of PSA both fluorometric and MALDI-TOF MS analysis in biological samples. Here we report a useful method for a means for discovery of biomarkers in complex body fluids.

  4. Predictive Direct Torque Control Application-Specific Integrated Circuit of an Induction Motor Drive with a Fuzzy Controller

    Directory of Open Access Journals (Sweden)

    Guo-Ming Sung

    2017-06-01

    Full Text Available This paper proposes a modified predictive direct torque control (PDTC application-specific integrated circuit (ASIC of a motor drive with a fuzzy controller for eliminating sampling and calculating delay times in hysteresis controllers. These delay times degrade the control quality and increase both torque and flux ripples in a motor drive. The proposed fuzzy PDTC ASIC calculates the stator’s magnetic flux and torque by detecting the three-phase current, three-phase voltage, and rotor speed, and eliminates the ripples in the torque and flux by using a fuzzy controller and predictive scheme. The Verilog hardware description language was used to implement the hardware architecture, and the ASIC was fabricated by the Taiwan Semiconductor Manufacturing Company through a 0.18-μm 1P6M CMOS process that involved a cell-based design method. The measurements revealed that the proposed fuzzy PDTC ASIC of the three-phase induction motor yielded a test coverage of 96.03%, fault coverage of 95.06%, chip area of 1.81 × 1.81 mm2, and power consumption of 296 mW, at an operating frequency of 50 MHz and a supply voltage of 1.8 V.

  5. Robust and distributed hypothesis testing

    CERN Document Server

    Gül, Gökhan

    2017-01-01

    This book generalizes and extends the available theory in robust and decentralized hypothesis testing. In particular, it presents a robust test for modeling errors which is independent from the assumptions that a sufficiently large number of samples is available, and that the distance is the KL-divergence. Here, the distance can be chosen from a much general model, which includes the KL-divergence as a very special case. This is then extended by various means. A minimax robust test that is robust against both outliers as well as modeling errors is presented. Minimax robustness properties of the given tests are also explicitly proven for fixed sample size and sequential probability ratio tests. The theory of robust detection is extended to robust estimation and the theory of robust distributed detection is extended to classes of distributions, which are not necessarily stochastically bounded. It is shown that the quantization functions for the decision rules can also be chosen as non-monotone. Finally, the boo...

  6. The venom optimization hypothesis revisited.

    Science.gov (United States)

    Morgenstern, David; King, Glenn F

    2013-03-01

    Animal venoms are complex chemical mixtures that typically contain hundreds of proteins and non-proteinaceous compounds, resulting in a potent weapon for prey immobilization and predator deterrence. However, because venoms are protein-rich, they come with a high metabolic price tag. The metabolic cost of venom is sufficiently high to result in secondary loss of venom whenever its use becomes non-essential to survival of the animal. The high metabolic cost of venom leads to the prediction that venomous animals may have evolved strategies for minimizing venom expenditure. Indeed, various behaviors have been identified that appear consistent with frugality of venom use. This has led to formulation of the "venom optimization hypothesis" (Wigger et al. (2002) Toxicon 40, 749-752), also known as "venom metering", which postulates that venom is metabolically expensive and therefore used frugally through behavioral control. Here, we review the available data concerning economy of venom use by animals with either ancient or more recently evolved venom systems. We conclude that the convergent nature of the evidence in multiple taxa strongly suggests the existence of evolutionary pressures favoring frugal use of venom. However, there remains an unresolved dichotomy between this economy of venom use and the lavish biochemical complexity of venom, which includes a high degree of functional redundancy. We discuss the evidence for biochemical optimization of venom as a means of resolving this conundrum. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Alien abduction: a medical hypothesis.

    Science.gov (United States)

    Forrest, David V

    2008-01-01

    In response to a new psychological study of persons who believe they have been abducted by space aliens that found that sleep paralysis, a history of being hypnotized, and preoccupation with the paranormal and extraterrestrial were predisposing experiences, I noted that many of the frequently reported particulars of the abduction experience bear more than a passing resemblance to medical-surgical procedures and propose that experience with these may also be contributory. There is the altered state of consciousness, uniformly colored figures with prominent eyes, in a high-tech room under a round bright saucerlike object; there is nakedness, pain and a loss of control while the body's boundaries are being probed; and yet the figures are thought benevolent. No medical-surgical history was apparently taken in the above mentioned study, but psychological laboratory work evaluated false memory formation. I discuss problems in assessing intraoperative awareness and ways in which the medical hypothesis could be elaborated and tested. If physicians are causing this syndrome in a percentage of patients, we should know about it; and persons who feel they have been abducted should be encouraged to inform their surgeons and anesthesiologists without challenging their beliefs.

  8. The oxidative hypothesis of senescence

    Directory of Open Access Journals (Sweden)

    Gilca M

    2007-01-01

    Full Text Available The oxidative hypothesis of senescence, since its origin in 1956, has garnered significant evidence and growing support among scientists for the notion that free radicals play an important role in ageing, either as "damaging" molecules or as signaling molecules. Age-increasing oxidative injuries induced by free radicals, higher susceptibility to oxidative stress in short-lived organisms, genetic manipulations that alter both oxidative resistance and longevity and the anti-ageing effect of caloric restriction and intermittent fasting are a few examples of accepted scientific facts that support the oxidative theory of senescence. Though not completely understood due to the complex "network" of redox regulatory systems, the implication of oxidative stress in the ageing process is now well documented. Moreover, it is compatible with other current ageing theories (e.g., those implicating the mitochondrial damage/mitochondrial-lysosomal axis, stress-induced premature senescence, biological "garbage" accumulation, etc. This review is intended to summarize and critically discuss the redox mechanisms involved during the ageing process: sources of oxidant agents in ageing (mitochondrial -electron transport chain, nitric oxide synthase reaction- and non-mitochondrial- Fenton reaction, microsomal cytochrome P450 enzymes, peroxisomal β -oxidation and respiratory burst of phagocytic cells, antioxidant changes in ageing (enzymatic- superoxide dismutase, glutathione-reductase, glutathion peroxidase, catalase- and non-enzymatic glutathione, ascorbate, urate, bilirubine, melatonin, tocopherols, carotenoids, ubiquinol, alteration of oxidative damage repairing mechanisms and the role of free radicals as signaling molecules in ageing.

  9. The linear hypothesis - an idea whose time has passed

    International Nuclear Information System (INIS)

    Tschaeche, A.N.

    1995-01-01

    The linear no-threshold hypothesis is the basis for radiation protection standards in the United States. In the words of the National Council on Radiation Protection and Measurements (NCRP), the hypothesis is: open-quotes In the interest of estimating effects in humans conservatively, it is not unreasonable to follow the assumption of a linear relationship between dose and effect in the low dose regions for which direct observational data are not available.close quotes The International Commission on Radiological Protection (ICRP) stated the hypothesis in a slightly different manner: open-quotes One such basic assumption ... is that ... there is ... a linear relationship without threshold between dose and the probability of an effect. The hypothesis was necessary 50 yr ago when it was first enunciated because the dose-effect curve for ionizing radiation for effects in humans was not known. The ICRP and NCRP needed a model to extrapolate high-dose effects to low-dose effects. So the linear no-threshold hypothesis was born. Certain details of the history of the development and use of the linear hypothesis are presented. In particular, use of the hypothesis by the U.S. regulatory agencies is examined. Over time, the sense of the hypothesis has been corrupted. The corruption of the hypothesis into the current paradigm of open-quote a little radiation, no matter how small, can and will harm youclose quotes is presented. The reasons the corruption occurred are proposed. The effects of the corruption are enumerated, specifically, the use of the corruption by the antinuclear forces in the United States and some of the huge costs to U.S. taxpayers due to the corruption. An alternative basis for radiation protection standards to assure public safety, based on the weight of scientific evidence on radiation health effects, is proposed

  10. 'Integration'

    DEFF Research Database (Denmark)

    Olwig, Karen Fog

    2011-01-01

    , while the countries have adopted disparate policies and ideologies, differences in the actual treatment and attitudes towards immigrants and refugees in everyday life are less clear, due to parallel integration programmes based on strong similarities in the welfare systems and in cultural notions...... of equality in the three societies. Finally, it shows that family relations play a central role in immigrants’ and refugees’ establishment of a new life in the receiving societies, even though the welfare society takes on many of the social and economic functions of the family....

  11. Integrated genetic and epigenetic analysis identifies haplotype-specific methylation in the FTO type 2 diabetes and obesity susceptibility locus.

    Directory of Open Access Journals (Sweden)

    Christopher G Bell

    2010-11-01

    Full Text Available Recent multi-dimensional approaches to the study of complex disease have revealed powerful insights into how genetic and epigenetic factors may underlie their aetiopathogenesis. We examined genotype-epigenotype interactions in the context of Type 2 Diabetes (T2D, focussing on known regions of genomic susceptibility. We assayed DNA methylation in 60 females, stratified according to disease susceptibility haplotype using previously identified association loci. CpG methylation was assessed using methylated DNA immunoprecipitation on a targeted array (MeDIP-chip and absolute methylation values were estimated using a Bayesian algorithm (BATMAN. Absolute methylation levels were quantified across LD blocks, and we identified increased DNA methylation on the FTO obesity susceptibility haplotype, tagged by the rs8050136 risk allele A (p = 9.40×10(-4, permutation p = 1.0×10(-3. Further analysis across the 46 kb LD block using sliding windows localised the most significant difference to be within a 7.7 kb region (p = 1.13×10(-7. Sequence level analysis, followed by pyrosequencing validation, revealed that the methylation difference was driven by the co-ordinated phase of CpG-creating SNPs across the risk haplotype. This 7.7 kb region of haplotype-specific methylation (HSM, encapsulates a Highly Conserved Non-Coding Element (HCNE that has previously been validated as a long-range enhancer, supported by the histone H3K4me1 enhancer signature. This study demonstrates that integration of Genome-Wide Association (GWA SNP and epigenomic DNA methylation data can identify potential novel genotype-epigenotype interactions within disease-associated loci, thus providing a novel route to aid unravelling common complex diseases.

  12. Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

    Science.gov (United States)

    Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun

    2016-09-01

    To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.

  13. Plasma cell-free DNA and its DNA integrity as biomarker to distinguish prostate cancer from benign prostatic hyperplasia in patients with increased serum prostate-specific antigen.

    Science.gov (United States)

    Feng, Jiang; Gang, Feng; Li, Xiao; Jin, Tang; Houbao, Huang; Yu, Cao; Guorong, Li

    2013-08-01

    To investigate whether plasma cell-free DNA (cfDNA) or its integrity could differentiate prostate cancer from benign prostate hyperplasia (BPH) in patients with serum prostate-specific antigen (PSA) ≥ 4 ng/ml. Ninety-six patients with prostate cancer and 112 patients with BPH were enrolled. cfDNA levels in plasma before prostate biopsy were quantified by real-time PCR amplification of ALU gene (product size of 115 bp), and quantitative ratio of ALU (247 bp) to ALU (115 bp) reflected the integrity of cfDNA. In patients with serum PSA ≥ 4 ng/ml, there were significant differences in plasma cfDNA or its integrity between the patients with prostate cancer (19.74 ± 4.43, 0.34 ± 0.05) and patients with BPH (7.36 ± 1.58, 0.19 ± 0.03; P Prostate cancer could be differentiated with a sensitivity of 73.2 % and a specificity of 72.7 % by cfDNA (AUC = 0.864). The integrity of cfDNA had a sensitivity of 81.7 % and a specificity of 78.8 % for the distinguishing prostate cancer from BPH (AUC = 0.910). cfDNA and its integrity could be applied to differentiate prostate cancer from BPH in patients with serum PSA ≥ 4 ng/ml.

  14. Apportioning sources of organic matter in streambed sediments: An integrated molecular and compound-specific stable isotope approach

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, Richard J., E-mail: Richard.J.Cooper@uea.ac.uk [School of Environmental Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 7TJ (United Kingdom); Pedentchouk, Nikolai; Hiscock, Kevin M.; Disdle, Paul [School of Environmental Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 7TJ (United Kingdom); Krueger, Tobias [IRI THESys, Humboldt University, 10099 Berlin (Germany); Rawlins, Barry G. [British Geological Survey, Keyworth, Nottingham NG12 5GG (United Kingdom)

    2015-07-01

    apportionment of organic matter sources. Median organic matter contributions ranged from 22% to 52% for trees, 29% to 50% for herbaceous perennials, 17% to 34% for C{sub 3} graminoids and 3% to 7% for C{sub 4} graminoids. The results presented here clearly demonstrate the effectiveness of an integrated molecular and stable isotope analysis for quantitatively apportioning, with uncertainty, plant-specific organic matter contributions to streambed sediments via a Bayesian mixing model approach. - Highlights: • Organic contributions from trees, herbs and C{sub 3}/C{sub 4} graminoids are apportioned. • δ{sup 2}H provides strong discrimination between plant functional types. • δ{sup 13}C provides strong contrasts between C{sub 3} and C{sub 4} plants. • δ{sup 2}H and δ{sup 13}C values could not differentiate aquatic and terrestrial species. • n-Alkane ratios compliment isotopic discrimination.

  15. Delirium pathophysiology: An updated hypothesis of the etiology of acute brain failure.

    Science.gov (United States)

    Maldonado, José R

    2017-12-26

    Delirium is the most common neuropsychiatric syndrome encountered by clinicians dealing with older adults and the medically ill and is best characterized by 5 core domains: cognitive deficits, attentional deficits, circadian rhythm dysregulation, emotional dysregulation, and alteration in psychomotor functioning. An extensive literature review and consolidation of published data into a novel interpretation of known pathophysiological causes of delirium. Available data suggest that numerous pathological factors may serve as precipitants for delirium, each having differential effects depending on patient-specific patient physiological characteristics (substrate). On the basis of an extensive literature search, a newly proposed theory, the systems integration failure hypothesis, was developed to bring together the most salient previously described theories, by describing the various contributions from each into a complex web of pathways-highlighting areas of intersection and commonalities and explaining how the variable contribution of these may lead to the development of various cognitive and behavioral dysfunctions characteristic of delirium. The specific cognitive and behavioral manifestations of the specific delirium picture result from a combination of neurotransmitter function and availability, variability in integration and processing of sensory information, motor responses to both external and internal cues, and the degree of breakdown in neuronal network connectivity, hence the term acute brain failure. The systems integration failure hypothesis attempts to explain how the various proposed delirium pathophysiologic theories interact with each other, causing various clinically observed delirium phenotypes. A better understanding of the underlying pathophysiology of delirium may eventually assist in designing better prevention and management approaches. Copyright © 2017 John Wiley & Sons, Ltd.

  16. Validity of Linder Hypothesis in Bric Countries

    Directory of Open Access Journals (Sweden)

    Rana Atabay

    2016-03-01

    Full Text Available In this study, the theory of similarity in preferences (Linder hypothesis has been introduced and trade in BRIC countries has been examined whether the trade between these countries was valid for this hypothesis. Using the data for the period 1996 – 2010, the study applies to panel data analysis in order to provide evidence regarding the empirical validity of the Linder hypothesis for BRIC countries’ international trade. Empirical findings show that the trade between BRIC countries is in support of Linder hypothesis.

  17. Vascular Gene Expression: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Angélica Concepción eMartínez-Navarro

    2013-07-01

    Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.

  18. Developmental Origins of Chronic Renal Disease: An Integrative Hypothesis

    Directory of Open Access Journals (Sweden)

    F. Boubred

    2013-01-01

    Full Text Available Cardiovascular diseases are one of the leading causes of mortality. Hypertension (HT is one of the principal risk factors associated with death. Chronic kidney disease (CKD, which is probably underestimated, increases the risk and the severity of adverse cardiovascular events. It is now recognized that low birth weight is a risk factor for these diseases, and this relationship is amplified by a rapid catch-up growth or overfeeding during infancy or childhood. The pathophysiological and molecular mechanisms involved in the “early programming” of CKD are multiple and partially understood. It has been proposed that the developmental programming of arterial hypertension and chronic kidney disease is related to a reduced nephron endowment. However, this mechanism is still discussed. This review discusses the complex relationship between birth weight and nephron endowment and how early growth and nutrition influence long term HT and CKD. We hypothesize that fetal environment reduces moderately the nephron number which appears insufficient by itself to induce long term diseases. Reduced nephron number constitutes a “factor of vulnerability” when additional factors, in particular a rapid postnatal growth or overfeeding, promote the early onset of diseases through a complex combination of various pathophysiological pathways.

  19. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  20. Quadratic Forms and Semiclassical Eigenfunction Hypothesis for Flat Tori

    Science.gov (United States)

    T. Sardari, Naser

    2018-03-01

    Let Q( X) be any integral primitive positive definite quadratic form in k variables, where {k≥4}, and discriminant D. For any integer n, we give an upper bound on the number of integral solutions of Q( X) = n in terms of n, k, and D. As a corollary, we prove a conjecture of Lester and Rudnick on the small scale equidistribution of almost all functions belonging to any orthonormal basis of a given eigenspace of the Laplacian on the flat torus {T^d} for {d≥ 5}. This conjecture is motivated by the work of Berry [2,3] on the semiclassical eigenfunction hypothesis.

  1. Hypothesis Testing in the Real World

    Science.gov (United States)

    Miller, Jeff

    2017-01-01

    Critics of null hypothesis significance testing suggest that (a) its basic logic is invalid and (b) it addresses a question that is of no interest. In contrast to (a), I argue that the underlying logic of hypothesis testing is actually extremely straightforward and compelling. To substantiate that, I present examples showing that hypothesis…

  2. Error probabilities in default Bayesian hypothesis testing

    NARCIS (Netherlands)

    Gu, Xin; Hoijtink, Herbert; Mulder, J,

    2016-01-01

    This paper investigates the classical type I and type II error probabilities of default Bayes factors for a Bayesian t test. Default Bayes factors quantify the relative evidence between the null hypothesis and the unrestricted alternative hypothesis without needing to specify prior distributions for

  3. Reassessing the Trade-off Hypothesis

    DEFF Research Database (Denmark)

    Rosas, Guillermo; Manzetti, Luigi

    2015-01-01

    Do economic conditions drive voters to punish politicians that tolerate corruption? Previous scholarly work contends that citizens in young democracies support corrupt governments that are capable of promoting good economic outcomes, the so-called trade-off hypothesis. We test this hypothesis based...

  4. Mastery Learning and the Decreasing Variability Hypothesis.

    Science.gov (United States)

    Livingston, Jennifer A.; Gentile, J. Ronald

    1996-01-01

    This report results from studies that tested two variations of Bloom's decreasing variability hypothesis using performance on successive units of achievement in four graduate classrooms that used mastery learning procedures. Data do not support the decreasing variability hypothesis; rather, they show no change over time. (SM)

  5. Life sciences payload definition and integration study, task C and D. Volume 4: Preliminary equipment item specification catalog

    Science.gov (United States)

    1973-01-01

    A specification catalog to define the equipment to be used for conducting life sciences experiments in a space laboratory is presented. The specification sheets list the purpose of the equipment item, and any specific technical requirements which can be identified. The status of similar hardware for ground use is stated with comments regarding modifications required to achieve spaceflight qualified hardware. Pertinent sketches, commercial catalog sheets, or drawings of the applicable equipment are included.

  6. Testing the gravitational instability hypothesis?

    Science.gov (United States)

    Babul, Arif; Weinberg, David H.; Dekel, Avishai; Ostriker, Jeremiah P.

    1994-01-01

    We challenge a widely accepted assumption of observational cosmology: that successful reconstruction of observed galaxy density fields from measured galaxy velocity fields (or vice versa), using the methods of gravitational instability theory, implies that the observed large-scale structures and large-scale flows were produced by the action of gravity. This assumption is false, in that there exist nongravitational theories that pass the reconstruction tests and gravitational theories with certain forms of biased galaxy formation that fail them. Gravitational instability theory predicts specific correlations between large-scale velocity and mass density fields, but the same correlations arise in any model where (a) structures in the galaxy distribution grow from homogeneous initial conditions in a way that satisfies the continuity equation, and (b) the present-day velocity field is irrotational and proportional to the time-averaged velocity field. We demonstrate these assertions using analytical arguments and N-body simulations. If large-scale structure is formed by gravitational instability, then the ratio of the galaxy density contrast to the divergence of the velocity field yields an estimate of the density parameter Omega (or, more generally, an estimate of beta identically equal to Omega(exp 0.6)/b, where b is an assumed constant of proportionality between galaxy and mass density fluctuations. In nongravitational scenarios, the values of Omega or beta estimated in this way may fail to represent the true cosmological values. However, even if nongravitational forces initiate and shape the growth of structure, gravitationally induced accelerations can dominate the velocity field at late times, long after the action of any nongravitational impulses. The estimated beta approaches the true value in such cases, and in our numerical simulations the estimated beta values are reasonably accurate for both gravitational and nongravitational models. Reconstruction tests

  7. Rehabilitation-specific challenges and advantages in the integration of migrant physicians in Germany: a multiperspective qualitative interview study in rehabilitative settings.

    Science.gov (United States)

    Jansen, E; Hänel, P; Klingler, C

    2018-07-01

    In Germany, rehabilitative healthcare institutions increasingly rely on migrant physicians to meet their staffing needs. Yet until now, research on the integration of migrant physicians has focussed entirely on the acute care setting. This study is the first to address the specific advantages and challenges to integration in the field of rehabilitative medicine where a high number of migrant physicians work. From the experiences of migrant physicians and their colleagues, we provide actionable suggestions to counteract potential sources of conflict and thereby improve the integration of migrant physicians in the German workforce. We conducted a qualitative interview study. We conducted 23 interviews with a total of 26 participants occupying a variety of roles in two different rehabilitation centres (maximum variation sampling). Interviews were recorded, transcribed verbatim and parsed through thematic analysis. Our research revealed advantages and challenges to integration in three distinct areas: rehabilitative care institutions, competencies of migrant professionals and interpersonal relations. The first set of issues hinges on the work processes within rehabilitative hospitals, professional prospects there and the location of the institutions themselves. Second, migrant physicians may encounter difficulties because of limited linguistic skills and country-specific knowledge. And finally, aspects of their interactions with care teams and patients may constitute barriers to integration. Some of the factors influencing the integration of migrant physicians are the same in both rehabilitative and acute medicine, but the rehabilitative setting presents distinct advantages and challenges that are worthy of study in their own right. We outline several measures which could help overcome challenges to the integration of migrant physicians, including those associated with professional relationships. Further research is needed to develop concrete support programmes

  8. DAMPs, ageing, and cancer: The 'DAMP Hypothesis'.

    Science.gov (United States)

    Huang, Jin; Xie, Yangchun; Sun, Xiaofang; Zeh, Herbert J; Kang, Rui; Lotze, Michael T; Tang, Daolin

    2015-11-01

    Ageing is a complex and multifactorial process characterized by the accumulation of many forms of damage at the molecular, cellular, and tissue level with advancing age. Ageing increases the risk of the onset of chronic inflammation-associated diseases such as cancer, diabetes, stroke, and neurodegenerative disease. In particular, ageing and cancer share some common origins and hallmarks such as genomic instability, epigenetic alteration, aberrant telomeres, inflammation and immune injury, reprogrammed metabolism, and degradation system impairment (including within the ubiquitin-proteasome system and the autophagic machinery). Recent advances indicate that damage-associated molecular pattern molecules (DAMPs) such as high mobility group box 1, histones, S100, and heat shock proteins play location-dependent roles inside and outside the cell. These provide interaction platforms at molecular levels linked to common hallmarks of ageing and cancer. They can act as inducers, sensors, and mediators of stress through individual plasma membrane receptors, intracellular recognition receptors (e.g., advanced glycosylation end product-specific receptors, AIM2-like receptors, RIG-I-like receptors, and NOD1-like receptors, and toll-like receptors), or following endocytic uptake. Thus, the DAMP Hypothesis is novel and complements other theories that explain the features of ageing. DAMPs represent ideal biomarkers of ageing and provide an attractive target for interventions in ageing and age-associated diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Pre-service teachers' competencies for technology integration: Insights from a mathematics-specific instructional technology course

    NARCIS (Netherlands)

    Agyei, D.D.; Voogt, Joke; Resta, P.

    2012-01-01

    A combination of various measures (self-report, learning outcomes and written reports) was employed to investigate 104 pre-service teachers’ competencies in spreadsheet integration after enrolling in an Instructional Technology course. The pre-service teachers engaged in a “learning technology by

  10. Pre-Service Teachers' TPACK Competencies for Spreadsheet Integration: Insights from a Mathematics-Specific Instructional Technology Course

    Science.gov (United States)

    Agyei, Douglas D.; Voogt, Joke M.

    2015-01-01

    This article explored the impact of strategies applied in a mathematics instructional technology course for developing technology integration competencies, in particular in the use of spreadsheets, in pre-service teachers. In this respect, 104 pre-service mathematics teachers from a teacher training programme in Ghana enrolled in the mathematics…

  11. Pre-service teachers’ TPACK competencies for spreadsheet integration: insights from a mathematics-specific instructional technology course

    NARCIS (Netherlands)

    Agyei, D.D.; Voogt, J.M.

    2015-01-01

    This article explored the impact of strategies applied in a mathematics instructional technology course for developing technology integration competencies, in particular in the use of spreadsheets, in pre-service teachers. In this respect, 104 pre-service mathematics teachers from a teacher training

  12. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  13. Implications of the Bohm-Aharonov hypothesis

    International Nuclear Information System (INIS)

    Ghirardi, G.C.; Rimini, A.; Weber, T.

    1976-01-01

    It is proved that the Bohm-Aharonov hypothesis concerning largerly separated subsystems of composite quantum systems implies that it is impossible to express the dynamical evolution in terms of the density operator

  14. Multi-agent sequential hypothesis testing

    KAUST Repository

    Kim, Kwang-Ki K.; Shamma, Jeff S.

    2014-01-01

    incorporate costs of taking private/public measurements, costs of time-difference and disagreement in actions of agents, and costs of false declaration/choices in the sequential hypothesis testing. The corresponding sequential decision processes have well

  15. The (not so) Immortal Strand Hypothesis

    OpenAIRE

    Tomasetti, Cristian; Bozic, Ivana

    2015-01-01

    Background: Non-random segregation of DNA strands during stem cell replication has been proposed as a mechanism to minimize accumulated genetic errors in stem cells of rapidly dividing tissues. According to this hypothesis, an “immortal” DNA strand is passed to the stem cell daughter and not the more differentiated cell, keeping the stem cell lineage replication error-free. After it was introduced, experimental evidence both in favor and against the hypothesis has been presented. Principal...

  16. The frequentist implications of optional stopping on Bayesian hypothesis tests.

    Science.gov (United States)

    Sanborn, Adam N; Hills, Thomas T

    2014-04-01

    Null hypothesis significance testing (NHST) is the most commonly used statistical methodology in psychology. The probability of achieving a value as extreme or more extreme than the statistic obtained from the data is evaluated, and if it is low enough, the null hypothesis is rejected. However, because common experimental practice often clashes with the assumptions underlying NHST, these calculated probabilities are often incorrect. Most commonly, experimenters use tests that assume that sample sizes are fixed in advance of data collection but then use the data to determine when to stop; in the limit, experimenters can use data monitoring to guarantee that the null hypothesis will be rejected. Bayesian hypothesis testing (BHT) provides a solution to these ills because the stopping rule used is irrelevant to the calculation of a Bayes factor. In addition, there are strong mathematical guarantees on the frequentist properties of BHT that are comforting for researchers concerned that stopping rules could influence the Bayes factors produced. Here, we show that these guaranteed bounds have limited scope and often do not apply in psychological research. Specifically, we quantitatively demonstrate the impact of optional stopping on the resulting Bayes factors in two common situations: (1) when the truth is a combination of the hypotheses, such as in a heterogeneous population, and (2) when a hypothesis is composite-taking multiple parameter values-such as the alternative hypothesis in a t-test. We found that, for these situations, while the Bayesian interpretation remains correct regardless of the stopping rule used, the choice of stopping rule can, in some situations, greatly increase the chance of experimenters finding evidence in the direction they desire. We suggest ways to control these frequentist implications of stopping rules on BHT.

  17. [Psychodynamic hypothesis about suicidality in elderly men].

    Science.gov (United States)

    Lindner, Reinhard

    2010-08-01

    Old men are overrepresented in the whole of all suicides. In contrast, only very few elderly men find their way to specialised treatment facilities. Elderly accept psychotherapy more rarely than younger persons. Therefore presentations on the psychodynamics of suicidality in old men are rare and mostly casuistical. By means of a stepwise reconstructable qualitative case comparison of five randomly chosen elderly suicidal men with ideal types of suicidal (younger) men concerning biography, suicidal symptoms and transference, psychodynamic hypothesis of suicidality in elderly men are developed. All patients came into psychotherapy in a specialised academic out-patient clinic for psychodynamic treatment of acute and chronic suicidality. The five elderly suicidal men predominantly were living in long-term, conflictuous sexual relationships and also had ambivalent relationships to their children. Suicidality in old age refers to lifelong existing intrapsychic conflicts, concerning (male) identity, self-esteem and a core conflict between fusion and separation wishes. The body gets a central role in suicidal experiences, being a defensive instance modified by age and/or physical illness, which brings up to consciousness aggressive and envious impulses, but also feelings of emptiness and insecurity, which have to be warded off again by projection into the body. In transference relationships there are on the one hand the regular transference, on the other hand an age specific turned around transference, with their counter transference reactions. The chosen methodological approach serves the systematic finding of hypotheses with a higher degree in evidence than hypotheses generated from single case studies. Georg Thieme Verlag KG Stuttgart - New York.

  18. Atopic dermatitis and the hygiene hypothesis revisited.

    Science.gov (United States)

    Flohr, Carsten; Yeo, Lindsey

    2011-01-01

    We published a systematic review on atopic dermatitis (AD) and the hygiene hypothesis in 2005. Since then, the body of literature has grown significantly. We therefore repeated our systematic review to examine the evidence from population-based studies for an association between AD risk and specific infections, childhood immunizations, the use of antibiotics and environmental exposures that lead to a change in microbial burden. Medline was searched from 1966 until June 2010 to identify relevant studies. We found an additional 49 papers suitable for inclusion. There is evidence to support an inverse relationship between AD and endotoxin, early day care, farm animal and dog exposure in early life. Cat exposure in the presence of skin barrier impairment is positively associated with AD. Helminth infection at least partially protects against AD. This is not the case for viral and bacterial infections, but consumption of unpasteurized farm milk seems protective. Routine childhood vaccinations have no effect on AD risk. The positive association between viral infections and AD found in some studies appears confounded by antibiotic prescription, which has been consistently associated with an increase in AD risk. There is convincing evidence for an inverse relationship between helminth infections and AD but no other pathogens. The protective effect seen with early day care, endotoxin, unpasteurized farm milk and animal exposure is likely to be due to a general increase in exposure to non-pathogenic microbes. This would also explain the risk increase associated with the use of broad-spectrum antibiotics. Future studies should assess skin barrier gene mutation carriage and phenotypic skin barrier impairment, as gene-environment interactions are likely to impact on AD risk. Copyright © 041_ S. Karger AG, Basel.

  19. The functional matrix hypothesis revisited. 3. The genomic thesis.

    Science.gov (United States)

    Moss, M L

    1997-09-01

    Although the initial versions of the functional matrix hypothesis (FMH) theoretically posited the ontogenetic primacy of "function," it is only in recent years that advances in the morphogenetic, engineering, and computer sciences provided an integrated experimental and numerical data base that permitted recent significant revisions of the FMH--revisions that strongly support the primary role of function in craniofacial growth and development. Acknowledging that the currently dominant scientific paradigm suggests that genomic, instead of epigenetic (functional) factors, regulate (cause, control) such growth, an analysis of this continuing controversy was deemed useful. Accordingly the method of dialectical analysis, is employed, stating a thesis, an antithesis, and a resolving synthesis based primarily on an extensive review of the pertinent current literature. This article extensively reviews the genomic hypothesis and offers a critique intended to remove some of the unintentional conceptual obscurantism that has recently come to surround it.

  20. The zinc dyshomeostasis hypothesis of Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Travis J A Craddock

    Full Text Available Alzheimer's disease (AD is the most common form of dementia in the elderly. Hallmark AD neuropathology includes extracellular amyloid plaques composed largely of the amyloid-β protein (Aβ, intracellular neurofibrillary tangles (NFTs composed of hyper-phosphorylated microtubule-associated protein tau (MAP-tau, and microtubule destabilization. Early-onset autosomal dominant AD genes are associated with excessive Aβ accumulation, however cognitive impairment best correlates with NFTs and disrupted microtubules. The mechanisms linking Aβ and NFT pathologies in AD are unknown. Here, we propose that sequestration of zinc by Aβ-amyloid deposits (Aβ oligomers and plaques not only drives Aβ aggregation, but also disrupts zinc homeostasis in zinc-enriched brain regions important for memory and vulnerable to AD pathology, resulting in intra-neuronal zinc levels, which are either too low, or excessively high. To evaluate this hypothesis, we 1 used molecular modeling of zinc binding to the microtubule component protein tubulin, identifying specific, high-affinity zinc binding sites that influence side-to-side tubulin interaction, the sensitive link in microtubule polymerization and stability. We also 2 performed kinetic modeling showing zinc distribution in extra-neuronal Aβ deposits can reduce intra-neuronal zinc binding to microtubules, destabilizing microtubules. Finally, we 3 used metallomic imaging mass spectrometry (MIMS to show anatomically-localized and age-dependent zinc dyshomeostasis in specific brain regions of Tg2576 transgenic, mice, a model for AD. We found excess zinc in brain regions associated with memory processing and NFT pathology. Overall, we present a theoretical framework and support for a new theory of AD linking extra-neuronal Aβ amyloid to intra-neuronal NFTs and cognitive dysfunction. The connection, we propose, is based on β-amyloid-induced alterations in zinc ion concentration inside neurons affecting stability of

  1. The zinc dyshomeostasis hypothesis of Alzheimer's disease.

    Science.gov (United States)

    Craddock, Travis J A; Tuszynski, Jack A; Chopra, Deepak; Casey, Noel; Goldstein, Lee E; Hameroff, Stuart R; Tanzi, Rudolph E

    2012-01-01

    Alzheimer's disease (AD) is the most common form of dementia in the elderly. Hallmark AD neuropathology includes extracellular amyloid plaques composed largely of the amyloid-β protein (Aβ), intracellular neurofibrillary tangles (NFTs) composed of hyper-phosphorylated microtubule-associated protein tau (MAP-tau), and microtubule destabilization. Early-onset autosomal dominant AD genes are associated with excessive Aβ accumulation, however cognitive impairment best correlates with NFTs and disrupted microtubules. The mechanisms linking Aβ and NFT pathologies in AD are unknown. Here, we propose that sequestration of zinc by Aβ-amyloid deposits (Aβ oligomers and plaques) not only drives Aβ aggregation, but also disrupts zinc homeostasis in zinc-enriched brain regions important for memory and vulnerable to AD pathology, resulting in intra-neuronal zinc levels, which are either too low, or excessively high. To evaluate this hypothesis, we 1) used molecular modeling of zinc binding to the microtubule component protein tubulin, identifying specific, high-affinity zinc binding sites that influence side-to-side tubulin interaction, the sensitive link in microtubule polymerization and stability. We also 2) performed kinetic modeling showing zinc distribution in extra-neuronal Aβ deposits can reduce intra-neuronal zinc binding to microtubules, destabilizing microtubules. Finally, we 3) used metallomic imaging mass spectrometry (MIMS) to show anatomically-localized and age-dependent zinc dyshomeostasis in specific brain regions of Tg2576 transgenic, mice, a model for AD. We found excess zinc in brain regions associated with memory processing and NFT pathology. Overall, we present a theoretical framework and support for a new theory of AD linking extra-neuronal Aβ amyloid to intra-neuronal NFTs and cognitive dysfunction. The connection, we propose, is based on β-amyloid-induced alterations in zinc ion concentration inside neurons affecting stability of polymerized

  2. Same-same but different: integrating central university support and faculty-specific knowledge for mentor training. A Practice Report

    Directory of Open Access Journals (Sweden)

    Deborah Rodrigo

    2014-08-01

    Full Text Available Mentoring literature often cites a tension between local initiatives that target the needs of specific groups and more efficient centralised programs addressing common concerns across a larger population. For several years, the University of Sydney has had a Mentoring Network consisting of the faculties of Arts and Social Sciences, Health Sciences, Science, Sydney Law School and the Business School. These faculties have worked together to develop a community of best practice for mentoring programs at our large, multi-campus institution, and for the past two years have included a representative from Student Support Services to incorporate a centralised support component into their faculty-specific training programs. This Practice Report showcases the work of the University of Sydney Mentoring Network in combining central university services with faculty-based mentoring.

  3. Drilling Specifications: Well Installations in the 300 Area to Support PNNL's Integrated Field-Scale Subsurface Research Challenge (IFC) Project

    International Nuclear Information System (INIS)

    Bjornstad, Bruce N.; Vermeul, Vince R.

    2008-01-01

    Part of the 300 Area Integrated Field-Scale Subsurface Research Challenge (IFC) will be installation of a network of high density borings and wells to monitor migration of fluids and contaminants (uranium), both in groundwater and vadose zone, away from an surface infiltration plot (Figure A-1). The infiltration plot will be located over an area of suspected contamination at the former 300 Area South Process Pond (SPP). The SPP is located in the southeastern portion of the Hanford Site, within the 300-FF-5 Operable Unit. Pacific Northwest National Laboratory (PNNL) with the support of FH shall stake the well locations prior to the start of drilling. Final locations will be based on accessibility and will avoid any surface or underground structures or hazards as well as surface contamination

  4. An integrated chemical biology approach identifies specific vulnerability of Ewing's sarcoma to combined inhibition of Aurora kinases A and B.

    Science.gov (United States)

    Winter, Georg E; Rix, Uwe; Lissat, Andrej; Stukalov, Alexey; Müllner, Markus K; Bennett, Keiryn L; Colinge, Jacques; Nijman, Sebastian M; Kubicek, Stefan; Kovar, Heinrich; Kontny, Udo; Superti-Furga, Giulio

    2011-10-01

    Ewing's sarcoma is a pediatric cancer of the bone that is characterized by the expression of the chimeric transcription factor EWS-FLI1 that confers a highly malignant phenotype and results from the chromosomal translocation t(11;22)(q24;q12). Poor overall survival and pronounced long-term side effects associated with traditional chemotherapy necessitate the development of novel, targeted, therapeutic strategies. We therefore conducted a focused viability screen with 200 small molecule kinase inhibitors in 2 different Ewing's sarcoma cell lines. This resulted in the identification of several potential molecular intervention points. Most notably, tozasertib (VX-680, MK-0457) displayed unique nanomolar efficacy, which extended to other cell lines, but was specific for Ewing's sarcoma. Furthermore, tozasertib showed strong synergies with the chemotherapeutic drugs etoposide and doxorubicin, the current standard agents for Ewing's sarcoma. To identify the relevant targets underlying the specific vulnerability toward tozasertib, we determined its cellular target profile by chemical proteomics. We identified 20 known and unknown serine/threonine and tyrosine protein kinase targets. Additional target deconvolution and functional validation by RNAi showed simultaneous inhibition of Aurora kinases A and B to be responsible for the observed tozasertib sensitivity, thereby revealing a new mechanism for targeting Ewing's sarcoma. We further corroborated our cellular observations with xenograft mouse models. In summary, the multilayered chemical biology approach presented here identified a specific vulnerability of Ewing's sarcoma to concomitant inhibition of Aurora kinases A and B by tozasertib and danusertib, which has the potential to become a new therapeutic option.

  5. The Twin Deficits Hypothesis: An Empirical Analysis for Tanzania

    Directory of Open Access Journals (Sweden)

    Manamba Epaphra

    2017-09-01

    Full Text Available This paper examines the relationship between current account and government budget deficits in Tanzania. The paper tests the validity of the twin deficits hypothesis, using annual time series data for the 1966-2015 period. The paper is thought to be significant because the concept of the twin deficit hypothesis is fraught with controversy. Some researches support the hypothesis that there is a positive relationship between current account deficits and fiscal deficits in the economy while others do not. In this paper, the empirical tests fail to reject the twin deficits hypothesis, indicating that rising budget deficits put more strain on the current account deficits in Tanzania. Specifically, the Vector Error Correction Model results support the conventional theory of a positive relationship between fiscal and external balances, with a relatively high speed of adjustment toward the equilibrium position. This evidence is consistent with a small open economy. To address the problem that may result from this kind of relationship, appropriate policy variables for reducing budget deficits such as reduction in non-development expenditure, enhancement of domestic revenue collection and actively fight corruption and tax evasion should be adopted. The government should also target export oriented firms and encourage an import substitution industry by creating favorable business environments.

  6. Updating the mild encephalitis hypothesis of schizophrenia.

    Science.gov (United States)

    Bechter, K

    2013-04-05

    Schizophrenia seems to be a heterogeneous disorder. Emerging evidence indicates that low level neuroinflammation (LLNI) may not occur infrequently. Many infectious agents with low overall pathogenicity are risk factors for psychoses including schizophrenia and for autoimmune disorders. According to the mild encephalitis (ME) hypothesis, LLNI represents the core pathogenetic mechanism in a schizophrenia subgroup that has syndromal overlap with other psychiatric disorders. ME may be triggered by infections, autoimmunity, toxicity, or trauma. A 'late hit' and gene-environment interaction are required to explain major findings about schizophrenia, and both aspects would be consistent with the ME hypothesis. Schizophrenia risk genes stay rather constant within populations despite a resulting low number of progeny; this may result from advantages associated with risk genes, e.g., an improved immune response, which may act protectively within changing environments, although they are associated with the disadvantage of increased susceptibility to psychotic disorders. Specific schizophrenic symptoms may arise with instances of LLNI when certain brain functional systems are involved, in addition to being shaped by pre-existing liability factors. Prodrome phase and the transition to a diseased status may be related to LLNI processes emerging and varying over time. The variability in the course of schizophrenia resembles the varying courses of autoimmune disorders, which result from three required factors: genes, the environment, and the immune system. Preliminary criteria for subgrouping neurodevelopmental, genetic, ME, and other types of schizophrenias are provided. A rare example of ME schizophrenia may be observed in Borna disease virus infection. Neurodevelopmental schizophrenia due to early infections has been estimated by others to explain approximately 30% of cases, but the underlying pathomechanisms of transition to disease remain in question. LLNI (e.g. from

  7. Aminoglycoside antibiotics and autism: a speculative hypothesis

    Directory of Open Access Journals (Sweden)

    Manev Hari

    2001-10-01

    Full Text Available Abstract Background Recently, it has been suspected that there is a relationship between therapy with some antibiotics and the onset of autism; but even more curious, some children benefited transiently from a subsequent treatment with a different antibiotic. Here, we speculate how aminoglycoside antibiotics might be associated with autism. Presentation We hypothesize that aminoglycoside antibiotics could a trigger the autism syndrome in susceptible infants by causing the stop codon readthrough, i.e., a misreading of the genetic code of a hypothetical critical gene, and/or b improve autism symptoms by correcting the premature stop codon mutation in a hypothetical polymorphic gene linked to autism. Testing Investigate, retrospectively, whether a link exists between aminoglycoside use (which is not extensive in children and the onset of autism symptoms (hypothesis "a", or between amino glycoside use and improvement of these symptoms (hypothesis "b". Whereas a prospective study to test hypothesis "a" is not ethically justifiable, a study could be designed to test hypothesis "b". Implications It should be stressed that at this stage no direct evidence supports our speculative hypothesis and that its main purpose is to initiate development of new ideas that, eventually, would improve our understanding of the pathobiology of autism.

  8. Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.).

    Science.gov (United States)

    Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir

    2015-01-22

    Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production

  9. Integrated analysis of DNA methylation and gene expression reveals specific signaling pathways associated with platinum resistance in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Chung Jae

    2009-06-01

    Full Text Available Abstract Background Cisplatin and carboplatin are the primary first-line therapies for the treatment of ovarian cancer. However, resistance to these platinum-based drugs occurs in the large majority of initially responsive tumors, resulting in fully chemoresistant, fatal disease. Although the precise mechanism(s underlying the development of platinum resistance in late-stage ovarian cancer patients currently remains unknown, CpG-island (CGI methylation, a phenomenon strongly associated with aberrant gene silencing and ovarian tumorigenesis, may contribute to this devastating condition. Methods To model the onset of drug resistance, and investigate DNA methylation and gene expression alterations associated with platinum resistance, we treated clonally derived, drug-sensitive A2780 epithelial ovarian cancer cells with increasing concentrations of cisplatin. After several cycles of drug selection, the isogenic drug-sensitive and -resistant pairs were subjected to global CGI methylation and mRNA expression microarray analyses. To identify chemoresistance-associated, biological pathways likely impacted by DNA methylation, promoter CGI methylation and mRNA expression profiles were integrated and subjected to pathway enrichment analysis. Results Promoter CGI methylation revealed a positive association (Spearman correlation of 0.99 between the total number of hypermethylated CGIs and GI50 values (i.e., increased drug resistance following successive cisplatin treatment cycles. In accord with that result, chemoresistance was reversible by DNA methylation inhibitors. Pathway enrichment analysis revealed hypermethylation-mediated repression of cell adhesion and tight junction pathways and hypomethylation-mediated activation of the cell growth-promoting pathways PI3K/Akt, TGF-beta, and cell cycle progression, which may contribute to the onset of chemoresistance in ovarian cancer cells. Conclusion Selective epigenetic disruption of distinct biological

  10. An integrated translation of design data of a nuclear power plant from a specification-driven plant design system to neutral model data

    Energy Technology Data Exchange (ETDEWEB)

    Mun, Duhwan, E-mail: dhmun@moeri.re.k [Marine Safety and Pollution Response Research Department, Maritime and Ocean Engineering Research Institute, KORDI, 171 Jang-dong, Yuseong-gu, Daejeon 305-343 (Korea, Republic of); Yang, Jeongsam, E-mail: jyang@ajou.ac.k [Division of Industrial and Information Systems Engineering, Ajou University, San 5, Wonchun-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of)

    2010-03-15

    How to efficiently integrate and manage lifecycle data of a nuclear power plant has gradually become an important object of study. Because plants usually have a very long period of operation and maintenance, the plant design data need to be presented in a computer-interpretable form and to be independent of any commercial systems. The conversion of plant design data from various design systems into neutral model data is therefore an important technology for the effective operation and maintenance of plants. In this study, a neutral model for the efficient integration of plant design data is chosen from among the currently available options and extended in order to cover the information model requirements of nuclear power plants in Korea. After the mapping of the neutral model and the data model of a specification-driven plant design system, a plant data translator is also implemented in accordance with the schema mapping results.

  11. An integrated translation of design data of a nuclear power plant from a specification-driven plant design system to neutral model data

    International Nuclear Information System (INIS)

    Mun, Duhwan; Yang, Jeongsam

    2010-01-01

    How to efficiently integrate and manage lifecycle data of a nuclear power plant has gradually become an important object of study. Because plants usually have a very long period of operation and maintenance, the plant design data need to be presented in a computer-interpretable form and to be independent of any commercial systems. The conversion of plant design data from various design systems into neutral model data is therefore an important technology for the effective operation and maintenance of plants. In this study, a neutral model for the efficient integration of plant design data is chosen from among the currently available options and extended in order to cover the information model requirements of nuclear power plants in Korea. After the mapping of the neutral model and the data model of a specification-driven plant design system, a plant data translator is also implemented in accordance with the schema mapping results.

  12. Are Sport-Specific Profiles of Tendon Stiffness and Cross-Sectional Area Determined by Structural or Functional Integrity?

    Directory of Open Access Journals (Sweden)

    Hans-Peter Wiesinger

    Full Text Available The present study aimed to determine whether distinct sets of tendon properties are seen in athletes engaged in sports with contrasting requirements for tendon function and structural integrity. Patellar and Achilles tendon morphology and force-deformation relation were measured by combining ultrasonography, electromyography and dynamometry in elite ski jumpers, distance runners, water polo players and sedentary individuals. Tendon cross-sectional area normalized to body mass2/3 was smaller in water polo players than in other athletes (patellar and Achilles tendon; -28 to -24% or controls (patellar tendon only; -9%. In contrast, the normalized cross-sectional area was larger in runners (patellar tendon only; +26% and ski jumpers (patellar and Achilles tendon; +21% and +13%, respectively than in controls. Tendon stiffness normalized to body mass2/3 only differed in ski jumpers, compared to controls (patellar and Achilles tendon; +11% and +27%, respectively and to water polo players (Achilles tendon only; +23%. Tendon size appears as an adjusting variable to changes in loading volume and/or intensity, possibly to preserve ultimate strength or fatigue resistance. However, uncoupled morphological and mechanical properties indicate that functional requirements may also influence tendon adaptations.

  13. Testing competing forms of the Milankovitch hypothesis

    DEFF Research Database (Denmark)

    Kaufmann, Robert K.; Juselius, Katarina

    2016-01-01

    We test competing forms of the Milankovitch hypothesis by estimating the coefficients and diagnostic statistics for a cointegrated vector autoregressive model that includes 10 climate variables and four exogenous variables for solar insolation. The estimates are consistent with the physical...... ice volume and solar insolation. The estimated adjustment dynamics show that solar insolation affects an array of climate variables other than ice volume, each at a unique rate. This implies that previous efforts to test the strong form of the Milankovitch hypothesis by examining the relationship...... that the latter is consistent with a weak form of the Milankovitch hypothesis and that it should be restated as follows: Internal climate dynamics impose perturbations on glacial cycles that are driven by solar insolation. Our results show that these perturbations are likely caused by slow adjustment between land...

  14. Rejecting the equilibrium-point hypothesis.

    Science.gov (United States)

    Gottlieb, G L

    1998-01-01

    The lambda version of the equilibrium-point (EP) hypothesis as developed by Feldman and colleagues has been widely used and cited with insufficient critical understanding. This article offers a small antidote to that lack. First, the hypothesis implicitly, unrealistically assumes identical transformations of lambda into muscle tension for antagonist muscles. Without that assumption, its definitions of command variables R, C, and lambda are incompatible and an EP is not defined exclusively by R nor is it unaffected by C. Second, the model assumes unrealistic and unphysiological parameters for the damping properties of the muscles and reflexes. Finally, the theory lacks rules for two of its three command variables. A theory of movement should offer insight into why we make movements the way we do and why we activate muscles in particular patterns. The EP hypothesis offers no unique ideas that are helpful in addressing either of these questions.

  15. The linear hypothesis and radiation carcinogenesis

    International Nuclear Information System (INIS)

    Roberts, P.B.

    1981-10-01

    An assumption central to most estimations of the carcinogenic potential of low levels of ionising radiation is that the risk always increases in direct proportion to the dose received. This assumption (the linear hypothesis) has been both strongly defended and attacked on several counts. It appears unlikely that conclusive, direct evidence on the validity of the hypothesis will be forthcoming. We review the major indirect arguments used in the debate. All of them are subject to objections that can seriously weaken their case. In the present situation, retention of the linear hypothesis as the basis of extrapolations from high to low dose levels can lead to excessive fears, over-regulation and unnecessarily expensive protection measures. To offset these possibilities, support is given to suggestions urging a cut-off dose, probably some fraction of natural background, below which risks can be deemed acceptable

  16. Rayleigh's hypothesis and the geometrical optics limit.

    Science.gov (United States)

    Elfouhaily, Tanos; Hahn, Thomas

    2006-09-22

    The Rayleigh hypothesis (RH) is often invoked in the theoretical and numerical treatment of rough surface scattering in order to decouple the analytical form of the scattered field. The hypothesis stipulates that the scattered field away from the surface can be extended down onto the rough surface even though it is formed by solely up-going waves. Traditionally this hypothesis is systematically used to derive the Volterra series under the small perturbation method which is equivalent to the low-frequency limit. In this Letter we demonstrate that the RH also carries the high-frequency or the geometrical optics limit, at least to first order. This finding has never been explicitly derived in the literature. Our result comforts the idea that the RH might be an exact solution under some constraints in the general case of random rough surfaces and not only in the case of small-slope deterministic periodic gratings.

  17. Simultaneous inference of phenotype-associated genes and relevant tissues from GWAS data via Bayesian integration of multiple tissue-specific gene networks.

    Science.gov (United States)

    Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung

    2017-12-01

    Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.

  18. Low spatial frequency bias in schizophrenia is not face specific: When the integration of coarse and fine information fails

    Directory of Open Access Journals (Sweden)

    Vincent eLaprevote

    2013-05-01

    Full Text Available Studies have shown that patients with schizophrenia exhibit visual processing impairments, particularly regarding the processing of spatial frequencies. In a previous work, we found that, compared to healthy volunteers, patients were biased towards low spatial frequencies (LSF to identify facial expression at a glance. Given the ubiquity of faces in visual perception, it remains an open question whether the LSF bias is face specific or also occurs with other visual objects. Here, fifteen patients with schizophrenia and eleven healthy control adults performed a categorization task with hybrid stimuli. These stimuli were single images consisting of two different objects, a fruit and an animal, each in a specific spatial frequency range, either low (LSF or high (HSF. Observers were asked to report if they saw an animal or a fruit. The reported category demonstrated which spatial scale was preferentially perceived in each trial. In a control experiment, participants performed the same task but with images of only a single object, either a LSF or HSF filtered animal or fruit, to verify that participants could perceive both HSF or LSF when presented in isolation. The results on the categorization task showed that patients chose more frequently LSF with hybrid stimuli compared to healthy controls. However, both populations performed equally well with HSF and LSF filtered pictures in the control experiment, demonstrating that the LSF preference found with hybrid stimuli in patients was not due to an inability to perceive HSF.The LSF preference found in schizophrenia confirms our previous study conducted with faces, and shows that this LSF bias generalizes to other categories of objects. When a broad range of spatial frequencies are present in the image, as in normal conditions of viewing, patients preferentially rely on coarse visual information contained in LSF. This result may be interpreted as a dysfunction of the guidance of HSF processing by LSF

  19. Quality specifications in postgraduate medical e-learning: an integrative literature review leading to a postgraduate medical e-learning model.

    Science.gov (United States)

    De Leeuw, R A; Westerman, Michiel; Nelson, E; Ket, J C F; Scheele, F

    2016-07-08

    E-learning is driving major shifts in medical education. Prioritizing learning theories and quality models improves the success of e-learning programs. Although many e-learning quality standards are available, few are focused on postgraduate medical education. We conducted an integrative review of the current postgraduate medical e-learning literature to identify quality specifications. The literature was thematically organized into a working model. Unique quality specifications (n = 72) were consolidated and re-organized into a six-domain model that we called the Postgraduate Medical E-learning Model (Postgraduate ME Model). This model was partially based on the ISO-19796 standard, and drew on cognitive load multimedia principles. The domains of the model are preparation, software design and system specifications, communication, content, assessment, and maintenance. This review clarified the current state of postgraduate medical e-learning standards and specifications. It also synthesized these specifications into a single working model. To validate our findings, the next-steps include testing the Postgraduate ME Model in controlled e-learning settings.

  20. Performance of an optical encoder based on a nondiffractive beam implemented with a specific photodetection integrated circuit and a diffractive optical element.

    Science.gov (United States)

    Quintián, Fernando Perez; Calarco, Nicolás; Lutenberg, Ariel; Lipovetzky, José

    2015-09-01

    In this paper, we study the incremental signal produced by an optical encoder based on a nondiffractive beam (NDB). The NDB is generated by means of a diffractive optical element (DOE). The detection system is composed by an application specific integrated circuit (ASIC) sensor. The sensor consists of an array of eight concentric annular photodiodes, each one provided with a programmable gain amplifier. In this way, the system is able to synthesize a nonuniform detectivity. The contrast, amplitude, and harmonic content of the sinusoidal output signal are analyzed. The influence of the cross talk among the annular photodiodes is placed in evidence through the dependence of the signal contrast on the wavelength.

  1. Note: A 102 dB dynamic-range charge-sampling readout for ionizing particle/radiation detectors based on an application-specific integrated circuit (ASIC)

    Science.gov (United States)

    Pullia, A.; Zocca, F.; Capra, S.

    2018-02-01

    An original technique for the measurement of charge signals from ionizing particle/radiation detectors has been implemented in an application-specific integrated circuit form. The device performs linear measurements of the charge both within and beyond its output voltage swing. The device features an unprecedented spectroscopic dynamic range of 102 dB and is suitable for high-resolution ion and X-γ ray spectroscopy. We believe that this approach may change a widespread paradigm according to which no high-resolution spectroscopy is possible when working close to or beyond the limit of the preamplifier's output voltage swing.

  2. Integrated use of biomarkers and bioaccumulation data in Zebra mussel (Dreissena polymorpha) for site-specific quality assessment.

    Science.gov (United States)

    Binelli, A; Ricciardi, F; Riva, C; Provini, A

    2006-01-01

    One of the useful biological tools for environmental management is the measurement of biomarkers whose changes are related to the exposure to chemicals or environmental stress. Since these responses might vary with different contaminants or depending on the pollutant concentration reached in the organism, the support of bioaccumulation data is needed to prevent false conclusions. In this study, several persistent organic pollutants -- 23 polychlorinated biphenyl (PCB) congeners, 11 polycyclic aromatic hydrocarbons (PAHs), six dichlorodiphenyltricholroethane (DDT) relatives, hexachlorobenzene (HCB), chlorpyrifos and its oxidized metabolite -- and some herbicides (lindane and the isomers alpha, beta, delta; terbutilazine; alachlor; metolachlor) were measured in the soft tissues of the freshwater mollusc Zebra mussel (Dreissena polymorpha) from 25 sampling sites in the Italian portions of the sub-alpine great lakes along with the measure of ethoxyresorufin dealkylation (EROD) and acetylcholinesterase (AChE) activity. The linkage between bioaccumulation and biomarker data allowed us to create site-specific environmental quality indexes towards man-made chemicals. This classification highlighted three different degrees of xenobiotic contamination of the Italian sub-alpine great lakes: a high water quality in Lake Lugano with negligible pollutant levels and no effects on enzyme activities, an homogeneous poor quality for Lakes Garda, Iseo and Como, and the presence of some xenobiotic point-sources in Lake Maggiore, whose ecological status could be jeopardized, also due to the heavy DDT contamination revealed since 1996.

  3. The discovery of putative urine markers for the specific detection of prostate tumor by integrative mining of public genomic profiles.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Urine has emerged as an attractive biofluid for the noninvasive detection of prostate cancer (PCa. There is a strong imperative to discover candidate urinary markers for the clinical diagnosis and prognosis of PCa. The rising flood of various omics profiles presents immense opportunities for the identification of prospective biomarkers. Here we present a simple and efficient strategy to derive candidate urine markers for prostate tumor by mining cancer genomic profiles from public databases. Prostate, bladder and kidney are three major tissues from which cellular matters could be released into urine. To identify urinary markers specific for PCa, upregulated entities that might be shed in exosomes of bladder cancer and kidney cancer are first excluded. Through the ontology-based filtering and further assessment, a reduced list of 19 entities encoding urinary proteins was derived as putative PCa markers. Among them, we have found 10 entities closely associated with the process of tumor cell growth and development by pathway enrichment analysis. Further, using the 10 entities as seeds, we have constructed a protein-protein interaction (PPI subnetwork and suggested a few urine markers as preferred prognostic markers to monitor the invasion and progression of PCa. Our approach is amenable to discover and prioritize potential markers present in a variety of body fluids for a spectrum of human diseases.

  4. Hypothesis driven development of new adjuvants: short peptides as immunomodulators.

    Science.gov (United States)

    Dong, Jessica C; Kobinger, Gary P

    2013-04-01

    To date, vaccinations have been one of the key strategies in the prevention and protection against infectious pathogens. Traditional vaccines have well-known limitations such as safety and efficacy issues, which consequently deems it inappropriate for particular populations and may not be an effective strategy against all pathogens. This evidence highlights the need to develop more efficacious vaccination regiments. Higher levels of protection can be achieved by the addition of immunostimulating adjuvants. Many adjuvants elicit strong, undefined inflammation, which produces increased immunogenicity but may also lead to undesirable effects. Hypothesis driven development of adjuvants is needed to achieve a more specific and directed immune response required for optimal and safe vaccine-induced immune protection. An example of such hypothesis driven development includes the use of short immunomodulating peptides as adjuvants. These peptides have the ability to influence the immune response and can be extrapolated for adjuvant use, but requires further investigation.

  5. On the generalized gravi-magnetic hypothesis

    International Nuclear Information System (INIS)

    Massa, C.

    1989-01-01

    According to a generalization of the gravi-magnetic hypothesis (GMH) any neutral mass moving in a curvilinear path with respect to an inertial frame creates a magnetic field, dependent on the curvature radius of the path. A simple astrophysical consequence of the generalized GMH is suggested considering the special cases of binary pulsars and binary neutron stars

  6. Remarks about the hypothesis of limiting fragmentation

    International Nuclear Information System (INIS)

    Chou, T.T.; Yang, C.N.

    1987-01-01

    Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

  7. Multiple hypothesis clustering in radar plot extraction

    NARCIS (Netherlands)

    Huizing, A.G.; Theil, A.; Dorp, Ph. van; Ligthart, L.P.

    1995-01-01

    False plots and plots with inaccurate range and Doppler estimates may severely degrade the performance of tracking algorithms in radar systems. This paper describes how a multiple hypothesis clustering technique can be applied to mitigate the problems involved in plot extraction. The measures of

  8. The (not so immortal strand hypothesis

    Directory of Open Access Journals (Sweden)

    Cristian Tomasetti

    2015-03-01

    Significance: Utilizing an approach that is fundamentally different from previous efforts to confirm or refute the immortal strand hypothesis, we provide evidence against non-random segregation of DNA during stem cell replication. Our results strongly suggest that parental DNA is passed randomly to stem cell daughters and provides new insight into the mechanism of DNA replication in stem cells.

  9. A Developmental Study of the Infrahumanization Hypothesis

    Science.gov (United States)

    Martin, John; Bennett, Mark; Murray, Wayne S.

    2008-01-01

    Intergroup attitudes in children were examined based on Leyen's "infrahumanization hypothesis". This suggests that some uniquely human emotions, such as shame and guilt (secondary emotions), are reserved for the in-group, whilst other emotions that are not uniquely human and shared with animals, such as anger and pleasure (primary…

  10. Morbidity and Infant Development: A Hypothesis.

    Science.gov (United States)

    Pollitt, Ernesto

    1983-01-01

    Results of a study conducted in 14 villages of Sui Lin Township, Taiwan, suggest the hypothesis that, under conditions of extreme economic impoverishment and among children within populations where energy protein malnutrition is endemic, there is an inverse relationship between incidence of morbidity in infancy and measures of motor and mental…

  11. Diagnostic Hypothesis Generation and Human Judgment

    Science.gov (United States)

    Thomas, Rick P.; Dougherty, Michael R.; Sprenger, Amber M.; Harbison, J. Isaiah

    2008-01-01

    Diagnostic hypothesis-generation processes are ubiquitous in human reasoning. For example, clinicians generate disease hypotheses to explain symptoms and help guide treatment, auditors generate hypotheses for identifying sources of accounting errors, and laypeople generate hypotheses to explain patterns of information (i.e., data) in the…

  12. Multi-hypothesis distributed stereo video coding

    DEFF Research Database (Denmark)

    Salmistraro, Matteo; Zamarin, Marco; Forchhammer, Søren

    2013-01-01

    for stereo sequences, exploiting an interpolated intra-view SI and two inter-view SIs. The quality of the SI has a major impact on the DVC Rate-Distortion (RD) performance. As the inter-view SIs individually present lower RD performance compared with the intra-view SI, we propose multi-hypothesis decoding...

  13. [Resonance hypothesis of heart rate variability origin].

    Science.gov (United States)

    Sheĭkh-Zade, Iu R; Mukhambetaliev, G Kh; Cherednik, I L

    2009-09-01

    A hypothesis is advanced of the heart rate variability being subjected to beat-to-beat regulation of cardiac cycle duration in order to ensure the resonance interaction between respiratory and own fluctuation of the arterial system volume for minimization of power expenses of cardiorespiratory system. Myogenic, parasympathetic and sympathetic machanisms of heart rate variability are described.

  14. In Defense of Chi's Ontological Incompatibility Hypothesis

    Science.gov (United States)

    Slotta, James D.

    2011-01-01

    This article responds to an article by A. Gupta, D. Hammer, and E. F. Redish (2010) that asserts that M. T. H. Chi's (1992, 2005) hypothesis of an "ontological commitment" in conceptual development is fundamentally flawed. In this article, I argue that Chi's theoretical perspective is still very much intact and that the critique offered by Gupta…

  15. Vacuum counterexamples to the cosmic censorship hypothesis

    International Nuclear Information System (INIS)

    Miller, B.D.

    1981-01-01

    In cylindrically symmetric vacuum spacetimes it is possible to specify nonsingular initial conditions such that timelike singularities will (necessarily) evolve from these conditions. Examples are given; the spacetimes are somewhat analogous to one of the spherically symmetric counterexamples to the cosmic censorship hypothesis

  16. An Integrated Metabolomic and Microbiome Analysis Identified Specific Gut Microbiota Associated with Fecal Cholesterol and Coprostanol in Clostridium difficile Infection.

    Directory of Open Access Journals (Sweden)

    Vijay C Antharam

    Full Text Available Clostridium difficile infection (CDI is characterized by dysbiosis of the intestinal microbiota and a profound derangement in the fecal metabolome. However, the contribution of specific gut microbes to fecal metabolites in C. difficile-associated gut microbiome remains poorly understood. Using gas-chromatography mass spectrometry (GC-MS and 16S rRNA deep sequencing, we analyzed the metabolome and microbiome of fecal samples obtained longitudinally from subjects with Clostridium difficile infection (n = 7 and healthy controls (n = 6. From 155 fecal metabolites, we identified two sterol metabolites at >95% match to cholesterol and coprostanol that significantly discriminated C. difficile-associated gut microbiome from healthy microbiota. By correlating the levels of cholesterol and coprostanol in fecal extracts with 2,395 bacterial operational taxonomic units (OTUs determined by 16S rRNA sequencing, we identified 63 OTUs associated with high levels of coprostanol and 2 OTUs correlated with low coprostanol levels. Using indicator species analysis (ISA, 31 of the 63 coprostanol-associated bacteria correlated with health, and two Veillonella species were associated with low coprostanol levels that correlated strongly with CDI. These 65 bacterial taxa could be clustered into 12 sub-communities, with each community containing a consortium of organisms that co-occurred with one another. Our studies identified 63 human gut microbes associated with cholesterol-reducing activities. Given the importance of gut bacteria in reducing and eliminating cholesterol from the GI tract, these results support the recent finding that gut microbiome may play an important role in host lipid metabolism.

  17. Effects of education and race on cognitive decline: An integrative analysis of generalizability versus study-specific results

    Science.gov (United States)

    Gross, Alden L.; Mungas, Dan M.; Crane, Paul K.; Gibbons, Laura E.; MacKay-Brandt, Anna; Manly, Jennifer J.; Mukherjee, Shubhabrata; Romero, Heather; Sachs, Bonnie; Thomas, Michael; Potter, Guy G.; Jones, Richard N.

    2015-01-01

    Objective To examine variability across multiple prospective cohort studies in level and rate of cognitive decline by race/ethnicity and years of education. Method To compare data across studies, we harmonized estimates of common latent factors representing overall or general cognitive performance, memory, and executive function derived from the: 1) Washington Heights, Hamilton Heights, Inwood Columbia Aging Project (N=4,115), 2) Spanish and English Neuropsychological Assessment Scales (N=525), 3) Duke Memory, Health, and Aging study (N=578), and 4) Neurocognitive Outcomes of Depression in the Elderly (N=585). We modeled cognitive change over age for cognitive outcomes by race, education, and study. We adjusted models for sex, dementia status, and study-specific characteristics. Results For baseline levels of overall cognitive performance, memory, and executive function, differences in race and education tended to be larger than between-study differences and consistent across studies. This pattern did not hold for rate of cognitive decline: effects of education and race/ethnicity on cognitive change were not consistently observed across studies, and when present were small, with racial/ethnic minorities and those with lower education declining at faster rates. Discussion In this diverse set of datasets, non-Hispanic whites and those with higher education had substantially higher baseline cognitive test scores. However, differences in the rate of cognitive decline by race/ethnicity and education did not follow this pattern. This study suggests that baseline test scores and longitudinal change have different determinants, and future studies to examine similarities and differences of causes of cognitive decline in racially/ethnically and educationally diverse older groups is needed. PMID:26523693

  18. An Integrated Metabolomic and Microbiome Analysis Identified Specific Gut Microbiota Associated with Fecal Cholesterol and Coprostanol in Clostridium difficile Infection.

    Science.gov (United States)

    Antharam, Vijay C; McEwen, Daniel C; Garrett, Timothy J; Dossey, Aaron T; Li, Eric C; Kozlov, Andrew N; Mesbah, Zhubene; Wang, Gary P

    2016-01-01

    Clostridium difficile infection (CDI) is characterized by dysbiosis of the intestinal microbiota and a profound derangement in the fecal metabolome. However, the contribution of specific gut microbes to fecal metabolites in C. difficile-associated gut microbiome remains poorly understood. Using gas-chromatography mass spectrometry (GC-MS) and 16S rRNA deep sequencing, we analyzed the metabolome and microbiome of fecal samples obtained longitudinally from subjects with Clostridium difficile infection (n = 7) and healthy controls (n = 6). From 155 fecal metabolites, we identified two sterol metabolites at >95% match to cholesterol and coprostanol that significantly discriminated C. difficile-associated gut microbiome from healthy microbiota. By correlating the levels of cholesterol and coprostanol in fecal extracts with 2,395 bacterial operational taxonomic units (OTUs) determined by 16S rRNA sequencing, we identified 63 OTUs associated with high levels of coprostanol and 2 OTUs correlated with low coprostanol levels. Using indicator species analysis (ISA), 31 of the 63 coprostanol-associated bacteria correlated with health, and two Veillonella species were associated with low coprostanol levels that correlated strongly with CDI. These 65 bacterial taxa could be clustered into 12 sub-communities, with each community containing a consortium of organisms that co-occurred with one another. Our studies identified 63 human gut microbes associated with cholesterol-reducing activities. Given the importance of gut bacteria in reducing and eliminating cholesterol from the GI tract, these results support the recent finding that gut microbiome may play an important role in host lipid metabolism.

  19. An Integrated “Multi-Omics” Comparison of Embryo and Endosperm Tissue-Specific Features and Their Impact on Rice Seed Quality

    Directory of Open Access Journals (Sweden)

    Marc Galland

    2017-11-01

    Full Text Available Although rice is a key crop species, few studies have addressed both rice seed physiological and nutritional quality, especially at the tissue level. In this study, an exhaustive “multi-omics” dataset on the mature rice seed was obtained by combining transcriptomics, label-free shotgun proteomics and metabolomics from embryo and endosperm, independently. These high-throughput analyses provide a new insight on the tissue-specificity related to rice seed quality. Foremost, we pinpointed that extensive post-transcriptional regulations occur at the end of rice seed development such that the embryo proteome becomes much more diversified than the endosperm proteome. Secondly, we observed that survival in the dry state in each seed compartment depends on contrasted metabolic and enzymatic apparatus in the embryo and the endosperm, respectively. Thirdly, it was remarkable to identify two different sets of starch biosynthesis enzymes as well as seed storage proteins (glutelins in both embryo and endosperm consistently with the supernumerary embryo hypothesis origin of the endosperm. The presence of a putative new glutelin with a possible embryonic favored abundance is described here for the first time. Finally, we quantified the rate of mRNA translation into proteins. Consistently, the embryonic panel of protein translation initiation factors is much more diverse than that of the endosperm. This work emphasizes the value of tissue-specificity-centered “multi-omics” study in the seed to highlight new features even from well-characterized pathways. It paves the way for future studies of critical genetic determinants of rice seed physiological and nutritional quality.

  20. A novel hypothesis splitting method implementation for multi-hypothesis filters

    DEFF Research Database (Denmark)

    Bayramoglu, Enis; Ravn, Ole; Andersen, Nils Axel

    2013-01-01

    The paper presents a multi-hypothesis filter library featuring a novel method for splitting Gaussians into ones with smaller variances. The library is written in C++ for high performance and the source code is open and free1. The multi-hypothesis filters commonly approximate the distribution tran...

  1. The Income Inequality Hypothesis Revisited : Assessing the Hypothesis Using Four Methodological Approaches

    NARCIS (Netherlands)

    Kragten, N.; Rözer, J.

    The income inequality hypothesis states that income inequality has a negative effect on individual’s health, partially because it reduces social trust. This article aims to critically assess the income inequality hypothesis by comparing several analytical strategies, namely OLS regression,

  2. Einstein's Revolutionary Light-Quantum Hypothesis

    Science.gov (United States)

    Stuewer, Roger H.

    2005-05-01

    The paper in which Albert Einstein proposed his light-quantum hypothesis was the only one of his great papers of 1905 that he himself termed ``revolutionary.'' Contrary to widespread belief, Einstein did not propose his light-quantum hypothesis ``to explain the photoelectric effect.'' Instead, he based his argument for light quanta on the statistical interpretation of the second law of thermodynamics, with the photoelectric effect being only one of three phenomena that he offered as possible experimental support for it. I will discuss Einstein's light-quantum hypothesis of 1905 and his introduction of the wave-particle duality in 1909 and then turn to the reception of his work on light quanta by his contemporaries. We will examine the reasons that prominent physicists advanced to reject Einstein's light-quantum hypothesis in succeeding years. Those physicists included Robert A. Millikan, even though he provided convincing experimental proof of the validity of Einstein's equation of the photoelectric effect in 1915. The turning point came after Arthur Holly Compton discovered the Compton effect in late 1922, but even then Compton's discovery was contested both on experimental and on theoretical grounds. Niels Bohr, in particular, had never accepted the reality of light quanta and now, in 1924, proposed a theory, the Bohr-Kramers-Slater theory, which assumed that energy and momentum were conserved only statistically in microscopic interactions. Only after that theory was disproved experimentally in 1925 was Einstein's revolutionary light-quantum hypothesis generally accepted by physicists---a full two decades after Einstein had proposed it.

  3. A Dopamine Hypothesis of Autism Spectrum Disorder.

    Science.gov (United States)

    Pavăl, Denis

    2017-01-01

    Autism spectrum disorder (ASD) comprises a group of neurodevelopmental disorders characterized by social deficits and stereotyped behaviors. While several theories have emerged, the pathogenesis of ASD remains unknown. Although studies report dopamine signaling abnormalities in autistic patients, a coherent dopamine hypothesis which could link neurobiology to behavior in ASD is currently lacking. In this paper, we present such a hypothesis by proposing that autistic behavior arises from dysfunctions in the midbrain dopaminergic system. We hypothesize that a dysfunction of the mesocorticolimbic circuit leads to social deficits, while a dysfunction of the nigrostriatal circuit leads to stereotyped behaviors. Furthermore, we discuss 2 key predictions of our hypothesis, with emphasis on clinical and therapeutic aspects. First, we argue that dopaminergic dysfunctions in the same circuits should associate with autistic-like behavior in nonautistic subjects. Concerning this, we discuss the case of PANDAS (pediatric autoimmune neuropsychiatric disorder associated with streptococcal infections) which displays behaviors similar to those of ASD, presumed to arise from dopaminergic dysfunctions. Second, we argue that providing dopamine modulators to autistic subjects should lead to a behavioral improvement. Regarding this, we present clinical studies of dopamine antagonists which seem to have improving effects on autistic behavior. Furthermore, we explore the means of testing our hypothesis by using neuroreceptor imaging, which could provide comprehensive evidence for dopamine signaling dysfunctions in autistic subjects. Lastly, we discuss the limitations of our hypothesis. Along these lines, we aim to provide a dopaminergic model of ASD which might lead to a better understanding of the ASD pathogenesis. © 2017 S. Karger AG, Basel.

  4. Integrated analysis of RNA-binding protein complexes using in vitro selection and high-throughput sequencing and sequence specificity landscapes (SEQRS).

    Science.gov (United States)

    Lou, Tzu-Fang; Weidmann, Chase A; Killingsworth, Jordan; Tanaka Hall, Traci M; Goldstrohm, Aaron C; Campbell, Zachary T

    2017-04-15

    RNA-binding proteins (RBPs) collaborate to control virtually every aspect of RNA function. Tremendous progress has been made in the area of global assessment of RBP specificity using next-generation sequencing approaches both in vivo and in vitro. Understanding how protein-protein interactions enable precise combinatorial regulation of RNA remains a significant problem. Addressing this challenge requires tools that can quantitatively determine the specificities of both individual proteins and multimeric complexes in an unbiased and comprehensive way. One approach utilizes in vitro selection, high-throughput sequencing, and sequence-specificity landscapes (SEQRS). We outline a SEQRS experiment focused on obtaining the specificity of a multi-protein complex between Drosophila RBPs Pumilio (Pum) and Nanos (Nos). We discuss the necessary controls in this type of experiment and examine how the resulting data can be complemented with structural and cell-based reporter assays. Additionally, SEQRS data can be integrated with functional genomics data to uncover biological function. Finally, we propose extensions of the technique that will enhance our understanding of multi-protein regulatory complexes assembled onto RNA. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Is physiotherapy integrated virtual walking effective on pain, function, and kinesiophobia in patients with non-specific low-back pain? Randomised controlled trial.

    Science.gov (United States)

    Yilmaz Yelvar, Gul Deniz; Çırak, Yasemin; Dalkılınç, Murat; Parlak Demir, Yasemin; Guner, Zeynep; Boydak, Ayşenur

    2017-02-01

    According to literature, virtual reality was found to reduce pain and kinesiophobia in patients with chronic pain. The purpose of the study was to investigate short-term effect of the virtual reality on pain, function, and kinesiophobia in patients with subacute and chronic non-specific low-back pain METHODS: This randomised controlled study in which 44 patients were randomly assigned to the traditional physiotherapy (control group, 22 subjects) or virtual walking integrated physiotherapy (experimental group, 22 subjects). Before and after treatment, Visual Analog Scale (VAS), TAMPA Kinesiophobia Scale (TKS), Oswestry Disability Index (ODI), Nottingham Health Profile (NHP), Timed-up and go Test (TUG), 6-Minute Walk Test (6MWT), and Single-Leg Balance Test were assessed. The interaction effect between group and time was assessed by using repeated-measures analysis of covariance. After treatment, both groups showed improvement in all parameters. However, VAS, TKS, TUG, and 6MWT scores showed significant differences in favor of the experimental group. Virtual walking integrated physiotherapy reduces pain and kinesiophobia, and improved function in patients with subacute and chronic non-specific low-back pain in short term.

  6. Association between abnormal serum myelin-specific protein levels and white matter integrity in first-episode and drug-naïve patients with major depressive disorder.

    Science.gov (United States)

    Jiang, Linling; Cheng, Yuqi; Jiang, Hongyan; Xu, Jian; Lu, Jin; Shen, Zonglin; Lu, Yi; Liu, Fang; Li, Luqiong; Xu, Xiufeng

    2018-05-01

    Although the structural abnormalities of white matter (WM) have been described in patients with major depressive disorder (MDD), the neuropathological changes remain unclear. The current study aimed to investigate the myelin oligodendrocyte glycoprotein (MOG) and myelin-associated glycoprotein (MAG) levels and their correlations with WM integrity in first-episode, drug-naïve MDD patients. We obtained diffusion tensor images of 102 first-episode, drug-naïve MDD patients and 81 age- and sex-matched controls. Serum MOG and MAG levels of all participants were measured and compared between the two groups. The correlations between WM integrity and MOG and MAG levels were examined. MOG and MAG serum levels were significantly higher in MDD patients than in controls. Patients with MDD also showed decreased fractional anisotropy (FA) and axial diffusivity in the WM of the bilateral thalamus, right hippocampus, right temporal lobe, and left pulvinar. At the whole-brain level, no regions showed any correlations of diffusivity parameters with MOG or MAG levels in healthy subjects. However, we observed two-way correlations between the MOG and MAG levels and the FA and mean diffusivity values in the WM of the left middle frontal lobe, right inferior parietal lobe, and right supplementary motor area in MDD patients. Further investigation with a larger sample size and longitudinal studies are required to better understand the neuropathology of WM integrity in MDD. Our findings represent the first evidence of a relationship between abnormal serum myelin-specific protein levels and impaired WM integrity, which may help to better understand the neurobiological mechanisms of MDD. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Inverse Scattering, the Coupling Constant Spectrum, and the Riemann Hypothesis

    International Nuclear Information System (INIS)

    Khuri, N. N.

    2002-01-01

    It is well known that the s-wave Jost function for a potential, λV, is an entire function of λ with an infinite number of zeros extending to infinity. For a repulsive V, and at zero energy, these zeros of the 'coupling constant', λ, will all be real and negative, λ n (0) n n =1/2+iγ n . Thus, finding a repulsive V whose coupling constant spectrum coincides with the Riemann zeros will establish the Riemann hypothesis, but this will be a very difficult and unguided search.In this paper we make a significant enlargement of the class of potentials needed for a generalization of the above idea. We also make this new class amenable to construction via inverse scattering methods. We show that all one needs is a one parameter class of potentials, U(s;x), which are analytic in the strip, 0≤Res≤1, Ims>T 0 , and in addition have an asymptotic expansion in powers of [s(s-1)] -1 , i.e. U(s;x)=V 0 (x)+gV 1 (x)+g 2 V 2 (x)+...+O(g N ), with g=[s(s-1)] -1 . The potentials V n (x) are real and summable. Under suitable conditions on the V n 's and the O(g N ) term we show that the condition, ∫ 0 ∞ vertical bar f 0 (x) vertical bar 2 V 1 (x) dx≠0, where f 0 is the zero energy and g=0 Jost function for U, is sufficient to guarantee that the zeros g n are real and, hence, s n =1/2+iγ n , for γ n ≥T 0 .Starting with a judiciously chosen Jost function, M(s,k), which is constructed such that M(s,0) is Riemann's ξ(s) function, we have used inverse scattering methods to actually construct a U(s;x) with the above properties. By necessity, we had to generalize inverse methods to deal with complex potentials and a nonunitary S-matrix. This we have done at least for the special cases under consideration.For our specific example, ∫ 0 ∞ vertical bar f 0 (x) vertical bar 2 V 1 (x) dx=0 and, hence, we get no restriction on Img n or Res n . The reasons for the vanishing of the above integral are given, and they give us hints on what one needs to proceed further. The problem

  8. Should the Equilibrium Point Hypothesis (EPH) be Considered a Scientific Theory?

    OpenAIRE

    Sainburg, Robert L.

    2014-01-01

    The purpose of this commentary is to discuss factors that limit consideration of the equilibrium point hypothesis as a scientific theory. The EPH describes control of motor neuron threshold through the variable lambda, which corresponds to a unique referent configuration for a muscle, joint, or combination of joints. One of the most compelling features of the equilibrium point hypothesis is the integration of posture and movement control into a single mechanism. While the essential core of th...

  9. Tests of the Giant Impact Hypothesis

    Science.gov (United States)

    Jones, J. H.

    1998-01-01

    The giant impact hypothesis has gained popularity as a means of explaining a volatile-depleted Moon that still has a chemical affinity to the Earth. As Taylor's Axiom decrees, the best models of lunar origin are testable, but this is difficult with the giant impact model. The energy associated with the impact would be sufficient to totally melt and partially vaporize the Earth. And this means that there should he no geological vestige of Barber times. Accordingly, it is important to devise tests that may be used to evaluate the giant impact hypothesis. Three such tests are discussed here. None of these is supportive of the giant impact model, but neither do they disprove it.

  10. The discovered preference hypothesis - an empirical test

    DEFF Research Database (Denmark)

    Lundhede, Thomas; Ladenburg, Jacob; Olsen, Søren Bøye

    Using stated preference methods for valuation of non-market goods is known to be vulnerable to a range of biases. Some authors claim that these so-called anomalies in effect render the methods useless for the purpose. However, the Discovered Preference Hypothesis, as put forth by Plott [31], offers...... an nterpretation and explanation of biases which entails that the stated preference methods need not to be completely written off. In this paper we conduct a test for the validity and relevance of the DPH interpretation of biases. In a choice experiment concerning preferences for protection of Danish nature areas...... as respondents evaluate more and more choice sets. This finding supports the Discovered Preference Hypothesis interpretation and explanation of starting point bias....

  11. The Hypothesis-Driven Physical Examination.

    Science.gov (United States)

    Garibaldi, Brian T; Olson, Andrew P J

    2018-05-01

    The physical examination remains a vital part of the clinical encounter. However, physical examination skills have declined in recent years, in part because of decreased time at the bedside. Many clinicians question the relevance of physical examinations in the age of technology. A hypothesis-driven approach to teaching and practicing the physical examination emphasizes the performance of maneuvers that can alter the likelihood of disease. Likelihood ratios are diagnostic weights that allow clinicians to estimate the post-probability of disease. This hypothesis-driven approach to the physical examination increases its value and efficiency, while preserving its cultural role in the patient-physician relationship. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. The Method of Hypothesis in Plato's Philosophy

    Directory of Open Access Journals (Sweden)

    Malihe Aboie Mehrizi

    2016-09-01

    Full Text Available The article deals with the examination of method of hypothesis in Plato's philosophy. This method, respectively, will be examined in three dialogues of Meno, Phaedon and Republic in which it is explicitly indicated. It will be shown the process of change of Plato’s attitude towards the position and usage of the method of hypothesis in his realm of philosophy. In Meno, considering the geometry, Plato attempts to introduce a method that can be used in the realm of philosophy. But, ultimately in Republic, Plato’s special attention to the method and its importance in the philosophical investigations, leads him to revise it. Here, finally Plato introduces the particular method of philosophy, i.e., the dialectic

  13. Debates—Hypothesis testing in hydrology: Introduction

    Science.gov (United States)

    Blöschl, Günter

    2017-03-01

    This paper introduces the papers in the "Debates—Hypothesis testing in hydrology" series. The four articles in the series discuss whether and how the process of testing hypotheses leads to progress in hydrology. Repeated experiments with controlled boundary conditions are rarely feasible in hydrology. Research is therefore not easily aligned with the classical scientific method of testing hypotheses. Hypotheses in hydrology are often enshrined in computer models which are tested against observed data. Testability may be limited due to model complexity and data uncertainty. All four articles suggest that hypothesis testing has contributed to progress in hydrology and is needed in the future. However, the procedure is usually not as systematic as the philosophy of science suggests. A greater emphasis on a creative reasoning process on the basis of clues and explorative analyses is therefore needed.

  14. Multi-agent sequential hypothesis testing

    KAUST Repository

    Kim, Kwang-Ki K.

    2014-12-15

    This paper considers multi-agent sequential hypothesis testing and presents a framework for strategic learning in sequential games with explicit consideration of both temporal and spatial coordination. The associated Bayes risk functions explicitly incorporate costs of taking private/public measurements, costs of time-difference and disagreement in actions of agents, and costs of false declaration/choices in the sequential hypothesis testing. The corresponding sequential decision processes have well-defined value functions with respect to (a) the belief states for the case of conditional independent private noisy measurements that are also assumed to be independent identically distributed over time, and (b) the information states for the case of correlated private noisy measurements. A sequential investment game of strategic coordination and delay is also discussed as an application of the proposed strategic learning rules.

  15. Hypothesis testing of scientific Monte Carlo calculations

    Science.gov (United States)

    Wallerberger, Markus; Gull, Emanuel

    2017-11-01

    The steadily increasing size of scientific Monte Carlo simulations and the desire for robust, correct, and reproducible results necessitates rigorous testing procedures for scientific simulations in order to detect numerical problems and programming bugs. However, the testing paradigms developed for deterministic algorithms have proven to be ill suited for stochastic algorithms. In this paper we demonstrate explicitly how the technique of statistical hypothesis testing, which is in wide use in other fields of science, can be used to devise automatic and reliable tests for Monte Carlo methods, and we show that these tests are able to detect some of the common problems encountered in stochastic scientific simulations. We argue that hypothesis testing should become part of the standard testing toolkit for scientific simulations.

  16. Reverse hypothesis machine learning a practitioner's perspective

    CERN Document Server

    Kulkarni, Parag

    2017-01-01

    This book introduces a paradigm of reverse hypothesis machines (RHM), focusing on knowledge innovation and machine learning. Knowledge- acquisition -based learning is constrained by large volumes of data and is time consuming. Hence Knowledge innovation based learning is the need of time. Since under-learning results in cognitive inabilities and over-learning compromises freedom, there is need for optimal machine learning. All existing learning techniques rely on mapping input and output and establishing mathematical relationships between them. Though methods change the paradigm remains the same—the forward hypothesis machine paradigm, which tries to minimize uncertainty. The RHM, on the other hand, makes use of uncertainty for creative learning. The approach uses limited data to help identify new and surprising solutions. It focuses on improving learnability, unlike traditional approaches, which focus on accuracy. The book is useful as a reference book for machine learning researchers and professionals as ...

  17. Exploring heterogeneous market hypothesis using realized volatility

    Science.gov (United States)

    Chin, Wen Cheong; Isa, Zaidi; Mohd Nor, Abu Hassan Shaari

    2013-04-01

    This study investigates the heterogeneous market hypothesis using high frequency data. The cascaded heterogeneous trading activities with different time durations are modelled by the heterogeneous autoregressive framework. The empirical study indicated the presence of long memory behaviour and predictability elements in the financial time series which supported heterogeneous market hypothesis. Besides the common sum-of-square intraday realized volatility, we also advocated two power variation realized volatilities in forecast evaluation and risk measurement in order to overcome the possible abrupt jumps during the credit crisis. Finally, the empirical results are used in determining the market risk using the value-at-risk approach. The findings of this study have implications for informationally market efficiency analysis, portfolio strategies and risk managements.

  18. A Hypothesis-Driven Approach to Site Investigation

    Science.gov (United States)

    Nowak, W.

    2008-12-01

    Variability of subsurface formations and the scarcity of data lead to the notion of aquifer parameters as geostatistical random variables. Given an information need and limited resources for field campaigns, site investigation is often put into the context of optimal design. In optimal design, the types, numbers and positions of samples are optimized under case-specific objectives to meet the information needs. Past studies feature optimal data worth (balancing maximum financial profit in an engineering task versus the cost of additional sampling), or aim at a minimum prediction uncertainty of stochastic models for a prescribed investigation budget. Recent studies also account for other sources of uncertainty outside the hydrogeological range, such as uncertain toxicity, ingestion and behavioral parameters of the affected population when predicting the human health risk from groundwater contaminations. The current study looks at optimal site investigation from a new angle. Answering a yes/no question under uncertainty directly requires recasting the original question as a hypothesis test. Otherwise, false confidence in the resulting answer would be pretended. A straightforward example is whether a recent contaminant spill will cause contaminant concentrations in excess of a legal limit at a nearby drinking water well. This question can only be answered down to a specified chance of error, i.e., based on the significance level used in hypothesis tests. Optimal design is placed into the hypothesis-driven context by using the chance of providing a false yes/no answer as new criterion to be minimized. Different configurations apply for one-sided and two-sided hypothesis tests. If a false answer entails financial liability, the hypothesis-driven context can be re-cast in the context of data worth. The remaining difference is that failure is a hard constraint in the data worth context versus a monetary punishment term in the hypothesis-driven context. The basic principle

  19. Water Taxation and the Double Dividend Hypothesis

    OpenAIRE

    Nicholas Kilimani

    2014-01-01

    The double dividend hypothesis contends that environmental taxes have the potential to yield multiple benefits for the economy. However, empirical evidence of the potential impacts of environmental taxation in developing countries is still limited. This paper seeks to contribute to the literature by exploring the impact of a water tax in a developing country context, with Uganda as a case study. Policy makers in Uganda are exploring ways of raising revenue by taxing environmental goods such a...

  20. [Working memory, phonological awareness and spelling hypothesis].

    Science.gov (United States)

    Gindri, Gigiane; Keske-Soares, Márcia; Mota, Helena Bolli

    2007-01-01

    Working memory, phonological awareness and spelling hypothesis. To verify the relationship between working memory, phonological awareness and spelling hypothesis in pre-school children and first graders. Participants of this study were 90 students, belonging to state schools, who presented typical linguistic development. Forty students were preschoolers, with the average age of six and 50 students were first graders, with the average age of seven. Participants were submitted to an evaluation of the working memory abilities based on the Working Memory Model (Baddeley, 2000), involving phonological loop. Phonological loop was evaluated using the Auditory Sequential Test, subtest 5 of Illinois Test of Psycholinguistic Abilities (ITPA), Brazilian version (Bogossian & Santos, 1977), and the Meaningless Words Memory Test (Kessler, 1997). Phonological awareness abilities were investigated using the Phonological Awareness: Instrument of Sequential Assessment (CONFIAS - Moojen et al., 2003), involving syllabic and phonemic awareness tasks. Writing was characterized according to Ferreiro & Teberosky (1999). Preschoolers presented the ability of repeating sequences of 4.80 digits and 4.30 syllables. Regarding phonological awareness, the performance in the syllabic level was of 19.68 and in the phonemic level was of 8.58. Most of the preschoolers demonstrated to have a pre-syllabic writing hypothesis. First graders repeated, in average, sequences of 5.06 digits and 4.56 syllables. These children presented a phonological awareness of 31.12 in the syllabic level and of 16.18 in the phonemic level, and demonstrated to have an alphabetic writing hypothesis. The performance of working memory, phonological awareness and spelling level are inter-related, as well as being related to chronological age, development and scholarity.

  1. Privacy on Hypothesis Testing in Smart Grids

    OpenAIRE

    Li, Zuxing; Oechtering, Tobias

    2015-01-01

    In this paper, we study the problem of privacy information leakage in a smart grid. The privacy risk is assumed to be caused by an unauthorized binary hypothesis testing of the consumer's behaviour based on the smart meter readings of energy supplies from the energy provider. Another energy supplies are produced by an alternative energy source. A controller equipped with an energy storage device manages the energy inflows to satisfy the energy demand of the consumer. We study the optimal ener...

  2. Box-particle probability hypothesis density filtering

    OpenAIRE

    Schikora, M.; Gning, A.; Mihaylova, L.; Cremers, D.; Koch, W.

    2014-01-01

    This paper develops a novel approach for multitarget tracking, called box-particle probability hypothesis density filter (box-PHD filter). The approach is able to track multiple targets and estimates the unknown number of targets. Furthermore, it is capable of dealing with three sources of uncertainty: stochastic, set-theoretic, and data association uncertainty. The box-PHD filter reduces the number of particles significantly, which improves the runtime considerably. The small number of box-p...

  3. Quantum effects and hypothesis of cosmic censorship

    International Nuclear Information System (INIS)

    Parnovskij, S.L.

    1989-01-01

    It is shown that filamentary characteristics with linear mass of less than 10 25 g/cm distort slightly the space-time at distances, exceeding Planck ones. Their formation doesn't change vacuum energy and doesn't lead to strong quantum radiation. Therefore, the problem of their occurrence can be considered within the framework of classical collapse. Quantum effects can be ignored when considering the problem of validity of cosmic censorship hypothesis

  4. The (not so) immortal strand hypothesis.

    Science.gov (United States)

    Tomasetti, Cristian; Bozic, Ivana

    2015-03-01

    Non-random segregation of DNA strands during stem cell replication has been proposed as a mechanism to minimize accumulated genetic errors in stem cells of rapidly dividing tissues. According to this hypothesis, an "immortal" DNA strand is passed to the stem cell daughter and not the more differentiated cell, keeping the stem cell lineage replication error-free. After it was introduced, experimental evidence both in favor and against the hypothesis has been presented. Using a novel methodology that utilizes cancer sequencing data we are able to estimate the rate of accumulation of mutations in healthy stem cells of the colon, blood and head and neck tissues. We find that in these tissues mutations in stem cells accumulate at rates strikingly similar to those expected without the protection from the immortal strand mechanism. Utilizing an approach that is fundamentally different from previous efforts to confirm or refute the immortal strand hypothesis, we provide evidence against non-random segregation of DNA during stem cell replication. Our results strongly suggest that parental DNA is passed randomly to stem cell daughters and provides new insight into the mechanism of DNA replication in stem cells. Copyright © 2015. Published by Elsevier B.V.

  5. A test of the orthographic recoding hypothesis

    Science.gov (United States)

    Gaygen, Daniel E.

    2003-04-01

    The Orthographic Recoding Hypothesis [D. E. Gaygen and P. A. Luce, Percept. Psychophys. 60, 465-483 (1998)] was tested. According to this hypothesis, listeners recognize spoken words heard for the first time by mapping them onto stored representations of the orthographic forms of the words. Listeners have a stable orthographic representation of words, but no phonological representation, when those words have been read frequently but never heard or spoken. Such may be the case for low frequency words such as jargon. Three experiments using visually and auditorily presented nonword stimuli tested this hypothesis. The first two experiments were explicit tests of memory (old-new tests) for words presented visually. In the first experiment, the recognition of auditorily presented nonwords was facilitated when they previously appeared on a visually presented list. The second experiment was similar, but included a concurrent articulation task during a visual word list presentation, thus preventing covert rehearsal of the nonwords. The results were similar to the first experiment. The third experiment was an indirect test of memory (auditory lexical decision task) for visually presented nonwords. Auditorily presented nonwords were identified as nonwords significantly more slowly if they had previously appeared on the visually presented list accompanied by a concurrent articulation task.

  6. Consumer health information seeking as hypothesis testing.

    Science.gov (United States)

    Keselman, Alla; Browne, Allen C; Kaufman, David R

    2008-01-01

    Despite the proliferation of consumer health sites, lay individuals often experience difficulty finding health information online. The present study attempts to understand users' information seeking difficulties by drawing on a hypothesis testing explanatory framework. It also addresses the role of user competencies and their interaction with internet resources. Twenty participants were interviewed about their understanding of a hypothetical scenario about a family member suffering from stable angina and then searched MedlinePlus consumer health information portal for information on the problem presented in the scenario. Participants' understanding of heart disease was analyzed via semantic analysis. Thematic coding was used to describe information seeking trajectories in terms of three key strategies: verification of the primary hypothesis, narrowing search within the general hypothesis area and bottom-up search. Compared to an expert model, participants' understanding of heart disease involved different key concepts, which were also differently grouped and defined. This understanding provided the framework for search-guiding hypotheses and results interpretation. Incorrect or imprecise domain knowledge led individuals to search for information on irrelevant sites, often seeking out data to confirm their incorrect initial hypotheses. Online search skills enhanced search efficiency, but did not eliminate these difficulties. Regardless of their web experience and general search skills, lay individuals may experience difficulty with health information searches. These difficulties may be related to formulating and evaluating hypotheses that are rooted in their domain knowledge. Informatics can provide support at the levels of health information portals, individual websites, and consumer education tools.

  7. The Literal Translation Hypothesis in ESP Teaching/Learning Environments

    Directory of Open Access Journals (Sweden)

    Pedro A. Fuertes-Olivera

    2015-11-01

    Full Text Available Research on the characteristics of specialized vocabulary usually replicates studies that deal with general words, e.g. they typically describe frequent terms and focus on their linguistic characteristics to aid in the learning and acquisition of the terms. We dispute this practise, as we believe that the basic characteristic of terms is that they are coined to restrict meaning, i.e. to be as precise and as specific as possible in a particular context. For instance, around 70% of English and Spanish accounting terms are multi-word terms, most of which contain more than three orthographic words that syntactically behave in a way that is very different from the syntactic behaviour of the node on which they are formed (Fuertes-Olivera and Tarp, forthcoming. This has prompted us to propose a research framework that investigates whether or not the literal translation hypothesis, which has been addressed in several areas of translation studies, can also be applied in ESP teaching/learning environments. If plausible, the assumptions on which this hypothesis is based can shed light on how learners disambiguate terms they encounter. Within this framework, this paper presents evidence that the literal translation hypothesis is possible in ESP; it offers the results of a pilot study that sheds light on how this hypothesis may work, and also discusses its usability in the context of ESP learning. In particular, this paper presents strategies for teaching multi-word terms that are different from those currently based on corpus data. We believe that exercises such as “cloze”, “fill in” and similar “guessing” exercises must be abandoned in ESP teaching/learning environments. Instead, we propose exercises that reproduce L1 teaching and learning activities, i.e., exercises that are typically used when acquiring specialised knowledge and skills in any domain, e.g. taking part in meetings and giving presentations in a business context.

  8. Water Pollution Detection Based on Hypothesis Testing in Sensor Networks

    Directory of Open Access Journals (Sweden)

    Xu Luo

    2017-01-01

    Full Text Available Water pollution detection is of great importance in water conservation. In this paper, the water pollution detection problems of the network and of the node in sensor networks are discussed. The detection problems in both cases of the distribution of the monitoring noise being normal and nonnormal are considered. The pollution detection problems are analyzed based on hypothesis testing theory firstly; then, the specific detection algorithms are given. Finally, two implementation examples are given to illustrate how the proposed detection methods are used in the water pollution detection in sensor networks and prove the effectiveness of the proposed detection methods.

  9. Element Specific Versus Integral Structural and Magnetic Properties of Co:ZnO and Gd:GaN Probed with Hard X-ray Absorption Spectroscopy

    Directory of Open Access Journals (Sweden)

    Andreas Ney

    2010-06-01

    Full Text Available Dilute magnetic semiconductors (DMS are envisioned as sources of spin-polarized carriers for future semiconductor devices which simultaneously utilize spin and charge of the carriers. The hope of discovering a DMS with ferromagnetic order up to room temperature still motivates research on suitable DMS materials. Two candidate wide-band gap DMS are Gd:GaN and Co:ZnO. We have used hard X-ray absorption spectroscopy (XAS and in particular X-ray linear dichroism (XLD and X-ray magnetic circular dichroism (XMCD to study both DMS materials with element specificity and compare these findings with results from integral SQUID magnetometry as well as electron paramagnetic resonance (EPR.

  10. Using hierarchical linear models to test differences in Swedish results from OECD’s PISA 2003: Integrated and subject-specific science education

    Directory of Open Access Journals (Sweden)

    Maria Åström

    2012-06-01

    Full Text Available The possible effects of different organisations of the science curriculum in schools participating in PISA 2003 are tested with a hierarchical linear model (HLM of two levels. The analysis is based on science results. Swedish schools are free to choose how they organise the science curriculum. They may choose to work subject-specifically (with Biology, Chemistry and Physics, integrated (with Science or to mix these two. In this study, all three ways of organising science classes in compulsory school are present to some degree. None of the different ways of organising science education displayed statistically significant better student results in scientific literacy as measured in PISA 2003. The HLM model used variables of gender, country of birth, home language, preschool attendance, an economic, social and cultural index as well as the teaching organisation.

  11. Updating the lamellar hypothesis of hippocampal organization

    Directory of Open Access Journals (Sweden)

    Robert S Sloviter

    2012-12-01

    Full Text Available In 1971, Andersen and colleagues proposed that excitatory activity in the entorhinal cortex propagates topographically to the dentate gyrus, and on through a trisynaptic circuit lying within transverse hippocampal slices or lamellae [Andersen, Bliss, and Skrede. 1971. Lamellar organization of hippocampal pathways. Exp Brain Res 13, 222-238]. In this way, a relatively simple structure might mediate complex functions in a manner analogous to the way independent piano keys can produce a nearly infinite variety of unique outputs. The lamellar hypothesis derives primary support from the lamellar distribution of dentate granule cell axons (the mossy fibers, which innervate dentate hilar neurons and area CA3 pyramidal cells and interneurons within the confines of a thin transverse hippocampal segment. Following the initial formulation of the lamellar hypothesis, anatomical studies revealed that unlike granule cells, hilar mossy cells, CA3 pyramidal cells, and Layer II entorhinal cells all form axonal projections that are more divergent along the longitudinal axis than the clearly lamellar mossy fiber pathway. The existence of pathways with translamellar distribution patterns has been interpreted, incorrectly in our view, as justifying outright rejection of the lamellar hypothesis [Amaral and Witter. 1989. The three-dimensional organization of the hippocampal formation: a review of anatomical data. Neuroscience 31, 571-591]. We suggest that the functional implications of longitudinally-projecting axons depend not on whether they exist, but on what they do. The observation that focal granule cell layer discharges normally inhibit, rather than excite, distant granule cells suggests that longitudinal axons in the dentate gyrus may mediate "lateral" inhibition and define lamellar function, rather than undermine it. In this review, we attempt a reconsideration of the evidence that most directly impacts the physiological concept of hippocampal lamellar

  12. Hypothesis Testing as an Act of Rationality

    Science.gov (United States)

    Nearing, Grey

    2017-04-01

    Statistical hypothesis testing is ad hoc in two ways. First, setting probabilistic rejection criteria is, as Neyman (1957) put it, an act of will rather than an act of rationality. Second, physical theories like conservation laws do not inherently admit probabilistic predictions, and so we must use what are called epistemic bridge principles to connect model predictions with the actual methods of hypothesis testing. In practice, these bridge principles are likelihood functions, error functions, or performance metrics. I propose that the reason we are faced with these problems is because we have historically failed to account for a fundamental component of basic logic - namely the portion of logic that explains how epistemic states evolve in the presence of empirical data. This component of Cox' (1946) calculitic logic is called information theory (Knuth, 2005), and adding information theory our hypothetico-deductive account of science yields straightforward solutions to both of the above problems. This also yields a straightforward method for dealing with Popper's (1963) problem of verisimilitude by facilitating a quantitative approach to measuring process isomorphism. In practice, this involves data assimilation. Finally, information theory allows us to reliably bound measures of epistemic uncertainty, thereby avoiding the problem of Bayesian incoherency under misspecified priors (Grünwald, 2006). I therefore propose solutions to four of the fundamental problems inherent in both hypothetico-deductive and/or Bayesian hypothesis testing. - Neyman (1957) Inductive Behavior as a Basic Concept of Philosophy of Science. - Cox (1946) Probability, Frequency and Reasonable Expectation. - Knuth (2005) Lattice Duality: The Origin of Probability and Entropy. - Grünwald (2006). Bayesian Inconsistency under Misspecification. - Popper (1963) Conjectures and Refutations: The Growth of Scientific Knowledge.

  13. The conscious access hypothesis: Explaining the consciousness.

    Science.gov (United States)

    Prakash, Ravi

    2008-01-01

    The phenomenon of conscious awareness or consciousness is complicated but fascinating. Although this concept has intrigued the mankind since antiquity, exploration of consciousness from scientific perspectives is not very old. Among myriad of theories regarding nature, functions and mechanism of consciousness, off late, cognitive theories have received wider acceptance. One of the most exciting hypotheses in recent times has been the "conscious access hypotheses" based on the "global workspace model of consciousness". It underscores an important property of consciousness, the global access of information in cerebral cortex. Present article reviews the "conscious access hypothesis" in terms of its theoretical underpinnings as well as experimental supports it has received.

  14. Interstellar colonization and the zoo hypothesis

    International Nuclear Information System (INIS)

    Jones, E.M.

    1978-01-01

    Michael Hart and others have pointed out that current estimates of the number of technological civilizations arisen in the Galaxy since its formation is in fundamental conflict with the expectation that such a civilization could colonize and utilize the entire Galaxy in 10 to 20 million years. This dilemma can be called Hart's paradox. Resolution of the paradox requires that one or more of the following are true: we are the Galaxy's first technical civilization; interstellar travel is immensely impractical or simply impossible; technological civilizations are very short-lived; or we inhabit a wildnerness preserve. The latter is the zoo hypothesis

  15. RANDOM WALK HYPOTHESIS IN FINANCIAL MARKETS

    Directory of Open Access Journals (Sweden)

    Nicolae-Marius JULA

    2017-05-01

    Full Text Available Random walk hypothesis states that the stock market prices do not follow a predictable trajectory, but are simply random. If you are trying to predict a random set of data, one should test for randomness, because, despite the power and complexity of the used models, the results cannot be trustworthy. There are several methods for testing these hypotheses and the use of computational power provided by the R environment makes the work of the researcher easier and with a cost-effective approach. The increasing power of computing and the continuous development of econometric tests should give the potential investors new tools in selecting commodities and investing in efficient markets.

  16. Confluence Model or Resource Dilution Hypothesis?

    DEFF Research Database (Denmark)

    Jæger, Mads

    have a negative effect on educational attainment most studies cannot distinguish empirically between the CM and the RDH. In this paper, I use the different theoretical predictions in the CM and the RDH on the role of cognitive ability as a partial or complete mediator of the sibship size effect......Studies on family background often explain the negative effect of sibship size on educational attainment by one of two theories: the Confluence Model (CM) or the Resource Dilution Hypothesis (RDH). However, as both theories – for substantively different reasons – predict that sibship size should...

  17. Set theory and the continuum hypothesis

    CERN Document Server

    Cohen, Paul J

    2008-01-01

    This exploration of a notorious mathematical problem is the work of the man who discovered the solution. The independence of the continuum hypothesis is the focus of this study by Paul J. Cohen. It presents not only an accessible technical explanation of the author's landmark proof but also a fine introduction to mathematical logic. An emeritus professor of mathematics at Stanford University, Dr. Cohen won two of the most prestigious awards in mathematics: in 1964, he was awarded the American Mathematical Society's Bôcher Prize for analysis; and in 1966, he received the Fields Medal for Logic.

  18. Statistical hypothesis testing with SAS and R

    CERN Document Server

    Taeger, Dirk

    2014-01-01

    A comprehensive guide to statistical hypothesis testing with examples in SAS and R When analyzing datasets the following questions often arise:Is there a short hand procedure for a statistical test available in SAS or R?If so, how do I use it?If not, how do I program the test myself? This book answers these questions and provides an overview of the most commonstatistical test problems in a comprehensive way, making it easy to find and performan appropriate statistical test. A general summary of statistical test theory is presented, along with a basicdescription for each test, including the

  19. Effect of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin on the growth performance, carcass quality and gut integrity of broiler chickens

    Directory of Open Access Journals (Sweden)

    M. H. H. Awaad

    2014-05-01

    Full Text Available Aim: The effect of a specific combination (SC of carvacrol, cinnamaldehyde, and Capsicum oleoresin was investigated on productive performance and immune response in broiler chickens. Materials and Methods: Six hundred one-day-old broiler chickens were randomly allocated into two groups for 5 weeks. The SC was supplemented at 100 ppm of ration (presence or absence. Results: Treatment of broiler chickens with the SC improved productive performance variables as compared with the blank control birds. It decreased total mortality, increased final body weight, weight gain, production number and decreased final feed conversion ratio (FCR (P<0.05. The SC had a positive effect on carcass quality and enhanced HI titer against Newcastle disease (ND virus vaccine, as compared to their untreated control group (P<0.05. The SC treated birds had higher values of intestinal diameter than the control ones. Conclusion: It could be concluded that administration of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin to broiler chickens improved chicken zootechnical performance response variables, had a potent immuno-modulatory effect (potentiated immune response and improved gut integrity. Eventually, this combination could be used as a replacement to the controversial feed additives (antibiotic growth promoters.

  20. Synchronization and phonological skills: precise auditory timing hypothesis (PATH

    Directory of Open Access Journals (Sweden)

    Adam eTierney

    2014-11-01

    Full Text Available Phonological skills are enhanced by music training, but the mechanisms enabling this cross-domain enhancement remain unknown. To explain this cross-domain transfer, we propose a precise auditory timing hypothesis (PATH whereby entrainment practice is the core mechanism underlying enhanced phonological abilities in musicians. Both rhythmic synchronization and language skills such as consonant discrimination, detection of word and phrase boundaries, and conversational turn-taking rely on the perception of extremely fine-grained timing details in sound. Auditory-motor timing is an acoustic feature which meets all five of the pre-conditions necessary for cross-domain enhancement to occur (Patel 2011, 2012, 2014. There is overlap between the neural networks that process timing in the context of both music and language. Entrainment to music demands more precise timing sensitivity than does language processing. Moreover, auditory-motor timing integration captures the emotion of the trainee, is repeatedly practiced, and demands focused attention. The precise auditory timing hypothesis predicts that musical training emphasizing entrainment will be particularly effective in enhancing phonological skills.

  1. A default Bayesian hypothesis test for mediation.

    Science.gov (United States)

    Nuijten, Michèle B; Wetzels, Ruud; Matzke, Dora; Dolan, Conor V; Wagenmakers, Eric-Jan

    2015-03-01

    In order to quantify the relationship between multiple variables, researchers often carry out a mediation analysis. In such an analysis, a mediator (e.g., knowledge of a healthy diet) transmits the effect from an independent variable (e.g., classroom instruction on a healthy diet) to a dependent variable (e.g., consumption of fruits and vegetables). Almost all mediation analyses in psychology use frequentist estimation and hypothesis-testing techniques. A recent exception is Yuan and MacKinnon (Psychological Methods, 14, 301-322, 2009), who outlined a Bayesian parameter estimation procedure for mediation analysis. Here we complete the Bayesian alternative to frequentist mediation analysis by specifying a default Bayesian hypothesis test based on the Jeffreys-Zellner-Siow approach. We further extend this default Bayesian test by allowing a comparison to directional or one-sided alternatives, using Markov chain Monte Carlo techniques implemented in JAGS. All Bayesian tests are implemented in the R package BayesMed (Nuijten, Wetzels, Matzke, Dolan, & Wagenmakers, 2014).

  2. Gaussian Hypothesis Testing and Quantum Illumination.

    Science.gov (United States)

    Wilde, Mark M; Tomamichel, Marco; Lloyd, Seth; Berta, Mario

    2017-09-22

    Quantum hypothesis testing is one of the most basic tasks in quantum information theory and has fundamental links with quantum communication and estimation theory. In this paper, we establish a formula that characterizes the decay rate of the minimal type-II error probability in a quantum hypothesis test of two Gaussian states given a fixed constraint on the type-I error probability. This formula is a direct function of the mean vectors and covariance matrices of the quantum Gaussian states in question. We give an application to quantum illumination, which is the task of determining whether there is a low-reflectivity object embedded in a target region with a bright thermal-noise bath. For the asymmetric-error setting, we find that a quantum illumination transmitter can achieve an error probability exponent stronger than a coherent-state transmitter of the same mean photon number, and furthermore, that it requires far fewer trials to do so. This occurs when the background thermal noise is either low or bright, which means that a quantum advantage is even easier to witness than in the symmetric-error setting because it occurs for a larger range of parameters. Going forward from here, we expect our formula to have applications in settings well beyond those considered in this paper, especially to quantum communication tasks involving quantum Gaussian channels.

  3. Inoculation stress hypothesis of environmental enrichment.

    Science.gov (United States)

    Crofton, Elizabeth J; Zhang, Yafang; Green, Thomas A

    2015-02-01

    One hallmark of psychiatric conditions is the vast continuum of individual differences in susceptibility vs. resilience resulting from the interaction of genetic and environmental factors. The environmental enrichment paradigm is an animal model that is useful for studying a range of psychiatric conditions, including protective phenotypes in addiction and depression models. The major question is how environmental enrichment, a non-drug and non-surgical manipulation, can produce such robust individual differences in such a wide range of behaviors. This paper draws from a variety of published sources to outline a coherent hypothesis of inoculation stress as a factor producing the protective enrichment phenotypes. The basic tenet suggests that chronic mild stress from living in a complex environment and interacting non-aggressively with conspecifics can inoculate enriched rats against subsequent stressors and/or drugs of abuse. This paper reviews the enrichment phenotypes, mulls the fundamental nature of environmental enrichment vs. isolation, discusses the most appropriate control for environmental enrichment, and challenges the idea that cortisol/corticosterone equals stress. The intent of the inoculation stress hypothesis of environmental enrichment is to provide a scaffold with which to build testable hypotheses for the elucidation of the molecular mechanisms underlying these protective phenotypes and thus provide new therapeutic targets to treat psychiatric/neurological conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Athlete's Heart: Is the Morganroth Hypothesis Obsolete?

    Science.gov (United States)

    Haykowsky, Mark J; Samuel, T Jake; Nelson, Michael D; La Gerche, Andre

    2018-05-01

    In 1975, Morganroth and colleagues reported that the increased left ventricular (LV) mass in highly trained endurance athletes versus nonathletes was primarily due to increased end-diastolic volume while the increased LV mass in resistance trained athletes was solely due to an increased LV wall thickness. Based on the divergent remodelling patterns observed, Morganroth and colleagues hypothesised that the increased "volume" load during endurance exercise may be similar to that which occurs in patients with mitral or aortic regurgitation while the "pressure" load associated with performing a Valsalva manoeuvre (VM) during resistance exercise may mimic the stress imposed on the heart by systemic hypertension or aortic stenosis. Despite widespread acceptance of the four-decade old Morganroth hypothesis in sports cardiology, some investigators have questioned whether such a divergent "athlete's heart" phenotype exists. Given this uncertainty, the purpose of this brief review is to re-evaluate the Morganroth hypothesis regarding: i) the acute effects of resistance exercise performed with a brief VM on LV wall stress, and the patterns of LV remodelling in resistance-trained athletes; ii) the acute effects of endurance exercise on biventricular wall stress, and the time course and pattern of LV and right ventricular (RV) remodelling with endurance training; and iii) the value of comparing "loading" conditions between athletes and patients with cardiac pathology. Copyright © 2018. Published by Elsevier B.V.

  5. Roots and Route of the Artification Hypothesis

    Directory of Open Access Journals (Sweden)

    Ellen Dissanayake

    2017-08-01

    Full Text Available Over four decades, my ideas about the arts in human evolution have themselves evolved, from an original notion of art as a human behaviour of “making special” to a full-fledged hypothesis of artification. A summary of the gradual developmental path (or route of the hypothesis, based on ethological principles and concepts, is given, and an argument presented in which artification is described as an exaptation whose roots lie in adaptive features of ancestral mother–infant interaction that contributed to infant survival and maternal reproductive success. I show how the interaction displays features of a ritualised behavior whose operations (formalization, repetition, exaggeration, and elaboration can be regarded as characteristic elements of human ritual ceremonies as well as of art (including song, dance, performance, literary language, altered surroundings, and other examples of making ordinary sounds, movement, language, environments, objects, and bodies extraordinary. Participation in these behaviours in ritual practices served adaptive ends in early Homo by coordinating brain and body states, and thereby emotionally bonding members of a group in common cause as well as reducing existential anxiety in individuals. A final section situates artification within contemporary philosophical and popular ideas of art, claiming that artifying is not a synonym for or definition of art but foundational to any evolutionary discussion of artistic/aesthetic behaviour.

  6. Hypothesis: does ochratoxin A cause testicular cancer?

    Science.gov (United States)

    Schwartz, Gary G

    2002-02-01

    Little is known about the etiology of testicular cancer, which is the most common cancer among young men. Epidemiologic data point to a carcinogenic exposure in early life or in utero, but the nature of the exposure is unknown. We hypothesize that the mycotoxin, ochratoxin A, is a cause of testicular cancer. Ochratoxin A is a naturally occurring contaminant of cereals, pigmeat, and other foods and is a known genotoxic carcinogen in animals. The major features of the descriptive epidemiology of testicular cancer (a high incidence in northern Europe, increasing incidence over time, and associations with high socioeconomic status, and with poor semen quality) are all associated with exposure to ochratoxin A. Exposure of animals to ochratoxin A via the diet or via in utero transfer induces adducts in testicular DNA. We hypothesize that consumption of foods contaminated with ochratoxin A during pregnancy and/or childhood induces lesions in testicular DNA and that puberty promotes these lesions to testicular cancer. We tested the ochratoxin A hypothesis using ecologic data on the per-capita consumption of cereals, coffee, and pigmeat, the principal dietary sources of ochratoxin A. Incidence rates for testicular cancer in 20 countries were significantly correlated with the per-capita consumption of coffee and pigmeat (r = 0.49 and 0.54, p = 0.03 and 0.01). The ochratoxin A hypothesis offers a coherent explanation for much of the descriptive epidemiology of testicular cancer and suggests new avenues for analytic research.

  7. Urbanization and the more-individuals hypothesis.

    Science.gov (United States)

    Chiari, Claudia; Dinetti, Marco; Licciardello, Cinzia; Licitra, Gaetano; Pautasso, Marco

    2010-03-01

    1. Urbanization is a landscape process affecting biodiversity world-wide. Despite many urban-rural studies of bird assemblages, it is still unclear whether more species-rich communities have more individuals, regardless of the level of urbanization. The more-individuals hypothesis assumes that species-rich communities have larger populations, thus reducing the chance of local extinctions. 2. Using newly collated avian distribution data for 1 km(2) grid cells across Florence, Italy, we show a significantly positive relationship between species richness and assemblage abundance for the whole urban area. This richness-abundance relationship persists for the 1 km(2) grid cells with less than 50% of urbanized territory, as well as for the remaining grid cells, with no significant difference in the slope of the relationship. These results support the more-individuals hypothesis as an explanation of patterns in species richness, also in human modified and fragmented habitats. 3. However, the intercept of the species richness-abundance relationship is significantly lower for highly urbanized grid cells. Our study confirms that urban communities have lower species richness but counters the common notion that assemblages in densely urbanized ecosystems have more individuals. In Florence, highly inhabited areas show fewer species and lower assemblage abundance. 4. Urbanized ecosystems are an ongoing large-scale natural experiment which can be used to test ecological theories empirically.

  8. The Younger Dryas impact hypothesis: A requiem

    Science.gov (United States)

    Pinter, Nicholas; Scott, Andrew C.; Daulton, Tyrone L.; Podoll, Andrew; Koeberl, Christian; Anderson, R. Scott; Ishman, Scott E.

    2011-06-01

    The Younger Dryas (YD) impact hypothesis is a recent theory that suggests that a cometary or meteoritic body or bodies hit and/or exploded over North America 12,900 years ago, causing the YD climate episode, extinction of Pleistocene megafauna, demise of the Clovis archeological culture, and a range of other effects. Since gaining widespread attention in 2007, substantial research has focused on testing the 12 main signatures presented as evidence of a catastrophic extraterrestrial event 12,900 years ago. Here we present a review of the impact hypothesis, including its evolution and current variants, and of efforts to test and corroborate the hypothesis. The physical evidence interpreted as signatures of an impact event can be separated into two groups. The first group consists of evidence that has been largely rejected by the scientific community and is no longer in widespread discussion, including: particle tracks in archeological chert; magnetic nodules in Pleistocene bones; impact origin of the Carolina Bays; and elevated concentrations of radioactivity, iridium, and fullerenes enriched in 3He. The second group consists of evidence that has been active in recent research and discussions: carbon spheres and elongates, magnetic grains and magnetic spherules, byproducts of catastrophic wildfire, and nanodiamonds. Over time, however, these signatures have also seen contrary evidence rather than support. Recent studies have shown that carbon spheres and elongates do not represent extraterrestrial carbon nor impact-induced megafires, but are indistinguishable from fungal sclerotia and arthropod fecal material that are a small but common component of many terrestrial deposits. Magnetic grains and spherules are heterogeneously distributed in sediments, but reported measurements of unique peaks in concentrations at the YD onset have yet to be reproduced. The magnetic grains are certainly just iron-rich detrital grains, whereas reported YD magnetic spherules are

  9. Approaches to informed consent for hypothesis-testing and hypothesis-generating clinical genomics research.

    Science.gov (United States)

    Facio, Flavia M; Sapp, Julie C; Linn, Amy; Biesecker, Leslie G

    2012-10-10

    Massively-parallel sequencing (MPS) technologies create challenges for informed consent of research participants given the enormous scale of the data and the wide range of potential results. We propose that the consent process in these studies be based on whether they use MPS to test a hypothesis or to generate hypotheses. To demonstrate the differences in these approaches to informed consent, we describe the consent processes for two MPS studies. The purpose of our hypothesis-testing study is to elucidate the etiology of rare phenotypes using MPS. The purpose of our hypothesis-generating study is to test the feasibility of using MPS to generate clinical hypotheses, and to approach the return of results as an experimental manipulation. Issues to consider in both designs include: volume and nature of the potential results, primary versus secondary results, return of individual results, duty to warn, length of interaction, target population, and privacy and confidentiality. The categorization of MPS studies as hypothesis-testing versus hypothesis-generating can help to clarify the issue of so-called incidental or secondary results for the consent process, and aid the communication of the research goals to study participants.

  10. Learning-Related Changes in Adolescents' Neural Networks during Hypothesis-Generating and Hypothesis-Understanding Training

    Science.gov (United States)

    Lee, Jun-Ki; Kwon, Yongju

    2012-01-01

    Fourteen science high school students participated in this study, which investigated neural-network plasticity associated with hypothesis-generating and hypothesis-understanding in learning. The students were divided into two groups and participated in either hypothesis-generating or hypothesis-understanding type learning programs, which were…

  11. A Spaceborne Synthetic Aperture Radar Partial Fixed-Point Imaging System Using a Field- Programmable Gate Array-Application-Specific Integrated Circuit Hybrid Heterogeneous Parallel Acceleration Technique.

    Science.gov (United States)

    Yang, Chen; Li, Bingyi; Chen, Liang; Wei, Chunpeng; Xie, Yizhuang; Chen, He; Yu, Wenyue

    2017-06-24

    With the development of satellite load technology and very large scale integrated (VLSI) circuit technology, onboard real-time synthetic aperture radar (SAR) imaging systems have become a solution for allowing rapid response to disasters. A key goal of the onboard SAR imaging system design is to achieve high real-time processing performance with severe size, weight, and power consumption constraints. In this paper, we analyse the computational burden of the commonly used chirp scaling (CS) SAR imaging algorithm. To reduce the system hardware cost, we propose a partial fixed-point processing scheme. The fast Fourier transform (FFT), which is the most computation-sensitive operation in the CS algorithm, is processed with fixed-point, while other operations are processed with single precision floating-point. With the proposed fixed-point processing error propagation model, the fixed-point processing word length is determined. The fidelity and accuracy relative to conventional ground-based software processors is verified by evaluating both the point target imaging quality and the actual scene imaging quality. As a proof of concept, a field- programmable gate array-application-specific integrated circuit (FPGA-ASIC) hybrid heterogeneous parallel accelerating architecture is designed and realized. The customized fixed-point FFT is implemented using the 130 nm complementary metal oxide semiconductor (CMOS) technology as a co-processor of the Xilinx xc6vlx760t FPGA. A single processing board requires 12 s and consumes 21 W to focus a 50-km swath width, 5-m resolution stripmap SAR raw data with a granularity of 16,384 × 16,384.

  12. A Spaceborne Synthetic Aperture Radar Partial Fixed-Point Imaging System Using a Field- Programmable Gate Array−Application-Specific Integrated Circuit Hybrid Heterogeneous Parallel Acceleration Technique

    Directory of Open Access Journals (Sweden)

    Chen Yang

    2017-06-01

    Full Text Available With the development of satellite load technology and very large scale integrated (VLSI circuit technology, onboard real-time synthetic aperture radar (SAR imaging systems have become a solution for allowing rapid response to disasters. A key goal of the onboard SAR imaging system design is to achieve high real-time processing performance with severe size, weight, and power consumption constraints. In this paper, we analyse the computational burden of the commonly used chirp scaling (CS SAR imaging algorithm. To reduce the system hardware cost, we propose a partial fixed-point processing scheme. The fast Fourier transform (FFT, which is the most computation-sensitive operation in the CS algorithm, is processed with fixed-point, while other operations are processed with single precision floating-point. With the proposed fixed-point processing error propagation model, the fixed-point processing word length is determined. The fidelity and accuracy relative to conventional ground-based software processors is verified by evaluating both the point target imaging quality and the actual scene imaging quality. As a proof of concept, a field- programmable gate array−application-specific integrated circuit (FPGA-ASIC hybrid heterogeneous parallel accelerating architecture is designed and realized. The customized fixed-point FFT is implemented using the 130 nm complementary metal oxide semiconductor (CMOS technology as a co-processor of the Xilinx xc6vlx760t FPGA. A single processing board requires 12 s and consumes 21 W to focus a 50-km swath width, 5-m resolution stripmap SAR raw data with a granularity of 16,384 × 16,384.

  13. Beyond hormones: a novel hypothesis for the biological basis of male sexual orientation.

    Science.gov (United States)

    Bocklandt, S; Hamer, D H

    2003-01-01

    For the past several decades, research on the development of human sexual orientation has focused on the role of pre- or peri-natal androgen levels on brain development. However, there is no evidence that physiologically occurring variations in androgen exposure influence differences in sexual orientation. In this review, we discuss an alternative hypothesis involving genomic imprinting in the regulation of sex specific expression of genes regulating sexually dimorphic traits, including sexual orientation. A possible experiment to test this hypothesis is discussed.

  14. Alternatives to the linear risk hypothesis

    International Nuclear Information System (INIS)

    Craig, A.G.

    1976-01-01

    A theoretical argument is presented which suggests that in using the linear hypothesis for all values of LET the low dose risk is overestimated for low LET but that it is underestimated for very high LET. The argument is based upon the idea that cell lesions which do not lead to cell death may in fact lead to a malignant cell. Expressions for the Surviving Fraction and the Cancer Risk based on this argument are given. An advantage of this very general approach is that is expresses cell survival and cancer risk entirely in terms of the cell lesions and avoids the rather contentious argument as to how the average number of lesions should be related to the dose. (U.K.)

  15. Large numbers hypothesis. II - Electromagnetic radiation

    Science.gov (United States)

    Adams, P. J.

    1983-01-01

    This paper develops the theory of electromagnetic radiation in the units covariant formalism incorporating Dirac's large numbers hypothesis (LNH). A direct field-to-particle technique is used to obtain the photon propagation equation which explicitly involves the photon replication rate. This replication rate is fixed uniquely by requiring that the form of a free-photon distribution function be preserved, as required by the 2.7 K cosmic radiation. One finds that with this particular photon replication rate the units covariant formalism developed in Paper I actually predicts that the ratio of photon number to proton number in the universe varies as t to the 1/4, precisely in accord with LNH. The cosmological red-shift law is also derived and it is shown to differ considerably from the standard form of (nu)(R) - const.

  16. Artistic talent in dyslexia--a hypothesis.

    Science.gov (United States)

    Chakravarty, Ambar

    2009-10-01

    The present article hints at a curious neurocognitive phenomenon of development of artistic talents in some children with dyslexia. The article also takes note of the phenomenon of creating in the midst of language disability as observed in the lives of such creative people like Leonardo da Vinci and Albert Einstein who were most probably affected with developmental learning disorders. It has been hypothesised that a developmental delay in the dominant hemisphere most likely 'disinhibits' the non-dominant parietal lobe to unmask talents, artistic or otherwise, in some such individuals. The present hypothesis follows the phenomenon of paradoxical functional facilitation described earlier. It has been suggested that children with learning disorders be encouraged to develop such hidden talents to full capacity, rather than be subjected to overemphasising on the correction of the disturbed coded symbol operations, in remedial training.

  17. Tissue misrepair hypothesis for radiation carcinogenesis

    International Nuclear Information System (INIS)

    Kondo, Sohei

    1991-01-01

    Dose-response curves for chronic leukemia in A-bomb survivors and liver tumors in patients given Thorotrast (colloidal thorium dioxide) show large threshold effects. The existence of these threshold effects can be explained by the following hypothesis. A high dose of radiation causes a persistent wound in a cellrenewable tissue. Disorder of the injured cell society partly frees the component cells from territorial restraints on their proliferation, enabling them to continue development of their cellular functions toward advanced autonomy. This progression might be achieved by continued epigenetic and genetic changes as a result of occasional errors in the otherwise concerted healing action of various endogeneous factors recruited for tissue repair. Carcinogenesis is not simply a single-cell problem but a cell-society problem. Therefore, it is not warranted to estimate risk at low doses by linear extrapolation from cancer data at high doses without knowledge of the mechanism of radiation carcinogenesis. (author) 57 refs

  18. Statistical hypothesis tests of some micrometeorological observations

    International Nuclear Information System (INIS)

    SethuRaman, S.; Tichler, J.

    1977-01-01

    Chi-square goodness-of-fit is used to test the hypothesis that the medium scale of turbulence in the atmospheric surface layer is normally distributed. Coefficients of skewness and excess are computed from the data. If the data are not normal, these coefficients are used in Edgeworth's asymptotic expansion of Gram-Charlier series to determine an altrnate probability density function. The observed data are then compared with the modified probability densities and the new chi-square values computed.Seventy percent of the data analyzed was either normal or approximatley normal. The coefficient of skewness g 1 has a good correlation with the chi-square values. Events with vertical-barg 1 vertical-bar 1 vertical-bar<0.43 were approximately normal. Intermittency associated with the formation and breaking of internal gravity waves in surface-based inversions over water is thought to be the reason for the non-normality

  19. The hexagon hypothesis: Six disruptive scenarios.

    Science.gov (United States)

    Burtles, Jim

    2015-01-01

    This paper aims to bring a simple but effective and comprehensive approach to the development, delivery and monitoring of business continuity solutions. To ensure that the arguments and principles apply across the board, the paper sticks to basic underlying concepts rather than sophisticated interpretations. First, the paper explores what exactly people are defending themselves against. Secondly, the paper looks at how defences should be set up. Disruptive events tend to unfold in phases, each of which invites a particular style of protection, ranging from risk management through to business continuity to insurance cover. Their impact upon any business operation will fall into one of six basic scenarios. The hexagon hypothesis suggests that everyone should be prepared to deal with each of these six disruptive scenarios and it provides them with a useful benchmark for business continuity.

  20. Novae, supernovae, and the island universe hypothesis

    International Nuclear Information System (INIS)

    Van Den Bergh, S.

    1988-01-01

    Arguments in Curtis's (1917) paper related to the island universe hypothesis and the existence of novae in spiral nebulae are considered. It is noted that the maximum magnitude versus rate-of-decline relation for novae may be the best tool presently available for the calibration of the extragalactic distance scale. Light curve observations of six novae are used to determine a distance of 18.6 + or - 3.5 MPc to the Virgo cluster. Results suggest that Type Ia supernovae cannot easily be used as standard candles, and that Type II supernovae are unsuitable as distance indicators. Factors other than precursor mass are probably responsible for determining the ultimate fate of evolving stars. 83 references

  1. Extra dimensions hypothesis in high energy physics

    Directory of Open Access Journals (Sweden)

    Volobuev Igor

    2017-01-01

    Full Text Available We discuss the history of the extra dimensions hypothesis and the physics and phenomenology of models with large extra dimensions with an emphasis on the Randall- Sundrum (RS model with two branes. We argue that the Standard Model extension based on the RS model with two branes is phenomenologically acceptable only if the inter-brane distance is stabilized. Within such an extension of the Standard Model, we study the influence of the infinite Kaluza-Klein (KK towers of the bulk fields on collider processes. In particular, we discuss the modification of the scalar sector of the theory, the Higgs-radion mixing due to the coupling of the Higgs boson to the radion and its KK tower, and the experimental restrictions on the mass of the radion-dominated states.

  2. Multiple model cardinalized probability hypothesis density filter

    Science.gov (United States)

    Georgescu, Ramona; Willett, Peter

    2011-09-01

    The Probability Hypothesis Density (PHD) filter propagates the first-moment approximation to the multi-target Bayesian posterior distribution while the Cardinalized PHD (CPHD) filter propagates both the posterior likelihood of (an unlabeled) target state and the posterior probability mass function of the number of targets. Extensions of the PHD filter to the multiple model (MM) framework have been published and were implemented either with a Sequential Monte Carlo or a Gaussian Mixture approach. In this work, we introduce the multiple model version of the more elaborate CPHD filter. We present the derivation of the prediction and update steps of the MMCPHD particularized for the case of two target motion models and proceed to show that in the case of a single model, the new MMCPHD equations reduce to the original CPHD equations.

  3. On the immunostimulatory hypothesis of cancer

    Directory of Open Access Journals (Sweden)

    Juan Bruzzo

    2011-12-01

    Full Text Available There is a rather generalized belief that the worst possible outcome for the application of immunological therapies against cancer is a null effect on tumor growth. However, a significant body of evidence summarized in the immunostimulatory hypothesis of cancer suggests that, upon certain circumstances, the growth of incipient and established tumors can be accelerated rather than inhibited by the immune response supposedly mounted to limit tumor growth. In order to provide more compelling evidence of this proposition, we have explored the growth behavior characteristics of twelve murine tumors -most of them of spontaneous origin- arisen in the colony of our laboratory, in putatively immunized and control mice. Using classical immunization procedures, 8 out of 12 tumors were actually stimulated in "immunized" mice while the remaining 4 were neither inhibited nor stimulated. Further, even these apparently non-antigenic tumors could reveal some antigenicity if more stringent than classical immunization procedures were used. This possibility was suggested by the results obtained with one of these four apparently non-antigenic tumors: the LB lymphoma. In effect, upon these stringent immunization pretreatments, LB was slightly inhibited or stimulated, depending on the titer of the immune reaction mounted against the tumor, with higher titers rendering inhibition and lower titers rendering tumor stimulation. All the above results are consistent with the immunostimulatory hypothesis that entails the important therapeutic implications -contrary to the orthodoxy- that, anti-tumor vaccines may run a real risk of doing harm if the vaccine-induced immunity is too weak to move the reaction into the inhibitory part of the immune response curve and that, a slight and prolonged immunodepression -rather than an immunostimulation- might interfere with the progression of some tumors and thus be an aid to cytotoxic therapies.

  4. The Stress Acceleration Hypothesis of Nightmares

    Directory of Open Access Journals (Sweden)

    Tore Nielsen

    2017-06-01

    Full Text Available Adverse childhood experiences can deleteriously affect future physical and mental health, increasing risk for many illnesses, including psychiatric problems, sleep disorders, and, according to the present hypothesis, idiopathic nightmares. Much like post-traumatic nightmares, which are triggered by trauma and lead to recurrent emotional dreaming about the trauma, idiopathic nightmares are hypothesized to originate in early adverse experiences that lead in later life to the expression of early memories and emotions in dream content. Accordingly, the objectives of this paper are to (1 review existing literature on sleep, dreaming and nightmares in relation to early adverse experiences, drawing upon both empirical studies of dreaming and nightmares and books and chapters by recognized nightmare experts and (2 propose a new approach to explaining nightmares that is based upon the Stress Acceleration Hypothesis of mental illness. The latter stipulates that susceptibility to mental illness is increased by adversity occurring during a developmentally sensitive window for emotional maturation—the infantile amnesia period—that ends around age 3½. Early adversity accelerates the neural and behavioral maturation of emotional systems governing the expression, learning, and extinction of fear memories and may afford short-term adaptive value. But it also engenders long-term dysfunctional consequences including an increased risk for nightmares. Two mechanisms are proposed: (1 disruption of infantile amnesia allows normally forgotten early childhood memories to influence later emotions, cognitions and behavior, including the common expression of threats in nightmares; (2 alterations of normal emotion regulation processes of both waking and sleep lead to increased fear sensitivity and less effective fear extinction. These changes influence an affect network previously hypothesized to regulate fear extinction during REM sleep, disruption of which leads to

  5. Why Does REM Sleep Occur? A Wake-up Hypothesis

    Directory of Open Access Journals (Sweden)

    Dr. W. R. eKlemm

    2011-09-01

    Full Text Available Brain activity differs in the various sleep stages and in conscious wakefulness. Awakening from sleep requires restoration of the complex nerve impulse patterns in neuronal network assemblies necessary to re-create and sustain conscious wakefulness. Herein I propose that the brain uses REM to help wake itself up after it has had a sufficient amount of sleep. Evidence suggesting this hypothesis includes the facts that, 1 when first going to sleep, the brain plunges into Stage N3 (formerly called Stage IV, a deep abyss of sleep, and, as the night progresses, the sleep is punctuated by episodes of REM that become longer and more frequent toward morning, 2 conscious-like dreams are a reliable component of the REM state in which the dreamer is an active mental observer or agent in the dream, 3 the last awakening during a night’s sleep usually occurs in a REM episode during or at the end of a dream, 4 both REM and awake consciousness seem to arise out of a similar brainstem ascending arousal system 5 N3 is a functionally perturbed state that eventually must be corrected so that embodied brain can direct adaptive behavior, and 6 corticofugal projections to brainstem arousal areas provide a way to trigger increased cortical activity in REM to progressively raise the sleeping brain to the threshold required for wakefulness. This paper shows how the hypothesis conforms to common experience and has substantial predictive and explanatory power regarding the phenomenology of sleep in terms of ontogeny, aging, phylogeny, abnormal/disease states, cognition, and behavioral physiology. That broad range of consistency is not matched by competing theories, which are summarized herein. Specific ways to test this wake-up hypothesis are suggested. Such research could lead to a better understanding of awake consciousness.

  6. Why does rem sleep occur? A wake-up hypothesis.

    Science.gov (United States)

    Klemm, W R

    2011-01-01

    Brain activity differs in the various sleep stages and in conscious wakefulness. Awakening from sleep requires restoration of the complex nerve impulse patterns in neuronal network assemblies necessary to re-create and sustain conscious wakefulness. Herein I propose that the brain uses rapid eye movement (REM) to help wake itself up after it has had a sufficient amount of sleep. Evidence suggesting this hypothesis includes the facts that, (1) when first going to sleep, the brain plunges into Stage N3 (formerly called Stage IV), a deep abyss of sleep, and, as the night progresses, the sleep is punctuated by episodes of REM that become longer and more frequent toward morning, (2) conscious-like dreams are a reliable component of the REM state in which the dreamer is an active mental observer or agent in the dream, (3) the last awakening during a night's sleep usually occurs in a REM episode during or at the end of a dream, (4) both REM and awake consciousness seem to arise out of a similar brainstem ascending arousal system (5) N3 is a functionally perturbed state that eventually must be corrected so that embodied brain can direct adaptive behavior, and (6) cortico-fugal projections to brainstem arousal areas provide a way to trigger increased cortical activity in REM to progressively raise the sleeping brain to the threshold required for wakefulness. This paper shows how the hypothesis conforms to common experience and has substantial predictive and explanatory power regarding the phenomenology of sleep in terms of ontogeny, aging, phylogeny, abnormal/disease states, cognition, and behavioral physiology. That broad range of consistency is not matched by competing theories, which are summarized herein. Specific ways to test this wake-up hypothesis are suggested. Such research could lead to a better understanding of awake consciousness.

  7. Verification of Scientific Simulations via Hypothesis-Driven Comparative and Quantitative Visualization

    Energy Technology Data Exchange (ETDEWEB)

    Ahrens, James P [ORNL; Heitmann, Katrin [ORNL; Petersen, Mark R [ORNL; Woodring, Jonathan [Los Alamos National Laboratory (LANL); Williams, Sean [Los Alamos National Laboratory (LANL); Fasel, Patricia [Los Alamos National Laboratory (LANL); Ahrens, Christine [Los Alamos National Laboratory (LANL); Hsu, Chung-Hsing [ORNL; Geveci, Berk [ORNL

    2010-11-01

    This article presents a visualization-assisted process that verifies scientific-simulation codes. Code verification is necessary because scientists require accurate predictions to interpret data confidently. This verification process integrates iterative hypothesis verification with comparative, feature, and quantitative visualization. Following this process can help identify differences in cosmological and oceanographic simulations.

  8. Velocity-based planning of rapid elbow movements expands the control scheme of the equilibrium point hypothesis.

    Science.gov (United States)

    Suzuki, Masataka; Yamazaki, Yoshihiko

    2005-01-01

    According to the equilibrium point hypothesis of voluntary motor control, control action of muscles is not explicitly computed, but rather arises as a consequence of interaction between moving equilibrium position, current kinematics and stiffness of the joint. This approach is attractive as it obviates the need to explicitly specify the forces controlling limb movements. However, many debatable aspects of this hypothesis remain in the manner of specification of the equilibrium point trajectory and muscle activation (or its stiffness), which elicits a restoring force toward the planned equilibrium trajectory. In this study, we expanded the framework of this hypothesis by assuming that the control system uses the velocity measure as the origin of subordinate variables scaling descending commands. The velocity command is translated into muscle control inputs by second order pattern generators, which yield reciprocal command and coactivation commands, and create alternating activation of the antagonistic muscles during movement and coactivation in the post-movement phase, respectively. The velocity command is also integrated to give a position command specifying a moving equilibrium point. This model is purely kinematics-dependent, since the descending commands needed to modulate the visco-elasticity of muscles are implicitly given by simple parametric specifications of the velocity command alone. The simulated movements of fast elbow single-joint movements corresponded well with measured data performed over a wide range of movement distances, in terms of both muscle excitations and kinematics. Our proposal on a synthesis for the equilibrium point approach and velocity command, may offer some insights into the control scheme of the single-joint arm movements.

  9. Temporal and SUMO-specific SUMOylation contribute to the dynamics of Polo-like kinase 1 (PLK1) and spindle integrity during mouse oocyte meiosis.

    Science.gov (United States)

    Feitosa, Weber Beringui; Hwang, KeumSil; Morris, Patricia L

    2018-02-15

    During mammalian meiosis, Polo-like kinase 1 (PLK1) is essential during cell cycle progression. In oocyte maturation, PLK1 expression is well characterized but timing of posttranslational modifications regulating its activity and subcellular localization are less clear. Small ubiquitin-related modifier (SUMO) posttranslational modifier proteins have been detected in mammalian gametes but their precise function during gametogenesis is largely unknown. In the present paper we report for mouse oocytes that both PLK1 and phosphorylated PLK1 undergo SUMOylation in meiosis II (MII) oocytes using immunocytochemistry, immunoprecipitation and in vitro SUMOylation assays. At MII, PLK1 is phosphorylated at threonine-210 and serine-137. MII oocyte PLK1 and phosphorylated PLK1 undergo SUMOylation by SUMO-1, -2 and -3 as shown by individual in vitro assays. Using these assays, forms of phosphorylated PLK1 normalized to PLK1 increased significantly and correlated with SUMOylated PLK1 levels. During meiotic progression and maturation, SUMO-1-SUMOylation of PLK1 is involved in spindle formation whereas SUMO-2/3-SUMOylation may regulate PLK1 activity at kinetochore-spindle attachment sites. Microtubule integrity is required for PLK1 localization with SUMO-1 but not with SUMO-2/3. Inhibition of SUMOylation disrupts proper meiotic bipolar spindle organization and spindle-kinetochore attachment. The data show that both temporal and SUMO-specific-SUMOylation play important roles in orchestrating functional dynamics of PLK1 during mouse oocyte meiosis, including subcellular compartmentalization. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  11. Verifying the Simulation Hypothesis via Infinite Nested Universe Simulacrum Loops

    Science.gov (United States)

    Sharma, Vikrant

    2017-01-01

    The simulation hypothesis proposes that local reality exists as a simulacrum within a hypothetical computer's dimension. More specifically, Bostrom's trilemma proposes that the number of simulations an advanced 'posthuman' civilization could produce makes the proposition very likely. In this paper a hypothetical method to verify the simulation hypothesis is discussed using infinite regression applied to a new type of infinite loop. Assign dimension n to any computer in our present reality, where dimension signifies the hierarchical level in nested simulations our reality exists in. A computer simulating known reality would be dimension (n-1), and likewise a computer simulating an artificial reality, such as a video game, would be dimension (n +1). In this method, among others, four key assumptions are made about the nature of the original computer dimension n. Summations show that regressing such a reality infinitely will create convergence, implying that the verification of whether local reality is a grand simulation is feasible to detect with adequate compute capability. The action of reaching said convergence point halts the simulation of local reality. Sensitivities to the four assumptions and implications are discussed.

  12. Pathogenesis of and unifying hypothesis for idiopathic pouchitis.

    LENUS (Irish Health Repository)

    Coffey, J Calvin

    2012-02-01

    Ileal pouch-anal anastomosis is the procedure of choice in the surgical management of refractory ulcerative colitis. Pouchitis affects up to 60% of patients following ileal pouch-anal anastomosis for ulcerative colitis. It overlaps significantly with ulcerative colitis such that improvements in our understanding of one will impact considerably on the other. The symptoms are distressing and impinge significantly on patients\\' quality of life. Despite 30 years of scientific and clinical investigation, the pathogenesis of pouchitis is unknown; however, recent advances in molecular and cell biology make a synergistic hypothesis possible. This hypothesis links interaction between epithelial metaplasia, changes in luminal bacteria (in particular sulfate-reducing bacteria), and altered mucosal immunity. Specifically, colonic metaplasia supports colonization by sulfate-reducing bacteria that produce hydrogen sulfide. This causes mucosal depletion and subsequent inflammation. Although in most cases antibiotics lead to bacterial clearance and symptom resolution, immunogenetic subpopulations can develop a chronic refractory variant of pouchitis. The aims of this paper are to discuss proposed pathogenic mechanisms and to describe a novel mechanism that combines many hypotheses and explains several aspects of pouchitis. The implications for the management of both pouchitis and ulcerative colitis are discussed.

  13. Pathogenesis of and unifying hypothesis for idiopathic pouchitis.

    LENUS (Irish Health Repository)

    Coffey, J Calvin

    2009-04-01

    Ileal pouch-anal anastomosis is the procedure of choice in the surgical management of refractory ulcerative colitis. Pouchitis affects up to 60% of patients following ileal pouch-anal anastomosis for ulcerative colitis. It overlaps significantly with ulcerative colitis such that improvements in our understanding of one will impact considerably on the other. The symptoms are distressing and impinge significantly on patients\\' quality of life. Despite 30 years of scientific and clinical investigation, the pathogenesis of pouchitis is unknown; however, recent advances in molecular and cell biology make a synergistic hypothesis possible. This hypothesis links interaction between epithelial metaplasia, changes in luminal bacteria (in particular sulfate-reducing bacteria), and altered mucosal immunity. Specifically, colonic metaplasia supports colonization by sulfate-reducing bacteria that produce hydrogen sulfide. This causes mucosal depletion and subsequent inflammation. Although in most cases antibiotics lead to bacterial clearance and symptom resolution, immunogenetic subpopulations can develop a chronic refractory variant of pouchitis. The aims of this paper are to discuss proposed pathogenic mechanisms and to describe a novel mechanism that combines many hypotheses and explains several aspects of pouchitis. The implications for the management of both pouchitis and ulcerative colitis are discussed.

  14. Romanticism and schizophrenia. Second part: The intimacy hypothesis.

    Science.gov (United States)

    López-Ibor, Juan J; López-Ibor, María I

    2014-01-01

    In the first part of this article we have analyzed the evidence supporting the recency hypothesis of schizophrenia and also what we can call the intimate nature of the disease. In this part we highlight the role of certain cultural aspects that have been ignored up to now, aspects that are associated with deep changes in the Weltanschauung and systems of beliefs on human nature brought up by the late Modernism, specifically by Romanticism. The description of the main characteristics of Romanticism, starting with the “discovery of intimacy”, leads to the conclusion that the characteristic alteration of subjectivity and ipseity of the disease appears to be a vulnerability factor when somebody has to face the new challenges raise Romanticism. The consideration of Hölderlin’s literary achievements and the deep psychological drama prevailing in them, makes explicit how the late modern human being finds in Romanticism the source of creativity and personal development but also the threat of his or her own destruction. Finally we link our hypothesis with recent genetic perspectives that consider sets of diseases associated to the same gene or genes (diseasome). In any case the process of associating the traits of Late Modernism and Romanticism with the core features of schizophrenia allows to consider the amalgamation of insanity with society, both at a general level an in what concerns individual patients, paving the way for novel therapeutic strategies.

  15. The Matter-Gravity Entanglement Hypothesis

    Science.gov (United States)

    Kay, Bernard S.

    2018-03-01

    I outline some of my work and results (some dating back to 1998, some more recent) on my matter-gravity entanglement hypothesis, according to which the entropy of a closed quantum gravitational system is equal to the system's matter-gravity entanglement entropy. The main arguments presented are: (1) that this hypothesis is capable of resolving what I call the second-law puzzle, i.e. the puzzle as to how the entropy increase of a closed system can be reconciled with the asssumption of unitary time-evolution; (2) that the black hole information loss puzzle may be regarded as a special case of this second law puzzle and that therefore the same resolution applies to it; (3) that the black hole thermal atmosphere puzzle (which I recall) can be resolved by adopting a radically different-from-usual description of quantum black hole equilibrium states, according to which they are total pure states, entangled between matter and gravity in such a way that the partial states of matter and gravity are each approximately thermal equilibrium states (at the Hawking temperature); (4) that the Susskind-Horowitz-Polchinski string-theoretic understanding of black hole entropy as the logarithm of the degeneracy of a long string (which is the weak string coupling limit of a black hole) cannot be quite correct but should be replaced by a modified understanding according to which it is the entanglement entropy between a long string and its stringy atmosphere, when in a total pure equilibrium state in a suitable box, which (in line with (3)) goes over, at strong-coupling, to a black hole in equilibrium with its thermal atmosphere. The modified understanding in (4) is based on a general result, which I also describe, which concerns the likely state of a quantum system when it is weakly coupled to an energy-bath and the total state is a random pure state with a given energy. This result generalizes Goldstein et al.'s `canonical typicality' result to systems which are not necessarily small.

  16. The Matter-Gravity Entanglement Hypothesis

    Science.gov (United States)

    Kay, Bernard S.

    2018-05-01

    I outline some of my work and results (some dating back to 1998, some more recent) on my matter-gravity entanglement hypothesis, according to which the entropy of a closed quantum gravitational system is equal to the system's matter-gravity entanglement entropy. The main arguments presented are: (1) that this hypothesis is capable of resolving what I call the second-law puzzle, i.e. the puzzle as to how the entropy increase of a closed system can be reconciled with the asssumption of unitary time-evolution; (2) that the black hole information loss puzzle may be regarded as a special case of this second law puzzle and that therefore the same resolution applies to it; (3) that the black hole thermal atmosphere puzzle (which I recall) can be resolved by adopting a radically different-from-usual description of quantum black hole equilibrium states, according to which they are total pure states, entangled between matter and gravity in such a way that the partial states of matter and gravity are each approximately thermal equilibrium states (at the Hawking temperature); (4) that the Susskind-Horowitz-Polchinski string-theoretic understanding of black hole entropy as the logarithm of the degeneracy of a long string (which is the weak string coupling limit of a black hole) cannot be quite correct but should be replaced by a modified understanding according to which it is the entanglement entropy between a long string and its stringy atmosphere, when in a total pure equilibrium state in a suitable box, which (in line with (3)) goes over, at strong-coupling, to a black hole in equilibrium with its thermal atmosphere. The modified understanding in (4) is based on a general result, which I also describe, which concerns the likely state of a quantum system when it is weakly coupled to an energy-bath and the total state is a random pure state with a given energy. This result generalizes Goldstein et al.'s `canonical typicality' result to systems which are not necessarily small.

  17. Hypothesis test for synchronization: twin surrogates revisited.

    Science.gov (United States)

    Romano, M Carmen; Thiel, Marco; Kurths, Jürgen; Mergenthaler, Konstantin; Engbert, Ralf

    2009-03-01

    The method of twin surrogates has been introduced to test for phase synchronization of complex systems in the case of passive experiments. In this paper we derive new analytical expressions for the number of twins depending on the size of the neighborhood, as well as on the length of the trajectory. This allows us to determine the optimal parameters for the generation of twin surrogates. Furthermore, we determine the quality of the twin surrogates with respect to several linear and nonlinear statistics depending on the parameters of the method. In the second part of the paper we perform a hypothesis test for phase synchronization in the case of experimental data from fixational eye movements. These miniature eye movements have been shown to play a central role in neural information processing underlying the perception of static visual scenes. The high number of data sets (21 subjects and 30 trials per person) allows us to compare the generated twin surrogates with the "natural" surrogates that correspond to the different trials. We show that the generated twin surrogates reproduce very well all linear and nonlinear characteristics of the underlying experimental system. The synchronization analysis of fixational eye movements by means of twin surrogates reveals that the synchronization between the left and right eye is significant, indicating that either the centers in the brain stem generating fixational eye movements are closely linked, or, alternatively that there is only one center controlling both eyes.

  18. Marginal contrasts and the Contrastivist Hypothesis

    Directory of Open Access Journals (Sweden)

    Daniel Currie Hall

    2016-12-01

    Full Text Available The Contrastivist Hypothesis (CH; Hall 2007; Dresher 2009 holds that the only features that can be phonologically active in any language are those that serve to distinguish phonemes, which presupposes that phonemic status is categorical. Many researchers, however, demonstrate the existence of gradient relations. For instance, Hall (2009 quantifies these using the information-theoretic measure of entropy (unpredictability of distribution and shows that a pair of sounds may have an entropy between 0 (totally predictable and 1 (totally unpredictable. We argue that the existence of such intermediate degrees of contrastiveness does not make the CH untenable, but rather offers insight into contrastive hierarchies. The existence of a continuum does not preclude categorical distinctions: a categorical line can be drawn between zero entropy (entirely predictable, and thus by the CH phonologically inactive and non-zero entropy (at least partially contrastive, and thus potentially phonologically active. But this does not mean that intermediate degrees of surface contrastiveness are entirely irrelevant to the CH; rather, we argue, they can shed light on how deeply ingrained a phonemic distinction is in the phonological system. As an example, we provide a case study from Pulaar [ATR] harmony, which has previously been claimed to be problematic for the CH.

  19. The Stem Cell Hypothesis of Aging

    Directory of Open Access Journals (Sweden)

    Anna Meiliana

    2010-04-01

    Full Text Available BACKGROUND: There is probably no single way to age. Indeed, so far there is no single accepted explanation or mechanisms of aging (although more than 300 theories have been proposed. There is an overall decline in tissue regenerative potential with age, and the question arises as to whether this is due to the intrinsic aging of stem cells or rather to the impairment of stem cell function in the aged tissue environment. CONTENT: Recent data suggest that we age, in part, because our self-renewing stem cells grow old as a result of heritable intrinsic events, such as DNA damage, as well as extrinsic forces, such as changes in their supporting niches. Mechanisms that suppress the development of cancer, such as senescence and apoptosis, which rely on telomere shortening and the activities of p53 and p16INK4a may also induce an unwanted consequence: a decline in the replicative function of certain stem cells types with advancing age. This decrease regenerative capacity appears to pointing to the stem cell hypothesis of aging. SUMMARY: Recent evidence suggested that we grow old partly because of our stem cells grow old as a result of mechanisms that suppress the development of cancer over a lifetime. We believe that a further, more precise mechanistic understanding of this process will be required before this knowledge can be translated into human anti-aging therapies. KEYWORDS: stem cells, senescence, telomere, DNA damage, epigenetic, aging.

  20. Confabulation: Developing the 'emotion dysregulation' hypothesis.

    Science.gov (United States)

    Turnbull, Oliver H; Salas, Christian E

    2017-02-01

    Confabulations offer unique opportunities for establishing the neurobiological basis of delusional thinking. As regards causal factors, a review of the confabulation literature suggests that neither amnesia nor executive impairment can be the sole (or perhaps even the primary) cause of all delusional beliefs - though they may act in concert with other factors. A key perspective in the modern literature is that many delusions have an emotionally positive or 'wishful' element, that may serve to modulate or manage emotional experience. Some authors have referred to this perspective as the 'emotion dysregulation' hypothesis. In this article we review the theoretical underpinnings of this approach, and develop the idea by suggesting that the positive aspects of confabulatory states may have a role in perpetuating the imbalance between cognitive control and emotion. We draw on existing evidence from fields outside neuropsychology, to argue for three main causal factors: that positive emotions are related to more global or schematic forms of cognitive processing; that positive emotions influence the accuracy of memory recollection; and that positive emotions make people more susceptible to false memories. These findings suggest that the emotions that we want to feel (or do not want to feel) can influence the way we reconstruct past experiences and generate a sense of self - a proposition that bears on a unified theory of delusional belief states. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  1. Evolutionary hypothesis for Chiari type I malformation.

    Science.gov (United States)

    Fernandes, Yvens Barbosa; Ramina, Ricardo; Campos-Herrera, Cynthia Resende; Borges, Guilherme

    2013-10-01

    Chiari I malformation (CM-I) is classically defined as a cerebellar tonsillar herniation (≥5 mm) through the foramen magnum. A decreased posterior fossa volume, mainly due to basioccipital hypoplasia and sometimes platybasia, leads to posterior fossa overcrowding and consequently cerebellar herniation. Regardless of radiological findings, embryological genetic hypothesis or any other postulations, the real cause behind this malformation is yet not well-elucidated and remains largely unknown. The aim of this paper is to approach CM-I under a broader and new perspective, conjoining anthropology, genetics and neurosurgery, with special focus on the substantial changes that have occurred in the posterior cranial base through human evolution. Important evolutionary allometric changes occurred during brain expansion and genetics studies of human evolution demonstrated an unexpected high rate of gene flow interchange and possibly interbreeding during this process. Based upon this review we hypothesize that CM-I may be the result of an evolutionary anthropological imprint, caused by evolving species populations that eventually met each other and mingled in the last 1.7 million years. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Environmental Kuznets Curve Hypothesis. A Survey

    International Nuclear Information System (INIS)

    Dinda, Soumyananda

    2004-01-01

    The Environmental Kuznets Curve (EKC) hypothesis postulates an inverted-U-shaped relationship between different pollutants and per capita income, i.e., environmental pressure increases up to a certain level as income goes up; after that, it decreases. An EKC actually reveals how a technically specified measurement of environmental quality changes as the fortunes of a country change. A sizeable literature on EKC has grown in recent period. The common point of all the studies is the assertion that the environmental quality deteriorates at the early stages of economic development/growth and subsequently improves at the later stages. In other words, environmental pressure increases faster than income at early stages of development and slows down relative to GDP growth at higher income levels. This paper reviews some theoretical developments and empirical studies dealing with EKC phenomenon. Possible explanations for this EKC are seen in (1) the progress of economic development, from clean agrarian economy to polluting industrial economy to clean service economy; (2) tendency of people with higher income having higher preference for environmental quality, etc. Evidence of the existence of the EKC has been questioned from several corners. Only some air quality indicators, especially local pollutants, show the evidence of an EKC. However, an EKC is empirically observed, till there is no agreement in the literature on the income level at which environmental degradation starts declining. This paper provides an overview of the EKC literature, background history, conceptual insights, policy and the conceptual and methodological critique

  3. Identity of Particles and Continuum Hypothesis

    Science.gov (United States)

    Berezin, Alexander A.

    2001-04-01

    Why all electrons are the same? Unlike other objects, particles and atoms (same isotopes) are forbidden to have individuality or personal history (or reveal their hidden variables, even if they do have them). Or at least, what we commonly call physics so far was unable to disprove particle's sameness (Berezin and Nakhmanson, Physics Essays, 1990). Consider two opposing hypotheses: (A) particles are indeed absolutely same, or (B) they do have individuality, but it is beyond our capacity to demonstrate. This dilemma sounds akin to undecidability of Continuum Hypothesis of existence (or not) of intermediate cardinalities between integers and reals (P.Cohen). Both yes and no of it are true. Thus, (alleged) sameness of electrons and atoms may be a physical translation (embodiment) of this fundamental Goedelian undecidability. Experiments unlikely to help: even if we find that all electrons are same within 30 decimal digits, could their masses (or charges) still differ in100-th digit? Within (B) personalized informationally rich (infinitely rich?) digital tails (starting at, say, 100-th decimal) may carry individual record of each particle history. Within (A) parameters (m, q) are indeed exactly same in all digits and their sameness is based on some inherent (meta)physical principle akin to Platonism or Eddington-type numerology.

  4. Environmental Kuznets Curve Hypothesis. A Survey

    Energy Technology Data Exchange (ETDEWEB)

    Dinda, Soumyananda [Economic Research Unit, Indian Statistical Institute, 203, B.T. Road, Kolkata-108 (India)

    2004-08-01

    The Environmental Kuznets Curve (EKC) hypothesis postulates an inverted-U-shaped relationship between different pollutants and per capita income, i.e., environmental pressure increases up to a certain level as income goes up; after that, it decreases. An EKC actually reveals how a technically specified measurement of environmental quality changes as the fortunes of a country change. A sizeable literature on EKC has grown in recent period. The common point of all the studies is the assertion that the environmental quality deteriorates at the early stages of economic development/growth and subsequently improves at the later stages. In other words, environmental pressure increases faster than income at early stages of development and slows down relative to GDP growth at higher income levels. This paper reviews some theoretical developments and empirical studies dealing with EKC phenomenon. Possible explanations for this EKC are seen in (1) the progress of economic development, from clean agrarian economy to polluting industrial economy to clean service economy; (2) tendency of people with higher income having higher preference for environmental quality, etc. Evidence of the existence of the EKC has been questioned from several corners. Only some air quality indicators, especially local pollutants, show the evidence of an EKC. However, an EKC is empirically observed, till there is no agreement in the literature on the income level at which environmental degradation starts declining. This paper provides an overview of the EKC literature, background history, conceptual insights, policy and the conceptual and methodological critique.

  5. Proform-Antecedent Linking in Individuals with Agrammatic Aphasia: A Test of the Intervener Hypothesis.

    Science.gov (United States)

    Engel, Samantha; Shapiro, Lewis P; Love, Tracy

    2018-02-01

    To evaluate processing and comprehension of pronouns and reflexives in individuals with agrammatic (Broca's) aphasia and age-matched control participants. Specifically, we evaluate processing and comprehension patterns in terms of a specific hypothesis -- the Intervener Hypothesis - that posits that the difficulty of individuals with agrammatic (Broca's) aphasia results from similarity-based interference caused by the presence of an intervening NP between two elements of a dependency chain. We used an eye tracking-while-listening paradigm to investigate real-time processing (Experiment 1) and a sentence-picture matching task to investigate final interpretive comprehension (Experiment 2) of sentences containing proforms in complement phrase and subject relative constructions. Individuals with agrammatic aphasia demonstrated a greater proportion of gazes to the correct referent of reflexives relative to pronouns and significantly greater comprehension accuracy of reflexives relative to pronouns. These results provide support for the Intervener Hypothesis, previous support for which comes from studies of Wh- questions and unaccusative verbs, and we argue that this account provides an explanation for the deficits of individuals with agrammatic aphasia across a growing set of sentence constructions. The current study extends this hypothesis beyond filler-gap dependencies to referential dependencies and allows us to refine the hypothesis in terms of the structural constraints that meet the description of the Intervener Hypothesis.

  6. Chi-square test and its application in hypothesis testing

    Directory of Open Access Journals (Sweden)

    Rakesh Rana

    2015-01-01

    Full Text Available In medical research, there are studies which often collect data on categorical variables that can be summarized as a series of counts. These counts are commonly arranged in a tabular format known as a contingency table. The chi-square test statistic can be used to evaluate whether there is an association between the rows and columns in a contingency table. More specifically, this statistic can be used to determine whether there is any difference between the study groups in the proportions of the risk factor of interest. Chi-square test and the logic of hypothesis testing were developed by Karl Pearson. This article describes in detail what is a chi-square test, on which type of data it is used, the assumptions associated with its application, how to manually calculate it and how to make use of an online calculator for calculating the Chi-square statistics and its associated P-value.

  7. Humans have evolved specialized skills of social cognition: the cultural intelligence hypothesis.

    Science.gov (United States)

    Herrmann, Esther; Call, Josep; Hernàndez-Lloreda, Maráa Victoria; Hare, Brian; Tomasello, Michael

    2007-09-07

    Humans have many cognitive skills not possessed by their nearest primate relatives. The cultural intelligence hypothesis argues that this is mainly due to a species-specific set of social-cognitive skills, emerging early in ontogeny, for participating and exchanging knowledge in cultural groups. We tested this hypothesis by giving a comprehensive battery of cognitive tests to large numbers of two of humans' closest primate relatives, chimpanzees and orangutans, as well as to 2.5-year-old human children before literacy and schooling. Supporting the cultural intelligence hypothesis and contradicting the hypothesis that humans simply have more "general intelligence," we found that the children and chimpanzees had very similar cognitive skills for dealing with the physical world but that the children had more sophisticated cognitive skills than either of the ape species for dealing with the social world.

  8. A NONPARAMETRIC HYPOTHESIS TEST VIA THE BOOTSTRAP RESAMPLING

    OpenAIRE

    Temel, Tugrul T.

    2001-01-01

    This paper adapts an already existing nonparametric hypothesis test to the bootstrap framework. The test utilizes the nonparametric kernel regression method to estimate a measure of distance between the models stated under the null hypothesis. The bootstraped version of the test allows to approximate errors involved in the asymptotic hypothesis test. The paper also develops a Mathematica Code for the test algorithm.

  9. Evidence for a Specific Integrative Mechanism for Episodic Memory Mediated by AMPA/kainate Receptors in a Circuit Involving Medial Prefrontal Cortex and Hippocampal CA3 Region.

    Science.gov (United States)

    de Souza Silva, Maria A; Huston, Joseph P; Wang, An-Li; Petri, David; Chao, Owen Yuan-Hsin

    2016-07-01

    We asked whether episodic-like memory requires neural mechanisms independent of those that mediate its component memories for "what," "when," and "where," and if neuronal connectivity between the medial prefrontal cortex (mPFC) and the hippocampus (HPC) CA3 subregion is essential for episodic-like memory. Unilateral lesion of the mPFC was combined with unilateral lesion of the CA3 in the ipsi- or contralateral hemispheres in rats. Episodic-like memory was tested using a task, which assesses the integration of memories for "what, where, and when" concomitantly. Tests for novel object recognition (what), object place (where), and temporal order memory (when) were also applied. Bilateral disconnection of the mPFC-CA3 circuit by N-methyl-d-aspartate (NMDA) lesions disrupted episodic-like memory, but left the component memories for object, place, and temporal order, per se, intact. Furthermore, unilateral NMDA lesion of the CA3 plus injection of (6-cyano-7-nitroquinoxaline-2,3-dione) (CNQX) (AMPA/kainate receptor antagonist), but not AP-5 (NMDA receptor antagonist), into the contralateral mPFC also disrupted episodic-like memory, indicating the mPFC AMPA/kainate receptors as critical for this circuit. These results argue for a selective neural system that specifically subserves episodic memory, as it is not critically involved in the control of its component memories for object, place, and time. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Interleukin-10 is produced by a specific subset of taste receptor cells and critical for maintaining structural integrity of mouse taste buds.

    Science.gov (United States)

    Feng, Pu; Chai, Jinghua; Zhou, Minliang; Simon, Nirvine; Huang, Liquan; Wang, Hong

    2014-02-12

    Although inflammatory responses are a critical component in defense against pathogens, too much inflammation is harmful. Mechanisms have evolved to regulate inflammation, including modulation by the anti-inflammatory cytokine interleukin-10 (IL-10). Previously we have shown that taste buds express various molecules involved in innate immune responses, including the proinflammatory cytokine tumor necrosis factor (TNF). Here, using a reporter mouse strain, we show that taste cells also express the anti-inflammatory cytokine IL-10. Remarkably, IL-10 is produced by only a specific subset of taste cells, which are different from the TNF-producing cells in mouse circumvallate and foliate taste buds: IL-10 expression was found exclusively in the G-protein gustducin-expressing bitter receptor cells, while TNF was found in sweet and umami receptor cells as reported previously. In contrast, IL-10R1, the ligand-binding subunit of the IL-10 receptor, is predominantly expressed by TNF-producing cells, suggesting a novel cellular hierarchy for regulating TNF production and effects in taste buds. In response to inflammatory challenges, taste cells can increase IL-10 expression both in vivo and in vitro. These findings suggest that taste buds use separate populations of taste receptor cells that coincide with sweet/umami and bitter taste reception to modulate local inflammatory responses, a phenomenon that has not been previously reported. Furthermore, IL-10 deficiency in mice leads to significant reductions in the number and size of taste buds, as well as in the number of taste receptor cells per taste bud, suggesting that IL-10 plays critical roles in maintaining structural integrity of the peripheral gustatory system.

  11. Behavioral Variability and Somatic Mosaicism: A Cytogenomic Hypothesis.

    Science.gov (United States)

    Vorsanova, Svetlana G; Zelenova, Maria A; Yurov, Yuri B; Iourov, Ivan Y

    2018-04-01

    Behavioral sciences are inseparably related to genetics. A variety of neurobehavioral phenotypes are suggested to result from genomic variations. However, the contribution of genetic factors to common behavioral disorders (i.e. autism, schizophrenia, intellectual disability) remains to be understood when an attempt to link behavioral variability to a specific genomic change is made. Probably, the least appreciated genetic mechanism of debilitating neurobehavioral disorders is somatic mosaicism or the occurrence of genetically diverse (neuronal) cells in an individual's brain. Somatic mosaicism is assumed to affect directly the brain being associated with specific behavioral patterns. As shown in studies of chromosome abnormalities (syndromes), genetic mosaicism is able to change dynamically the phenotype due to inconsistency of abnormal cell proportions. Here, we hypothesize that brain-specific postzygotic changes of mosaicism levels are able to modulate variability of behavioral phenotypes. More precisely, behavioral phenotype variability in individuals exhibiting somatic mosaicism might correlate with changes in the amount of genetically abnormal cells throughout the lifespan. If proven, the hypothesis can be used as a basis for therapeutic interventions through regulating levels of somatic mosaicism to increase functioning and to improve overall condition of individuals with behavioral problems.

  12. Niche-specific cognitive strategies

    DEFF Research Database (Denmark)

    Hulgard, K.; Ratcliffe, J. M.

    2014-01-01

    Related species with different diets are predicted to rely on different cognitive strategies: those best suited for locating available and appropriate foods. Here we tested two predictions of the niche-specific cognitive strategies hypothesis in bats, which suggests that predatory species should...... the niche-specific cognitive strategies hypothesis and suggest that for gleaning and clutter-resistant aerial hawking bats, learning to associate shape with food interferes with subsequent spatial memory learning....

  13. A simple hypothesis of executive function

    Directory of Open Access Journals (Sweden)

    Bruno eKopp

    2012-06-01

    Full Text Available Executive function is traditionally conceptualized as a set of abilities required to guide behavior toward goals. Here, an integrated theoretical framework for executive function is developed which has its roots in the notion of hierarchical mental models. Further following Duncan (2010a,b, executive function is construed as a hierarchical recursive system of test-operation-test-exit units (Miller, Galanter, and Pribram, 1960. Importantly, it is shown that this framework can be used to model the main regional prefrontal syndromes, which are characterized by apathetic, disinhibited and dysexecutive cognition and behavior, respectively. Implications of these considerations for the neuropsychological assessment of executive function are discussed.

  14. Speculations on the initiation of chromosome replication in Escherichia coli: the dualism hypothesis.

    Science.gov (United States)

    Norris, Vic

    2011-05-01

    The exact nature of the mechanism that triggers initiation of chromosome replication in the best understood of all organisms, Escherichia coli, remains mysterious. Here, I suggest that this mechanism evolved in response to the problems that arise if chromosome replication does not occur. E. coli is now known to be highly structured. This leads me to propose a mechanism for initiation of replication based on the dynamics of large assemblies of molecules and macromolecules termed hyperstructures. In this proposal, hyperstructures and their constituents are put into two classes, non-equilibrium and equilibrium, that spontaneously separate and that are appropriate for life in either good or bad conditions. Maintaining the right ratio(s) of non-equilibrium to equilibrium hyperstructures is therefore a major challenge for cells. I propose that this maintenance entails a major transfer of material from equilibrium to non-equilibrium hyperstructures once per cell and I further propose that this transfer times the cell cycle. More specifically, I speculate that the dialogue between hyperstructures involves the structuring of water and the condensation of cations and that one of the outcomes of ion condensation on ribosomal hyperstructures and decondensation from the origin hyperstructure is the separation of strands at oriC responsible for triggering initiation of replication. The dualism hypothesis that comes out of these speculations may help integrate models for initiation of replication, chromosome segregation and cell division with the 'prebiotic ecology' scenario of the origins of life. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. A Hypothesis Concerning a Potential Involvement of Ceramide in Apoptosis and Acantholysis Induced by Pemphigus Autoantibodies

    Directory of Open Access Journals (Sweden)

    Wendy B. Bollag

    2010-01-01

    Full Text Available Autoimmune diseases affect more than 50 million Americans, resulting in significant healthcare costs. Most autoimmune diseases occur sporadically; however, endemic pemphigus foliaceus (EPF is an autoimmune skin disease localized to specific geographic loci. EPF, and the related diseases pemphigus vulgaris (PV and pemphigus foliaceus (PF, are characterized by skin lesions and autoantibodies to molecules found on epidermal keratinocytes. A variant of EPF in patients from El Bagre, Colombia, South America, has recently been reported to be distinct from previously described loci in Brazil and Tunisia epidemiologically and immunologically. As in PF and EPF, El Bagre EPF patients exhibit autoantibodies towards desmoglein-1, a cell adhesion molecule critical for maintaining epidermal integrity. An association of El Bagre EPF with sun exposure has been detected, and ultraviolet irradiation also exacerbates symptoms in PV, PF and EPF. Our hypothesis is that: (1 the autoantibodies generate pathology through an alteration in ceramide metabolism in targeted keratinocytes, resulting in apoptosis and/or cell death and acantholysis, but only when the cell's ability to metabolize ceramide is exceeded, and (2 apoptosis in response to this altered ceramide metabolism is initiated and/or exacerbated by other agents that increase ceramide levels, such as cytokines, ultraviolet irradiation, and senescence.

  16. A hypothesis concerning a potential involvement of ceramide in apoptosis and acantholysis induced by pemphigus autoantibodies.

    Science.gov (United States)

    Bollag, Wendy B

    2010-01-01

    Autoimmune diseases affect more than 50 million Americans, resulting in significant healthcare costs. Most autoimmune diseases occur sporadically; however, endemic pemphigus foliaceus (EPF) is an autoimmune skin disease localized to specific geographic loci. EPF, and the related diseases pemphigus vulgaris (PV) and pemphigus foliaceus (PF), are characterized by skin lesions and autoantibodies to molecules found on epidermal keratinocytes. A variant of EPF in patients from El Bagre, Colombia, South America, has recently been reported to be distinct from previously described loci in Brazil and Tunisia epidemiologically and immunologically. As in PF and EPF, El Bagre EPF patients exhibit autoantibodies towards desmoglein-1, a cell adhesion molecule critical for maintaining epidermal integrity. An association of El Bagre EPF with sun exposure has been detected, and ultraviolet irradiation also exacerbates symptoms in PV, PF and EPF. Our hypothesis is that: (1) the autoantibodies generate pathology through an alteration in ceramide metabolism in targeted keratinocytes, resulting in apoptosis and/or cell death and acantholysis, but only when the cell's ability to metabolize ceramide is exceeded, and (2) apoptosis in response to this altered ceramide metabolism is initiated and/or exacerbated by other agents that increase ceramide levels, such as cytokines, ultraviolet irradiation, and senescence.

  17. Realizing Relevance: The Influence of Domain-Specific Information on Generation of New Knowledge through Integration in 4- to 8-Year-Old Children

    Science.gov (United States)

    Bauer, Patricia J.; Larkina, Marina

    2017-01-01

    In accumulating knowledge, direct modes of learning are complemented by productive processes, including self-generation based on integration of separate episodes. Effects of the number of potentially relevant episodes on integration were examined in 4- to 8-year-olds (N = 121; racially/ethnically heterogeneous sample, English speakers, from large…

  18. Core Didactic Thematics and Methodology in Business Spanish: Developing Leadership with Integrity as a Priority for Language for the Professions and Specific Purposes

    Science.gov (United States)

    Doyle, Michael S.

    2017-01-01

    Business Spanish typically teaches the vocabulary, content, and context of the functional areas of business, and how to conduct business in a cultural setting. But it should do more than just that. Leadership with integrity should be primed and personalized as a signature and integrative core value that frameworks any ensuing learning of the…

  19. Oscillatory integration windows in neurons

    Science.gov (United States)

    Gupta, Nitin; Singh, Swikriti Saran; Stopfer, Mark

    2016-01-01

    Oscillatory synchrony among neurons occurs in many species and brain areas, and has been proposed to help neural circuits process information. One hypothesis states that oscillatory input creates cyclic integration windows: specific times in each oscillatory cycle when postsynaptic neurons become especially responsive to inputs. With paired local field potential (LFP) and intracellular recordings and controlled stimulus manipulations we directly test this idea in the locust olfactory system. We find that inputs arriving in Kenyon cells (KCs) sum most effectively in a preferred window of the oscillation cycle. With a computational model, we show that the non-uniform structure of noise in the membrane potential helps mediate this process. Further experiments performed in vivo demonstrate that integration windows can form in the absence of inhibition and at a broad range of oscillation frequencies. Our results reveal how a fundamental coincidence-detection mechanism in a neural circuit functions to decode temporally organized spiking. PMID:27976720

  20. Testing the Conditional Convergence Hypothesis for Pakistan

    Directory of Open Access Journals (Sweden)

    Sajjad Ahmad Jan (Corresponding Author

    2011-09-01

    Full Text Available This study investigates for the existence or non-existence of conditional convergence across the provinces of Pakistan. The annual output data from 1973 to 2000 is pooled for the four Pakistani provinces. The cross-sectional specific effects, the time specific effects, the manufacturing output, and the structural variable for aggregate supply or production shocks are used to control the different steady state levels of per capita incomes of thedifferent provinces. The equation for conditional convergence is estimated through generalized least squares (GLS method, after controlling for the different steady states of the provinces. The result shows that the provinces of Pakistan converge to their own respective steady states with a convergence speed of 11% per annum. At the same time manufacturing output is also statistically significant and positively affects the economic growth in the provinces. However the structural variable is not statistically significant.

  1. Testing the activitystat hypothesis: a randomised controlled trial protocol.

    Science.gov (United States)

    Gomersall, Sjaan; Maher, Carol; Norton, Kevin; Dollman, Jim; Tomkinson, Grant; Esterman, Adrian; English, Coralie; Lewis, Nicole; Olds, Tim

    2012-10-08

    has been specifically designed to test the activitystat hypothesis while taking into account the key conceptual and methodological considerations of testing a biologically regulated homeostatic feedback loop. Results of this study will be an important addition to the growing literature and debate concerning the possible existence of an activitystat. Australian New Zealand Clinical Trials Registry ACTRN12610000248066.

  2. Seeing via miniature eye movements: A dynamic hypothesis for vision

    Directory of Open Access Journals (Sweden)

    Ehud eAhissar

    2012-11-01

    Full Text Available During natural viewing, the eyes are never still. Even during fixation, miniature movements of the eyes move the retinal image across tens of foveal photoreceptors. Most theories of vision implicitly assume that the visual system ignores these movements and somehow overcomes the resulting smearing. However, evidence has accumulated to indicate that fixational eye movements cannot be ignored by the visual system if fine spatial details are to be resolved. We argue that the only way the visual system can achieve its high resolution given its fixational movements is by seeing via these movements. Seeing via eye movements also eliminates the instability of the image, which would be induced by them otherwise. Here we present a hypothesis for vision, in which coarse details are spatially-encoded in gaze-related coordinates, and fine spatial details are temporally-encoded in relative retinal coordinates. The temporal encoding presented here achieves its highest resolution by encoding along the elongated axes of simple cell receptive fields and not across these axes as suggested by spatial models of vision. According to our hypothesis, fine details of shape are encoded by inter-receptor temporal phases, texture by instantaneous intra-burst rates of individual receptors, and motion by inter-burst temporal frequencies. We further describe the ability of the visual system to readout the encoded information and recode it internally. We show how reading out of retinal signals can be facilitated by neuronal phase-locked loops (NPLLs, which lock to the retinal jitter; this locking enables recoding of motion information and temporal framing of shape and texture processing. A possible implementation of this locking-and-recoding process by specific thalamocortical loops is suggested. Overall it is suggested that high-acuity vision is based primarily on temporal mechanisms of the sort presented here and low-acuity vision is based primarily on spatial mechanisms.

  3. The Psychoanalytic Concept of Jouissance and the Kindling Hypothesis.

    Science.gov (United States)

    Dimitriadis, Yorgos

    2017-01-01

    This article aims to define the conceptual field of jouissance in Lacanian theory, and put forth the hypothesis of a relationship between certain neurophysiological mechanisms and specific clinical phenomena where jouissance is "kindled" and outside the control of the symbolic process. First, the author briefly introduces Lacan's notion of jouissance and the way it draws on Freud's theorization, and describes the preliminary stages of this conceptual field in Lacan's work. Then, the jouissance related to two other concepts: repetition, with its Freudian and Lacanian nuances, as well as the-exclusively-Lacanian concept of the object petit a . Lacan's later conceptualization of language as jouissance (the notion of lalangue ) is then discussed in relation to Freud's early ideas ("Letter 52") on the different kinds of inscriptions that help form the mental apparatus. Finally, the author tries to formulate a hypothesis regarding specific neurophysiological mechanisms, based on clinical situations where jouissance becomes "kindled" and escapes the control of the symbolic processes through the neurophysiological mechanisms of conditioning, "kindling-sensitization" and "excitotoxicity." In these cases, jouissance can have a destructive effect on the body and can affect, among others organs, the brain-a process the author has previously described heuristically as the "psychosomatic diseases of the brain." This would be a special mechanism of automatism that would be triggered under the specific conditions of the fragility of the signifying chain (foreclosure of the Name-of-the-Father or solidification of the signifying chain) in combination with biological factors, including genetic factors. In this process, signifiers are reduced to signals, which in turn may be reduced to stimuli, with a tendency toward self-perpetuation, while affects are reduced to emotions and moods. Thus, conditioning and kindling-sensitization could also be understood in terms of a "semiotic

  4. The Psychoanalytic Concept of Jouissance and the Kindling Hypothesis

    Directory of Open Access Journals (Sweden)

    Yorgos Dimitriadis

    2017-09-01

    Full Text Available This article aims to define the conceptual field of jouissance in Lacanian theory, and put forth the hypothesis of a relationship between certain neurophysiological mechanisms and specific clinical phenomena where jouissance is “kindled” and outside the control of the symbolic process. First, the author briefly introduces Lacan's notion of jouissance and the way it draws on Freud's theorization, and describes the preliminary stages of this conceptual field in Lacan's work. Then, the jouissance related to two other concepts: repetition, with its Freudian and Lacanian nuances, as well as the—exclusively—Lacanian concept of the object petit a. Lacan's later conceptualization of language as jouissance (the notion of lalangue is then discussed in relation to Freud's early ideas (“Letter 52” on the different kinds of inscriptions that help form the mental apparatus. Finally, the author tries to formulate a hypothesis regarding specific neurophysiological mechanisms, based on clinical situations where jouissance becomes “kindled” and escapes the control of the symbolic processes through the neurophysiological mechanisms of conditioning, “kindling-sensitization” and “excitotoxicity.” In these cases, jouissance can have a destructive effect on the body and can affect, among others organs, the brain—a process the author has previously described heuristically as the “psychosomatic diseases of the brain.” This would be a special mechanism of automatism that would be triggered under the specific conditions of the fragility of the signifying chain (foreclosure of the Name-of-the-Father or solidification of the signifying chain in combination with biological factors, including genetic factors. In this process, signifiers are reduced to signals, which in turn may be reduced to stimuli, with a tendency toward self-perpetuation, while affects are reduced to emotions and moods. Thus, conditioning and kindling-sensitization could also

  5. Convergent evolution of germ granule nucleators: A hypothesis.

    Science.gov (United States)

    Kulkarni, Arpita; Extavour, Cassandra G

    2017-10-01

    Germ cells have been considered "the ultimate stem cell" because they alone, during normal development of sexually reproducing organisms, are able to give rise to all organismal cell types. Morphological descriptions of a specialized cytoplasm termed 'germ plasm' and associated electron dense ribonucleoprotein (RNP) structures called 'germ granules' within germ cells date back as early as the 1800s. Both germ plasm and germ granules are implicated in germ line specification across metazoans. However, at a molecular level, little is currently understood about the molecular mechanisms that assemble these entities in germ cells. The discovery that in some animals, the gene products of a small number of lineage-specific genes initiate the assembly (also termed nucleation) of germ granules and/or germ plasm is the first step towards facilitating a better understanding of these complex biological processes. Here, we draw on research spanning over 100years that supports the hypothesis that these nucleator genes may have evolved convergently, allowing them to perform analogous roles across animal lineages. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Biodiversity, productivity, and the spatial insurance hypothesis revisited

    Science.gov (United States)

    Shanafelt, David W.; Dieckmann, Ulf; Jonas, Matthias; Franklin, Oskar; Loreau, Michel; Perrings, Charles

    2015-01-01

    Accelerating rates of biodiversity loss have led ecologists to explore the effects of species richness on ecosystem functioning and the flow of ecosystem services. One explanation of the relationship between biodiversity and ecosystem functioning lies in the spatial insurance hypothesis, which centers on the idea that productivity and stability increase with biodiversity in a temporally varying, spatially heterogeneous environment. However, there has been little work on the impact of dispersal where environmental risks are more or less spatially correlated, or where dispersal rates are variable. In this paper, we extend the original Loreau model to consider stochastic temporal variation in resource availability, which we refer to as “environmental risk,” and heterogeneity in species dispersal rates. We find that asynchronies across communities and species provide community-level stabilizing effects on productivity, despite varying levels of species richness. Although intermediate dispersal rates play a role in mitigating risk, they are less effective in insuring productivity against global (metacommunity-level) than local (individual community-level) risks. These results are particularly interesting given the emergence of global sources of risk such as climate change or the closer integration of world markets. Our results offer deeper insights into the Loreau model and new perspectives on the effectiveness of spatial insurance in the face of environmental risks. PMID:26100182

  7. New Targets for Schizophrenia Treatment beyond the Dopamine Hypothesis

    Directory of Open Access Journals (Sweden)

    Albert C. Yang

    2017-08-01

    Full Text Available Schizophrenia has been primarily associated with dopamine dysfunction, and treatments have been developed that target the dopamine pathway in the central nervous system. However, accumulating evidence has shown that the core pathophysiology of schizophrenia might involve dysfunction in dopaminergic, glutamatergic, serotonergic, and gamma-aminobutyric acid (GABA signaling, which may lead to aberrant functioning of interneurons that manifest as cognitive, behavioral, and social dysfunction through altered functioning of a broad range of macro- and microcircuits. The interactions between neurotransmitters can be modeled as nodes and edges by using graph theory, and oxidative balance, immune, and glutamatergic systems may represent multiple nodes interlocking at a central hub; imbalance within any of these nodes might affect the entire system. Therefore, this review attempts to address novel treatment targets beyond the dopamine hypothesis, including glutamate, serotonin, acetylcholine, GABA, and inflammatory cytokines. Furthermore, we outline that these treatment targets can be possibly integrated with novel treatment strategies aimed at different symptoms or phases of the illness. We anticipate that reversing anomalous activity in these novel treatment targets or combinations between these strategies might be beneficial in the treatment of schizophrenia.

  8. Hypothesis testing in the Maimai Catchments, Westland

    International Nuclear Information System (INIS)

    Stewart, M.K.

    1993-01-01

    Seven experiments were carried out on the Maimai Catchments, Westland, to test assumptions about the nature of unsaturated zone waters flows in this humid environment. Hypotheses tested were: 1) that the deuterium (D) content of base flow water sources in small streams are constant at any given time, 2) that different soil moisture sampling methods give the same D contents, 3) that throughfall has the same D content as rainfall, 4) that saturation overland flow is mainly composed of current event rainfall, 5) that macropores are not connected into pipe networks, 6) that the underlying substrate (Old Man Gravel conglomerate) does not deliver water to the stream during rainfall events, and 7) that different near-stream water sources have the same D contents at a given time. Over 570 samples were collected of which 300 were analysed for deuterium in 1992-1993. This report gives the background, rationale, methods and brief results of the experiments. The results will be integrated with other measurements and written up in one or more papers for journal publication. (author). 18 refs.; 4 figs.; 1 tab

  9. A dynamical systems hypothesis of schizophrenia.

    Directory of Open Access Journals (Sweden)

    Marco Loh

    2007-11-01

    Full Text Available We propose a top-down approach to the symptoms of schizophrenia based on a statistical dynamical framework. We show that a reduced depth in the basins of attraction of cortical attractor states destabilizes the activity at the network level due to the constant statistical fluctuations caused by the stochastic spiking of neurons. In integrate-and-fire network simulations, a decrease in the NMDA receptor conductances, which reduces the depth of the attractor basins, decreases the stability of short-term memory states and increases distractibility. The cognitive symptoms of schizophrenia such as distractibility, working memory deficits, or poor attention could be caused by this instability of attractor states in prefrontal cortical networks. Lower firing rates are also produced, and in the orbitofrontal and anterior cingulate cortex could account for the negative symptoms, including a reduction of emotions. Decreasing the GABA as well as the NMDA conductances produces not only switches between the attractor states, but also jumps from spontaneous activity into one of the attractors. We relate this to the positive symptoms of schizophrenia, including delusions, paranoia, and hallucinations, which may arise because the basins of attraction are shallow and there is instability in temporal lobe semantic memory networks, leading thoughts to move too freely round the attractor energy landscape.

  10. Enhancing Concept Comprehension in a Web-Based Course Using a Framework Integrating the Learning Cycle with Variation Theory

    Science.gov (United States)

    Hsu, Chih-Chao; Wang, Tzone-I

    2014-01-01

    Concept comprehension is an important foundation for more complex thoughts. To enhance concept comprehension, teachers of traditional classrooms have been using instructional strategies and specific course designs, which have been proven effective. It initiates a hypothesis that integrating instructional strategies in the course designs of an…

  11. Nedley Depression Hit Hypothesis: Identifying Depression and Its Causes.

    Science.gov (United States)

    Nedley, Neil; Ramirez, Francisco E

    2016-11-01

    Depression is often diagnosed using the Diagnostic and Statistical Manual of Mental Disorders Fifth Edition (DSM-5) criteria. We propose how certain lifestyle choices and non-modifiable factors can predict the development of depression. We identified 10 cause categories (hits or "blows" to the brain) and theorize that four or more active hits could trigger a depression episode. Methods. A sample of 4271 participants from our community-based program (70% female; ages 17-94 years) was assessed at baseline and at the eighth week of the program using a custom test. Ten cause categories were examined as predictors of depression are (1) Genetic, (2)Developmental, (3)Lifestyle, (4)Circadian Rhythm, (5)Addiction, (6)Nutrition, (7)Toxic, (8)Social/Complicated Grief, (9)Medical Condition, and (10)Frontal Lobe. Results. The relationship between the DSM-5 score and a person having four hits categories in the first program week showed a sensitivity of 89.98 % (95% CI: 89.20 % - 90.73%), specificity 48.84% (CI 45.94-51.75) and Matthew Correlation Coefficient (MCC) .41 . For the eight-week test, the results showed a sensitivity 83.6% (CI 81.9-85.5), specificity 53.7% (CI 51.7-55.6) and MCC .38. Overall, the hits that improved the most from baseline after the eighth week were: Nutrition (47%), Frontal lobe (36%), Addiction (24%), Circadian rhythm (24%), Lifestyle (20%), Social (12%) and Medical (10%). Conclusions. The Nedley four-hit hypothesis seems to predict a depressive episode and correlates well with the DSM-5 criteria with good sensitivity and MCC but less specificity. Identifying these factors and applying lifestyle therapies could play an important role in the treatment of depressed individuals.

  12. Integral equations

    CERN Document Server

    Moiseiwitsch, B L

    2005-01-01

    Two distinct but related approaches hold the solutions to many mathematical problems--the forms of expression known as differential and integral equations. The method employed by the integral equation approach specifically includes the boundary conditions, which confers a valuable advantage. In addition, the integral equation approach leads naturally to the solution of the problem--under suitable conditions--in the form of an infinite series.Geared toward upper-level undergraduate students, this text focuses chiefly upon linear integral equations. It begins with a straightforward account, acco

  13. Fractal Markets Hypothesis and the Global Financial Crisis: Wavelet Power Evidence

    Science.gov (United States)

    Kristoufek, Ladislav

    2013-10-01

    We analyze whether the prediction of the fractal markets hypothesis about a dominance of specific investment horizons during turbulent times holds. To do so, we utilize the continuous wavelet transform analysis and obtained wavelet power spectra which give the crucial information about the variance distribution across scales and its evolution in time. We show that the most turbulent times of the Global Financial Crisis can be very well characterized by the dominance of short investment horizons which is in hand with the assertions of the fractal markets hypothesis.

  14. Near death experiences: a multidisciplinary hypothesis.

    Science.gov (United States)

    Bókkon, István; Mallick, Birendra N; Tuszynski, Jack A

    2013-01-01

    Recently, we proposed a novel biophysical concept regarding on the appearance of brilliant lights during near death experiences (NDEs) (Bókkon and Salari, 2012). Specifically, perceiving brilliant light in NDEs has been proposed to arise due to the reperfusion that produces unregulated overproduction of free radicals and energetically excited molecules that can generate a transient enhancement of bioluminescent biophotons in different areas of the brain, including retinotopic visual areas. If this excess of bioluminescent photon emission exceeds a threshold in retinotopic visual areas, this can appear as (phosphene) lights because the brain interprets these intrinsic retinotopic bioluminescent photons as if they originated from the external physical world. Here, we review relevant literature that reported experimental studies (Imaizumi et al., 1984; Suzuki et al., 1985) that essentially support our previously published conception, i.e., that seeing lights in NDEs may be due to the transient enhancement of bioluminescent biophotons. Next, we briefly describe our biophysical visual representation model that may explain brilliant lights experienced during NDEs (by phosphenes as biophotons) and REM sleep associated dream-like intrinsic visual imageries through biophotons in NDEs. Finally, we link our biophysical visual representation notion to self-consciousness that may involve extremely low-energy quantum entanglements. This article is intended to introduce novel concepts for discussion and does not pretend to give the ultimate explanation for the currently unanswerable questions about matter, life and soul; their creation and their interrelationship.

  15. Men’s Perception of Raped Women: Test of the Sexually Transmitted Disease Hypothesis and the Cuckoldry Hypothesis

    Directory of Open Access Journals (Sweden)

    Prokop Pavol

    2016-06-01

    Full Text Available Rape is a recurrent adaptive problem of female humans and females of a number of non-human animals. Rape has various physiological and reproductive costs to the victim. The costs of rape are furthermore exaggerated by social rejection and blaming of a victim, particularly by men. The negative perception of raped women by men has received little attention from an evolutionary perspective. Across two independent studies, we investigated whether the risk of sexually transmitted diseases (the STD hypothesis, Hypothesis 1 or paternity uncertainty (the cuckoldry hypothesis, Hypothesis 2 influence the negative perception of raped women by men. Raped women received lower attractiveness score than non-raped women, especially in long-term mate attractiveness score. The perceived attractiveness of raped women was not influenced by the presence of experimentally manipulated STD cues on faces of putative rapists. Women raped by three men received lower attractiveness score than women raped by one man. These results provide stronger support for the cuckoldry hypothesis (Hypothesis 2 than for the STD hypothesis (Hypothesis 1. Single men perceived raped women as more attractive than men in a committed relationship (Hypothesis 3, suggesting that the mating opportunities mediate men’s perception of victims of rape. Overall, our results suggest that the risk of cuckoldry underlie the negative perception of victims of rape by men rather than the fear of disease transmission.

  16. Concept-guided development of classroom use of ICT : Concept-specific types of ICT use and their integration into teachers’ practices

    NARCIS (Netherlands)

    de Koster, S.

    2017-01-01

    Does a concept-guided approach in schools with either a ‘traditional’ or an ‘innovative’ educational concept contribute to the development of ICT use that becomes integrated in the teachers’ classroom practices? In order to answer this question we performed four, mainly qualitative, studies in five

  17. Revisiting the continuum hypothesis: toward an in-depth exploration of executive functions in korsakoff syndrome.

    Science.gov (United States)

    Brion, Mélanie; Pitel, Anne-Lise; Beaunieux, Hélène; Maurage, Pierre

    2014-01-01

    Korsakoff syndrome (KS) is a neurological state mostly caused by alcohol-dependence and leading to disproportionate episodic memory deficits. KS patients present more severe anterograde amnesia than Alcohol-Dependent Subjects (ADS), which led to the continuum hypothesis postulating a progressive increase in brain and cognitive damages during the evolution from ADS to KS. This hypothesis has been extensively examined for memory but is still debated for other abilities, notably executive functions (EF). EF have up to now been explored by unspecific tasks in KS, and few studies explored their interactions with memory. Exploring EF in KS by specific tasks based on current EF models could thus renew the exploration of the continuum hypothesis. This paper will propose a research program aiming at: (1) clarifying the extent of executive dysfunctions in KS by tasks focusing on specific EF subcomponents; (2) determining the differential EF deficits in ADS and KS; (3) exploring EF-memory interactions in KS with innovative tasks. At the fundamental level, this exploration will test the continuum hypothesis beyond memory. At the clinical level, it will propose new rehabilitation tools focusing on the EF specifically impaired in KS.

  18. Revisiting the continuum hypothesis: towards an in-depth exploration of executive functions in Korsakoff syndrome.

    Directory of Open Access Journals (Sweden)

    Mélanie eBrion

    2014-07-01

    Full Text Available Korsakoff syndrome (KS is a neurological state mostly caused by alcohol-dependence and leading to disproportionate episodic memory deficits. KS patients present more severe anterograde amnesia than alcohol-dependent subjects (ADS, which led to the continuum hypothesis postulating a progressive increase in brain and cognitive damages during the evolution from ADS to KS. This hypothesis has been extensively examined for memory but is still debated for other abilities, notably executive functions (EF. EF have up to now been explored by unspecific tasks in KS, and few studies explored their interactions with memory. Exploring EF in KS by specific tasks based on current EF models could thus renew the exploration of the continuum hypothesis. This paper will propose a research program aiming at: (1 clarifying the extent of executive dysfunctions in KS by tasks focusing on specific EF subcomponents; (2 determining the differential EF deficits in ADS and KS; (3 exploring EF-memory interactions in KS with innovative tasks. At the fundamental level, this exploration will test the continuum hypothesis beyond memory. At the clinical level, it will propose new rehabilitation tools focusing on the EF specifically impaired in KS.

  19. New Hypothesis for SOFC Ceramic Oxygen Electrode Mechanisms

    DEFF Research Database (Denmark)

    Mogensen, Mogens Bjerg; Chatzichristodoulou, Christodoulos; Graves, Christopher R.

    2016-01-01

    A new hypothesis for the electrochemical reaction mechanism in solid oxide cell ceramic oxygen electrodes is proposed based on literature including our own results. The hypothesis postulates that the observed thin layers of SrO-La2O3 on top of ceramic perovskite and other Ruddlesden-Popper...

  20. Assess the Critical Period Hypothesis in Second Language Acquisition

    Science.gov (United States)

    Du, Lihong

    2010-01-01

    The Critical Period Hypothesis aims to investigate the reason for significant difference between first language acquisition and second language acquisition. Over the past few decades, researchers carried out a series of studies to test the validity of the hypothesis. Although there were certain limitations in these studies, most of their results…

  1. Dynamical agents' strategies and the fractal market hypothesis

    Czech Academy of Sciences Publication Activity Database

    Vácha, Lukáš; Vošvrda, Miloslav

    2005-01-01

    Roč. 14, č. 2 (2005), s. 172-179 ISSN 1210-0455 Grant - others:GA UK(CZ) 454/2004/A EK/FSV Institutional research plan: CEZ:AV0Z10750506 Keywords : efficient market hypothesis * fractal market hypothesis * agent's investment horizons Subject RIV: AH - Economics

  2. An Exercise for Illustrating the Logic of Hypothesis Testing

    Science.gov (United States)

    Lawton, Leigh

    2009-01-01

    Hypothesis testing is one of the more difficult concepts for students to master in a basic, undergraduate statistics course. Students often are puzzled as to why statisticians simply don't calculate the probability that a hypothesis is true. This article presents an exercise that forces students to lay out on their own a procedure for testing a…

  3. A default Bayesian hypothesis test for ANOVA designs

    NARCIS (Netherlands)

    Wetzels, R.; Grasman, R.P.P.P.; Wagenmakers, E.J.

    2012-01-01

    This article presents a Bayesian hypothesis test for analysis of variance (ANOVA) designs. The test is an application of standard Bayesian methods for variable selection in regression models. We illustrate the effect of various g-priors on the ANOVA hypothesis test. The Bayesian test for ANOVA

  4. Adaptation hypothesis of biological efficiency of ionizing radiation

    International Nuclear Information System (INIS)

    Kudritskij, Yu.K.; Georgievskij, A.B.; Karpov, V.I.

    1992-01-01

    Adaptation hypothesis of biological efficiency of ionizing radiation is based on acknowledgement of invariance of fundamental laws and principles of biology related to unity of biota and media, evolution and adaptation for radiobiology. The basic arguments for adaptation hypothesis validity, its correspondence to the requirements imposed on scientific hypothes are presented

  5. New methods of testing nonlinear hypothesis using iterative NLLS estimator

    Science.gov (United States)

    Mahaboob, B.; Venkateswarlu, B.; Mokeshrayalu, G.; Balasiddamuni, P.

    2017-11-01

    This research paper discusses the method of testing nonlinear hypothesis using iterative Nonlinear Least Squares (NLLS) estimator. Takeshi Amemiya [1] explained this method. However in the present research paper, a modified Wald test statistic due to Engle, Robert [6] is proposed to test the nonlinear hypothesis using iterative NLLS estimator. An alternative method for testing nonlinear hypothesis using iterative NLLS estimator based on nonlinear hypothesis using iterative NLLS estimator based on nonlinear studentized residuals has been proposed. In this research article an innovative method of testing nonlinear hypothesis using iterative restricted NLLS estimator is derived. Pesaran and Deaton [10] explained the methods of testing nonlinear hypothesis. This paper uses asymptotic properties of nonlinear least squares estimator proposed by Jenrich [8]. The main purpose of this paper is to provide very innovative methods of testing nonlinear hypothesis using iterative NLLS estimator, iterative NLLS estimator based on nonlinear studentized residuals and iterative restricted NLLS estimator. Eakambaram et al. [12] discussed least absolute deviation estimations versus nonlinear regression model with heteroscedastic errors and also they studied the problem of heteroscedasticity with reference to nonlinear regression models with suitable illustration. William Grene [13] examined the interaction effect in nonlinear models disused by Ai and Norton [14] and suggested ways to examine the effects that do not involve statistical testing. Peter [15] provided guidelines for identifying composite hypothesis and addressing the probability of false rejection for multiple hypotheses.

  6. The Younger Dryas impact hypothesis: A critical review

    NARCIS (Netherlands)

    van Hoesel, A.; Hoek, W.Z.; Pennock, G.M.; Drury, Martyn

    2014-01-01

    The Younger Dryas impact hypothesis suggests that multiple extraterrestrial airbursts or impacts resulted in the Younger Dryas cooling, extensive wildfires, megafaunal extinctions and changes in human population. After the hypothesis was first published in 2007, it gained much criticism, as the

  7. Hyperdeterminants as integrable discrete systems

    International Nuclear Information System (INIS)

    Tsarev, Sergey P; Wolf, Thomas

    2009-01-01

    We give the basic definitions and some theoretical results about hyperdeterminants, introduced by A Cayley in 1845. We prove integrability (understood as 4D consistency) of a nonlinear difference equation defined by the 2 x 2 x 2-hyperdeterminant. This result gives rise to the following hypothesis: the difference equations defined by hyperdeterminants of any size are integrable. We show that this hypothesis already fails in the case of the 2 x 2 x 2 x 2-hyperdeterminant.

  8. Hyperdeterminants as integrable discrete systems

    Energy Technology Data Exchange (ETDEWEB)

    Tsarev, Sergey P [Institute of Space and Information Technologies, Siberian Federal University, Svobodnyi Avenue, 79, 660041, Krasnoyarsk (Russian Federation); Wolf, Thomas [Department of Mathematics, Brock University, 500 Glenridge Avenue, St Catharines, Ontario L2S 3A1 (Canada)], E-mail: sptsarev@mail.ru, E-mail: twolf@brocku.ca

    2009-10-30

    We give the basic definitions and some theoretical results about hyperdeterminants, introduced by A Cayley in 1845. We prove integrability (understood as 4D consistency) of a nonlinear difference equation defined by the 2 x 2 x 2-hyperdeterminant. This result gives rise to the following hypothesis: the difference equations defined by hyperdeterminants of any size are integrable. We show that this hypothesis already fails in the case of the 2 x 2 x 2 x 2-hyperdeterminant.

  9. Contradicting the twin deficits hypothesis: The role of tax revenues composition

    Directory of Open Access Journals (Sweden)

    Obadić Alka

    2014-01-01

    Full Text Available The general theory of twin deficits hypothesis does not consider specific characteristics of domestic tax systems, i.e. whether the revenue side of the budget is dominated by indirect or by direct taxes. The main hypothesis of the paper is that in countries with fiscal systems dominated by indirect taxes, the deterioration of the current account balance would imply higher fiscal revenues due to larger imports and consumption. The hypothesis is based on the characteristics of domestic tax systems of Bulgaria, Croatia, Poland and Romania in which indirect tax revenues account for the majority of total budget tax revenues. Results suggest that the co-movements of the current account and the fiscal balance cannot be explained by the twin deficit theory in countries with indirect tax-oriented systems. These results imply that only the structural economic transformation and export orientation of the economy may reverse the causality direction between two deficits.

  10. Statistical inference an integrated Bayesianlikelihood approach

    CERN Document Server

    Aitkin, Murray

    2010-01-01

    Filling a gap in current Bayesian theory, Statistical Inference: An Integrated Bayesian/Likelihood Approach presents a unified Bayesian treatment of parameter inference and model comparisons that can be used with simple diffuse prior specifications. This novel approach provides new solutions to difficult model comparison problems and offers direct Bayesian counterparts of frequentist t-tests and other standard statistical methods for hypothesis testing.After an overview of the competing theories of statistical inference, the book introduces the Bayes/likelihood approach used throughout. It pre

  11. Organization of haemopoietic stem cells: the generation-age hypothesis

    International Nuclear Information System (INIS)

    Rosendaal, M.; Hodgson, G.S.; Bradley, T.R.

    1978-01-01

    This paper proposes that the previous division history of each stem cell is one determinant of the functional organisation of the haemopoietic stem cell population. Older stem cell are used to form blood before younger ones. The stem cells generating capacity of a lineage is finite, and cells are eventually lost to the system by forming two committed precursors of the cell lines, and the next oldest stem cell takes over. Hence the proposed term 'generation-age hypothesis', supported by experimental evidence. Older stem cells from normal bone marrow and 13 day foetal liver were stripped away with phase-specific drugs revealing a younger population of stem cells with three-to four-fold greater stem cell generating capacity. Normal stem cells aged by continuous irradiation and serial retransplantation had eight-fold reduced generating capacity. That of stem cells in the bloodstream was half to a quarter that of normal bone marrow stem cells. There were some circulating stem cells, identified by reaction to brain-associated antigen, positive for 75% of normal femoral stem cells but not their progeny, whose capacity for stem cell generation was an eighth to one fortieth that of normal cells. (U.K.)

  12. An endocannabinoid hypothesis of drug reward and drug addiction.

    Science.gov (United States)

    Onaivi, Emmanuel S

    2008-10-01

    Pharmacologic treatment of drug and alcohol dependency has largely been disappointing, and new therapeutic targets and hypotheses are needed. There is accumulating evidence indicating a central role for the previously unknown but ubiquitous endocannabinoid physiological control system (EPCS) in the regulation of the rewarding effects of abused substances. Thus an endocannabinoid hypothesis of drug reward is postulated. Endocannabinoids mediate retrograde signaling in neuronal tissues and are involved in the regulation of synaptic transmission to suppress neurotransmitter release by the presynaptic cannabinoid receptors (CB-Rs). This powerful modulatory action on synaptic transmission has significant functional implications and interactions with the effects of abused substances. Our data, along with those from other investigators, provide strong new evidence for a role for EPCS modulation in the effects of drugs of abuse, and specifically for involvement of cannabinoid receptors in the neural basis of addiction. Cannabinoids and endocannabinoids appear to be involved in adding to the rewarding effects of addictive substances, including, nicotine, opiates, alcohol, cocaine, and BDZs. The results suggest that the EPCS may be an important natural regulatory mechanism for drug reward and a target for the treatment of addictive disorders.

  13. Early hominins in Europe: The Galerian migration hypothesis

    Science.gov (United States)

    Muttoni, Giovanni; Scardia, Giancarlo; Kent, Dennis V.

    2018-01-01

    Our updated review of sites bearing hominin remains and/or tools from Europe, including new findings from the Balkans, still indicates that the only compelling evidence of main hominin presence in these regions was only since ∼0.9 million years ago (Ma), bracketed by the end of the Jaramillo geomagnetic polarity subchron (0.99 Ma) and the Brunhes-Matuyama polarity chron boundary (0.78 Ma). This time window straddled the late Early Pleistocene climate transition (EPT) at the onset of enhanced glacial/interglacial activity that reverberated worldwide. Europe may have become initially populated during the EPT when, possibly for the first time in the Pleistocene, vast and exploitable ecosystems were generated along the eustatically emergent Po-Danube terrestrial conduit. These newly formed settings, characterized by stable terrestrial lowlands with open grasslands and reduced woody cover especially during glacial/interglacial transitions, are regarded as optimal ecosystems for several large Galerian immigrant mammals such as African and Asian megaherbivores, possibly linked with hominins in a common food web, to expand into en route to Europe. The question of when hominins first arrived in Europe thus places the issue in the context of changes in climate, paleogeography and faunal associations as potential environmental drivers and controlling agents in a specific time frame, a key feature of the Galerian migration hypothesis.

  14. The fetal programming of telomere biology hypothesis: an update.

    Science.gov (United States)

    Entringer, Sonja; de Punder, Karin; Buss, Claudia; Wadhwa, Pathik D

    2018-03-05

    Research on mechanisms underlying fetal programming of health and disease risk has focused primarily on processes that are specific to cell types, organs or phenotypes of interest. However, the observation that developmental conditions concomitantly influence a diverse set of phenotypes, the majority of which are implicated in age-related disorders, raises the possibility that such developmental conditions may additionally exert effects via a common underlying mechanism that involves cellular/molecular ageing-related processes. In this context, we submit that telomere biology represents a process of particular interest in humans because, firstly, this system represents among the most salient antecedent cellular phenotypes for common age-related disorders; secondly, its initial (newborn) setting appears to be particularly important for its long-term effects; and thirdly, its initial setting appears to be plastic and under developmental regulation. We propose that the effects of suboptimal intrauterine conditions on the initial setting of telomere length and telomerase expression/activity capacity may be mediated by the programming actions of stress-related maternal-placental-fetal oxidative, immune, endocrine and metabolic pathways in a manner that may ultimately accelerate cellular dysfunction, ageing and disease susceptibility over the lifespan. This perspectives paper provides an overview of each of the elements underlying this hypothesis, with an emphasis on recent developments, findings and future directions.This article is part of the theme issue 'Understanding diversity in telomere dynamics'. © 2018 The Author(s).

  15. Should the Equilibrium Point Hypothesis (EPH) be Considered a Scientific Theory?

    Science.gov (United States)

    Sainburg, Robert L

    2015-04-01

    The purpose of this commentary is to discuss factors that limit consideration of the equilibrium point hypothesis as a scientific theory. The EPH describes control of motor neuron threshold through the variable lambda, which corresponds to a unique referent configuration for a muscle, joint, or combination of joints. One of the most compelling features of the equilibrium point hypothesis is the integration of posture and movement control into a single mechanism. While the essential core of the hypothesis is based upon spinal circuitry interacting with peripheral mechanics, the proponents have extended the theory to include the higher-level processes that generate lambda, and in doing so, imposed an injunction against the supraspinal nervous system modeling, computing, or predicting dynamics. This limitation contradicts evidence that humans take account of body and environmental dynamics in motor selection, motor control, and motor adaptation processes. A number of unresolved limitations to the EPH have been debated in the literature for many years, including whether muscle resistance to displacement, measured during movement, is adequate to support this form of control, violations in equifinality predictions, spinal circuits that alter the proposed invariant characteristic for muscles, and limitations in the description of how the complexity of spinal circuitry might be integrated to yield a unique and stable equilibrium position for a given motor neuron threshold. In addition, an important empirical limitation of EPH is the measurement of the invariant characteristic, which needs to be done under a constant central state. While there is no question that the EPH is an elegant and generative hypothesis for motor control research, the claim that this hypothesis has reached the status of a scientific theory is premature.

  16. An Efficient Implementation of Track-Oriented Multiple Hypothesis Tracker Using Graphical Model Approaches

    Directory of Open Access Journals (Sweden)

    Jinping Sun

    2017-01-01

    Full Text Available The multiple hypothesis tracker (MHT is currently the preferred method for addressing data association problem in multitarget tracking (MTT application. MHT seeks the most likely global hypothesis by enumerating all possible associations over time, which is equal to calculating maximum a posteriori (MAP estimate over the report data. Despite being a well-studied method, MHT remains challenging mostly because of the computational complexity of data association. In this paper, we describe an efficient method for solving the data association problem using graphical model approaches. The proposed method uses the graph representation to model the global hypothesis formation and subsequently applies an efficient message passing algorithm to obtain the MAP solution. Specifically, the graph representation of data association problem is formulated as a maximum weight independent set problem (MWISP, which translates the best global hypothesis formation into finding the maximum weight independent set on the graph. Then, a max-product belief propagation (MPBP inference algorithm is applied to seek the most likely global hypotheses with the purpose of avoiding a brute force hypothesis enumeration procedure. The simulation results show that the proposed MPBP-MHT method can achieve better tracking performance than other algorithms in challenging tracking situations.

  17. Global Anthropogenic Carbon Dioxide Emission in 2005: Environmental Kuznets Curve Hypothesis and Implications for Policy

    Directory of Open Access Journals (Sweden)

    T. S. Krishnan

    2016-05-01

    Full Text Available Environmental Kuznets Curve (EKC hypothesis provides support for public policies that emphasize economic growth at the expense of environmental degradation. This hypothesis postulates an inverted U-shaped relationship between economic growth and environmental degradation with plausible explanations. We contribute to the discussion on EKC hypothesis by focusing on anthropogenic carbon dioxide (CO2 emission (a greenhouse gas during an extreme year. In the year 2005, concentration of anthropogenic CO2 became higher than the natural range observed over the last 650,000 years. Using econometric modeling of data from 122 countries for the year 2005, we study the key question: Does EKC hypothesis hold for anthropogenic CO2 emission after controlling for energy consumption and environmental governance? We do not find statistical support for EKC hypothesis. But, we find that improvements in environmental governance reduces CO2 emission. This suggests support for environmental policies that specifically promote CO2 emission reduction and does not emphasize economic growth at the expense of environmental degradation.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-2, March-May 2016, Page: 48-60

  18. Geographic variation in chin shape challenges the universal facial attractiveness hypothesis.

    Directory of Open Access Journals (Sweden)

    Zaneta M Thayer

    Full Text Available The universal facial attractiveness (UFA hypothesis proposes that some facial features are universally preferred because they are reliable signals of mate quality. The primary evidence for this hypothesis comes from cross-cultural studies of perceived attractiveness. However, these studies do not directly address patterns of morphological variation at the population level. An unanswered question is therefore: Are universally preferred facial phenotypes geographically invariant, as the UFA hypothesis implies? The purpose of our study is to evaluate this often overlooked aspect of the UFA hypothesis by examining patterns of geographic variation in chin shape. We collected symphyseal outlines from 180 recent human mandibles (90 male, 90 female representing nine geographic regions. Elliptical Fourier functions analysis was used to quantify chin shape, and principle components analysis was used to compute shape descriptors. In contrast to the expectations of the UFA hypothesis, we found significant geographic differences in male and female chin shape. These findings are consistent with region-specific sexual selection and/or random genetic drift, but not universal sexual selection. We recommend that future studies of facial attractiveness take into consideration patterns of morphological variation within and between diverse human populations.

  19. ONC201 kills solid tumor cells by triggering an integrated stress response dependent on ATF4 activation by specific eIF2α kinases

    OpenAIRE

    Kline, C. Leah B.; Van den Heuvel, A. Pieter J.; Allen, Joshua E.; Prabhu, Varun V.; Dicker, David T.; El-Deiry, Wafik S.

    2016-01-01

    ONC201 (also called TIC10) is a small molecule that inactivates the cell proliferation- and cell survival-promoting kinases AKT and ERK and induces cell death through the pro-apoptotic protein TRAIL. ONC201 is currently in early phase clinical testing for various malignancies. Here, we found through gene expression and protein analyses that ONC201 triggered an increase in TRAIL abundance and cell death through an integrated stress response (ISR) involving the transcription factor ATF4, the tr...

  20. Environmental policy without costs? A review of the Porter hypothesis

    Energy Technology Data Exchange (ETDEWEB)

    Braennlund, Runar; Lundgren, Tommy. e-mail: runar.brannlund@econ.umu.se

    2009-03-15

    This paper reviews the theoretical and empirical literature connected to the so called Porter Hypothesis. That is, to review the literature connected to the discussion about the relation between environmental policy and competitiveness. According to the conventional wisdom environmental policy, aiming for improving the environment through for example emission reductions, do imply costs since scarce resources must be diverted from somewhere else. However, this conventional wisdom has been challenged and questioned recently through what has been denoted the 'Porter hypothesis'. Those in the forefront of the Porter hypothesis challenge the conventional wisdom basically on the ground that resources are used inefficiently in the absence of the right kind of environmental regulations, and that the conventional neo-classical view is too static to take inefficiencies into account. The conclusions that can be made from this review is (1) that the theoretical literature can identify the circumstances and mechanisms that must exist for a Porter effect to occur, (2) that these circumstances are rather non-general, hence rejecting the Porter hypothesis in general, (3) that the empirical literature give no general support for the Porter hypothesis. Furthermore, a closer look at the 'Swedish case' reveals no support for the Porter hypothesis in spite of the fact that Swedish environmental policy the last 15-20 years seems to be in line the prerequisites stated by the Porter hypothesis concerning environmental policy

  1. Bayesian inference supports the host selection hypothesis in explaining adaptive host specificity by European bitterling

    Czech Academy of Sciences Publication Activity Database

    Smith, Carl

    2017-01-01

    Roč. 183, č. 2 (2017), s. 379-389 ISSN 0029-8549 R&D Projects: GA ČR GA13-05872S Institutional support: RVO:68081766 Keywords : Brood parasite * Host–parasite co-evolution * Oviposition * Spawning site * Superparasitism Subject RIV: EG - Zoology OBOR OECD: Ecology Impact factor: 3.130, year: 2016

  2. The public goods hypothesis for the evolution of life on Earth

    LENUS (Irish Health Repository)

    McInerney, James O

    2011-08-23

    Abstract It is becoming increasingly difficult to reconcile the observed extent of horizontal gene transfers with the central metaphor of a great tree uniting all evolving entities on the planet. In this manuscript we describe the Public Goods Hypothesis and show that it is appropriate in order to describe biological evolution on the planet. According to this hypothesis, nucleotide sequences (genes, promoters, exons, etc.) are simply seen as goods, passed from organism to organism through both vertical and horizontal transfer. Public goods sequences are defined by having the properties of being largely non-excludable (no organism can be effectively prevented from accessing these sequences) and non-rival (while such a sequence is being used by one organism it is also available for use by another organism). The universal nature of genetic systems ensures that such non-excludable sequences exist and non-excludability explains why we see a myriad of genes in different combinations in sequenced genomes. There are three features of the public goods hypothesis. Firstly, segments of DNA are seen as public goods, available for all organisms to integrate into their genomes. Secondly, we expect the evolution of mechanisms for DNA sharing and of defense mechanisms against DNA intrusion in genomes. Thirdly, we expect that we do not see a global tree-like pattern. Instead, we expect local tree-like patterns to emerge from the combination of a commonage of genes and vertical inheritance of genomes by cell division. Indeed, while genes are theoretically public goods, in reality, some genes are excludable, particularly, though not only, when they have variant genetic codes or behave as coalition or club goods, available for all organisms of a coalition to integrate into their genomes, and non-rival within the club. We view the Tree of Life hypothesis as a regionalized instance of the Public Goods hypothesis, just like classical mechanics and euclidean geometry are seen as

  3. The Public Goods Hypothesis for the evolution of life on Earth.

    Science.gov (United States)

    McInerney, James O; Pisani, Davide; Bapteste, Eric; O'Connell, Mary J

    2011-08-23

    It is becoming increasingly difficult to reconcile the observed extent of horizontal gene transfers with the central metaphor of a great tree uniting all evolving entities on the planet. In this manuscript we describe the Public Goods Hypothesis and show that it is appropriate in order to describe biological evolution on the planet. According to this hypothesis, nucleotide sequences (genes, promoters, exons, etc.) are simply seen as goods, passed from organism to organism through both vertical and horizontal transfer. Public goods sequences are defined by having the properties of being largely non-excludable (no organism can be effectively prevented from accessing these sequences) and non-rival (while such a sequence is being used by one organism it is also available for use by another organism). The universal nature of genetic systems ensures that such non-excludable sequences exist and non-excludability explains why we see a myriad of genes in different combinations in sequenced genomes. There are three features of the public goods hypothesis. Firstly, segments of DNA are seen as public goods, available for all organisms to integrate into their genomes. Secondly, we expect the evolution of mechanisms for DNA sharing and of defense mechanisms against DNA intrusion in genomes. Thirdly, we expect that we do not see a global tree-like pattern. Instead, we expect local tree-like patterns to emerge from the combination of a commonage of genes and vertical inheritance of genomes by cell division. Indeed, while genes are theoretically public goods, in reality, some genes are excludable, particularly, though not only, when they have variant genetic codes or behave as coalition or club goods, available for all organisms of a coalition to integrate into their genomes, and non-rival within the club. We view the Tree of Life hypothesis as a regionalized instance of the Public Goods hypothesis, just like classical mechanics and euclidean geometry are seen as regionalized

  4. The Dopamine Imbalance Hypothesis of Fatigue in Multiple Sclerosis and Other Neurological Disorders.

    Directory of Open Access Journals (Sweden)

    Ekaterina eDobryakova

    2015-03-01

    Full Text Available Fatigue is one of the most pervasive symptoms of multiple sclerosis (MS, and has engendered hundreds of investigations on the topic. While there is a growing literature using various methods to study fatigue, a unified theory of fatigue in MS is yet to emerge. In the current review, we synthesize findings from neuroimaging, pharmacological, neuropsychological and immunological studies of fatigue in MS, which point to a specific hypothesis of fatigue in MS: the dopamine imbalance hypothesis. The communication between the striatum and prefrontal cortex is reliant on dopamine, a modulatory neurotransmitter. Neuroimaging findings suggest that fatigue results from the disruption of communication between these regions. Supporting the dopamine imbalance hypothesis, structural and functional neuroimaging studies show abnormalities in the frontal and striatal regions that are heavily innervated by dopamine neurons. Further, dopaminergic psychostimulant medication has been shown to alleviate fatigue in individuals with traumatic brain injury, chronic fatigue syndrome and in cancer patients, also indicating that dopamine might play an important role in fatigue perception. This paper reviews the structural and functional neuroimaging evidence as well as pharmacological studies that suggest that dopamine plays a critical role in the phenomenon of fatigue. We conclude with how specific aspects of the dopamine imbalance hypothesis can be tested in future research.

  5. Biostatistics series module 2: Overview of hypothesis testing

    Directory of Open Access Journals (Sweden)

    Avijit Hazra

    2016-01-01

    Full Text Available Hypothesis testing (or statistical inference is one of the major applications of biostatistics. Much of medical research begins with a research question that can be framed as a hypothesis. Inferential statistics begins with a null hypothesis that reflects the conservative position of no change or no difference in comparison to baseline or between groups. Usually, the researcher has reason to believe that there is some effect or some difference which is the alternative hypothesis. The researcher therefore proceeds to study samples and measure outcomes in the hope of generating evidence strong enough for the statistician to be able to reject the null hypothesis. The concept of the P value is almost universally used in hypothesis testing. It denotes the probability of obtaining by chance a result at least as extreme as that observed, even when the null hypothesis is true and no real difference exists. Usually, if P is < 0.05 the null hypothesis is rejected and sample results are deemed statistically significant. With the increasing availability of computers and access to specialized statistical software, the drudgery involved in statistical calculations is now a thing of the past, once the learning curve of the software has been traversed. The life sciences researcher is therefore free to devote oneself to optimally designing the study, carefully selecting the hypothesis tests to be applied, and taking care in conducting the study well. Unfortunately, selecting the right test seems difficult initially. Thinking of the research hypothesis as addressing one of five generic research questions helps in selection of the right hypothesis test. In addition, it is important to be clear about the nature of the variables (e.g., numerical vs. categorical; parametric vs. nonparametric and the number of groups or data sets being compared (e.g., two or more than two at a time. The same research question may be explored by more than one type of hypothesis test

  6. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli.

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J M

    2013-05-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism.

  7. Stability of transmembrane amyloid β-peptide and membrane integrity tested by molecular modeling of site-specific Aβ42 mutations.

    Directory of Open Access Journals (Sweden)

    Chetan Poojari

    Full Text Available Interactions of the amyloid β-protein (Aβ with neuronal cell membranes, leading to the disruption of membrane integrity, are considered to play a key role in the development of Alzheimer's disease. Natural mutations in Aβ42, such as the Arctic mutation (E22G have been shown to increase Aβ42 aggregation and neurotoxicity, leading to the early-onset of Alzheimer's disease. A correlation between the propensity of Aβ42 to form protofibrils and its effect on neuronal dysfunction and degeneration has been established. Using rational mutagenesis of the Aβ42 peptide it was further revealed that the aggregation of different Aβ42 mutants in lipid membranes results in a variety of polymorphic aggregates in a mutation dependent manner. The mutant peptides also have a variable ability to disrupt bilayer integrity. To further test the connection between Aβ42 mutation and peptide-membrane interactions, we perform molecular dynamics simulations of membrane-inserted Aβ42 variants (wild-type and E22G, D23G, E22G/D23G, K16M/K28M and K16M/E22G/D23G/K28M mutants as β-sheet monomers and tetramers. The effects of charged residues on transmembrane Aβ42 stability and membrane integrity are analyzed at atomistic level. We observe an increased stability for the E22G Aβ42 peptide and a decreased stability for D23G compared to wild-type Aβ42, while D23G has the largest membrane-disruptive effect. These results support the experimental observation that the altered toxicity arising from mutations in Aβ is not only a result of the altered aggregation propensity, but also originates from modified Aβ interactions with neuronal membranes.

  8. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M.; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J.M.

    2013-01-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism. PMID:23445770

  9. CROSS-COMPLIANCE Facilitating the CAP reform: Compliance and competitiveness of European agriculture : Specific Targeted Research or Innovation Project (STREP) Integrating and Strengthening the European Research Area

    NARCIS (Netherlands)

    Jongeneel, R.A.; Bezlepkina, I.; Winsten, J.; Fox, G.

    2008-01-01

    The prime aim or the project was on assessing the impacts of compliance with standards, more specifically those part of cross-compliance, on EU’s external competitiveness. This is why in several deliverables and also in the main text of this Deliverable 13 a lot of attention is given to the EU and

  10. Life sciences payload definition and integration study. Volume 3: Preliminary equipment item specification catalog for the carry-on laboratories. [for Spacelab

    Science.gov (United States)

    1974-01-01

    All general purpose equipment items contained in the final carry-on laboratory (COL) design concepts are described in terms of specific requirements identified for COL use, hardware status, and technical parameters such as weight, volume, power, range, and precision. Estimated costs for each item are given, along with projected development times.

  11. An integrated specification for the nexus of water pollution and economic growth in China: Panel cointegration, long-run causality and environmental Kuznets curve.

    Science.gov (United States)

    Zhang, Chen; Wang, Yuan; Song, Xiaowei; Kubota, Jumpei; He, Yanmin; Tojo, Junji; Zhu, Xiaodong

    2017-12-31

    This paper concentrates on a Chinese context and makes efforts to develop an integrated process to explicitly elucidate the relationship between economic growth and water pollution discharge-chemical oxygen demand (COD) discharge and ammonia nitrogen (NH 3 -N), using two unbalanced panel data sets covering the period separately from 1990 to 2014, and 2001 to 2014. In our present study, the panel unit root tests, cointegration tests, and Granger causality tests allowing for cross-sectional dependence, nonstationary, and heterogeneity are conducted to examine the causal effects of economic growth on COD/NH 3 -N discharge. Further, we simultaneously apply semi-parametric fixed effects estimation and parametric fixed effects estimation to investigate environmental Kuznets curve relationship for COD/NH 3 -N discharge. Our empirical results show a long-term bidirectional causality between economic growth and COD/NH 3 -N discharge in China. Within the Stochastic Impacts by Regression on Population, Affluence and Technology framework, we find evidence in support of an inverted U-shaped curved link between economic growth and COD/NH 3 -N discharge. To the best of our knowledge, there have not been any efforts made in investigating the nexus of economic growth and water pollution in such an integrated manner. Therefore, this study takes a fresh look on this topic. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Null but not void: considerations for hypothesis testing.

    Science.gov (United States)

    Shaw, Pamela A; Proschan, Michael A

    2013-01-30

    Standard statistical theory teaches us that once the null and alternative hypotheses have been defined for a parameter, the choice of the statistical test is clear. Standard theory does not teach us how to choose the null or alternative hypothesis appropriate to the scientific question of interest. Neither does it tell us that in some cases, depending on which alternatives are realistic, we may want to define our null hypothesis differently. Problems in statistical practice are frequently not as pristinely summarized as the classic theory in our textbooks. In this article, we present examples in statistical hypothesis testing in which seemingly simple choices are in fact rich with nuance that, when given full consideration, make the choice of the right hypothesis test much less straightforward. Published 2012. This article is a US Government work and is in the public domain in the USA.

  13. Alzheimer's disease: the amyloid hypothesis and the Inverse Warburg effect

    KAUST Repository

    Demetrius, Lloyd A.; Magistretti, Pierre J.; Pellerin, Luc

    2015-01-01

    Epidemiological and biochemical studies show that the sporadic forms of Alzheimer's disease (AD) are characterized by the following hallmarks: (a) An exponential increase with age; (b) Selective neuronal vulnerability; (c) Inverse cancer comorbidity. The present article appeals to these hallmarks to evaluate and contrast two competing models of AD: the amyloid hypothesis (a neuron-centric mechanism) and the Inverse Warburg hypothesis (a neuron-astrocytic mechanism). We show that these three hallmarks of AD conflict with the amyloid hypothesis, but are consistent with the Inverse Warburg hypothesis, a bioenergetic model which postulates that AD is the result of a cascade of three events—mitochondrial dysregulation, metabolic reprogramming (the Inverse Warburg effect), and natural selection. We also provide an explanation for the failures of the clinical trials based on amyloid immunization, and we propose a new class of therapeutic strategies consistent with the neuroenergetic selection model.

  14. Cross-system log file analysis for hypothesis testing

    NARCIS (Netherlands)

    Glahn, Christian

    2008-01-01

    Glahn, C. (2008). Cross-system log file analysis for hypothesis testing. Presented at Empowering Learners for Lifelong Competence Development: pedagogical, organisational and technological issues. 4th TENCompetence Open Workshop. April, 10, 2008, Madrid, Spain.

  15. Hypothesis Testing Using the Films of the Three Stooges

    Science.gov (United States)

    Gardner, Robert; Davidson, Robert

    2010-01-01

    The use of The Three Stooges' films as a source of data in an introductory statistics class is described. The Stooges' films are separated into three populations. Using these populations, students may conduct hypothesis tests with data they collect.

  16. Incidence of allergy and atopic disorders and hygiene hypothesis.

    Czech Academy of Sciences Publication Activity Database

    Bencko, V.; Šíma, Petr

    2017-01-01

    Roč. 2, 6 March (2017), č. článku 1244. ISSN 2474-1663 Institutional support: RVO:61388971 Keywords : allergy disorders * atopic disorders * hygiene hypothesis Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology

  17. Alzheimer's disease: the amyloid hypothesis and the Inverse Warburg effect

    KAUST Repository

    Demetrius, Lloyd A.

    2015-01-14

    Epidemiological and biochemical studies show that the sporadic forms of Alzheimer\\'s disease (AD) are characterized by the following hallmarks: (a) An exponential increase with age; (b) Selective neuronal vulnerability; (c) Inverse cancer comorbidity. The present article appeals to these hallmarks to evaluate and contrast two competing models of AD: the amyloid hypothesis (a neuron-centric mechanism) and the Inverse Warburg hypothesis (a neuron-astrocytic mechanism). We show that these three hallmarks of AD conflict with the amyloid hypothesis, but are consistent with the Inverse Warburg hypothesis, a bioenergetic model which postulates that AD is the result of a cascade of three events—mitochondrial dysregulation, metabolic reprogramming (the Inverse Warburg effect), and natural selection. We also provide an explanation for the failures of the clinical trials based on amyloid immunization, and we propose a new class of therapeutic strategies consistent with the neuroenergetic selection model.

  18. The Double-Deficit Hypothesis in Spanish Developmental Dyslexia

    Science.gov (United States)

    Jimenez, Juan E.; Hernandez-Valle, Isabel; Rodriguez, Cristina; Guzman, Remedios; Diaz, Alicia; Ortiz, Rosario

    2008-01-01

    The double-deficit hypothesis (DDH) of developmental dyslexia was investigated in seven to twelve year old Spanish children. It was observed that the double deficit (DD) group had the greatest difficulty with reading.

  19. TWRSview system requirements specification

    International Nuclear Information System (INIS)

    Caldwell, J.A.; Lee, A.K.

    1995-12-01

    This document provides the system requirements specification for the TWRSview software system. The TWRSview software system is being developed to integrate electronic data supporting the development of the TWRS technical baseline

  20. The Random-Walk Hypothesis on the Indian Stock Market

    OpenAIRE

    Ankita Mishra; Vinod Mishra; Russell Smyth

    2014-01-01

    This study tests the random walk hypothesis for the Indian stock market. Using 19 years of monthly data on six indices from the National Stock Exchange (NSE) and the Bombay Stock Exchange (BSE), this study applies three different unit root tests with two structural breaks to analyse the random walk hypothesis. We find that unit root tests that allow for two structural breaks alone are not able to reject the unit root null; however, a recently developed unit root test that simultaneously accou...

  1. The Fractal Market Hypothesis: Applications to Financial Forecasting

    OpenAIRE

    Blackledge, Jonathan

    2010-01-01

    Most financial modelling systems rely on an underlying hypothesis known as the Efficient Market Hypothesis (EMH) including the famous Black-Scholes formula for placing an option. However, the EMH has a fundamental flaw: it is based on the assumption that economic processes are normally distributed and it has long been known that this is not the case. This fundamental assumption leads to a number of shortcomings associated with using the EMH to analyse financial data which includes failure to ...

  2. Dopamine and Reward: The Anhedonia Hypothesis 30 years on

    OpenAIRE

    Wise, Roy A.

    2008-01-01

    The anhedonia hypothesis – that brain dopamine plays a critical role in the subjective pleasure associated with positive rewards – was intended to draw the attention of psychiatrists to the growing evidence that dopamine plays a critical role in the objective reinforcement and incentive motivation associated with food and water, brain stimulation reward, and psychomotor stimulant and opiate reward. The hypothesis called to attention the apparent paradox that neuroleptics, drugs used to treat ...

  3. Testing the null hypothesis: the forgotten legacy of Karl Popper?

    Science.gov (United States)

    Wilkinson, Mick

    2013-01-01

    Testing of the null hypothesis is a fundamental aspect of the scientific method and has its basis in the falsification theory of Karl Popper. Null hypothesis testing makes use of deductive reasoning to ensure that the truth of conclusions is irrefutable. In contrast, attempting to demonstrate the new facts on the basis of testing the experimental or research hypothesis makes use of inductive reasoning and is prone to the problem of the Uniformity of Nature assumption described by David Hume in the eighteenth century. Despite this issue and the well documented solution provided by Popper's falsification theory, the majority of publications are still written such that they suggest the research hypothesis is being tested. This is contrary to accepted scientific convention and possibly highlights a poor understanding of the application of conventional significance-based data analysis approaches. Our work should remain driven by conjecture and attempted falsification such that it is always the null hypothesis that is tested. The write up of our studies should make it clear that we are indeed testing the null hypothesis and conforming to the established and accepted philosophical conventions of the scientific method.

  4. Site-Specific Growth and in Situ Integration of Different Nanowire Material Networks on a Single Chip: Toward a Nanowire-Based Electronic Nose for Gas Detection.

    Science.gov (United States)

    Hrachowina, Lukas; Domènech-Gil, Guillem; Pardo, Antonio; Seifner, Michael S; Gràcia, Isabel; Cané, Carles; Romano-Rodríguez, Albert; Barth, Sven

    2018-03-23

    A new method for the site-selective synthesis of nanowires has been developed to enable material growth with defined morphology and, at the same time, different composition on the same chip surface. The chemical vapor deposition approach for the growth of these nanowire-based resistive devices using micromembranes can be easily modified and represents a simple, adjustable fabrication process for the direct integration of nanowire meshes in multifunctional devices. This proof-of-concept study includes the deposition of SnO 2 , WO 3 , and Ge nanowires on the same chip. The individual resistors exhibit adequate gas sensing responses toward changing gas concentrations of CO, NO 2 , and humidity diluted in synthetic air. The data have been processed by principal component analysis with cluster responses that can be easily separated, and thus, the devices described herein are in principle suitable for environmental monitoring.

  5. The Role of Theory-Specific Techniques and Therapeutic Alliance in Promoting Positive Outcomes: Integrative Psychotherapy for World Trade Center Responders.

    Science.gov (United States)

    Haugen, Peter Tejas; Werth, Aditi Sinha; Foster, Alyce Lauren; Owen, Jesse

    2016-12-01

    World Trade Center responders demonstrate high symptom burden, underscoring the importance of refining treatment approaches for this cohort. One method is examining the impact of therapy techniques on outcomes, and the interactions between technique and alliance on outcomes. This study a) examined the interaction of early treatment techniques on integrative psychotherapy outcomes and b) explored whether associations differed at varying levels of alliance. Twenty-nine adult responders diagnosed with partial or full posttraumatic stress disorder received outpatient psychotherapy and completed weekly measures of alliance, technique, and symptom distress. Analyses indicated significant interactions between 1) alliance and psychodynamic interventions on outcomes and 2) alliance and cognitive behavioral (CB) interventions on outcomes. Clients with high alliance had better outcomes when their therapist used fewer CB techniques. No meaningful differences were found between technique and outcomes for clients with lower alliance. These findings reiterate the critical roles technique and responsiveness to the alliance play in engendering successful outcomes.

  6. The truthful signalling hypothesis: an explicit general equilibrium model.

    Science.gov (United States)

    Hausken, Kjell; Hirshleifer, Jack

    2004-06-21

    In mating competition, the truthful signalling hypothesis (TSH), sometimes known as the handicap principle, asserts that higher-quality males signal while lower-quality males do not (or else emit smaller signals). Also, the signals are "believed", that is, females mate preferentially with higher-signalling males. Our analysis employs specific functional forms to generate analytic solutions and numerical simulations that illuminate the conditions needed to validate the TSH. Analytic innovations include: (1) A Mating Success Function indicates how female mating choices respond to higher and lower signalling levels. (2) A congestion function rules out corner solutions in which females would mate exclusively with higher-quality males. (3) A Malthusian condition determines equilibrium population size as related to per-capita resource availability. Equilibria validating the TSH are achieved over a wide range of parameters, though not universally. For TSH equilibria it is not strictly necessary that the high-quality males have an advantage in terms of lower per-unit signalling costs, but a cost difference in favor of the low-quality males cannot be too great if a TSH equilibrium is to persist. And although the literature has paid less attention to these points, TSH equilibria may also fail if: the quality disparity among males is too great, or the proportion of high-quality males in the population is too large, or if the congestion effect is too weak. Signalling being unprofitable in aggregate, it can take off from a no-signalling equilibrium only if the trait used for signalling is not initially a handicap, but instead is functionally useful at low levels. Selection for this trait sets in motion a bandwagon, whereby the initially useful indicator is pushed by male-male competition into the domain where it does indeed become a handicap.

  7. Cumulative risk hypothesis: Predicting and preventing child maltreatment recidivism.

    Science.gov (United States)

    Solomon, David; Åsberg, Kia; Peer, Samuel; Prince, Gwendolyn

    2016-08-01

    Although Child Protective Services (CPS) and other child welfare agencies aim to prevent further maltreatment in cases of child abuse and neglect, recidivism is common. Having a better understanding of recidivism predictors could aid in preventing additional instances of maltreatment. A previous study identified two CPS interventions that predicted recidivism: psychotherapy for the parent, which was related to a reduced risk of recidivism, and temporary removal of the child from the parent's custody, which was related to an increased recidivism risk. However, counter to expectations, this previous study did not identify any other specific risk factors related to maltreatment recidivism. For the current study, it was hypothesized that (a) cumulative risk (i.e., the total number of risk factors) would significantly predict maltreatment recidivism above and beyond intervention variables in a sample of CPS case files and that (b) therapy for the parent would be related to a reduced likelihood of recidivism. Because it was believed that the relation between temporary removal of a child from the parent's custody and maltreatment recidivism is explained by cumulative risk, the study also hypothesized that that the relation between temporary removal of the child from the parent's custody and recidivism would be mediated by cumulative risk. After performing a hierarchical logistic regression analysis, the first two hypotheses were supported, and an additional predictor, psychotherapy for the child, also was related to reduced chances of recidivism. However, Hypothesis 3 was not supported, as risk did not significantly mediate the relation between temporary removal and recidivism. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Mirror neurons and the social nature of language: the neural exploitation hypothesis.

    Science.gov (United States)

    Gallese, Vittorio

    2008-01-01

    This paper discusses the relevance of the discovery of mirror neurons in monkeys and of the mirror neuron system in humans to a neuroscientific account of primates' social cognition and its evolution. It is proposed that mirror neurons and the functional mechanism they underpin, embodied simulation, can ground within a unitary neurophysiological explanatory framework important aspects of human social cognition. In particular, the main focus is on language, here conceived according to a neurophenomenological perspective, grounding meaning on the social experience of action. A neurophysiological hypothesis--the "neural exploitation hypothesis"--is introduced to explain how key aspects of human social cognition are underpinned by brain mechanisms originally evolved for sensorimotor integration. It is proposed that these mechanisms were later on adapted as new neurofunctional architecture for thought and language, while retaining their original functions as well. By neural exploitation, social cognition and language can be linked to the experiential domain of action.

  9. Asymmetrically dominated choice problems, the isolation hypothesis and random incentive mechanisms.

    Directory of Open Access Journals (Sweden)

    James C Cox

    Full Text Available This paper presents an experimental study of the random incentive mechanisms which are a standard procedure in economic and psychological experiments. Random incentive mechanisms have several advantages but are incentive-compatible only if responses to the single tasks are independent. This is true if either the independence axiom of expected utility theory or the isolation hypothesis of prospect theory holds. We present a simple test of this in the context of choice under risk. In the baseline (one task treatment we observe risk behavior in a given choice problem. We show that by integrating a second, asymmetrically dominated choice problem in a random incentive mechanism risk behavior can be manipulated systematically. This implies that the isolation hypothesis is violated and the random incentive mechanism does not elicit true preferences in our example.

  10. Asymmetrically dominated choice problems, the isolation hypothesis and random incentive mechanisms.

    Science.gov (United States)

    Cox, James C; Sadiraj, Vjollca; Schmidt, Ulrich

    2014-01-01

    This paper presents an experimental study of the random incentive mechanisms which are a standard procedure in economic and psychological experiments. Random incentive mechanisms have several advantages but are incentive-compatible only if responses to the single tasks are independent. This is true if either the independence axiom of expected utility theory or the isolation hypothesis of prospect theory holds. We present a simple test of this in the context of choice under risk. In the baseline (one task) treatment we observe risk behavior in a given choice problem. We show that by integrating a second, asymmetrically dominated choice problem in a random incentive mechanism risk behavior can be manipulated systematically. This implies that the isolation hypothesis is violated and the random incentive mechanism does not elicit true preferences in our example.

  11. Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

    Directory of Open Access Journals (Sweden)

    Geoffrey R Bennett

    Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

  12. Motivational activation: a unifying hypothesis of orexin/hypocretin function.

    Science.gov (United States)

    Mahler, Stephen V; Moorman, David E; Smith, Rachel J; James, Morgan H; Aston-Jones, Gary

    2014-10-01

    Orexins (hypocretins) are two peptides (orexin A and B) produced from the pre-pro-orexin precursor and expressed in a limited region of dorsolateral hypothalamus. Orexins were originally thought to specifically mediate feeding and promote wakefulness, but it is now clear that they participate in a wide range of behavioral and physiological processes under select circumstances. Orexins primarily mediate behavior under situations of high motivational relevance, such as during physiological need states, exposure to threats or reward opportunities. We hypothesize that many behavioral functions of orexins (including regulation of sleep/wake cycling) reflect a fundamentally integrated function for orexins in translating motivational activation into organized suites of psychological and physiological processes supporting adaptive behaviors. We also discuss how numerous forms of neural heterogeneity modulate this function, allowing orexin neurons to organize diverse, adaptive responses in a variety of motivationally relevant situations. Thus, the involvement of orexins in diverse behaviors may reflect a common underlying function for this peptide system.

  13. Enamel biorhythms of humans and great apes: the Havers-Halberg Oscillation hypothesis reconsidered

    OpenAIRE

    Mahoney, Patrick; Miszkiewicz, Justyna J.; Pitfield, Rosie; Deter, Chris; Guatelli-Steinberg, Debbie

    2017-01-01

    The Havers-Halberg Oscillation (HHO) hypothesis links evidence for the timing of a biorhythm retained in permanent tooth enamel (Retzius periodicity) to adult body mass and life history traits across mammals. Potentially, these links provide a way to access life history of fossil species from teeth. Recently we assessed intra-specific predictions of the HHO on human children. We reported Retzius periodicity (RP) corresponded with enamel thickness, and cusp formation time, when calculated from...

  14. Two-dimensional Forster resonance energy transfer (2-D FRET) and the membrane raft hypothesis

    OpenAIRE

    Acasandrei, Maria; Dale, Robert; VAN DE VEN, Martin; AMELOOT, Marcel

    2006-01-01

    A model for analyzing Forster resonance energy transfer (FRET) data in relation to the cell plasma membrane raft hypothesis is developed to take into account: (a) the distribution of FRET donors and acceptors at the surface of probing antibody fragments specific for a putative raft component; (b) partitioning of the raft component between raft and non-raft areas of the membrane; and (c) the dependence of the raft partition on the expression level of the considered component. Analysis of relev...

  15. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  16. Pulsed remineralisation in the northwestern Mediterranean Sea: a hypothesis

    Science.gov (United States)

    Denis, Michel; Martin, Valérie; Momzikoff, André; Gondry, Geneviève; Stemmann, Lars; Demers, Serge; Gorsky, Gaby; Andersen, Valérie

    2003-02-01

    A general study of biogeochemical processes (DYNAPROC cruise) was conducted in May 1995 at a time-series station in the open northwestern Mediterranean Sea where horizontal advection was weak. Short-term variations of the vertical distributions of pico- and nanophytoplankton were investigated over four 36-h cycles, along with parallel determinations of metabolic CO 2 production rates and amino acid-containing colloid (AACC) concentrations at the chlorophyll maximum depth. The vertical (0-1000-m depth) distributions of (i) AACC, (ii) suspended particles and (iii) metabolic CO 2 production rate were documented during the initial and final stages of these 36-h cycles. This study was concerned with diel vertical migration (DVM) of zooplankton, which provided periodic perturbations. Accordingly, the time scale of the experimental work varied from a few hours to a few days. Although all distributions exhibited a periodic behaviour, AACC distributions were generally not linked to diel vertical migrations. In the subsurface layer, Synechococcus made the most abundant population and large variations in concentration were observed both at day and at night. The corresponding integrated (over the upper 90 m) losses of Synechococcus during one night pointed to a potential source of exported organic matter amounting to 534 mg C m -2. This study stresses the potential importance of organic matter export from the euphotic zone through the daily grazing activity of vertically migrating organisms, which would not be accounted for by measurements at longer time scales. The metabolic CO 2 production exhibited a peak of activity below 500 m that was shifted downward, apparently in a recurrent way and independently of the vertical distributions of AACC or of suspended particulate material. To account for this phenomenon, a «sustained wave train» hypothesis is proposed that combines the effect of the diel superficial faecal pellet production by swarming migrators and the repackaging

  17. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  18. ONC201 kills solid tumor cells by triggering an integrated stress response dependent on ATF4 activation by specific eIF2α kinases.

    Science.gov (United States)

    Kline, C Leah B; Van den Heuvel, A Pieter J; Allen, Joshua E; Prabhu, Varun V; Dicker, David T; El-Deiry, Wafik S

    2016-02-16

    ONC201 (also called TIC10) is a small molecule that inactivates the cell proliferation- and cell survival-promoting kinases Akt and ERK and induces cell death through the proapoptotic protein TRAIL. ONC201 is currently in early-phase clinical testing for various malignancies. We found through gene expression and protein analyses that ONC201 triggered an increase in TRAIL abundance and cell death through an integrated stress response (ISR) involving the transcription factor ATF4, the transactivator CHOP, and the TRAIL receptor DR5. ATF4 was not activated in ONC201-resistant cancer cells, and in ONC201-sensitive cells, knockdown of ATF4 or CHOP partially abrogated ONC201-induced cytotoxicity and diminished the ONC201-stimulated increase in DR5 abundance. The activation of ATF4 in response to ONC201 required the kinases HRI and PKR, which phosphorylate and activate the translation initiation factor eIF2α. ONC201 rapidly triggered cell cycle arrest, which was associated with decreased abundance of cyclin D1, decreased activity of the kinase complex mTORC1, and dephosphorylation of the retinoblastoma (Rb) protein. The abundance of X-linked inhibitor of apoptosis protein (XIAP) negatively correlated with the extent of apoptosis in response to ONC201. These effects of ONC201 were independent of whether cancer cells had normal or mutant p53. Thus, ONC201 induces cell death through the coordinated induction of TRAIL by an ISR pathway. Copyright © 2016, American Association for the Advancement of Science.

  19. Transformation of chlorpyrifos in integrated recirculating constructed wetlands (IRCWs) as revealed by compound-specific stable isotope (CSIA) and microbial community structure analysis.

    Science.gov (United States)

    Tang, Xiaoyan; Yang, Yang; Huang, Wenda; McBride, Murray B; Guo, Jingjing; Tao, Ran; Dai, Yunv

    2017-06-01

    Carbon isotope analysis and 454 pyrosequencing methods were used to investigate in situ biodegradation of chlorpyrifos during its transport through three model integrated recirculating constructed wetlands (IRCWs). Results show that plant and Fe-impregnated biochar promoted degradation of chlorpyrifos and its metabolite 3,5,6-trichloro-2-pyridinol (TCP). Carbon isotope ratios in the IRCWs shifted to -31.24±0.58‰ (IRCW1, plant free), -26.82±0.60‰ (IRCW2, with plant) and -24.76±0.94‰ (IRCW3, with plant and Fe-biochar). The enrichment factors (Ɛ bulk,c ) were determined as -0.69±0.06‰ (IRCW1), -0.91±0.07‰ (IRCW2) and -1.03±0.09‰ (IRCW3). Microbial community analysis showed that IRCW3 was dominated by members of Bacillus, which can utilize and degrade chlorpyrifos. These results reveal that plant and Fe-biochar can induce carbon isotope fractionation and have a positive impact on the chlorpyrifos degradation efficiency by influencing the development of beneficial microbial communities. Copyright © 2017. Published by Elsevier Ltd.

  20. Behavioural mediators of genetic life-history trade-offs: a test of the pace-of-life syndrome hypothesis in field crickets.

    Science.gov (United States)

    Santostefano, Francesca; Wilson, Alastair J; Niemelä, Petri T; Dingemanse, Niels J

    2017-10-11

    The pace-of-life syndrome (POLS) hypothesis predicts associations between life history and 'risky' behaviours. Individuals with 'fast' lifestyles should develop faster, reproduce earlier, exhibit more risk-prone behaviours, and die sooner than those with 'slow' lifestyles. While support for POLS has been equivocal to date, studies have relied on individual-level (phenotypic) patterns in which genetic trade-offs may be masked by environmental effects on phenotypes. We estimated genetic correlations between life history (development, lifespan, size) and risky behaviours (exploration, aggression) in a pedigreed population of Mediterranean field crickets ( Gryllus bimaculatus ). Path analyses showed that behaviours mediated some genetic relationships between life history traits, though not those involved in trade-offs. Thus, while specific predictions of POLS theory were not supported, genetic integration of behaviour and life history was present. This implies a major role for risky behaviours in life history evolution. © 2017 The Author(s).

  1. The Sapir-Whorf Hypothesis and Probabilistic Inference: Evidence from the Domain of Color.

    Science.gov (United States)

    Cibelli, Emily; Xu, Yang; Austerweil, Joseph L; Griffiths, Thomas L; Regier, Terry

    2016-01-01

    The Sapir-Whorf hypothesis holds that our thoughts are shaped by our native language, and that speakers of different languages therefore think differently. This hypothesis is controversial in part because it appears to deny the possibility of a universal groundwork for human cognition, and in part because some findings taken to support it have not reliably replicated. We argue that considering this hypothesis through the lens of probabilistic inference has the potential to resolve both issues, at least with respect to certain prominent findings in the domain of color cognition. We explore a probabilistic model that is grounded in a presumed universal perceptual color space and in language-specific categories over that space. The model predicts that categories will most clearly affect color memory when perceptual information is uncertain. In line with earlier studies, we show that this model accounts for language-consistent biases in color reconstruction from memory in English speakers, modulated by uncertainty. We also show, to our knowledge for the first time, that such a model accounts for influential existing data on cross-language differences in color discrimination from memory, both within and across categories. We suggest that these ideas may help to clarify the debate over the Sapir-Whorf hypothesis.

  2. Integration of genome-scale metabolic networks into whole-body PBPK models shows phenotype-specific cases of drug-induced metabolic perturbation.

    Science.gov (United States)

    Cordes, Henrik; Thiel, Christoph; Baier, Vanessa; Blank, Lars M; Kuepfer, Lars

    2018-01-01

    Drug-induced perturbations of the endogenous metabolic network are a potential root cause of cellular toxicity. A mechanistic understanding of such unwanted side effects during drug therapy is therefore vital for patient safety. The comprehensive assessment of such drug-induced injuries requires the simultaneous consideration of both drug exposure at the whole-body and resulting biochemical responses at the cellular level. We here present a computational multi-scale workflow that combines whole-body physiologically based pharmacokinetic (PBPK) models and organ-specific genome-scale metabolic network (GSMN) models through shared reactions of the xenobiotic metabolism. The applicability of the proposed workflow is illustrated for isoniazid, a first-line antibacterial agent against Mycobacterium tuberculosis , which is known to cause idiosyncratic drug-induced liver injuries (DILI). We combined GSMN models of a human liver with N-acetyl transferase 2 (NAT2)-phenotype-specific PBPK models of isoniazid. The combined PBPK-GSMN models quantitatively describe isoniazid pharmacokinetics, as well as intracellular responses, and changes in the exometabolome in a human liver following isoniazid administration. Notably, intracellular and extracellular responses identified with the PBPK-GSMN models are in line with experimental and clinical findings. Moreover, the drug-induced metabolic perturbations are distributed and attenuated in the metabolic network in a phenotype-dependent manner. Our simulation results show that a simultaneous consideration of both drug pharmacokinetics at the whole-body and metabolism at the cellular level is mandatory to explain drug-induced injuries at the patient level. The proposed workflow extends our mechanistic understanding of the biochemistry underlying adverse events and may be used to prevent drug-induced injuries in the future.

  3. Metabolic reconstruction of Setaria italica: a systems biology approach for integrating tissue-specific omics and pathway analysis of bioenergy grasses

    Directory of Open Access Journals (Sweden)

    Cristiana Gomes De Oliveira Dal'molin

    2016-08-01

    Full Text Available The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica, as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S.italica. mRNA, protein and metabolite abundances, were measured in mature and immature stem/leaf phytomers and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME. Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study

  4. Metabolic Reconstruction of Setaria italica: A Systems Biology Approach for Integrating Tissue-Specific Omics and Pathway Analysis of Bioenergy Grasses.

    Science.gov (United States)

    de Oliveira Dal'Molin, Cristiana G; Orellana, Camila; Gebbie, Leigh; Steen, Jennifer; Hodson, Mark P; Chrysanthopoulos, Panagiotis; Plan, Manuel R; McQualter, Richard; Palfreyman, Robin W; Nielsen, Lars K

    2016-01-01

    The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica), as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S. italica. mRNA, protein, and metabolite abundances, were measured in mature and immature stem/leaf phytomers, and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME). Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin, and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study, we demonstrated

  5. A Design Support Framework through Dynamic Deployment of Hypothesis and Verification in the Design Process

    Science.gov (United States)

    Nomaguch, Yutaka; Fujita, Kikuo

    This paper proposes a design support framework, named DRIFT (Design Rationale Integration Framework of Three layers), which dynamically captures and manages hypothesis and verification in the design process. A core of DRIFT is a three-layered design process model of action, model operation and argumentation. This model integrates various design support tools and captures design operations performed on them. Action level captures the sequence of design operations. Model operation level captures the transition of design states, which records a design snapshot over design tools. Argumentation level captures the process of setting problems and alternatives. The linkage of three levels enables to automatically and efficiently capture and manage iterative hypothesis and verification processes through design operations over design tools. In DRIFT, such a linkage is extracted through the templates of design operations, which are extracted from the patterns embeded in design tools such as Design-For-X (DFX) approaches, and design tools are integrated through ontology-based representation of design concepts. An argumentation model, gIBIS (graphical Issue-Based Information System), is used for representing dependencies among problems and alternatives. A mechanism of TMS (Truth Maintenance System) is used for managing multiple hypothetical design stages. This paper also demonstrates a prototype implementation of DRIFT and its application to a simple design problem. Further, it is concluded with discussion of some future issues.

  6. A large scale test of the gaming-enhancement hypothesis

    Directory of Open Access Journals (Sweden)

    Andrew K. Przybylski

    2016-11-01

    Full Text Available A growing research literature suggests that regular electronic game play and game-based training programs may confer practically significant benefits to cognitive functioning. Most evidence supporting this idea, the gaming-enhancement hypothesis, has been collected in small-scale studies of university students and older adults. This research investigated the hypothesis in a general way with a large sample of 1,847 school-aged children. Our aim was to examine the relations between young people’s gaming experiences and an objective test of reasoning performance. Using a Bayesian hypothesis testing approach, evidence for the gaming-enhancement and null hypotheses were compared. Results provided no substantive evidence supporting the idea that having preference for or regularly playing commercially available games was positively associated with reasoning ability. Evidence ranged from equivocal to very strong in support for the null hypothesis over what was predicted. The discussion focuses on the value of Bayesian hypothesis testing for investigating electronic gaming effects, the importance of open science practices, and pre-registered designs to improve the quality of future work.

  7. A large scale test of the gaming-enhancement hypothesis.

    Science.gov (United States)

    Przybylski, Andrew K; Wang, John C

    2016-01-01

    A growing research literature suggests that regular electronic game play and game-based training programs may confer practically significant benefits to cognitive functioning. Most evidence supporting this idea, the gaming-enhancement hypothesis , has been collected in small-scale studies of university students and older adults. This research investigated the hypothesis in a general way with a large sample of 1,847 school-aged children. Our aim was to examine the relations between young people's gaming experiences and an objective test of reasoning performance. Using a Bayesian hypothesis testing approach, evidence for the gaming-enhancement and null hypotheses were compared. Results provided no substantive evidence supporting the idea that having preference for or regularly playing commercially available games was positively associated with reasoning ability. Evidence ranged from equivocal to very strong in support for the null hypothesis over what was predicted. The discussion focuses on the value of Bayesian hypothesis testing for investigating electronic gaming effects, the importance of open science practices, and pre-registered designs to improve the quality of future work.

  8. Investigating the environmental Kuznets curve hypothesis in Vietnam

    International Nuclear Information System (INIS)

    Al-Mulali, Usama; Saboori, Behnaz; Ozturk, Ilhan

    2015-01-01

    This study investigates the existence of the environmental Kuznets curve (EKC) hypothesis in Vietnam during the period 1981–2011. To realize the goals of this study, a pollution model was established applying the Autoregressive Distributed Lag (ARDL) methodology. The results revealed that the pollution haven hypothesis does exist in Vietnam because capital increases pollution. In addition, imports also increase pollution which indicates that most of Vietnam's imported products are energy intensive and highly polluted. However, exports have no effect on pollution which indicates that the level of exports is not significant enough to affect pollution. Moreover, fossil fuel energy consumption increases pollution while renewable energy consumption has no significant effect in reducing pollution. Furthermore, labor force reduces pollution since most of Vietnam's labor force is in the agricultural and services sectors which are less energy intensive than the industrial sector. Based on the obtained results, the EKC hypothesis does not exist because the relationship between GDP and pollution is positive in both the short and long run. - Highlights: • The environmental Kuznets curve (EKC) hypothesis in Vietnam is investigated. • The Autoregressive Distributed Lag (ARDL) methodology was utilized. • The EKC hypothesis does not exist

  9. Social learning and evolution: the cultural intelligence hypothesis

    Science.gov (United States)

    van Schaik, Carel P.; Burkart, Judith M.

    2011-01-01

    If social learning is more efficient than independent individual exploration, animals should learn vital cultural skills exclusively, and routine skills faster, through social learning, provided they actually use social learning preferentially. Animals with opportunities for social learning indeed do so. Moreover, more frequent opportunities for social learning should boost an individual's repertoire of learned skills. This prediction is confirmed by comparisons among wild great ape populations and by social deprivation and enculturation experiments. These findings shaped the cultural intelligence hypothesis, which complements the traditional benefit hypotheses for the evolution of intelligence by specifying the conditions in which these benefits can be reaped. The evolutionary version of the hypothesis argues that species with frequent opportunities for social learning should more readily respond to selection for a greater number of learned skills. Because improved social learning also improves asocial learning, the hypothesis predicts a positive interspecific correlation between social-learning performance and individual learning ability. Variation among primates supports this prediction. The hypothesis also predicts that more heavily cultural species should be more intelligent. Preliminary tests involving birds and mammals support this prediction too. The cultural intelligence hypothesis can also account for the unusual cognitive abilities of humans, as well as our unique mechanisms of skill transfer. PMID:21357223

  10. Dopamine and reward: the anhedonia hypothesis 30 years on.

    Science.gov (United States)

    Wise, Roy A

    2008-10-01

    The anhedonia hypothesis--that brain dopamine plays a critical role in the subjective pleasure associated with positive rewards--was intended to draw the attention of psychiatrists to the growing evidence that dopamine plays a critical role in the objective reinforcement and incentive motivation associated with food and water, brain stimulation reward, and psychomotor stimulant and opiate reward. The hypothesis called to attention the apparent paradox that neuroleptics, drugs used to treat a condition involving anhedonia (schizophrenia), attenuated in laboratory animals the positive reinforcement that we normally associate with pleasure. The hypothesis held only brief interest for psychiatrists, who pointed out that the animal studies reflected acute actions of neuroleptics whereas the treatment of schizophrenia appears to result from neuroadaptations to chronic neuroleptic administration, and that it is the positive symptoms of schizophrenia that neuroleptics alleviate, rather than the negative symptoms that include anhedonia. Perhaps for these reasons, the hypothesis has had minimal impact in the psychiatric literature. Despite its limited heuristic value for the understanding of schizophrenia, however, the anhedonia hypothesis has had major impact on biological theories of reinforcement, motivation, and addiction. Brain dopamine plays a very important role in reinforcement of response habits, conditioned preferences, and synaptic plasticity in cellular models of learning and memory. The notion that dopamine plays a dominant role in reinforcement is fundamental to the psychomotor stimulant theory of addiction, to most neuroadaptation theories of addiction, and to current theories of conditioned reinforcement and reward prediction. Properly understood, it is also fundamental to recent theories of incentive motivation.

  11. Social learning and evolution: the cultural intelligence hypothesis.

    Science.gov (United States)

    van Schaik, Carel P; Burkart, Judith M

    2011-04-12

    If social learning is more efficient than independent individual exploration, animals should learn vital cultural skills exclusively, and routine skills faster, through social learning, provided they actually use social learning preferentially. Animals with opportunities for social learning indeed do so. Moreover, more frequent opportunities for social learning should boost an individual's repertoire of learned skills. This prediction is confirmed by comparisons among wild great ape populations and by social deprivation and enculturation experiments. These findings shaped the cultural intelligence hypothesis, which complements the traditional benefit hypotheses for the evolution of intelligence by specifying the conditions in which these benefits can be reaped. The evolutionary version of the hypothesis argues that species with frequent opportunities for social learning should more readily respond to selection for a greater number of learned skills. Because improved social learning also improves asocial learning, the hypothesis predicts a positive interspecific correlation between social-learning performance and individual learning ability. Variation among primates supports this prediction. The hypothesis also predicts that more heavily cultural species should be more intelligent. Preliminary tests involving birds and mammals support this prediction too. The cultural intelligence hypothesis can also account for the unusual cognitive abilities of humans, as well as our unique mechanisms of skill transfer.

  12. Design and characterization of a laterally mounted phased-array transducer breast-specific MRgHIFU device with integrated 11-channel receiver array.

    Science.gov (United States)

    Payne, A; Merrill, R; Minalga, E; Vyas, U; de Bever, J; Todd, N; Hadley, R; Dumont, E; Neumayer, L; Christensen, D; Roemer, R; Parker, D

    2012-03-01

    This work presents the design and preliminary evaluation of a new laterally mounted phased-array MRI-guided high-intensity focused ultrasound (MRgHIFU) system with an integrated 11-channel phased-array radio frequency (RF) coil intended for breast cancer treatment. The design goals for the system included the ability to treat the majority of tumor locations, to increase the MR image's signal-to-noise ratio (SNR) throughout the treatment volume and to provide adequate comfort for the patient. In order to treat the majority of the breast volume, the device was designed such that the treated breast is suspended in a 17-cm diameter treatment cylinder. A laterally shooting 1-MHz, 256-element phased-array ultrasound transducer with flexible positioning is mounted outside the treatment cylinder. This configuration achieves a reduced water volume to minimize RF coil loading effects, to position the coils closer to the breast for increased signal sensitivity, and to reduce the MR image noise associated with using water as the coupling fluid. This design uses an 11-channel phased-array RF coil that is placed on the outer surface of the cylinder surrounding the breast. Mechanical positioning of the transducer and electronic steering of the focal spot enable placement of the ultrasound focus at arbitrary locations throughout the suspended breast. The treatment platform allows the patient to lie prone in a face-down position. The system was tested for comfort with 18 normal volunteers and SNR capabilities in one normal volunteer and for heating accuracy and stability in homogeneous phantom and inhomogeneous ex vivo porcine tissue. There was a 61% increase in mean relative SNR achieved in a homogeneous phantom using the 11-channel RF coil when compared to using only a single-loop coil around the chest wall. The repeatability of the system's energy delivery in a single location was excellent, with less than 3% variability between repeated temperature measurements at the same

  13. A comparator-hypothesis account of biased contingency detection.

    Science.gov (United States)

    Vadillo, Miguel A; Barberia, Itxaso

    2018-02-12

    Our ability to detect statistical dependencies between different events in the environment is strongly biased by the number of coincidences between them. Even when there is no true covariation between a cue and an outcome, if the marginal probability of either of them is high, people tend to perceive some degree of statistical contingency between both events. The present paper explores the ability of the Comparator Hypothesis to explain the general pattern of results observed in this literature. Our simulations show that this model can account for the biasing effects of the marginal probabilities of cues and outcomes. Furthermore, the overall fit of the Comparator Hypothesis to a sample of experimental conditions from previous studies is comparable to that of the popular Rescorla-Wagner model. These results should encourage researchers to further explore and put to the test the predictions of the Comparator Hypothesis in the domain of biased contingency detection. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. The large numbers hypothesis and a relativistic theory of gravitation

    International Nuclear Information System (INIS)

    Lau, Y.K.; Prokhovnik, S.J.

    1986-01-01

    A way to reconcile Dirac's large numbers hypothesis and Einstein's theory of gravitation was recently suggested by Lau (1985). It is characterized by the conjecture of a time-dependent cosmological term and gravitational term in Einstein's field equations. Motivated by this conjecture and the large numbers hypothesis, we formulate here a scalar-tensor theory in terms of an action principle. The cosmological term is required to be spatially dependent as well as time dependent in general. The theory developed is appled to a cosmological model compatible with the large numbers hypothesis. The time-dependent form of the cosmological term and the scalar potential are then deduced. A possible explanation of the smallness of the cosmological term is also given and the possible significance of the scalar field is speculated

  15. Universality hypothesis breakdown at one-loop order

    Science.gov (United States)

    Carvalho, P. R. S.

    2018-05-01

    We probe the universality hypothesis by analytically computing the at least two-loop corrections to the critical exponents for q -deformed O (N ) self-interacting λ ϕ4 scalar field theories through six distinct and independent field-theoretic renormalization group methods and ɛ -expansion techniques. We show that the effect of q deformation on the one-loop corrections to the q -deformed critical exponents is null, so the universality hypothesis is broken down at this loop order. Such an effect emerges only at the two-loop and higher levels, and the validity of the universality hypothesis is restored. The q -deformed critical exponents obtained through the six methods are the same and, furthermore, reduce to their nondeformed values in the appropriated limit.

  16. Unicorns do exist: a tutorial on "proving" the null hypothesis.

    Science.gov (United States)

    Streiner, David L

    2003-12-01

    Introductory statistics classes teach us that we can never prove the null hypothesis; all we can do is reject or fail to reject it. However, there are times when it is necessary to try to prove the nonexistence of a difference between groups. This most often happens within the context of comparing a new treatment against an established one and showing that the new intervention is not inferior to the standard. This article first outlines the logic of "noninferiority" testing by differentiating between the null hypothesis (that which we are trying to nullify) and the "nill" hypothesis (there is no difference), reversing the role of the null and alternate hypotheses, and defining an interval within which groups are said to be equivalent. We then work through an example and show how to calculate sample sizes for noninferiority studies.

  17. Almost-Quantum Correlations Violate the No-Restriction Hypothesis.

    Science.gov (United States)

    Sainz, Ana Belén; Guryanova, Yelena; Acín, Antonio; Navascués, Miguel

    2018-05-18

    To identify which principles characterize quantum correlations, it is essential to understand in which sense this set of correlations differs from that of almost-quantum correlations. We solve this problem by invoking the so-called no-restriction hypothesis, an explicit and natural axiom in many reconstructions of quantum theory stating that the set of possible measurements is the dual of the set of states. We prove that, contrary to quantum correlations, no generalized probabilistic theory satisfying the no-restriction hypothesis is able to reproduce the set of almost-quantum correlations. Therefore, any theory whose correlations are exactly, or very close to, the almost-quantum correlations necessarily requires a rule limiting the possible measurements. Our results suggest that the no-restriction hypothesis may play a fundamental role in singling out the set of quantum correlations among other nonsignaling ones.

  18. Motor synergies and the equilibrium-point hypothesis.

    Science.gov (United States)

    Latash, Mark L

    2010-07-01

    The article offers a way to unite three recent developments in the field of motor control and coordination: (1) The notion of synergies is introduced based on the principle of motor abundance; (2) The uncontrolled manifold hypothesis is described as offering a computational framework to identify and quantify synergies; and (3) The equilibrium-point hypothesis is described for a single muscle, single joint, and multijoint systems. Merging these concepts into a single coherent scheme requires focusing on control variables rather than performance variables. The principle of minimal final action is formulated as the guiding principle within the referent configuration hypothesis. Motor actions are associated with setting two types of variables by a controller, those that ultimately define average performance patterns and those that define associated synergies. Predictions of the suggested scheme are reviewed, such as the phenomenon of anticipatory synergy adjustments, quick actions without changes in synergies, atypical synergies, and changes in synergies with practice. A few models are briefly reviewed.

  19. On Using Taylor's Hypothesis for Three-Dimensional Mixing Layers

    Science.gov (United States)

    LeBoeuf, Richard L.; Mehta, Rabindra D.

    1995-01-01

    In the present study, errors in using Taylor's hypothesis to transform measurements obtained in a temporal (or phase) frame onto a spatial one were evaluated. For the first time, phase-averaged ('real') spanwise and streamwise vorticity data measured on a three-dimensional grid were compared directly to those obtained using Taylor's hypothesis. The results show that even the qualitative features of the spanwise and streamwise vorticity distributions given by the two techniques can be very different. This is particularly true in the region of the spanwise roller pairing. The phase-averaged spanwise and streamwise peak vorticity levels given by Taylor's hypothesis are typically lower (by up to 40%) compared to the real measurements.

  20. A hypothesis on a role of oxytocin in the social mechanisms of speech and vocal learning.

    Science.gov (United States)

    Theofanopoulou, Constantina; Boeckx, Cedric; Jarvis, Erich D

    2017-08-30

    Language acquisition in humans and song learning in songbirds naturally happen as a social learning experience, providing an excellent opportunity to reveal social motivation and reward mechanisms that boost sensorimotor learning. Our knowledge about the molecules and circuits that control these social mechanisms for vocal learning and language is limited. Here we propose a hypothesis of a role for oxytocin (OT) in the social motivation and evolution of vocal learning and language. Building upon existing evidence, we suggest specific neural pathways and mechanisms through which OT might modulate vocal learning circuits in specific developmental stages. © 2017 The Authors.

  1. Integrated site-specific quantification of faecal bacteria and detection of DNA markers in faecal contamination source tracking as a microbial risk tracking tool in urban Lake ecosystems

    Science.gov (United States)

    Donde, Oscar Omondi; Tian, Cuicui; Xiao, Bangding

    2017-11-01

    The presence of feacal-derived pathogens in water is responsible for several infectious diseases and deaths worldwide. As a solution, sources of fecal pollution in waters must be accurately assessed, properly determined and strictly controlled. However, the exercise has remained challenging due to the existing overlapping characteristics by different members of faecal coliform bacteria and the inadequacy of information pertaining to the contribution of seasonality and weather condition on tracking the possible sources of pollution. There are continued efforts to improve the Faecal Contamination Source Tracking (FCST) techniques such as Microbial Source Tracking (MST). This study aimed to make contribution to MST by evaluating the efficacy of combining site specific quantification of faecal contamination indicator bacteria and detection of DNA markers while accounting for seasonality and weather conditions' effects in tracking the major sources of faecal contamination in a freshwater system (Donghu Lake, China). The results showed that the use of cyd gene in addition to lacZ and uidA genes differentiates E. coli from other closely related faecal bacteria. The use of selective media increases the pollution source tracking accuracy. BSA addition boosts PCR detection and increases FCST efficiency. Seasonality and weather variability also influence the detection limit for DNA markers.

  2. Towards an interpretive measurement framework to assess the levels of integrated and integrative thinking within organisations

    Directory of Open Access Journals (Sweden)

    Daniel Schörger

    2015-07-01

    Full Text Available This research study is located within the context of corporate reporting and is relevant for the agenda of sustainability and sustainable development. The specific context for this study is the South African mining industry, within which three units in the form of three companies, were chosen to provide a coherent case for this study. The sample for the analysis is based on the integrated reports of these companies for the years 2012 and 2013. This gives this research a total sample size of six reports. Based on the research findings an initial interpretive measurement framework to assess the levels of capital integration has been theorised which enables the various stakeholders of an organisation to assess the integrated and integrative thinking capabilities. The level of integration is represented as a maturity scale on which integrated thinking is associated with the lower levels, while integrative thinking is attributed to higher levels of maturity. In the elaborated framework, integrated thinking is perceived as being a prerequisite for integrative thinking. The practical implication of this study is that it provides a potential measurement framework for various organisational stakeholders, including investors, to assess the thinking capabilities that are more likely to lead to long term financial stability and sustainability. The value of this research study is that it provides an initial step towards measuring the level of integrated and integrative thinking capabilities within organisations where no such measurement framework currently exists. The limitations and implications of this research study are that the interpretive measurement framework represents merely an initial step and an ongoing working hypothesis which requires further research to develop its maturity and usefulness.

  3. Thermalization without eigenstate thermalization hypothesis after a quantum quench.

    Science.gov (United States)

    Mori, Takashi; Shiraishi, Naoto

    2017-08-01

    Nonequilibrium dynamics of a nonintegrable system without the eigenstate thermalization hypothesis is studied. It is shown that, in the thermodynamic limit, this model thermalizes after an arbitrary quantum quench at finite temperature, although it does not satisfy the eigenstate thermalization hypothesis. In contrast, when the system size is finite and the temperature is low enough, the system may not thermalize. In this case, the steady state is well described by the generalized Gibbs ensemble constructed by using highly nonlocal conserved quantities. We also show that this model exhibits prethermalization, in which the prethermalized state is characterized by nonthermal energy eigenstates.

  4. Tunguska, 1908: the gas pouch and soil fluidization hypothesis

    Science.gov (United States)

    Nistor, I.

    2012-01-01

    The Siberian taiga explosion of 30 June 1908 remains one of the great mysteries of the 20th century: millions of trees put down over an area of 2200 km2 without trace of a crater or meteorite fragments. Hundred years of failed searches have followed, resulting in as many flawed hypothesis which could not offer satisfactory explanations: meteorite, comet, UFO, etc. In the author's opinion, the cause is that the energy the explorers looked for was simply not there! The author's hypothesis is that a meteoroid encountered a gas pouch in the atmosphere, producing a devastating explosion, its effects being amplified by soil fluidization.

  5. The equilibrium-point hypothesis--past, present and future.

    Science.gov (United States)

    Feldman, Anatol G; Levin, Mindy F

    2009-01-01

    This chapter is a brief account of fundamentals of the equilibrium-point hypothesis or more adequately called the threshold control theory (TCT). It also compares the TCT with other approaches to motor control. The basic notions of the TCT are reviewed with a major focus on solutions to the problems of multi-muscle and multi-degrees of freedom redundancy. The TCT incorporates cognitive aspects by explaining how neurons recognize that internal (neural) and external (environmental) events match each other. These aspects as well as how motor learning occurs are subjects of further development of the TCT hypothesis.

  6. The cosmic censorship hypothesis and the positive energy conjecture

    International Nuclear Information System (INIS)

    Jang, P.S.; Wald, R.W.

    1979-01-01

    The position so far is summarized. Penrose derived an inequality; if a data set was found to violate this then the assumptions deriving the inequality must be false. In this case it could show a counter example to the cosmic censorship hypothesis. The authors have shown elsewhere that a positive energy argument of Geroch can be modified to rule out a violation of Penrose's inequality with any time-symmetric initial data set whose apparent horizon consists of a single component. This increases confidence in the hypothesis and also indicates there may be a close relationship between this conjecture and the positive energy conjecture. (UK)

  7. Eat dirt and avoid atopy: the hygiene hypothesis revisited.

    Science.gov (United States)

    Patki, Anil

    2007-01-01

    The explosive rise in the incidence of atopic diseases in the Western developed countries can be explained on the basis of the so-called "hygiene hypothesis". In short, it attributes the rising incidence of atopic dermatitis to reduced exposure to various childhood infections and bacterial endotoxins. Reduced exposure to dirt in the clean environment results in a skewed development of the immune system which results in an abnormal allergic response to various environmental allergens which are otherwise innocuous. This article reviews the historical aspects, epidemiological and immunological basis of the hygiene hypothesis and implications for Indian conditions.

  8. Coastal Modelling Environment version 1.0: a framework for integrating landform-specific component models in order to simulate decadal to centennial morphological changes on complex coasts

    Directory of Open Access Journals (Sweden)

    A. Payo

    2017-07-01

    Full Text Available The ability to model morphological changes on complex, multi-landform coasts over decadal to centennial timescales is essential for sustainable coastal management worldwide. One approach involves coupling of landform-specific simulation models (e.g. cliffs, beaches, dunes and estuaries that have been independently developed. An alternative, novel approach explored in this paper is to capture the essential characteristics of the landform-specific models using a common spatial representation within an appropriate software framework. This avoid the problems that result from the model-coupling approach due to between-model differences in the conceptualizations of geometries, volumes and locations of sediment. In the proposed framework, the Coastal Modelling Environment (CoastalME, change in coastal morphology is represented by means of dynamically linked raster and geometrical objects. A grid of raster cells provides the data structure for representing quasi-3-D spatial heterogeneity and sediment conservation. Other geometrical objects (lines, areas and volumes that are consistent with, and derived from, the raster structure represent a library of coastal elements (e.g. shoreline, beach profiles and estuary volumes as required by different landform-specific models. As a proof-of-concept, we illustrate the capabilities of an initial version of CoastalME by integrating a cliff–beach model and two wave propagation approaches. We verify that CoastalME can reproduce behaviours of the component landform-specific models. Additionally, the integration of these component models within the CoastalME framework reveals behaviours that emerge from the interaction of landforms, which have not previously been captured, such as the influence of the regional bathymetry on the local alongshore sediment-transport gradient and the effect on coastal change on an undefended coastal segment and on sediment bypassing of coastal structures.

  9. A systematic evaluation of integration free reprogramming methods for deriving clinically relevant patient specific induced pluripotent stem (iPS cells.

    Directory of Open Access Journals (Sweden)

    Pollyanna A Goh

    Full Text Available A systematic evaluation of three different methods for generating induced pluripotent stem (iPS cells was performed using the same set of parental cells in our quest to develop a feeder independent and xeno-free method for somatic cell reprogramming that could be transferred into a GMP environment. When using the BJ fibroblast cell line, the highest reprogramming efficiency (1.89% of starting cells was observed with the mRNA based method which was almost 20 fold higher than that observed with the retrovirus (0.2% and episomal plasmid (0.10% methods. Standard characterisation tests did not reveal any differences in an array of pluripotency markers between the iPS lines derived using the various methods. However, when the same methods were used to reprogram three different primary fibroblasts lines, two derived from patients with rapid onset parkinsonism dystonia and one from an elderly healthy volunteer, we consistently observed higher reprogramming efficiencies with the episomal plasmid method, which was 4 fold higher when compared to the retroviral method and over 50 fold higher than the mRNA method. Additionally, with the plasmid reprogramming protocol, recombinant vitronectin and synthemax® could be used together with commercially available, fully defined, xeno-free essential 8 medium without significantly impacting the reprogramming efficiency. To demonstrate the robustness of this protocol, we reprogrammed a further 2 primary patient cell lines, one with retinosa pigmentosa and the other with Parkinsons disease. We believe that we have optimised a simple and reproducible method which could be used as a starting point for developing GMP protocols, a prerequisite for generating clinically relevant patient specific iPS cells.

  10. Ten alien chromosome additions of Gossypium hirsutum-Gossypium bickii developed by integrative uses of GISH and species-specific SSR markers.

    Science.gov (United States)

    Tang, Dong; Feng, Shouli; Li, Sai; Chen, Yu; Zhou, Baoliang

    2018-03-27

    Gossypium bickii: (2n = 26, G 1 G 1 ), a wild diploid cotton, carries many favourable traits. However, these favourable traits cannot be directly transferred into G. hirsutum (2n = 52, AADD) cultivars due to the differences in genomes. Monosomic alien addition lines (MAALs) are considered an invaluable tool for the introgression of genes of interest from wild relatives into cultivated crops. In this study, the G. hirsutum-G. bickii amphidiploid (2n = 78, AADDG 1 G 1 ) was backcrossed with G. hirsutum to develop alien additions containing individual G. bickii chromosomes in a G. hirsutum background. Genomic in situ hybridization was employed to detect the number of alien chromosomes added to the backcross progenies. A total of 183 G. bickii-specific DNA markers were developed to discriminate the identities of the G. bickii chromosomes added to G. hirsutum and assess the alien chromosome transmissibility. Chromosomes 4G b and 13G b showed the highest transmissibility, while chromosomes 1G b , 7G b and 11G b showed the lowest. Ten of the 13 possible G. hirsutum-G. bickii MAALs were isolated and characterized, which will lay the foundation for transferring resistance genes of G. bickii into G. hirsutum, as well as for gene assignment, physical mapping, and selective isolation and mapping of cDNAs for particular G. bickii chromosomes. The strategies of how to use MAALs to develop varieties with the trait of interest from wild species (such as glanded plant-glandless seed) were proposed and discussed.

  11. Wagner’s law versus Keynesian hypothesis: Evidence from pre-WWII Greece

    Directory of Open Access Journals (Sweden)

    Antonis Antoniou

    2013-01-01

    Full Text Available With data of over a century, 1833-1938, this paper attempts, for the first time, to analyze the causal relationship between income and government spending in the Greek economy for such a long period; that is, to gain some insight into Wagner and Keynesian Hypotheses. The time period of the analysis represents a period of growth, industrialization and modernization of the economy, conditions which are conducive to Wagner’s Law but also to the Keynesian Hypothesis. The empirical analysis resorts to Autoregressive Distributed Lag (ARDL Cointegration method and tests for the presence of possible structural breaks. The results reveal a positive and statistically significant long run causal effect running from economic performance towards the public size giving support to Wagner’s Law in Greece, whereas for the Keynesian hypothesis some doubts arise for specific time sub-periods.

  12. The null hypothesis of GSEA, and a novel statistical model for competitive gene set analysis

    DEFF Research Database (Denmark)

    Debrabant, Birgit

    2017-01-01

    MOTIVATION: Competitive gene set analysis intends to assess whether a specific set of genes is more associated with a trait than the remaining genes. However, the statistical models assumed to date to underly these methods do not enable a clear cut formulation of the competitive null hypothesis....... This is a major handicap to the interpretation of results obtained from a gene set analysis. RESULTS: This work presents a hierarchical statistical model based on the notion of dependence measures, which overcomes this problem. The two levels of the model naturally reflect the modular structure of many gene set...... analysis methods. We apply the model to show that the popular GSEA method, which recently has been claimed to test the self-contained null hypothesis, actually tests the competitive null if the weight parameter is zero. However, for this result to hold strictly, the choice of the dependence measures...

  13. Becoming a vampire without being bitten: the narrative collective-assimilation hypothesis.

    Science.gov (United States)

    Gabriel, Shira; Young, Ariana F

    2011-08-01

    We propose the narrative collective-assimilation hypothesis--that experiencing a narrative leads one to psychologically become a part of the collective described within the narrative. In a test of this hypothesis, participants read passages from either a book about wizards (from the Harry Potter series) or a book about vampires (from the Twilight series). Both implicit and explicit measures revealed that participants who read about wizards psychologically became wizards, whereas those who read about vampires psychologically became vampires. The results also suggested that narrative collective assimilation is psychologically meaningful and relates to the basic human need for connection. Specifically, the tendency to fulfill belongingness needs through group affiliation moderated the extent to which narrative collective assimilation occurred, and narrative collective assimilation led to increases in life satisfaction and positive mood, two primary outcomes of belonging. The implications for the importance of narratives, the need to belong to groups, and social surrogacy are discussed.

  14. New Hypothesis and Theory about Functions of Sleep and Dreams

    Directory of Open Access Journals (Sweden)

    Nikola N. Ilanković

    2014-03-01

    Conclusion: IEP-P1 could be a new biological marker to distinction of sleep organization in different psychotic states and other states of altered consciousness. The developed statistical models could be the basis for new hypothesis and theories about functions of sleep and dreams.

  15. A test of the reward-value hypothesis.

    Science.gov (United States)

    Smith, Alexandra E; Dalecki, Stefan J; Crystal, Jonathon D

    2017-03-01

    Rats retain source memory (memory for the origin of information) over a retention interval of at least 1 week, whereas their spatial working memory (radial maze locations) decays within approximately 1 day. We have argued that different forgetting functions dissociate memory systems. However, the two tasks, in our previous work, used different reward values. The source memory task used multiple pellets of a preferred food flavor (chocolate), whereas the spatial working memory task provided access to a single pellet of standard chow-flavored food at each location. Thus, according to the reward-value hypothesis, enhanced performance in the source memory task stems from enhanced encoding/memory of a preferred reward. We tested the reward-value hypothesis by using a standard 8-arm radial maze task to compare spatial working memory accuracy of rats rewarded with either multiple chocolate or chow pellets at each location using a between-subjects design. The reward-value hypothesis predicts superior accuracy for high-valued rewards. We documented equivalent spatial memory accuracy for high- and low-value rewards. Importantly, a 24-h retention interval produced equivalent spatial working memory accuracy for both flavors. These data are inconsistent with the reward-value hypothesis and suggest that reward value does not explain our earlier findings that source memory survives unusually long retention intervals.

  16. Revisiting Hudson’s (1992) OO = O2 hypothesis

    DEFF Research Database (Denmark)

    Shibuya, Yoshikata; Jensen, Kim Ebensgaard

    2018-01-01

    In an important paper on the English “double-object”, or ditransitive, construction, Richard Hudson proposes a hypothesis that conflates the ditransitive direct object, or O2, and the monotransitive direct object, or OO, into the same syntactic functional category. While making important departures...

  17. Hypothesis, Prediction, and Conclusion: Using Nature of Science Terminology Correctly

    Science.gov (United States)

    Eastwell, Peter

    2012-01-01

    This paper defines the terms "hypothesis," "prediction," and "conclusion" and shows how to use the terms correctly in scientific investigations in both the school and science education research contexts. The scientific method, or hypothetico-deductive (HD) approach, is described and it is argued that an understanding of the scientific method,…

  18. A sequential hypothesis test based on a generalized Azuma inequality

    NARCIS (Netherlands)

    Reijsbergen, D.P.; Scheinhardt, Willem R.W.; de Boer, Pieter-Tjerk

    We present a new power-one sequential hypothesis test based on a bound for the probability that a bounded zero-mean martingale ever crosses a curve of the form $a(n+k)^b$. The proof of the bound is of independent interest.

  19. Planned Hypothesis Tests Are Not Necessarily Exempt from Multiplicity Adjustment

    Science.gov (United States)

    Frane, Andrew V.

    2015-01-01

    Scientific research often involves testing more than one hypothesis at a time, which can inflate the probability that a Type I error (false discovery) will occur. To prevent this Type I error inflation, adjustments can be made to the testing procedure that compensate for the number of tests. Yet many researchers believe that such adjustments are…

  20. A default Bayesian hypothesis test for correlations and partial correlations

    NARCIS (Netherlands)

    Wetzels, R.; Wagenmakers, E.J.

    2012-01-01

    We propose a default Bayesian hypothesis test for the presence of a correlation or a partial correlation. The test is a direct application of Bayesian techniques for variable selection in regression models. The test is easy to apply and yields practical advantages that the standard frequentist tests