WorldWideScience

Sample records for integrated specificity comment

  1. In Search of Integrated Specificity: Comment on Denson, Spanovic, and Miller (2009)

    Science.gov (United States)

    Miller, Gregory E.

    2009-01-01

    Psychologists have long been interested in the integrated specificity hypothesis, which maintains that stressors elicit fairly distinct behavioral, emotional, and biological responses that are molded by selective pressures to meet specific demands from the environment. This issue of "Psychological Bulletin" features a meta-analytic review of the…

  2. In search of integrated specificity: comment on Denson, Spanovic, and Miller (2009).

    Science.gov (United States)

    Miller, Gregory E

    2009-11-01

    Psychologists have long been interested in the integrated specificity hypothesis, which maintains that stressors elicit fairly distinct behavioral, emotional, and biological responses that are molded by selective pressures to meet specific demands from the environment. This issue of Psychological Bulletin features a meta-analytic review of the evidence for this proposition by T. F. Denson, M. Spanovic, and N. Miller. Their review concluded that the meta-analytic findings support the "core concept behind the integrated specificity model" (p. 845) and reveal that "within the context of a stressful event, organisms produce an integrated and coordinated response at multiple levels (i.e., cognitive, emotional, physiological)" (p. 845). I argue that conclusions such as this are unwarranted, given the data. Aside from some effects for cortisol, little evidence of specificity was presented, and most of the significant findings reported would be expected by chance alone. I also contend that Denson et al. failed to consider some important sources of evidence bearing on the specificity hypothesis, particularly how appraisals and emotions couple with autonomic nervous system endpoints and functional indices of immune response. If selective pressures did give rise to an integrated stress response, such pathways almost certainly would have been involved. By omitting such outcomes from the meta-analysis, Denson et al. overlooked what are probably the most definitive tests of the specificity hypothesis. As a result, the field is back where it started: with a lot of affection for the concept of integrated specificity but little in the way of definitive evidence to refute or accept it.

  3. Review panel comments on geomedia specific research

    International Nuclear Information System (INIS)

    Heath, C.A.

    1984-01-01

    This includes remarks made by three panel members concerning geomedia-specific repository relevant research. The scientific work in the materials area has progressed significantly. Investigators are showing a better understanding of the importance of groundwater compositions. Significant attention is being paid to the importance of colloids and complexing agents. Good planning seems to be in evidence in the Nevada program. Much cooperation and planning in the materials program is needed. Requirements concerning the performance of waste management systems were included. Other topics discussed at the symposium were interactive testing of waste forms, canister materials, and repository rock. Characterization of the chemical and physical environment in the near-field was considered by several speakers. These papers and discussions were part of the Seventh International Symposium on the Scientific Ban's for Nuclear Waste Management

  4. Management of comments on DOE's Site Characterization Plan (SCP) and integration with the planned geotechnical program

    International Nuclear Information System (INIS)

    Bjerstedt, T.W.; Gil, A.V.; Baird, F.A.

    1991-01-01

    The US DOE has committed to respond to comments on the SCP throughout the site characterization process. As of January 1990 DOE has received 4,574 comments on both the SCP/Consultation Draft and the statutory SCP. Of these, 2,662 responses have been completed and returned to the originators. Many comments are programmatic in nature and express diverse concerns beyond the scope of the SCP. DOE uses a three-tiered process in responding to comments that integrated technical and management responsibilities. The process defines specific roles in developing, reviewing, and concurring on responses. Commitments or open-items can be generated in DOE responses to comments, which are tracked on a relational database. Major changes reflected in the Secretary of Energy's 1989 reassessment of the high-level waste program were advocated in comments on the SCP. Most DOE commitments, however, deal with consideration of recommendations contained in SCP comments relevant to low-levels of technical planning detail (SCP Study Plans). Commitments are discharged when referred to the appropriate quality-affecting or management process whereupon their merits can be evaluated

  5. 78 FR 63170 - Integrated Postsecondary Education Data System (IPEDS) 2013-2016; Extension of Public Comment...

    Science.gov (United States)

    2013-10-23

    ... DEPARTMENT OF EDUCATION Integrated Postsecondary Education Data System (IPEDS) 2013-2016; Extension of Public Comment Period; Correction AGENCY: Department of Education. ACTION: Correction notice... entitled, ``Integrated Postsecondary Education Data System (IPEDS) 2013-2016''. The comment period for this...

  6. RD53A Integrated Circuit Specifications

    OpenAIRE

    Garcia-Sciveres, Mauricio

    2015-01-01

    Specifications for the RD53 collaboration’s first engineering wafer run of an integrated circuit (IC) for hybrid pixel detector readout, called RD53A. RD53A is intended to demonstrate in a large format IC the suitability of the technology (including radiation tolerance), the stable low threshold operation, and the high hit and trigger rate capabilities, required for HL-LHC upgrades of ATLAS and CMS. The wafer scale production will permit the experiments to prototype bump bonding assembly with...

  7. RD53A Integrated Circuit Specifications

    CERN Document Server

    Garcia-Sciveres, Mauricio

    2015-01-01

    Specifications for the RD53 collaboration’s first engineering wafer run of an integrated circuit (IC) for hybrid pixel detector readout, called RD53A. RD53A is intended to demonstrate in a large format IC the suitability of the technology (including radiation tolerance), the stable low threshold operation, and the high hit and trigger rate capabilities, required for HL-LHC upgrades of ATLAS and CMS. The wafer scale production will permit the experiments to prototype bump bonding assembly with realistic sensors in this new technology and to measure the performance of hybrid assemblies. RD53A is not intended to be a final production IC for use in an experiment, and will contain design variations for testing purposes, making the pixel matrix non-uniform.

  8. Comment

    DEFF Research Database (Denmark)

    Sørensen, Peter Birch

    1999-01-01

    Comment on: Besley and Seabright (1999) The effects and policy implications of state aid to industry: an economic analysis. Economic Policy 14 (28), 13-53......Comment on: Besley and Seabright (1999) The effects and policy implications of state aid to industry: an economic analysis. Economic Policy 14 (28), 13-53...

  9. Comment

    DEFF Research Database (Denmark)

    Sørensen, Peter Birch

    1999-01-01

    Comment on: Alessandra Casella (1999) Tradable deficit permits: efficient implementation of the Stability Pact in the European Monetary Union. Economic Policy 14 (29), 321-362......Comment on: Alessandra Casella (1999) Tradable deficit permits: efficient implementation of the Stability Pact in the European Monetary Union. Economic Policy 14 (29), 321-362...

  10. The Use of Non-Specific Comments in a Conversation Aid for Non-Speaking People.

    Science.gov (United States)

    Todman, John; Morrison, Zara

    1995-01-01

    TALK (Talk Aid using pre-Loaded Knowledge) is a computer system linked to a speech synthesizer which enables nonspeaking people to engage in real-time social conversation. TALK provides categories of general comments that can be used whenever a suitable specific response is unavailable. Results are reported of a study evaluating effectiveness of…

  11. A CNN-Specific Integrated Processor

    Directory of Open Access Journals (Sweden)

    Suleyman Malki

    2009-01-01

    Full Text Available Integrated Processors (IP are algorithm-specific cores that either by programming or by configuration can be re-used within many microelectronic systems. This paper looks at Cellular Neural Networks (CNN to become realized as IP. First current digital implementations are reviewed, and the memoryprocessor bandwidth issues are analyzed. Then a generic view is taken on the structure of the network, and a new intra-communication protocol based on rotating wheels is proposed. It is shown that this provides for guaranteed high-performance with a minimal network interface. The resulting node is small and supports multi-level CNN designs, giving the system a 30-fold increase in capacity compared to classical designs. As it facilitates multiple operations on a single image, and single operations on multiple images, with minimal access to the external image memory, balancing the internal and external data transfer requirements optimizes the system operation. In conventional digital CNN designs, the treatment of boundary nodes requires additional logic to handle the CNN value propagation scheme. In the new architecture, only a slight modification of the existing cells is necessary to model the boundary effect. A typical prototype for visual pattern recognition will house 4096 CNN cells with a 2% overhead for making it an IP.

  12. Comments on the Calculations of Specific Electricity and Fuel Consumption

    DEFF Research Database (Denmark)

    Jørgensen, Kaj

    1996-01-01

    Calculation of specific consumption of electricity and fuel for model electrical vehicles (passenger cars and vans). Both the present technological level and projected future technological developments. Used as background paper for a review of the scope for electrical vehicles in Denmark, carried...

  13. 78 FR 16259 - Agency Information Collection Activities; Comment Request; Integrated Postsecondary Education...

    Science.gov (United States)

    2013-03-14

    ... collection system designed to collect basic data from all postsecondary institutions in the United States and...; Comment Request; Integrated Postsecondary Education Data System (IPEDS) 2013-2016 AGENCY: National Center... Postsecondary Education Data System (IPEDS) 2013-2016. OMB Control Number: 1850-0582. Type of Review: Revision...

  14. Comment on integrability in Dijkgraaf-Vafa {beta}-ensembles

    Energy Technology Data Exchange (ETDEWEB)

    Mironov, A., E-mail: mironov@lpi.ru [Lebedev Physics Institute (Russian Federation); ITEP, Moscow (Russian Federation); Morozov, A., E-mail: morozov@itep.ru [ITEP, Moscow (Russian Federation); Zakirova, Z., E-mail: zolya_zakirova@mail.ru [Kazan Energy State University, Kazan (Russian Federation)

    2012-05-15

    We briefly discuss the recent claims that the ordinary KP/Toda integrability, which is a characteristic property of ordinary eigenvalue matrix models, persists also for the Dijkgraaf-Vafa (DV) partition functions and for the refined topological vertex. We emphasize that in both cases what is meant is a particular representation of partition functions: a peculiar sum over all DV phases in the first case and hiding the deformation parameters in a sophisticated potential in the second case, i.e. essentially a reformulation of some questions in the new theory in the language of the old one. It is at best obscure if this treatment can be made consistent with the AGT relations and even with the quantization of the underlying integrable systems in the Nekrasov-Shatashvili limit, which seem to require a full-scale {beta}-deformation of individual DV partition functions. Thus, it is unclear if the story of integrability is indeed closed by these recent considerations.

  15. Comment for nuclear data from the FNS integral experiments

    International Nuclear Information System (INIS)

    Maekawa, Hiroshi

    1983-01-01

    Among the integral experiments that were carried out during last one year at FNS, the following three experimental results and their analyses are discribed. 1) Tritium production-rate distribution in a Li 2 O-C assembly, 2) Angle dependent neutron leakage spectra from Li 2 O slab assemblies, 3) Induced activity of Type 316 stainless steel. (author)

  16. Some comments about the use of J1 integral criterion

    International Nuclear Information System (INIS)

    Roche, Roland.

    1977-01-01

    Use of J 1 integral criterion in Post Yield Fracture Mechanics is considered. If J 1 is path independent, it can be considered as a crack tip singularity characterization and then, as a good criterion for crack initiation. But it is not proved that J 1 is path independent in general case. The current practice is to consider a material with a mechanical potential energy, it is to say to suppose that strain energy W is only function of the state of strain, but not of the loading history. It is possible to introduce the defect vector concept (or driving force). The resultants of defect vectors included inside a volume are the surface integrals J vector and L vector. So the general condition for J 1 path indepedence can be written. It seems that J 1 is path independent for radial loading but the question is still open for more complex ways of loading. What is the effect of material memory on the J 1 path dependence [fr

  17. Electrophysiological evidence for speech-specific audiovisual integration

    NARCIS (Netherlands)

    Baart, M.; Stekelenburg, J.J.; Vroomen, J.

    2014-01-01

    Lip-read speech is integrated with heard speech at various neural levels. Here, we investigated the extent to which lip-read induced modulations of the auditory N1 and P2 (measured with EEG) are indicative of speech-specific audiovisual integration, and we explored to what extent the ERPs were

  18. Speech-specificity of two audiovisual integration effects

    DEFF Research Database (Denmark)

    Eskelund, Kasper; Tuomainen, Jyrki; Andersen, Tobias

    2010-01-01

    Seeing the talker’s articulatory mouth movements can influence the auditory speech percept both in speech identification and detection tasks. Here we show that these audiovisual integration effects also occur for sine wave speech (SWS), which is an impoverished speech signal that naïve observers...... often fail to perceive as speech. While audiovisual integration in the identification task only occurred when observers were informed of the speech-like nature of SWS, integration occurred in the detection task both for informed and naïve observers. This shows that both speech-specific and general...... mechanisms underlie audiovisual integration of speech....

  19. System specification/system design document comment review: Plutonium Stabilization and Packaging System. Notes of conference

    International Nuclear Information System (INIS)

    1996-01-01

    A meeting was held between DOE personnel and the BNFL team to review the proposed resolutions to DOE comments on the initial issue of the system specification and system design document for the Plutonium Stabilization and Packaging System. The objectives of this project are to design, fabricate, install, and start up a glovebox system for the safe repackaging of plutonium oxide and metal, with a requirement of a 50-year storage period. The areas discussed at the meeting were: nitrogen in can; moisture instrumentation; glovebox atmosphere; can marking bar coding; weld quality; NFPA-101 references; inner can swabbing; ultimate storage environment; throughput; convenience can screw-top design; furnacetrays; authorization basis; compactor safety; schedule for DOE review actions; fire protection; criticality safety; applicable standards; approach to MC and A; homogeneous oxide; resistance welder power; and tray overfill. Revised resolutions were drafted and are presented

  20. Comment on 'Path integral solution for a Mie-type potential'

    International Nuclear Information System (INIS)

    Steiner, F.

    1985-01-01

    We comment on several incorrect results given in a recent paper by Erkoc and Sever (ES). In particular, it is pointed out that their path integral formula for the one-dimensional Mie-Lennard-Jones potential is wrong, since a quantum correction proportional to (h/2π) 2 - which is a consequence of the stochastic nature of the Feynman paths - has been overlooked. The correct expression can be obtained from a general path integral formula, which we have derived in a previous paper. For the particular potential discussed in detail by ES, we give a complete path integral treatment, which allows us to derive the energies and normalized wave functions of the discrete spectrum. (orig.)

  1. An Integrated Framework to Specify Domain-Specific Modeling Languages

    DEFF Research Database (Denmark)

    Zarrin, Bahram; Baumeister, Hubert

    2018-01-01

    , a logic-based specification language. The drawback of MS DSL Tools is it does not provide a formal and rigorous approach for semantics specifications. In this framework, we use Microsoft DSL Tools to define the metamodel and graphical notations of DSLs, and an extended version of ForSpec as a formal......In this paper, we propose an integrated framework that can be used by DSL designers to implement their desired graphical domain-specific languages. This framework relies on Microsoft DSL Tools, a meta-modeling framework to build graphical domain-specific languages, and an extension of ForSpec...... language to define their semantics. Integrating these technologies under the umbrella of Microsoft Visual Studio IDE allows DSL designers to utilize a single development environment for developing their desired domain-specific languages....

  2. Comment on 'Analytical results for a Bessel function times Legendre polynomials class integrals'

    International Nuclear Information System (INIS)

    Cregg, P J; Svedlindh, P

    2007-01-01

    A result is obtained, stemming from Gegenbauer, where the products of certain Bessel functions and exponentials are expressed in terms of an infinite series of spherical Bessel functions and products of associated Legendre functions. Closed form solutions for integrals involving Bessel functions times associated Legendre functions times exponentials, recently elucidated by Neves et al (J. Phys. A: Math. Gen. 39 L293), are then shown to result directly from the orthogonality properties of the associated Legendre functions. This result offers greater flexibility in the treatment of classical Heisenberg chains and may do so in other problems such as occur in electromagnetic diffraction theory. (comment)

  3. Integrated flight/propulsion control - Subsystem specifications for performance

    Science.gov (United States)

    Neighbors, W. K.; Rock, Stephen M.

    1993-01-01

    A procedure is presented for calculating multiple subsystem specifications given a number of performance requirements on the integrated system. This procedure applies to problems where the control design must be performed in a partitioned manner. It is based on a structured singular value analysis, and generates specifications as magnitude bounds on subsystem uncertainties. The performance requirements should be provided in the form of bounds on transfer functions of the integrated system. This form allows the expression of model following, command tracking, and disturbance rejection requirements. The procedure is demonstrated on a STOVL aircraft design.

  4. Integrating the avoided deforestation in a new agreement on climate. Comments on the current debate related to the reduction of emissions induced by deforestation and forest degradation (REDD) in developing countries

    International Nuclear Information System (INIS)

    Wertz-Kanounnikoff, S.; Tubiana, L.

    2007-01-01

    The authors propose some reflections about the current debate related to the reduction of emissions induced by deforestation and forest degradation (REDD) in developing countries. The author comments the two possibilities about one of the issues in this debate: to decide whether this mechanism must be financed by means of mandatory markets or voluntary funds. She also comments the issue on the institutional framework: to integrate REDD implementation in the framework foreseen by Kyoto beyond 2012, or to integrate it in a distinct agreement or protocol. She discusses the variety of national specificities and expectations, and tries to identify perspectives

  5. System specification for the integrated monitoring and surveillance system

    International Nuclear Information System (INIS)

    1997-09-01

    This System Specification establishes the requirements for the Plutonium Focus Area (PFA) Integrated Monitoring and Surveillance System (IMSS). In this document, ''Integrated Monitoring and Surveillance System'' is used to describe the concept of integrated sensors, computers, personnel, and systems that perform the functions of sensing conditions, acquiring data, monitoring environmental safety and health, controlling and accounting for materials, monitoring material stability, monitoring container integrity, transferring data, and analyzing, reporting, and storing data. This concept encompasses systems (e.g. sensors, personnel, databases, etc.) that are already in place at the sites but may require modifications or additions to meet all identified surveillance requirements. The purpose of this System Specification is to provide Department of Energy (DOE) sites that store plutonium materials with a consolidation of all known requirements for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides. This compilation may be used (1) as a baseline for surveillance system design specifications where 3013 packages of stabilized plutonium metals and oxides will be stored and monitored; (2) as a checklist for evaluating existing surveillance systems to ensure that all requirements are met for the storage and surveillance of 3013 packages of stabilized plutonium metals and oxides; and (3) as a baseline for preparing procurement specifications tailored for site specific storage and surveillance of 3013 packages of stabilized plutonium metals and oxides

  6. Multiloop Integral System Test (MIST): MIST Facility Functional Specification

    International Nuclear Information System (INIS)

    Habib, T.F.; Koksal, C.G.; Moskal, T.E.; Rush, G.C.; Gloudemans, J.R.

    1991-04-01

    The Multiloop Integral System Test (MIST) is part of a multiphase program started in 1983 to address small-break loss-of-coolant accidents (SBLOCAs) specific to Babcock and Wilcox designed plants. MIST is sponsored by the US Nuclear Regulatory Commission, the Babcock ampersand Wilcox Owners Group, the Electric Power Research Institute, and Babcock and Wilcox. The unique features of the Babcock and Wilcox design, specifically the hot leg U-bends and steam generators, prevented the use of existing integral system data or existing integral facilities to address the thermal-hydraulic SBLOCA questions. MIST was specifically designed and constructed for this program, and an existing facility -- the Once Through Integral System (OTIS) -- was also used. Data from MIST and OTIS are used to benchmark the adequacy of system codes, such as RELAP5 and TRAC, for predicting abnormal plant transients. The MIST Functional Specification documents as-built design features, dimensions, instrumentation, and test approach. It also presents the scaling basis for the facility and serves to define the scope of work for the facility design and construction. 13 refs., 112 figs., 38 tabs

  7. Comment

    Science.gov (United States)

    2001-07-01

    schools and colleges are exploring electronic learning through the internet and virtual labs (see Steve Mellema's use of IT in his Lecture for the 21st Century). We aim to provide useful material for everybody at and in between the extremes. But some words of caution, sounded by Robertson in Stirling: today we might find that our classes are motivated and interested when we use computers, but how long will the excitement last? If every lesson faces children with computer screens will they soon get bored and demotivated? Individual learning, through worksheets, was a great success when it was developed in the 70s, but when every lesson faced a child with yet another worksheet, students were turned off. It became known as 'death by a thousand worksheets'. Let's not abuse computers in the same way. Physics for the beach and the igloo Physics is about being cool, as we are always trying to tell our students! In this 'summer' issue we have two papers which allow us to demonstrate this practically. I should also like to remind readers that Physics Education is available online (www.iop.org/Journals/pe) in addition to the paper version. The electronic version has the advantages of hotlinks to websites, search facilities and the ability to download teaching materials. My guess is that we haven't begun to explore the possibilities of the electronic journal as a teaching resource for teachers. If it can be stored electronically, we can include it as a multimedia clip pictures, worksheets, spreadsheets, videos, sounds... But there are also many advantages of paper—convenience and permanence being just two. Physics Education is a worthwhile publication and it feels like that in your hand. Having a journal like this, to put in my bag, or stack on my bookshelf, still feels good to me. And judging by readers' comments, you agree. IOPP will, no doubt, support both formats for a long time to come. So, this summer, enjoy the format you are reading, read Physics Education on screen or on

  8. Comment.

    Science.gov (United States)

    Cossey, D

    1993-01-01

    In the UK, the Chairwoman of the Family Planning Association (FPA) praises the staff and volunteers with whom she has worked for their incessant inability to meet the many challenges they face. During her 6 years, however, the FPA had to reduce the number of regional offices and staff. It did not need to reduce salaries, however. FPA membership directly elects the National Executive Council which is now smaller. FPA is exploring new sources of funding and is adapting to the purchaser/provider relationship in the statutory sector, resulting in its successful financial strategy. The Department of Health helps in maintaining FPA's ability to continue to operate. The Chairwoman sees indications of needing to fight old battles again, e.g., some officials have suggested limiting the range of oral contraceptives available from prescription by the National Health Services (NHS) which would be the end of almost 20 years of free contraception and free choice under the NHS. The government is not open to including sex education the school curriculum. The NHS gives the impression in its report "The Health of the Nation" that it is committed to reducing adolescent pregnancies among the youngest teenagers and to recognizing the importance of good policies on sexual health. Yet, its actions exhibit no compassion for single parents. Participants at FPA's 1992 conference agree that variety, quality, and sensitivity of family planning provisions are needed and that family planning clinics and general practitioners should work together. FPA has contributed to the UK the clinic network; the concept of family planning being an integral part of a comprehensive health service; and the notion that family planning includes contraception, empowerment of women, sexual health, rights, and responsibilities. FPA should reaffirm these ideas and secure the future for informed choice and planned pregnancy.

  9. Specific and Complete Local Integration of Patterns in Bayesian Networks

    Directory of Open Access Journals (Sweden)

    Martin Biehl

    2017-05-01

    Full Text Available We present a first formal analysis of specific and complete local integration. Complete local integration was previously proposed as a criterion for detecting entities or wholes in distributed dynamical systems. Such entities in turn were conceived to form the basis of a theory of emergence of agents within dynamical systems. Here, we give a more thorough account of the underlying formal measures. The main contribution is the disintegration theorem which reveals a special role of completely locally integrated patterns (what we call ι-entities within the trajectories they occur in. Apart from proving this theorem we introduce the disintegration hierarchy and its refinement-free version as a way to structure the patterns in a trajectory. Furthermore, we construct the least upper bound and provide a candidate for the greatest lower bound of specific local integration. Finally, we calculate the ι -entities in small example systems as a first sanity check and find that ι -entities largely fulfil simple expectations.

  10. USER SPECIFICATIONS FOR PRESSURE VESSELS AND TECHNICAL INTEGRITY

    Directory of Open Access Journals (Sweden)

    K.S. Johnston

    2012-01-01

    Full Text Available

    ENGLISH ABSTRACT: Specifications translated from user requirements are prescribed in an attempt to capture and incorporate best practices with regards to the design, fabrication, testing, and operation of pressure vessels. The question as to whether these requirements affect the technical integrity of pressure vessels is often a subjective matter. This paper examines typical user requirement specifications against technical integrity of pressure vessels.
    The paper draws on a survey of a convenience sample of practising engineers in a diversified petrochemical company. When compared with failures on selected pressure vessels recorded by Phillips and Warwick, the respondent feedback confirms the user specifications that have the highest impact on technical integrity.

    AFRIKAANSE OPSOMMING: Gebruikersbehoeftes word saamgevat in spesifikasies wat lei tot goeie praktyk vir ontwerp, vervaarding, toetsing en bedryf van drukvate. Subjektiwiteit van die gebruikersbehoeftes mag soms die tegniese integriteit van ‘n drukvat beinvloed.
    Die navorsing maak by wyse van monsterneming gebruik van die kennis van ingenieurs wat werk in ‘n gediversifiseerde petrochemiese bedryf. Die terugvoering bevestig dat bogenoemde spesifikasies inderdaad die grootste invloed het op tegniese integriteit.

  11. Electrophysiological evidence for speech-specific audiovisual integration.

    Science.gov (United States)

    Baart, Martijn; Stekelenburg, Jeroen J; Vroomen, Jean

    2014-01-01

    Lip-read speech is integrated with heard speech at various neural levels. Here, we investigated the extent to which lip-read induced modulations of the auditory N1 and P2 (measured with EEG) are indicative of speech-specific audiovisual integration, and we explored to what extent the ERPs were modulated by phonetic audiovisual congruency. In order to disentangle speech-specific (phonetic) integration from non-speech integration, we used Sine-Wave Speech (SWS) that was perceived as speech by half of the participants (they were in speech-mode), while the other half was in non-speech mode. Results showed that the N1 obtained with audiovisual stimuli peaked earlier than the N1 evoked by auditory-only stimuli. This lip-read induced speeding up of the N1 occurred for listeners in speech and non-speech mode. In contrast, if listeners were in speech-mode, lip-read speech also modulated the auditory P2, but not if listeners were in non-speech mode, thus revealing speech-specific audiovisual binding. Comparing ERPs for phonetically congruent audiovisual stimuli with ERPs for incongruent stimuli revealed an effect of phonetic stimulus congruency that started at ~200 ms after (in)congruence became apparent. Critically, akin to the P2 suppression, congruency effects were only observed if listeners were in speech mode, and not if they were in non-speech mode. Using identical stimuli, we thus confirm that audiovisual binding involves (partially) different neural mechanisms for sound processing in speech and non-speech mode. © 2013 Published by Elsevier Ltd.

  12. Integrating Occupational Therapy Specific Assessments in Practice: Exploring Practitioner Experiences

    Directory of Open Access Journals (Sweden)

    Eric Asaba

    2017-01-01

    Full Text Available Background. Occupational therapists sometimes find it challenging to integrate client-centered and occupational therapy specific assessments in practice. The aim of this study was to explore the use of occupational therapy specific assessments such as the Assessment of Motor and Process Skills (AMPS among occupational therapists in Sweden and Japan. Methods. Interviews and qualitative thematic analyses were utilized. Findings. Four themes are reported: (1 use it or lose it, (2 simply no space until after hours, (3 biggest barriers can be colleagues, and (4 being more specific: communication. Conclusion. In keeping with previous studies, occupational therapists often find it challenging to implement client-centered and occupation-based assessment tools into practice. However, more work is needed to understand how best practices can be incorporated into a changing occupational therapy daily practice.

  13. Integrating Cloud-Computing-Specific Model into Aircraft Design

    Science.gov (United States)

    Zhimin, Tian; Qi, Lin; Guangwen, Yang

    Cloud Computing is becoming increasingly relevant, as it will enable companies involved in spreading this technology to open the door to Web 3.0. In the paper, the new categories of services introduced will slowly replace many types of computational resources currently used. In this perspective, grid computing, the basic element for the large scale supply of cloud services, will play a fundamental role in defining how those services will be provided. The paper tries to integrate cloud computing specific model into aircraft design. This work has acquired good results in sharing licenses of large scale and expensive software, such as CFD (Computational Fluid Dynamics), UG, CATIA, and so on.

  14. Comment on 'Integral cross sections for electron impact excitation of electronic states of N2'

    International Nuclear Information System (INIS)

    Cenian, A; Chernukho, A; Bogaerts, A; Gijbels, R

    2002-01-01

    Based on the existing experimental data and their statistical errors, it is not possible to make a sound recommendation of the cross-section set of Campbell et al (J. Phys. B: At. Mol. Opt. Phys. 34 (2001) 1185). We comment on this paper. (comment)

  15. Reactor protection system design using application specific integrated circuits

    International Nuclear Information System (INIS)

    Battle, R.E.; Bryan, W.L.; Kisner, R.A.; Wilson, T.L. Jr.

    1992-01-01

    Implementing reactor protection systems (RPS) or other engineering safeguard systems with application specific integrated circuits (ASICs) offers significant advantages over conventional analog or software based RPSs. Conventional analog RPSs suffer from setpoints drifts and large numbers of discrete analog electronics, hardware logic, and relays which reduce reliability because of the large number of potential failures of components or interconnections. To resolve problems associated with conventional discrete RPSs and proposed software based RPS systems, a hybrid analog and digital RPS system implemented with custom ASICs is proposed. The actual design of the ASIC RPS resembles a software based RPS but the programmable software portion of each channel is implemented in a fixed digital logic design including any input variable computations. Set point drifts are zero as in proposed software systems, but the verification and validation of the computations is made easier since the computational logic an be exhaustively tested. The functionality is assured fixed because there can be no future changes to the ASIC without redesign and fabrication. Subtle error conditions caused by out of order evaluation or time dependent evaluation of system variables against protection criteria are eliminated by implementing all evaluation computations in parallel for simultaneous results. On- chip redundancy within each RPS channel and continuous self-testing of all channels provided enhanced assurance that a particular channel is available and faults are identified as soon as possible for corrective actions. The use of highly integrated ASICs to implement channel electronics rather than the use of discrete electronics greatly reduces the total number of components and interconnections in the RPS to further increase system reliability. A prototype ASIC RPS channel design and the design environment used for ASIC RPS systems design is discussed

  16. Context-specific effects of musical expertise on audiovisual integration

    Science.gov (United States)

    Bishop, Laura; Goebl, Werner

    2014-01-01

    Ensemble musicians exchange auditory and visual signals that can facilitate interpersonal synchronization. Musical expertise improves how precisely auditory and visual signals are perceptually integrated and increases sensitivity to asynchrony between them. Whether expertise improves sensitivity to audiovisual asynchrony in all instrumental contexts or only in those using sound-producing gestures that are within an observer's own motor repertoire is unclear. This study tested the hypothesis that musicians are more sensitive to audiovisual asynchrony in performances featuring their own instrument than in performances featuring other instruments. Short clips were extracted from audio-video recordings of clarinet, piano, and violin performances and presented to highly-skilled clarinetists, pianists, and violinists. Clips either maintained the audiovisual synchrony present in the original recording or were modified so that the video led or lagged behind the audio. Participants indicated whether the audio and video channels in each clip were synchronized. The range of asynchronies most often endorsed as synchronized was assessed as a measure of participants' sensitivities to audiovisual asynchrony. A positive relationship was observed between musical training and sensitivity, with data pooled across stimuli. While participants across expertise groups detected asynchronies most readily in piano stimuli and least readily in violin stimuli, pianists showed significantly better performance for piano stimuli than for either clarinet or violin. These findings suggest that, to an extent, the effects of expertise on audiovisual integration can be instrument-specific; however, the nature of the sound-producing gestures that are observed has a substantial effect on how readily asynchrony is detected as well. PMID:25324819

  17. General guidelines about performance specifications for purchasing equipment for x-ray diagnostics, with comments

    International Nuclear Information System (INIS)

    1995-12-01

    These general guidelines are intended to be used as a basis for what requirements are reasonable from a radiation protection point of view and should be part of the contract in connection with the purchase of equipment for x-ray diagnostics. Technical performance requirements are addressed as well as items like documentation, instructions for use and education and training. The guidelines are also useful for the design of quality assurance programs. In the comments in addition to these guidelines legal aspects are noted, including a list of relevant laws, regulations and directives. Standards, both national and international, within the field are referred to with a short description of their content. 40 refs

  18. General guidelines about performance specifications for purchasing equipment for x-ray diagnostics, with comments

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-01

    These general guidelines are intended to be used as a basis for what requirements are reasonable from a radiation protection point of view and should be part of the contract in connection with the purchase of equipment for x-ray diagnostics. Technical performance requirements are addressed as well as items like documentation, instructions for use and education and training. The guidelines are also useful for the design of quality assurance programs. In the comments in addition to these guidelines legal aspects are noted, including a list of relevant laws, regulations and directives. Standards, both national and international, within the field are referred to with a short description of their content. 40 refs.

  19. Response to Niklasson's comment on Lin, et al. (2012) : "the relation between postural movement and bilateral motor integration".

    Science.gov (United States)

    Lin, Chin-Kai; Kuo, Bor-Chen; Wu, Huey-Min

    2014-10-01

    In the study of Lin, Wu, Lin, Wu, Wu, Kuo, and Yeung (2012 ), the relationship between the validity of postural movement and bilateral motor integration in terms of sensory integration theory was examined. Postural movement is the ability to use the antigravity postures required for stabilization of the neck, trunk and upper extremities via muscle co-contractions in the neck and upper extremities, and balance. Niklasson's (2013 ) comment argued that postural movement should include primitive reflexes in terms of the general abilities approach. Niklasson (2013 ) focused on the efficacy of the treatment rather than the theoretical frameworks implied in the therapeutic activities. For that purpose Lin, et al. (2012 ) used sensory integration as the theoretical foundation, and the relationship between postural movement and bilateral motor integration was assessed via empirical data. The result of Lin, et al. (2012 ) was offered as a theoretical reference for therapeutic activities.

  20. An integrated in silico approach to design specific inhibitors targeting human poly(a-specific ribonuclease.

    Directory of Open Access Journals (Sweden)

    Dimitrios Vlachakis

    Full Text Available Poly(A-specific ribonuclease (PARN is an exoribonuclease/deadenylase that degrades 3'-end poly(A tails in almost all eukaryotic organisms. Much of the biochemical and structural information on PARN comes from the human enzyme. However, the existence of PARN all along the eukaryotic evolutionary ladder requires further and thorough investigation. Although the complete structure of the full-length human PARN, as well as several aspects of the catalytic mechanism still remain elusive, many previous studies indicate that PARN can be used as potent and promising anti-cancer target. In the present study, we attempt to complement the existing structural information on PARN with in-depth bioinformatics analyses, in order to get a hologram of the molecular evolution of PARNs active site. In an effort to draw an outline, which allows specific drug design targeting PARN, an unequivocally specific platform was designed for the development of selective modulators focusing on the unique structural and catalytic features of the enzyme. Extensive phylogenetic analysis based on all the publicly available genomes indicated a broad distribution for PARN across eukaryotic species and revealed structurally important amino acids which could be assigned as potentially strong contributors to the regulation of the catalytic mechanism of PARN. Based on the above, we propose a comprehensive in silico model for the PARN's catalytic mechanism and moreover, we developed a 3D pharmacophore model, which was subsequently used for the introduction of DNP-poly(A amphipathic substrate analog as a potential inhibitor of PARN. Indeed, biochemical analysis revealed that DNP-poly(A inhibits PARN competitively. Our approach provides an efficient integrated platform for the rational design of pharmacophore models as well as novel modulators of PARN with therapeutic potential.

  1. Gesture-speech integration in children with specific language impairment.

    Science.gov (United States)

    Mainela-Arnold, Elina; Alibali, Martha W; Hostetter, Autumn B; Evans, Julia L

    2014-11-01

    Previous research suggests that speakers are especially likely to produce manual communicative gestures when they have relative ease in thinking about the spatial elements of what they are describing, paired with relative difficulty organizing those elements into appropriate spoken language. Children with specific language impairment (SLI) exhibit poor expressive language abilities together with within-normal-range nonverbal IQs. This study investigated whether weak spoken language abilities in children with SLI influence their reliance on gestures to express information. We hypothesized that these children would rely on communicative gestures to express information more often than their age-matched typically developing (TD) peers, and that they would sometimes express information in gestures that they do not express in the accompanying speech. Participants were 15 children with SLI (aged 5;6-10;0) and 18 age-matched TD controls. Children viewed a wordless cartoon and retold the story to a listener unfamiliar with the story. Children's gestures were identified and coded for meaning using a previously established system. Speech-gesture combinations were coded as redundant if the information conveyed in speech and gesture was the same, and non-redundant if the information conveyed in speech was different from the information conveyed in gesture. Children with SLI produced more gestures than children in the TD group; however, the likelihood that speech-gesture combinations were non-redundant did not differ significantly across the SLI and TD groups. In both groups, younger children were significantly more likely to produce non-redundant speech-gesture combinations than older children. The gesture-speech integration system functions similarly in children with SLI and TD, but children with SLI rely more on gesture to help formulate, conceptualize or express the messages they want to convey. This provides motivation for future research examining whether interventions

  2. Specification and Generation of Adapters for System Integration

    NARCIS (Netherlands)

    Mooij, A.J.; Voorhoeve, M.

    2013-01-01

    Large systems-of-systems are developed by integrating several smaller systems that have been developed independently. System integration often requires adaptation mechanisms for bridging any technical incompatibilities between the systems. In order to develop adapters in a faster way, we study ways

  3. Closed expressions for specific massive multiloop self-energy integrals

    International Nuclear Information System (INIS)

    Berends, F.A.; Boehm, M.; Buza, M.; Scharf, R.

    1994-01-01

    In this paper the class of N loop massive scalar self-energy diagrams with N + 1 propagators is studied in an arbitrary number of dimensions. As it is known these integrals cannot be expressed in terms of polylogarithms. Here it is shown, however, that they can be described by generalized hypergeometric functions of several variables, namely Laricella functions. These results represent previous small and large momentum expansions in closed form. Numerical comparisons for the finite part in four dimensions with a two-dimensional integral representation show good agreement. (orig.)

  4. Application specific integrated circuit for high temperature oil well applications

    Energy Technology Data Exchange (ETDEWEB)

    Fallet, T.; Gakkestad, J.; Forre, G.

    1994-12-31

    This paper describes the design of an integrated BiCMOS circuit for high temperature applications. The circuit contains Pierce oscillators with automatic gain control, and measurements show that it is operating up to 266{sup o}C. The relative frequency variation up to 200 {sup o}C is less than 60 ppm caused mainly by the crystal element itself. 4 refs., 7 figs.

  5. Summary of comments received at workshop on use of a Site Specific Advisory Board (SSAB) to facilitate public participation in decommissioning cases

    International Nuclear Information System (INIS)

    Caplin, J.; Padge, G.; Smith, D.; Wiblin, C.

    1995-06-01

    The Nuclear Regulatory Commission (NRC) is conducting an enhanced participatory rulemaking to establish radiological criteria for the decommissioning of NRC-licensed facilities. As part of this rulemaking, On August 20, 1994 the NRC published a proposed rule for public comment. Paragraph 20.1406(b) of the proposed rule would require that the licensee convene a Site Specific Advisory Board (SSAB) if the licensee proposed release of the site for restricted use after decommissioning. To encourage comment the NRC held a workshop on the subject of $SABs on December 6, 7, and 8, 1994. This report summarizes the 567 comments categorized from the transcript of the workshop. The commenters at the workshop generally supported public participation in decommissioning cases. Many participants favored promulgating requirements in the NRC's rules. Some industry participants favored relying on voluntary exchanges between the public and the licensees. Many participants indicated that a SSAB or something functionally equivalent is needed in controversial decommissioning cases, but that some lesser undertaking can achieve meaningful public participation in other cases. No analysis or response to the comments is included in this report

  6. The specification of a hospital cost function. A comment on the recent literature.

    Science.gov (United States)

    Breyer, F

    1987-06-01

    In the empirical estimation of hospital cost functions, two radically different types of specifications have been chosen to date, ad-hoc forms and flexible functional forms based on neoclassical production theory. This paper discusses the respective strengths and weaknesses of both approaches and emphasizes the apparently unreconcilable conflict between the goals of maintaining functional flexibility and keeping the number of variables manageable if at the same time patient heterogeneity is to be adequately reflected in the case mix variables. A new specification is proposed which strikes a compromise between these goals, and the underlying assumptions are discussed critically.

  7. Task Specificity and the Influence of Memory on Visual Search: Comment on Vo and Wolfe (2012)

    Science.gov (United States)

    Hollingworth, Andrew

    2012-01-01

    Recent results from Vo and Wolfe (2012b) suggest that the application of memory to visual search may be task specific: Previous experience searching for an object facilitated later search for that object, but object information acquired during a different task did not appear to transfer to search. The latter inference depended on evidence that a…

  8. Comment on “Drug Screening for ALS Using Patient-Specific Induced Pluripotent Stem Cells”

    Science.gov (United States)

    Bilican, Bilada; Serio, Andrea; Barmada, Sami J.; Nishimura, Agnes Lumi; Sullivan, Gareth J.; Carrasco, Monica; Phatnani, Hemali P.; Puddifoot, Clare A.; Story, David; Fletcher, Judy; Park, In-Hyun; Friedman, Brad A.; Daley, George Q.; Wyllie, David J. A.; Hardingham, Giles E.; Wilmut, Ian; Finkbeiner, Steven; Maniatis, Tom; Shaw, Christopher E.; Chandran, Siddharthan

    2014-01-01

    Egawa et al. recently showed the value of patient-specific induced pluripotent stem cells (iPSCs) for modeling amyotrophic lateral sclerosis in vitro. Their study and our work highlight the need for complementary assays to detect small, but potentially important, phenotypic differences between control iPSC lines and those carrying disease mutations. PMID:23740897

  9. Comments on 'SKB RD and D-Programme 98'. Focused on canister integrity and corrosion

    International Nuclear Information System (INIS)

    Bowyer, W.H.; Hermansson, H.P.

    1999-04-01

    According to the Act on Nuclear Activities the nuclear utilities are requested to submit a comprehensive programme for research and development every third year, aiming at the safe storage of radioactive waste produced by the nuclear power plants. The latest was published by SKB in September 1998 and is called the 'RDandD Programme 98'. The work presented in the present report was commissioned by SKI and is a result of reading the 'RDandD Programme 98' and related reports with focus on canister production, integrity and corrosion. We find that those parts of the programme often are difficult to follow owing to the lack of detail in the Programme and in one of the supporting reports. In our opinion this will make the work difficult to monitor by SKI and SKB. We also feel that the interpretation of information already available often is overoptimistic. As a consequence the difficulties ahead are understated and the programme is allowed to converge too quickly. We agree that the materials choices for both the inner and outer canisters are appropriate providing they both can be produced commercially and in a satisfactory metallurgical condition, that they can be quality assured and that no further unforeseen difficulties arise. We also agree that alternative technologies merit consideration for production of the outer canister and that alternative joining processes should be studied. We are actually concerned that greater prominence is not given to the alternatives in the programme. We believe that it should be possible to develop a satisfactory canister for disposal of high level nuclear waste according to the general method proposed by SKB and with the proposed capacity within the time-scale of the overall programme. We do not believe, however, that all the difficulties have been recognised. As a consequence of this the results to date are interpreted optimistically. We believe that progress should be subjected to more professional review within SKB and that a higher

  10. Practice specific model regulations: Radiation safety of non-medical irradiation facilities. Interim report for comment

    International Nuclear Information System (INIS)

    2003-08-01

    the infrastructure aimed at achieving its maximum efficiency, and extensively covers performance regulations. The BSS cover the application of ionizing radiation for all practices and interventions and are, therefore, basic and general in nature. Users must apply these basic requirements to their own particular practices. In this context, the preamble of the BSS states that: 'The Regulatory Authority may need to provide guidance on how certain regulatory requirements are to be fulfilled for various practices, for example in regulatory guideline documents.' There are certain requirements that, when applied to specific practices, can be fulfilled through virtually only one practical solution. In these cases, the regulatory authority would use a 'shall' statement for this solution. To meet other requirements, there may be more than one option. In these cases the regulatory authority would usually indicate the recommended option with a 'should' statement, which implies that licensees may choose another alternative provided that the level of safety is equivalent. This distinction has been maintained in this 'model regulations' for irradiation facilities in order to facilitate the decision of regulatory authorities on the degree of obligation

  11. Selective pressures to maintain attachment site specificity of integrative and conjugative elements.

    Directory of Open Access Journals (Sweden)

    Kayla L Menard

    Full Text Available Integrative and conjugative elements (ICEs are widespread mobile genetic elements that are usually found integrated in bacterial chromosomes. They are important agents of evolution and contribute to the acquisition of new traits, including antibiotic resistances. ICEs can excise from the chromosome and transfer to recipients by conjugation. Many ICEs are site-specific in that they integrate preferentially into a primary attachment site in the bacterial genome. Site-specific ICEs can also integrate into secondary locations, particularly if the primary site is absent. However, little is known about the consequences of integration of ICEs into alternative attachment sites or what drives the apparent maintenance and prevalence of the many ICEs that use a single attachment site. Using ICEBs1, a site-specific ICE from Bacillus subtilis that integrates into a tRNA gene, we found that integration into secondary sites was detrimental to both ICEBs1 and the host cell. Excision of ICEBs1 from secondary sites was impaired either partially or completely, limiting the spread of ICEBs1. Furthermore, induction of ICEBs1 gene expression caused a substantial drop in proliferation and cell viability within three hours. This drop was dependent on rolling circle replication of ICEBs1 that was unable to excise from the chromosome. Together, these detrimental effects provide selective pressure against the survival and dissemination of ICEs that have integrated into alternative sites and may explain the maintenance of site-specific integration for many ICEs.

  12. Life sciences payload definition and integration study, task C and D. Volume 4: Preliminary equipment item specification catalog

    Science.gov (United States)

    1973-01-01

    A specification catalog to define the equipment to be used for conducting life sciences experiments in a space laboratory is presented. The specification sheets list the purpose of the equipment item, and any specific technical requirements which can be identified. The status of similar hardware for ground use is stated with comments regarding modifications required to achieve spaceflight qualified hardware. Pertinent sketches, commercial catalog sheets, or drawings of the applicable equipment are included.

  13. 77 FR 21158 - VA Directive 0005 on Scientific Integrity: Availability for Review and Comment

    Science.gov (United States)

    2012-04-09

    ... Draft VA Directive 0005 on Scientific Integrity: [square] Fosters a culture of transparency, integrity, and ethical behavior in the development and application of scientific and technological findings in VA... information from inappropriate political or commercial influence; [square] Ensures that selection and...

  14. Theoretical Orientation and Psychotherapy Integration: Comment on Poznanski and McLennan.

    Science.gov (United States)

    Arnkoff, Diane B.

    1995-01-01

    Considers Poznanski and McLennan's (1995) discussion and proposals for measurement of theoretical orientation in light of recent interest in psychotherapy integration. Presents suggestions to allow better assessment of the orientation of counselors who espouse integrative theories or technical eclecticism. (JPS)

  15. Comment on id-based remote data integrity checking with data privacy preserving

    Science.gov (United States)

    Zhang, Jianhong; Meng, Hongxin

    2017-09-01

    Recently, an ID-based remote data integrity checking protocol with perfect data privacy preserving (IEEE Transactions on Information Forensics and Security, doi: 10.1109/TIFS.2016.2615853) was proposed to achieve data privacy protection and integrity checking. Unfortunately, in this letter, we demonstrate that their protocol is insecure. An active hacker can modify the stored data without being detected by the verifier in the auditing. And we also show malicious cloud server can convince the verifier that the stored data are kept intact after the outsourced data blocks are deleted. Finally, the reasons to produce such attacks are given.

  16. 76 FR 42735 - Comment Request for Information Collection for State Integrated Workforce Plan Requirements for...

    Science.gov (United States)

    2011-07-19

    .../Wagner- Peyser ``stand-alone'' planning guidance, formerly entitled ``Planning Guidance and Instructions... Seasonal Farmworker (MSFW) Annual Outreach Plan (AOP), Trade Adjustment Assistance (TAA), and Senior... integrate DOL-funded programs into a single plan, it does not replace Unified Plan guidance that exists...

  17. Some comments on rigorous quantum field path integrals in the analytical regularization scheme

    Energy Technology Data Exchange (ETDEWEB)

    Botelho, Luiz C.L. [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Dept. de Matematica Aplicada]. E-mail: botelho.luiz@superig.com.br

    2008-07-01

    Through the systematic use of the Minlos theorem on the support of cylindrical measures on R{sup {infinity}}, we produce several mathematically rigorous path integrals in interacting euclidean quantum fields with Gaussian free measures defined by generalized powers of the Laplacian operator. (author)

  18. Some comments on rigorous quantum field path integrals in the analytical regularization scheme

    International Nuclear Information System (INIS)

    Botelho, Luiz C.L.

    2008-01-01

    Through the systematic use of the Minlos theorem on the support of cylindrical measures on R ∞ , we produce several mathematically rigorous path integrals in interacting euclidean quantum fields with Gaussian free measures defined by generalized powers of the Laplacian operator. (author)

  19. 76 FR 54245 - Agency Information Collection Activities: Submission for OMB Review; Comment Request, Integrated...

    Science.gov (United States)

    2011-08-31

    ... system to alert and warn the American people in situations of war, terrorist attack, natural disaster, or... Request, Integrated Public Alert and Warning Systems (IPAWS) Inventory AGENCY: Federal Emergency... will continue to consist of the public alert and warning systems, as well as the communication systems...

  20. Comments on the integrability of the loop-space chiral equations

    International Nuclear Information System (INIS)

    Gu, C.; Wang, L.L.C.

    1980-01-01

    A demonstration is given how the ordinary space chiral equations provide the existence conditions for the infinite number of conserved currents and how these currents are related to the so-called inverse-scattering equations, whose integrability is provided by the original chiral equations. Loop-space chiral equations are introduced. The integrability conditions of the non-local currents in two possible different situations are discussed. In the first case, the generating functions are functionals of the loop alone. The integrability conditions are not satisfied and higher order conserved non-local currents do not exist. In the second case, the generating functions are functionals of the loop as well as a parameter the integrability conditions at a restricted point of the parameter are satisfied, however there is an infinite fold of arbitrariness. It indicates that additional guiding principles are needed in addition to the original loop-space chiral equation in order to uniquely determine the infinite conserved non-local currents as functionals of the loop and the parameter

  1. The Social Dimension of Computer-Integrated Manufacturing: An Extended Comment.

    Science.gov (United States)

    Badham, Richard J.

    1991-01-01

    The effect of computer-integrated manufacturing (CIM) on working conditions depends on the way in which the technologies are designed to fit operator requirements, work organization, and organizational objectives. Recent attempts to promote skill-based human-centered approaches to CIM design are aimed at introducing humane working conditions…

  2. Sound specificity effects in spoken word recognition: The effect of integrality between words and sounds.

    Science.gov (United States)

    Strori, Dorina; Zaar, Johannes; Cooke, Martin; Mattys, Sven L

    2018-01-01

    Recent evidence has shown that nonlinguistic sounds co-occurring with spoken words may be retained in memory and affect later retrieval of the words. This sound-specificity effect shares many characteristics with the classic voice-specificity effect. In this study, we argue that the sound-specificity effect is conditional upon the context in which the word and sound coexist. Specifically, we argue that, besides co-occurrence, integrality between words and sounds is a crucial factor in the emergence of the effect. In two recognition-memory experiments, we compared the emergence of voice and sound specificity effects. In Experiment 1 , we examined two conditions where integrality is high. Namely, the classic voice-specificity effect (Exp. 1a) was compared with a condition in which the intensity envelope of a background sound was modulated along the intensity envelope of the accompanying spoken word (Exp. 1b). Results revealed a robust voice-specificity effect and, critically, a comparable sound-specificity effect: A change in the paired sound from exposure to test led to a decrease in word-recognition performance. In the second experiment, we sought to disentangle the contribution of integrality from a mere co-occurrence context effect by removing the intensity modulation. The absence of integrality led to the disappearance of the sound-specificity effect. Taken together, the results suggest that the assimilation of background sounds into memory cannot be reduced to a simple context effect. Rather, it is conditioned by the extent to which words and sounds are perceived as integral as opposed to distinct auditory objects.

  3. Sound specificity effects in spoken word recognition: The effect of integrality between words and sounds

    DEFF Research Database (Denmark)

    Strori, Dorina; Zaar, Johannes; Cooke, Martin

    2017-01-01

    Recent evidence has shown that nonlinguistic sounds co-occurring with spoken words may be retained in memory and affect later retrieval of the words. This sound-specificity effect shares many characteristics with the classic voice-specificity effect. In this study, we argue that the sound......-specificity effect is conditional upon the context in which the word and sound coexist. Specifically, we argue that, besides co-occurrence, integrality between words and sounds is a crucial factor in the emergence of the effect. In two recognition-memory experiments, we compared the emergence of voice and sound...... from a mere co-occurrence context effect by removing the intensity modulation. The absence of integrality led to the disappearance of the sound-specificity effect. Taken together, the results suggest that the assimilation of background sounds into memory cannot be reduced to a simple context effect...

  4. Marketing trends impede conceptual integration in psychology courses: Comment on Gurung et al. (2016).

    Science.gov (United States)

    Carver, Charles S

    2017-01-01

    A recent American Psychologist article on teaching (Gurung et al., 2016) stressed the importance of fostering integration across topic areas. A current trend in publishing and marketing of textbooks is creating pressure that makes this goal harder to implement. The trend is offering custom tailoring of online texts by adopters, letting instructors assign some sections and make other sections unavailable to students. To permit this option, textbook publishers now insist that authors not cross-reference anywhere, so that no instructor will face the possibility of a student looking for material that has not been assigned and thus does not exist. Ironically, this pressure from publishers actively impedes conceptual integration in our textbooks. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  5. Some comments about the J1 integral criterion in post yield fracture mechanics

    International Nuclear Information System (INIS)

    Roche, R.L.

    1977-01-01

    Several criteria have been proposed for Post Yield Fracture Mechanics. One of the most interesting ones is the J 1 integral. When the behaviour of material is elastic (even non-linear) it can be shown that J 1 is not path dependent (for a straight crack without thermal stresses). For this reason, it may be considered that J 1 characterizes the crack tip singularity. Extension is easy to deformation-type elastic plastic material, but there is no proof of path independence for flow-type plastic material (incremental plasticity or creep). Experimental results are often given as a proof of J 1 criterion validity, but there is no experimental value of a contour integral and assumptions are made in the use of experimental results. The main assumption implies that the received mechanical work (strain energy) is not dependent on the loading history (is only dependent on mechanical state). A general method to assess J 1 path dependence can be founded on the 'defect vector' (or driving force) concept. It can be shown that the resultant of defects included in a volumne is the J integral on the surface surrounding the volume (and L for the moment). In order to have an empirical idea of the J 1 path independence, it is possible to make computations with finite elements method. Some results are given and it seems that no noticeable path dependence is seen with simple shapes and radial (proportional) loading. A few cases with complex way of loading are also studied. (Auth.)

  6. Comment on the consistency of truncated nonlinear integral equation based theories of freezing

    International Nuclear Information System (INIS)

    Cerjan, C.; Bagchi, B.; Rice, S.A.

    1985-01-01

    We report the results of two studies of aspects of the consistency of truncated nonlinear integral equation based theories of freezing: (i) We show that the self-consistent solutions to these nonlinear equations are unfortunately sensitive to the level of truncation. For the hard sphere system, if the Wertheim--Thiele representation of the pair direct correlation function is used, the inclusion of part but not all of the triplet direct correlation function contribution, as has been common, worsens the predictions considerably. We also show that the convergence of the solutions found, with respect to number of reciprocal lattice vectors kept in the Fourier expansion of the crystal singlet density, is slow. These conclusions imply great sensitivity to the quality of the pair direct correlation function employed in the theory. (ii) We show the direct correlation function based and the pair correlation function based theories of freezing can be cast into a form which requires solution of isomorphous nonlinear integral equations. However, in the pair correlation function theory the usual neglect of the influence of inhomogeneity of the density distribution on the pair correlation function is shown to be inconsistent to the lowest order in the change of density on freezing, and to lead to erroneous predictions

  7. Neutrophil glycoprotein Mo1 is an integral membrane protein of plasma membranes and specific granules

    International Nuclear Information System (INIS)

    Stevenson, K.B.; Nauseef, W.M.; Clark, R.A.

    1987-01-01

    The glucoprotein Mo1 has previously been demonstrated to be on the cell surface and in the specific granule fraction of neutrophils and to be translocated to the cell surface during degranulation. It is not known, however, whether Mo1 is an integral membrane protein or a soluble, intragranular constituent loosely associated with the specific granule membrane. Purified neutrophils were disrupted by nitrogen cavitation and separated on Percoll density gradients into four fractions enriched for azurophilic granules, specific granules, plasma membrane, and cytosol, respectively. The glycoproteins in these fractions were labeled with 3 H-borohydride reduction, extracted with Triton X-114, and immunoprecipitated with 60.3, an anti-Mo1 monoclonal antibody. Mo1 was detected only in the specific granule and plasma membrane fractions and partitioned exclusively into the detergent-rich fraction consistent with Mo1 being an integral membrane protein. In addition, treatment of specific granule membranes with a high salt, high urea buffer to remove adsorbed or peripheral proteins failed to dissociate Mo1. These data support the hypothesis that Mo1 is an integral membrane protein of plasma and specific granule membranes in human neutrophils

  8. Database specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)

    Energy Technology Data Exchange (ETDEWEB)

    Faby, E.Z.; Fluker, J.; Hancock, B.R.; Grubb, J.W.; Russell, D.L. [Univ. of Tennessee, Knoxville, TN (United States); Loftis, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States)

    1994-03-01

    This Database Specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB) describes the database organization and storage allocation, provides the detailed data model of the logical and physical designs, and provides information for the construction of parts of the database such as tables, data elements, and associated dictionaries and diagrams.

  9. Integration of aerial imaging and variable-rate technology for site-specific aerial herbicide application

    Science.gov (United States)

    As remote sensing and variable rate technology are becoming more available for aerial applicators, practical methodologies on effective integration of these technologies are needed for site-specific aerial applications of crop production and protection materials. The objectives of this study were to...

  10. Application specific integrated circuits and hybrid micro circuits for nuclear instrumentation

    International Nuclear Information System (INIS)

    Chandratre, V.B.; Sukhwani, Menka; Mukhopadhyay, P.K.; Shastrakar, R.S.; Sudheer, M.; Shedam, V.; Keni, Anubha

    2009-01-01

    Rapid development in semiconductor technology, sensors, detectors and requirements of high energy physics experiments as well as advances in commercially available nuclear instruments have lead to challenges for instrumentation. These challenges are met with development of Application Specific Integrated Circuits and Hybrid Micro Circuits. This paper discusses various activities in ASIC and HMC development in Bhabha Atomic Research Centre. (author)

  11. SELECTED REQUIREMENTS OF INTEGRATED MANAGEMENT SYSTEMS BASED ON PAS 99 SPECIFICATION

    Directory of Open Access Journals (Sweden)

    Paweł Nowicki

    2013-03-01

    Full Text Available The aim this research was to analyze the ways of integration of management systems in food sector. The study involved the documentation, audits, corrective and preventive actions and management's review phases described in the specification PAS 99, which is one of common elements of integrated management systems. Four organizations were selected for the study. The organizations had introduced and certified at least two standardized management systems. It was assumed that the investigated organizations should have implemented the HACCP system. Studies were conducted as a case study. The employees responsible for the functioning of management systems were interviewed in all four organizations. The study was conducted in the form of in-depth interviews based on pre-prepared script. The scenario was developed based on the PAS 99 guideline. The process of integration of management systems implemented in the studied companies reveals the full compliance of an integrated management system with PASS 99 in the policy area.

  12. Chemical Entity Semantic Specification: Knowledge representation for efficient semantic cheminformatics and facile data integration

    Science.gov (United States)

    2011-01-01

    Background Over the past several centuries, chemistry has permeated virtually every facet of human lifestyle, enriching fields as diverse as medicine, agriculture, manufacturing, warfare, and electronics, among numerous others. Unfortunately, application-specific, incompatible chemical information formats and representation strategies have emerged as a result of such diverse adoption of chemistry. Although a number of efforts have been dedicated to unifying the computational representation of chemical information, disparities between the various chemical databases still persist and stand in the way of cross-domain, interdisciplinary investigations. Through a common syntax and formal semantics, Semantic Web technology offers the ability to accurately represent, integrate, reason about and query across diverse chemical information. Results Here we specify and implement the Chemical Entity Semantic Specification (CHESS) for the representation of polyatomic chemical entities, their substructures, bonds, atoms, and reactions using Semantic Web technologies. CHESS provides means to capture aspects of their corresponding chemical descriptors, connectivity, functional composition, and geometric structure while specifying mechanisms for data provenance. We demonstrate that using our readily extensible specification, it is possible to efficiently integrate multiple disparate chemical data sources, while retaining appropriate correspondence of chemical descriptors, with very little additional effort. We demonstrate the impact of some of our representational decisions on the performance of chemically-aware knowledgebase searching and rudimentary reaction candidate selection. Finally, we provide access to the tools necessary to carry out chemical entity encoding in CHESS, along with a sample knowledgebase. Conclusions By harnessing the power of Semantic Web technologies with CHESS, it is possible to provide a means of facile cross-domain chemical knowledge integration with full

  13. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    Directory of Open Access Journals (Sweden)

    Atsuo Kawahara

    2016-05-01

    Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  14. An Exploratory Study into Perceived Task Complexity, Topic Specificity and Usefulness for Integrated Search

    DEFF Research Database (Denmark)

    Ingwersen, Peter; Lioma, Christina; Larsen, Birger

    2012-01-01

    We investigate the relations between user perceptions of work task complexity, topic specificity, and usefulness of retrieved results. 23 academic researchers submitted detailed descriptions of 65 real-life work tasks in the physics domain, and assessed documents retrieved from an integrated...... collection consisting of full text research articles in PDF, abstracts, and bibliographic records [6]. Bibliographic records were found to be more precise than full text PDFs, regardless of task complexity and topic specificity. PDFs were found to be more useful. Overall, for higher task complexity and topic...

  15. Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

    Science.gov (United States)

    Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

    2014-12-01

    Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Application-specific integrated circuit design for a typical pressurized water reactor pressure channel trip

    International Nuclear Information System (INIS)

    Battle, R.E.; Manges, W.W.; Emery, M.S.; Vendermolen, R.I.; Bhatt, S.

    1994-01-01

    This article discusses the use of application-specific integrated circuits (ASICs) in nuclear plant safety systems. ASICs have certain advantages over software-based systems because they can be simple enough to be thoroughly tested, and they can be tailored to replace existing equipment. An architecture to replace a pressurized water reactor pressure channel trip is presented. Methods of implementing digital algorithms are also discussed

  17. Development of Integral Effect Test Facility P and ID and Technical Specification for SMART Fluid System

    International Nuclear Information System (INIS)

    Lee, Sang Il; Jung, Y. H.; Yang, H. J.; Song, S. Y.; Han, O. J.; Lee, B. J.; Kim, Y. A.; Lim, J. H.; Park, K. W.; Kim, N. G.

    2010-01-01

    SMART integral test loop is the thermal hydraulic test facility with a high pressure and temperature for simulating the major systems of the prototype reactor, SMART-330. The objective of this project is to conduct the basic design for constructing SMART ITL. The major results of this project include a series of design documents, technical specifications and P and ID. The results can be used as the fundamental materials for making the detailed design which is essential for manufacturing and installing SMART ITL

  18. Prespacer processing and specific integration in a Type I-A CRISPR system

    Science.gov (United States)

    Rollie, Clare; Graham, Shirley; Rouillon, Christophe

    2018-01-01

    Abstract The CRISPR–Cas system for prokaryotic adaptive immunity provides RNA-mediated protection from viruses and mobile genetic elements. Adaptation is dependent on the Cas1 and Cas2 proteins along with varying accessory proteins. Here we analyse the process in Sulfolobus solfataricus, showing that while Cas1 and Cas2 catalyze spacer integration in vitro, host factors are required for specificity. Specific integration also requires at least 400 bp of the leader sequence, and is dependent on the presence of hydrolysable ATP, suggestive of an active process that may involve DNA remodelling. Specific spacer integration is associated with processing of prespacer 3′ ends in a PAM-dependent manner. This is reflected in PAM-dependent processing of prespacer 3′ ends in vitro in the presence of cell lysate or the Cas4 nuclease, in a reaction consistent with PAM-directed binding and protection of prespacer DNA. These results highlight the diverse interplay between CRISPR–Cas elements and host proteins across CRISPR types. PMID:29228332

  19. Efficient site-specific integration in Plasmodium falciparum chromosomes mediated by mycobacteriophage Bxb1 integrase.

    Science.gov (United States)

    Nkrumah, Louis J; Muhle, Rebecca A; Moura, Pedro A; Ghosh, Pallavi; Hatfull, Graham F; Jacobs, William R; Fidock, David A

    2006-08-01

    Here we report an efficient, site-specific system of genetic integration into Plasmodium falciparum malaria parasite chromosomes. This is mediated by mycobacteriophage Bxb1 integrase, which catalyzes recombination between an incoming attP and a chromosomal attB site. We developed P. falciparum lines with the attB site integrated into the glutaredoxin-like cg6 gene. Transfection of these attB(+) lines with a dual-plasmid system, expressing a transgene on an attP-containing plasmid together with a drug resistance gene and the integrase on a separate plasmid, produced recombinant parasites within 2 to 4 weeks that were genetically uniform for single-copy plasmid integration. Integrase-mediated recombination resulted in proper targeting of parasite proteins to intra-erythrocytic compartments, including the apicoplast, a plastid-like organelle. Recombinant attB x attP parasites were genetically stable in the absence of drug and were phenotypically homogeneous. This system can be exploited for rapid genetic integration and complementation analyses at any stage of the P. falciparum life cycle, and it illustrates the utility of Bxb1-based integrative recombination for genetic studies of intracellular eukaryotic organisms.

  20. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    International Nuclear Information System (INIS)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon; Hunsberger, Carol

    2013-01-01

    Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods that these models do not consider. Maintaining and enhancing robust livelihoods upon bioenergy deployment is an equally important sustainability goal that warrants greater attention. The social implications of biofuel production are complex, varied and place-specific, difficult to model, operationalize and quantify. However, a rapidly developing body of social science literature is advancing the understanding of these interactions. In this letter we link human geography research on the interaction between biofuel crops and livelihoods in developing countries to integrated assessments on biofuels. We review case-study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences are a crucial complement to aggregate outcomes; this has not been given enough weight in comprehensive assessments to date. By narrowing the gap between place-specific case studies and global models, our discussion offers a route towards integrating livelihood and equity considerations into scenarios of future bioenergy deployment, thus contributing to a key challenge in sustainability sciences. (letter)

  1. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    Science.gov (United States)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon; Hunsberger, Carol

    2013-09-01

    Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods that these models do not consider. Maintaining and enhancing robust livelihoods upon bioenergy deployment is an equally important sustainability goal that warrants greater attention. The social implications of biofuel production are complex, varied and place-specific, difficult to model, operationalize and quantify. However, a rapidly developing body of social science literature is advancing the understanding of these interactions. In this letter we link human geography research on the interaction between biofuel crops and livelihoods in developing countries to integrated assessments on biofuels. We review case-study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences are a crucial complement to aggregate outcomes; this has not been given enough weight in comprehensive assessments to date. By narrowing the gap between place-specific case studies and global models, our discussion offers a route towards integrating livelihood and equity considerations into scenarios of future bioenergy deployment, thus contributing to a key challenge in sustainability sciences.

  2. Safe genetic modification of cardiac stem cells using a site-specific integration technique.

    Science.gov (United States)

    Lan, Feng; Liu, Junwei; Narsinh, Kazim H; Hu, Shijun; Han, Leng; Lee, Andrew S; Karow, Marisa; Nguyen, Patricia K; Nag, Divya; Calos, Michele P; Robbins, Robert C; Wu, Joseph C

    2012-09-11

    Human cardiac progenitor cells (hCPCs) are a promising cell source for regenerative repair after myocardial infarction. Exploitation of their full therapeutic potential may require stable genetic modification of the cells ex vivo. Safe genetic engineering of stem cells, using facile methods for site-specific integration of transgenes into known genomic contexts, would significantly enhance the overall safety and efficacy of cellular therapy in a variety of clinical contexts. We used the phiC31 site-specific recombinase to achieve targeted integration of a triple fusion reporter gene into a known chromosomal context in hCPCs and human endothelial cells. Stable expression of the reporter gene from its unique chromosomal integration site resulted in no discernible genomic instability or adverse changes in cell phenotype. Namely, phiC31-modified hCPCs were unchanged in their differentiation propensity, cellular proliferative rate, and global gene expression profile when compared with unaltered control hCPCs. Expression of the triple fusion reporter gene enabled multimodal assessment of cell fate in vitro and in vivo using fluorescence microscopy, bioluminescence imaging, and positron emission tomography. Intramyocardial transplantation of genetically modified hCPCs resulted in significant improvement in myocardial function 2 weeks after cell delivery, as assessed by echocardiography (P=0.002) and MRI (P=0.001). We also demonstrated the feasibility and therapeutic efficacy of genetically modifying differentiated human endothelial cells, which enhanced hind limb perfusion (Pmodification system is a safe, efficient tool to enable site-specific integration of reporter transgenes in progenitor and differentiated cell types.

  3. Integrating place-specific livelihood and equity outcomes into global assessments of bioenergy deployment

    DEFF Research Database (Denmark)

    Creutzig, Felix; Corbera, Esteve; Bolwig, Simon

    2013-01-01

    -study research focused on first-generation biofuel crops to demonstrate that food, income, land and other assets such as health are key livelihood dimensions that can be impacted by such crops and we highlight how place-specific and global dynamics influence both aggregate and distributional outcomes across......Integrated assessment models suggest that the large-scale deployment of bioenergy could contribute to ambitious climate change mitigation efforts. However, such a shift would intensify the global competition for land, with possible consequences for 1.5 billion smallholder livelihoods...... these livelihood dimensions. We argue that place-specific production models and land tenure regimes mediate livelihood outcomes, which are also in turn affected by global and regional markets and their resulting equilibrium dynamics. The place-specific perspective suggests that distributional consequences...

  4. Integrating Hypnosis with Other Therapies for Treating Specific Phobias: A Case Series.

    Science.gov (United States)

    Hirsch, Joseph A

    2018-04-01

    There is a high prevalence of anxiety disorders including specific phobias and panic disorder in the United States and Europe. A variety of therapeutic modalities including pharmacotherapy, cognitive behavioral therapy, systematic desensitization, hypnosis, in vivo exposure, and virtual reality exposure therapy have been applied. No one modality has been entirely successful. There has been only a limited attempt to combine psychological therapies in the treatment of specific phobias and panic disorder and what has been done has been primarily with systematic desensitization or cognitive behavioral therapy along with hypnotherapy. I present two cases of multiple specific phobias that were successfully treated with hypnotherapy combined with virtual reality exposure therapy or in vivo exposure therapy. The rationale for this integrative therapy and the neurobiological constructs are considered.

  5. INTEGRATING COUNTRY-SPECIFIC CULTURE IN THE BRANDING STRATEGY FOR BUILDING GLOBAL SUCCESS

    Directory of Open Access Journals (Sweden)

    Alexandra IOANID

    2014-11-01

    Full Text Available A strong brand is the one that integrates its cultural origins and values with the cultural values of the countries where it operates, building relationships based on trust with the local consumers. The chances for a company to gain share market when starting operations in a new country grows a lot if the management allows enough regional flexibility on how the brands are marketed, according to the cultural characteristics of the potential local customers. In the actual globalized business environment, the brand marketer has the choice to adopt a global or a local approach in the marketing strategy, that most of the times determines the success or the failure of the business in a specific country. An important challenge for any marketer is the integration of the brand-culture with the country-culture and in this context, the paper analyses different cultures and offers some branding strategies valid for both products and services. This paper aims to demonstrate the importance of the country-specific culture integration in the marketing strategy of a company for growing the effectiveness of all its operations. The ideas mentioned in this paper are based on literature research and also on authors’ experience with multicultural environments.

  6. Operational Excellence through Schedule Optimization and Production Simulation of Application Specific Integrated Circuits.

    Energy Technology Data Exchange (ETDEWEB)

    Flory, John Andrew [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Padilla, Denise D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Gauthier, John H. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Zwerneman, April Marie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Miller, Steven P [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-05-01

    Upcoming weapon programs require an aggressive increase in Application Specific Integrated Circuit (ASIC) production at Sandia National Laboratories (SNL). SNL has developed unique modeling and optimization tools that have been instrumental in improving ASIC production productivity and efficiency, identifying optimal operational and tactical execution plans under resource constraints, and providing confidence in successful mission execution. With ten products and unprecedented levels of demand, a single set of shared resources, highly variable processes, and the need for external supplier task synchronization, scheduling is an integral part of successful manufacturing. The scheduler uses an iterative multi-objective genetic algorithm and a multi-dimensional performance evaluator. Schedule feasibility is assessed using a discrete event simulation (DES) that incorporates operational uncertainty, variability, and resource availability. The tools provide rapid scenario assessments and responses to variances in the operational environment, and have been used to inform major equipment investments and workforce planning decisions in multiple SNL facilities.

  7. Integrating Iris and Signature Traits for Personal Authentication Using User-SpecificWeighting

    Directory of Open Access Journals (Sweden)

    Serestina Viriri

    2012-03-01

    Full Text Available Biometric systems based on uni-modal traits are characterized by noisy sensor data, restricted degrees of freedom, non-universality and are susceptible to spoof attacks. Multi-modal biometric systems seek to alleviate some of these drawbacks by providing multiple evidences of the same identity. In this paper, a user-score-based weighting technique for integrating the iris and signature traits is presented. This user-specific weighting technique has proved to be an efficient and effective fusion scheme which increases the authentication accuracy rate of multi-modal biometric systems. The weights are used to indicate the importance of matching scores output by each biometrics trait. The experimental results show that our biometric system based on the integration of iris and signature traits achieve a false rejection rate (FRR of 0.08% and a false acceptance rate (FAR of 0.01%.

  8. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  9. Integration of Descending Command Systems for the Generation of Context-Specific Locomotor Behaviors

    Directory of Open Access Journals (Sweden)

    Linda H. Kim

    2017-10-01

    Full Text Available Over the past decade there has been a renaissance in our understanding of spinal cord circuits; new technologies are beginning to provide key insights into descending circuits which project onto spinal cord central pattern generators. By integrating work from both the locomotor and animal behavioral fields, we can now examine context-specific control of locomotion, with an emphasis on descending modulation arising from various regions of the brainstem. Here we examine approach and avoidance behaviors and the circuits that lead to the production and arrest of locomotion.

  10. Design and Verification of Application Specific Integrated Circuits in a Network of Online Labs

    Directory of Open Access Journals (Sweden)

    A.Y. Al-Zoubi

    2009-08-01

    Full Text Available A solution to implement a remote laboratory for testing and designing analog Application-Specific Integrated Circuits of the type (ispPAC10 is presented. The application allows electrical engineering students to access and perform measurements and conduct analog electronics experiments over the internet. PAC-Designer software, running on a Citrix server, is used in the circuit design in which the signals are generated and the responses are acquired by a data acquisition board controlled by LabVIEW. Three interconnected remote labs located in three different continents will be implementing the proposed system.

  11. A Domain Specific Embedded Language in C++ for Automatic Differentiation, Projection, Integration and Variational Formulations

    Directory of Open Access Journals (Sweden)

    Christophe Prud'homme

    2006-01-01

    Full Text Available In this article, we present a domain specific embedded language in C++ that can be used in various contexts such as numerical projection onto a functional space, numerical integration, variational formulations and automatic differentiation. Albeit these tools operate in different ways, the language overcomes this difficulty by decoupling expression constructions from evaluation. The language is implemented using expression templates and meta-programming techniques and uses various Boost libraries. The language is exercised on a number of non-trivial examples and a benchmark presents the performance behavior on a few test problems.

  12. CEO Appointments and the Loss of Firm-specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren

    2008-01-01

    the last thirty years. Assuming that general managerial skills are becoming more important relative to firm-specific skills, the authors conclude that competition in the managerial labor market establishes optimal contracts. In our model and our empirical analysis we question this explanation by assuming...... that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest...

  13. CEO Appointments and the Loss of Firm-Specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren; Osterloh, Margit

    2008-01-01

    the last thirty years. Assuming that general managerial skills are becoming more important relative to firm-specific skills, the authors conclude that competition in the managerial labor market establishes optimal contracts. In our model and our empirical analysis we question this explanation by assuming...... that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest...

  14. Interpretative commenting.

    Science.gov (United States)

    Vasikaran, Samuel

    2008-08-01

    * Clinical laboratories should be able to offer interpretation of the results they produce. * At a minimum, contact details for interpretative advice should be available on laboratory reports.Interpretative comments may be verbal or written and printed. * Printed comments on reports should be offered judiciously, only where they would add value; no comment preferred to inappropriate or dangerous comment. * Interpretation should be based on locally agreed or nationally recognised clinical guidelines where available. * Standard tied comments ("canned" comments) can have some limited use.Individualised narrative comments may be particularly useful in the case of tests that are new, complex or unfamiliar to the requesting clinicians and where clinical details are available. * Interpretative commenting should only be provided by appropriately trained and credentialed personnel. * Audit of comments and continued professional development of personnel providing them are important for quality assurance.

  15. Field Assessment and Specification Review for Roller-Integrated Compaction Monitoring Technologies

    Directory of Open Access Journals (Sweden)

    David J. White

    2011-01-01

    Full Text Available Roller-integrated compaction monitoring (RICM technologies provide virtually 100-percent coverage of compacted areas with real-time display of the compaction measurement values. Although a few countries have developed quality control (QC and quality assurance (QA specifications, broader implementation of these technologies into earthwork construction operations still requires a thorough understanding of relationships between RICM values and traditional in situ point test measurements. The purpose of this paper is to provide: (a an overview of two technologies, namely, compaction meter value (CMV and machine drive power (MDP; (b a comprehensive review of field assessment studies, (c an overview of factors influencing statistical correlations, (d modeling for visualization and characterization of spatial nonuniformity; and (e a brief review of the current specifications.

  16. Testing Requirements to Manage Data Exchange Specifications in Enterprise Integration - A Schema Design Quality Focus.

    Energy Technology Data Exchange (ETDEWEB)

    Kulvatunyou, Boonserm [ORNL; Ivezic, Nenad [ORNL; Buhwan, Jeong [POSTECH University, South Korea

    2004-07-01

    In this paper, we describe the requirements to test W3C XML Schema usage when defining message schemas for data exchange in any large and evolving enterprise integration project. We then decompose the XML Schema testing into four (4) aspects including the message schema conformance to the XML Schema specification grammar, the message schema conformance to the XML Schema specification semantics, the message schema conformance to design quality testing, and canonical semantics testing of the message schema. We describe these four testing aspects in some detail and point to other related efforts. We further focus to provide some technical details for the message schema design quality testing. As a future work, we describe the requirements for canonical semantics testing and potential solution approaches. Finally, we describe an implementation architecture for the message schema design quality testing.

  17. Issues of verification and validation of application-specific integrated circuits in reactor trip systems

    International Nuclear Information System (INIS)

    Battle, R.E.; Alley, G.T.

    1993-01-01

    Concepts of using application-specific integrated circuits (ASICs) in nuclear reactor safety systems are evaluated. The motivation for this evaluation stems from the difficulty of proving that software-based protection systems are adequately reliable. Important issues concerning the reliability of computers and software are identified and used to evaluate features of ASICS. These concepts indicate that ASICs have several advantages over software for simple systems. The primary advantage of ASICs over software is that verification and validation (V ampersand V) of ASICs can be done with much higher confidence than can be done with software. A method of performing this V ampersand V on ASICS is being developed at Oak Ridge National Laboratory. The purpose of the method's being developed is to help eliminate design and fabrication errors. It will not solve problems with incorrect requirements or specifications

  18. [Integrity].

    Science.gov (United States)

    Gómez Rodríguez, Rafael Ángel

    2014-01-01

    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  19. Comments on 'SKB RD and D-Programme 98'. Focused on canister integrity and corrosion

    Energy Technology Data Exchange (ETDEWEB)

    Bowyer, W.H. [Meadow End Farm, Farnham (United Kingdom); Hermansson, H.P. [Studsvik Material AB, Nykoeping (Sweden)

    1999-04-01

    According to the Act on Nuclear Activities the nuclear utilities are requested to submit a comprehensive programme for research and development every third year, aiming at the safe storage of radioactive waste produced by the nuclear power plants. The latest was published by SKB in September 1998 and is called the 'RDandD Programme 98'. The work presented in the present report was commissioned by SKI and is a result of reading the 'RDandD Programme 98' and related reports with focus on canister production, integrity and corrosion. We find that those parts of the programme often are difficult to follow owing to the lack of detail in the Programme and in one of the supporting reports. In our opinion this will make the work difficult to monitor by SKI and SKB. We also feel that the interpretation of information already available often is overoptimistic. As a consequence the difficulties ahead are understated and the programme is allowed to converge too quickly. We agree that the materials choices for both the inner and outer canisters are appropriate providing they both can be produced commercially and in a satisfactory metallurgical condition, that they can be quality assured and that no further unforeseen difficulties arise. We also agree that alternative technologies merit consideration for production of the outer canister and that alternative joining processes should be studied. We are actually concerned that greater prominence is not given to the alternatives in the programme. We believe that it should be possible to develop a satisfactory canister for disposal of high level nuclear waste according to the general method proposed by SKB and with the proposed capacity within the time-scale of the overall programme. We do not believe, however, that all the difficulties have been recognised. As a consequence of this the results to date are interpreted optimistically. We believe that progress should be subjected to more professional review within

  20. Systematic identification and integrative analysis of novel genes expressed specifically or predominantly in mouse epididymis

    Directory of Open Access Journals (Sweden)

    Lee Hoyong

    2006-12-01

    Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.

  1. Test and verification of a reactor protection system application-specific integrated circuit

    International Nuclear Information System (INIS)

    Battle, R.E.; Turner, G.W.; Vandermolen, R.I.; Vitalbo, C.

    1997-01-01

    Application-specific integrated circuits (ASICs) were utilized in the design of nuclear plant safety systems because they have certain advantages over software-based systems and analog-based systems. An advantage they have over software-based systems is that an ASIC design can be simple enough to not include branch statements and also can be thoroughly tested. A circuit card on which an ASIC is mounted can be configured to replace various versions of older analog equipment with fewer design types required. The approach to design and testing of ASICs for safety system applications is discussed in this paper. Included are discussions of the ASIC architecture, how it is structured to assist testing, and of the functional and enhanced circuit testing

  2. Differential and Integral Calculus in careers of technical sciences. Specificities of their teaching

    Directory of Open Access Journals (Sweden)

    Iván Javier Villamar-Alvarado

    2017-12-01

    Full Text Available The Differential and Integral Calculus has great relevance for the professionals of the technical sciences since it provides them with a solid theoretical-conceptual body to process information, to use models that simulate real processes, to solve technical problems, to work in multidisciplinary projects and to communicate with precision. In spite of this relevance, there are numerous international dissatisfactions related to their learning by training engineers. The objective was to unveil the specificities of the teaching-learning process of this discipline that favor a successful appropriation of its content by the future engineers. The result was to unveil the didactic need to resolve the dialectical contradiction that manifests itself between the systematization of the engineering functionality of the aforementioned content and its contextualized interdisciplinary generalization. As a consequence, the need arises to create new didactic proposals that overcome this contradiction, as a way to perfect the teaching-learning process of this discipline in the engineering careers.

  3. An application specific integrated circuit and data acquisition system for digital X-ray imaging

    International Nuclear Information System (INIS)

    Beuville, E.; Cederstroem, B.; Danielsson, M.; Luo, L.; Nygren, D.; Oltman, E.; Vestlund, J.

    1998-01-01

    We have developed an application specific integrated circuit (ASIC) and data acquisition system for digital X-ray imaging. The chip consists of 16 parallel channels, each containing preamplifier, shaper, comparator and a 16 bit counter. We have demonstrated noiseless single-photon counting over a threshold of 7.2 keV using Silicon detectors and are presently capable of maximum counting rates of 2 MHz per channel. The ASIC is controlled by a personal computer through a commercial PCI card, which is also used for data acquisition. The content of the 16 bit counters are loaded into a shift register and transferred to the PC at any time at a rate of 20 MHz. The system is non-complicated, low cost and high performance and is optimised for digital X-ray imaging applications. (orig.)

  4. Application specific integrated circuit (ASIC) readout technologies for future ion beam analytical instruments

    Energy Technology Data Exchange (ETDEWEB)

    Whitlow, Harry J. E-mail: harry_j.whitlow@nuclear.lu.se

    2000-03-01

    New possibilities for ion beam analysis (IBA) are afforded by recent developments in detector technology which facilitate the parallel collection of data from a large number of channels. Application specific integrated circuit (ASIC) technologies, which have been widely employed for multi-channel readout systems in nuclear and particle physics, are more net-cost effective (160/channel for 1000 channels) and a more rational solution for readout of a large number of channels than afforded by conventional electronics. Based on results from existing and on-going chip designs, the possibilities and issues of ASIC readout technology are considered from the IBA viewpoint. Consideration is given to readout chip architecture and how the stringent resolution, linearity and stability requirements for IBA may be met. In addition the implications of the restrictions imposed by ASIC technology are discussed.

  5. An application specific integrated circuit and data acquisition system for digital X-ray imaging

    Energy Technology Data Exchange (ETDEWEB)

    Beuville, E.; Cederstroem, B.; Danielsson, M.; Luo, L.; Nygren, D.; Oltman, E.; Vestlund, J. [Lawrence Berkeley National Lab., CA (United States)

    1998-04-01

    We have developed an application specific integrated circuit (ASIC) and data acquisition system for digital X-ray imaging. The chip consists of 16 parallel channels, each containing preamplifier, shaper, comparator and a 16 bit counter. We have demonstrated noiseless single-photon counting over a threshold of 7.2 keV using Silicon detectors and are presently capable of maximum counting rates of 2 MHz per channel. The ASIC is controlled by a personal computer through a commercial PCI card, which is also used for data acquisition. The content of the 16 bit counters are loaded into a shift register and transferred to the PC at any time at a rate of 20 MHz. The system is non-complicated, low cost and high performance and is optimised for digital X-ray imaging applications. (orig.). 11 refs.

  6. Sport Skill-Specific Expertise Biases Sensory Integration for Spatial Referencing and Postural Control.

    Science.gov (United States)

    Thalassinos, Michalis; Fotiadis, Giorgos; Arabatzi, Fotini; Isableu, Brice; Hatzitaki, Vassilia

    2017-09-15

    The authors asked how sport expertise modulates visual field dependence and sensory reweighting for controlling posture. Experienced soccer athletes, ballet dancers, and nonathletes performed (a) a Rod and Frame test and (b) a 100-s bipedal stance task during which vision and proprioception were successively or concurrently disrupted in 20-s blocks. Postural adaptation was assessed in the mean center of pressure displacement, root mean square of center of pressure velocity and ankle muscles integrated electromyography activity. Soccer athletes were more field dependent than were nonathletes. During standing, dancers were more destabilized by vibration and required more time to reweigh sensory information compared with the other 2 groups. These findings reveal a sport skill-specific bias in the reweighing of sensory inputs for spatial orientation and postural control.

  7. Direct effects of ionizing radiation on integral membrane proteins. Noncovalent energy transfer requires specific interpeptide interactions

    International Nuclear Information System (INIS)

    Jhun, E.; Jhun, B.H.; Jones, L.R.; Jung, C.Y.

    1991-01-01

    The 12 transmembrane alpha helices (TMHs) of human erythrocyte glucose transporter were individually cut by pepsin digestion as membrane-bound 2.5-3.5-kDa peptide fragments. Radiation-induced chemical degradation of these fragments showed an average target size of 34 kDa. This is 10-12 x larger than the average size of an individual TMH, demonstrating that a significant energy transfer occurs among these TMHs in the absence of covalent linkage. Heating this TMH preparation at 100 degree C for 15 min reduced the target size to 5 kDa or less, suggesting that the noncovalent energy transfer requires specific helix-helix interactions. Purified phospholamban, a small (6-kDa) integral membrane protein containing a single TMH, formed a pentameric assembly in sodium dodecyl sulfate. The chemical degradation target size of this phospholamban pentamer was 5-6 kDa, illustrating that not all integral membrane protein assemblies permit intersubunit energy transfer. These findings together with other published observations suggest strongly that significant noncovalent energy transfer can occur within the tertiary and quaternary structure of membrane proteins and that as yet undefined proper molecular interactions are required for such covalent energy transfer. Our results with pepsin-digested glucose transporter also illustrate the importance of the interhelical interaction as a predominating force in maintaining the tertiary structure of a transmembrane protein

  8. Hanford Integrated Planning Process: 1993 Hanford Site-specific science and technology plan

    International Nuclear Information System (INIS)

    1993-12-01

    This document is the FY 1993 report on Hanford Site-specific science and technology (S ampersand T) needs for cleanup of the Site as developed via the Hanford Integrated Planning Process (HIPP). It identifies cleanup problems that lack demonstrated technology solutions and technologies that require additional development. Recommendations are provided regarding allocation of funding to address Hanford's highest-priority technology improvement needs, technology development needs, and scientific research needs, all compiled from a Sitewide perspective. In the past, the S ampersand T agenda for Hanford Site cleanup was sometimes driven by scientists and technologists, with minimal input from the ''problem owners'' (i.e., Westinghouse Hanford Company [WHC] staff who are responsible for cleanup activities). At other times, the problem-owners made decisions to proceed with cleanup without adequate scientific and technological inputs. Under both of these scenarios, there was no significant stakeholder involvement in the decision-making process. One of the key objectives of HIPP is to develop an understanding of the integrated S ampersand T requirements to support the cleanup mission, (a) as defined by the needs of the problem owners, the values of the stakeholders, and the technology development expertise that exists at Hanford and elsewhere. This requires a periodic, systematic assessment of these needs and values to appropriately define a comprehensive technology development program and a complementary scientific research program. Basic to our success is a methodology that is defensible from a technical perspective and acceptable to the stakeholders

  9. System/subsystem specifications for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)

    Energy Technology Data Exchange (ETDEWEB)

    Rollow, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States); Faby, E.Z.; Fluker, J.; Grubb, J.; Hancock, B.R. [Univ. of Tennessee, Knoxville, TN (United States); Ferguson, R.A. [Science Applications International Corp., Oak Ridge, TN (United States)

    1995-11-20

    A system is being developed by the Military Traffic Management Command (MTMC) to provide data integration and worldwide management and tracking of surface cargo movements. The Integrated Cargo Database (ICDB) will be a data repository for the WPS terminal-level system, will be a primary source of queries and cargo traffic reports, will receive data from and provide data to other MTMC and non-MTMC systems, will provide capabilities for processing Advance Transportation Control and Movement Documents (ATCMDs), and will process and distribute manifests. This System/Subsystem Specifications for the Worldwide Port System Regional ICDB documents the system/subsystem functions, provides details of the system/subsystem analysis in order to provide a communication link between developers and operational personnel, and identifies interfaces with other systems and subsystems. It must be noted that this report is being produced near the end of the initial development phase of ICDB, while formal software testing is being done. Following the initial implementation of the ICDB system, maintenance contractors will be in charge of making changes and enhancing software modules. Formal testing and user reviews may indicate the need for additional software units or changes to existing ones. This report describes the software units that are components of this ICDB system as of August 1995.

  10. A High-Performance Application Specific Integrated Circuit for Electrical and Neurochemical Traumatic Brain Injury Monitoring.

    Science.gov (United States)

    Pagkalos, Ilias; Rogers, Michelle L; Boutelle, Martyn G; Drakakis, Emmanuel M

    2018-05-22

    This paper presents the first application specific integrated chip (ASIC) for the monitoring of patients who have suffered a Traumatic Brain Injury (TBI). By monitoring the neurophysiological (ECoG) and neurochemical (glucose, lactate and potassium) signals of the injured human brain tissue, it is possible to detect spreading depolarisations, which have been shown to be associated with poor TBI patient outcome. This paper describes the testing of a new 7.5 mm 2 ASIC fabricated in the commercially available AMS 0.35 μm CMOS technology. The ASIC has been designed to meet the demands of processing the injured brain tissue's ECoG signals, recorded by means of depth or brain surface electrodes, and neurochemical signals, recorded using microdialysis coupled to microfluidics-based electrochemical biosensors. The potentiostats use switchedcapacitor charge integration to record currents with 100 fA resolution, and allow automatic gain changing to track the falling sensitivity of a biosensor. This work supports the idea of a "behind the ear" wireless microplatform modality, which could enable the monitoring of currently non-monitored mobile TBI patients for the onset of secondary brain injury. ©2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  11. An integrated domain specific language for post-processing and visualizing electrophysiological signals in Java.

    Science.gov (United States)

    Strasser, T; Peters, T; Jagle, H; Zrenner, E; Wilke, R

    2010-01-01

    Electrophysiology of vision - especially the electroretinogram (ERG) - is used as a non-invasive way for functional testing of the visual system. The ERG is a combined electrical response generated by neural and non-neuronal cells in the retina in response to light stimulation. This response can be recorded and used for diagnosis of numerous disorders. For both clinical practice and clinical trials it is important to process those signals in an accurate and fast way and to provide the results as structured, consistent reports. Therefore, we developed a freely available and open-source framework in Java (http://www.eye.uni-tuebingen.de/project/idsI4sigproc). The framework is focused on an easy integration with existing applications. By leveraging well-established software patterns like pipes-and-filters and fluent interfaces as well as by designing the application programming interfaces (API) as an integrated domain specific language (DSL) the overall framework provides a smooth learning curve. Additionally, it already contains several processing methods and visualization features and can be extended easily by implementing the provided interfaces. In this way, not only can new processing methods be added but the framework can also be adopted for other areas of signal processing. This article describes in detail the structure and implementation of the framework and demonstrate its application through the software package used in clinical practice and clinical trials at the University Eye Hospital Tuebingen one of the largest departments in the field of visual electrophysiology in Europe.

  12. Integrating English for Specific Purposes Courseware into Task-Based Learning in a Context of Preparing for International Trade Fairs

    Science.gov (United States)

    Tsai, Shu-Chiao

    2013-01-01

    This study reports on integrating courseware for participating in international trade fairs into English for specific purposes (ESP) instruction at a technical university in Taiwan. An Information and Communication Technology (ICT) approach combining courseware integration with Task Based Learning (TBL), was adopted. Evaluation of implementing…

  13. Towards a synergy framework across neuroscience and robotics: Lessons learned and open questions. Reply to comments on: "Hand synergies: Integration of robotics and neuroscience for understanding the control of biological and artificial hands"

    Science.gov (United States)

    Santello, Marco; Bianchi, Matteo; Gabiccini, Marco; Ricciardi, Emiliano; Salvietti, Gionata; Prattichizzo, Domenico; Ernst, Marc; Moscatelli, Alessandro; Jorntell, Henrik; Kappers, Astrid M. L.; Kyriakopoulos, Kostas; Schaeffer, Alin Abu; Castellini, Claudio; Bicchi, Antonio

    2016-07-01

    We would like to thank all commentators for their insightful commentaries. Thanks to their diverse and complementary expertise in neuroscience and robotics, the commentators have provided us with the opportunity to further discuss state-of-the-art and gaps in the integration of neuroscience and robotics reviewed in our article. We organized our reply in two sections that capture the main points of all commentaries [1-9]: (1) Advantages and limitations of the synergy approach in neuroscience and robotics, and (2) Learning and role of sensory feedback in biological and robotics synergies.

  14. Autonomous Integrated Receive System (AIRS) requirements definition. Volume 4: Functional specification for the prototype Automated Integrated Receive System (AIRS)

    Science.gov (United States)

    Chie, C. M.

    1984-01-01

    The functional requirements for the performance, design, and testing for the prototype Automated Integrated Receive System (AIRS) to be demonstrated for the TDRSS S-Band Single Access Return Link are presented.

  15. Occurrence of Terranova larval types (Nematoda: Anisakidae in Australian marine fish with comments on their specific identities

    Directory of Open Access Journals (Sweden)

    Shokoofeh Shamsi

    2016-03-01

    Full Text Available Pseudoterranovosis is a well-known human disease caused by anisakid larvae belonging to the genus Pseudoterranova. Human infection occurs after consuming infected fish. Hence the presence of Pseudoterranova larvae in the flesh of the fish can cause serious losses and problems for the seafood, fishing and fisheries industries. The accurate identification of Pseudoterranova larvae in fish is important, but challenging because the larval stages of a number of different genera, including Pseudoterranova, Terranova and Pulchrascaris, look similar and cannot be differentiated from each other using morphological criteria, hence they are all referred to as Terranova larval type. Given that Terranova larval types in seafood are not necessarily Pseudoterranova and may not be dangerous, the aim of the present study was to investigate the occurrence of Terranova larval types in Australian marine fish and to determine their specific identity. A total of 137 fish belonging to 45 species were examined. Terranova larval types were found in 13 species, some of which were popular edible fish in Australia. The sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2 respectively of the Terranova larvae in the present study showed a high degree of similarity suggesting that they all belong to the same species. Due to the lack of a comparable sequence data of a well identified adult in the GenBank database the specific identity of Terranova larval type in the present study remains unknown. The sequence of the ITS regions of the Terranova larval type in the present study and those of Pseudoterranova spp. available in GenBank are significantly different, suggesting that larvae found in the present study do not belong to the genus Pseudoterranova, which is zoonotic. This study does not rule out the presence of Pseudoterranova larvae in Australian fish as Pseudoterranova decipiens E has been reported in adult form from seals in Antarctica and it

  16. Some comments on mapping from disease-specific to generic health-related quality-of-life scales.

    Science.gov (United States)

    Palta, Mari

    2013-01-01

    An article by Lu et al. in this issue of Value in Health addresses the mapping of treatment or group differences in disease-specific measures (DSMs) of health-related quality of life onto differences in generic health-related quality-of-life scores, with special emphasis on how the mapping is affected by the reliability of the DSM. In the proposed mapping, a factor analytic model defines a conversion factor between the scores as the ratio of factor loadings. Hence, the mapping applies to convert true underlying scales and has desirable properties facilitating the alignment of instruments and understanding their relationship in a coherent manner. It is important to note, however, that when DSM means or differences in mean DSMs are estimated, their mapping is still of a measurement error-prone predictor, and the correct conversion coefficient is the true mapping multiplied by the reliability of the DSM in the relevant sample. In addition, the proposed strategy for estimating the factor analytic mapping in practice requires assumptions that may not hold. We discuss these assumptions and how they may be the reason we obtain disparate estimates of the mapping factor in an application of the proposed methods to groups of patients. Copyright © 2013 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  17. 77 FR 35661 - Proposed Collection; Comment Request

    Science.gov (United States)

    2012-06-14

    ... annual financial statement certified by an independent Certified Public Accountant. No specific form is... extension of a public information collection and seeks public comment on the provisions thereof. Comments... policy for comments and other submissions from members of the public is to make these submissions...

  18. Evolutionary considerations on complex emotions and music-induced emotions. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Gingras, Bruno; Marin, Manuela M.

    2015-06-01

    Recent efforts to uncover the neural underpinnings of emotional experiences have provided a foundation for novel neurophysiological theories of emotions, adding to the existing body of psychophysiological, motivational, and evolutionary theories. Besides explicitly modeling human-specific emotions and considering the interactions between emotions and language, Koelsch et al.'s original contribution to this challenging endeavor is to identify four brain areas as distinct "affect systems" which differ in terms of emotional qualia and evolutionary pathways [1]. Here, we comment on some features of this promising Quartet Theory of Emotions, focusing particularly on evolutionary and biological aspects related to the four affect systems and their relation to prevailing emotion theories, as well as on the role of music-induced emotions.

  19. Aesthetic emotions goals. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Perlovsky, Leonid

    2015-06-01

    Review by Koelsch et al. [10] presents an interdisciplinary theory of emotions, including a neurobiological emotion theory originating in four core emotional systems. The Quartet Theory (QT) includes specifically human emotions and considers the role of language for emotions. This comment considers questions about how the QT can address aesthetic emotions, what class of emotions they are, and what their function in cognition is. Can QT help defining aesthetic emotions neurally and functionally? Such a definition of aesthetic emotions would be necessary for their scientific exploration, because as widely used today there is no definition, aesthetics is defined through art, and art through aesthetics. Since contents of many art museums are not accepted as art by many artists and admirers of art, it is not clear what should be the subject of aesthetic emotions research.

  20. Region-specific role for Pten in maintenance of epithelial phenotype and integrity

    Science.gov (United States)

    Flodby, Per; Sunohara, Mitsuhiro; Castillo, Dan R.; McConnell, Alicia M.; Krishnaveni, Manda S.; Banfalvi, Agnes; Li, Min; Stripp, Barry; Zhou, Beiyun; Crandall, Edward D.; Minoo, Parviz

    2017-01-01

    Previous studies have demonstrated resistance to naphthalene-induced injury in proximal airways of mice with lung epithelial-specific deletion of the tumor-suppressor gene Pten, attributed to increased proliferation of airway progenitors. We tested effects of Pten loss following bleomycin injury, a model typically used to study distal lung epithelial injury, in conditional PtenSFTPC-cre knockout mice. Pten-deficient airway epithelium exhibited marked hyperplasia, particularly in small bronchioles and at bronchoalveolar duct junctions, with reduced E-cadherin and β-catenin expression between cells toward the luminal aspect of the hyperplastic epithelium. Bronchiolar epithelial and alveolar epithelial type II (AT2) cells in PtenSFTPC-cre mice showed decreased expression of epithelial markers and increased expression of mesenchymal markers, suggesting at least partial epithelial-mesenchymal transition at baseline. Surprisingly, and in contrast to previous studies, mutant mice were exquisitely sensitive to bleomycin, manifesting rapid weight loss, respiratory distress, increased early mortality (by day 5), and reduced dynamic lung compliance. This was accompanied by sloughing of the hyperplastic airway epithelium with occlusion of small bronchioles by cellular debris, without evidence of increased parenchymal lung injury. Increased airway epithelial cell apoptosis due to loss of antioxidant defenses, reflected by decreased expression of superoxide dismutase 3, in combination with deficient intercellular adhesion, likely predisposed to airway sloughing in knockout mice. These findings demonstrate an important role for Pten in maintenance of airway epithelial phenotype integrity and indicate that responses to Pten deletion in respiratory epithelium following acute lung injury are highly context-dependent and region-specific. PMID:27864284

  1. Growth specificity of vertical ZnO nanorods on patterned seeded substrates through integrated chemical process

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, P. Suresh [Thin Film and Nanomaterials Laboratory, Department of Physics, Bharathiar University, Coimbatore 641 046 (India); Maniam, S.M. [Centre for Quantum Technologies, National University of Singapore (Singapore); Sundaramurthy, J. [Department of Chemical and Biomolecular Engineering, National University of Singapore (NUS) (Singapore); Arokiaraj, J. [3M R and D Center (Singapore); Mangalaraj, D., E-mail: dmraj800@yahoo.com [Department of Nanoscience and Technology, Bharathiar University, Coimbatore 641046 (India); Rajarathnam, D. [CERAR, University of South Australia, Mawson Lakes, SA-5095 (Australia); Srinivasan, M.P. [Department of Chemical and Biomolecular Engineering, National University of Singapore (NUS) (Singapore); Jian, L.K. [Singapore Synchrotron Light Source (SSLS), National University of Singapore (NUS) (Singapore)

    2012-03-15

    Highlights: Black-Right-Pointing-Pointer Simple integrated chemical process was adopted for specific ZnO nanorod growth. Black-Right-Pointing-Pointer Size and orientation of nanorods are well controlled by optimum reaction time and temperature. Black-Right-Pointing-Pointer Different site-selective ZnO nanorod growths are demonstrated. - Abstract: A simple and cost effective method has been employed for the random growth and oriented ZnO nanorod arrays over as-prepared and patterned seeded glass substrates by low temperature two step growth process and growth specificity by direct laser writing (DLW) process. Scanning electron microscopy (SEM) images and X-ray diffraction analysis confirm the growth of vertical ZnO nanorods with perfect (0 0 2) orientation along c-axis which is in conjunction with optimizing the parameters at different reaction times and temperatures. Transmission electron microscopy (TEM) images show the formation of vertical ZnO nanorods with diameter and length of {approx}120 nm and {approx}400 nm respectively. Photoluminescence (PL) spectroscopic studies show a narrow emission at {approx}385 nm and a broad visible emission from 450 to 600 nm. Further, site-selective ZnO nanorod growth is demonstrated for its high degree of control over size, orientation, uniformity, and periodicity on a positive photoresist ZnO seed layer by simple geometrical (line, circle and ring) patterns of 10 {mu}m and 5 {mu}m dimensions. The demonstrated control over size, orientation and periodicity of ZnO nanorods process opens up an opportunity to develop multifunctional properties which promises their potential applications in sensor, piezoelectric, and optoelectronic devices.

  2. Linux OS integrated modular avionics application development framework with apex API of ARINC653 specification

    Directory of Open Access Journals (Sweden)

    Anna V. Korneenkova

    2017-01-01

    Full Text Available The framework is made to provide tools to develop the integrated modular avionics (IMA applications, which could be launched on the target platform LynxOs-178 without modifying their source code. The framework usage helps students to form skills for developing modern modules of the avionics. In addition, students obtain deeper knowledge for the development of competencies in the field of technical creativity by using of the framework.The article describes the architecture and implementation of the Linux OS framework for ARINC653 compliant OS application development.The proposed approach reduces ARINC-653 application development costs and gives a unified tool to implement OS vendor independent code that meets specification. To achieve import substitution free and open-source Linux OS is used as an environment for developing IMA applications.The proposed framework is applicable for using as the tool to develop IMA applications and as the tool for development of the following competencies: the ability to master techniques of using software to solve practical problems, the ability to develop components of hardware and software systems and databases, using modern tools and programming techniques, the ability to match hardware and software tools in the information and automated systems, the readiness to apply the fundamentals of informatics and programming to designing, constructing and testing of software products, the readiness to apply basic methods and tools of software development, knowledge of various technologies of software development.

  3. Applying an Integrative Framework of Executive Function to Preschoolers With Specific Language Impairment.

    Science.gov (United States)

    Kapa, Leah L; Plante, Elena; Doubleday, Kevin

    2017-08-16

    The first goal of this research was to compare verbal and nonverbal executive function abilities between preschoolers with and without specific language impairment (SLI). The second goal was to assess the group differences on 4 executive function components in order to determine if the components may be hierarchically related as suggested within a developmental integrative framework of executive function. This study included 26 4- and 5-year-olds diagnosed with SLI and 26 typically developing age- and sex-matched peers. Participants were tested on verbal and nonverbal measures of sustained selective attention, working memory, inhibition, and shifting. The SLI group performed worse compared with typically developing children on both verbal and nonverbal measures of sustained selective attention and working memory, the verbal inhibition task, and the nonverbal shifting task. Comparisons of standardized group differences between executive function measures revealed a linear increase with the following order: working memory, inhibition, shifting, and sustained selective attention. The pattern of results suggests that preschoolers with SLI have deficits in executive functioning compared with typical peers, and deficits are not limited to verbal tasks. A significant linear relationship between group differences across executive function components supports the possibility of a hierarchical relationship between executive function skills.

  4. Applying an Integrative Framework of Executive Function to Preschoolers With Specific Language Impairment

    Science.gov (United States)

    Plante, Elena; Doubleday, Kevin

    2017-01-01

    Purpose The first goal of this research was to compare verbal and nonverbal executive function abilities between preschoolers with and without specific language impairment (SLI). The second goal was to assess the group differences on 4 executive function components in order to determine if the components may be hierarchically related as suggested within a developmental integrative framework of executive function. Method This study included 26 4- and 5-year-olds diagnosed with SLI and 26 typically developing age- and sex-matched peers. Participants were tested on verbal and nonverbal measures of sustained selective attention, working memory, inhibition, and shifting. Results The SLI group performed worse compared with typically developing children on both verbal and nonverbal measures of sustained selective attention and working memory, the verbal inhibition task, and the nonverbal shifting task. Comparisons of standardized group differences between executive function measures revealed a linear increase with the following order: working memory, inhibition, shifting, and sustained selective attention. Conclusion The pattern of results suggests that preschoolers with SLI have deficits in executive functioning compared with typical peers, and deficits are not limited to verbal tasks. A significant linear relationship between group differences across executive function components supports the possibility of a hierarchical relationship between executive function skills. PMID:28724132

  5. Simultaneous and Sequential Integration by Cre/loxP Site-Specific Recombination in Saccharomyces cerevisiae.

    Science.gov (United States)

    Choi, Ho-Jung; Kim, Yeon-Hee

    2018-05-28

    A Cre/ loxP -δ-integration system was developed to allow sequential and simultaneous integration of a multiple gene expression cassette in Saccharomyces cerevisiae . To allow repeated integrations, the reusable Candida glabrata MARKER ( CgMARKER ) carrying loxP sequences was used, and the integrated CgMARKER was efficiently removed by inducing Cre recombinase. The XYLP and XYLB genes encoding endoxylanase and β-xylosidase, respectively, were used as model genes for xylan metabolism in this system, and the copy number of these genes was increased to 15.8 and 16.9 copies/cell, respectively, by repeated integration. This integration system is a promising approach for the easy construction of yeast strains with enhanced metabolic pathways through multicopy gene expression.

  6. SPECIFICS AND WAYS OF DEVELOPMENT OF ENTERPRISE INTEGRATION IN THE FORMER SOVIET UNION

    Directory of Open Access Journals (Sweden)

    Еlena А. Hudorenko

    2014-01-01

    Full Text Available The article is focused on problems and futuredevelopment of integration processes in thepost-Soviet space. The author highlightssome of the key factors contributing to thedevelopment of centripetal and centrifugaltrends of the region. Special attention isgiven to the industrial policy of countriesinvolved in integration processes. The paper analyzes the role and importance of corporate integration as well as discovers ways ofits development.

  7. Visual-motor integration performance in children with severe specific language impairment.

    Science.gov (United States)

    Nicola, K; Watter, P

    2016-09-01

    This study investigated (1) the visual-motor integration (VMI) performance of children with severe specific language impairment (SLI), and any effect of age, gender, socio-economic status and concomitant speech impairment; and (2) the relationship between language and VMI performance. It is hypothesized that children with severe SLI would present with VMI problems irrespective of gender and socio-economic status; however, VMI deficits will be more pronounced in younger children and those with concomitant speech impairment. Furthermore, it is hypothesized that there will be a relationship between VMI and language performance, particularly in receptive scores. Children enrolled between 2000 and 2008 in a school dedicated to children with severe speech-language impairments were included, if they met the criteria for severe SLI with or without concomitant speech impairment which was verified by a government organization. Results from all initial standardized language and VMI assessments found during a retrospective review of chart files were included. The final study group included 100 children (males = 76), from 4 to 14 years of age with mean language scores at least 2SD below the mean. For VMI performance, 52% of the children scored below -1SD, with 25% of the total group scoring more than 1.5SD below the mean. Age, gender and the addition of a speech impairment did not impact on VMI performance; however, children living in disadvantaged suburbs scored significantly better than children residing in advantaged suburbs. Receptive language scores of the Clinical Evaluation of Language Fundamentals was the only score associated with and able to predict VMI performance. A small subgroup of children with severe SLI will also have poor VMI skills. The best predictor of poor VMI is receptive language scores on the Clinical Evaluation of Language Fundamentals. Children with poor receptive language performance may benefit from VMI assessment and multidisciplinary

  8. Integrating UML, the Q-model and a Multi-Agent Approach in Process Specifications and Behavioural Models of Organisations

    Directory of Open Access Journals (Sweden)

    Raul Savimaa

    2005-08-01

    Full Text Available Efficient estimation and representation of an organisation's behaviour requires specification of business processes and modelling of actors' behaviour. Therefore the existing classical approaches that concentrate only on planned processes are not suitable and an approach that integrates process specifications with behavioural models of actors should be used instead. The present research indicates that a suitable approach should be based on interactive computing. This paper examines the integration of UML diagrams for process specifications, the Q-model specifications for modelling timing criteria of existing and planned processes and a multi-agent approach for simulating non-deterministic behaviour of human actors in an organisation. The corresponding original methodology is introduced and some of its applications as case studies are reviewed.

  9. Specification of an integrated information architecture for a mobile teleoperated robot for home telecare.

    Science.gov (United States)

    Iannuzzi, David; Grant, Andrew; Corriveau, Hélène; Boissy, Patrick; Michaud, Francois

    2016-12-01

    The objective of this study was to design effectively integrated information architecture for a mobile teleoperated robot in remote assistance to the delivery of home health care. Three role classes were identified related to the deployment of a telerobot, namely, engineer, technology integrator, and health professional. Patients and natural caregivers were indirectly considered, this being a component of future field studies. Interviewing representatives of each class provided the functions, and information content and flows for each function. Interview transcripts enabled the formulation of UML (Universal Modeling Language) diagrams for feedback from participants. The proposed information architecture was validated with a use-case scenario. The integrated information architecture incorporates progressive design, ergonomic integration, and the home care needs from medical specialist, nursing, physiotherapy, occupational therapy, and social worker care perspectives. The integrated architecture iterative process promoted insight among participants. The use-case scenario evaluation showed the design's robustness. Complex innovation such as a telerobot must coherently mesh with health-care service delivery needs. The deployment of integrated information architecture bridging development, with specialist and home care applications, is necessary for home care technology innovation. It enables continuing evolution of robot and novel health information design in the same integrated architecture, while accounting for patient ecological need.

  10. Grid connected integrated community energy system. Phase II: final stage 2 report. Outline specifications of cogeneration plant; continued

    Energy Technology Data Exchange (ETDEWEB)

    1978-03-22

    Specifications are presented for the electrical equipment, site preparation, building construction and mechanical systems for a dual-purpose power plant to be located on the University of Minnesota campus. This power plant will supply steam and electrical power to a grid-connected Integrated Community Energy System. (LCL)

  11. Site-specific integration in CHO cells mediated by CRISPR/Cas9 and homology-directed DNA repair pathway

    DEFF Research Database (Denmark)

    Lee, Jae Seong; Beuchert Kallehauge, Thomas; Pedersen, Lasse Ebdrup

    2015-01-01

    gene integration into site-specific loci in CHO cells using CRISPR/Cas9 genome editing system and compatible donor plasmid harboring a gene of interest (GOI) and short homology arms. This strategy has enabled precise insertion of a 3.7-kb gene expression cassette at defined loci in CHO cells following...

  12. More of the same? Comment on "An integrated framework for the optimisation of sport and athlete development: a practitioner approach".

    Science.gov (United States)

    MacNamara, Aine; Collins, Dave

    2014-01-01

    Gulbin and colleagues (Gulbin, J. P., Croser, M. J., Morley, E. J., & Weissensteiner, J. R. (2013). An integrated framework for the optimisation of sport and athlete development: A practitioner approach. Journal of Sports Sciences) present a new sport and athlete development framework that evolved from empirical observations from working with the Australian Institute of Sport. The FTEM (Foundations, Talent, Elite, Mastery) framework is proposed to integrate general and specialised phases of development for participants within the active lifestyle, sport participation and sport excellence pathways. A number of issues concerning the FTEM framework are presented. We also propose the need to move beyond prescriptive models of talent identification and development towards a consideration of features of best practice and process markers of development together with robust guidelines about the implementation of these in applied practice.

  13. NuSEE: an integrated environment of software specification and V and V for PLC based safety-critical systems

    International Nuclear Information System (INIS)

    Koo, Seo Ryong; Seong, Poong Hyun; Yoo, Jun Beom; Cha, Sung Deok; Youn, Cheong; Han, Hyun Chul

    2006-01-01

    As the use of digital systems becomes more prevalent, adequate techniques for software specification and analysis have become increasingly important in Nuclear Power Plant (NPP) safety-critical systems. Additionally, the importance of software Verification and Validation (V and V) based on adequate specification has received greater emphasis in view of improving software quality. For thorough V and V of safety-critical systems, V and V should be performed throughout the software lifecycle. However, systematic V and V is difficult as it involves many manual-oriented tasks. Tool support is needed in order to more conveniently perform software V and V. In response, we developed four kinds of Computer Aided Software Engineering (CASE) tools to support system specification for a formal-based analysis according to the software lifecycle. In this work, we achieved optimized integration of each tool. The toolset, NuSEE, is an integrated environment for software specification and V and V for PLC based safety-critical systems. In accordance with the software lifecycle, NuSEE consists of NuSISRT for the concept phase, NuSRS for the requirements phase, NuSDS for the design phase and NuSCM for configuration management. It is believed that after further development our integrated environment will be a unique and promising software specification and analysis toolset that will support the entire software lifecycle for the development of PLC based NPP safety-critical systems

  14. On the complex interaction between mathematics and the sciences of living systems. Comment on "Move me, astonish me...delight my eyes and brain: The Vienna Integrated Model of top-down and bottom-up processes in Art Perception (VIMAP) and corresponding affective, evaluative, and neurophysiological correlates" by Matthew Pelowski et al.

    Science.gov (United States)

    Bellomo, Nicola; Outada, Nisrine

    2017-07-01

    Cultural framework: Our comment looks at the general framework given by the interactions between the so-called ;soft; and ;hard; sciences. Specifically, it looks at the development of a mathematics for living systems. Our comment aims at showing how the interesting survey [11] can contribute to the aforementioned challenging task.

  15. Angular distributions of plasma edge velocity and integrated intensity: Update on specific impulse for Ablative Laser Propulsion

    Science.gov (United States)

    Lin, Jun; Pakhomov, Andrew V.

    2005-04-01

    This work concludes our discussion of the image processing technique developed earlier for determination of specific impulse (Isp) for Ablative Laser Propulsion (ALP). The plasma plumes are recorded with a time-resolved intensified charge-coupled device (ICCD) camera. The plasma was formed in vacuum (˜ 3×10-3 Torr) by focusing output pulses of a laser system (100-ps pulsewidth at 532 nm wavelength and ˜35 mJ energy) on surfaces of C (graphite), Al, Si, Fe, Cu, Zn, Sn, and Pb elements. Angular profiles for integrated intensity and plasma expansion velocity were determined for the tested elements. Such profiles were used further for assessment of specific impulse. Specific impulses derived from angular distributions of plasma expansion velocity and integral intensity appeared in excellent agreement with the data derived earlier from force measurements.

  16. Angular distributions of plasma edge velocity and integrated intensity: Update on specific impulse for Ablative Laser Propulsion

    International Nuclear Information System (INIS)

    Lin Jun; Pakhomov, Andrew V.

    2005-01-01

    This work concludes our discussion of the image processing technique developed earlier for determination of specific impulse (Isp) for Ablative Laser Propulsion (ALP). The plasma plumes are recorded with a time-resolved intensified charge-coupled device (ICCD) camera. The plasma was formed in vacuum (∼ 3x10-3 Torr) by focusing output pulses of a laser system (100-ps pulsewidth at 532 nm wavelength and ∼35 mJ energy) on surfaces of C (graphite), Al, Si, Fe, Cu, Zn, Sn, and Pb elements. Angular profiles for integrated intensity and plasma expansion velocity were determined for the tested elements. Such profiles were used further for assessment of specific impulse. Specific impulses derived from angular distributions of plasma expansion velocity and integral intensity appeared in excellent agreement with the data derived earlier from force measurements

  17. Detecting Specific Health-Related Events Using an Integrated Sensor System for Vital Sign Monitoring

    Directory of Open Access Journals (Sweden)

    Mourad Adnane

    2009-09-01

    Full Text Available In this paper, a new method for the detection of apnea/hypopnea periods in physiological data is presented. The method is based on the intelligent combination of an integrated sensor system for long-time cardiorespiratory signal monitoring and dedicated signal-processing packages. Integrated sensors are a PVDF film and conductive fabric sheets. The signal processing package includes dedicated respiratory cycle (RC and QRS complex detection algorithms and a new method using the respiratory cycle variability (RCV for detecting apnea/hypopnea periods in physiological data. Results show that our method is suitable for online analysis of long time series data.

  18. Crack arrest: some comments on microscopic and macroscopic aspects in relation to the assurance of structural integrity

    Energy Technology Data Exchange (ETDEWEB)

    Lidbury, D.P.G.; Druce, S.G.; Tomkins, B. [AEA Technology, Risley (United Kingdom)

    1996-12-31

    Fracture prevention in high integrity structures in general, and steel nuclear reactor pressure vessels (RPVs) in particular, is based upon the avoidance of crack initiation, with due regard to real or postulated defects, material toughness and anticipated normal and off-normal loading conditions. However, avoidance of crack initiation can never be guaranteed in any absolute sense. Thus, in cases where there is the possibility of an initiated crack propagating by brittle, cleavage fracture, the crack arrest concept may be usefully applied to provide some additional assurance of structural integrity. Within this context, the mechanical processes operative during the initiation and arrest of cleavage cracks are briefly compared and contrasted. The empirical evidence for indexing and onset-of-upper-shelf temperature for initiation (OUST) and the crack arrest temperature (CAT) relative to the Pellini drop-weight nil-ductility transition temperature (NDTT) is examined, and estimates of the parameter (OUST-CAT) are made for a range of steels. In the light of this, correlations between small-scale tests and more structurally relevant, large-scale tests are examined in relation to both initiation- and arrest-based failure avoidance methodologies. (author).

  19. 76 FR 14840 - Extension of Comment Period: EPA's Plan for Retrospective Review Under Executive Order 13563

    Science.gov (United States)

    2011-03-18

    .... Integration and Innovation Submit a comment on ``Improving Regulations: Integration and Innovation'' at docket.... Economic Conditions/Market Submit a comment about ``Improving Regulations: Economic Conditions/Market'' at...

  20. What Will An Integrated Socialist World Look Like? Brief comments on Warren Wagar ' s article: "Toward a Praxisof a World Integration"

    Directory of Open Access Journals (Sweden)

    Maria A. Pozas

    2015-08-01

    Full Text Available World integration under a single state is foreseen by world -system theorists as the only means to save the world from destruction and chaos. The exhaustion of capitalism will lead, in their view, to the substitution of the current system of competing sovereign states by a democratic,liberal and socialist commonwealth. In his article Warren Wagar discusses who will lead this transition, and indirectly suggests that a world system party similar to that of his novel A Short History of the Future (1992 may be the most feasible way to guarantee the socialist character of the new world state.

  1. The Reviewing of Object Files: Object-Specific Integration of Information.

    Science.gov (United States)

    Kahneman, Daniel; And Others

    1992-01-01

    Seven experiments involving a total of 203 college students explored a form of object-specific priming and established a robust object-specific benefit that indicates that a new stimulus will be named faster if it physically matches a previous stimulus seen as part of the same perceptual object. (SLD)

  2. Patient-specific cardiovascular progenitor cells derived from integration-free induced pluripotent stem cells for vascular tissue regeneration.

    Science.gov (United States)

    Hu, Jiang; Wang, Yongyu; Jiao, Jiao; Liu, Zhongning; Zhao, Chao; Zhou, Zhou; Zhang, Zhanpeng; Forde, Kaitlynn; Wang, Lunchang; Wang, Jiangang; Baylink, David J; Zhang, Xiao-Bing; Gao, Shaorong; Yang, Bo; Chen, Y Eugene; Ma, Peter X

    2015-12-01

    Tissue-engineered blood vessels (TEBVs) are promising in regenerating a live vascular replacement. However, the vascular cell source is limited, and it is crucial to develop a scaffold that accommodates new type of vascular progenitor cells and facilitates in vivo lineage specification of the cells into functional vascular smooth muscle cells (VSMCs) to regenerate vascular tissue. In the present study, integration-free human induced pluripotent stem cells (hiPSCs) were established from patient peripheral blood mononuclear cells through episomal vector nucleofection of reprogramming factors. The established hiPSCs were then induced into mesoderm-originated cardiovascular progenitor cells (CVPCs) with a highly efficient directed lineage specification method. The derived CVPCs were demonstrated to be able to differentiate into functional VSMCs. Subcutaneous implantation of CVPCs seeded on macroporous nanofibrous poly(l-lactide) scaffolds led to in vivo VSMC lineage specification and matrix deposition inside the scaffolds. In summary, we established integration-free patient-specific hiPSCs from peripheral blood mononuclear cells, derived CVPCs through directed lineage specification, and developed an advanced scaffold for these progenitor cells to further differentiate in vivo into VSMCs and regenerate vascular tissue in a subcutaneous implantation model. This study has established an efficient patient-specific approach towards in vivo regeneration of vascular tissue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. The quartet theory: Implications for autism spectrum disorder. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Pehrs, Corinna; Samson, Andrea C.; Gross, James J.

    2015-06-01

    Autism Spectrum Disorder (ASD) is a neurodevelopmental disorder characterized by social and communication deficits as well as restricted and repetitive behaviors [1]. Specific deficits include failure to initiate reciprocal social interactions, verbal and non-verbal communication difficulties, decreased sensitivity to social and emotional cues, and limited perspective-taking abilities. Social withdrawal, avoidance or indifference to affection or physical contact, lack of eye contact, and decreased joint attention and facial responsiveness are also common [2]. In addition to these core features, there is a growing body of literature that describes problematic patterns of emotional reactivity (increased negative and decreased positive emotions) and emotion regulation (increased use of maladaptive and decreased use of adaptive emotion regulation strategies) [3-5]. The present comment seeks to link difficulties in socio-emotional domains to the Quartet Theory of Human Emotions by mapping characteristic ASD social deficits and emotion dysregulation onto two of the affect systems described in this theory: the hippocampal and orbitofrontal-centered systems.

  4. Design and integration of components for site specific control of fertilizer application

    NARCIS (Netherlands)

    Bergeijk, van J.

    2001-01-01

    Keywords: Precision Agriculture, Site Specific Agriculture, Global Positioning System, GPS, Fertilizer Application, Information System.

    Spatial and temporal variability in soil, crop and climate characteristics results in non optimal use of fertilizers when the application

  5. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    International Nuclear Information System (INIS)

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-01-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence

  6. Integrative functional genomic analyses implicate specific molecular pathways and circuits in autism

    OpenAIRE

    Parikshak, Neelroop N.; Luo, Rui; Zhang, Alice; Won, Hyejung; Lowe, Jennifer K.; Chandran, Vijayendran; Horvath, Steve; Geschwind, Daniel H.

    2013-01-01

    Genetic studies have identified dozens of autism spectrum disorder (ASD) susceptibility genes, raising two critical questions: 1) do these genetic loci converge on specific biological processes, and 2) where does the phenotypic specificity of ASD arise, given its genetic overlap with intellectual disability (ID)? To address this, we mapped ASD and ID risk genes onto co-expression networks representing developmental trajectories and transcriptional profiles representing fetal and adult cortica...

  7. Incorporating and evaluating an integrated gender-specific medicine curriculum: a survey study in Dutch GP training

    Science.gov (United States)

    Dielissen, Patrick W; Bottema, Ben JAM; Verdonk, Petra; Lagro-Janssen, Toine LM

    2009-01-01

    Background We recently set standards for gender-specific medicine training as an integrated part of the GP training curriculum. This paper describes the programme and evaluation of this training. Methods The programme is designed for GP registrars throughout the 3-year GP training. The modules emphasize interaction, application, and clinically integrated learning and teaching methods in peer groups. In 2005 - 2008, after completion of each tutorial, GP registrars were asked to fill in a questionnaire on a 5-point Likert scale to assess the programme's methods and content. GP registrars were also asked to identify two learning points related to the programme. Results The teaching programme consists of five 3-hour modules that include gender themes related to and frequently seen by GPs such as in doctor-patient communication and cardiovascular disease. GP registrars evaluated the training course positively. The written learning points suggest that GP registrars have increased their awareness of why attention to gender-specific information is relevant. Conclusion In summary, gender-specific medicine training has been successfully integrated into an existing GP training curriculum. The modules and teaching methods are transferable to other training institutes for postgraduate training. The evaluation of the teaching programme shows a positive impact on GP registrars' gender awareness. PMID:19737396

  8. Incorporating and evaluating an integrated gender-specific medicine curriculum: a survey study in Dutch GP training

    Directory of Open Access Journals (Sweden)

    Lagro-Janssen Toine LM

    2009-09-01

    Full Text Available Abstract Background We recently set standards for gender-specific medicine training as an integrated part of the GP training curriculum. This paper describes the programme and evaluation of this training. Methods The programme is designed for GP registrars throughout the 3-year GP training. The modules emphasize interaction, application, and clinically integrated learning and teaching methods in peer groups. In 2005 - 2008, after completion of each tutorial, GP registrars were asked to fill in a questionnaire on a 5-point Likert scale to assess the programme's methods and content. GP registrars were also asked to identify two learning points related to the programme. Results The teaching programme consists of five 3-hour modules that include gender themes related to and frequently seen by GPs such as in doctor-patient communication and cardiovascular disease. GP registrars evaluated the training course positively. The written learning points suggest that GP registrars have increased their awareness of why attention to gender-specific information is relevant. Conclusion In summary, gender-specific medicine training has been successfully integrated into an existing GP training curriculum. The modules and teaching methods are transferable to other training institutes for postgraduate training. The evaluation of the teaching programme shows a positive impact on GP registrars' gender awareness.

  9. CEO Appointments and the Loss of Firm-specific Knowledge - Putting Integrity Back into Hiring Decisions

    DEFF Research Database (Denmark)

    Rost, Katja; Salomo, Søren

    2008-01-01

    that over the past decades the dishonesty of the predecessor has become relatively more important for the appointment decisions of firms. We conclude that outside hires are a suboptimal trend because external candidates even step up the regression of integrity in firms: As nobody has an incentive to invest......A rarely studied trend in corporate governance is the increasing tendency to fill CEO openings through external hires rather than through internal promotions: Kevin J. Murphy and Ján Zábojník (2004) show that the proportion of outside hires has doubled and their pay premium almost quadrupled over...

  10. Site-specific landslide assessment in Alpine area using a reliable integrated monitoring system

    Science.gov (United States)

    Romeo, Saverio; Di Matteo, Lucio; Kieffer, Daniel Scott

    2016-04-01

    Rockfalls are one of major cause of landslide fatalities around the world. The present work discusses the reliability of integrated monitoring of displacements in a rockfall within the Alpine region (Salzburg Land - Austria), taking into account also the effect of the ongoing climate change. Due to the unpredictability of the frequency and magnitude, that threatens human lives and infrastructure, frequently it is necessary to implement an efficient monitoring system. For this reason, during the last decades, integrated monitoring systems of unstable slopes were widely developed and used (e.g., extensometers, cameras, remote sensing, etc.). In this framework, Remote Sensing techniques, such as GBInSAR technique (Groung-Based Interferometric Synthetic Aperture Radar), have emerged as efficient and powerful tools for deformation monitoring. GBInSAR measurements can be useful to achieve an early warning system using surface deformation parameters as ground displacement or inverse velocity (for semi-empirical forecasting methods). In order to check the reliability of GBInSAR and to monitor the evolution of landslide, it is very important to integrate different techniques. Indeed, a multi-instrumental approach is essential to investigate movements both in surface and in depth and the use of different monitoring techniques allows to perform a cross analysis of the data and to minimize errors, to check the data quality and to improve the monitoring system. During 2013, an intense and complete monitoring campaign has been conducted on the Ingelsberg landslide. By analyzing both historical temperature series (HISTALP) recorded during the last century and those from local weather stations, temperature values (Autumn-Winter, Winter and Spring) are clearly increased in Bad Hofgastein area as well as in Alpine region. As consequence, in the last decades the rockfall events have been shifted from spring to summer due to warmer winters. It is interesting to point out that

  11. Specific features of the temperature dependence of the exciton absorption integral in CdS crystals

    International Nuclear Information System (INIS)

    Novikov, A.B.; Solov'ev, L.E.; Talalaev, V.G.

    1986-01-01

    Cadmium sulfide crystals 0.4-2 μm thick in the 4.2-120 K temperature range are investigated experimentally. The shape of the first exciton absorption line in CdS and dependence of integral exciton absorption factor (IEAF) on the quenching constant j are calculated. Rapid growth of the absorption factor in the maximum of the absorption line and decrease of halfwidth of the factor are shown to take place with j increase. The calculation has disclosed that the Bouguer law is observed excluding negligible IEAF oscillations at variation of crystal thickness. Non-monotonous temperature dependence of IEAF is disclosed in some investigated samples; it, obviously, testifies to non-monotonous temperature dependence of j. Depolarization of the absorption line of high-energy exciton states with n=2 and n=3 is discovered in some samples for the first time

  12. All-organic microelectromechanical systems integrating specific molecular recognition--a new generation of chemical sensors.

    Science.gov (United States)

    Ayela, Cédric; Dubourg, Georges; Pellet, Claude; Haupt, Karsten

    2014-09-03

    Cantilever-type all-organic microelectromechanical systems based on molecularly imprinted polymers for specific analyte recognition are used as chemical sensors. They are produced by a simple spray-coating-shadow-masking process. Analyte binding to the cantilever generates a measurable change in its resonance frequency. This allows label-free detection by direct mass sensing of low-molecular-weight analytes at nanomolar concentrations. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. MUSI: an integrated system for identifying multiple specificity from very large peptide or nucleic acid data sets.

    Science.gov (United States)

    Kim, Taehyung; Tyndel, Marc S; Huang, Haiming; Sidhu, Sachdev S; Bader, Gary D; Gfeller, David; Kim, Philip M

    2012-03-01

    Peptide recognition domains and transcription factors play crucial roles in cellular signaling. They bind linear stretches of amino acids or nucleotides, respectively, with high specificity. Experimental techniques that assess the binding specificity of these domains, such as microarrays or phage display, can retrieve thousands of distinct ligands, providing detailed insight into binding specificity. In particular, the advent of next-generation sequencing has recently increased the throughput of such methods by several orders of magnitude. These advances have helped reveal the presence of distinct binding specificity classes that co-exist within a set of ligands interacting with the same target. Here, we introduce a software system called MUSI that can rapidly analyze very large data sets of binding sequences to determine the relevant binding specificity patterns. Our pipeline provides two major advances. First, it can detect previously unrecognized multiple specificity patterns in any data set. Second, it offers integrated processing of very large data sets from next-generation sequencing machines. The results are visualized as multiple sequence logos describing the different binding preferences of the protein under investigation. We demonstrate the performance of MUSI by analyzing recent phage display data for human SH3 domains as well as microarray data for mouse transcription factors.

  14. Medical Image Processing for Fully Integrated Subject Specific Whole Brain Mesh Generation

    Directory of Open Access Journals (Sweden)

    Chih-Yang Hsu

    2015-05-01

    Full Text Available Currently, anatomically consistent segmentation of vascular trees acquired with magnetic resonance imaging requires the use of multiple image processing steps, which, in turn, depend on manual intervention. In effect, segmentation of vascular trees from medical images is time consuming and error prone due to the tortuous geometry and weak signal in small blood vessels. To overcome errors and accelerate the image processing time, we introduce an automatic image processing pipeline for constructing subject specific computational meshes for entire cerebral vasculature, including segmentation of ancillary structures; the grey and white matter, cerebrospinal fluid space, skull, and scalp. To demonstrate the validity of the new pipeline, we segmented the entire intracranial compartment with special attention of the angioarchitecture from magnetic resonance imaging acquired for two healthy volunteers. The raw images were processed through our pipeline for automatic segmentation and mesh generation. Due to partial volume effect and finite resolution, the computational meshes intersect with each other at respective interfaces. To eliminate anatomically inconsistent overlap, we utilized morphological operations to separate the structures with a physiologically sound gap spaces. The resulting meshes exhibit anatomically correct spatial extent and relative positions without intersections. For validation, we computed critical biometrics of the angioarchitecture, the cortical surfaces, ventricular system, and cerebrospinal fluid (CSF spaces and compared against literature values. Volumina and surface areas of the computational mesh were found to be in physiological ranges. In conclusion, we present an automatic image processing pipeline to automate the segmentation of the main intracranial compartments including a subject-specific vascular trees. These computational meshes can be used in 3D immersive visualization for diagnosis, surgery planning with haptics

  15. Brain systems for probabilistic and dynamic prediction: computational specificity and integration.

    Directory of Open Access Journals (Sweden)

    Jill X O'Reilly

    2013-09-01

    Full Text Available A computational approach to functional specialization suggests that brain systems can be characterized in terms of the types of computations they perform, rather than their sensory or behavioral domains. We contrasted the neural systems associated with two computationally distinct forms of predictive model: a reinforcement-learning model of the environment obtained through experience with discrete events, and continuous dynamic forward modeling. By manipulating the precision with which each type of prediction could be used, we caused participants to shift computational strategies within a single spatial prediction task. Hence (using fMRI we showed that activity in two brain systems (typically associated with reward learning and motor control could be dissociated in terms of the forms of computations that were performed there, even when both systems were used to make parallel predictions of the same event. A region in parietal cortex, which was sensitive to the divergence between the predictions of the models and anatomically connected to both computational networks, is proposed to mediate integration of the two predictive modes to produce a single behavioral output.

  16. Experiences from the formal specification of the integration platform and the synthesis of SDT with the software bus

    International Nuclear Information System (INIS)

    Thunem, Harald; Mohn, Peter; Sandmark, Haakon; Stoelen, Ketil

    1999-04-01

    The three year programme 1997-1999 for the OECD Halden Reactor Project (HRP) identifies the need to gain experience from applying formal techniques in real-life system developments. This motivated the initiation of the HRP research activity Integration of Formal Specification in the Development of HAMMLAB 2000 (INT-FS). The principal objective was to experiment with formal techniques in system developments at the HRP; in particular, system developments connected to HAMMLAB 2000 - the computerised laboratory for man-machine-interaction experiments currently under construction. It was hoped that this experimentation with formal techniques should result in a better understanding of how such techniques should be utilised in a more industrial setting. To obtain more knowledge with respect to the practical effects and consequences of an increased level of formalization was another objective. This report summarises experiences, results and conclusions from a pre-study addressing INT-FS related issues connected to the development of the HAMMLAB 2000 Integration Platform (IP). The report starts by giving a brief overview of the IP. Then it describes and summarises experiences from the formalization of a top-level requirements specification for the IP. Finally, it discusses various approaches for the integration of applications generated automatically through the CASE-tool SDT and the Software Bus on which the communication within HAMMLAB 2000 will be based. The report concludes that the selected formalisms and tools are well-suited to describe IP-like systems. The report also concludes that the integration of SDT applications with the Software Bus will not be a major obstacle, and finally that a monitoring component for the IP is well-suited for development within INT-FS (author) (ml)

  17. Hierarchical mesosilicalite nanoformulation integrated with cisplatin exhibits target-specific efficient anticancer activity

    Science.gov (United States)

    Jermy, B. Rabindran; Acharya, Sadananda; Ravinayagam, Vijaya; Alghamdi, Hajer Saleh; Akhtar, Sultan; Basuwaidan, Rehab S.

    2018-04-01

    Hierarchically structured zeolitic ZSM-5 and meso MCM-41 interlinked domain had an impeccable use as catalysis in many applications. The aim of the study was to develop a new drug delivery nanoformulation, specifically, cisplatin/mesosilicalite using top-down approach for cancer therapy. Hierarchical mesosilicalite with variable porosity was synthesized using alkaline molar solution (0.2 and 0.7 M NaOH) and was loaded with cisplatin through equilibrium adsorption technique. Physico-chemical properties of the nanoformulation (IAUM-56—Imam Abdulrahman Bin Faisal University Mesosilicalite-56) were characterized using X-ray diffraction, surface area analysis (BET), Fourier transformed infrared spectroscopy (FT-IR), diffuse reflectance UV-Vis spectroscopy, and transmission electron microscopy. Drug release study and anticancer activity were assayed on HeLa and MCF7 cancer cells using MTT assay. X-ray diffraction pattern showed interrelated meso- and microphases, while BET analysis revealed considerable mesoporosity formation with a remodulation of isotherm hysteresis indicating the presence of hierarchical pores. FT-IR showed the presence of nanozeolitic subunits into mesostructure with a band at about 550 cm-1. IAUM-56 demonstrated high cytotoxic activity against HeLa cancer cells with an LC50 of 0.02 mg/ml, MCF7 cancer cells with an LC50 of 0.05 mg/ml, and less toxic to normal fibroblast cells with an LC50 of approximately ten times higher at 0.5 mg/ml. Overall, IAUM-56 showed a high rate of sustained release of cisplatin imparting target specific cytotoxic effect against tumor cells with at least tenfold lower toxicity on normal fibroblast cells. Our nanoformulation has the potential use in cancer therapy as a targeted drug delivery system.

  18. Thermal Radiometer Signal Processing Using Radiation Hard CMOS Application Specific Integrated Circuits for Use in Harsh Planetary Environments

    Science.gov (United States)

    Quilligan, G.; DuMonthier, J.; Aslam, S.; Lakew, B.; Kleyner, I.; Katz, R.

    2015-01-01

    Thermal radiometers such as proposed for the Europa Clipper flyby mission require low noise signal processing for thermal imaging with immunity to Total Ionizing Dose (TID) and Single Event Latchup (SEL). Described is a second generation Multi- Channel Digitizer (MCD2G) Application Specific Integrated Circuit (ASIC) that accurately digitizes up to 40 thermopile pixels with greater than 50 Mrad (Si) immunity TID and 174 MeV-sq cm/mg SEL. The MCD2G ASIC uses Radiation Hardened By Design (RHBD) techniques with a 180 nm CMOS process node.

  19. Health care fraud and abuse data collection program: technical revisions to healthcare integrity and protection data bank data collection activities. Interim final rule with comment period.

    Science.gov (United States)

    2004-06-17

    The rule makes technical changes to the Healthcare Integrity and Protection Data Bank (HIPDB) data collection reporting requirements set forth in 45 CFR part 61 by clarifying the types of personal numeric identifiers that may be reported to the data bank in connection with adverse actions. Specifically, the rule clarifies that in lieu of a Social Security Number (SSN), an individual taxpayer identification number (ITIN) may be reported to the data bank when, in those limited situations, an individual does not have an SSN.

  20. Levels of analysis in neuroscientific studies of emotion: Comment on "The quartet theory of human emotions: an integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Kuiken, Don; Douglas, Shawn

    2015-06-01

    In the conduct of neuroscience research, methodological choices and theoretical claims often reveal underlying metamethodological and ontological commitments. Koelsch et al. [1] accentuate such commitments in their description of four "neuroanatomically distinct systems," each the substrate of "a specific class of affects" (p. 1). Explication of those classes of affect require theoretical integration across methodologically diverse disciplines, including "psychology, neurobiology, sociology, anthropology, and psycholinguistics" (p. 3). (Philosophy is noticeably missing from this list, but several aspects of the authors' stance indicate that it is not ignored.)

  1. Integration

    DEFF Research Database (Denmark)

    Emerek, Ruth

    2004-01-01

    Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration......Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration...

  2. Integrative Analysis of Sex-Specific microRNA Networks Following Stress in Mouse Nucleus Accumbens.

    Science.gov (United States)

    Pfau, Madeline L; Purushothaman, Immanuel; Feng, Jian; Golden, Sam A; Aleyasin, Hossein; Lorsch, Zachary S; Cates, Hannah M; Flanigan, Meghan E; Menard, Caroline; Heshmati, Mitra; Wang, Zichen; Ma'ayan, Avi; Shen, Li; Hodes, Georgia E; Russo, Scott J

    2016-01-01

    Adult women are twice as likely as men to suffer from affective and anxiety disorders, although the mechanisms underlying heightened female stress susceptibility are incompletely understood. Recent findings in mouse Nucleus Accumbens (NAc) suggest a role for DNA methylation-driven sex differences in genome-wide transcriptional profiles. However, the role of another epigenetic process-microRNA (miR) regulation-has yet to be explored. We exposed male and female mice to Subchronic Variable Stress (SCVS), a stress paradigm that produces depression-like behavior in female, but not male, mice, and performed next generation mRNA and miR sequencing on NAc tissue. We applied a combination of differential expression, miR-mRNA network and functional enrichment analyses to characterize the transcriptional and post-transcriptional landscape of sex differences in NAc stress response. We find that male and female mice exhibit largely non-overlapping miR and mRNA profiles following SCVS. The two sexes also show enrichment of different molecular pathways and functions. Collectively, our results suggest that males and females mount fundamentally different transcriptional and post-transcriptional responses to SCVS and engage sex-specific molecular processes following stress. These findings have implications for the pathophysiology and treatment of stress-related disorders in women.

  3. B827 Chemical Synthhesis Project - Industrial Control System Integration - Statement of Work & Specification with Attachments 1-14

    Energy Technology Data Exchange (ETDEWEB)

    Wade, F. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-04-21

    The Chemical Synthesis Pilot Process at the Lawrence Livermore National Laboratory (LLNL) Site 300 827 Complex will be used to synthesize small quantities of material to support research and development. The project will modernize and increase current capabilities for chemical synthesis at LLNL. The primary objective of this project is the conversion of a non-automated hands-on process to a remoteoperation process, while providing enhanced batch process step control, stored recipe-specific parameter sets, process variable visibility, monitoring, alarm and warning handling, and comprehensive batch record data logging. This Statement of Work and Specification provides the industrial-grade process control requirements for the chemical synthesis batching control system, hereafter referred to as the “Control System” to be delivered by the System Integrator.

  4. Auditory-visual integration modulates location-specific repetition suppression of auditory responses.

    Science.gov (United States)

    Shrem, Talia; Murray, Micah M; Deouell, Leon Y

    2017-11-01

    Space is a dimension shared by different modalities, but at what stage spatial encoding is affected by multisensory processes is unclear. Early studies observed attenuation of N1/P2 auditory evoked responses following repetition of sounds from the same location. Here, we asked whether this effect is modulated by audiovisual interactions. In two experiments, using a repetition-suppression paradigm, we presented pairs of tones in free field, where the test stimulus was a tone presented at a fixed lateral location. Experiment 1 established a neural index of auditory spatial sensitivity, by comparing the degree of attenuation of the response to test stimuli when they were preceded by an adapter sound at the same location versus 30° or 60° away. We found that the degree of attenuation at the P2 latency was inversely related to the spatial distance between the test stimulus and the adapter stimulus. In Experiment 2, the adapter stimulus was a tone presented from the same location or a more medial location than the test stimulus. The adapter stimulus was accompanied by a simultaneous flash displayed orthogonally from one of the two locations. Sound-flash incongruence reduced accuracy in a same-different location discrimination task (i.e., the ventriloquism effect) and reduced the location-specific repetition-suppression at the P2 latency. Importantly, this multisensory effect included topographic modulations, indicative of changes in the relative contribution of underlying sources across conditions. Our findings suggest that the auditory response at the P2 latency is affected by spatially selective brain activity, which is affected crossmodally by visual information. © 2017 Society for Psychophysiological Research.

  5. S3QL: A distributed domain specific language for controlled semantic integration of life sciences data

    Directory of Open Access Journals (Sweden)

    de Lencastre Hermínia

    2011-07-01

    Full Text Available Abstract Background The value and usefulness of data increases when it is explicitly interlinked with related data. This is the core principle of Linked Data. For life sciences researchers, harnessing the power of Linked Data to improve biological discovery is still challenged by a need to keep pace with rapidly evolving domains and requirements for collaboration and control as well as with the reference semantic web ontologies and standards. Knowledge organization systems (KOSs can provide an abstraction for publishing biological discoveries as Linked Data without complicating transactions with contextual minutia such as provenance and access control. We have previously described the Simple Sloppy Semantic Database (S3DB as an efficient model for creating knowledge organization systems using Linked Data best practices with explicit distinction between domain and instantiation and support for a permission control mechanism that automatically migrates between the two. In this report we present a domain specific language, the S3DB query language (S3QL, to operate on its underlying core model and facilitate management of Linked Data. Results Reflecting the data driven nature of our approach, S3QL has been implemented as an application programming interface for S3DB systems hosting biomedical data, and its syntax was subsequently generalized beyond the S3DB core model. This achievement is illustrated with the assembly of an S3QL query to manage entities from the Simple Knowledge Organization System. The illustrative use cases include gastrointestinal clinical trials, genomic characterization of cancer by The Cancer Genome Atlas (TCGA and molecular epidemiology of infectious diseases. Conclusions S3QL was found to provide a convenient mechanism to represent context for interoperation between public and private datasets hosted at biomedical research institutions and linked data formalisms.

  6. Comment on: Path integral solution of the Schroedinger equation in curvilinear coordinates: A straightforward procedure [J. Math. Phys. 37, 4310 endash 4319 (1996)

    International Nuclear Information System (INIS)

    Wurm, A.; LaChapelle, J.

    1997-01-01

    The authors comment on the paper by J. LaChapelle, J. Math. Phys. 37, 4310 (1996), and give explicit expressions for the parametrization, its solution, and the Lie derivatives of the Schroedinger equation for the case of n-dimensional spherical coordinates

  7. Comments on management of radioactive wastes

    International Nuclear Information System (INIS)

    Kindness, T.N.

    1978-01-01

    A few comments are made concerning the recognized need for a management of radioactive wastes. The comment is made that perhaps a lack of a set of specific understandable goals is why the need hasn't been met. An outline is included that the author feels would lead to a filling of the need

  8. Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.

    Science.gov (United States)

    Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J

    2015-10-01

    FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental

  9. EFFECTIVENESS OF INTEGRATED NEUROMUSCULAR INHIBITORY TECHNIQUE (INIT WITH SPECIFIC STRENGTH TRAINING EXERCISES IN SUBJECTS WITH UPPER TRAPEZIUS TRIGGER POINTS

    Directory of Open Access Journals (Sweden)

    B. Jyothirmai

    2015-10-01

    Full Text Available Background: Upper trapezius trigger points is a common cause for neck pain, decreased cervical range of motion and functional activities. The purpose of the study was to evaluate the effectiveness of integrated neuromuscular inhibitory technique (INIT along with specific strength training exercises in reducing pain, improving ROM and functional activities in subjects with upper trapezius trigger point. Methods: Thirty subjects were diagnosed with upper trapezius trigger points were included in the study. These patients were randomly allocated to intervention group (n=15, which underwent a 4- weeks training program of INIT along with specific strength training & control group (n=15 that received INIT alone. The outcome measures were taken before and after treatment. Outcomes were measured by visual analogue scale, cervical range of motion and neck disability index. Within the groups VAS, NDI, and cervical lateral flexion and rotation showed significant change in the mean value. The comparison of pre and post VAS in experimental group and control group showed a significant change in the experimental group .Paired sample t- test was used to analyze changes from before and after intervention programmed. Results: There is a statistically significant (p<0.00 improvement in both variables from baseline to 4th week in experimental group and control group but compared to control group, experimental group shows highly significant values in all parameters. Conclusion: INIT along with specific strength training is proved to be effective in reducing pain, decreasing disability and improving range of motion in individuals with upper trapezius trigger points.

  10. An Energy efficient application specific integrated circuit for electrocardiogram feature detection and its potential for ambulatory cardiovascular disease detection.

    Science.gov (United States)

    Jain, Sanjeev Kumar; Bhaumik, Basabi

    2016-03-01

    A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm(2). The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system.

  11. A resolvase-like protein is requered for the site-specific integration of the temperate lactococcal bacteriophage TP901-1

    DEFF Research Database (Denmark)

    Christiansen, Bettina; Brøndsted, Lone; Vogensen, Finn K.

    1996-01-01

    upstream of attP. The N-terminal 150 to 1180 amino acids of Orf1 showed 38 to 44% similarity to the resolvase group of site-specific integrases, while no similarity to know proteins was found in the C-terminal end. Bacteriophage 'TP901-1 therefore contains a unique integration system that does not resemble...... the Int class of site-specific integrases usually found in temperate bacteriophages. The constructed integration vector, pBC170, integrates into the chromosomal attachment site very efficiently and forms stable transformants with a frequency corresponding to 20% of the transformation efficiency....

  12. Integrated imaging using MRI and 123I metaiodobenzylguanidine scintigraphy to improve sensitivity and specificity in the diagnosis of pediatric neuroblastoma.

    Science.gov (United States)

    Pfluger, Thomas; Schmied, Christoph; Porn, Ute; Leinsinger, Gerda; Vollmar, Christian; Dresel, Stefan; Schmid, Irene; Hahn, Klaus

    2003-10-01

    The objectives of this study were to compare MRI and iodine-123 ((123)I) metaiodobenzylguanidine (MIBG) scintigraphy in the detection of neuroblastoma lesions in pediatric patients and to assess the additional value of combined imaging. Fifty MRI and 50 (123)I MIBG examinations (mean interval, 6.4 days) were analyzed retrospectively with regard to suspected or proven neuroblastoma lesions (n = 193) in 28 patients. MRI and MIBG scans were reviewed by two independent observers each. Separate and combined analyses of MRI and MIBG scintigraphy were compared with clinical and histologic findings. With regard to the diagnosis of neuroblastoma lesion, MIBG scintigraphy, MRI, and combined analysis showed a sensitivity of 69%, 86%, and 99% and a specificity of 85%, 77%, and 95%, respectively. On MRI, 15 false-positive findings were recorded: posttherapeutic reactive changes (n = 10), benign adrenal tumors (n = 3), and enlarged lymph nodes (n = 2). On MIBG scintigraphy, 10 false-positive findings occurred: ganglioneuromas (n = 2), benign liver tumors (n = 2), and physiologic uptake (n = 6). Thirteen neuroblastoma metastases and two residual masses under treatment with chemotherapy were judged to be false-negative findings on MRI. Two primary or residual neuroblastomas and one orbital metastasis were misinterpreted as Wilms' tumor, reactive changes after surgery, and rhabdomyosarcoma on MRI. Thirty-two bone metastases, six other neuroblastoma metastases, and one adrenal neuroblastoma showed no MIBG uptake. On combined imaging, one false-negative (bone metastasis) and three false-positive (two ganglioneuromas and one pheochromocytoma) findings remained. In the assessment of neuroblastoma lesions in pediatric patients, MRI showed a higher sensitivity and MIBG scintigraphy a higher specificity. However, integrated imaging showed an increase in both sensitivity and specificity.

  13. Energy storage technologies and hybrid architectures for specific diesel-driven rail duty cycles: Design and system integration aspects

    International Nuclear Information System (INIS)

    Meinert, M.; Prenleloup, P.; Schmid, S.; Palacin, R.

    2015-01-01

    Highlights: • We assessed integration of energy storage systems into hybrid system architectures. • We considered mechanical and electrical energy storage systems. • Potential of different combinations has been analyzed by standardized duty cycles. • Most promising are diesel-driven suburban, regional and shunting operations. • Double-layer capacitors and Lithium-ion batteries have the highest potential. - Abstract: The use of diesel-driven traction is an intrinsic part of the functioning of railway systems and it is expected to continue being so for the foreseeable future. The recent introduction of more restrictive greenhouse gas emission levels and other legislation aiming at the improvement of the environmental performance of railway systems has led to the need of exploring alternatives for cleaner diesel rolling stock. This paper focuses on assessing energy storage systems and the design of hybrid system architectures to determine their potential use in specific diesel-driven rail duty cycles. Hydrostatic accumulators, flywheels, Lithium-ion batteries and double-layer capacitors have been assessed and used to design hybrid system architectures. The potential of the different technology combinations has been analyzed using standardized duty cycles enhanced with gradient profiles related to suburban, regional and shunting operations. The results show that double-layer capacitors and Lithium-ion batteries have the highest potential to be successfully integrated into the system architecture of diesel-driven rail vehicles. Furthermore, the results also suggest that combining these two energy storage technologies into a single hybridisation package is a highly promising design that draws on their strengthens without any significant drawbacks.

  14. What is reconfigured?. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Engelen, Eva-Maria

    2015-06-01

    The research group around Koelsch presents a neurobiological emotion theory that is supposed to have the following plus factors: (1) Interdisciplinary approach towards understanding human emotions and their neural correlates, (2) concentration on human emotions, (3) interaction between language and emotion, (4) allows research on short-term emotional phenomena and takes long-term emotional phenomena into account, as well as the differences of the neural correlates underlying short-term and long-term emotions [5]. This is a very ambitious program. My comment will focus on (3) and (4).

  15. Cell-laden hydrogel/titanium microhybrids: Site-specific cell delivery to metallic implants for improved integration.

    Science.gov (United States)

    Koenig, Geraldine; Ozcelik, Hayriye; Haesler, Lisa; Cihova, Martina; Ciftci, Sait; Dupret-Bories, Agnes; Debry, Christian; Stelzle, Martin; Lavalle, Philippe; Vrana, Nihal Engin

    2016-03-01

    Porous titanium implants are widely used in dental, orthopaedic and otorhinolaryngology fields to improve implant integration to host tissue. A possible step further to improve the integration with the host is the incorporation of autologous cells in porous titanium structures via cell-laden hydrogels. Fast gelling hydrogels have advantageous properties for in situ applications such as localisation of specific cells and growth factors at a target area without dispersion. The ability to control the cell types in different regions of an implant is important in applications where the target tissue (i) has structural heterogeneity (multiple cell types with a defined spatial configuration with respect to each other); (ii) has physical property gradients essential for its function (such as in the case of osteochondral tissue transition). Due to their near immediate gelation, such gels can also be used for site-specific modification of porous titanium structures, particularly for implants which would face different tissues at different locations. Herein, we describe a step by step design of a model system: the model cell-laden gel-containing porous titanium implants in the form of titanium microbead/hydrogel (maleimide-dextran or maleimide-PVA based) microhybrids. These systems enable the determination of the effect of titanium presence on gel properties and encapsulated cell behaviour as a miniaturized version of full-scale implants, providing a system compatible with conventional analysis methods. We used a fibroblast/vascular endothelial cell co-cultures as our model system and by utilising single microbeads we have quantified the effect of gel microenvironment (degradability, presence of RGD peptides within gel formulation) on cell behaviour and the effect of the titanium presence on cell behaviour and gel formation. Titanium presence slightly changed gel properties without hindering gel formation or affecting cell viability. Cells showed a preference to move towards

  16. Electromechanical modeling of a honeycomb core integrated vibration energy converter with increased specific power for energy harvesting applications

    Science.gov (United States)

    Chandrasekharan, Nataraj

    Innovation in integrated circuit technology along with improved manufacturing processes has resulted in considerable reduction in power consumption of electromechanical devices. Majority of these devices are currently powered by batteries. However, the issues posed by batteries, including the need for frequent battery recharge/replacement has resulted in a compelling need for alternate energy to achieve self-sufficient device operation or to supplement battery power. Vibration based energy harvesting methods through piezoelectric transduction provides with a promising potential towards replacing or supplementing battery power source. However, current piezoelectric energy harvesters generate low specific power (power-to-weight ratio) when compared to batteries that the harvesters seek to replace or supplement. In this study, the potential of integrating lightweight cellular honeycomb structures with existing piezoelectric device configurations (bimorph) to achieve higher specific power is investigated. It is shown in this study that at low excitation frequency ranges, replacing the solid continuous substrate of a conventional piezoelectric bimorph with honeycomb structures of the same material results in a significant increase in power-to-weight ratio of the piezoelectric harvester. In order to maximize the electrical response of vibration based power harvesters, the natural frequency of these harvesters is designed to match the input driving frequency. The commonly used technique of adding a tip mass is employed to lower the natural frequency (to match driving frequency) of both, solid and honeycomb substrate bimorphs. At higher excitation frequency, the natural frequency of the traditional solid substrate bimorph can only be altered (to match driving frequency) through a change in global geometric design parameters, typically achieved by increasing the thickness of the harvester. As a result, the size of the harvester is increased and can be disadvantageous

  17. Microfluidic-integrated patterned ITO immunosensor for rapid detection of prostate-specific membrane antigen biomarker in prostate cancer.

    Science.gov (United States)

    Seenivasan, Rajesh; Singh, Chandra K; Warrick, Jay W; Ahmad, Nihal; Gunasekaran, Sundaram

    2017-09-15

    An optically transparent patterned indium tin oxide (ITO) three-electrode sensor integrated with a microfluidic channel was designed for label-free immunosensing of prostate-specific membrane antigen (PSMA), a prostate cancer (PCa) biomarker, expressed on prostate tissue and circulating tumor cells but also found in serum. The sensor relies on cysteamine capped gold nanoparticles (N-AuNPs) covalently linked with anti-PSMA antibody (Ab) for target specificity. A polydimethylsiloxane (PDMS) microfluidic channel is used to efficiently and reproducibly introduce sample containing soluble proteins/cells to the sensor. The PSMA is detected and quantified by measuring the change in differential pulse voltammetry signal of a redox probe ([Fe(CN) 6 ] 3- /[Fe(CN) 6 ] 4- ) that is altered upon binding of PSMA with PSMA-Ab immobilized on N-AuNPs/ITO. Detection of PSMA expressing cells and soluble PSMA was tested. The limit of detection (LOD) of the sensor for PSMA-based PCa cells is 6/40µL (i.e., 150 cells/mL) (n=3) with a linear range of 15-400 cells/40µL (i.e., 375-10,000 cells/mL), and for the soluble PSMA is 0.499ng/40µL (i.e., 12.5ng/mL) (n=3) with the linear range of 0.75-250ng/40µL (i.e., 19-6250ng/mL), both with an incubation time of 10min. The results indicate that the sensor has a suitable sensitivity and dynamic range for routine detection of PCa circulating tumor cells and can be adapted to detect other biomarkers/cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. A Sol-gel Integrated Dual-readout Microarray Platform for Quantification and Identification of Prostate-specific Antigen.

    Science.gov (United States)

    Lee, SangWook; Lee, Jong Hyun; Kwon, Hyuck Gi; Laurell, Thomas; Jeong, Ok Chan; Kim, Soyoun

    2018-01-01

    Here, we report a sol-gel integrated affinity microarray for on-chip matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) that enables capture and identification of prostate?specific antigen (PSA) in samples. An anti-PSA antibody (H117) was mixed with a sol?gel, and the mixture was spotted onto a porous silicon (pSi) surface without additional surface modifications. The antibody easily penetrates the sol-gel macropore fluidic network structure, making possible high affinities. To assess the capture affinity of the platform, we performed a direct assay using fluorescein isothiocyanate-labeled PSA. Pure PSA was subjected to on-chip MALDI-TOF-MS analysis, yielding three clear mass peptide peaks (m/z = 1272, 1407, and 1872). The sol-gel microarray platform enables dual readout of PSA both fluorometric and MALDI-TOF MS analysis in biological samples. Here we report a useful method for a means for discovery of biomarkers in complex body fluids.

  19. Predictive Direct Torque Control Application-Specific Integrated Circuit of an Induction Motor Drive with a Fuzzy Controller

    Directory of Open Access Journals (Sweden)

    Guo-Ming Sung

    2017-06-01

    Full Text Available This paper proposes a modified predictive direct torque control (PDTC application-specific integrated circuit (ASIC of a motor drive with a fuzzy controller for eliminating sampling and calculating delay times in hysteresis controllers. These delay times degrade the control quality and increase both torque and flux ripples in a motor drive. The proposed fuzzy PDTC ASIC calculates the stator’s magnetic flux and torque by detecting the three-phase current, three-phase voltage, and rotor speed, and eliminates the ripples in the torque and flux by using a fuzzy controller and predictive scheme. The Verilog hardware description language was used to implement the hardware architecture, and the ASIC was fabricated by the Taiwan Semiconductor Manufacturing Company through a 0.18-μm 1P6M CMOS process that involved a cell-based design method. The measurements revealed that the proposed fuzzy PDTC ASIC of the three-phase induction motor yielded a test coverage of 96.03%, fault coverage of 95.06%, chip area of 1.81 × 1.81 mm2, and power consumption of 296 mW, at an operating frequency of 50 MHz and a supply voltage of 1.8 V.

  20. Introductory Comments

    Directory of Open Access Journals (Sweden)

    Jolanta Sujecka

    2016-12-01

    Full Text Available Introductory Comments The fifth yearly volume of the Colloquia Humanistica comprises a thematic section on Nation, Natsiya, Ethnie. The subject it discusses has thus far received little attention as a research problem in the Slavia Orthodoxa, the Slavia Romana, the Balkans but also in Central and Eastern Europe.   Uwagi wstępne Piąty numer rocznika "Colloquia Humanistica" przedstawia dział tematyczny, poświęcony kategoriom narodu, nacji i etni. Temat ten, w takiej perspektywie, którą proponujemy, nie spotkał się dotąd z należytym namysłem badawczym w sferze Slavia Otrhodoxa, Slavia Romana i na Bałkanach, jak też w Europie Środkowo-Wschodniej.

  1. Comment on 'Large-Scale Cognitive GWAS Meta-Analysis Reveals Tissue-Specific Neural Expression and Potential Nootropic Drug Targets' by Lam et al.

    Science.gov (United States)

    Hill, W David

    2018-04-01

    Intelligence and educational attainment are strongly genetically correlated. This relationship can be exploited by Multi-Trait Analysis of GWAS (MTAG) to add power to Genome-wide Association Studies (GWAS) of intelligence. MTAG allows the user to meta-analyze GWASs of different phenotypes, based on their genetic correlations, to identify association's specific to the trait of choice. An MTAG analysis using GWAS data sets on intelligence and education was conducted by Lam et al. (2017). Lam et al. (2017) reported 70 loci that they described as 'trait specific' to intelligence. This article examines whether the analysis conducted by Lam et al. (2017) has resulted in genetic information about a phenotype that is more similar to education than intelligence.

  2. Comment response document for the Secretary of Energy's ''Report to Congress on Reassessment of the Civilian Radioactive Waste Management Program''

    International Nuclear Information System (INIS)

    1990-11-01

    On November 29, 1989, the Secretary of Energy published his ''Report to Congress on the Reassessment of the Civilian Radioactive Waste Management Program'' (Report), and sent copies to numerous interested parties for their review and comment. This document summarizes comments received on the Report and presents the DOE's current responses to those comments as a basis for further discussions. Included as appendixes are a list of commenters, a crosswalk showing where each comment is addressed, the comment letters themselves with specific comments delineated, and the DOE's response to those letters. Twenty-five individuals or organizations submitted comments on the Report. The DOE identified 130 individual comments and classified them into the following seven categories: Management, Institutional, Regulatory, Transportation, Monitored Retrievable Storage, Scheduling, and Yucca Mountain. For the responses, comments were than grouped into more specific topics under each of the major headings. The DOE attempted to respond to all comments

  3. 'Integration'

    DEFF Research Database (Denmark)

    Olwig, Karen Fog

    2011-01-01

    , while the countries have adopted disparate policies and ideologies, differences in the actual treatment and attitudes towards immigrants and refugees in everyday life are less clear, due to parallel integration programmes based on strong similarities in the welfare systems and in cultural notions...... of equality in the three societies. Finally, it shows that family relations play a central role in immigrants’ and refugees’ establishment of a new life in the receiving societies, even though the welfare society takes on many of the social and economic functions of the family....

  4. Integrated genetic and epigenetic analysis identifies haplotype-specific methylation in the FTO type 2 diabetes and obesity susceptibility locus.

    Directory of Open Access Journals (Sweden)

    Christopher G Bell

    2010-11-01

    Full Text Available Recent multi-dimensional approaches to the study of complex disease have revealed powerful insights into how genetic and epigenetic factors may underlie their aetiopathogenesis. We examined genotype-epigenotype interactions in the context of Type 2 Diabetes (T2D, focussing on known regions of genomic susceptibility. We assayed DNA methylation in 60 females, stratified according to disease susceptibility haplotype using previously identified association loci. CpG methylation was assessed using methylated DNA immunoprecipitation on a targeted array (MeDIP-chip and absolute methylation values were estimated using a Bayesian algorithm (BATMAN. Absolute methylation levels were quantified across LD blocks, and we identified increased DNA methylation on the FTO obesity susceptibility haplotype, tagged by the rs8050136 risk allele A (p = 9.40×10(-4, permutation p = 1.0×10(-3. Further analysis across the 46 kb LD block using sliding windows localised the most significant difference to be within a 7.7 kb region (p = 1.13×10(-7. Sequence level analysis, followed by pyrosequencing validation, revealed that the methylation difference was driven by the co-ordinated phase of CpG-creating SNPs across the risk haplotype. This 7.7 kb region of haplotype-specific methylation (HSM, encapsulates a Highly Conserved Non-Coding Element (HCNE that has previously been validated as a long-range enhancer, supported by the histone H3K4me1 enhancer signature. This study demonstrates that integration of Genome-Wide Association (GWA SNP and epigenomic DNA methylation data can identify potential novel genotype-epigenotype interactions within disease-associated loci, thus providing a novel route to aid unravelling common complex diseases.

  5. Implications of the Vienna Integrated Model of Art Perception for art-based interventions in clinical populations: Comment on "Move me, astonish me... delight my eyes and brain: The Vienna Integrated Model of top-down and bottom-up processes in Art Perception (VIMAP) and corresponding affective, evaluative, and neurophysiological correlates" by Matthew Pelowski et al.

    Science.gov (United States)

    Taruffi, Liila; Koelsch, Stefan

    2017-07-01

    Pelowski et al. present a holistic framework within which the multiple processes underlying art viewing can be systematically organized [1]. The proposed model integrates a broad range of dynamic mechanisms, which can effectively account for empirical as well as humanistic perspectives on art perception. Particularly challenging is the final section of the article, where the authors draw a correspondence between behavioral and cognitive components and brain structures (as well as networks). Here, we comment on the implications of the Vienna Integrated Model of Art Perception for art therapy in clinical populations, particularly focusing on (1) expanding Pelowski et al.'s considerations of the Default Mode Network (DMN) into discussion of its relevance to mental diseases, and (2) elaborating on empathic resonance in aesthetic contexts and the capacity of art to build up empathic skills.

  6. Comments on the article by A. J. Lecloux (J Nanopart Res (2015) 17:447) regarding the use of volume-specific surface area (VSSA) to classify nanomaterials

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, Neil, E-mail: neil.gibson@ec.europa.eu; Rauscher, Hubert [Joint Research Centre of the European Commission, Directorate for Health, Consumers and Reference Materials (Italy); Roebben, Gert [Joint Research Centre of the European Commission, Directorate for Health, Consumers and Reference Materials (Belgium)

    2016-08-15

    In November 2015, an article by A. J. Lecloux was published in this journal (J Nanopart Res, 17:447, 2015). The article focused on the use of volume-specific surface area (VSSA) for the implementation of the European Commission’s recommended definition of “nanomaterial”. In that paper, VSSA values were calculated for polydisperse particulate materials using a particle number-based averaging method which do not agree with earlier results of VSSA simulations of polydisperse materials reported in 2014 by the Joint Research Centre (JRC) of the European Commission (EC). In this contribution, we explain the difference between traditional view of VSSA which was used by the JRC and the proposed model of Lecloux. Through the use of some simple examples for polydisperse materials, it is demonstrated that the latter produces values which neither correspond to the generally accepted definition of VSSA nor relate to the commonly used experimental methods for determining VSSA using gas adsorption. Lecloux’s model therefore does not constitute a basis for practical implementation of the EC’s definition of nanomaterial using gas adsorption techniques.

  7. Comments on the article by A. J. Lecloux (J Nanopart Res (2015) 17:447) regarding the use of volume-specific surface area (VSSA) to classify nanomaterials

    International Nuclear Information System (INIS)

    Gibson, Neil; Rauscher, Hubert; Roebben, Gert

    2016-01-01

    In November 2015, an article by A. J. Lecloux was published in this journal (J Nanopart Res, 17:447, 2015). The article focused on the use of volume-specific surface area (VSSA) for the implementation of the European Commission’s recommended definition of “nanomaterial”. In that paper, VSSA values were calculated for polydisperse particulate materials using a particle number-based averaging method which do not agree with earlier results of VSSA simulations of polydisperse materials reported in 2014 by the Joint Research Centre (JRC) of the European Commission (EC). In this contribution, we explain the difference between traditional view of VSSA which was used by the JRC and the proposed model of Lecloux. Through the use of some simple examples for polydisperse materials, it is demonstrated that the latter produces values which neither correspond to the generally accepted definition of VSSA nor relate to the commonly used experimental methods for determining VSSA using gas adsorption. Lecloux’s model therefore does not constitute a basis for practical implementation of the EC’s definition of nanomaterial using gas adsorption techniques.

  8. Site-specific integration of CAR gene into Jurkat T cells with a linear close-ended AAV-based DNA vector for CAR-T engineering.

    Science.gov (United States)

    Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun

    2016-09-01

    To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.

  9. Plasma cell-free DNA and its DNA integrity as biomarker to distinguish prostate cancer from benign prostatic hyperplasia in patients with increased serum prostate-specific antigen.

    Science.gov (United States)

    Feng, Jiang; Gang, Feng; Li, Xiao; Jin, Tang; Houbao, Huang; Yu, Cao; Guorong, Li

    2013-08-01

    To investigate whether plasma cell-free DNA (cfDNA) or its integrity could differentiate prostate cancer from benign prostate hyperplasia (BPH) in patients with serum prostate-specific antigen (PSA) ≥ 4 ng/ml. Ninety-six patients with prostate cancer and 112 patients with BPH were enrolled. cfDNA levels in plasma before prostate biopsy were quantified by real-time PCR amplification of ALU gene (product size of 115 bp), and quantitative ratio of ALU (247 bp) to ALU (115 bp) reflected the integrity of cfDNA. In patients with serum PSA ≥ 4 ng/ml, there were significant differences in plasma cfDNA or its integrity between the patients with prostate cancer (19.74 ± 4.43, 0.34 ± 0.05) and patients with BPH (7.36 ± 1.58, 0.19 ± 0.03; P Prostate cancer could be differentiated with a sensitivity of 73.2 % and a specificity of 72.7 % by cfDNA (AUC = 0.864). The integrity of cfDNA had a sensitivity of 81.7 % and a specificity of 78.8 % for the distinguishing prostate cancer from BPH (AUC = 0.910). cfDNA and its integrity could be applied to differentiate prostate cancer from BPH in patients with serum PSA ≥ 4 ng/ml.

  10. Apportioning sources of organic matter in streambed sediments: An integrated molecular and compound-specific stable isotope approach

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, Richard J., E-mail: Richard.J.Cooper@uea.ac.uk [School of Environmental Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 7TJ (United Kingdom); Pedentchouk, Nikolai; Hiscock, Kevin M.; Disdle, Paul [School of Environmental Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 7TJ (United Kingdom); Krueger, Tobias [IRI THESys, Humboldt University, 10099 Berlin (Germany); Rawlins, Barry G. [British Geological Survey, Keyworth, Nottingham NG12 5GG (United Kingdom)

    2015-07-01

    apportionment of organic matter sources. Median organic matter contributions ranged from 22% to 52% for trees, 29% to 50% for herbaceous perennials, 17% to 34% for C{sub 3} graminoids and 3% to 7% for C{sub 4} graminoids. The results presented here clearly demonstrate the effectiveness of an integrated molecular and stable isotope analysis for quantitatively apportioning, with uncertainty, plant-specific organic matter contributions to streambed sediments via a Bayesian mixing model approach. - Highlights: • Organic contributions from trees, herbs and C{sub 3}/C{sub 4} graminoids are apportioned. • δ{sup 2}H provides strong discrimination between plant functional types. • δ{sup 13}C provides strong contrasts between C{sub 3} and C{sub 4} plants. • δ{sup 2}H and δ{sup 13}C values could not differentiate aquatic and terrestrial species. • n-Alkane ratios compliment isotopic discrimination.

  11. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  12. Introductory Comments

    Directory of Open Access Journals (Sweden)

    Jolanta Sujecka

    2017-11-01

    Full Text Available Introductory Comments The sixth issue (not just in the Thematic Section is devoted to the borders of civilization in our memory, in culture, in art, in literature, in the arrangement of political objectives. Both their demarcation and their crossing is a matter of the objectives we can and want to set ourselves in the context of the order that exists and into which we try to fit, transforming it or levelling. The value of this survey of  “images of borders” is its setting in such varied material, owing to which the theoretical speculations gain a representative illustration and, at the same time, a guarantee of being rooted, even if it is only a “contact zone”.   Wprowadzenie Szósty numer (nie tylko sekcja tematyczna jest poświęcony kwestii granic cywilizacji w naszej pamięci, kulturze, sztuce, literaturze, w definiowaniu celów politycznych. Zarówno ich wyznaczanie, jak i przekraczanie, jest kwestią celów, jakie możemy i chcemy postawić sobie w kontekście istniejącego ładu, w który staramy się wpisać, przekształcając go lub dostosowując się do niego. Wartością niniejszego przeglądu "obrazów granic" jest przedstawienie ich poprzez tak zróżnicowany materiał, dzięki czemu rozważania teoretyczne zyskują reprezentatywną ilustrację, a zarazem gwarancję zakorzenienia, nawet jeśli będzie to tylko "sfera kontaktu".

  13. Rehabilitation-specific challenges and advantages in the integration of migrant physicians in Germany: a multiperspective qualitative interview study in rehabilitative settings.

    Science.gov (United States)

    Jansen, E; Hänel, P; Klingler, C

    2018-07-01

    In Germany, rehabilitative healthcare institutions increasingly rely on migrant physicians to meet their staffing needs. Yet until now, research on the integration of migrant physicians has focussed entirely on the acute care setting. This study is the first to address the specific advantages and challenges to integration in the field of rehabilitative medicine where a high number of migrant physicians work. From the experiences of migrant physicians and their colleagues, we provide actionable suggestions to counteract potential sources of conflict and thereby improve the integration of migrant physicians in the German workforce. We conducted a qualitative interview study. We conducted 23 interviews with a total of 26 participants occupying a variety of roles in two different rehabilitation centres (maximum variation sampling). Interviews were recorded, transcribed verbatim and parsed through thematic analysis. Our research revealed advantages and challenges to integration in three distinct areas: rehabilitative care institutions, competencies of migrant professionals and interpersonal relations. The first set of issues hinges on the work processes within rehabilitative hospitals, professional prospects there and the location of the institutions themselves. Second, migrant physicians may encounter difficulties because of limited linguistic skills and country-specific knowledge. And finally, aspects of their interactions with care teams and patients may constitute barriers to integration. Some of the factors influencing the integration of migrant physicians are the same in both rehabilitative and acute medicine, but the rehabilitative setting presents distinct advantages and challenges that are worthy of study in their own right. We outline several measures which could help overcome challenges to the integration of migrant physicians, including those associated with professional relationships. Further research is needed to develop concrete support programmes

  14. 76 FR 50726 - Integrated System Power Rates: Correction

    Science.gov (United States)

    2011-08-16

    ... DEPARTMENT OF ENERGY Southwestern Power Administration Integrated System Power Rates: Correction AGENCY: Southwestern Power Administration, DOE. ACTION: Notice of public review and comment; Correction... date listed for the combined Public Information and Comment Forum (Forum) was erroneously listed in the...

  15. Pre-service teachers' competencies for technology integration: Insights from a mathematics-specific instructional technology course

    NARCIS (Netherlands)

    Agyei, D.D.; Voogt, Joke; Resta, P.

    2012-01-01

    A combination of various measures (self-report, learning outcomes and written reports) was employed to investigate 104 pre-service teachers’ competencies in spreadsheet integration after enrolling in an Instructional Technology course. The pre-service teachers engaged in a “learning technology by

  16. Pre-Service Teachers' TPACK Competencies for Spreadsheet Integration: Insights from a Mathematics-Specific Instructional Technology Course

    Science.gov (United States)

    Agyei, Douglas D.; Voogt, Joke M.

    2015-01-01

    This article explored the impact of strategies applied in a mathematics instructional technology course for developing technology integration competencies, in particular in the use of spreadsheets, in pre-service teachers. In this respect, 104 pre-service mathematics teachers from a teacher training programme in Ghana enrolled in the mathematics…

  17. Pre-service teachers’ TPACK competencies for spreadsheet integration: insights from a mathematics-specific instructional technology course

    NARCIS (Netherlands)

    Agyei, D.D.; Voogt, J.M.

    2015-01-01

    This article explored the impact of strategies applied in a mathematics instructional technology course for developing technology integration competencies, in particular in the use of spreadsheets, in pre-service teachers. In this respect, 104 pre-service mathematics teachers from a teacher training

  18. Public comments and responses to the 1989 Hanford cleanup five-year plan

    International Nuclear Information System (INIS)

    1991-06-01

    In April 1990 the US Department of Energy (DOE) issued a site- specific Five-Year Plan (DOE-RL 1989a) on Hanford's cleanup for public review and comment. The plan guides Hanford in carrying out DOE's national plan for environmental restoration and waste management. During the 90-day public comment period, DOE held nine public meetings to answer questions and gather comments on the plan. This report is in three main sections. The first presents consolidated public comments and responses. These were compiled from both verbal comments from public meetings and written comments. The second section contains comments not responded to in this plan. Those comments were outside this plan's scope, related to how we gathered public comments, or intended for and directed to DOE-Headquarters. In the appendixes are the written comment letters we received and a short glossary and list of special terms we use. The source of comments is shown in parentheses after the comment. The individual who made the comment, the city of the public meeting, or the organization name is generally used. When several sources gave the same comment, a source was not listed. 26 refs

  19. 77 FR 35753 - Submission for OMB Review; Comment Request

    Science.gov (United States)

    2012-06-14

    ..., Public Law 104-13, on or after the date of publication of this notice. DATES: Comments should be received on or before July 16, 2012 to be assured of consideration. ADDRESSES: Send comments regarding the...-Contract Award Information. Abstract: Information requested of contractors is specific to each contract and...

  20. 78 FR 59086 - Proposed Agency Information Collection Activities; Comment Request

    Science.gov (United States)

    2013-09-25

    ... extension while it is determining the proper course of action to take to ensure that certain unattended... transporting hazardous materials, are properly secured against unintended movement. Before submitting these... soliciting public comment on specific aspects of the activities identified below. DATES: Comments must be...

  1. 77 FR 20478 - Proposed Agency Information Collection Activities; Comment Request

    Science.gov (United States)

    2012-04-04

    ... soliciting public comment on specific aspects of the activities identified below. DATES: Comments must be... an accident or incident arising from the failure of a signal appliance, device, method, or [[Page... favorable aspect than intended or other condition hazardous to the movement of a train. Section 233.7 sets...

  2. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  3. How to account for irreversibility in integrated assessment of climate change?; Comment tenir compte de l'irreversibilite dans l'evaluation integree du changement climatique?

    Energy Technology Data Exchange (ETDEWEB)

    Ha Duong, M

    1998-04-15

    How to account for irreversibility in integrated assessment of climate change? This Ph. D. thesis in Economics balances discounting, technical progress and the inertia of existing capital stock against uncertainty and the inertia of socio-economic systems to examine the issue of near term limitations of greenhouse gases emissions. After a general overview in chapter 2, and a more historical presentation of the debates in chapter 3, chapter 4 proceeds to review a large number of integrated assessment models. Chapter 5 introduces a Model on the Dynamics of Inertia and Adaptability of energy systems: DIAM, used to discuss how much previous studies might have overestimated the long term costs of CO{sub 2} limitations and underestimated adjustment costs. It shows that, given a target date for atmospheric CO{sub 2} concentration stabilisation, a higher inertia implies a lower optimal concentration trajectory. In a sequential decision framework, chapter 6 shows that current uncertainties about which CO{sub 2} concentration ceiling would not present dangerous interference with the climate system justifies precautionary action. Finally, chapter 7 uses the irreversibility effect theory to define formally situations of decision under controversy and compare the irreversibility of CO{sub 2} accumulation with the irreversibility of investments needed to moderate it. An option value for greenhouse gases emissions limitations is computed. (author)

  4. How to account for irreversibility in integrated assessment of climate change?; Comment tenir compte de l'irreversibilite dans l'evaluation integree du changement climatique?

    Energy Technology Data Exchange (ETDEWEB)

    Ha Duong, M

    1998-04-15

    How to account for irreversibility in integrated assessment of climate change? This Ph. D. thesis in Economics balances discounting, technical progress and the inertia of existing capital stock against uncertainty and the inertia of socio-economic systems to examine the issue of near term limitations of greenhouse gases emissions. After a general overview in chapter 2, and a more historical presentation of the debates in chapter 3, chapter 4 proceeds to review a large number of integrated assessment models. Chapter 5 introduces a Model on the Dynamics of Inertia and Adaptability of energy systems: DIAM, used to discuss how much previous studies might have overestimated the long term costs of CO{sub 2} limitations and underestimated adjustment costs. It shows that, given a target date for atmospheric CO{sub 2} concentration stabilisation, a higher inertia implies a lower optimal concentration trajectory. In a sequential decision framework, chapter 6 shows that current uncertainties about which CO{sub 2} concentration ceiling would not present dangerous interference with the climate system justifies precautionary action. Finally, chapter 7 uses the irreversibility effect theory to define formally situations of decision under controversy and compare the irreversibility of CO{sub 2} accumulation with the irreversibility of investments needed to moderate it. An option value for greenhouse gases emissions limitations is computed. (author)

  5. Same-same but different: integrating central university support and faculty-specific knowledge for mentor training. A Practice Report

    Directory of Open Access Journals (Sweden)

    Deborah Rodrigo

    2014-08-01

    Full Text Available Mentoring literature often cites a tension between local initiatives that target the needs of specific groups and more efficient centralised programs addressing common concerns across a larger population. For several years, the University of Sydney has had a Mentoring Network consisting of the faculties of Arts and Social Sciences, Health Sciences, Science, Sydney Law School and the Business School. These faculties have worked together to develop a community of best practice for mentoring programs at our large, multi-campus institution, and for the past two years have included a representative from Student Support Services to incorporate a centralised support component into their faculty-specific training programs. This Practice Report showcases the work of the University of Sydney Mentoring Network in combining central university services with faculty-based mentoring.

  6. Drilling Specifications: Well Installations in the 300 Area to Support PNNL's Integrated Field-Scale Subsurface Research Challenge (IFC) Project

    International Nuclear Information System (INIS)

    Bjornstad, Bruce N.; Vermeul, Vince R.

    2008-01-01

    Part of the 300 Area Integrated Field-Scale Subsurface Research Challenge (IFC) will be installation of a network of high density borings and wells to monitor migration of fluids and contaminants (uranium), both in groundwater and vadose zone, away from an surface infiltration plot (Figure A-1). The infiltration plot will be located over an area of suspected contamination at the former 300 Area South Process Pond (SPP). The SPP is located in the southeastern portion of the Hanford Site, within the 300-FF-5 Operable Unit. Pacific Northwest National Laboratory (PNNL) with the support of FH shall stake the well locations prior to the start of drilling. Final locations will be based on accessibility and will avoid any surface or underground structures or hazards as well as surface contamination

  7. An integrated chemical biology approach identifies specific vulnerability of Ewing's sarcoma to combined inhibition of Aurora kinases A and B.

    Science.gov (United States)

    Winter, Georg E; Rix, Uwe; Lissat, Andrej; Stukalov, Alexey; Müllner, Markus K; Bennett, Keiryn L; Colinge, Jacques; Nijman, Sebastian M; Kubicek, Stefan; Kovar, Heinrich; Kontny, Udo; Superti-Furga, Giulio

    2011-10-01

    Ewing's sarcoma is a pediatric cancer of the bone that is characterized by the expression of the chimeric transcription factor EWS-FLI1 that confers a highly malignant phenotype and results from the chromosomal translocation t(11;22)(q24;q12). Poor overall survival and pronounced long-term side effects associated with traditional chemotherapy necessitate the development of novel, targeted, therapeutic strategies. We therefore conducted a focused viability screen with 200 small molecule kinase inhibitors in 2 different Ewing's sarcoma cell lines. This resulted in the identification of several potential molecular intervention points. Most notably, tozasertib (VX-680, MK-0457) displayed unique nanomolar efficacy, which extended to other cell lines, but was specific for Ewing's sarcoma. Furthermore, tozasertib showed strong synergies with the chemotherapeutic drugs etoposide and doxorubicin, the current standard agents for Ewing's sarcoma. To identify the relevant targets underlying the specific vulnerability toward tozasertib, we determined its cellular target profile by chemical proteomics. We identified 20 known and unknown serine/threonine and tyrosine protein kinase targets. Additional target deconvolution and functional validation by RNAi showed simultaneous inhibition of Aurora kinases A and B to be responsible for the observed tozasertib sensitivity, thereby revealing a new mechanism for targeting Ewing's sarcoma. We further corroborated our cellular observations with xenograft mouse models. In summary, the multilayered chemical biology approach presented here identified a specific vulnerability of Ewing's sarcoma to concomitant inhibition of Aurora kinases A and B by tozasertib and danusertib, which has the potential to become a new therapeutic option.

  8. Regulating with imagery and the complexity of basic emotions. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Meyer, Marcel; Kuchinke, Lars

    2015-06-01

    Literature, music and the arts have long attested to the complexity of human emotions. Hitherto, psychological and biological theories of emotions have largely neglected this rich heritage. In their review Koelsch and colleagues [1] have embarked upon the pioneering endeavour of integrating the diverse perspectives in emotion research. Noting that the focus of prior neurobiological theories relies mainly on animal studies, the authors sought to complement this body of research with a model of complex ("moral") emotions in humans (henceforth: complex emotions). According to this novel framework, there are four main interacting affective centres in the brain. Each centre is associated with a dominant affective function, such as ascending activation (brainstem), pain/pleasure (diencephalon), attachment-related affects (hippocampus) or moral emotions and unconscious cognitive appraisal (orbitofrontal cortex). Furthermore, language is ascribed a key role in (a) the communication of subjective feeling (reconfiguration) and (b) in the conscious regulation of emotions (by means of logic and rational thought).

  9. Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.).

    Science.gov (United States)

    Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir

    2015-01-22

    Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production

  10. Integrated analysis of DNA methylation and gene expression reveals specific signaling pathways associated with platinum resistance in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Chung Jae

    2009-06-01

    Full Text Available Abstract Background Cisplatin and carboplatin are the primary first-line therapies for the treatment of ovarian cancer. However, resistance to these platinum-based drugs occurs in the large majority of initially responsive tumors, resulting in fully chemoresistant, fatal disease. Although the precise mechanism(s underlying the development of platinum resistance in late-stage ovarian cancer patients currently remains unknown, CpG-island (CGI methylation, a phenomenon strongly associated with aberrant gene silencing and ovarian tumorigenesis, may contribute to this devastating condition. Methods To model the onset of drug resistance, and investigate DNA methylation and gene expression alterations associated with platinum resistance, we treated clonally derived, drug-sensitive A2780 epithelial ovarian cancer cells with increasing concentrations of cisplatin. After several cycles of drug selection, the isogenic drug-sensitive and -resistant pairs were subjected to global CGI methylation and mRNA expression microarray analyses. To identify chemoresistance-associated, biological pathways likely impacted by DNA methylation, promoter CGI methylation and mRNA expression profiles were integrated and subjected to pathway enrichment analysis. Results Promoter CGI methylation revealed a positive association (Spearman correlation of 0.99 between the total number of hypermethylated CGIs and GI50 values (i.e., increased drug resistance following successive cisplatin treatment cycles. In accord with that result, chemoresistance was reversible by DNA methylation inhibitors. Pathway enrichment analysis revealed hypermethylation-mediated repression of cell adhesion and tight junction pathways and hypomethylation-mediated activation of the cell growth-promoting pathways PI3K/Akt, TGF-beta, and cell cycle progression, which may contribute to the onset of chemoresistance in ovarian cancer cells. Conclusion Selective epigenetic disruption of distinct biological

  11. An integrated translation of design data of a nuclear power plant from a specification-driven plant design system to neutral model data

    Energy Technology Data Exchange (ETDEWEB)

    Mun, Duhwan, E-mail: dhmun@moeri.re.k [Marine Safety and Pollution Response Research Department, Maritime and Ocean Engineering Research Institute, KORDI, 171 Jang-dong, Yuseong-gu, Daejeon 305-343 (Korea, Republic of); Yang, Jeongsam, E-mail: jyang@ajou.ac.k [Division of Industrial and Information Systems Engineering, Ajou University, San 5, Wonchun-dong, Yeongtong-gu, Suwon 443-749 (Korea, Republic of)

    2010-03-15

    How to efficiently integrate and manage lifecycle data of a nuclear power plant has gradually become an important object of study. Because plants usually have a very long period of operation and maintenance, the plant design data need to be presented in a computer-interpretable form and to be independent of any commercial systems. The conversion of plant design data from various design systems into neutral model data is therefore an important technology for the effective operation and maintenance of plants. In this study, a neutral model for the efficient integration of plant design data is chosen from among the currently available options and extended in order to cover the information model requirements of nuclear power plants in Korea. After the mapping of the neutral model and the data model of a specification-driven plant design system, a plant data translator is also implemented in accordance with the schema mapping results.

  12. An integrated translation of design data of a nuclear power plant from a specification-driven plant design system to neutral model data

    International Nuclear Information System (INIS)

    Mun, Duhwan; Yang, Jeongsam

    2010-01-01

    How to efficiently integrate and manage lifecycle data of a nuclear power plant has gradually become an important object of study. Because plants usually have a very long period of operation and maintenance, the plant design data need to be presented in a computer-interpretable form and to be independent of any commercial systems. The conversion of plant design data from various design systems into neutral model data is therefore an important technology for the effective operation and maintenance of plants. In this study, a neutral model for the efficient integration of plant design data is chosen from among the currently available options and extended in order to cover the information model requirements of nuclear power plants in Korea. After the mapping of the neutral model and the data model of a specification-driven plant design system, a plant data translator is also implemented in accordance with the schema mapping results.

  13. Final environmental impact statement: US Spent Fuel Policy. Comment letters on draft statements and major comments with DOE responses

    International Nuclear Information System (INIS)

    1980-05-01

    Notice of availability of the draft environmental impact statement for storage of US spent power reactor fuel was published by DOE in the Federal Register on September 6, 1978. A subsequent notice was published in the Federal Register on December 14, 1978, on the availability of the draft EISs on storage of foreign fuel, on charge for spent fuel storage, and a supplement to the draft EIS on storage of US fuel. Copies of the draft EISs were distributed for review and comment by appropriate Federal agencies, state governments, and other organizations and individuals who were known to have an interest in spent fuel storage activities and those who requested them. Comments and views concerning the draft EISs were requested from other interested agencies, organizations, and individuals by means of the Federal Register notices. Approximately 1600 copies each of the draft Domestic, Foreign, and Charge EISs were distributed for comment. The closing date for comments to be received on the draft EISs was February 15, 1979. Copies of the EISs (upon publication) and comment letters received were placed for public inspection in DOE public document rooms at 10 locations throughout the country. To the extent practicable, comments received after the closing date were also considered in the preparation of the final EIS. A total of 78 comment letters (some with supplements) were received. These comment letters are reproduced in their entirety in Section I of this volume. Approximately 600 specific comments were identified in these letters

  14. Are Sport-Specific Profiles of Tendon Stiffness and Cross-Sectional Area Determined by Structural or Functional Integrity?

    Directory of Open Access Journals (Sweden)

    Hans-Peter Wiesinger

    Full Text Available The present study aimed to determine whether distinct sets of tendon properties are seen in athletes engaged in sports with contrasting requirements for tendon function and structural integrity. Patellar and Achilles tendon morphology and force-deformation relation were measured by combining ultrasonography, electromyography and dynamometry in elite ski jumpers, distance runners, water polo players and sedentary individuals. Tendon cross-sectional area normalized to body mass2/3 was smaller in water polo players than in other athletes (patellar and Achilles tendon; -28 to -24% or controls (patellar tendon only; -9%. In contrast, the normalized cross-sectional area was larger in runners (patellar tendon only; +26% and ski jumpers (patellar and Achilles tendon; +21% and +13%, respectively than in controls. Tendon stiffness normalized to body mass2/3 only differed in ski jumpers, compared to controls (patellar and Achilles tendon; +11% and +27%, respectively and to water polo players (Achilles tendon only; +23%. Tendon size appears as an adjusting variable to changes in loading volume and/or intensity, possibly to preserve ultimate strength or fatigue resistance. However, uncoupled morphological and mechanical properties indicate that functional requirements may also influence tendon adaptations.

  15. The multi-instrumentalist hippocampus. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Strange, Bryan A.; Yebra, Mar

    2015-06-01

    Characterizing the neural circuitry of emotion is important not only from a basic science perspective, but also for understanding how these circuits may malfunction in psychiatric disease. A fundamental question for affective neuroscience is whether there are specialised neuroanatomical areas, or "modules", dedicated to the processing of emotional stimuli. In their review, Koelsch and colleagues [1] argue for the existence of a quartet of neuroanatomically distinct cerebral systems involved in the generation of a specific class of affects. Intriguingly, all four systems (brainstem-, diencephalon-, hippocampus-, and orbitofrontal-centred) comprise brain areas whose role in emotional processing is in addition to mediating other specific aspects of cognition. One member of the quartet in which this is particularly apparent is the hippocampus, a structure known to be critical for episodic memory and navigation. If areas involved in emotion also mediate other brain functions, this raises an issue of whether these multiple functions are executed by segregated circuits within each structure - i.e., a "module" for emotion residing in a sub-division of a brain structure - or whether these circuits are superimposed.

  16. Variability and situatedness of human emotions. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Nadal, Marcos; Rosselló, Jaume

    2015-06-01

    We commend Koelsch and colleagues [14] for developing a broad and integrative explanation of the neurobiological foundations of emotions. We especially welcome this framework's emphasis on the interaction between language and emotion, and its focus on the characteristically human moral emotions. Emotions elicited by art and aesthetics also seem to be distinctively human, but comparatively little research has been devoted to understanding these. This is probably because they are usually viewed as atypical in several respects. William James [12], for instance, regarded emotional responses to artworks and aesthetic qualities as subtler emotions, because they lacked the strong bodily changes and adaptive value characteristic of coarser emotions, such as joy, anger, or fear. This view is still predominant today, and aesthetic emotions are often distinguished from everyday emotions [13]. However, the notion of a class of aesthetic emotions, separate from everyday emotions, rests on the questionable assumption that artistic and aesthetic experiences and activities are different in essence from everyday experiences and activities. The discontinuity between "aesthetic experience [and] normal processes of living" [9, p. 10], however, is the product of social and cultural developments in Europe during the 18th century [7,15,20]. Distinctions that oppose art to craft, or aesthetic to practical, in reference to objects, behaviors, experiences, and emotions, make little sense in a broader historic and geographic context [1,7,20], and hinder empirical research [7].

  17. Simultaneous inference of phenotype-associated genes and relevant tissues from GWAS data via Bayesian integration of multiple tissue-specific gene networks.

    Science.gov (United States)

    Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung

    2017-12-01

    Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.

  18. Low spatial frequency bias in schizophrenia is not face specific: When the integration of coarse and fine information fails

    Directory of Open Access Journals (Sweden)

    Vincent eLaprevote

    2013-05-01

    Full Text Available Studies have shown that patients with schizophrenia exhibit visual processing impairments, particularly regarding the processing of spatial frequencies. In a previous work, we found that, compared to healthy volunteers, patients were biased towards low spatial frequencies (LSF to identify facial expression at a glance. Given the ubiquity of faces in visual perception, it remains an open question whether the LSF bias is face specific or also occurs with other visual objects. Here, fifteen patients with schizophrenia and eleven healthy control adults performed a categorization task with hybrid stimuli. These stimuli were single images consisting of two different objects, a fruit and an animal, each in a specific spatial frequency range, either low (LSF or high (HSF. Observers were asked to report if they saw an animal or a fruit. The reported category demonstrated which spatial scale was preferentially perceived in each trial. In a control experiment, participants performed the same task but with images of only a single object, either a LSF or HSF filtered animal or fruit, to verify that participants could perceive both HSF or LSF when presented in isolation. The results on the categorization task showed that patients chose more frequently LSF with hybrid stimuli compared to healthy controls. However, both populations performed equally well with HSF and LSF filtered pictures in the control experiment, demonstrating that the LSF preference found with hybrid stimuli in patients was not due to an inability to perceive HSF.The LSF preference found in schizophrenia confirms our previous study conducted with faces, and shows that this LSF bias generalizes to other categories of objects. When a broad range of spatial frequencies are present in the image, as in normal conditions of viewing, patients preferentially rely on coarse visual information contained in LSF. This result may be interpreted as a dysfunction of the guidance of HSF processing by LSF

  19. Quality specifications in postgraduate medical e-learning: an integrative literature review leading to a postgraduate medical e-learning model.

    Science.gov (United States)

    De Leeuw, R A; Westerman, Michiel; Nelson, E; Ket, J C F; Scheele, F

    2016-07-08

    E-learning is driving major shifts in medical education. Prioritizing learning theories and quality models improves the success of e-learning programs. Although many e-learning quality standards are available, few are focused on postgraduate medical education. We conducted an integrative review of the current postgraduate medical e-learning literature to identify quality specifications. The literature was thematically organized into a working model. Unique quality specifications (n = 72) were consolidated and re-organized into a six-domain model that we called the Postgraduate Medical E-learning Model (Postgraduate ME Model). This model was partially based on the ISO-19796 standard, and drew on cognitive load multimedia principles. The domains of the model are preparation, software design and system specifications, communication, content, assessment, and maintenance. This review clarified the current state of postgraduate medical e-learning standards and specifications. It also synthesized these specifications into a single working model. To validate our findings, the next-steps include testing the Postgraduate ME Model in controlled e-learning settings.

  20. Musical rhythm and affect. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Witek, Maria A. G.; Kringelbach, Morten L.; Vuust, Peter

    2015-06-01

    The Quartet Theory of Human Emotion (QT) proposed by Koelsch et al. [1] adds to existing affective models, e.g. by directing more attention to emotional contagion, attachment-related and non-goal-directed emotions. Such an approach seems particularly appropriate to modelling musical emotions, and music is indeed a recurring example in the text, used to illustrate the distinct characteristics of the affect systems that are at the centre of the theory. Yet, it would seem important for any theory of emotion to account for basic functions such as prediction and anticipation, which are only briefly mentioned. Here we propose that QT, specifically its focus on emotional contagion, attachment-related and non-goal directed emotions, might help generate new ideas about a largely neglected source of emotion - rhythm - a musical property that relies fundamentally on the mechanism of prediction.

  1. 76 FR 59399 - Proposed Information Collection Activity; Comment Request

    Science.gov (United States)

    2011-09-26

    ... organizations such as their organizational structure, program services, populations served, and specific... DEPARTMENT OF HEALTH AND HUMAN SERVICES Administration for Children and Families Proposed Information Collection Activity; Comment Request Title: Responsible Fatherhood Reentry Strategies Study...

  2. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  3. Performance of an optical encoder based on a nondiffractive beam implemented with a specific photodetection integrated circuit and a diffractive optical element.

    Science.gov (United States)

    Quintián, Fernando Perez; Calarco, Nicolás; Lutenberg, Ariel; Lipovetzky, José

    2015-09-01

    In this paper, we study the incremental signal produced by an optical encoder based on a nondiffractive beam (NDB). The NDB is generated by means of a diffractive optical element (DOE). The detection system is composed by an application specific integrated circuit (ASIC) sensor. The sensor consists of an array of eight concentric annular photodiodes, each one provided with a programmable gain amplifier. In this way, the system is able to synthesize a nonuniform detectivity. The contrast, amplitude, and harmonic content of the sinusoidal output signal are analyzed. The influence of the cross talk among the annular photodiodes is placed in evidence through the dependence of the signal contrast on the wavelength.

  4. Note: A 102 dB dynamic-range charge-sampling readout for ionizing particle/radiation detectors based on an application-specific integrated circuit (ASIC)

    Science.gov (United States)

    Pullia, A.; Zocca, F.; Capra, S.

    2018-02-01

    An original technique for the measurement of charge signals from ionizing particle/radiation detectors has been implemented in an application-specific integrated circuit form. The device performs linear measurements of the charge both within and beyond its output voltage swing. The device features an unprecedented spectroscopic dynamic range of 102 dB and is suitable for high-resolution ion and X-γ ray spectroscopy. We believe that this approach may change a widespread paradigm according to which no high-resolution spectroscopy is possible when working close to or beyond the limit of the preamplifier's output voltage swing.

  5. A comment on the infra-red problem in the AdS/CFT correspondence

    International Nuclear Information System (INIS)

    Gottschalk, Hanno; Thaler, Horst

    2008-01-01

    In this note we report on some recent progress in proving the AdS/CFT correspondence for quantum fields using rigorously defined Euclidean path integrals. We also comment on the infra-red problem in the AdS/CFT correspondence and argue that it is different from the usual IR problem in constructive quantum field theory. To illustrate this, a triviality proof based on hypercontractivity estimates is given for the case of an ultraviolet regularized potential of type: φ 4 :. We also give a brief discussion on possible renormalization strategies and the specific problems that arise in this context. (orig.)

  6. A comment on the infra-red problem in the AdS/CFT correspondence

    Energy Technology Data Exchange (ETDEWEB)

    Gottschalk, Hanno; Thaler, Horst

    2008-03-15

    In this note we report on some recent progress in proving the AdS/CFT correspondence for quantum fields using rigorously defined Euclidean path integrals. We also comment on the infra-red problem in the AdS/CFT correspondence and argue that it is different from the usual IR problem in constructive quantum field theory. To illustrate this, a triviality proof based on hypercontractivity estimates is given for the case of an ultraviolet regularized potential of type: {phi}{sup 4}:. We also give a brief discussion on possible renormalization strategies and the specific problems that arise in this context. (orig.)

  7. 75 FR 9275 - Proposed Collection; Comment Request

    Science.gov (United States)

    2010-03-01

    ... INFORMATION: Title: New Markets Tax Credit (NMTC) Allocation Tracking System. OMB Number: 1559-0024. Abstract... and recipients of tax credit authority allocations through New Markets Tax Credit (NMTC). The specific... comments should be received on or before April 30, 2010 to be assured of consideration. ADDRESSES: Direct...

  8. Integrated use of biomarkers and bioaccumulation data in Zebra mussel (Dreissena polymorpha) for site-specific quality assessment.

    Science.gov (United States)

    Binelli, A; Ricciardi, F; Riva, C; Provini, A

    2006-01-01

    One of the useful biological tools for environmental management is the measurement of biomarkers whose changes are related to the exposure to chemicals or environmental stress. Since these responses might vary with different contaminants or depending on the pollutant concentration reached in the organism, the support of bioaccumulation data is needed to prevent false conclusions. In this study, several persistent organic pollutants -- 23 polychlorinated biphenyl (PCB) congeners, 11 polycyclic aromatic hydrocarbons (PAHs), six dichlorodiphenyltricholroethane (DDT) relatives, hexachlorobenzene (HCB), chlorpyrifos and its oxidized metabolite -- and some herbicides (lindane and the isomers alpha, beta, delta; terbutilazine; alachlor; metolachlor) were measured in the soft tissues of the freshwater mollusc Zebra mussel (Dreissena polymorpha) from 25 sampling sites in the Italian portions of the sub-alpine great lakes along with the measure of ethoxyresorufin dealkylation (EROD) and acetylcholinesterase (AChE) activity. The linkage between bioaccumulation and biomarker data allowed us to create site-specific environmental quality indexes towards man-made chemicals. This classification highlighted three different degrees of xenobiotic contamination of the Italian sub-alpine great lakes: a high water quality in Lake Lugano with negligible pollutant levels and no effects on enzyme activities, an homogeneous poor quality for Lakes Garda, Iseo and Como, and the presence of some xenobiotic point-sources in Lake Maggiore, whose ecological status could be jeopardized, also due to the heavy DDT contamination revealed since 1996.

  9. The discovery of putative urine markers for the specific detection of prostate tumor by integrative mining of public genomic profiles.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Urine has emerged as an attractive biofluid for the noninvasive detection of prostate cancer (PCa. There is a strong imperative to discover candidate urinary markers for the clinical diagnosis and prognosis of PCa. The rising flood of various omics profiles presents immense opportunities for the identification of prospective biomarkers. Here we present a simple and efficient strategy to derive candidate urine markers for prostate tumor by mining cancer genomic profiles from public databases. Prostate, bladder and kidney are three major tissues from which cellular matters could be released into urine. To identify urinary markers specific for PCa, upregulated entities that might be shed in exosomes of bladder cancer and kidney cancer are first excluded. Through the ontology-based filtering and further assessment, a reduced list of 19 entities encoding urinary proteins was derived as putative PCa markers. Among them, we have found 10 entities closely associated with the process of tumor cell growth and development by pathway enrichment analysis. Further, using the 10 entities as seeds, we have constructed a protein-protein interaction (PPI subnetwork and suggested a few urine markers as preferred prognostic markers to monitor the invasion and progression of PCa. Our approach is amenable to discover and prioritize potential markers present in a variety of body fluids for a spectrum of human diseases.

  10. An Integrated Metabolomic and Microbiome Analysis Identified Specific Gut Microbiota Associated with Fecal Cholesterol and Coprostanol in Clostridium difficile Infection.

    Directory of Open Access Journals (Sweden)

    Vijay C Antharam

    Full Text Available Clostridium difficile infection (CDI is characterized by dysbiosis of the intestinal microbiota and a profound derangement in the fecal metabolome. However, the contribution of specific gut microbes to fecal metabolites in C. difficile-associated gut microbiome remains poorly understood. Using gas-chromatography mass spectrometry (GC-MS and 16S rRNA deep sequencing, we analyzed the metabolome and microbiome of fecal samples obtained longitudinally from subjects with Clostridium difficile infection (n = 7 and healthy controls (n = 6. From 155 fecal metabolites, we identified two sterol metabolites at >95% match to cholesterol and coprostanol that significantly discriminated C. difficile-associated gut microbiome from healthy microbiota. By correlating the levels of cholesterol and coprostanol in fecal extracts with 2,395 bacterial operational taxonomic units (OTUs determined by 16S rRNA sequencing, we identified 63 OTUs associated with high levels of coprostanol and 2 OTUs correlated with low coprostanol levels. Using indicator species analysis (ISA, 31 of the 63 coprostanol-associated bacteria correlated with health, and two Veillonella species were associated with low coprostanol levels that correlated strongly with CDI. These 65 bacterial taxa could be clustered into 12 sub-communities, with each community containing a consortium of organisms that co-occurred with one another. Our studies identified 63 human gut microbes associated with cholesterol-reducing activities. Given the importance of gut bacteria in reducing and eliminating cholesterol from the GI tract, these results support the recent finding that gut microbiome may play an important role in host lipid metabolism.

  11. Effects of education and race on cognitive decline: An integrative analysis of generalizability versus study-specific results

    Science.gov (United States)

    Gross, Alden L.; Mungas, Dan M.; Crane, Paul K.; Gibbons, Laura E.; MacKay-Brandt, Anna; Manly, Jennifer J.; Mukherjee, Shubhabrata; Romero, Heather; Sachs, Bonnie; Thomas, Michael; Potter, Guy G.; Jones, Richard N.

    2015-01-01

    Objective To examine variability across multiple prospective cohort studies in level and rate of cognitive decline by race/ethnicity and years of education. Method To compare data across studies, we harmonized estimates of common latent factors representing overall or general cognitive performance, memory, and executive function derived from the: 1) Washington Heights, Hamilton Heights, Inwood Columbia Aging Project (N=4,115), 2) Spanish and English Neuropsychological Assessment Scales (N=525), 3) Duke Memory, Health, and Aging study (N=578), and 4) Neurocognitive Outcomes of Depression in the Elderly (N=585). We modeled cognitive change over age for cognitive outcomes by race, education, and study. We adjusted models for sex, dementia status, and study-specific characteristics. Results For baseline levels of overall cognitive performance, memory, and executive function, differences in race and education tended to be larger than between-study differences and consistent across studies. This pattern did not hold for rate of cognitive decline: effects of education and race/ethnicity on cognitive change were not consistently observed across studies, and when present were small, with racial/ethnic minorities and those with lower education declining at faster rates. Discussion In this diverse set of datasets, non-Hispanic whites and those with higher education had substantially higher baseline cognitive test scores. However, differences in the rate of cognitive decline by race/ethnicity and education did not follow this pattern. This study suggests that baseline test scores and longitudinal change have different determinants, and future studies to examine similarities and differences of causes of cognitive decline in racially/ethnically and educationally diverse older groups is needed. PMID:26523693

  12. An Integrated Metabolomic and Microbiome Analysis Identified Specific Gut Microbiota Associated with Fecal Cholesterol and Coprostanol in Clostridium difficile Infection.

    Science.gov (United States)

    Antharam, Vijay C; McEwen, Daniel C; Garrett, Timothy J; Dossey, Aaron T; Li, Eric C; Kozlov, Andrew N; Mesbah, Zhubene; Wang, Gary P

    2016-01-01

    Clostridium difficile infection (CDI) is characterized by dysbiosis of the intestinal microbiota and a profound derangement in the fecal metabolome. However, the contribution of specific gut microbes to fecal metabolites in C. difficile-associated gut microbiome remains poorly understood. Using gas-chromatography mass spectrometry (GC-MS) and 16S rRNA deep sequencing, we analyzed the metabolome and microbiome of fecal samples obtained longitudinally from subjects with Clostridium difficile infection (n = 7) and healthy controls (n = 6). From 155 fecal metabolites, we identified two sterol metabolites at >95% match to cholesterol and coprostanol that significantly discriminated C. difficile-associated gut microbiome from healthy microbiota. By correlating the levels of cholesterol and coprostanol in fecal extracts with 2,395 bacterial operational taxonomic units (OTUs) determined by 16S rRNA sequencing, we identified 63 OTUs associated with high levels of coprostanol and 2 OTUs correlated with low coprostanol levels. Using indicator species analysis (ISA), 31 of the 63 coprostanol-associated bacteria correlated with health, and two Veillonella species were associated with low coprostanol levels that correlated strongly with CDI. These 65 bacterial taxa could be clustered into 12 sub-communities, with each community containing a consortium of organisms that co-occurred with one another. Our studies identified 63 human gut microbes associated with cholesterol-reducing activities. Given the importance of gut bacteria in reducing and eliminating cholesterol from the GI tract, these results support the recent finding that gut microbiome may play an important role in host lipid metabolism.

  13. The hippocampus is an integral part of the temporal limbic system during emotional processing. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Trost, Wiebke; Frühholz, Sascha

    2015-06-01

    The proposed quartet theory of human emotions by Koelsch and colleagues [1] identifies four different affect systems to be involved in the processing of particular types of emotions. Moreover, the theory integrates both basic emotions and more complex emotion concepts, which include also aesthetic emotions such as musical emotions. The authors identify a particular brain system for each kind of emotion type, also by contrasting them to brain structures that are generally involved in emotion processing irrespective of the type of emotion. A brain system that has been less regarded in emotion theories, but which represents one of the four systems of the quartet to induce attachment related emotions, is the hippocampus.

  14. Integrated analysis of RNA-binding protein complexes using in vitro selection and high-throughput sequencing and sequence specificity landscapes (SEQRS).

    Science.gov (United States)

    Lou, Tzu-Fang; Weidmann, Chase A; Killingsworth, Jordan; Tanaka Hall, Traci M; Goldstrohm, Aaron C; Campbell, Zachary T

    2017-04-15

    RNA-binding proteins (RBPs) collaborate to control virtually every aspect of RNA function. Tremendous progress has been made in the area of global assessment of RBP specificity using next-generation sequencing approaches both in vivo and in vitro. Understanding how protein-protein interactions enable precise combinatorial regulation of RNA remains a significant problem. Addressing this challenge requires tools that can quantitatively determine the specificities of both individual proteins and multimeric complexes in an unbiased and comprehensive way. One approach utilizes in vitro selection, high-throughput sequencing, and sequence-specificity landscapes (SEQRS). We outline a SEQRS experiment focused on obtaining the specificity of a multi-protein complex between Drosophila RBPs Pumilio (Pum) and Nanos (Nos). We discuss the necessary controls in this type of experiment and examine how the resulting data can be complemented with structural and cell-based reporter assays. Additionally, SEQRS data can be integrated with functional genomics data to uncover biological function. Finally, we propose extensions of the technique that will enhance our understanding of multi-protein regulatory complexes assembled onto RNA. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Is physiotherapy integrated virtual walking effective on pain, function, and kinesiophobia in patients with non-specific low-back pain? Randomised controlled trial.

    Science.gov (United States)

    Yilmaz Yelvar, Gul Deniz; Çırak, Yasemin; Dalkılınç, Murat; Parlak Demir, Yasemin; Guner, Zeynep; Boydak, Ayşenur

    2017-02-01

    According to literature, virtual reality was found to reduce pain and kinesiophobia in patients with chronic pain. The purpose of the study was to investigate short-term effect of the virtual reality on pain, function, and kinesiophobia in patients with subacute and chronic non-specific low-back pain METHODS: This randomised controlled study in which 44 patients were randomly assigned to the traditional physiotherapy (control group, 22 subjects) or virtual walking integrated physiotherapy (experimental group, 22 subjects). Before and after treatment, Visual Analog Scale (VAS), TAMPA Kinesiophobia Scale (TKS), Oswestry Disability Index (ODI), Nottingham Health Profile (NHP), Timed-up and go Test (TUG), 6-Minute Walk Test (6MWT), and Single-Leg Balance Test were assessed. The interaction effect between group and time was assessed by using repeated-measures analysis of covariance. After treatment, both groups showed improvement in all parameters. However, VAS, TKS, TUG, and 6MWT scores showed significant differences in favor of the experimental group. Virtual walking integrated physiotherapy reduces pain and kinesiophobia, and improved function in patients with subacute and chronic non-specific low-back pain in short term.

  16. Association between abnormal serum myelin-specific protein levels and white matter integrity in first-episode and drug-naïve patients with major depressive disorder.

    Science.gov (United States)

    Jiang, Linling; Cheng, Yuqi; Jiang, Hongyan; Xu, Jian; Lu, Jin; Shen, Zonglin; Lu, Yi; Liu, Fang; Li, Luqiong; Xu, Xiufeng

    2018-05-01

    Although the structural abnormalities of white matter (WM) have been described in patients with major depressive disorder (MDD), the neuropathological changes remain unclear. The current study aimed to investigate the myelin oligodendrocyte glycoprotein (MOG) and myelin-associated glycoprotein (MAG) levels and their correlations with WM integrity in first-episode, drug-naïve MDD patients. We obtained diffusion tensor images of 102 first-episode, drug-naïve MDD patients and 81 age- and sex-matched controls. Serum MOG and MAG levels of all participants were measured and compared between the two groups. The correlations between WM integrity and MOG and MAG levels were examined. MOG and MAG serum levels were significantly higher in MDD patients than in controls. Patients with MDD also showed decreased fractional anisotropy (FA) and axial diffusivity in the WM of the bilateral thalamus, right hippocampus, right temporal lobe, and left pulvinar. At the whole-brain level, no regions showed any correlations of diffusivity parameters with MOG or MAG levels in healthy subjects. However, we observed two-way correlations between the MOG and MAG levels and the FA and mean diffusivity values in the WM of the left middle frontal lobe, right inferior parietal lobe, and right supplementary motor area in MDD patients. Further investigation with a larger sample size and longitudinal studies are required to better understand the neuropathology of WM integrity in MDD. Our findings represent the first evidence of a relationship between abnormal serum myelin-specific protein levels and impaired WM integrity, which may help to better understand the neurobiological mechanisms of MDD. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Integrative proteomics, genomics, and translational immunology approaches reveal mutated forms of Proteolipid Protein 1 (PLP1) and mutant-specific immune response in multiple sclerosis.

    Science.gov (United States)

    Qendro, Veneta; Bugos, Grace A; Lundgren, Debbie H; Glynn, John; Han, May H; Han, David K

    2017-03-01

    In order to gain mechanistic insights into multiple sclerosis (MS) pathogenesis, we utilized a multi-dimensional approach to test the hypothesis that mutations in myelin proteins lead to immune activation and central nervous system autoimmunity in MS. Mass spectrometry-based proteomic analysis of human MS brain lesions revealed seven unique mutations of PLP1; a key myelin protein that is known to be destroyed in MS. Surprisingly, in-depth genomic analysis of two MS patients at the genomic DNA and mRNA confirmed mutated PLP1 in RNA, but not in the genomic DNA. Quantification of wild type and mutant PLP RNA levels by qPCR further validated the presence of mutant PLP RNA in the MS patients. To seek evidence linking mutations in abundant myelin proteins and immune-mediated destruction of myelin, specific immune response against mutant PLP1 in MS patients was examined. Thus, we have designed paired, wild type and mutant peptide microarrays, and examined antibody response to multiple mutated PLP1 in sera from MS patients. Consistent with the idea of different patients exhibiting unique mutation profiles, we found that 13 out of 20 MS patients showed antibody responses against specific but not against all the mutant-PLP1 peptides. Interestingly, we found mutant PLP-directed antibody response against specific mutant peptides in the sera of pre-MS controls. The results from integrative proteomic, genomic, and immune analyses reveal a possible mechanism of mutation-driven pathogenesis in human MS. The study also highlights the need for integrative genomic and proteomic analyses for uncovering pathogenic mechanisms of human diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Response to Commentators

    Directory of Open Access Journals (Sweden)

    Tomasello Michael

    2016-03-01

    Full Text Available This paper is a reply to the comments by Henrike Moll, Glenda Satne, Ladislav Koreň and Michael Schmitz on Michael Tomasello, A Natural History of Human Thinking (Harvard University Press, 2014.

  19. Discussion of comments from a peer review of a technique for human event analysis (ATHEANA)

    International Nuclear Information System (INIS)

    Forester, J.A.; Ramey-Smith, A.; Bley, D.C.; Kolaczkowski, A.M.; Cooper, S.E.; Wreathall, J.

    1998-01-01

    In May of 1998, a technical basis and implementation guidelines document for A Technique for Human Event Analysis (ATHEANA) was issued as a draft report for public comment (NUREG-1624). In conjunction with the release of the draft NUREG, a paper review of the method, its documentation, and the results of an initial test of the method was held over a two-day period in Seattle, Washington, in June of 1998. Four internationally-known and respected experts in human reliability analysis (HRA) were selected to serve as the peer reviewers and were paid for their services. In addition, approximately 20 other individuals with an interest in HRA and ATHEANA also attended the peer review meeting and were invited to provide comments. The peer review team was asked to comment on any aspect of the method or the report in which improvements could be made and to discuss its strengths and weaknesses. All of the reviewers thought the ATEANA method had made significant contributions to the field of PRA/HRA, in particular by addressing the most important open questions and issues in HRA, by attempting to develop an integrated approach, and by developing a framework capable of identifying types of unsafe actions that generally have not been considered using existing methods. The reviewers had many concerns about specific aspects of the methodology and made many recommendations for ways to improve and extend the method, and to make its application more cost effective and useful to PRA in general. Details of the reviewers' comments and the ATHEANA team's responses to specific criticisms will be discussed

  20. Integration of robotics and neuroscience beyond the hand: What kind of synergies?. Comment on "Hand synergies: Integration of robotics and neuroscience for understanding the control of biological and artificial hands" by Marco Santello et al.

    Science.gov (United States)

    d'Avella, Andrea

    2016-07-01

    Santello et al. [1] review an impressive amount of work on the control of biological and artificial hands that demonstrates how the concept of synergies can lead to a successful integration of robotics and neuroscience. Is it possible to generalize the same approach to the control of biological and artificial limbs and bodies beyond the hand? The human hand synergies that appear most relevant for robotic hands are those defined at the kinematic level, i.e. postural synergies [2]. Postural synergies capture the geometric relations among the many joints of the hand and allow for a low dimensional characterization and synthesis of the static hand postures involved in grasping and manipulating a large set of objects. However, many other complex motor skills such as walking, reaching, throwing, and catching require controlling multi-articular time-varying trajectories rather than static postures. Dynamic control of biological and artificial limbs and bodies, especially when geometric and inertial parameters are uncertain and the joints are compliant, poses great challenges. What kind of synergies might simplify the dynamic control of motor skills involving upper and lower limbs as well as the whole body?

  1. Element Specific Versus Integral Structural and Magnetic Properties of Co:ZnO and Gd:GaN Probed with Hard X-ray Absorption Spectroscopy

    Directory of Open Access Journals (Sweden)

    Andreas Ney

    2010-06-01

    Full Text Available Dilute magnetic semiconductors (DMS are envisioned as sources of spin-polarized carriers for future semiconductor devices which simultaneously utilize spin and charge of the carriers. The hope of discovering a DMS with ferromagnetic order up to room temperature still motivates research on suitable DMS materials. Two candidate wide-band gap DMS are Gd:GaN and Co:ZnO. We have used hard X-ray absorption spectroscopy (XAS and in particular X-ray linear dichroism (XLD and X-ray magnetic circular dichroism (XMCD to study both DMS materials with element specificity and compare these findings with results from integral SQUID magnetometry as well as electron paramagnetic resonance (EPR.

  2. Using hierarchical linear models to test differences in Swedish results from OECD’s PISA 2003: Integrated and subject-specific science education

    Directory of Open Access Journals (Sweden)

    Maria Åström

    2012-06-01

    Full Text Available The possible effects of different organisations of the science curriculum in schools participating in PISA 2003 are tested with a hierarchical linear model (HLM of two levels. The analysis is based on science results. Swedish schools are free to choose how they organise the science curriculum. They may choose to work subject-specifically (with Biology, Chemistry and Physics, integrated (with Science or to mix these two. In this study, all three ways of organising science classes in compulsory school are present to some degree. None of the different ways of organising science education displayed statistically significant better student results in scientific literacy as measured in PISA 2003. The HLM model used variables of gender, country of birth, home language, preschool attendance, an economic, social and cultural index as well as the teaching organisation.

  3. Comments on the NRC Safety Research Program Budget for Fiscal Years 1984 and 1985

    International Nuclear Information System (INIS)

    1982-07-01

    The comments are divided into three parts. Section 2 relates generally to programs for which greater effort or emphasis is needed. Section 3 provides specific comments on the proposed programs in each Decision Unit and, in most cases, for individual Subelements within each Decision Unit. Specific recommendations regarding the Research Program Support Budget are given in Section 4

  4. IRIS Toxicological Review of Tert-Butyl Alcohol (Tert-Butanol) (Public Comment Draft)

    Science.gov (United States)

    EPA is developing an Integrated Risk Information System (IRIS) assessment of tert-butyl Alcohol (tert-butanol) and has released the public comment draft assessment for public comment and external peer review. When final, the assessment will appear on the IRIS databa...

  5. Effect of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin on the growth performance, carcass quality and gut integrity of broiler chickens

    Directory of Open Access Journals (Sweden)

    M. H. H. Awaad

    2014-05-01

    Full Text Available Aim: The effect of a specific combination (SC of carvacrol, cinnamaldehyde, and Capsicum oleoresin was investigated on productive performance and immune response in broiler chickens. Materials and Methods: Six hundred one-day-old broiler chickens were randomly allocated into two groups for 5 weeks. The SC was supplemented at 100 ppm of ration (presence or absence. Results: Treatment of broiler chickens with the SC improved productive performance variables as compared with the blank control birds. It decreased total mortality, increased final body weight, weight gain, production number and decreased final feed conversion ratio (FCR (P<0.05. The SC had a positive effect on carcass quality and enhanced HI titer against Newcastle disease (ND virus vaccine, as compared to their untreated control group (P<0.05. The SC treated birds had higher values of intestinal diameter than the control ones. Conclusion: It could be concluded that administration of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin to broiler chickens improved chicken zootechnical performance response variables, had a potent immuno-modulatory effect (potentiated immune response and improved gut integrity. Eventually, this combination could be used as a replacement to the controversial feed additives (antibiotic growth promoters.

  6. Effective management of regulator RI/FS comments

    International Nuclear Information System (INIS)

    Wolinsky, S.M.; Lojek, D.; George, R.D.; Houser, S.M.; Strimbu, M.J.

    1995-01-01

    This paper describes a successful strategy that facilitates regulatory approval of CERCLA documents required by compliance agreement and CERCLA, based on the experience of Operable Unit 1, Waste Storage Area, of the Fernald Environmental Management Project (FEMP). This strategy, which has become the site standard at the FEMP, was instrumental in obtaining regulator approval of the OU1 RI and FS, and early approval of the Record of Decision during a very tight compliance agreement-driven schedule. This strategy can be applied at any DOE Superfund site, especially where there is need to recover lost schedule, an incentive to meet milestones early, a need to improve the relationship between the DOE and the regulators, or where the regulatory agencies have historically provided a large volume of comments on CERCLA documents. The strategy focuses on early identification and resolution of issues relating to draft RI/FS documents, as raised in regulatory agency review comments. This pro-active strategy has the potential for schedule and cost savings, as well as for improved communication between DOE and the regulators. The strategy includes preparation of a separate comment response document, integration of comment responses with RI/FS documents, development of a database of agency comments and their resolution, and sharing lessons learned with preparers of subsequent RI/FS documents. The paper provides background on the FEMP and describes the FEMP comment response strategy; DOE and regulator interface; the Sitewide Comment Database; networked electronic file management; the process for classifying, analyzing, and responding to comments; integration with base RI/FS documents; and a conclusion

  7. Effective management of regulator RI/FS comments

    Energy Technology Data Exchange (ETDEWEB)

    Wolinsky, S.M.; Lojek, D.; George, R.D.; Houser, S.M.; Strimbu, M.J.

    1995-12-31

    This paper describes a successful strategy that facilitates regulatory approval of CERCLA documents required by compliance agreement and CERCLA, based on the experience of Operable Unit 1, Waste Storage Area, of the Fernald Environmental Management Project (FEMP). This strategy, which has become the site standard at the FEMP, was instrumental in obtaining regulator approval of the OU1 RI and FS, and early approval of the Record of Decision during a very tight compliance agreement-driven schedule. This strategy can be applied at any DOE Superfund site, especially where there is need to recover lost schedule, an incentive to meet milestones early, a need to improve the relationship between the DOE and the regulators, or where the regulatory agencies have historically provided a large volume of comments on CERCLA documents. The strategy focuses on early identification and resolution of issues relating to draft RI/FS documents, as raised in regulatory agency review comments. This pro-active strategy has the potential for schedule and cost savings, as well as for improved communication between DOE and the regulators. The strategy includes preparation of a separate comment response document, integration of comment responses with RI/FS documents, development of a database of agency comments and their resolution, and sharing lessons learned with preparers of subsequent RI/FS documents. The paper provides background on the FEMP and describes the FEMP comment response strategy; DOE and regulator interface; the Sitewide Comment Database; networked electronic file management; the process for classifying, analyzing, and responding to comments; integration with base RI/FS documents; and a conclusion.

  8. 77 FR 42764 - Certain Integrated Circuits, Chipsets, & Products Containing Same Including Televisions; Notice...

    Science.gov (United States)

    2012-07-20

    ...Notice is hereby given that the presiding administrative law judge has issued a Final Initial Determination and Recommended Determination on Remedy and Bonding in the above-captioned investigation. The Commission is soliciting comments on public interest issues raised by the recommended relief, specifically a limited exclusion order against certain integrated circuits, chipsets, and products containing the same including televisions, imported by respondents MediaTek Inc. of Hsinchu City, Taiwan and Zoran Corporation of Sunnyvale, California.

  9. Students' Responses to Teacher Comments

    Science.gov (United States)

    Gee, Thomas C.

    1972-01-01

    In an investigation of the effects of praise, negative comment and no comment on expository compositions of eleventh grade students, author hypothesized that praise might increase motivation more than criticism or no comment. He suggests an experiment to test this phypothesis. (NL)

  10. A Spaceborne Synthetic Aperture Radar Partial Fixed-Point Imaging System Using a Field- Programmable Gate Array-Application-Specific Integrated Circuit Hybrid Heterogeneous Parallel Acceleration Technique.

    Science.gov (United States)

    Yang, Chen; Li, Bingyi; Chen, Liang; Wei, Chunpeng; Xie, Yizhuang; Chen, He; Yu, Wenyue

    2017-06-24

    With the development of satellite load technology and very large scale integrated (VLSI) circuit technology, onboard real-time synthetic aperture radar (SAR) imaging systems have become a solution for allowing rapid response to disasters. A key goal of the onboard SAR imaging system design is to achieve high real-time processing performance with severe size, weight, and power consumption constraints. In this paper, we analyse the computational burden of the commonly used chirp scaling (CS) SAR imaging algorithm. To reduce the system hardware cost, we propose a partial fixed-point processing scheme. The fast Fourier transform (FFT), which is the most computation-sensitive operation in the CS algorithm, is processed with fixed-point, while other operations are processed with single precision floating-point. With the proposed fixed-point processing error propagation model, the fixed-point processing word length is determined. The fidelity and accuracy relative to conventional ground-based software processors is verified by evaluating both the point target imaging quality and the actual scene imaging quality. As a proof of concept, a field- programmable gate array-application-specific integrated circuit (FPGA-ASIC) hybrid heterogeneous parallel accelerating architecture is designed and realized. The customized fixed-point FFT is implemented using the 130 nm complementary metal oxide semiconductor (CMOS) technology as a co-processor of the Xilinx xc6vlx760t FPGA. A single processing board requires 12 s and consumes 21 W to focus a 50-km swath width, 5-m resolution stripmap SAR raw data with a granularity of 16,384 × 16,384.

  11. A Spaceborne Synthetic Aperture Radar Partial Fixed-Point Imaging System Using a Field- Programmable Gate Array−Application-Specific Integrated Circuit Hybrid Heterogeneous Parallel Acceleration Technique

    Directory of Open Access Journals (Sweden)

    Chen Yang

    2017-06-01

    Full Text Available With the development of satellite load technology and very large scale integrated (VLSI circuit technology, onboard real-time synthetic aperture radar (SAR imaging systems have become a solution for allowing rapid response to disasters. A key goal of the onboard SAR imaging system design is to achieve high real-time processing performance with severe size, weight, and power consumption constraints. In this paper, we analyse the computational burden of the commonly used chirp scaling (CS SAR imaging algorithm. To reduce the system hardware cost, we propose a partial fixed-point processing scheme. The fast Fourier transform (FFT, which is the most computation-sensitive operation in the CS algorithm, is processed with fixed-point, while other operations are processed with single precision floating-point. With the proposed fixed-point processing error propagation model, the fixed-point processing word length is determined. The fidelity and accuracy relative to conventional ground-based software processors is verified by evaluating both the point target imaging quality and the actual scene imaging quality. As a proof of concept, a field- programmable gate array−application-specific integrated circuit (FPGA-ASIC hybrid heterogeneous parallel accelerating architecture is designed and realized. The customized fixed-point FFT is implemented using the 130 nm complementary metal oxide semiconductor (CMOS technology as a co-processor of the Xilinx xc6vlx760t FPGA. A single processing board requires 12 s and consumes 21 W to focus a 50-km swath width, 5-m resolution stripmap SAR raw data with a granularity of 16,384 × 16,384.

  12. 78 FR 22277 - Notice of Proposed Information Collection: Comment Request Office of Sustainable Housing...

    Science.gov (United States)

    2013-04-15

    ... Information Collection: Comment Request Office of Sustainable Housing Communities Progress Report Template AGENCY: Office of Sustainable Housing and Communities (OSHC), HUD. ACTION: Notice. SUMMARY: The proposed... Sustainable Communities Initiative to improve regional planning efforts that integrate housing and...

  13. Temporal and SUMO-specific SUMOylation contribute to the dynamics of Polo-like kinase 1 (PLK1) and spindle integrity during mouse oocyte meiosis.

    Science.gov (United States)

    Feitosa, Weber Beringui; Hwang, KeumSil; Morris, Patricia L

    2018-02-15

    During mammalian meiosis, Polo-like kinase 1 (PLK1) is essential during cell cycle progression. In oocyte maturation, PLK1 expression is well characterized but timing of posttranslational modifications regulating its activity and subcellular localization are less clear. Small ubiquitin-related modifier (SUMO) posttranslational modifier proteins have been detected in mammalian gametes but their precise function during gametogenesis is largely unknown. In the present paper we report for mouse oocytes that both PLK1 and phosphorylated PLK1 undergo SUMOylation in meiosis II (MII) oocytes using immunocytochemistry, immunoprecipitation and in vitro SUMOylation assays. At MII, PLK1 is phosphorylated at threonine-210 and serine-137. MII oocyte PLK1 and phosphorylated PLK1 undergo SUMOylation by SUMO-1, -2 and -3 as shown by individual in vitro assays. Using these assays, forms of phosphorylated PLK1 normalized to PLK1 increased significantly and correlated with SUMOylated PLK1 levels. During meiotic progression and maturation, SUMO-1-SUMOylation of PLK1 is involved in spindle formation whereas SUMO-2/3-SUMOylation may regulate PLK1 activity at kinetochore-spindle attachment sites. Microtubule integrity is required for PLK1 localization with SUMO-1 but not with SUMO-2/3. Inhibition of SUMOylation disrupts proper meiotic bipolar spindle organization and spindle-kinetochore attachment. The data show that both temporal and SUMO-specific-SUMOylation play important roles in orchestrating functional dynamics of PLK1 during mouse oocyte meiosis, including subcellular compartmentalization. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  15. 1647 comments.pmd

    African Journals Online (AJOL)

    driniev

    ask for fax line). Cell: +2772 40 59 561. E-mail: frank.winde@gmx.de. Comments on: “Gold tailings as a source of waterborne uranium contamination of streams – The Koekemoerspruit as a case study” published in Water SA 30 (2) 219-240.

  16. Response to state comments on the revised draft North Central Regional characterization reports for the Crystalline Repository Project

    International Nuclear Information System (INIS)

    1985-08-01

    The purpose of this document is to respond to the comments received from the states of the North Central Region on the revised draft North Central Regional Characterization Reports (RCRs). The responses in this document indicate the manner in which the suggestions or comments received have been considered in modifying the revised draft North Central RCRs. Both general comments related to the overall Crystalline Repository Project (CRP) and comments on specific sections of the RCRs are addressed. This document responds to North Central State comments on both the revised draft North Central Regional Geologic Characterization Report (RGCR) and the revised draft North Central Regional Environmental Characterization Report (RECR)

  17. Response to state comments on the revised draft Southeastern Regional Characterization Reports for the Crystalline Repository Project

    International Nuclear Information System (INIS)

    1985-08-01

    The purpose of this document is to respond to the comments received from the states of the Southeastern Region on the revised draft Southeastern Regional Characterization Reports (RCRs). The responses in this document indicate the manner in which the suggestions or comments received have been considered in modifying the revised draft Southeastern RCRs. Both general comments related to the overall Crystalline Repository Project (CRP) and comments on specific sections of the RCRs are addressed. This document responds to Southeastern State comments on both the revised draft Southeastern Regional Geologic Characterization Report (RGCR) and the revised draft Southeastern Regional Environmental Characterization Report (RECR)

  18. Response to state comments on the revised draft northeastern regional characterization reports for the Crystalline Repository Project

    International Nuclear Information System (INIS)

    1985-08-01

    The purpose of this document is to respond to the comments received from the States of the Northeastern Region on the revised draft Northeastern Regional Characterization Reports (RCRs). The responses in this document indicate the manner in which the suggestions or comments received have been considered in modifying the revised draft Northeastern RCRs. Both general comments related to the overall Crystalline Repository Project (CRP) and comments on specific sections of the RCRs are addressed. This document responds to Northeastern State comments on both the revised draft Northeastern Regional Geologic Characterization Report (RGCR) and the revised draft Northeastern Regional Environmental Characterization Report (RECR)

  19. 78 FR 10002 - Proposed Collection; Comment Request for Regulation Project

    Science.gov (United States)

    2013-02-12

    ... comments should be received on or before April 15, 2013 to be assured of consideration. ADDRESSES: Direct...: FI-59-91. Abstract: This regulation relates to the tax treatment of debt instruments that provide for... an integrated transaction. The regulation provides general rules, definitions, and reporting and...

  20. Comment and response document for the long-term surveillance plan for the Bodo Canyon Disposal Site, Durango, Colorado, Revision 0

    International Nuclear Information System (INIS)

    1995-11-01

    This report contains the comment and response document for the Draft Long-Term Surveillance Plan of the Bodo Canyon Site in Durango, California. This is a part of the Uranium Mill Tailings Remedial Action (UMTRA) Project. Questions and comments regarding specific sections or statements in the report are described and then a response to each review comment or question is provided

  1. 78 FR 2960 - Request for Comments on Preparation of Patent Applications

    Science.gov (United States)

    2013-01-15

    ... seeking public comment on advantages and disadvantages of applicants employing the following practices... comments on advantages and disadvantages of applicants employing the following practices when preparing... the specification and/or claims, particularly for inventions related to certain technologies, such as...

  2. 75 FR 27346 - Agency Information Collection Request. 30-Day Public Comment Request

    Science.gov (United States)

    2010-05-14

    ... of a proposed collection for public comment. Interested persons are invited to send comments... plans, employers, and health care providers. We know very little about why consumers, and specifically... the newer, more robust Internet-based tools for tracking their health and health care services. This...

  3. 75 FR 7268 - Agency Information Collection Request; 60-Day Public Comment Request

    Science.gov (United States)

    2010-02-18

    ... information collection request for public comment. Interested persons are invited to send comments regarding... plans, employers, and health care providers. We know very little about why consumers, and specifically... the newer, more robust Internet-based tools for tracking their health and health care services. This...

  4. 78 FR 18576 - Agency Information Collection Activities; Comment Request; Experimental Sites Data Collection...

    Science.gov (United States)

    2013-03-27

    ... and provide the requested data in the desired format. ED is soliciting comments on the proposed... specific information/performance data for analysis of the experiments. This effort will assist the...; Comment Request; Experimental Sites Data Collection Instrument AGENCY: Department of Education (ED...

  5. 77 FR 47835 - Agency Information Collection Activities; Proposed Collection; Comment Request; Consolidated...

    Science.gov (United States)

    2012-08-10

    ... Number 2050-0096 (National Oil and Hazardous Substance Pollution Contingency Plan (NCP)). The first ICR... or view public comments, access the index listing of the contents of the docket, and to access those... comments: 1. Explain your views as clearly as possible and provide specific examples. 2. Describe any...

  6. 76 FR 25331 - Agency Information Collection Activities; Proposed Collection; Comment Request; National Oil and...

    Science.gov (United States)

    2011-05-04

    ... Activities; Proposed Collection; Comment Request; National Oil and Hazardous Substance Pollution Contingency... http://www.regulations.gov to obtain a copy of the draft collection of information, submit or view... comments: 1. Explain your views as clearly as possible and provide specific examples. 2. Describe any...

  7. Evidence for a Specific Integrative Mechanism for Episodic Memory Mediated by AMPA/kainate Receptors in a Circuit Involving Medial Prefrontal Cortex and Hippocampal CA3 Region.

    Science.gov (United States)

    de Souza Silva, Maria A; Huston, Joseph P; Wang, An-Li; Petri, David; Chao, Owen Yuan-Hsin

    2016-07-01

    We asked whether episodic-like memory requires neural mechanisms independent of those that mediate its component memories for "what," "when," and "where," and if neuronal connectivity between the medial prefrontal cortex (mPFC) and the hippocampus (HPC) CA3 subregion is essential for episodic-like memory. Unilateral lesion of the mPFC was combined with unilateral lesion of the CA3 in the ipsi- or contralateral hemispheres in rats. Episodic-like memory was tested using a task, which assesses the integration of memories for "what, where, and when" concomitantly. Tests for novel object recognition (what), object place (where), and temporal order memory (when) were also applied. Bilateral disconnection of the mPFC-CA3 circuit by N-methyl-d-aspartate (NMDA) lesions disrupted episodic-like memory, but left the component memories for object, place, and temporal order, per se, intact. Furthermore, unilateral NMDA lesion of the CA3 plus injection of (6-cyano-7-nitroquinoxaline-2,3-dione) (CNQX) (AMPA/kainate receptor antagonist), but not AP-5 (NMDA receptor antagonist), into the contralateral mPFC also disrupted episodic-like memory, indicating the mPFC AMPA/kainate receptors as critical for this circuit. These results argue for a selective neural system that specifically subserves episodic memory, as it is not critically involved in the control of its component memories for object, place, and time. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Interleukin-10 is produced by a specific subset of taste receptor cells and critical for maintaining structural integrity of mouse taste buds.

    Science.gov (United States)

    Feng, Pu; Chai, Jinghua; Zhou, Minliang; Simon, Nirvine; Huang, Liquan; Wang, Hong

    2014-02-12

    Although inflammatory responses are a critical component in defense against pathogens, too much inflammation is harmful. Mechanisms have evolved to regulate inflammation, including modulation by the anti-inflammatory cytokine interleukin-10 (IL-10). Previously we have shown that taste buds express various molecules involved in innate immune responses, including the proinflammatory cytokine tumor necrosis factor (TNF). Here, using a reporter mouse strain, we show that taste cells also express the anti-inflammatory cytokine IL-10. Remarkably, IL-10 is produced by only a specific subset of taste cells, which are different from the TNF-producing cells in mouse circumvallate and foliate taste buds: IL-10 expression was found exclusively in the G-protein gustducin-expressing bitter receptor cells, while TNF was found in sweet and umami receptor cells as reported previously. In contrast, IL-10R1, the ligand-binding subunit of the IL-10 receptor, is predominantly expressed by TNF-producing cells, suggesting a novel cellular hierarchy for regulating TNF production and effects in taste buds. In response to inflammatory challenges, taste cells can increase IL-10 expression both in vivo and in vitro. These findings suggest that taste buds use separate populations of taste receptor cells that coincide with sweet/umami and bitter taste reception to modulate local inflammatory responses, a phenomenon that has not been previously reported. Furthermore, IL-10 deficiency in mice leads to significant reductions in the number and size of taste buds, as well as in the number of taste receptor cells per taste bud, suggesting that IL-10 plays critical roles in maintaining structural integrity of the peripheral gustatory system.

  9. Realizing Relevance: The Influence of Domain-Specific Information on Generation of New Knowledge through Integration in 4- to 8-Year-Old Children

    Science.gov (United States)

    Bauer, Patricia J.; Larkina, Marina

    2017-01-01

    In accumulating knowledge, direct modes of learning are complemented by productive processes, including self-generation based on integration of separate episodes. Effects of the number of potentially relevant episodes on integration were examined in 4- to 8-year-olds (N = 121; racially/ethnically heterogeneous sample, English speakers, from large…

  10. Core Didactic Thematics and Methodology in Business Spanish: Developing Leadership with Integrity as a Priority for Language for the Professions and Specific Purposes

    Science.gov (United States)

    Doyle, Michael S.

    2017-01-01

    Business Spanish typically teaches the vocabulary, content, and context of the functional areas of business, and how to conduct business in a cultural setting. But it should do more than just that. Leadership with integrity should be primed and personalized as a signature and integrative core value that frameworks any ensuing learning of the…

  11. Geographic specificity and positionality of public input in transportation: a rural transportation planning case from Central Texas

    Directory of Open Access Journals (Sweden)

    Greg P. Griffin

    2014-01-01

    Full Text Available Current transportation planning processes often incorporate public input, but the types of engagement techniques can affect the ability of practitioners to meaningfully include local ideas. This study incorporates literature integrating communicative rationality with participatory mapping, supported by a case study focusing on two public engagement techniques. A transportation planning process in Central Texas is evaluated in terms of the geographic specificity and positionality of comments received from open-ended responses on a questionnaire and a facilitated mapping session, and reviews this input for relevance to developing a transportation plan. Although all input received from the public can be valuable in the process, location-based comments may be more actionable by transportation planners. Participants’ perceived roles likely affect their level of engagement, which planners can facilitate to maximize the quality of involvement. Planners are advised to understand the positionality of project stakeholders and professionals, designing involvement methods considering geographic specificity appropriate for each project.

  12. Opinion Summarizationof CustomerComments

    Science.gov (United States)

    Fan, Miao; Wu, Guoshi

    Web 2.0 technologies have enabled more and more customers to freely comment on different kinds of entities, such as sellers, products and services. The large scale of information poses the need and challenge of automatic summarization. In many cases, each of the user-generated short comments implies the opinions which rate the target entity. In this paper, we aim to mine and to summarize all the customer comments of a product. The algorithm proposed in this researchis more reliable on opinion identification because it is unsupervised and the accuracy of the result improves as the number of comments increases. Our research is performed in four steps: (1) mining the frequent aspects of a product that have been commented on by customers; (2) mining the infrequent aspects of a product which have been commented by customers (3) identifying opinion words in each comment and deciding whether each opinion word is positive, negative or neutral; (4) summarizing the comments. This paper proposes several novel techniques to perform these tasks. Our experimental results using comments of a number of products sold online demonstrate the effectiveness of the techniques.

  13. Comments on Unruh's Paper

    OpenAIRE

    Stapp, Henry P.

    1998-01-01

    Unruh has commented upon my recent proof that certain predictions of quantum theory are incompatible with the assertion that no influence of any kind acts backward in time in any Lorentz frame. Unruh fails to make a necessary distinction between statements that assert the existence of values, and statements that assert the existence merely of correlations between possible values. Consequently his argument fails to show that my proof involves a tacit or hidden reality assumption that is alien ...

  14. Comments on `A discrete optimal control problem for descriptor systems'

    DEFF Research Database (Denmark)

    Ravn, Hans

    1990-01-01

    In the above-mentioned work (see ibid., vol.34, p.177-81 (1989)), necessary and sufficient optimality conditions are derived for a discrete-time optimal problem, as well as other specific cases of implicit and explicit dynamic systems. The commenter corrects a mistake and demonstrates that there ......In the above-mentioned work (see ibid., vol.34, p.177-81 (1989)), necessary and sufficient optimality conditions are derived for a discrete-time optimal problem, as well as other specific cases of implicit and explicit dynamic systems. The commenter corrects a mistake and demonstrates...

  15. Analysis of public comments on the proposed rule on nuclear power plant license renewal

    International Nuclear Information System (INIS)

    1991-12-01

    This report provides a summary and analysis of public comments on the proposed license renewal rule for the nuclear power plants (10 CFR Part 54) published in the Federal Register on 17 July 1990. It also documents the NRC's resolution of the issues raised by the commenters. Comments from 121 organizations and 76 individuals were reviewed and analyzed to identify the issues, including those pertaining to the adequacy of the licensing basis, the performance of an integrated plant assessment, backfit considerations, and need for public hearings. The analysis included grouping of commenters' views according to the issues raised. The public comments analyzed in this report were taken into consideration in the development of the final rule and revisions to the supporting documents

  16. Anatomy and history of an external quality assessment program for interpretative comments in clinical biochemistry.

    Science.gov (United States)

    Vasikaran, Samuel D

    2015-05-01

    The provision of clinical interpretation of results, either verbally or in the printed report, may be considered an integral part of clinical biochemistry diagnostic service. Proficiency testing or external quality assessment (EQA) of such activity may be useful in education, training, continuing professional development and ensuring the quality of such service. Details of the Patient Report Comments Program (RPCProgram) developed by the Royal College of Pathologists of Australasia (RCPA) Chemical Pathology Quality Assurance Programs Pty Ltd (QAP) is described in this review. The program is aimed at pathologists, clinical scientists and trainees. Registered participants are provided a report with case details and a set of clinical biochemistry results at monthly intervals and submit an interpretative comment for the report. Comments received are broken up into components that are translated into common key phrases. An expert panel evaluates the key phrases, classifies them according to appropriateness and drafts a suggested comment, a case summary and a rationale, which are included in a summary report returned to participants. There is considerable diversity in the quality of interpretative comments received from participants of the PRCProgram. The primary purpose of EQA of interpretative commenting is educational self-assessment, and they are recognized as a continuing professional development activity. Whilst there is some evidence for the utility of interpretative comments in improving patient outcomes, evidence for the utility of EQA in improving quality of comments is awaited. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  17. 76 FR 59660 - Proposed Information Collection; Comment Request; National Marine Sanctuary Permits

    Science.gov (United States)

    2011-09-27

    ... Collection; Comment Request; National Marine Sanctuary Permits AGENCY: National Oceanic and Atmospheric... and extension of this information collection. National Marine Sanctuary regulations at 15 CFR part 922 list specific activities that are prohibited in national marine sanctuaries. These regulations also...

  18. Integral equations

    CERN Document Server

    Moiseiwitsch, B L

    2005-01-01

    Two distinct but related approaches hold the solutions to many mathematical problems--the forms of expression known as differential and integral equations. The method employed by the integral equation approach specifically includes the boundary conditions, which confers a valuable advantage. In addition, the integral equation approach leads naturally to the solution of the problem--under suitable conditions--in the form of an infinite series.Geared toward upper-level undergraduate students, this text focuses chiefly upon linear integral equations. It begins with a straightforward account, acco

  19. 76 FR 76981 - Request for Public Comments Concerning U.S.-Canada Action Plan for Perimeter Security and...

    Science.gov (United States)

    2011-12-09

    ... Jobs; Integrated Cross-Border Law Enforcement; and Critical Infrastructure and Cybersecurity. Progress... comments submitted electronically containing business confidential information, the file name of the business confidential version should begin with the characters ``BC''. The top of any page containing...

  20. Concept-guided development of classroom use of ICT : Concept-specific types of ICT use and their integration into teachers’ practices

    NARCIS (Netherlands)

    de Koster, S.

    2017-01-01

    Does a concept-guided approach in schools with either a ‘traditional’ or an ‘innovative’ educational concept contribute to the development of ICT use that becomes integrated in the teachers’ classroom practices? In order to answer this question we performed four, mainly qualitative, studies in five

  1. The Principles of Economics from Now until Then: A Comment.

    Science.gov (United States)

    Amacher, Ryan C.

    1988-01-01

    Comments on Bell's article "The Principles of Economics from Now until Then," responding to the author's two general premises as well as citing specific arguments. Concludes that Bell's premises are based on a small and unrepresentative number of textbooks. Many textbooks that present material according to the recommendations were…

  2. 76 FR 57037 - Proposed Agency Information Collection Activities; Comment Request

    Science.gov (United States)

    2011-09-15

    ... two types of authentication mechanisms: dual-message transactions (those generally requiring a... specifically requests comment on the following: a. The best terms to use in identifying types of authentication... card programs that use two types of authentication mechanisms: Dual-message transactions (those...

  3. 76 FR 77052 - Proposed Collection; Comment Request for Regulation Project

    Science.gov (United States)

    2011-12-09

    ... 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A)). The IRS is soliciting comments concerning... requires large banks to change from reserve method of accounting to the specific charge off method of accounting for bad debts. Section 1.585-8 of the regulation contains reporting requirements in cases in which...

  4. 78 FR 47814 - Data Collection Available for Public Comments

    Science.gov (United States)

    2013-08-06

    ... only the relevant information to the audience member's specific needs, Information is also collected to... information, contribute information, and interact with SBA and other users of the site. Description of... approved information collection. DATES: Submit comments on or before October 7, 2013. ADDRESSES: Send all...

  5. 77 FR 10533 - Proposed Information Collection Activity; Comment Request

    Science.gov (United States)

    2012-02-22

    ... employment and public assistance. The guide will be used to interview respondents in order to learn about...; use of public benefit programs and reasons for using or not using specific benefits; their financial... technology. Consideration will be given to comments and suggestions submitted within 60 days of this...

  6. 75 FR 81615 - Submission for OMB Review; Comment Request

    Science.gov (United States)

    2010-12-28

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Administration for Children and Families Submission for... Specific Consent. OMB No.: New Collection. Description: The William Wilberforce Trafficking Victims... effect if OMB receives it within 30 days of publication. Written comments and recommendations for the...

  7. 76 FR 34287 - Proposed Agency Information Collection Activities; Comment Request

    Science.gov (United States)

    2011-06-13

    ... the Office of Management and Budget (OMB), FRA is soliciting public comment on specific aspects of the........... 1 minute 350 Locomotives. 229.17--Accident Reports......... 744 Railroads...... 1 report 15 minutes... removal tags. 1 minute 17 Preserving Accident Data..... 744 Railroads...... 2,930 data reports. 15 minutes...

  8. 78 FR 24151 - Submission for OMB Review; Comment Request

    Science.gov (United States)

    2013-04-24

    ... and clearance under the Paperwork Reduction Act of 1995, Public Law 104-13. Comments regarding (a... of information unless it displays a currently valid OMB control number. Forest Service Title: Bid for... appraised value; bidders meet specific criteria when submitting a bid; and anti-trust violations do not...

  9. Answer to the comments made by N. Gibson, H. Rauscher and G. Roebben on the article by A.J. Lecloux (J Nanopart Res (2015) 17:447) regarding the use of the volume-specific surface area (VSSA) to classify nanomaterials

    Energy Technology Data Exchange (ETDEWEB)

    Lecloux, André J., E-mail: envicat@skynet.be [ENVICAT Consulting (Belgium)

    2016-08-15

    This article is an answer to the comments made by N. Gibson, H. Rauscher and G. Roebben on the article by Lecloux (J Nanopart Res 17:447, 2015) regarding the use of the volume-specific surface area (VSSA) to classify nanomaterials. The key point of discussion is the comparison of two models. The VSSA concept, developed for monodispersed spherical non-porous particle size distribution, was applied in two different ways to calculate the VSSA corresponding to a poly-dispersed distribution of particle size: on one side, a total VSSA value that is the number-weighted sum of the individual VSSAs corresponding to each particle size present with its frequency in the distribution. On the other side, a weight-averaged VSSA based on the measurement method, dividing the total surface area of all the particles by their total volume. The key questions are which model is better representing the experimental VSSA values obtained by analysis of the nitrogen adsorption isotherms and which model is the most appropriate to identify nanomaterials? This cannot be answered on a theoretical basis. Only a comparison with various experimental data could decide which model is the most appropriate.

  10. ITER ISS system alternative specification study

    International Nuclear Information System (INIS)

    Kveton, O.K.

    1990-08-01

    Recent comments suggested that the fuel systems, in particular the ISS, could be simplified if the ITER specifications were relaxed from the data specified for ITER. This interim report addresses the first part of the analysis, which considers the impact of design specifications on fuel systems design

  11. 78 FR 12042 - Electric Grid Integration Technical Workshops

    Science.gov (United States)

    2013-02-21

    ... DEPARTMENT OF ENERGY Electric Grid Integration Technical Workshops AGENCY: Grid Tech Team, U.S. Department of Energy. ACTION: Notice of availability; request for comments. SUMMARY: Notice is hereby given that two documents are publicly available and the Department of Energy is requesting public comments...

  12. 77 FR 11115 - Mobility Fund Phase I Auction Limited Extension of Deadlines for Comments and Reply Comments on...

    Science.gov (United States)

    2012-02-24

    ... FEDERAL COMMUNICATIONS COMMISSION [AU Docket No. 12-25; DA 12-236] Mobility Fund Phase I Auction... the Mobility Fund Phase I Auction Limited Extension of Comment Deadlines Public Notice (Public Notice... respect to the potential eligibility of specific census blocks for Mobility Fund Phase I support by March...

  13. Can modular psychological concepts like affect and emotion be assigned to a distinct subset of regional neural circuits?. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Fehr, Thorsten; Herrmann, Manfred

    2015-06-01

    The proposed Quartet Theory of Human Emotions by Koelsch and co-workers [11] adumbrates evidence from various scientific sources to integrate and assign the psychological concepts of 'affect' and 'emotion' to four brain circuits or to four neuronal core systems for affect-processing in the brain. The authors differentiate between affect and emotion and assign several facultative, or to say modular, psychological domains and principles of information processing, such as learning and memory, antecedents of affective activity, emotion satiation, cognitive complexity, subjective quality feelings, degree of conscious appraisal, to different affect systems. Furthermore, they relate orbito-frontal brain structures to moral affects as uniquely human, and the hippocampus to attachment-related affects. An additional feature of the theory describes 'emotional effector-systems' for motor-related processes (e.g., emotion-related actions), physiological arousal, attention and memory that are assumed to be cross-linked with the four proposed affect systems. Thus, higher principles of emotional information processing, but also modular affect-related issues, such as moral and attachment related affects, are thought to be handled by these four different physiological sub-systems that are on the other side assumed to be highly interwoven at both physiological and functional levels. The authors also state that the proposed sub-systems have many features in common, such as the selection and modulation of biological processes related to behaviour, perception, attention and memory. The latter aspect challenges an ongoing discussion about the mind-body problem: To which degree do the proposed sub-systems 'sufficiently' cover the processing of complex modular or facultative emotional/affective and/or cognitive phenomena? There are current models and scientific positions that almost completely reject the idea that modular psychological phenomena are handled by a distinct selection of

  14. ONC201 kills solid tumor cells by triggering an integrated stress response dependent on ATF4 activation by specific eIF2α kinases

    OpenAIRE

    Kline, C. Leah B.; Van den Heuvel, A. Pieter J.; Allen, Joshua E.; Prabhu, Varun V.; Dicker, David T.; El-Deiry, Wafik S.

    2016-01-01

    ONC201 (also called TIC10) is a small molecule that inactivates the cell proliferation- and cell survival-promoting kinases AKT and ERK and induces cell death through the pro-apoptotic protein TRAIL. ONC201 is currently in early phase clinical testing for various malignancies. Here, we found through gene expression and protein analyses that ONC201 triggered an increase in TRAIL abundance and cell death through an integrated stress response (ISR) involving the transcription factor ATF4, the tr...

  15. Media brand loyalty through online audience integration?

    OpenAIRE

    Lischka, Juliane A

    2015-01-01

    This chapter discusses the question whether audience members become loyal toward a media brand when sharing, liking or commenting on online media content – or are loyal readers more inclined to write comments on online articles or to like and share them? The aim is to answer this chicken-egg causality dilemma on the audience integration-loyalty relation on a theoretical basis. Therefore, the concept of attitude-behavior consistency, the theory of reasoned action, involvement theory, uses and ...

  16. Public comments and responses to the 1991 Hanford Cleanup Five-Year Plan

    International Nuclear Information System (INIS)

    1992-05-01

    The Department of Energy (DOE) Richland Field Office (RL) updated its Site-Specific Plan (DOE-RL 1991a) dealing with cleanup and operation of the Hanford Site in September 1991. The plan provides direction as to how DOE will carry out the national strategy for managing and cleaning up the Hanford Site wastes resulting from production of nuclear weapons. The plan is updated annually. We asked the public to comment on the plan during its 60-day public comment period. This report presents the comments and provides responses. The introduction explains how the comments were gathered and how we responded. This report is in four main sections: (1) comments and responses addressed locally; (2) comments forwarded to DOE-Headquarters for their response (these responses will appear in the National Five-Year Plan [DOE 1991a]); (3) comments we did not respond to here because they were outside the scope, or about how we gathered the public's comments; and (4) the appendices, which include a glossary, a list of acronyms used in the document, and the letters and cards we received reproduced in their entirety

  17. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli.

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J M

    2013-05-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism.

  18. Stability of transmembrane amyloid β-peptide and membrane integrity tested by molecular modeling of site-specific Aβ42 mutations.

    Directory of Open Access Journals (Sweden)

    Chetan Poojari

    Full Text Available Interactions of the amyloid β-protein (Aβ with neuronal cell membranes, leading to the disruption of membrane integrity, are considered to play a key role in the development of Alzheimer's disease. Natural mutations in Aβ42, such as the Arctic mutation (E22G have been shown to increase Aβ42 aggregation and neurotoxicity, leading to the early-onset of Alzheimer's disease. A correlation between the propensity of Aβ42 to form protofibrils and its effect on neuronal dysfunction and degeneration has been established. Using rational mutagenesis of the Aβ42 peptide it was further revealed that the aggregation of different Aβ42 mutants in lipid membranes results in a variety of polymorphic aggregates in a mutation dependent manner. The mutant peptides also have a variable ability to disrupt bilayer integrity. To further test the connection between Aβ42 mutation and peptide-membrane interactions, we perform molecular dynamics simulations of membrane-inserted Aβ42 variants (wild-type and E22G, D23G, E22G/D23G, K16M/K28M and K16M/E22G/D23G/K28M mutants as β-sheet monomers and tetramers. The effects of charged residues on transmembrane Aβ42 stability and membrane integrity are analyzed at atomistic level. We observe an increased stability for the E22G Aβ42 peptide and a decreased stability for D23G compared to wild-type Aβ42, while D23G has the largest membrane-disruptive effect. These results support the experimental observation that the altered toxicity arising from mutations in Aβ is not only a result of the altered aggregation propensity, but also originates from modified Aβ interactions with neuronal membranes.

  19. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M.; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J.M.

    2013-01-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism. PMID:23445770

  20. Grand Theories of Personality Cannot Be Integrated

    Science.gov (United States)

    Wood, Alex; Joseph, Stephen

    2007-01-01

    Comments on the original article "A New Big Five: Fundamental Principles for an Integrative Science of Personality," by Dan P. McAdams and Jennifer L. Pals (see record 2006-03947-002). McAdams and Pals (April 2006) presented a new model to integrate the field of personality psychology. Cultural and evolutionary factors interact with an…

  1. PhD students and integrative research

    NARCIS (Netherlands)

    Fry, G.; Tress, B.; Tress, G.

    2006-01-01

    The training of PhD students is currently very dynamic and varies widely from place to place. We present some examples of this variation and comment on how it may affect the way PhD students cope with integrative studies. Our focus is on the training needs of PhD students studying integrative

  2. Comment on 'Conservative discretizations of the Kepler motion'

    International Nuclear Information System (INIS)

    Cieslinski, Jan L

    2010-01-01

    We show that the exact integrator for the classical Kepler motion, recently found by Kozlov (2007 J. Phys. A: Math. Theor. 40 4529-39), can be derived in a simple natural way, using a well-known exact discretization of the harmonic oscillator. We also draw attention to important earlier references, where the exact discretization of the four-dimensional isotropic harmonic oscillator has been applied to the perturbed Kepler problem. (comments and replies)

  3. CROSS-COMPLIANCE Facilitating the CAP reform: Compliance and competitiveness of European agriculture : Specific Targeted Research or Innovation Project (STREP) Integrating and Strengthening the European Research Area

    NARCIS (Netherlands)

    Jongeneel, R.A.; Bezlepkina, I.; Winsten, J.; Fox, G.

    2008-01-01

    The prime aim or the project was on assessing the impacts of compliance with standards, more specifically those part of cross-compliance, on EU’s external competitiveness. This is why in several deliverables and also in the main text of this Deliverable 13 a lot of attention is given to the EU and

  4. Life sciences payload definition and integration study. Volume 3: Preliminary equipment item specification catalog for the carry-on laboratories. [for Spacelab

    Science.gov (United States)

    1974-01-01

    All general purpose equipment items contained in the final carry-on laboratory (COL) design concepts are described in terms of specific requirements identified for COL use, hardware status, and technical parameters such as weight, volume, power, range, and precision. Estimated costs for each item are given, along with projected development times.

  5. An integrated specification for the nexus of water pollution and economic growth in China: Panel cointegration, long-run causality and environmental Kuznets curve.

    Science.gov (United States)

    Zhang, Chen; Wang, Yuan; Song, Xiaowei; Kubota, Jumpei; He, Yanmin; Tojo, Junji; Zhu, Xiaodong

    2017-12-31

    This paper concentrates on a Chinese context and makes efforts to develop an integrated process to explicitly elucidate the relationship between economic growth and water pollution discharge-chemical oxygen demand (COD) discharge and ammonia nitrogen (NH 3 -N), using two unbalanced panel data sets covering the period separately from 1990 to 2014, and 2001 to 2014. In our present study, the panel unit root tests, cointegration tests, and Granger causality tests allowing for cross-sectional dependence, nonstationary, and heterogeneity are conducted to examine the causal effects of economic growth on COD/NH 3 -N discharge. Further, we simultaneously apply semi-parametric fixed effects estimation and parametric fixed effects estimation to investigate environmental Kuznets curve relationship for COD/NH 3 -N discharge. Our empirical results show a long-term bidirectional causality between economic growth and COD/NH 3 -N discharge in China. Within the Stochastic Impacts by Regression on Population, Affluence and Technology framework, we find evidence in support of an inverted U-shaped curved link between economic growth and COD/NH 3 -N discharge. To the best of our knowledge, there have not been any efforts made in investigating the nexus of economic growth and water pollution in such an integrated manner. Therefore, this study takes a fresh look on this topic. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. TWRSview system requirements specification

    International Nuclear Information System (INIS)

    Caldwell, J.A.; Lee, A.K.

    1995-12-01

    This document provides the system requirements specification for the TWRSview software system. The TWRSview software system is being developed to integrate electronic data supporting the development of the TWRS technical baseline

  7. Devices and Desires: Integrative Strategy Instruction from a Motivational Perspective.

    Science.gov (United States)

    Vauras, Marja; And Others

    1993-01-01

    This critique of Edwin Ellis's Integrative Strategy Instruction model comments that analyses are needed concerning the mutual social adaptations of differently disposed (cognitively, motivationally, and emotionally) students with learning disabilities and teachers within the social frames of learning environments. (JDD)

  8. Competencies "plus": the nature of written comments on internal medicine residents' evaluation forms.

    Science.gov (United States)

    Ginsburg, Shiphra; Gold, Wayne; Cavalcanti, Rodrigo B; Kurabi, Bochra; McDonald-Blumer, Heather

    2011-10-01

    Comments on residents' in-training evaluation reports (ITERs) may be more useful than scores in identifying trainees in difficulty. However, little is known about the nature of comments written by internal medicine faculty on residents' ITERs. Comments on 1,770 ITERs (from 180 residents in postgraduate years 1-3) were analyzed using constructivist grounded theory beginning with an existing framework. Ninety-three percent of ITERs contained comments, which were frequently easy to map onto traditional competencies, such as knowledge base (n = 1,075 comments) to the CanMEDs Medical Expert role. Many comments, however, could be linked to several overlapping competencies. Also common were comments completely unrelated to competencies, for instance, the resident's impact on staff (813), or personality issues (450). Residents' "trajectory" was a major theme (performance in relation to expected norms [494], improvement seen [286], or future predictions [286]). Faculty's assessments of residents are underpinned by factors related and unrelated to traditional competencies. Future evaluations should attempt to capture these holistic, integrated impressions.

  9. Site-Specific Growth and in Situ Integration of Different Nanowire Material Networks on a Single Chip: Toward a Nanowire-Based Electronic Nose for Gas Detection.

    Science.gov (United States)

    Hrachowina, Lukas; Domènech-Gil, Guillem; Pardo, Antonio; Seifner, Michael S; Gràcia, Isabel; Cané, Carles; Romano-Rodríguez, Albert; Barth, Sven

    2018-03-23

    A new method for the site-selective synthesis of nanowires has been developed to enable material growth with defined morphology and, at the same time, different composition on the same chip surface. The chemical vapor deposition approach for the growth of these nanowire-based resistive devices using micromembranes can be easily modified and represents a simple, adjustable fabrication process for the direct integration of nanowire meshes in multifunctional devices. This proof-of-concept study includes the deposition of SnO 2 , WO 3 , and Ge nanowires on the same chip. The individual resistors exhibit adequate gas sensing responses toward changing gas concentrations of CO, NO 2 , and humidity diluted in synthetic air. The data have been processed by principal component analysis with cluster responses that can be easily separated, and thus, the devices described herein are in principle suitable for environmental monitoring.

  10. The Role of Theory-Specific Techniques and Therapeutic Alliance in Promoting Positive Outcomes: Integrative Psychotherapy for World Trade Center Responders.

    Science.gov (United States)

    Haugen, Peter Tejas; Werth, Aditi Sinha; Foster, Alyce Lauren; Owen, Jesse

    2016-12-01

    World Trade Center responders demonstrate high symptom burden, underscoring the importance of refining treatment approaches for this cohort. One method is examining the impact of therapy techniques on outcomes, and the interactions between technique and alliance on outcomes. This study a) examined the interaction of early treatment techniques on integrative psychotherapy outcomes and b) explored whether associations differed at varying levels of alliance. Twenty-nine adult responders diagnosed with partial or full posttraumatic stress disorder received outpatient psychotherapy and completed weekly measures of alliance, technique, and symptom distress. Analyses indicated significant interactions between 1) alliance and psychodynamic interventions on outcomes and 2) alliance and cognitive behavioral (CB) interventions on outcomes. Clients with high alliance had better outcomes when their therapist used fewer CB techniques. No meaningful differences were found between technique and outcomes for clients with lower alliance. These findings reiterate the critical roles technique and responsiveness to the alliance play in engendering successful outcomes.

  11. EPA scientific integrity policy draft

    Science.gov (United States)

    Showstack, Randy

    2011-08-01

    The U.S. Environmental Protection Agency (EPA) issued its draft scientific integrity policy on 5 August. The draft policy addresses scientific ethical standards, communications with the public, the use of advisory committees and peer review, and professional development. The draft policy was developed by an ad hoc group of EPA senior staff and scientists in response to a December 2010 memorandum on scientific integrity from the White House Office of Science and Technology Policy. The agency is accepting public comments on the draft through 6 September; comments should be sent to osa.staff@epa.gov. For more information, see http://www.epa.gov/stpc/pdfs/draft-scientific-integrity-policy-aug2011.pdf.

  12. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  13. ONC201 kills solid tumor cells by triggering an integrated stress response dependent on ATF4 activation by specific eIF2α kinases.

    Science.gov (United States)

    Kline, C Leah B; Van den Heuvel, A Pieter J; Allen, Joshua E; Prabhu, Varun V; Dicker, David T; El-Deiry, Wafik S

    2016-02-16

    ONC201 (also called TIC10) is a small molecule that inactivates the cell proliferation- and cell survival-promoting kinases Akt and ERK and induces cell death through the proapoptotic protein TRAIL. ONC201 is currently in early-phase clinical testing for various malignancies. We found through gene expression and protein analyses that ONC201 triggered an increase in TRAIL abundance and cell death through an integrated stress response (ISR) involving the transcription factor ATF4, the transactivator CHOP, and the TRAIL receptor DR5. ATF4 was not activated in ONC201-resistant cancer cells, and in ONC201-sensitive cells, knockdown of ATF4 or CHOP partially abrogated ONC201-induced cytotoxicity and diminished the ONC201-stimulated increase in DR5 abundance. The activation of ATF4 in response to ONC201 required the kinases HRI and PKR, which phosphorylate and activate the translation initiation factor eIF2α. ONC201 rapidly triggered cell cycle arrest, which was associated with decreased abundance of cyclin D1, decreased activity of the kinase complex mTORC1, and dephosphorylation of the retinoblastoma (Rb) protein. The abundance of X-linked inhibitor of apoptosis protein (XIAP) negatively correlated with the extent of apoptosis in response to ONC201. These effects of ONC201 were independent of whether cancer cells had normal or mutant p53. Thus, ONC201 induces cell death through the coordinated induction of TRAIL by an ISR pathway. Copyright © 2016, American Association for the Advancement of Science.

  14. Transformation of chlorpyrifos in integrated recirculating constructed wetlands (IRCWs) as revealed by compound-specific stable isotope (CSIA) and microbial community structure analysis.

    Science.gov (United States)

    Tang, Xiaoyan; Yang, Yang; Huang, Wenda; McBride, Murray B; Guo, Jingjing; Tao, Ran; Dai, Yunv

    2017-06-01

    Carbon isotope analysis and 454 pyrosequencing methods were used to investigate in situ biodegradation of chlorpyrifos during its transport through three model integrated recirculating constructed wetlands (IRCWs). Results show that plant and Fe-impregnated biochar promoted degradation of chlorpyrifos and its metabolite 3,5,6-trichloro-2-pyridinol (TCP). Carbon isotope ratios in the IRCWs shifted to -31.24±0.58‰ (IRCW1, plant free), -26.82±0.60‰ (IRCW2, with plant) and -24.76±0.94‰ (IRCW3, with plant and Fe-biochar). The enrichment factors (Ɛ bulk,c ) were determined as -0.69±0.06‰ (IRCW1), -0.91±0.07‰ (IRCW2) and -1.03±0.09‰ (IRCW3). Microbial community analysis showed that IRCW3 was dominated by members of Bacillus, which can utilize and degrade chlorpyrifos. These results reveal that plant and Fe-biochar can induce carbon isotope fractionation and have a positive impact on the chlorpyrifos degradation efficiency by influencing the development of beneficial microbial communities. Copyright © 2017. Published by Elsevier Ltd.

  15. Comment on the Adler-Bardeen theorem and related problems

    International Nuclear Information System (INIS)

    Fujikawa, Kazuo

    1987-06-01

    Some aspects of the constructive proof of the Adler-Bardeen theorem in the sense of exact bare identities are discussed by using the higher derivative regularization. It is argued that the formal path integral derivation of chiral and scale (counting identity) anomalies is compatible with the construction of those regularized Green's functions. We also comment on the T*-product in the Lagrangian formalism and discuss how the complications associated with the (anomalous) symmetry charges in the operator approach are avoided in a suitably defined path integral formalism. (author)

  16. Recommendations and comments on the report of the Ontario Nuclear Safety Review

    International Nuclear Information System (INIS)

    1988-12-01

    The report of the Ontario Nuclear Safety Review (ONSR) prepared by Dr. F. Kenneth Hare in March 1988, is reviewed by the Advisory Committee on Nuclear Safety (ACNS) to assess for the Atomic Energy Control Board the relevance and importance of the ONSR recommendations and comments. The ACNS conclusions from this study are embodied in nineteen recommendations, as well as several suggestions and some specific comments

  17. Reply to 'Comment on 'Secure direct communication with a quantum one-time-pad''

    International Nuclear Information System (INIS)

    Deng Fuguo; Long Guilu

    2005-01-01

    We reply to the preceding comment which focused on whether there exists a quantum privacy amplification technique for purifying the unknown single-photon states transmitted. In this Reply, we will show that quantum privacy amplification is principally possible, and a specific scheme for direct communication protocol based on single photons has been constructed and will be published elsewhere. Then the secure direct quantum communication is secure against the attack strategy in the preceding comment by using quantum privacy amplification directly

  18. Comments on EPA's LLW preproposal

    International Nuclear Information System (INIS)

    Littleton, B.K.; Weinstock, L.

    1995-01-01

    The Environmental Protection Agency (EPA) is currently developing standards for the management, storage, and disposal of Low-Level Radioactive Waste (LLW). The Atomic Energy Act delegated EPA, among other provisions, the authority to establish generally applicable standards for the disposal of radioactive waste to ensure that the public and the environment are adequately protected from potential radiation impacts. As an initial effort to open communications on a standard for LLW, the Agency developed a preproposal draft (Preproposal Draft of 40 CFR Part 193 - 30 Nov 94) and circulated it to interested parties for review and comment. The extended comment period ended April 12, 1995. A summary of the comments received and analyzed to date follows. After all comments have been analyzed, the rule will undergo an Agency clearance process and be sent to the Office of Management and Budget for review. After that review, the formal process of publication of the proposed rule in the Federal Register and the formal public comment period will begin

  19. Environmental challenges and opportunities of the evolving North American electricity market : Government comments on Environmental Challenges and Opportunities of the evolving North American electricity market: Secretariat report to Council under article 13 of the North American Agreement on Environmental Cooperation : Canada, Mexico, United States

    International Nuclear Information System (INIS)

    2002-06-01

    Canada, Mexico, and the United States commented in turn on the issues related to the integration of the North American electricity market. Canada indicated that the report was based on on specific sets of data, analyses, and several assumptions. It provides a starting point for further discussions as information and analyses are further improved. Four categories of issues were identified: transboundary airshed management, innovative economic instruments, energy efficiency and renewable energy, and information planning and transboundary cumulative impact assessment. Some of those areas are already the subject of improved cooperation. Mexico mentioned that the major problem was one of pollution in geographically shared but jurisdictionally divided regions. This situation could lead to preferences in the selection of locations for power generation plants, as environmental rules differ. The suggestions made in the report do not always reflect the approaches being discussed in Mexico. Some specific comments about the various working papers were offered. The United States stated that the report provides a solid foundation for further discussions on the topic. The United States also indicated that further qualification, analysis, and/or discussion is required on some important issues. It felt that the future growth, continental-scale integration, and environmental impacts related to the electricity sector had been overestimated. More comprehensive comparisons between the three countries would benefit the entire process. More specific comments were included

  20. An Integrated “Multi-Omics” Comparison of Embryo and Endosperm Tissue-Specific Features and Their Impact on Rice Seed Quality

    Directory of Open Access Journals (Sweden)

    Marc Galland

    2017-11-01

    Full Text Available Although rice is a key crop species, few studies have addressed both rice seed physiological and nutritional quality, especially at the tissue level. In this study, an exhaustive “multi-omics” dataset on the mature rice seed was obtained by combining transcriptomics, label-free shotgun proteomics and metabolomics from embryo and endosperm, independently. These high-throughput analyses provide a new insight on the tissue-specificity related to rice seed quality. Foremost, we pinpointed that extensive post-transcriptional regulations occur at the end of rice seed development such that the embryo proteome becomes much more diversified than the endosperm proteome. Secondly, we observed that survival in the dry state in each seed compartment depends on contrasted metabolic and enzymatic apparatus in the embryo and the endosperm, respectively. Thirdly, it was remarkable to identify two different sets of starch biosynthesis enzymes as well as seed storage proteins (glutelins in both embryo and endosperm consistently with the supernumerary embryo hypothesis origin of the endosperm. The presence of a putative new glutelin with a possible embryonic favored abundance is described here for the first time. Finally, we quantified the rate of mRNA translation into proteins. Consistently, the embryonic panel of protein translation initiation factors is much more diverse than that of the endosperm. This work emphasizes the value of tissue-specificity-centered “multi-omics” study in the seed to highlight new features even from well-characterized pathways. It paves the way for future studies of critical genetic determinants of rice seed physiological and nutritional quality.

  1. Integration of genome-scale metabolic networks into whole-body PBPK models shows phenotype-specific cases of drug-induced metabolic perturbation.

    Science.gov (United States)

    Cordes, Henrik; Thiel, Christoph; Baier, Vanessa; Blank, Lars M; Kuepfer, Lars

    2018-01-01

    Drug-induced perturbations of the endogenous metabolic network are a potential root cause of cellular toxicity. A mechanistic understanding of such unwanted side effects during drug therapy is therefore vital for patient safety. The comprehensive assessment of such drug-induced injuries requires the simultaneous consideration of both drug exposure at the whole-body and resulting biochemical responses at the cellular level. We here present a computational multi-scale workflow that combines whole-body physiologically based pharmacokinetic (PBPK) models and organ-specific genome-scale metabolic network (GSMN) models through shared reactions of the xenobiotic metabolism. The applicability of the proposed workflow is illustrated for isoniazid, a first-line antibacterial agent against Mycobacterium tuberculosis , which is known to cause idiosyncratic drug-induced liver injuries (DILI). We combined GSMN models of a human liver with N-acetyl transferase 2 (NAT2)-phenotype-specific PBPK models of isoniazid. The combined PBPK-GSMN models quantitatively describe isoniazid pharmacokinetics, as well as intracellular responses, and changes in the exometabolome in a human liver following isoniazid administration. Notably, intracellular and extracellular responses identified with the PBPK-GSMN models are in line with experimental and clinical findings. Moreover, the drug-induced metabolic perturbations are distributed and attenuated in the metabolic network in a phenotype-dependent manner. Our simulation results show that a simultaneous consideration of both drug pharmacokinetics at the whole-body and metabolism at the cellular level is mandatory to explain drug-induced injuries at the patient level. The proposed workflow extends our mechanistic understanding of the biochemistry underlying adverse events and may be used to prevent drug-induced injuries in the future.

  2. Metabolic reconstruction of Setaria italica: a systems biology approach for integrating tissue-specific omics and pathway analysis of bioenergy grasses

    Directory of Open Access Journals (Sweden)

    Cristiana Gomes De Oliveira Dal'molin

    2016-08-01

    Full Text Available The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica, as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S.italica. mRNA, protein and metabolite abundances, were measured in mature and immature stem/leaf phytomers and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME. Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study

  3. Metabolic Reconstruction of Setaria italica: A Systems Biology Approach for Integrating Tissue-Specific Omics and Pathway Analysis of Bioenergy Grasses.

    Science.gov (United States)

    de Oliveira Dal'Molin, Cristiana G; Orellana, Camila; Gebbie, Leigh; Steen, Jennifer; Hodson, Mark P; Chrysanthopoulos, Panagiotis; Plan, Manuel R; McQualter, Richard; Palfreyman, Robin W; Nielsen, Lars K

    2016-01-01

    The urgent need for major gains in industrial crops productivity and in biofuel production from bioenergy grasses have reinforced attention on understanding C4 photosynthesis. Systems biology studies of C4 model plants may reveal important features of C4 metabolism. Here we chose foxtail millet (Setaria italica), as a C4 model plant and developed protocols to perform systems biology studies. As part of the systems approach, we have developed and used a genome-scale metabolic reconstruction in combination with the use of multi-omics technologies to gain more insights into the metabolism of S. italica. mRNA, protein, and metabolite abundances, were measured in mature and immature stem/leaf phytomers, and the multi-omics data were integrated into the metabolic reconstruction framework to capture key metabolic features in different developmental stages of the plant. RNA-Seq reads were mapped to the S. italica resulting for 83% coverage of the protein coding genes of S. italica. Besides revealing similarities and differences in central metabolism of mature and immature tissues, transcriptome analysis indicates significant gene expression of two malic enzyme isoforms (NADP- ME and NAD-ME). Although much greater expression levels of NADP-ME genes are observed and confirmed by the correspondent protein abundances in the samples, the expression of multiple genes combined to the significant abundance of metabolites that participates in C4 metabolism of NAD-ME and NADP-ME subtypes suggest that S. italica may use mixed decarboxylation modes of C4 photosynthetic pathways under different plant developmental stages. The overall analysis also indicates different levels of regulation in mature and immature tissues in carbon fixation, glycolysis, TCA cycle, amino acids, fatty acids, lignin, and cellulose syntheses. Altogether, the multi-omics analysis reveals different biological entities and their interrelation and regulation over plant development. With this study, we demonstrated

  4. Working hard to make a simple definition of synergies. Comment on: "Hand synergies: Integration of robotics and neuroscience for understanding the control of biological and artificial hands" by Marco Santello et al.

    Science.gov (United States)

    Alessandro, Cristiano; Oliveira Barroso, Filipe; Tresch, Matthew

    2016-07-01

    The paper ;Hand synergies: Integration of robotics and neuroscience for understanding the control of biological and artificial hands; [1] presents a comprehensive review of the work carried out as part of the EU funded project ;The Hand Embodied;. The work uses the concept of ;synergy; to study the neuromuscular control of the human hand and to design novel robotics systems. The project has been very productive and has made important contributions. We are therefore confident that it will lead to further advancements and experiments in the future.

  5. Design and characterization of a laterally mounted phased-array transducer breast-specific MRgHIFU device with integrated 11-channel receiver array.

    Science.gov (United States)

    Payne, A; Merrill, R; Minalga, E; Vyas, U; de Bever, J; Todd, N; Hadley, R; Dumont, E; Neumayer, L; Christensen, D; Roemer, R; Parker, D

    2012-03-01

    This work presents the design and preliminary evaluation of a new laterally mounted phased-array MRI-guided high-intensity focused ultrasound (MRgHIFU) system with an integrated 11-channel phased-array radio frequency (RF) coil intended for breast cancer treatment. The design goals for the system included the ability to treat the majority of tumor locations, to increase the MR image's signal-to-noise ratio (SNR) throughout the treatment volume and to provide adequate comfort for the patient. In order to treat the majority of the breast volume, the device was designed such that the treated breast is suspended in a 17-cm diameter treatment cylinder. A laterally shooting 1-MHz, 256-element phased-array ultrasound transducer with flexible positioning is mounted outside the treatment cylinder. This configuration achieves a reduced water volume to minimize RF coil loading effects, to position the coils closer to the breast for increased signal sensitivity, and to reduce the MR image noise associated with using water as the coupling fluid. This design uses an 11-channel phased-array RF coil that is placed on the outer surface of the cylinder surrounding the breast. Mechanical positioning of the transducer and electronic steering of the focal spot enable placement of the ultrasound focus at arbitrary locations throughout the suspended breast. The treatment platform allows the patient to lie prone in a face-down position. The system was tested for comfort with 18 normal volunteers and SNR capabilities in one normal volunteer and for heating accuracy and stability in homogeneous phantom and inhomogeneous ex vivo porcine tissue. There was a 61% increase in mean relative SNR achieved in a homogeneous phantom using the 11-channel RF coil when compared to using only a single-loop coil around the chest wall. The repeatability of the system's energy delivery in a single location was excellent, with less than 3% variability between repeated temperature measurements at the same

  6. Integrated site-specific quantification of faecal bacteria and detection of DNA markers in faecal contamination source tracking as a microbial risk tracking tool in urban Lake ecosystems

    Science.gov (United States)

    Donde, Oscar Omondi; Tian, Cuicui; Xiao, Bangding

    2017-11-01

    The presence of feacal-derived pathogens in water is responsible for several infectious diseases and deaths worldwide. As a solution, sources of fecal pollution in waters must be accurately assessed, properly determined and strictly controlled. However, the exercise has remained challenging due to the existing overlapping characteristics by different members of faecal coliform bacteria and the inadequacy of information pertaining to the contribution of seasonality and weather condition on tracking the possible sources of pollution. There are continued efforts to improve the Faecal Contamination Source Tracking (FCST) techniques such as Microbial Source Tracking (MST). This study aimed to make contribution to MST by evaluating the efficacy of combining site specific quantification of faecal contamination indicator bacteria and detection of DNA markers while accounting for seasonality and weather conditions' effects in tracking the major sources of faecal contamination in a freshwater system (Donghu Lake, China). The results showed that the use of cyd gene in addition to lacZ and uidA genes differentiates E. coli from other closely related faecal bacteria. The use of selective media increases the pollution source tracking accuracy. BSA addition boosts PCR detection and increases FCST efficiency. Seasonality and weather variability also influence the detection limit for DNA markers.

  7. Recommendations for resolution of public comments on USI [Unresolved Safety Issues] A-40, ''Seismic Design Criteria''

    International Nuclear Information System (INIS)

    Philippacopoulos, A.J.

    1989-06-01

    In June 1988 the Nuclear Regulatory Commission (NRC) issued for public comment the proposed Revision 2 of the Standard Review Plan (SRP) Sections 2.5.2, 3.7.1, 3.7.2. and 3.7.3. Comments were received from six organizations. Brookhaven National Laboratory (BNL) was requested by NRC to provide expert consultation in the seismic and soil-structure interaction areas for the review and resolution of these comments. For this purpose, a panel of consultants was established to assist BNL with the review and evaluation of the public comments. This review was carried out during the period of October 1988 through January 1989. Many of the suggestions given in the public comments were found to be significant and a number of modifications to appropriate SRP sections are recommended. Other public comments were found to have no impact on the proposed Revision 2 of the SRP. Major changes are recommended to the SRP sections dealing with (a) Power Spectral Density (PSD) and ground motion requirements and (b) soil-structure interaction requirements. This report contains specific recommendations to NRC for resolution of the public comments made on the proposed Revision 2 of the SRP

  8. Qualitative content analysis of online news media coverage of weight loss surgery and related reader comments.

    Science.gov (United States)

    Glenn, N M; Champion, C C; Spence, J C

    2012-10-01

    The media has the ability to affect public opinion and policy direction. Prevalence of morbid obesity in Canada is increasing; as is the only effective long-term treatment, weight loss surgery (WLS). Limited research has explored media re/presentations of WLS. The purpose of this study was to examine national online news coverage (and reader comments) of WLS using content analysis. We sought to understand the dominant messages being conveyed within the news texts and reader comments, specifically whose voice was represented, who was the intended audience and what was the overall tone. Articles and comments were retrieved from the Canadian Broadcasting Corporation news web site and analysed using line-by-line techniques. Articles were predominantly 'positive/supportive' (63%) in tone and frequently presented the voices and opinions of 'experts' conveying a biomedical perspective. Comments were overwhelmingly 'negative' (56%) and often derogatory including such language as 'piggy' and 'fatty'. Comments were almost exclusively anonymous (99%) and were frequently directed at other commenters (33%) and 'fat' people (6%). The potentially problematic nature of media framing and reader comments, particularly as they could relate to weight-based stigmatization and discrimination is discussed. © 2012 The Authors. Clinical Obesity © 2012 International Association for the Study of Obesity.

  9. Asymptotic expansion of the Keesom integral

    International Nuclear Information System (INIS)

    Abbott, Paul C

    2007-01-01

    The asymptotic evaluation and expansion of the Keesom integral, K(a), is discussed at some length in Battezzati and Magnasco (2004 J. Phys. A: Math. Gen. 37 9677; 2005 J. Phys. A: Math. Gen. 38 6715). Here, using standard identities, it is shown that this triple integral can be reduced to a single integral from which the asymptotic behaviour is readily obtained using Laplace's method. (comment)

  10. Coastal Modelling Environment version 1.0: a framework for integrating landform-specific component models in order to simulate decadal to centennial morphological changes on complex coasts

    Directory of Open Access Journals (Sweden)

    A. Payo

    2017-07-01

    Full Text Available The ability to model morphological changes on complex, multi-landform coasts over decadal to centennial timescales is essential for sustainable coastal management worldwide. One approach involves coupling of landform-specific simulation models (e.g. cliffs, beaches, dunes and estuaries that have been independently developed. An alternative, novel approach explored in this paper is to capture the essential characteristics of the landform-specific models using a common spatial representation within an appropriate software framework. This avoid the problems that result from the model-coupling approach due to between-model differences in the conceptualizations of geometries, volumes and locations of sediment. In the proposed framework, the Coastal Modelling Environment (CoastalME, change in coastal morphology is represented by means of dynamically linked raster and geometrical objects. A grid of raster cells provides the data structure for representing quasi-3-D spatial heterogeneity and sediment conservation. Other geometrical objects (lines, areas and volumes that are consistent with, and derived from, the raster structure represent a library of coastal elements (e.g. shoreline, beach profiles and estuary volumes as required by different landform-specific models. As a proof-of-concept, we illustrate the capabilities of an initial version of CoastalME by integrating a cliff–beach model and two wave propagation approaches. We verify that CoastalME can reproduce behaviours of the component landform-specific models. Additionally, the integration of these component models within the CoastalME framework reveals behaviours that emerge from the interaction of landforms, which have not previously been captured, such as the influence of the regional bathymetry on the local alongshore sediment-transport gradient and the effect on coastal change on an undefended coastal segment and on sediment bypassing of coastal structures.

  11. A systematic evaluation of integration free reprogramming methods for deriving clinically relevant patient specific induced pluripotent stem (iPS cells.

    Directory of Open Access Journals (Sweden)

    Pollyanna A Goh

    Full Text Available A systematic evaluation of three different methods for generating induced pluripotent stem (iPS cells was performed using the same set of parental cells in our quest to develop a feeder independent and xeno-free method for somatic cell reprogramming that could be transferred into a GMP environment. When using the BJ fibroblast cell line, the highest reprogramming efficiency (1.89% of starting cells was observed with the mRNA based method which was almost 20 fold higher than that observed with the retrovirus (0.2% and episomal plasmid (0.10% methods. Standard characterisation tests did not reveal any differences in an array of pluripotency markers between the iPS lines derived using the various methods. However, when the same methods were used to reprogram three different primary fibroblasts lines, two derived from patients with rapid onset parkinsonism dystonia and one from an elderly healthy volunteer, we consistently observed higher reprogramming efficiencies with the episomal plasmid method, which was 4 fold higher when compared to the retroviral method and over 50 fold higher than the mRNA method. Additionally, with the plasmid reprogramming protocol, recombinant vitronectin and synthemax® could be used together with commercially available, fully defined, xeno-free essential 8 medium without significantly impacting the reprogramming efficiency. To demonstrate the robustness of this protocol, we reprogrammed a further 2 primary patient cell lines, one with retinosa pigmentosa and the other with Parkinsons disease. We believe that we have optimised a simple and reproducible method which could be used as a starting point for developing GMP protocols, a prerequisite for generating clinically relevant patient specific iPS cells.

  12. Ten alien chromosome additions of Gossypium hirsutum-Gossypium bickii developed by integrative uses of GISH and species-specific SSR markers.

    Science.gov (United States)

    Tang, Dong; Feng, Shouli; Li, Sai; Chen, Yu; Zhou, Baoliang

    2018-03-27

    Gossypium bickii: (2n = 26, G 1 G 1 ), a wild diploid cotton, carries many favourable traits. However, these favourable traits cannot be directly transferred into G. hirsutum (2n = 52, AADD) cultivars due to the differences in genomes. Monosomic alien addition lines (MAALs) are considered an invaluable tool for the introgression of genes of interest from wild relatives into cultivated crops. In this study, the G. hirsutum-G. bickii amphidiploid (2n = 78, AADDG 1 G 1 ) was backcrossed with G. hirsutum to develop alien additions containing individual G. bickii chromosomes in a G. hirsutum background. Genomic in situ hybridization was employed to detect the number of alien chromosomes added to the backcross progenies. A total of 183 G. bickii-specific DNA markers were developed to discriminate the identities of the G. bickii chromosomes added to G. hirsutum and assess the alien chromosome transmissibility. Chromosomes 4G b and 13G b showed the highest transmissibility, while chromosomes 1G b , 7G b and 11G b showed the lowest. Ten of the 13 possible G. hirsutum-G. bickii MAALs were isolated and characterized, which will lay the foundation for transferring resistance genes of G. bickii into G. hirsutum, as well as for gene assignment, physical mapping, and selective isolation and mapping of cDNAs for particular G. bickii chromosomes. The strategies of how to use MAALs to develop varieties with the trait of interest from wild species (such as glanded plant-glandless seed) were proposed and discussed.

  13. Comments on numerical simulations

    International Nuclear Information System (INIS)

    Sato, T.

    1984-01-01

    The author comments on a couple of things about numerical simulation. One is just about the philosophical discussion that is, spontaneous or driven. The other thing is the numerical or technical one. Frankly, the author didn't want to touch on the technical matter because this should be a common sense one for those who are working at numerical simulation. But since many people take numerical simulation results at their face value, he would like to remind you of the reality hidden behind them. First, he would point out that the meaning of ''driven'' in driven reconnection is different from that defined by Schindler or Akasofu. The author's definition is closer to Axford's definition. In the spontaneous case, for some unpredicted reason an excess energy of the system is suddenly released at a certain point. However, one does not answer how such an unstable state far beyond a stable limit is realized in the magnetotail. In the driven case, there is a definite energy buildup phase starting from a stable state; namely, energy in the black box increases from a stable level subject to an external source. When the state has reached a certain position, the energy is released suddenly. The difference between driven and spontaneous is whether the cause (plasma flow) to trigger reconnection is specified or reconnection is triggered unpredictably. Another difference is that in driven reconnection the reconnection rate is dependent on the speed of the external plasma flow, but in spontaneous reconnection the rate is dependent on the internal condition such as the resistivity

  14. Medicare program; revisions to payment policies under the physician fee schedule, clinical laboratory fee schedule & other revisions to Part B for CY 2014. Final rule with comment period.

    Science.gov (United States)

    2013-12-10

    This major final rule with comment period addresses changes to the physician fee schedule, clinical laboratory fee schedule, and other Medicare Part B payment policies to ensure that our payment systems are updated to reflect changes in medical practice and the relative value of services. This final rule with comment period also includes a discussion in the Supplementary Information regarding various programs. (See the Table of Contents for a listing of the specific issues addressed in the final rule with comment period.)

  15. 76 FR 50188 - Notice of Proposed Methodology for the Delaware River and Bay Integrated List Water Quality...

    Science.gov (United States)

    2011-08-12

    ... Integrated List Water Quality Assessment AGENCY: Delaware River Basin Commission. ACTION: Notice. SUMMARY... Integrated List Water Quality Assessment is available for review and comment. DATES: Comments must be... should have the phrase ``Water Quality Assessment 2012'' in the subject line and should include the name...

  16. 77 FR 189 - Federal Acquisition Regulation; Brand-Name Specifications

    Science.gov (United States)

    2012-01-03

    ... 2006-0020, Sequence 26] RIN 9000-AK55 Federal Acquisition Regulation; Brand-Name Specifications... Management and Budget memoranda on brand-name specifications. DATES: Effective Date: February 2, 2012. FOR... brand- name specifications. Eight respondents submitted 32 comments in response to the interim rule. The...

  17. State of Nevada comments on the US Department of Energy consultation draft site characterization plan, Yucca Mountain site, Nevada research and development area, Nevada

    International Nuclear Information System (INIS)

    1988-09-01

    The comments presented here represent a review effort by the Nevada Agency for Nuclear Projects and its Technical Support Contractors and advisors. Part I presents an overview of the comments contained in the document. The overview takes the form of general concerns and comments organized by specific areas of concern. The overview does not follow the format of the CD-SCP. Part II contains specific comments of the Nevada Agency for Nuclear Projects. These comments respond to specifics of the CD-SCP and do so in relation to the organizational format employed in the CD-SCP. Because of the way it is organized, the CD-SCP encouraged a certain degree of redundancy in our response. Part III of this document contains verbatim comments received from the Agency's Technical Contractors and advisors. These comments address issues and contain information not contained in Parts I and II. As such, these comments should be viewed as important in their own right -- not as appendices to the State's comment document

  18. Systems integration.

    Science.gov (United States)

    Siemieniuch, C E; Sinclair, M A

    2006-01-01

    The paper presents a view of systems integration, from an ergonomics/human factors perspective, emphasising the process of systems integration as is carried out by humans. The first section discusses some of the fundamental issues in systems integration, such as the significance of systems boundaries, systems lifecycle and systems entropy, issues arising from complexity, the implications of systems immortality, and so on. The next section outlines various generic processes for executing systems integration, to act as guides for practitioners. These address both the design of the system to be integrated and the preparation of the wider system in which the integration will occur. Then the next section outlines some of the human-specific issues that would need to be addressed in such processes; for example, indeterminacy and incompleteness, the prediction of human reliability, workload issues, extended situation awareness, and knowledge lifecycle management. For all of these, suggestions and further readings are proposed. Finally, the conclusions section reiterates in condensed form the major issues arising from the above.

  19. Integrated safety assessment report: Integrated Safety Assessment Program: Millstone Nuclear Power Station, Unit 1 (Docket No. 50-245): Draft report

    International Nuclear Information System (INIS)

    1987-04-01

    The Integrated Safety Assessment Program (ISAP) was initiated in November 1984, by the US Nuclear Regulatory Commission to conduct integrated assessments for operating nuclear power reactors. The integrated assessment is conducted in a plant-specific basis to evaluate all licensing actions, licensee initiated plant improvements and selected unresolved generic/safety issues to establish implementation schedules for each item. In addition, procedures will be established to allow for a periodic updating of the schedules to account for licensing issues that arise in the future. This report documents the review of Millstone Nuclear Power Station, Unit No. 1, operated by Northeast Nuclear Energy Company (located in Waterford, Connecticut). Millstone Nuclear Power Station, Unit No. 1, is one of two plants being reviewed under the pilot program for ISAP. This report indicates how 85 topics selected for review were addressed. This report presents the staff's recommendations regarding the corrective actions to resolve the 85 topics and other actions to enhance plant safety. The report is being issued in draft form to obtain comments from the licensee, nuclear safety experts, and the Advisory Committee for Reactor Safeguards (ACRS). Once those comments have been resolved, the staff will present its positions, along with a long-term implementation schedule from the licensee, in the final version of this report

  20. Human emotion in the brain and the body: Why language matters. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    Science.gov (United States)

    Herbert, Cornelia

    2015-06-01

    What is an Emotion? This question has fascinated scientific research since William James. Despite the fact that a consensus has been reached about the biological origin of emotions, uniquely human aspects of emotions are still poorly understood. One of these blind spots concerns the relationship between emotion and human language. Historically, many theories imply a duality between emotions on the one hand and cognitive functions such as language on the other hand. Especially for symbolic forms of written language and word processing, it has been assumed that semantic information would bear no relation to bodily, affective, or sensorimotor processing (for an overview see Ref. [1]). The Quartet Theory proposed by Koelsch and colleagues [2] could provide a solution to this problem. It offers a novel, integrative neurofunctional model of human emotions which considers language and emotion as closely related. Crucially, language - be it spoken or written - is assumed to "regulate, modulate, and partly initiate" activity in core affective brain systems in accord with physical needs and individual concerns [cf. page 34, line 995]. In this regard, the Quartet Theory combines assumptions from earlier bioinformational theories of emotions [3], contemporary theories of embodied cognition [4], and appraisal theories such as the Component Process Model [5] into one framework, thereby providing a holistic model for the neuroscientific investigation of human emotion processing at the interface of emotion and cognition, mind and body.

  1. A closer look at the FTEM framework. Response to "More of the same? Comment on 'An integrated framework for the optimisation of sport and athlete development: a practitioner approach'".

    Science.gov (United States)

    Gulbin, Jason P; Croser, Morag J; Morley, Elissa J; Weissensteiner, Juanita R

    2014-01-01

    The Foundations, Talent, Elite and Mastery (FTEM) framework was designed through the lens of a world leading high-performance sport agency to assist sporting stakeholders operationalise and research their whole of sport development pathways (Gulbin, J. P., Croser, M. J., Morley, E. J., & Weissensteiner, J. R. (2013). An integrated framework for the optimisation of sport and athlete development: A practitioner approach. Journal of Sport Sciences, 31, 1319-1331). In response to the commentary by MacNamara and Collins (2013) (Journal of Sports Sciences, doi:10.1080/02640414.2013. 855805), it was possible to document many inaccurate, false and misleading statements based on inattentive reading of the original article. We reinforce that: FTEM is a holistic framework of sport and athlete development and not a surrogate for a talent identification ( TID) model; bio-psycho-social components of development are liberally embedded throughout the FTEM framework; and the combined research and applied insights of development practitioners provide strong ecological validity for the consideration of stakeholders looking to explore applied approaches to athlete pathway management.

  2. Learning in robotic manipulation: The role of dimensionality reduction in policy search methods. Comment on "Hand synergies: Integration of robotics and neuroscience for understanding the control of biological and artificial hands" by Marco Santello et al.

    Science.gov (United States)

    Ficuciello, Fanny; Siciliano, Bruno

    2016-07-01

    A question that often arises, among researchers working on artificial hands and robotic manipulation, concerns the real meaning of synergies. Namely, are they a realistic representation of the central nervous system control of manipulation activities at different levels and of the sensory-motor manipulation apparatus of the human being, or do they constitute just a theoretical framework exploiting analytical methods to simplify the representation of grasping and manipulation activities? Apparently, this is not a simple question to answer and, in this regard, many minds from the field of neuroscience and robotics are addressing the issue [1]. The interest of robotics is definitely oriented towards the adoption of synergies to tackle the control problem of devices with high number of degrees of freedom (DoFs) which are required to achieve motor and learning skills comparable to those of humans. The synergy concept is useful for innovative underactuated design of anthropomorphic hands [2], while the resulting dimensionality reduction simplifies the control of biomedical devices such as myoelectric hand prostheses [3]. Synergies might also be useful in conjunction with the learning process [4]. This aspect is less explored since few works on synergy-based learning have been realized in robotics. In learning new tasks through trial-and-error, physical interaction is important. On the other hand, advanced mechanical designs such as tendon-driven actuation, underactuated compliant mechanisms and hyper-redundant/continuum robots might exhibit enhanced capabilities of adapting to changing environments and learning from exploration. In particular, high DoFs and compliance increase the complexity of modelling and control of these devices. An analytical approach to manipulation planning requires a precise model of the object, an accurate description of the task, and an evaluation of the object affordance, which all make the process rather time consuming. The integration of

  3. 76 FR 329 - Proposed Information Collection; Comment Request; Reporting Requirements for the Ocean Salmon...

    Science.gov (United States)

    2011-01-04

    ... Collection; Comment Request; Reporting Requirements for the Ocean Salmon Fishery Off the Coasts of Washington..., designated regulatory areas in the commercial ocean salmon fishery off the coasts of Washington, Oregon, and... requirements to land salmon within specific time frames and in specific areas may be implemented in the...

  4. 76 FR 22116 - Agency Information Collection Activities: Submission for OMB Review; Comment Request, OMB No...

    Science.gov (United States)

    2011-04-20

    ...-specific issues. Results are also shared with other Federal agencies that lend expertise in specific areas... DEPARTMENT OF HOMELAND SECURITY Federal Emergency Management Agency [Docket ID: FEMA-2010-0070.... Comments should be addressed to the Desk Officer for the Department of Homeland Security, Federal Emergency...

  5. 78 FR 24392 - Agency Information Collection Activities; Comment Request; Evaluation and Accountability Report...

    Science.gov (United States)

    2013-04-25

    ... integrating technology into curricula and instruction and improving student achievement. The purpose of this... positive impacts for student learning, and can be widely replicated by other State educational agencies and... respondents, including through the use of information technology. Please note that written comments received...

  6. 76 FR 68791 - Notice of Availability for Public Comment on the Interagency Ocean Observing Committee Draft...

    Science.gov (United States)

    2011-11-07

    .... This criteria was developed in response to a requirement in the Integrated Coastal Ocean Observation....us . For the public unable to access the internet, printed copies can be requested by contacting the.... Comments may be submitted in writing to the Consortium for Ocean Leadership, Attention: IOOC Support Office...

  7. Attitudes towards chiropractic: an analysis of written comments from a survey of north american orthopaedic surgeons

    Directory of Open Access Journals (Sweden)

    Busse Jason W

    2011-10-01

    Full Text Available Abstract Background There is increasing interest by chiropractors in North America regarding integration into mainstream healthcare; however, there is limited information about attitudes towards the profession among conventional healthcare providers, including orthopaedic surgeons. Methods We administered a 43-item cross-sectional survey to 1000 Canadian and American orthopaedic surgeons that inquired about demographic variables and their attitudes towards chiropractic. Our survey included an option for respondants to include written comments, and our present analysis is restricted to these comments. Two reviewers, independantly and in duplicate, coded all written comments using thematic analysis. Results 487 surgeons completed the survey (response rate 49%, and 174 provided written comments. Our analysis revealed 8 themes and 24 sub-themes represented in surgeons' comments. Reported themes were: variability amongst chiropractors (n = 55; concerns with chiropractic treatment (n = 54; areas where chiropractic is perceived as effective (n = 43; unethical behavior (n = 43; patient interaction (n = 36; the scientific basis of chiropractic (n = 26; personal experiences with chiropractic (n = 21; and chiropractic training (n = 18. Common sub-themes endorsed by surgeon's were diversity within the chiropractic profession as a barrier to increased interprofessional collaboration, endorsement for chiropractic treatment of musculoskeletal complaints, criticism for treatment of non-musculoskeletal complaints, and concern over whether chiropractic care was evidence-based. Conclusions Our analysis identified a number of issues that will have to be considered by the chiropractic profession as part of its efforts to further integrate chiropractic into mainstream healthcare.

  8. Integrated Toys

    DEFF Research Database (Denmark)

    Petersson, Eva

    2005-01-01

    the theoretical foundations of play and learning. In this presentation, we explore pedagogical potentials of new technologies and traditional toys integrated into a physical and virtual toy (hereinafter called integrated toy) with specific focus on the open-ended toy and non-formal learning. The integrated toy......Toys play a crucial role in supporting children’s learning and creation of meaning in their everyday life. Children also play with toys out of an interest to interact with others e.g. peers and adults. Tendencies of digital technology in toys have led to greater opportunities for manipulation...... and interaction supporting children’s play and learning such that technology is ever-present in the play environments of children. Although electronics have been deployed in tools for play and learning, most of it has facilitated individual learning. Computer games, for instance, most often are designed...

  9. Immigrants in Slovenia: Integration Aspects

    Directory of Open Access Journals (Sweden)

    Janja Žitnik

    2004-09-01

    Full Text Available On the basis of the latest statistics, the author estimates the present share of first- and second-generation immigrants in Slovenia’s population. After examining the quantity and intensity of those public efforts in Slovenia that have been focused on unresolved problems of the immigrants’ social and cultural integration, she continues to question the equality of immigrant minorities in Slovenia, and the sufficiency of the existing programs aimed at facilitating their integration with Slovenian society at large. She explains her doubts about the general assumption that a very clear distinction should be made between the rights of the autochthonous minorities and those of the immigrant ones as far as their special protection is concerned. In the third section of this article, the author discusses the social-ethnic stratification of Slovenian society and tries to look into the psychological background of the nationality/ethnicity statistics. She presents some aspects of the immigrants’ daily experience in Slovenian social, cultural, educational and working milieu, and points to the authorities’ attitude toward them. She comments on the burning issue of the “deleted residents”, and illustrates it with the experience of one of the persons involved. The fourth section, in which the most regular symptoms of Slovenian xenophobia are presented, consists of first-hand observations and focuses on the daily human attitude of the national majority towards the immigrant minorities. Finally the author compares the nature of the specific needs of Slovenians as a “European national minority” with the needs of the immigrant minorities in Slovenia.

  10. 77 FR 24509 - Notice of Proposed Information Collection for Public Comment Emergency Comment Request; Single...

    Science.gov (United States)

    2012-04-24

    ... Information Collection for Public Comment Emergency Comment Request; Single Family Customer Satisfaction... information: Title of Proposal: Single Family Customer Satisfaction Survey. Description of Information... and changes in performance. In addition to the importance HUD management places on the information...

  11. 14 CFR 11.89 - How much time do I have to submit comments to FAA on a petition for exemption?

    Science.gov (United States)

    2010-01-01

    ... to FAA on a petition for exemption? 11.89 Section 11.89 Aeronautics and Space FEDERAL AVIATION... Petitions for Rulemaking and for Exemption § 11.89 How much time do I have to submit comments to FAA on a petition for exemption? The FAA states the specific time allowed for comments in the Federal Register...

  12. NCPA No. 2: IX comments and responses to Draft JES

    International Nuclear Information System (INIS)

    1980-01-01

    Comments received from twenty-six separate entities are included. Following each letter or set of comments are staff responses. Sections of the draft environmental statement which have been revised in response to these comments are noted

  13. 76 FR 51126 - Proposed Collection; Comment Request for Notice; Notice

    Science.gov (United States)

    2011-08-17

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service Proposed Collection; Comment Request for Notice; Notice AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... in electing investment partnership (EIP). DATES: Written comments should be received on or before...

  14. 75 FR 66165 - Information Collection Activities: Proposed Collection; Comment Request

    Science.gov (United States)

    2010-10-27

    ... additional information should be collected to further the aims of government transparency. DATES: Comments... OFFICE OF MANAGEMENT AND BUDGET Information Collection Activities: Proposed Collection; Comment... are warranted. We are particularly interested in comments on whether the information collected in the...

  15. An array of virtual Frisch-grid CdZnTe detectors and a front-end application-specific integrated circuit for large-area position-sensitive gamma-ray cameras

    Energy Technology Data Exchange (ETDEWEB)

    Bolotnikov, A. E., E-mail: bolotnik@bnl.gov; Ackley, K.; Camarda, G. S.; Cherches, C.; Cui, Y.; De Geronimo, G.; Fried, J.; Hossain, A.; Mahler, G.; Maritato, M.; Roy, U.; Salwen, C.; Vernon, E.; Yang, G.; James, R. B. [Brookhaven National Laboratory, Upton, New York 11793 (United States); Hodges, D. [University of Texas at El Paso, El Paso, Texas 79968 (United States); Lee, W. [Korea University, Seoul 136-855 (Korea, Republic of); Petryk, M. [SUNY Binghamton, Vestal, New York 13902 (United States)

    2015-07-15

    We developed a robust and low-cost array of virtual Frisch-grid CdZnTe detectors coupled to a front-end readout application-specific integrated circuit (ASIC) for spectroscopy and imaging of gamma rays. The array operates as a self-reliant detector module. It is comprised of 36 close-packed 6 × 6 × 15 mm{sup 3} detectors grouped into 3 × 3 sub-arrays of 2 × 2 detectors with the common cathodes. The front-end analog ASIC accommodates up to 36 anode and 9 cathode inputs. Several detector modules can be integrated into a single- or multi-layer unit operating as a Compton or a coded-aperture camera. We present the results from testing two fully assembled modules and readout electronics. The further enhancement of the arrays’ performance and reduction of their cost are possible by using position-sensitive virtual Frisch-grid detectors, which allow for accurate corrections of the response of material non-uniformities caused by crystal defects.

  16. Integrating self-determined needs into the relationship among product design, willingness-to-pay a premium, and word-of-mouth: a cross-cultural gender-specific study.

    Science.gov (United States)

    Gilal, Faheem Gul; Zhang, Jian; Gilal, Naeem Gul; Gilal, Rukhsana Gul

    2018-01-01

    The present study integrates self-determined needs satisfaction into a relationship between product design (eg, aesthetic, functional, and symbolic design) and consumer behavior (eg, willingness-to-pay [WTP] a premium and negative word-of-mouth [WOM]) and to explore whether gender can differentiate the effects of aesthetic, functional, and symbolic product designs on self-determined needs satisfaction. To this end, participants from Pakistan and China were recruited, and the hypotheses for this study were tested using structural equation modeling and SPSS-PROCESS. The effects of three product designs on self-determined needs satisfaction were significantly positive across samples. The results further show that self-determined needs satisfaction had the strongest positive effect on WTP a premium and the strongest negative effect on vindictive WOM for Pakistanis. Self-determined needs frustration had the strongest negative effect on the WTP a premium for Chinese participants and an equivalent magnitude effect on vindictive WOM for Pakistani and Chinese participants. The cross-cultural gender-specific findings revealed that Pakistani men are more aesthetic and hedonic than women in Pakistan. Surprisingly, Chinese women resemble Pakistani men in the sense that they prefer aesthetically pleasing products. Chinese men resemble Pakistani women in terms of little interest in symbolic products, whereas Chinese women and Pakistani men respond similarly regarding their decisions to choose symbolic products. To the best of the authors' knowledge, the present study is one of the initial attempts to integrate self-determined needs into the relationship between product design and consumer WTP a premium and WOM, and further explore cross-cultural gender-specific differences across Pakistan and China. The findings of the present study may help international marketers in terms of segmenting, targeting, and positioning their markets.

  17. Integral or integrated marketing

    Directory of Open Access Journals (Sweden)

    Davčik Nebojša

    2006-01-01

    Full Text Available Marketing theorists and experts try to develop business efficient organization and to get marketing performance at higher, business integrated level since its earliest beginnings. The core issue in this paperwork is the dialectic and practical approach dilemma should we develop integrated or integral marketing approach in the organization. The presented company cases as well as dialectic and functional explanations of this dilemma clearly shows that integrated marketing is narrower approach than integral marketing if we take as focal point new, unique and completed entity. In the integration the essence is in getting different parts together, which do not have to make necessary the new entity. The key elements in the definition of the integral marketing are necessity and holistic, e.g. necessity to develop new, holistic entity.

  18. Foundations for Psychotherapy Integration

    Directory of Open Access Journals (Sweden)

    António Branco Vasco

    2014-10-01

    Full Text Available The movement for integration in psychotheray is clearly one of the main trends that can be observed in the field. The author stresses three main reasons for this state of affairs and as a way of justifying the importance of integration: historical and psychosocial, empirical and philosophical. A specific way of thinking in integrative terms is also outlined - "paradigmatic complementarity."

  19. ACHP | News | ACHP Issues Program Comment to Streamline Communication

    Science.gov (United States)

    Program Comment to Streamline Communication Facilities Construction and Modification ACHP Issues Program Comment to Streamline Communication Facilities Construction and Modification The Advisory Council on

  20. Comments on chelation therapy

    International Nuclear Information System (INIS)

    Wrenn, M.E.

    1981-01-01

    The primary purpose of actinide chelation is to decrease the risk from radiation-induced cancer. While occupational exposures in the past have mainly involved low specific activity 239 Pu, future exposures will increasingly involve high specific activity plutonium, americium, and curium - all of which clear more rapidly from the lung. This will tend to shift the cancer risk from lung to bone and liver. Although therapy with Ca- or Zn-DTPA rapidly removes 241 Am from the canine, the sub-human primate, and the human liver, improved methods for removal from bone and lung are needed. DTPA can remove 241 Am more easily from the growing skeleton of a child than from the mature skeleton of an adult. Investigators at Karlsruhe are developing chelation agents for oral administration and are investigating the reduction in local dose to bone resulting from chelation therapy

  1. Public comments and responses to the 1993 Hanford cleanup five-year plan

    International Nuclear Information System (INIS)

    1993-08-01

    In March 1993, the US Department of Energy, Richland Operations Office (DOE-RL) published its annual Site-Specific Five-Year Plan. The Site-Specific Plan is published to inform the public about the background, status, and plans for Environmental Restoration (ER) and Waste Management (WM) activities at the Hanford site. It is the only document that seeks to bring all ER and WM elements together in one document. The Site-Specific Plan is a companion document to the National Five-Year Plan that deals with all the sites within the DOE complex on a summary level. This Response to Comments document does not try to address every question or concern raised during the public comment period. Some questions were outside the scope of the Five-Year Plan, some we could not decipher, others were variations of the same question. The initial round of public meetings was held in Portland, Oregon, and Seattle, Pasco, and Olympia, Washington. At the request of the Oregon Department of Energy (ODOE) and the Washington State Department of Ecology (Ecology), a second round of meetings was held in Portland and Olympia. Both agencies felt that the first two meetings were held with too little advance notice, and before the Plan could be distributed. Once the public meetings were over and the comment period closed, we then compiled the public comments, largely from audio tapes of the meetings. Individual functions within Hanford were asked to consider and respond to the comments

  2. [Comments on "A practical dictionary of Chinese medicine" by Wiseman].

    Science.gov (United States)

    Lan, Feng-li

    2006-02-01

    At least 24 Chinese-English dictionaries of Chinese Medicine have been published in China during the recent 24 years (1984-2003). This thesis comments on "A Practical Dictionary of Chinese Medicine" by Wiseman, agreeing on its establishing principles, sources and formation methods of the English system of Chinese medical terminology, and pointing out the defect. The author holds that study on the origin and development of TCM terms, standardization of Chinese medical terms in different layers, i.e. Chinese medical in classic, in commonly used modern TCM terms, and integrative medical texts, are prerequisites to the standardization of English translation of Chinese medical terms.

  3. Medicare Program; Hospital Inpatient Prospective Payment Systems for Acute Care Hospitals and the Long-Term Care Hospital Prospective Payment System and Policy Changes and Fiscal Year 2017 Rates; Quality Reporting Requirements for Specific Providers; Graduate Medical Education; Hospital Notification Procedures Applicable to Beneficiaries Receiving Observation Services; Technical Changes Relating to Costs to Organizations and Medicare Cost Reports; Finalization of Interim Final Rules With Comment Period on LTCH PPS Payments for Severe Wounds, Modifications of Limitations on Redesignation by the Medicare Geographic Classification Review Board, and Extensions of Payments to MDHs and Low-Volume Hospitals. Final rule.

    Science.gov (United States)

    2016-08-22

    We are revising the Medicare hospital inpatient prospective payment systems (IPPS) for operating and capital-related costs of acute care hospitals to implement changes arising from our continuing experience with these systems for FY 2017. Some of these changes will implement certain statutory provisions contained in the Pathway for Sustainable Growth Reform Act of 2013, the Improving Medicare Post-Acute Care Transformation Act of 2014, the Notice of Observation Treatment and Implications for Care Eligibility Act of 2015, and other legislation. We also are providing the estimated market basket update to apply to the rate-of-increase limits for certain hospitals excluded from the IPPS that are paid on a reasonable cost basis subject to these limits for FY 2017. We are updating the payment policies and the annual payment rates for the Medicare prospective payment system (PPS) for inpatient hospital services provided by long-term care hospitals (LTCHs) for FY 2017. In addition, we are making changes relating to direct graduate medical education (GME) and indirect medical education payments; establishing new requirements or revising existing requirements for quality reporting by specific Medicare providers (acute care hospitals, PPS-exempt cancer hospitals, LTCHs, and inpatient psychiatric facilities), including related provisions for eligible hospitals and critical access hospitals (CAHs) participating in the Electronic Health Record Incentive Program; updating policies relating to the Hospital Value-Based Purchasing Program, the Hospital Readmissions Reduction Program, and the Hospital-Acquired Condition Reduction Program; implementing statutory provisions that require hospitals and CAHs to furnish notification to Medicare beneficiaries, including Medicare Advantage enrollees, when the beneficiaries receive outpatient observation services for more than 24 hours; announcing the implementation of the Frontier Community Health Integration Project Demonstration; and

  4. Feynman's path integrals and Bohm's particle paths

    International Nuclear Information System (INIS)

    Tumulka, Roderich

    2005-01-01

    Both Bohmian mechanics, a version of quantum mechanics with trajectories, and Feynman's path integral formalism have something to do with particle paths in space and time. The question thus arises how the two ideas relate to each other. In short, the answer is, path integrals provide a re-formulation of Schroedinger's equation, which is half of the defining equations of Bohmian mechanics. I try to give a clear and concise description of the various aspects of the situation. (letters and comments)

  5. Integrative Treatment of Personality Disorder. Part I: Psychotherapy.

    Science.gov (United States)

    Jovanovic, Mirjana Divac; Svrakic, Dragan

    2017-03-01

    In this paper, we outline the concept of integrative therapy of borderline personality, also referred to as fragmented personality, which we consider to be the core psychopathology underlying all clinical subtypes of personality disorder. Hence, the terms borderline personality, borderline disorder, fragmented personality, and personality disorder are used interchangeably, as synonyms. Our integrative approach combines pharmacotherapy and psychotherapy, each specifically tailored to accomplish a positive feedback modulation of their respective effects. We argue that pharmacotherapy and psychotherapy of personality disorder complement each other. Pharmacological control of disruptive affects clears the stage, in some cases builds the stage, for the psychotherapeutic process to take place. In turn, psychotherapy promotes integration of personality fragments into more cohesive structures of self and identity, ultimately establishing self-regulation of mood and anxiety. We introduce our original method of psychotherapy, called reconstructive interpersonal therapy (RIT). The RIT integrates humanistic-existential and psychodynamic paradigms, and is thereby designed to accomplish a deep reconstruction of core psychopathology within the setting of high structure. We review and comment the current literature on the strategies, goals, therapy process, priorities, and phases of psychotherapy of borderline disorders, and describe in detail the fundamental principles of RIT.

  6. Integral-preserving integrators

    International Nuclear Information System (INIS)

    McLaren, D I; Quispel, G R W

    2004-01-01

    Ordinary differential equations having a first integral may be solved numerically using one of several methods, with the integral preserved to machine accuracy. One such method is the discrete gradient method. It is shown here that the order of the method can be bootstrapped repeatedly to higher orders of accuracy. The method is illustrated using the Henon-Heiles system. (letter to the editor)

  7. 75 FR 67666 - Use of Various Winemaking Terms on Wine Labels and in Advertisements; Request for Public Comment

    Science.gov (United States)

    2010-11-03

    ...The Alcohol and Tobacco Tax and Trade Bureau is considering amending the regulations concerning various winemaking terms commonly used on labels and in advertisements to provide consumers with information about the growing or bottling conditions of wine. We invite comments from industry members, consumers, and other interested parties as to whether and to what extent we should propose specific regulatory amendments for further public comment.

  8. Medicaid program; premiums and cost sharing. Final rule; delay of effective date and reopening of comment period.

    Science.gov (United States)

    2009-03-27

    This action temporarily delays the effective date of the November 25, 2008 final rule entitled, Medicaid Program; Premiums and Cost Sharing" (73 FR 71828) until December 31, 2009. In addition, this action reopens the comment period on the policies set out in the November 25, 2008 final rule, and specifically solicits comments on the effect of certain provisions of the American Recovery and Reinvestment Act of 2009.

  9. Comments on fake supersymmetry

    International Nuclear Information System (INIS)

    Diaz Dorronsoro, Juan; Truijen, Brecht; Van Riet, Thomas

    2017-01-01

    Flat domain walls and spherical black holes are solutions to coupled second-order ODE’s of the Hamiltonian form. Hamilton–Jacobi theory then implies that first-order flow equations always exist (possibly up to isolated submanifolds). If the first-order equations factorise in a specific way, they take a form that has been named fake supersymmetry. We point out that this factorisation is always possible at zero temperature. We therefore propose a less generic definition of fake supersymmetry, which involves the boundary conditions in a non-trivial way, and we analyse its physical relevance. For instance, attractor flows are necessarily fake supersymmetric in our restricted sense. To illustrate the definition we provide new analytic solutions for axion-dilaton domain walls with fake superpotentials that were argued not to exist. (paper)

  10. Integrating self-determined needs into the relationship among product design, willingness-to-pay a premium, and word-of-mouth: a cross-cultural gender-specific study

    Directory of Open Access Journals (Sweden)

    Gilal FG

    2018-06-01

    Full Text Available Faheem Gul Gilal,1 Jian Zhang,1 Naeem Gul Gilal,2 Rukhsana Gul Gilal3 1Donlinks School of Economics and Management, University of Science and Technology Beijing, Beijing, People’s Republic of China; 2School of Management, Huazhong University of Science and Technology, Wuhan, Hubei, People’s Republic of China; 3Department of Business Administration, Sukkur IBA University, Sindh, Pakistan Background: The present study integrates self-determined needs satisfaction into a relationship between product design (eg, aesthetic, functional, and symbolic design and consumer behavior (eg, willingness-to-pay [WTP] a premium and negative word-of-mouth [WOM] and to explore whether gender can differentiate the effects of aesthetic, functional, and symbolic product designs on self-determined needs satisfaction. Methods: To this end, participants from Pakistan and China were recruited, and the hypotheses for this study were tested using structural equation modeling and SPSS-PROCESS. Results: The effects of three product designs on self-determined needs satisfaction were significantly positive across samples. The results further show that self-determined needs satisfaction had the strongest positive effect on WTP a premium and the strongest negative effect on vindictive WOM for Pakistanis. Self-determined needs frustration had the strongest negative effect on the WTP a premium for Chinese participants and an equivalent magnitude effect on vindictive WOM for Pakistani and Chinese participants. The cross-cultural gender-specific findings revealed that Pakistani men are more aesthetic and hedonic than women in Pakistan. Surprisingly, Chinese women resemble Pakistani men in the sense that they prefer aesthetically pleasing products. Chinese men resemble Pakistani women in terms of little interest in symbolic products, whereas Chinese women and Pakistani men respond similarly regarding their decisions to choose symbolic products. Conclusion: To the best of the

  11. 77 FR 31898 - Proposed Collection; Comment Request

    Science.gov (United States)

    2012-05-30

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish... Charles Mierzwa, Railroad Retirement Board, 844 North Rush Street, Chicago, Illinois 60611-2092 or emailed to Charles[email protected] . Written comments should be received within 60 days of this notice...

  12. 75 FR 21685 - Proposed Collection; Comment Request

    Science.gov (United States)

    2010-04-26

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish...-mail request to Charles[email protected] . Comments regarding the information collection should be... days of this notice. Charles Mierzwa, Clearance Officer. [FR Doc. 2010-9531 Filed 4-23-10; 8:45 am...

  13. 75 FR 36451 - Proposed Collection; Comment Request

    Science.gov (United States)

    2010-06-25

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish... send an e-mail request to Charles[email protected] . Comments regarding the information collection... within 60 days of this notice. Charles Mierzwa, Clearance Officer. [FR Doc. 2010-15449 Filed 6-24-10; 8...

  14. 78 FR 6152 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-01-29

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will [email protected] . Comments regarding the information collection should be addressed to Charles Mierzwa, Railroad Retirement Board, 844 North Rush Street, Chicago, Illinois 60611-2092 or emailed to Charles...

  15. 78 FR 76336 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-12-17

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish... be addressed to Charles Mierzwa, Railroad Retirement Board, 844 North Rush Street, Chicago, Illinois 60611-2092 or emailed to Charles[email protected] . Written comments should be received within 60 days of...

  16. 76 FR 72010 - Proposed Collection; Comment Request

    Science.gov (United States)

    2011-11-21

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish..., and/or supporting material, contact Charles Mierzwa, the RRB Clearance Officer, at (312) 751-3363 or Charles[email protected] . Comments regarding the information collection should be addressed to Patricia...

  17. 78 FR 13914 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-03-01

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish... collection should be addressed to Charles Mierzwa, Railroad Retirement Board, 844 North Rush Street, Chicago, Illinois 60611-2092 or emailed to Charles[email protected] . Written comments should be received within 60...

  18. 76 FR 15351 - Proposed Collection; Comment Request

    Science.gov (United States)

    2011-03-21

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish.../Password. Completion is voluntary, however, the RRB will be unable to provide a PRC or allow a requestor to... Charles[email protected] . Comments regarding the information collection should be sent to Patricia A...

  19. 77 FR 53936 - Proposed Collection; Comment Request

    Science.gov (United States)

    2012-09-04

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish... addressed to Charles Mierzwa, Railroad Retirement Board, 844 North Rush Street, Chicago, Illinois 60611-2092 or emailed to Charles.[email protected] . Written comments should be received within 60 days of this...

  20. 78 FR 38412 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-06-26

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will [email protected] . Comments regarding the information collection should be addressed to Charles Mierzwa, Railroad Retirement Board, 844 North Rush Street, Chicago, Illinois 60611-2092 or emailed to Charles...

  1. 75 FR 21370 - Proposed Collection; Comment Request

    Science.gov (United States)

    2010-04-23

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish... Charles[email protected] . Comments regarding the information collection should be addressed to Patricia A.... Charles Mierzwa, Clearance Officer. [FR Doc. 2010-9435 Filed 4-22-10; 8:45 am] BILLING CODE 7905-01-P ...

  2. 75 FR 41557 - Proposed Collection; Comment Request

    Science.gov (United States)

    2010-07-16

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish...) 751-3363 or send an e-mail request to Charles[email protected] . Comments regarding the information... received within 60 days of this notice. Charles Mierzwa, RRB Clearance Officer. [FR Doc. 2010-17368 Filed 7...

  3. 76 FR 62098 - Proposed Collection; Comment Request

    Science.gov (United States)

    2011-10-06

    ... public comment on new or revised data collections, the Railroad Retirement Board (RRB) will publish periodic summaries of proposed data collections. Comments are invited on: (a) Whether the proposed... that the information provided is correct and the applicant's agreement to sign the form by proxy. The...

  4. 78 FR 64293 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-10-28

    ... Investment Companies. OMB Number: 1545-1010. Form Number: 1120-RIC. Abstract: Internal Revenue Code sections... DEPARTMENT OF THE TREASURY Internal Revenue Service [Form 1120-RIC] Proposed Collection; Comment Request AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments. SUMMARY...

  5. 77 FR 71176 - Proposed Collection; Comment Request

    Science.gov (United States)

    2012-11-29

    ...; Comment Request AGENCY: TRICARE Management Activity, Office of Administration, Personnel Security Division... techniques or other forms of information technology. DATES: Consideration will be given to all comments... available for public viewing on the Internet at http://www.regulations.gov as they are received without...

  6. 75 FR 57506 - Summary of Comments

    Science.gov (United States)

    2010-09-21

    ... on the environmental impact of the good or service produced or the production process used. Several... comment noted environmental impacts in this category, i.e., using fresh versus packaged food, reduces... activities in this category. One comment recommended moving nuclear energy to category 1, renewable energy...

  7. 77 FR 13175 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-03-05

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also available at...

  8. 77 FR 65248 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-10-25

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... consideration. ADDRESSES: Direct all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments...

  9. 77 FR 43430 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-07-24

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... consideration. ADDRESSES: Direct all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments...

  10. 77 FR 19057 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-03-29

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also available at www...

  11. 78 FR 34161 - Proposed Collection: Comment Request

    Science.gov (United States)

    2013-06-06

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the...: Direct all written comments to Bureau of the Fiscal Service, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also...

  12. 77 FR 19058 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-03-29

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the...: Direct all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also...

  13. 77 FR 32178 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-05-31

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also available at www...

  14. 76 FR 61479 - Proposed Collection: Comment Request

    Science.gov (United States)

    2011-10-04

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also available at...

  15. 77 FR 74053 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-12-12

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... consideration. ADDRESSES: Direct all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments...

  16. 77 FR 69547 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-11-19

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the.... ADDRESSES: Direct all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also...

  17. 77 FR 19754 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-04-02

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also...

  18. 78 FR 25535 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-05-01

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also available at...

  19. 77 FR 5090 - Proposed Collection: Comment Request

    Science.gov (United States)

    2012-02-01

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A)). Currently the... all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also...

  20. 78 FR 149 - Proposed Collection: Comment Request

    Science.gov (United States)

    2013-01-02

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the... consideration. ADDRESSES: Direct all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments...

  1. 78 FR 25533 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-05-01

    ... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the.... ADDRESSES: Direct all written comments to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or bruce.sharp@bpd.treas.gov . The opportunity to make comments online is also...

  2. 78 FR 41035 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-07-09

    ...; Comment Request AGENCY: Defense Finance and Accounting Service, DoD. ACTION: Notice. SUMMARY: In compliance with Section 3506(c)(2)(A) of the Paperwork Reduction Act of 1995, the Defense Finance and Accounting Service (DFAS) announces a proposed public information collection and seeks public comment on the...

  3. 78 FR 43864 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-07-22

    ...; Comment Request AGENCY: Defense Finance and Accounting Service, DoD. ACTION: Notice. SUMMARY: In compliance with Section 3506(c)(2)(A) of the Paperwork Reduction Act of 1995, the Defense Finance and Accounting Service announces a proposed public information collection and seeks public comment on the...

  4. 77 FR 18794 - Proposed Collection; Comment Request

    Science.gov (United States)

    2012-03-28

    ... to the Bureau's authorities under the Dodd-Frank Wall Street Reform and Consumer Protection Act (Dodd... BUREAU OF CONSUMER FINANCIAL PROTECTION [Docket No. CFPB-2012-0011] Proposed Collection; Comment Request AGENCY: Bureau of Consumer Financial Protection. ACTION: Notice and request for public comment...

  5. 36 CFR 801.4 - Council comments.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Council comments. 801.4 Section 801.4 Parks, Forests, and Public Property ADVISORY COUNCIL ON HISTORIC PRESERVATION HISTORIC PRESERVATION REQUIREMENTS OF THE URBAN DEVELOPMENT ACTION GRANT PROGRAM § 801.4 Council comments. The following...

  6. 77 FR 8841 - Proposed Collection; Comment Request

    Science.gov (United States)

    2012-02-15

    ... Force Academy announces a proposed public information collection and seeks public comment on the...://www.regulations.gov . Follow the instructions for submitting comments. Mail: Federal Docket Management... Air Force Academy. Each student's background and aptitude is reviewed to determine eligibility. If the...

  7. Data specifications for INSPIRE

    Science.gov (United States)

    Portele, Clemens; Woolf, Andrew; Cox, Simon

    2010-05-01

    In Europe a major recent development has been the entering in force of the INSPIRE Directive in May 2007, establishing an infrastructure for spatial information in Europe to support Community environmental policies, and policies or activities which may have an impact on the environment. INSPIRE is based on the infrastructures for spatial information established and operated by the 27 Member States of the European Union. The Directive addresses 34 spatial data themes needed for environmental applications, with key components specified through technical implementing rules. This makes INSPIRE a unique example of a legislative "regional" approach. One of the requirements of the INSPIRE Directive is to make existing spatial data sets with relevance for one of the spatial data themes available in an interoperable way, i.e. where the spatial data from different sources in Europe can be combined to a coherent result. Since INSPIRE covers a wide range of spatial data themes, the first step has been the development of a modelling framework that provides a common foundation for all themes. This framework is largely based on the ISO 19100 series of standards. The use of common generic spatial modelling concepts across all themes is an important enabler for interoperability. As a second step, data specifications for the first set of themes has been developed based on the modelling framework. The themes include addresses, transport networks, protected sites, hydrography, administrative areas and others. The data specifications were developed by selected experts nominated by stakeholders from all over Europe. For each theme a working group was established in early 2008 working on their specific theme and collaborating with the other working groups on cross-theme issues. After a public review of the draft specifications starting in December 2008, an open testing process and thorough comment resolution process, the draft technical implementing rules for these themes have been

  8. Sentiment topic mining based on comment tags

    Science.gov (United States)

    Zhang, Daohai; Liu, Xue; Li, Juan; Fan, Mingyue

    2018-03-01

    With the development of e-commerce, various comments based on tags are generated, how to extract valuable information from these comment tags has become an important content of business management decisions. This study takes HUAWEI mobile phone tags as an example using the sentiment analysis and topic LDA mining method. The first step is data preprocessing and classification of comment tag topic mining. And then make the sentiment classification for comment tags. Finally, mine the comments again and analyze the emotional theme distribution under different sentiment classification. The results show that HUAWEI mobile phone has a good user experience in terms of fluency, cost performance, appearance, etc. Meanwhile, it should pay more attention to independent research and development, product design and development. In addition, battery and speed performance should be enhanced.

  9. Integrated data management for RODOS

    International Nuclear Information System (INIS)

    Abramowicz, K.; Koschel, A.; Rafat, M.; Wendelgass, R.

    1995-12-01

    The report presents the results of a feasibility study on an integrated data organisation and management in RODOS, the real-time on-line decision support system for off-site nuclear emergency management. The conceptual design of the functional components of the integrated data management are described taking account of the software components and the operation environment of the RODOS system. In particular, the scheme architecture of a database integration manager for accessing and updating a multi-database system is discussed in detail under a variety of database management aspects. Furthermore, the structural design of both a simple knowledge database and a real-time database are described. Finally, some short comments on the benefits and disadvantages of the proposed concept of data integration in RODOS are given. (orig.) [de

  10. 12 CFR 516.130 - Where are comments filed?

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Where are comments filed? 516.130 Section 516.130 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY APPLICATION PROCESSING PROCEDURES Comment Procedures § 516.130 Where are comments filed? A commenter must file with the appropriate...

  11. Comments from physicsworld.com

    Science.gov (United States)

    2009-02-01

    US President Barack Obama's decision to include several scientists in his cabinet-including two physicists, John Holdren and Steven Chu, who will serve as science advisor and energy secretary, respectively - is discussed in this month's news section (see pp8-9). Two articles posted on physicsworld.com when the announcements were first made ("Nobel laureate goes to Washington?" 11 December 2008 and "Obama nominates physicist as science advisor" 22 December 2008) sparked a number of comments, both sceptical and supportive, from readers.

  12. Integrated Design

    DEFF Research Database (Denmark)

    Jørgensen, Michael; Nielsen, M. W.; Strømann-Andersen, Jakob Bjørn

    2011-01-01

    and describe the decision process. Specific attention is given to how the engineering input was presented and how it was able to facilitate the design development. Site and context, building shape, organization of functions and HVAC-systems were all included to obtain a complete picture of the building......, low-energy consumption, and high-quality indoor environment. We use this case study to investigate how technical knowledge about building performance can be integrated into the conceptual design stage. We have selected certain points during the design process that represented design challenges...

  13. Comments on the Joint Proposed Rulemaking to Establish Light-Duty Vehicle Greenhouse Gas Emission Standards and Corporate Average Fuel Economy Standards

    Energy Technology Data Exchange (ETDEWEB)

    Wenzel, Tom [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2009-10-27

    Tom Wenzel of Lawrence Berkeley National Laboratory comments on the joint rulemaking to establish greenhouse gas emission and fuel economy standards for light-duty vehicle, specifically on the relationship between vehicle weight and vehicle safety.

  14. Editor's Comment and Announcement.

    Science.gov (United States)

    Bortolussi, Robert

    2017-12-17

    It is hard to believe but Clinical and Investigative Medicine (CIM), the official journal of Canadian Society for Clinical Investigation (CSCI), will soon celebrate its 40th birthday!  Over these past four decades, CIM has been the premier journal for Canadian clinician scientists; publishing over 1,000 articles on breakthroughs and major advances from Canada and around the world.  We are listed on Medline, PubMed and the Library of Science. We have been, and will continue to be, an independent journal. To celebrate this auspicious occasion, we have plans to become an even bigger showpiece for national and international clinical advances. We want to connect more closely with Canadian clinician scientists and trainees and we particularly want to encourage more Canadian publications. Changes will soon be coming to CIM with several new features: Newsletter with announcements and news on activities of interest to clinician scientists and trainees; Focused Reviews on specific areas of research; Reflections on work and life experiences of trainees and senior clinician scientists; Methods Papers describing novel methods anticipated to be useful for others; and  Guidelines or Recommendations on clinical care that are endorsed by a Canadian Medical or Surgical Society. Starting in 2018, we will be publishing on a quarterly basis. This will help to ensure we will focus on important breakthroughs and commentaries. However, we are also planning a special edition in the autumn to commemorate the 40th birthday. Stay tuned! Of course CIM will continue to publish original papers on discoveries in pathophysiology, prevention, management, treatment and outcome of clinical problems confronting clinicians in Canada and around the world.  Please join us as we embark on these changes and a new era for CIM, Robert Bortolussi Clinical and Investigative Medicine (CIM) Editor in Chief.

  15. Specifying Specification.

    Science.gov (United States)

    Paulo, Norbert

    2016-03-01

    This paper tackles the accusation that applied ethics is no serious academic enterprise because it lacks theoretical bracing. It does so in two steps. In the first step I introduce and discuss a highly acclaimed method to guarantee stability in ethical theories: Henry Richardson's specification. The discussion shows how seriously ethicists take the stability of the connection between the foundational parts of their theories and their further development as well as their "application" to particular problems or cases. A detailed scrutiny of specification leads to the second step, where I use insights from legal theory to inform the debate around stability from that point of view. This view reveals some of specification's limitations. I suggest that, once specification is sufficiently specified, it appears astonishingly similar to deduction as used in legal theory. Legal theory also provides valuable insight into the functional range of deduction and its relation to other forms of reasoning. This leads to a richer understanding of stability in normative theories and to a smart division of labor between deduction and other forms of reasoning. The comparison to legal theory thereby provides a framework for how different methods such as specification, deduction, balancing, and analogy relate to one another.

  16. 77 FR 55470 - Agency Information Collection Activities; Proposed Collection; Comment Request; Reporting and...

    Science.gov (United States)

    2012-09-10

    ... Internet. If you submit an electronic comment, EPA recommends that you include your name and other contact... exemptions for essential uses, critical uses, previously-used material, and material that is transformed... and restrictions on production, imports, and trades and specific exemptions from the phaseout for...

  17. 75 FR 65625 - Agency Information Collection Activities; Proposed Collection; Comment Request; Hazardous Waste...

    Science.gov (United States)

    2010-10-26

    ... Activities; Proposed Collection; Comment Request; Hazardous Waste Specific Unit Requirements, and Special Waste Processes and Types, EPA ICR Number 1572.08, OMB Control Number 2050-0050 AGENCY: Environmental..., and Special Waste Processes and Types. ICR numbers: EPA ICR No. 1572.08, OMB Control No. 2050-0050...

  18. 78 FR 75947 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Welding...

    Science.gov (United States)

    2013-12-13

    ... for OMB Review; Comment Request; Welding, Cutting, and Brazing Standard ACTION: Notice. SUMMARY: The... information collection request (ICR) titled, ``Welding, Cutting, and Brazing Standard,'' to the Office of... the Welding, Cutting, and Brazing Standard, regulations 29 CFR part 1910, subpart Q. More specifically...

  19. 76 FR 40731 - Agency Information Collection Activities; Proposed Collection; Comment Request

    Science.gov (United States)

    2011-07-11

    ... that your comment doesn't include any sensitive personal information, like anyone's Social Security..., media advertisements, as well as manufacturer specification sheets and product brochures, would contain... assumes advertising or promotions managers prepare the disclosures contained in product brochures and...

  20. 78 FR 52915 - Agency Information Collection Activities; Proposed Collection; Comment Request; Extension

    Science.gov (United States)

    2013-08-27

    ... requires that the disclosures be ``clear and prominent,'' as defined specific to the media used.\\6\\ \\6\\ See... advertising under trade names that resemble the names of legitimate government programs. Given that the... comment does not include any sensitive personal information, like anyone's Social Security number, date of...

  1. 78 FR 33424 - Tobacco Product Analysis; Scientific Workshop; Request for Comments

    Science.gov (United States)

    2013-06-04

    ... different tobacco product types and strengths. 13. The specific method challenges and limitations when... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-N-0212] Tobacco Product Analysis; Scientific Workshop; Request for Comments AGENCY: Food and Drug Administration...

  2. 76 FR 40918 - Proposed Data Collections Submitted for Public Comment and Recommendations

    Science.gov (United States)

    2011-07-12

    ... technology. Written comments should be received within 60 days of this notice. Proposed Project Validation of... United States has increased the demand for Spanish-language occupational safety and health training... into Spanish rather than developing new materials specifically designed for Latino immigrants. Critics...

  3. 77 FR 36330 - Agency Information Collection Activities: Requests for Comments; Clearance of Renewed Approval of...

    Science.gov (United States)

    2012-06-18

    ... a specific investigation. That information is then provided to the FAA decision making authority to... the quality of the collected information. The agency will summarize and/or include your comments in... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Agency Information Collection...

  4. 75 FR 77906 - Agency Information Collection Activities: Proposed Collection; Comments Requested: Drug...

    Science.gov (United States)

    2010-12-14

    ... Collection Activities: Proposed Collection; Comments Requested: Drug Questionnaire DEA Form 341 ACTION: 60...: Extension of a currently approved collection. (2) Title of the Form/Collection: Drug Questionnaire (DEA Form... specific questions about their personal history, if any, of illegal drug use. (5) An estimate of the total...

  5. 77 FR 53887 - Proposed Data Collections Submitted for Public Comment and Recommendations

    Science.gov (United States)

    2012-09-04

    ... techniques or other forms of information technology. Written comments should be received within 60 days of.... Depending on the specific purpose, data collection methods may be conducted either in-person, by telephone, on paper, or online. Data may be collected in quantitative and/or qualitative forms. Each proposed...

  6. 75 FR 38809 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Comment...

    Science.gov (United States)

    2010-07-06

    ... Management (OEM). EPA has established an effectiveness threshold for listing dispersants (40 CFR 300.920(a)(2... information collection and its estimated burden and cost. DATES: Additional comments may be submitted on or... manufacturer conduct specific toxicity and effectiveness tests and submit the corresponding technical product...

  7. 77 FR 18804 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Comment...

    Science.gov (United States)

    2012-03-28

    ... Budget (OMB) for review and approval. This is a request to renew an existing approved collection. The ICR... and without change, unless the comment contains copyrighted material, confidential business... attitudes, beliefs, motivations and feelings regarding specific issues and will provide invaluable...

  8. Joint analyses of open comments and quantitative data: Added value in a job satisfaction survey of hospital professionals.

    Directory of Open Access Journals (Sweden)

    Ingrid Gilles

    Full Text Available To obtain a comprehensive understanding of the job opinions of hospital professionals by conducting qualitative analyses of the open comments included in a job satisfaction survey and combining these results with the quantitative results.A cross-sectional survey targeting all Lausanne University Hospital professionals was performed in the fall of 2013.The survey considered ten job satisfaction dimensions (e.g. self-fulfilment, workload, management, work-related burnout, organisational commitment, intent to stay and included an open comment section. Computer-assisted qualitative analyses were conducted on these comments. Satisfaction rates on the included dimensions and professional groups were entered as predictive variables in the qualitative analyses.Of 10 838 hospital professionals, 4978 participated in the survey and 1067 provided open comments. Data from 1045 respondents with usable comments constituted the analytic sample (133 physicians, 393 nurses, 135 laboratory technicians, 247 administrative staff, including researchers, 67 logistic staff, 44 psycho-social workers, and 26 unspecified.Almost a third of the comments addressed scheduling issues, mostly related to problems and exhaustion linked to shifts, work-life balance, and difficulties with colleagues' absences and the consequences for quality of care and patient safety. The other two-thirds related to classic themes included in job satisfaction surveys. Although some comments were provided equally by all professional groups, others were group specific: work and hierarchy pressures for physicians, healthcare quality and patient safety for nurses, skill recognition for administrative staff. Overall, respondents' comments were consistent with their job satisfaction ratings.Open comment analysis provides a comprehensive understanding of hospital professionals' job experiences, allowing better consideration of quality initiatives that match the needs of professionals with reality.

  9. Joint analyses of open comments and quantitative data: Added value in a job satisfaction survey of hospital professionals.

    Science.gov (United States)

    Gilles, Ingrid; Mayer, Mauro; Courvoisier, Nelly; Peytremann-Bridevaux, Isabelle

    2017-01-01

    To obtain a comprehensive understanding of the job opinions of hospital professionals by conducting qualitative analyses of the open comments included in a job satisfaction survey and combining these results with the quantitative results. A cross-sectional survey targeting all Lausanne University Hospital professionals was performed in the fall of 2013. The survey considered ten job satisfaction dimensions (e.g. self-fulfilment, workload, management, work-related burnout, organisational commitment, intent to stay) and included an open comment section. Computer-assisted qualitative analyses were conducted on these comments. Satisfaction rates on the included dimensions and professional groups were entered as predictive variables in the qualitative analyses. Of 10 838 hospital professionals, 4978 participated in the survey and 1067 provided open comments. Data from 1045 respondents with usable comments constituted the analytic sample (133 physicians, 393 nurses, 135 laboratory technicians, 247 administrative staff, including researchers, 67 logistic staff, 44 psycho-social workers, and 26 unspecified). Almost a third of the comments addressed scheduling issues, mostly related to problems and exhaustion linked to shifts, work-life balance, and difficulties with colleagues' absences and the consequences for quality of care and patient safety. The other two-thirds related to classic themes included in job satisfaction surveys. Although some comments were provided equally by all professional groups, others were group specific: work and hierarchy pressures for physicians, healthcare quality and patient safety for nurses, skill recognition for administrative staff. Overall, respondents' comments were consistent with their job satisfaction ratings. Open comment analysis provides a comprehensive understanding of hospital professionals' job experiences, allowing better consideration of quality initiatives that match the needs of professionals with reality.

  10. Rule-based Information Integration

    NARCIS (Netherlands)

    de Keijzer, Ander; van Keulen, Maurice

    2005-01-01

    In this report, we show the process of information integration. We specifically discuss the language used for integration. We show that integration consists of two phases, the schema mapping phase and the data integration phase. We formally define transformation rules, conversion, evolution and

  11. Integration of generic issues

    International Nuclear Information System (INIS)

    Thatcher, D.

    1989-01-01

    The NRC has recognized the need to integrate generic issues (GIs). The GI process includes a number of phases, all of which should recognize the potential for overlap and conflict among related issues. In addition to the issues themselves, other related NRC and industry programs and activities need to be factored into the GI process. Integration has taken place, or is taking place, for a number of GIs. Each case of integration involves a specific set of circumstances and, as a result, the way in which integration proceeds can vary. This paper discusses the integration of issues in the generic issue process and provides a number of examples

  12. Probe specificity

    International Nuclear Information System (INIS)

    Laget, J.M.

    1986-11-01

    Specificity and complementarity of hadron and electron probes must be systematically developed to answer three questions currently asked in intermediate energy nuclear physics: what is nucleus structure at short distances, what is nature of short range correlations, what is three body force nature [fr

  13. Emotions and feelings as the body's comment to personal relationships:

    DEFF Research Database (Denmark)

    Willert, Søren

    as eflections of phylogenetically evolved, evaluative and apperceptively based action systems helping organisms to structure and relate in adaptive fashion to their species-specific Umwelt. One special feature of humans' emotional life, setting our species apart from all other, is that emotions not only guide...... describing - as the title does - emotions and feelings as the body's (subjectively experienced) comments to personal relationships. A model of human self- or second order consciousness, consistent with the described theoretical framework, will be presented. Implications of the model for the understanding...

  14. 76 FR 21742 - Wireless Telecommunications Bureau Extends Period for Filing Comments and Reply Comments on...

    Science.gov (United States)

    2011-04-18

    ...In this document, the Wireless Telecommunications Bureau extends the deadline for filing comments and reply comments in response to the Public Notice seeking comment on the December 3, 2010 petition for declaratory ruling (Petition) filed by CTIA--The Wireless Association (Petitioners). The Petitioners asked the Federal Communications Commission (Commission) to clarify ``the scope of Section 332(c)(3)(A)'s ban on state and local entry regulation.''

  15. Microwaves integrated circuits: hybrids and monolithics - fabrication technology

    International Nuclear Information System (INIS)

    Cunha Pinto, J.K. da

    1983-01-01

    Several types of microwave integrated circuits are presented together with comments about technologies and fabrication processes; advantages and disadvantages in their utilization are analysed. Basic structures, propagation modes, materials used and major steps in the construction of hybrid thin film and monolithic microwave integrated circuits are described. Important technological applications are revised and main activities of the microelectronics lab. of the University of Sao Paulo (Brazil) in the field of hybrid and monolithic microwave integrated circuits are summarized. (C.L.B.) [pt

  16. Theory and Metatheory in the Study of Dual Processing: Reply to Comments.

    Science.gov (United States)

    Evans, Jonathan St B T; Stanovich, Keith E

    2013-05-01

    In this article, we respond to the four comments on our target article. Some of the commentators suggest that we have formulated our proposals in a way that renders our account of dual-process theory untestable and less interesting than the broad theory that has been critiqued in recent literature. Our response is that there is a confusion of levels. Falsifiable predictions occur not at the level of paradigm or metatheory-where this debate is taking place-but rather in the instantiation of such a broad framework in task level models. Our proposal that many dual-processing characteristics are only correlated features does not weaken the testability of task-level dual-processing accounts. We also respond to arguments that types of processing are not qualitatively distinct and discuss specific evidence disputed by the commentators. Finally, we welcome the constructive comments of one commentator who provides strong arguments for the reality of the dual-process distinction. © The Author(s) 2013.

  17. Loaded Questions: Internet Commenters' Opinions on Physician-Patient Firearm Safety Conversations.

    Science.gov (United States)

    Knoepke, Christopher E; Allen, Amanda; Ranney, Megan L; Wintemute, Garen J; Matlock, Daniel D; Betz, Marian E

    2017-08-01

    Medical and public health societies advocate that healthcare providers (HCPs) counsel at-risk patients to reduce firearm injury risk. Anonymous online media comments often contain extreme viewpoints and may therefore help in understanding challenges of firearm safety counseling. To help inform injury prevention efforts, we sought to examine commenters' stated opinions regarding firearm safety counseling HCPs. Qualitative descriptive analysis of online comments posted following news items (in May-June, 2016) about a peer-reviewed publication addressing when and how HCPs should counsel patients regarding firearms. Among 871 comments posted by 522 individuals, most (57%) were generally negative toward firearm discussions, 17% were positive, and 26% were neutral/unclear. Two major categories and multiple themes emerged. "Areas of agreement" included that discussions may be valuable (1) when addressing risk of harm to self or others, (2) in pediatric injury prevention, and (3) as general safety education (without direct questioning), and that (4) HCPs lack gun safety and cultural knowledge. "Areas of tension" included whether (1) firearms are a public health issue, (2) counseling is effective prevention practice, (3) suicide could/should be prevented, and (4) firearm safety counseling is within HCPs' purview. Among this set of commenters with likely extreme viewpoints, opinions were generally negative toward firearm safety conversations, but with some support in specific situations. Providing education, counseling, or materials without asking about firearm ownership was encouraged. Engaging firearm advocates when developing materials may enhance the acceptability of prevention activities.

  18. Comments received on proposed rule on radiological criteria for decommissioning and related documents

    International Nuclear Information System (INIS)

    Page, G.; Caplin, J.; Smith, D.

    1996-03-01

    The Nuclear Regulatory Commission (NRC) is conducting an enhanced participatory rulemaking to establish radiological criteria for the decommissioning of NRC-licensed facilities. As a part of this action, the Commission published in the Federal Register (59 FR 43200), on August 22, 1994, a proposed rule on radiological criteria for decommissioning, soliciting comments both on the rule as proposed and on certain specific items as identified in its supplementary statement of considerations. A draft Generic Environmental Impact Statement (GEIS) in support of the rule, also published in August 1994 as NUREG-1496, along with its Appendix A (NUREG-1501), were also made available for comment. A staff working draft on regulatory guidance (NUREG-1500)was also made available. This report summarizes the 1,309 comments on the proposed rule and supplementary items and the 311 comments on the GEIS as excerpted from 101 docketed letters received associated in the Federal/Register notice. Comments from two NRC/Agreement-States meetings are also summarized

  19. Retroviral integration: Site matters

    Science.gov (United States)

    Demeulemeester, Jonas; De Rijck, Jan

    2015-01-01

    Here, we review genomic target site selection during retroviral integration as a multistep process in which specific biases are introduced at each level. The first asymmetries are introduced when the virus takes a specific route into the nucleus. Next, by co‐opting distinct host cofactors, the integration machinery is guided to particular chromatin contexts. As the viral integrase captures a local target nucleosome, specific contacts introduce fine‐grained biases in the integration site distribution. In vivo, the established population of proviruses is subject to both positive and negative selection, thereby continuously reshaping the integration site distribution. By affecting stochastic proviral expression as well as the mutagenic potential of the virus, integration site choice may be an inherent part of the evolutionary strategies used by different retroviruses to maximise reproductive success. PMID:26293289

  20. The potential of the Internet for music perception research: A comment on lab-based versus Web-based studies

    NARCIS (Netherlands)

    Honing, H.; Ladinig, O.

    2008-01-01

    While the discussion on the integrity of data obtained from Web-delivered experiments is mainly about issues of method and control (Mehler, 1999; McGraw et al., 2000; Auditory, 2007), this comment stresses the potential that Web-based experiments might have for studies in music perception. It is

  1. Comment on: withdrawal of growth-promoting antibiotics in Europe and its effects in relation to human health

    DEFF Research Database (Denmark)

    Hammerum, Anette Marie; Heuer, Ole Eske; Lester, Camilla H.

    2007-01-01

    In response to a review titled 'Withdrawal of growth-promoting antibiotics in Europe and its effects in relation to human health', published in this Journal by Ian Phillips, we hereby comment on the review. Phillips makes use of data from the Danish Integrated Antimicrobial Resistance Monitoring...

  2. 78 FR 22801 - Request for Comments on Developing a Program To Provide Loan Guarantees to Small- or Medium-Sized...

    Science.gov (United States)

    2013-04-17

    ... manufacturing; manufacture an innovative technology product or an integral component of such a product; or, to... use or production of innovative technologies for manufacturing? Dated: April 10, 2013. Matt Erskine.... SUMMARY: The Economic Development Administration (EDA) seeks public comment on, how to design and...

  3. Does Mind Wandering Reflect Executive Function or Executive Failure? Comment on Smallwood and Schooler (2006) and Watkins (2008)

    Science.gov (United States)

    McVay, Jennifer C.; Kane, Michael J.

    2010-01-01

    In this comment, we contrast different conceptions of mind wandering that were presented in 2 recent theoretical reviews: Smallwood and Schooler (2006) and Watkins (2008). We also introduce a new perspective on the role of executive control in mind wandering by integrating empirical evidence presented in Smallwood and Schooler with 2 theoretical…

  4. IRIS Toxicological Review of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine (RDX) (Public Comment Draft)

    Science.gov (United States)

    EPA is developing an Integrated Risk Information System (IRIS) assessment of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and has released the draft assessment for public comment. When final, the assessment will appear on the IRIS database.

  5. 75 FR 60767 - Office of the Commissioner; Request for Comments on the Food and Drug Administration Fiscal Year...

    Science.gov (United States)

    2010-10-01

    ... Science and Innovation, (2) Strengthen the Safety and Integrity of the Global Supply Chain, (3) Strengthen... comments to the Division of Dockets Management (HFA- 305), Food and Drug Administration, 5630 Fishers Lane... strengthen the strategic management structure currently in place. For comparison purposes, the current FDA...

  6. The Lorentz integral transform and its inversion

    International Nuclear Information System (INIS)

    Barnea, N.; Efros, V.D.; Leidemann, W.; Orlandini, G.

    2010-01-01

    The Lorentz integral transform method is briefly reviewed. The issue of the inversion of the transform, and in particular its ill-posedness, is addressed. It is pointed out that the mathematical term ill-posed is misleading and merely due to a historical misconception. In this connection standard regularization procedures for the solution of the integral transform problem are presented. In particular a recent one is considered in detail and critical comments on it are provided. In addition a general remark concerning the concept of the Lorentz integral transform as a method with a controlled resolution is made. (author)

  7. 78 FR 53195 - Proposed Information Collection (Dental Patient Satisfaction Survey) Activity: Comment Request

    Science.gov (United States)

    2013-08-28

    ... Patient Satisfaction Survey) Activity: Comment Request AGENCY: Veterans Health Administration, Department... notice solicits comments for information needed to measure patient satisfaction with VA's dental services... Patient Satisfaction Survey)'' in any correspondence. During the comment period, comments may be viewed...

  8. 77 FR 54620 - Proposed Collection; Comment Request

    Science.gov (United States)

    2012-09-05

    ... prepared by the company. Written comments are invited on: (a) Whether this proposed collection of information is necessary for the proper performance of the functions of the agency, including whether the...

  9. 76 FR 9814 - Proposed Collection, Comment Request

    Science.gov (United States)

    2011-02-22

    ... 25, 2011. ADDRESSES: Send comments to Nora Kincaid, BLS Clearance Officer, Division of Management... INFORMATION CONTACT: Nora Kincaid, BLS Clearance Officer, at 202-691-7628 (this is not a toll free number...

  10. 78 FR 29383 - Proposed Collection, Comment Request

    Science.gov (United States)

    2013-05-20

    ... comments to Nora Kincaid, BLS Clearance Officer, Division of Management Systems, Bureau of Labor Statistics... by fax to 202-691-5111 (this is not a toll free number). FOR FURTHER INFORMATION CONTACT: Nora...

  11. 76 FR 2149 - Proposed Collection, Comment Request

    Science.gov (United States)

    2011-01-12

    ... comments to Nora Kincaid, BLS Clearance Officer, Division of Management Systems, Bureau of Labor Statistics... by fax to 202-691-5111 (this is not a toll free number). FOR FURTHER INFORMATION CONTACT: Nora...

  12. 77 FR 11593 - Proposed Collection, Comment Request

    Science.gov (United States)

    2012-02-27

    ... in the Addresses section of this notice on or before April 27, 2012. ADDRESSES: Send comments to Nora... (this is not a toll free number). FOR FURTHER INFORMATION CONTACT: Nora Kincaid, BLS Clearance Officer...

  13. Comments on 'Generation of Deccan Trap magmas'

    Indian Academy of Sciences (India)

    R.Narasimhan(krishtel emaging)1461 1996 Oct 15 13:05:22

    Comments on 'Generation of Deccan Trap magmas' by Gautam Sen ... Department of Geology & Geophysics, School of Ocean & Earth Science & Technology (SOEST), University of .... Mahoney J J, Sheth H C, Chandrasekharan D and Peng Z.

  14. 78 FR 36607 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-06-18

    ... dealer to withdraw its registration. This information is also important to the municipal securities... person to contact regarding any of the municipal securities dealer's unfinished business. Based upon past... SECURITIES AND EXCHANGE COMMISSION Proposed Collection; Comment Request Upon Written Request...

  15. Reply to comments by L. L. Lengyel

    International Nuclear Information System (INIS)

    Parks, P.B.; Turnbull, R.J.

    1980-01-01

    In reply to comments by Lengyel, it is asserted that boundary conditions used in the pellet ablation model are quite satisfactory but that a more realistic equation of state than the ideal gas law should have been used

  16. 78 FR 59010 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-09-25

    ... submitting comments. Mail: Federal Docket Management System Office, 4800 Mark Center Drive, East Tower, Suite... seamlessly to the SUS module for invoice data entry referencing the ERP contract data. Dated: September 20...

  17. 78 FR 19689 - Proposed Collection; Comment Request

    Science.gov (United States)

    2013-04-02

    ... information technology. DATES: Consideration will be given to all comments received by June 3, 2013. ADDRESSES... of Defense Access Card--Defense Biometric Identification System (DBIDS) Enrollment; OMB Control...

  18. 76 FR 72400 - Proposed Collection; Comment Request

    Science.gov (United States)

    2011-11-23

    ... techniques or other forms of information technology. DATES: Consideration will be given to all comments... developed biometric information systems capable of collecting and storing biometric images, associated biographic and contextual information; matching biometrics against local and external biometric galleries...

  19. Comment

    Science.gov (United States)

    2001-01-01

    Physics...fun? 'Physics is Fun' - it's a book, a course, a summer school... Physics, with a reputation for hard maths, nonsensical equations and crazy teachers living with a permanent bad hair day, yes, PHYSICS IS FUN! Maybe if we say it often enough our students will believe us. PHYSICS IS FUN! Keep saying it, and try to believe it. But we are scientists, and we have to look at the evidence and acknowledge the truth: when most people recall the fun times they had at school-how many think about their physics classes? Try asking them. Let's face it - although our students enjoy our exciting demonstrations, the well-structured development of concepts in our classes, and the cooperative and supportive atmosphere of our classrooms and laboratories, even when they find that their physics teachers are the most kind, considerate and approachable of people, even then, when we've done all we can to make physics pleasant, fun and exciting, our students have to fathom out physics... and that can be hard! 'Physics isn't fun in the trivial sense, it's hard work: but you get a fantastic sense of achievement when you make progress.' This is my counsel to most young people who come to discuss whether or not to opt for physics. We try our best to make the material accessible and interesting, but at the end of the day, struggling with something that intially you can't do, but eventually you can do, is part of developing in physics. But what about the teachers? November's meeting of physics teachers from across Europe, Physics on Stage, featured many of the best innovations in physics teaching from the 22 countries which sent delegations (see News). It is probably no surprise, but we need to take note that the most popular stands, talks and lectures were the ones which were most fun. And there is lots of fun to be had doing physics. Whether it is toys, music, poetry, or simply talking about the symmetry in particle physics-the most popular stands, workshops and lectures were those where teachers could enjoy the fun in physics again. Even physics teachers are human! It is so easy to get bogged down in the drudge of everyday teaching and forget the students, let alone ourselves. But if you think back to the good teachers you had at school - weren't they the ones who were enjoying themselves, and maybe not perfectly organized. There has to be a moment at which a good teacher says 'I'm going to do this, because I want to... it's fun physics!' No other justification is needed. Our new look for 2001 So here is the first issue of the new-look Physics Education - and we sincerely hope that you enjoy it. The Editorial Board and the publishing team have been working hard for the past few months to keep the best of the old format, but to make a fresher, more user-friendly publication. As incoming Editor I must acknowledge the excellent work done by Ken Dobson and Jill Membrey, the outgoing team. It is a tough act to follow, but a challenge I am privileged to undertake. As a physics teacher I know how difficult it can be to stay inspired and up-to-date, so as Editor of Physics Education I want to support your professional development as much as possible. Starting with support for student teachers (see Starting Out), through to teachers in charge of equipment and budgets (see Technical Trimmings and Reviews): we want to share good practice. Finally, let's laugh at ourselves-don't miss Signing Off: a humorous look at physics teaching. I've really enjoyed working on this new format, and I hope that you enjoy the read. Please give us lots of feedback and send in your own contributions. I'm very pleased that our first issue has two special features: to me they represent the potential and the purpose of physics education. Sport is an exciting growth area of science in which increasing numbers of students want to understand the basic laws of motion and the application of sophisticated technology; and communicating physics - well that's not just fun, it's fundamental. EditorDr Kerry Parker

  20. Comment

    CERN Multimedia

    1972-01-01

    Our opening article in this issue celebrates the first operation, on 1 March, of the proton synchrotron at the National Accelerator Laboratory, Batavia, at its design energy of 200 GeV. The article gives a short description of the machine and some of its building and commissioning story. It is a great achievement to reach the highest energy in the world from a particle accelerator and NAL have done it in a style which is all their own.

  1. Comment

    Science.gov (United States)

    2001-03-01

    Virtual reality - whose reality? There is an old joke about a farmer who wanted to improve his milk yields and employed an engineer, a psychologist and a physicist to make suggestions. They all went away for a month and came back with their proposals. The engineer had measured the size of the milking stalls, the ambient temperature and the milking process. She suggested a modest rise in ambient temperature and an alteration in the pumping equipment. The psychologist decided to paint the stalls green and play a tape-recording of birdsong to the cows to make them feel more content and release their milk more easily. The physicist explained that he had decided to look at things more fundamentally: 'Let us assume that the cow is a sphere' ... he began. And that's the joke. Some people think that this is the funniest thing out - a physicist can't recognize a cow when they see one. What troubles me is that I didn't get the joke straight away. I am so used to the language and the often-ludicrous assumptions in physics that it did not seem particularly strange or funny. What did you think? The joke, for me, illustrates the essence of our problem in physics teaching. In a very real way, physics is about another world. It isn't about the real world in which ordinary people live, and they know it. Physics has its own language, its own laws and its own values. Depleted uranium has been in the news of late. It is interesting to compare the casual way in which physics teachers have discussed the possibilitiy that one atom of uranium can kill someone with the shock-horror reporting of this fact in the press. We are caricatured, sometimes for good reason, being callous, calculating, cold people - out of touch with the things that really matter. And then there's that other 'real world' - of really tough people who make serious money. Our friends who work out in the worlds of commerce and industry like to mutter, with some superiority, that teachers would never survive in the real world. So here we are, buffered from the 'reality' of commerce by kind managers, left to teach equations at the expense of moral standards ... Excuse me! Physics is the only subject that confronts real reality head on. Physics is all about how this world, this Universe, this reality works. Moral laws, government legislation and theories of economics are all well, and sometimes good, but they take place within this space we call Our Universe. Physics is real This issue of Physics Education contains lots of excellent suggestions for practical work - demonstrations of what happens, and suggestions for investigations. I hope that readers will find them useful and maybe share some good ideas of their own. We are dealing with stuff that actually happens, and that is what makes physics both significant and attractive. The joke I really hate runs 'If it moves it's biology, if it smells it's chemistry and if it doesn't work it's physics'. This is rubbish: gravity always works, in my experience, physics never gets it wrong. In the classroom, maybe a piece of equipment is broken, or the technician forgot the batteries, but we can never say truthfully that 'the experiment didn't work'. Virtual physics Last week a school governor challenged me to justify the cost of so much laboratory space and equipment when, nowadays, so much can be done using computers. Probably the best 'virtual physics' currently available is on CD-ROM. In this issue of Physics Education we have concentrated on CDs for our review section. There is lots of good material out there which can enhance our teaching with wonderful images, immediate feedback for students, and the possibility of continuously monitored differentiated work but, as I explained to the governor, I don't want to teach virtual physics - physics is very firmly, fairly and squarely in this real world (which may, of course, approximate to a sphere ... .). EditorDr Kerry Parker

  2. Comment

    Science.gov (United States)

    Wasawo, David

    1973-01-01

    Presents a discussion showing that scientific development and technological innovation is feasible in sub-Saharan Africa. Stresses need for meaningful science education for pre-primary through adult levels as well as need for such organizations as the Organization of African Unity to formulate scientific and technological policy continent-wide.…

  3. Stylistic Features of Comment in Arabic Blogosphere

    Directory of Open Access Journals (Sweden)

    Gabdulzyamil G. Zaynullin

    2017-11-01

    Full Text Available One of the most important issues in the study of the functioning of the Internet language is the definition of the features of each Internet genre presented in online communication, taking into account the linguocultural features of the language in question. This paper studies the genre of the Internet comments of the Arabic-speaking blogosphere and reveals its stylistic features. The most common goal of the comment is gratitude, followed by praise. We created a corpus of comments from blogs of various subjects, and then conducted the tagging, having identified the group to which we attributed a comment, depending on the subject and the communicative goal. With the help of the Lexico 3 software, the most frequent lexical units were identified, the lexical features of the comments were described, the main one being the widespread use of religionyms, and the relationship between the blog subject and the stylistic characteristics of communication was revealed. The article traces the correlation between the literary and colloquial functional style in the comments, and also draws a conclusion that the comments are of a conversational, informal character. The main devices of expressiveness that are characteristic for both network and pre-network communication were revealed, and the tendency of the analysts to observe in the comments a stable three-part composition (greeting, message, final formula. The influence of traditional Arabic rhetoric, as well as the epistolary genre, was preserved. The results of the paper can be used when studying other genres of Internet communication in Arabic and in comparative studies to create the linguistic software.

  4. The Continuing Evolution of Languages for Specific Purposes

    Science.gov (United States)

    Grosse, Christine Uber; Voght, Geoffrey M.

    2012-01-01

    This overview to "The Modern Language Journal"'s Focus Issue on Languages for Specific Purposes (LSP) takes a fresh look at issues examined in a 1991 article by Grosse and Voght. Reflecting on change drivers and growth in LSP, the authors comment on current challenges to the field and future research needs. Their remarks are based on new insights…

  5. 78 FR 10100 - Data Specifications for Collecting Study Area Boundaries

    Science.gov (United States)

    2013-02-13

    ... comment on a process to reduce support where such an unsubsidized competitor offers voice and broadband... to determine whether unsubsidized competitors offer service within all or a portion of an incumbent's... physical surveys in order to produce the degree of accuracy required by the data specification. Incumbent...

  6. Comments on "A closed-form solution to Tensor voting: theory and applications"

    OpenAIRE

    Maggiori, Emmanuel; Lotito, Pablo Andres; Manterola, Hugo Luis; del Fresno, Mariana

    2017-01-01

    We comment on a paper that describes a closed-form formulation to Tensor Voting, a technique to perceptually group clouds of points, usually applied to infer features in images. The authors proved an analytic solution to the technique, a highly relevant contribution considering that the original formulation required numerical integration, a time-consuming task. Their work constitutes the first closed-form expression for the Tensor Voting framework. In this work we first observe that the propo...

  7. Evaluation of personal integrating dosimeters

    International Nuclear Information System (INIS)

    Correa, C.A.; Bisauta, Mauricio A.

    2007-01-01

    The objective of this work is to analyze the different types of dosimeters present in the international market that are used to provide personal dose monitoring, specifically for external gamma and beta radiation, Hp(10) and Hp (0,07), as well as to add comments of advances in the field of passive and operative dosimetry, and the changes that are being produced in the regulating policy in other countries regarding the use of this devices. The technical specification of each dosimeter has been extracted of different catalogues of products. To conclude, the importance has been stressed in a proper selection of dosimeters with its advantages and disadvantages before its use. (author) [es

  8. Integral transforms and their applications

    CERN Document Server

    Debnath, Lokenath

    2006-01-01

    Keeping the style, content, and focus that made the first edition a bestseller, Integral Transforms and their Applications, Second Edition stresses the development of analytical skills rather than the importance of more abstract formulation. The authors provide a working knowledge of the analytical methods required in pure and applied mathematics, physics, and engineering. The second edition includes many new applications, exercises, comments, and observations with some sections entirely rewritten. It contains more than 500 worked examples and exercises with answers as well as hints to selecte

  9. Buried waste integrated demonstration technology integration process

    International Nuclear Information System (INIS)

    Ferguson, J.S.; Ferguson, J.E.

    1992-04-01

    A Technology integration Process was developed for the Idaho National Energy Laboratories (INEL) Buried Waste Integrated Demonstration (BWID) Program to facilitate the transfer of technology and knowledge from industry, universities, and other Federal agencies into the BWID; to successfully transfer demonstrated technology and knowledge from the BWID to industry, universities, and other Federal agencies; and to share demonstrated technologies and knowledge between Integrated Demonstrations and other Department of Energy (DOE) spread throughout the DOE Complex. This document also details specific methods and tools for integrating and transferring technologies into or out of the BWID program. The document provides background on the BWID program and technology development needs, demonstrates the direction of technology transfer, illustrates current processes for this transfer, and lists points of contact for prospective participants in the BWID technology transfer efforts. The Technology Integration Process was prepared to ensure compliance with the requirements of DOE's Office of Technology Development (OTD)

  10. Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Lu, Fengmin

    2017-01-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis‐activate the expression of proto‐oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV‐integrated haplotype, and a long‐range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long‐range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence‐associated acidic β‐gal activity in HeLa cells. These data indicate a long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. PMID:28470669

  11. Long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele-specific MYC expression in HeLa cells.

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Chen, Xiangmei; Lu, Fengmin

    2017-08-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis-activate the expression of proto-oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV-integrated haplotype, and a long-range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long-range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence-associated acidic β-gal activity in HeLa cells. These data indicate a long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  12. 77 FR 33218 - Graco, Inc.; Analysis of Proposed Agreement Containing Consent Orders To Aid Public Comment

    Science.gov (United States)

    2012-06-05

    ... ``Graco, Dkt. No. 9350'' on your comment, and file your comment online at https://ftcpublic.commentworks... ``Graco, Dkt. No. 9350'' on your comment. Your comment--including your name and your state--will be placed... file a comment through that Web site. If you file your comment on paper, write ``Graco, Dkt. No. 9350...

  13. HRT Specification

    CERN Document Server

    Möller, M

    1996-01-01

    In the context of the AIS Project (Advanced Informatics Systems for administration and management) a study has been conducted that resulted in the definition of a high level information systems model. Thirteen proposed systems were defined for detailed analysis. The Finance, Foundation, Human Resources, Logistics and Purchasing areas have been studied in detail. These studies have lead to the purchase and implementation of the ORIAC and SIRIAC packages, the Foundation database, the Oracle HR package, the Triton package and EDH and BHT. This specification describes the Human Resources Toolkit (HRT) intended to be used for accessing data in the HR and Foundation systems. This toolkit should help the divisions carry out their Human Resource management, planning and follow-up. It will have extensive report generation capabilities and offer a variety of standard graphs. It should have an easy-to-use graphical user interface and run on the CERN standard desktop platforms.

  14. Technical specification for fabrication of HANARO pool cover

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jeong Soo; Woo, Sang Ik

    2001-06-01

    This technical specification details the requirements and the acceptance criteria for design, seismic analysis, function test, installation and quality assurance for HANARO pool cover which will be installed at the top of reactor pool. The pool cover is classified as non-nuclear safety, seismic category II and quality class T. The basic design of the pool cover for increasing HANARO applications has been carried out for supporting the driving devices which can load, unload and rotate the irradiation targets in the in-core and out-core vertical irradiation holes under on-power operation. The comments of HANARO user group related with irradiation tests have optimally considered in the process of design. The interference between fuel handling and control absorber units in the reactor pool and activities to load, unload and rotate the irradiation targets at the top of the reactor pool have been minimized. The pool cover can be moved for maintenance and can protect the reactor pool from unexpected drop of foreign materials. It provides the space to vertical access of driving devices for NTD, CT/IR and OR4/OR5 under on-power operation. And the pool cover assembly must maintain its structural integrity under seismic load. Based on the above design concept, the HANARO pool cover has been proposed as supporting structure of driving devices for NTD, fission moly and RI production under on-power operation.

  15. Harmonization of renewable electricity feed-in laws: A comment

    International Nuclear Information System (INIS)

    Soederholm, Patrik

    2008-01-01

    This comment aims at critically analyzing some of the economic efficiency issues that are raised in the paper by Munoz et al. [2007. Harmonization of renewable electricity feed-in laws in the European Union. Energy Policy 35, 3104-3114] on the harmonization of feed-in law schemes for renewable electricity in the European Union. We comment on the choice between green certificate systems and feed-in laws, but pay particular attention to the implementation and design of a harmonized feed-in law scheme. In the comment we argue first that the approach suggested by Munoz et al. tends to downplay many of the practical difficulties in assessing the real costs facing investors in renewable electricity, not the least since the presence of regulatory uncertainty about the marginal costs of renewable electricity may be essential for the choice between different support systems. Concerning the benefit side of renewable electricity promotion, the Munoz et al. (2007) paper builds on an interpretation of the EU Renewables Directive that provides plenty of room for national priorities and that therefore essentially implies that harmonized support premiums per se are of little value. We argue instead that a harmonized system should primarily address the international spillover effects from renewable electricity promotion, not the least those related to improved security of supply in Europe. There exists then a strong case for disregarding the specific national benefits of renewable electricity production in the design of harmonized support systems, and for instead considering international-perhaps at the start bilateral-policy support coordination based on entirely uniform support levels

  16. 78 FR 39829 - Proposed Collection; Comment Request for Regulation Project

    Science.gov (United States)

    2013-07-02

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service Proposed Collection; Comment Request for Regulation Project AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments...: Title: Reporting of Nonpayroll Withheld Tax Liabilities. OMB Number: 1545-1413. Regulation Project...

  17. 78 FR 23975 - Proposed Collection; Comment Request for Regulation Project

    Science.gov (United States)

    2013-04-23

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service Proposed Collection; Comment Request for Regulation Project AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... definition of a controlled foreign corporation, foreign base company income and foreign personal holding...

  18. 76 FR 43381 - Proposed Collection; Comment Request for Regulation Project

    Science.gov (United States)

    2011-07-20

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service Proposed Collection; Comment Request for Regulation Project AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... Financial Asset Securitization Investment Trusts; Real Estate Mortgage Investment Conduits (TD 9004 (final...

  19. 76 FR 49836 - Proposed Collection; Comment Request for Form 8846

    Science.gov (United States)

    2011-08-11

    ... Actions: Lines 7 through 11 will be removed, since the passive activity limit and the carryover amounts... included in the request for OMB approval. All comments will become a matter of public record. Comments are...

  20. 75 FR 39583 - Agency Information Collection Activities: Comment Request

    Science.gov (United States)

    2010-07-09

    ... the World Wide Web. The survey is a fully automated web data collection effort and is handled... NATIONAL SCIENCE FOUNDATION Agency Information Collection Activities: Comment Request AGENCY: National Science Foundation. ACTION: Notice; Submission for OMB Review; Comment Request. SUMMARY: The...

  1. Comment on ``Communicating Government Science''

    Science.gov (United States)

    Lins, Harry F.

    2006-05-01

    Soroosh Sorooshian's editorial in the 18 April issue of Eos (87(16) 2005) is a timely reminder of the need for unambiguous guidelines governing the interactions between government scientists and the media. His comments implicitly recognize the central role that science plays in a modern democratic society, which includes informing policy at the highest levels of government and educating the general public about the world we inhabit. Federal research scientists, who constitute approximately 15 percent of the AGU's U.S. membership, have a unique public responsibility. They would welcome a consistent policy for the review and approval of publications, oral presentations, and media communications. An example of the value and success that such a policy can have to both science and the nation is evident in the operations of the U.S. Geological Survey (USGS). For more than a century, the USGS has had clear policies and procedures for ensuring the communication of accurate, high-quality, and impartial scientific information. These policies and procedures are set forth in the USGS Manual under sections entitled ``Approval by the director for outside publication and oral presentation,'' ``Review of USGS publications and abstracts of oral presentations for policy-sensitive issues,'' and ``News release and media relations policy.'' These policies are available online at http:// www.usgs.gov/usgs-manual/500/500-9.html (.../500-8.html and .../500 5.html).

  2. Integrated economics

    International Nuclear Information System (INIS)

    Bratton, T.J.

    1992-01-01

    This article offers ideas for evaluating integrated solid waste management systems through the use of a conceptual cost overview. The topics of the article include the integrated solid waste management system; making assumptions about community characteristics, waste generation rates, waste collection responsibility, integrated system components, sizing and economic life of system facilities, system implementation schedule, facility ownership, and system administration; integrated system costs; integrated system revenues; system financing; cost projections; and making decisions

  3. Biomass Program 2007 Peer Review - Integrated Biorefinery Platform Summary

    Energy Technology Data Exchange (ETDEWEB)

    none,

    2009-10-27

    This document discloses the comments provided by a review panel at the U.S. Department of Energy Office of the Biomass Program Peer Review held on November 15-16, 2007 in Baltimore, MD and the Integrated Biorefinery Platform Review held on August 13-15, 2007 in Golden, Colorado.

  4. 76 FR 72923 - Pool Corporation; Analysis To Aid Public Comment

    Science.gov (United States)

    2011-11-28

    ... manufacturers, warehouse them, and then resell the products to pool retail stores, pool service companies and.... ADDRESSES: Interested parties may file a comment online or on paper, by following the instructions in the... 0115'' on your comment, and file your comment online at https://ftcpublic.commentworks.com/ftc...

  5. 49 CFR 1110.5 - Consideration of comments received.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 8 2010-10-01 2010-10-01 false Consideration of comments received. 1110.5 Section 1110.5 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION... PROCEEDINGS § 1110.5 Consideration of comments received. All timely comments will be considered before final...

  6. 78 FR 29205 - Proposed Collection; Comment Request for Form 4952

    Science.gov (United States)

    2013-05-17

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service Proposed Collection; Comment Request for Form 4952 AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments. SUMMARY... 4952, Investment Interest Expense Deduction. DATES: Written comments should be received on or before...

  7. 78 FR 45616 - Proposed Collection; Comment Request for Form 8960

    Science.gov (United States)

    2013-07-29

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service Proposed Collection; Comment Request for Form 8960 AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments. SUMMARY... 8960, Net Investment Income Tax-Individuals, Estates, and Trusts. DATES: Written comments should be...

  8. 75 FR 33380 - Proposed Collection; Comment Request for Form 4952

    Science.gov (United States)

    2010-06-11

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service Proposed Collection; Comment Request for Form 4952 AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments. SUMMARY... 4952, Investment Interest Expense Deduction. DATES: Written comments should be received on or before...

  9. The Impact of Teachers' Commenting Strategies on Children's Vocabulary Growth

    Science.gov (United States)

    Barnes, Erica M.; Dickinson, David K.

    2017-01-01

    We examined the relations between teachers' use of comments during book reading sessions in preschool classrooms and the vocabulary growth of children with low and moderately low language ability. Using data from a larger randomized controlled trial, we analyzed comments defined as utterances that give, explain, expand, or define. Comments were…

  10. 76 FR 44048 - Agency Information Collection Activities: Comment Request

    Science.gov (United States)

    2011-07-22

    .../webcaspar . A public release file is also made available on the World Wide Web. Comment: On May 11, 2011 we... NATIONAL SCIENCE FOUNDATION Agency Information Collection Activities: Comment Request AGENCY: National Science Foundation. ACTION: Submission for OMB review; Request for Comments. SUMMARY: The National...

  11. Predicting the volume of comments on online news stories

    NARCIS (Netherlands)

    Tsagkias, M.; Weerkamp, W.; de Rijke, M.; Cheung, D.; Song, I.-Y.; Chu, W.; Hu, X.; Lin, J.; Li, J.; Peng, Z.

    2009-01-01

    On-line news agents provide commenting facilities for readers to express their views with regard to news stories. The number of user supplied comments on a news article may be indicative of its importance or impact. We report on exploratory work that predicts the comment volume of news articles

  12. Telephone Flat Geothermal Development Project Environmental Impact Statement Environmental Impact Report. Final: Comments and Responses to Comments

    Energy Technology Data Exchange (ETDEWEB)

    None

    1999-02-01

    This document is the Comments and Responses to Comments volume of the Final Environmental Impact Statement and Environmental Impact Report prepared for the proposed Telephone Flat Geothermal Development Project (Final EIS/EIR). This volume of the Final EIS/EIR provides copies of the written comments received on the Draft EIS/EIR and the leady agency responses to those comments in conformance with the requirements of the National Environmental Policy Act (NEPA) and the California Environmental Quality Act (CEQA).

  13. PENGEMBANGAN SUBJECT SPECIFIC PEDAGOGY (SSP IPA TERPADU UNTUK MENINGKATKAN HASIL BELAJAR SISWA

    Directory of Open Access Journals (Sweden)

    Fitri Yuliawati

    2016-05-01

    Full Text Available Background of this research is the analysis of the results of interviews some junior secondary schools in Yogyakarta and the conclusion that teachers do not use an integrated science teaching and teachers still find difficulties in the application of learning science in an integrated manner. It can be influenced by several factors, such as the lack of reference used by teachers in presenting the material Integrated Science relevantly, most of science teachers are from educational background of chemistry, physics, and biology instead of science education, so that teachers find difficulties to create an integrated learning of science. In addition, teachers feel difficulty in determining the depth of the material, limits of integration in integrated science teaching, and did not know the concept of integrated science teaching. This research is a development research. Learning tools developed included : student books, lesson plans, student activity sheets and evaluation tools. The development of the learning which is done in this study use the models of 4D development which includes the step of Define (definition which at this stage conducted a needs analysis. Design : it is the stage of Subject Specific Pedagogy (SSP software design. Development, it is the stage of development after the draft was made followed by a learning device validation by experts. This stage is also conducted to seek input from all the responses, reactions and comments from teachers, students, and observers so that it can be used for further improvement of science teaching later. The Disseminate, it is the stage of field tests are widely but not done. Data collection instruments used in this study include : test items and questionnaire. The conclusion of this development research are as follows : the results of the validation SSP integrated science by learning tools expert, material experts and media experts indicate the category of Very Good (SB so that SSP integrated

  14. 78 FR 14515 - Extension of Comment Period for Request for Comments on a Patent Small Claims Proceeding in the...

    Science.gov (United States)

    2013-03-06

    ... be sent by email to ip[email protected] . Comments may also be submitted by postal mail addressed to... be submitted by postal mail, the USPTO prefers to receive comments via email. Written comments should be identified in the subject line of the email or postal mailing as ``Patent Small Claims.'' Because...

  15. Medicare Program; Hospital Inpatient Prospective Payment Systems for Acute Care Hospitals and the Long-Term Care Hospital Prospective Payment System Policy Changes and Fiscal Year 2016 Rates; Revisions of Quality Reporting Requirements for Specific Providers, Including Changes Related to the Electronic Health Record Incentive Program; Extensions of the Medicare-Dependent, Small Rural Hospital Program and the Low-Volume Payment Adjustment for Hospitals. Final rule; interim final rule with comment period.

    Science.gov (United States)

    2015-08-17

    We are revising the Medicare hospital inpatient prospective payment systems (IPPS) for operating and capital related costs of acute care hospitals to implement changes arising from our continuing experience with these systems for FY 2016. Some of these changes implement certain statutory provisions contained in the Patient Protection and Affordable Care Act and the Health Care and Education Reconciliation Act of 2010 (collectively known as the Affordable Care Act), the Pathway for Sustainable Growth Reform(SGR) Act of 2013, the Protecting Access to Medicare Act of 2014, the Improving Medicare Post-Acute Care Transformation Act of 2014, the Medicare Access and CHIP Reauthorization Act of 2015, and other legislation. We also are addressing the update of the rate-of-increase limits for certain hospitals excluded from the IPPS that are paid on a reasonable cost basis subject to these limits for FY 2016.As an interim final rule with comment period, we are implementing the statutory extensions of the Medicare dependent,small rural hospital (MDH)Program and changes to the payment adjustment for low-volume hospitals under the IPPS.We also are updating the payment policies and the annual payment rates for the Medicare prospective payment system (PPS) for inpatient hospital services provided by long-term care hospitals (LTCHs) for FY 2016 and implementing certain statutory changes to the LTCH PPS under the Affordable Care Act and the Pathway for Sustainable Growth Rate (SGR) Reform Act of 2013 and the Protecting Access to Medicare Act of 2014.In addition, we are establishing new requirements or revising existing requirements for quality reporting by specific providers (acute care hospitals,PPS-exempt cancer hospitals, and LTCHs) that are participating in Medicare, including related provisions for eligible hospitals and critical access hospitals participating in the Medicare Electronic Health Record (EHR)Incentive Program. We also are updating policies relating to the

  16. A data base processor semantics specification package

    Science.gov (United States)

    Fishwick, P. A.

    1983-01-01

    A Semantics Specification Package (DBPSSP) for the Intel Data Base Processor (DBP) is defined. DBPSSP serves as a collection of cross assembly tools that allow the analyst to assemble request blocks on the host computer for passage to the DBP. The assembly tools discussed in this report may be effectively used in conjunction with a DBP compatible data communications protocol to form a query processor, precompiler, or file management system for the database processor. The source modules representing the components of DBPSSP are fully commented and included.

  17. Optimisation of technical specifications using probabilistic methods

    International Nuclear Information System (INIS)

    Ericsson, G.; Knochenhauer, M.; Hultqvist, G.

    1986-01-01

    During the last few years the development of methods for modifying and optimising nuclear power plant Technical Specifications (TS) for plant operations has received increased attention. Probalistic methods in general, and the plant and system models of probabilistic safety assessment (PSA) in particular, seem to provide the most forceful tools for optimisation. This paper first gives some general comments on optimisation, identifying important parameters and then gives a description of recent Swedish experiences from the use of nuclear power plant PSA models and results for TS optimisation

  18. Review of specific radiological accident considerations

    International Nuclear Information System (INIS)

    Elder, J.

    1984-01-01

    Specific points of guidance provided in the forthcoming document A Guide to Radiological Accident Considerations for Siting and Design of Nonreactor Nuclear Facilities are discussed. Of these, the following are considered of particular interest to analysts of hypothetical accidents: onsite dose limits; population dose, public health effects, and environmental contamination as accident consequences which should be addressed; risk analysis; natural phenomena as accident initiators; recommended dose models; multiple organ equivalent dose; and recommended methods and parameters for source terms and release amount calculations. Comments are being invited on this document, which is undergoing rewrite after the first stage of peer review

  19. First Steps Towards AN Integrated Citygml-Based 3d Model of Vienna

    Science.gov (United States)

    Agugiaro, G.

    2016-06-01

    This paper presents and discusses the results regarding the initial steps (selection, analysis, preparation and eventual integration of a number of datasets) for the creation of an integrated, semantic, three-dimensional, and CityGML-based virtual model of the city of Vienna. CityGML is an international standard conceived specifically as information and data model for semantic city models at urban and territorial scale. It is being adopted by more and more cities all over the world. The work described in this paper is embedded within the European Marie-Curie ITN project "Ci-nergy, Smart cities with sustainable energy systems", which aims, among the rest, at developing urban decision making and operational optimisation software tools to minimise non-renewable energy use in cities. Given the scope and scale of the project, it is therefore vital to set up a common, unique and spatio-semantically coherent urban model to be used as information hub for all applications being developed. This paper reports about the experiences done so far, it describes the test area and the available data sources, it shows and exemplifies the data integration issues, the strategies developed to solve them in order to obtain the integrated 3D city model. The first results as well as some comments about their quality and limitations are presented, together with the discussion regarding the next steps and some planned improvements.

  20. Online News Sites and Journalism 2.0: Reader Comments on Al Jazeera Arabic

    Directory of Open Access Journals (Sweden)

    Muhammad M. Abdul-Mageed

    2008-12-01

    Full Text Available The current paper investigates reader commenting on news sites as one facet of journalism 2.0. Specifically, the themes, frequency, and regional coverage of readers’ comments—and in general, their activity levels and distribution—are considered, with a goal to increase knowledge of convergent media and computer-mediated communication (CMC, as well as shed light on the interactivity strategies adopted by influential news producers. The corpus is collected from the Arabic news site of the controversial Middle East-based, bilingual network Al Jazeera. Reader commenting was found to be a regular occurrence on the site but distributed unevenly across stories. The stories focused mostly on themes related to military and political violence, politics, and foreign relations, and covered events related to the Arab world more than other regions. Also, patterns of commenting varied according to day of the week and position of the story on the web page. Overall, these findings suggest that citizen journalism—journalism is performed by lay persons—on Al Jazeera tends to be shaped by the coverage and layout of the news site. Moreover, citizen participation in online news sites such as Al Jazeera is still far from ideal, in that commenters are given neither the access nor the facilitation to use modalities other than written text. These limitations are critiqued in light of contemporary discourses about media convergence and journalism 2.0.