HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

A web-based adaptive tutor to teach PCR primer design

NARCIS (Netherlands)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

A Web-based Adaptive Tutor to Teach PCR Primer Design

NARCIS (Netherlands)

Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

A Web-Based Adaptive Tutor to Teach PCR Primer Design

Science.gov (United States)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

Science.gov (United States)

2016-03-01

This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Science.gov (United States)

Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François

2010-02-01

QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

Directory of Open Access Journals (Sweden)

Fernando L. Mantelatto

Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

Science.gov (United States)

Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

2010-08-01

To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

Directory of Open Access Journals (Sweden)

Assawamakin Anunchai

2007-08-01

Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Integrated Design

DEFF Research Database (Denmark)

Lenau, Torben Anker

1999-01-01

A homepage on the internet with course material, lecture plan, student exercises, etc. Continuesly updated during the course Integrated Design (80402, 80403)......A homepage on the internet with course material, lecture plan, student exercises, etc. Continuesly updated during the course Integrated Design (80402, 80403)...

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

MOS integrated circuit design

CERN Document Server

Wolfendale, E

2013-01-01

MOS Integral Circuit Design aims to help in the design of integrated circuits, especially large-scale ones, using MOS Technology through teaching of techniques, practical applications, and examples. The book covers topics such as design equation and process parameters; MOS static and dynamic circuits; logic design techniques, system partitioning, and layout techniques. Also featured are computer aids such as logic simulation and mask layout, as well as examples on simple MOS design. The text is recommended for electrical engineers who would like to know how to use MOS for integral circuit desi

Integrated STEM: A New Primer for Teaching Technology Education

Science.gov (United States)

Asunda, Paul A.; Mativo, John

2017-01-01

Part One of this article ("Technology and Engineering Teacher," 75(4), December/January, 2016) presented a process that science, math, engineering, and technology teachers could use to collaborate and design integrated STEM courses. A conceptual framework was discussed that could provide a premise that educators interested in delivery of…

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

[Design of primers to DNA of lactic acid bacteria].

Science.gov (United States)

Lashchevskiĭ, V V; Kovalenko, N K

2003-01-01

Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Integrated Design

DEFF Research Database (Denmark)

Jørgensen, Michael; Nielsen, M. W.; Strømann-Andersen, Jakob Bjørn

2011-01-01

and describe the decision process. Specific attention is given to how the engineering input was presented and how it was able to facilitate the design development. Site and context, building shape, organization of functions and HVAC-systems were all included to obtain a complete picture of the building......, low-energy consumption, and high-quality indoor environment. We use this case study to investigate how technical knowledge about building performance can be integrated into the conceptual design stage. We have selected certain points during the design process that represented design challenges...

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Integrated circuit design using design automation

International Nuclear Information System (INIS)

Gwyn, C.W.

1976-09-01

Although the use of computer aids to develop integrated circuits is relatively new at Sandia, the program has been very successful. The results have verified the utility of the in-house CAD design capability. Custom IC's have been developed in much shorter times than available through semiconductor device manufacturers. In addition, security problems were minimized and a saving was realized in circuit cost. The custom CMOS IC's were designed at less than half the cost of designing with conventional techniques. In addition to the computer aided design, the prototype fabrication and testing capability provided by the semiconductor development laboratory and microelectronics computer network allows the circuits to be fabricated and evaluated before the designs are transferred to the commercial semiconductor manufacturers for production. The Sandia design and prototype fabrication facilities provide the capability of complete custom integrated circuit development entirely within the ERDA laboratories

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Integrated Structural Design Education

DEFF Research Database (Denmark)

Bjerregaard Jensen, Lotte; Almegaard, Henrik

2011-01-01

to EU legislation. And a successful engineering student must be prepared to work in the open-ended, multidisciplinary environment necessary to produce structures which comply with EIA demands. This paper describes an innovative course developed at the Technical University of Denmark which integrates...... landscaping and structural design. The integrated courses create a setting for learning about the design of large-scale structures and involve geometry, statics, computer simulation, graphical design and landscape architecture. Together, they educate engineers who can take part in the early design phases...... of a project, function well in design teams, and comply with EU EIA demands....

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

Science.gov (United States)

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

A Primer on Autonomous Aerial Vehicle Design.

Science.gov (United States)

Coppejans, Hugo H G; Myburgh, Herman C

2015-12-02

There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV), such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM) solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

Decision-Based Design Integrating Consumer Preferences into Engineering Design

CERN Document Server

Chen, Wei; Wassenaar, Henk Jan

2013-01-01

Building upon the fundamental principles of decision theory, Decision-Based Design: Integrating Consumer Preferences into Engineering Design presents an analytical approach to enterprise-driven Decision-Based Design (DBD) as a rigorous framework for decision making in engineering design.  Once the related fundamentals of decision theory, economic analysis, and econometrics modelling are established, the remaining chapters describe the entire process, the associated analytical techniques, and the design case studies for integrating consumer preference modeling into the enterprise-driven DBD framework. Methods for identifying key attributes, optimal design of human appraisal experiments, data collection, data analysis, and demand model estimation are presented and illustrated using engineering design case studies. The scope of the chapters also provides: •A rigorous framework of integrating the interests from both producer and consumers in engineering design, •Analytical techniques of consumer choice model...

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Architectures for Green-Field Supply Chain Integration: Supply Chain Integration Design

OpenAIRE

Radanliev, Petar

2015-01-01

This paper applied case study research to design architectures for green-field supply chain integration. The integration design is based on a case study of a supply chain integration of 5 companies, operating in different, but supply chain complimenting industry sectors. The case study research is applied to design and validate the architectures in a real world scenario. The supply\\ud chain integration architectures enable the conversion of individual into integrated strategies. The architect...

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Integrated design for space transportation system

CERN Document Server

Suresh, B N

2015-01-01

The book addresses the overall integrated design aspects of a space transportation system involving several disciplines like propulsion, vehicle structures, aerodynamics, flight mechanics, navigation, guidance and control systems, stage auxiliary systems, thermal systems etc. and discusses the system approach for design, trade off analysis, system life cycle considerations, important aspects in mission management, the risk assessment, etc. There are several books authored to describe the design aspects of various areas, viz., propulsion, aerodynamics, structures, control, etc., but there is no book which presents space transportation system (STS) design in an integrated manner. This book attempts to fill this gap by addressing systems approach for STS design, highlighting the integrated design aspects, interactions between various subsystems and interdependencies. The main focus is towards the complex integrated design to arrive at an optimum, robust and cost effective space transportation system. The orbit...

A Primer on Autonomous Aerial Vehicle Design

Directory of Open Access Journals (Sweden)

Hugo H. G. Coppejans

2015-12-01

Full Text Available There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV, such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Integration of design and inspection

Science.gov (United States)

Simmonds, William H.

1990-08-01

Developments in advanced computer integrated manufacturing technology, coupled with the emphasis on Total Quality Management, are exposing needs for new techniques to integrate all functions from design through to support of the delivered product. One critical functional area that must be integrated into design is that embracing the measurement, inspection and test activities necessary for validation of the delivered product. This area is being tackled by a collaborative project supported by the UK Government Department of Trade and Industry. The project is aimed at developing techniques for analysing validation needs and for planning validation methods. Within the project an experimental Computer Aided Validation Expert system (CAVE) is being constructed. This operates with a generalised model of the validation process and helps with all design stages: specification of product requirements; analysis of the assurance provided by a proposed design and method of manufacture; development of the inspection and test strategy; and analysis of feedback data. The kernel of the system is a knowledge base containing knowledge of the manufacturing process capabilities and of the available inspection and test facilities. The CAVE system is being integrated into a real life advanced computer integrated manufacturing facility for demonstration and evaluation.

Computational Design Tools for Integrated Design

DEFF Research Database (Denmark)

Holst, Malene Kirstine; Kirkegaard, Poul Henning

2010-01-01

In an architectural conceptual sketching process, where an architect is working with the initial ideas for a design, the process is characterized by three phases: sketching, evaluation and modification. Basically the architect needs to address three areas in the conceptual sketching phase......: aesthetical, functional and technical requirements. The aim of the present paper is to address the problem of a vague or not existing link between digital conceptual design tools used by architects and designers and engineering analysis and simulation tools. Based on an analysis of the architectural design...... process different digital design methods are related to tasks in an integrated design process....

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

Science.gov (United States)

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

SUBSURFACE REPOSITORY INTEGRATED CONTROL SYSTEM DESIGN

International Nuclear Information System (INIS)

Randle, D.C.

2000-01-01

The primary purpose of this document is to develop a preliminary high-level functional and physical control system architecture for the potential repository at Yucca Mountain. This document outlines an overall control system concept that encompasses and integrates the many diverse process and communication systems being developed for the subsurface repository design. This document presents integrated design concepts for monitoring and controlling the diverse set of subsurface operations. The Subsurface Repository Integrated Control System design will be composed of a series of diverse process systems and communication networks. The subsurface repository design contains many systems related to instrumentation and control (I andC) for both repository development and waste emplacement operations. These systems include waste emplacement, waste retrieval, ventilation, radiological and air monitoring, rail transportation, construction development, utility systems (electrical, lighting, water, compressed air, etc.), fire protection, backfill emplacement, and performance confirmation. Each of these systems involves some level of I andC and will typically be integrated over a data communications network throughout the subsurface facility. The subsurface I andC systems will also interface with multiple surface-based systems such as site operations, rail transportation, security and safeguards, and electrical/piped utilities. In addition to the I andC systems, the subsurface repository design also contains systems related to voice and video communications. The components for each of these systems will be distributed and linked over voice and video communication networks throughout the subsurface facility. The scope and primary objectives of this design analysis are to: (1) Identify preliminary system-level functions and interfaces (Section 6.2). (2) Examine the overall system complexity and determine how and on what levels the engineered process systems will be monitored

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

International Nuclear Information System (INIS)

Ben salem, Issam

2007-01-01

Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Integrating product design into the supply chain

DEFF Research Database (Denmark)

Khan, Omera; Stolte, Terje; Creazza, Alessandro

2016-01-01

into the supply chain. Originality/Value: This paper provides novel insights to both practitioners and researchers. For practitioners detailed recommendations are given on how they can maximise benefits through integrating product design into the supply chain. The RBV has been harnessed to highlight how......Purpose: The aim of the research is to illustrate how companies can create competitive capabilities through integration of product design into the supply chain. In doing so the paper reveals the challenges and the opportunities that companies face when integrating product design and supply chain...... of opportunities and challenges when integrating product design and the supply chain and subsequently a step-by-step guide is developed to address these. Practical Implications: The research provides key recommendations to companies on how to create competitive capabilities by integrating product design...

Integrating product design into the supply chain

DEFF Research Database (Denmark)

Khan, Omera; Stolte, Terje; Creazza, Alessandro

2016-01-01

Purpose: The aim of the research is to illustrate how companies can create competitive capabilities through integration of product design into the supply chain. In doing so the paper reveals the challenges and the opportunities that companies face when integrating product design and supply chain...... of opportunities and challenges when integrating product design and the supply chain and subsequently a step-by-step guide is developed to address these. Practical Implications: The research provides key recommendations to companies on how to create competitive capabilities by integrating product design...... into the supply chain. Originality/Value: This paper provides novel insights to both practitioners and researchers. For practitioners detailed recommendations are given on how they can maximise benefits through integrating product design into the supply chain. The RBV has been harnessed to highlight how...

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

Efectos de una metodología integral en el aprendizaje de la geometría en alumnos de primer semestre de ingenierías

OpenAIRE

Rojas, Carlos

2007-01-01

El presente estudio tuvo como objetivo determinar el efecto de una metodología, que se denominó integral, sobre el aprendizaje de la geometría en dos grupos de alumnos de primer semestre de ingenierías de la Universidad del Norte. Dicha metodología consistió en: los sistemas de representación de Bruner, como estrategia en el aprendizaje de conceptos y teoremas; los mentefactos, como instrumento en el aprendizaje conceptual; la argumentación deductiva en la respuesta a preguntas, y un heurísti...

Semiconductors integrated circuit design for manufacturability

CERN Document Server

Balasinki, Artur

2011-01-01

Because of the continuous evolution of integrated circuit manufacturing (ICM) and design for manufacturability (DfM), most books on the subject are obsolete before they even go to press. That's why the field requires a reference that takes the focus off of numbers and concentrates more on larger economic concepts than on technical details. Semiconductors: Integrated Circuit Design for Manufacturability covers the gradual evolution of integrated circuit design (ICD) as a basis to propose strategies for improving return-on-investment (ROI) for ICD in manufacturing. Where most books put the spotl

Integral Design methodology for Industrial Collaboration Design of Sustainable Industrial Flexible Demountable buildings

NARCIS (Netherlands)

Zeiler, W.; Quanjel, E.M.C.J.; Bauer, M.; Lima, C.

2007-01-01

Starting in 1998 from developing and designing their own office Kropman, a major Dutch Building Services contractor, developed a new methodology for structuring and documenting integral design processes. Integral design is meant to integrate the different disciplines involved in the building design

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

Model reduction in integrated controls-structures design

Science.gov (United States)

Maghami, Peiman G.

1993-01-01

It is the objective of this paper to present a model reduction technique developed for the integrated controls-structures design of flexible structures. Integrated controls-structures design problems are typically posed as nonlinear mathematical programming problems, where the design variables consist of both structural and control parameters. In the solution process, both structural and control design variables are constantly changing; therefore, the dynamic characteristics of the structure are also changing. This presents a problem in obtaining a reduced-order model for active control design and analysis which will be valid for all design points within the design space. In other words, the frequency and number of the significant modes of the structure (modes that should be included) may vary considerably throughout the design process. This is also true as the locations and/or masses of the sensors and actuators change. Moreover, since the number of design evaluations in the integrated design process could easily run into thousands, any feasible order-reduction method should not require model reduction analysis at every design iteration. In this paper a novel and efficient technique for model reduction in the integrated controls-structures design process, which addresses these issues, is presented.

Design Integration of Facilities Management

DEFF Research Database (Denmark)

Jensen, Per Anker

2009-01-01

One of the problems in the building industry is a limited degree of learning from experiences of use and operation of existing buildings. Development of professional facilities management (FM) can be seen as the missing link to bridge the gap between building operation and building design....... Strategies, methods and barriers for the transfer and integration of operational knowledge into the design process are discussed. Multiple strategies are needed to improve the integration of FM in design. Building clients must take on a leading role in defining and setting up requirements and procedures...... on literature studies and case studies from the Nordic countries in Europe, including research reflections on experiences from a main case study, where the author, before becoming a university researcher, was engaged in the client organization as deputy project director with responsibility for the integration...

A Primer on Observational Measurement.

Science.gov (United States)

Girard, Jeffrey M; Cohn, Jeffrey F

2016-08-01

Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Integrating ergonomic knowledge into engineering design processes

DEFF Research Database (Denmark)

Hall-Andersen, Lene Bjerg

Integrating ergonomic knowledge into engineering design processes has been shown to contribute to healthy and effective designs of workplaces. However, it is also well-recognized that, in practice, ergonomists often have difficulties gaining access to and impacting engineering design processes...... employed in the same company, constituted a supporting factor for the possibilities to integrate ergonomic knowledge into the engineering design processes. However, the integration activities remained discrete and only happened in some of the design projects. A major barrier was related to the business...... to the ergonomic ambitions of the clients. The ergonomists’ ability to navigate, act strategically, and compromise on ergonomic inputs is also important in relation to having an impact in the engineering design processes. Familiarity with the engineering design terminology and the setup of design projects seems...

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Integrated design of MEMS

DEFF Research Database (Denmark)

De Grave, Arnaud; Brissaud, Daniel

2007-01-01

Emerging technologies of Micro-Electromechanical Systems (MEMS) are applications such as airbag accelerometers. Micro-products present many physical differences from macro-products. Moreover, there is a high level of integration in multiple fields of physics with strongly coupled effects...... industrial immersion to propose a socio-technological description of the design process and MEMS design tools....

The Application of Integrated Design System for HTR-PM Design

International Nuclear Information System (INIS)

Qi Shi; Xiaojing Kang

2014-01-01

SmartPlant Enterprise(SPE) developed by Intergraph from America is a new generation integrated solution for engineering design. Combined with the application in a nuclear engineering, this paper introduced the composition and the data flow of Integrated Design System established by SPE, analyzed the advantages and the insufficiency, and provided the direction of continuous improvement. (author)

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Integrated Energy Design

DEFF Research Database (Denmark)

Brunsgaard, Camilla; Dvořáková, Pavla; Wyckmans, Annemie

2014-01-01

the development, it is essential that educational institutions foster professionals with such knowledge, skills and competences. An initiative toward this direction is the EUproject of IDES-EDU: “Master and Post-Graduate education and training in multi-disciplinary teams”. The paper describes the necessity...... of more integrated and cross-disciplinary approaches to building design through state-of-the-art of the building sector and educational initiatives in the participating countries in the project, and through theory of design processes. The paper also communicates the results of newly developed cross...

Consequence Based Design. An approach for integrating computational collaborative models (Integrated Dynamic Models) in the building design phase

DEFF Research Database (Denmark)

Negendahl, Kristoffer

relies on various advancements in the area of integrated dynamic models. It also relies on the application and test of the approach in practice to evaluate the Consequence based design and the use of integrated dynamic models. As a result, the Consequence based design approach has been applied in five...... and define new ways to implement integrated dynamic models for the following project. In parallel, seven different developments of new methods, tools and algorithms have been performed to support the application of the approach. The developments concern: Decision diagrams – to clarify goals and the ability...... affect the design process and collaboration between building designers and simulationists. Within the limits of applying the approach of Consequence based design to five case studies, followed by documentation based on interviews, surveys and project related documentations derived from internal reports...

Integrated Radiation Analysis and Design Tools

Data.gov (United States)

National Aeronautics and Space Administration — The Integrated Radiation Analysis and Design Tools (IRADT) Project develops and maintains an integrated tool set that collects the current best practices, databases,...

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Design Creativity: Future Directions for Integrated Visualisation

Directory of Open Access Journals (Sweden)

Jack Steven Goulding

2015-11-01

Full Text Available The Architecture, Engineering and Construction (AEC sectors are facing unprecedented challenges, not just with increased complexity of projects per se, but design-related integration. This requires stakeholders to radically re-think their existing business models (and thinking that underpins them, but also the technological challenges and skills required to deliver these projects. Whilst opponents will no doubt cite that this is nothing new as the sector as a whole has always had to respond to change; the counter to this is that design ‘creativity’ is now much more dependent on integration from day one. Given this, collaborative processes embedded in Building Information Modelling (BIM models have been proffered as a panacea solution to embrace this change and deliver streamlined integration. The veracity of design teams’ “project data” is increasingly becoming paramount - not only for the coordination of design, processes, engineering services, fabrication, construction, and maintenance; but more importantly, facilitate ‘true’ project integration and interchange – the actualisation of which will require firm consensus and commitment. This Special Issue envisions some of these issues, challenges and opportunities (from a future landscape perspective, by highlighting a raft of concomitant factors, which include: technological challenges, design visualisation and integration, future digital tools, new and anticipated operating environments, and training requirements needed to deliver these aspirations. A fundamental part of this Special Issue’s ‘call’ was to capture best practice in order to demonstrate how design, visualisation and delivery processes (and technologies affect the finished product viz: design outcome, design procedures, production methodologies and construction implementation. In this respect, the use of virtual environments are now particularly effective at supporting the design and delivery processes. In

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

Design of 3D integrated circuits and systems

CERN Document Server

Sharma, Rohit

2014-01-01

Three-dimensional (3D) integration of microsystems and subsystems has become essential to the future of semiconductor technology development. 3D integration requires a greater understanding of several interconnected systems stacked over each other. While this vertical growth profoundly increases the system functionality, it also exponentially increases the design complexity. Design of 3D Integrated Circuits and Systems tackles all aspects of 3D integration, including 3D circuit and system design, new processes and simulation techniques, alternative communication schemes for 3D circuits and sys

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

SUBSURFACE REPOSITORY INTEGRATED CONTROL SYSTEM DESIGN

International Nuclear Information System (INIS)

C.J. Fernado

1998-01-01

The purpose of this document is to develop preliminary high-level functional and physical control system architectures for the proposed subsurface repository at Yucca Mountain. This document outlines overall control system concepts that encompass and integrate the many diverse systems being considered for use within the subsurface repository. This document presents integrated design concepts for monitoring and controlling the diverse set of subsurface operations. The subsurface repository design will be composed of a series of diverse systems that will be integrated to accomplish a set of overall functions and objectives. The subsurface repository contains several Instrumentation and Control (I andC) related systems including: waste emplacement systems, ventilation systems, communication systems, radiation monitoring systems, rail transportation systems, ground control monitoring systems, utility monitoring systems (electrical, lighting, water, compressed air, etc.), fire detection and protection systems, retrieval systems, and performance confirmation systems. Each of these systems involve some level of I andC and will typically be integrated over a data communication network. The subsurface I andC systems will also integrate with multiple surface-based site-wide systems such as emergency response, health physics, security and safeguards, communications, utilities and others. The scope and primary objectives of this analysis are to: (1) Identify preliminary system level functions and interface needs (Presented in the functional diagrams in Section 7.2). (2) Examine the overall system complexity and determine how and on what levels these control systems will be controlled and integrated (Presented in Section 7.2). (3) Develop a preliminary subsurface facility-wide design for an overall control system architecture, and depict this design by a series of control system functional block diagrams (Presented in Section 7.2). (4) Develop a series of physical architectures

SUBSURFACE REPOSITORY INTEGRATED CONTROL SYSTEM DESIGN

Energy Technology Data Exchange (ETDEWEB)

C.J. Fernado

1998-09-17

The purpose of this document is to develop preliminary high-level functional and physical control system architectures for the proposed subsurface repository at Yucca Mountain. This document outlines overall control system concepts that encompass and integrate the many diverse systems being considered for use within the subsurface repository. This document presents integrated design concepts for monitoring and controlling the diverse set of subsurface operations. The subsurface repository design will be composed of a series of diverse systems that will be integrated to accomplish a set of overall functions and objectives. The subsurface repository contains several Instrumentation and Control (I&C) related systems including: waste emplacement systems, ventilation systems, communication systems, radiation monitoring systems, rail transportation systems, ground control monitoring systems, utility monitoring systems (electrical, lighting, water, compressed air, etc.), fire detection and protection systems, retrieval systems, and performance confirmation systems. Each of these systems involve some level of I&C and will typically be integrated over a data communication network. The subsurface I&C systems will also integrate with multiple surface-based site-wide systems such as emergency response, health physics, security and safeguards, communications, utilities and others. The scope and primary objectives of this analysis are to: (1) Identify preliminary system level functions and interface needs (Presented in the functional diagrams in Section 7.2). (2) Examine the overall system complexity and determine how and on what levels these control systems will be controlled and integrated (Presented in Section 7.2). (3) Develop a preliminary subsurface facility-wide design for an overall control system architecture, and depict this design by a series of control system functional block diagrams (Presented in Section 7.2). (4) Develop a series of physical architectures that

Primer on gas integrated resource planning

Energy Technology Data Exchange (ETDEWEB)

Goldman, C.; Comnes, G.A.; Busch, J.; Wiel, S. [Lawrence Berkeley Lab., CA (United States)

1993-12-01

This report discusses the following topics: gas resource planning: need for IRP; gas integrated resource planning: methods and models; supply and capacity planning for gas utilities; methods for estimating gas avoided costs; economic analysis of gas utility DSM programs: benefit-cost tests; gas DSM technologies and programs; end-use fuel substitution; and financial aspects of gas demand-side management programs.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Safety design integrated in the building delivery system

DEFF Research Database (Denmark)

Jørgensen, Kirsten

2013-01-01

. The purpose of this article is to demonstrate how safety and health can be integrated in the design phases integrated in the management delivery systems within construction, The method for the research was to go through the building delivery system step by step and create a normative description of what, when......In construction, it is important to view safety and health as an integrated part of the way that “designers” are working. The designers cowers architects, constructors, engineers and others who carry out their consulting services in the design phase of a construction project. The philosophy...... and how to fully integrate safety in each part of the process. The result is a concept and guideline including control forms for how to integrate safety design in the Building Delivery System plus what to do and when. The concept has been tested in an educational context. The practical value...

Designing to target cost: one approach to design/construction integration

DEFF Research Database (Denmark)

Jørgensen, Bo

2005-01-01

One approach to a more integrated construction delivery process is the concept of ‘designing to target cost’ of which the first examples of application within a lean construction framework have recently been seen. This paper introduces the main principles of the design to target cost method...... and discusses the applicability of this approach to construction. The low degree of organizational and technical continuity from one construction project to the next limits the applicability of the design for target cost approach when compared to its origin in product development of mass manufactured artefacts....... It can be argued that design to target cost may also provide a frame for developing the supply chain towards better coordination and collaboration. Thus methods of design to target cost may serve to facilitate the development of a more integrated supply chain....

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

Suspended Integrated Strip-line Transition Design for Highly Integrated Radar Systems

Science.gov (United States)

2017-03-01

technology. The measured results show good correlation to the simulated results with a return loss and insertion loss of less than 10 dB and greater...SSS); Suspended Integrated Strip-line (SISL) RF packaging; Ultra-wideband (UWB). Introduction The next generation of highly integrated radar...RF Circuit Design,” Second Edition, Pearson Education, 2009. 3. B. Ma, A. Chousseaud, and S. Toutain, “A new design of compact planar microstrip

Laser and photonic systems design and integration

CERN Document Server

Nof, Shimon Y; Cheng, Gary J

2014-01-01

New, significant scientific discoveries in laser and photonic technologies, systems perspectives, and integrated design approaches can improve even further the impact in critical areas of challenge. Yet this knowledge is dispersed across several disciplines and research arenas. Laser and Photonic Systems: Design and Integration brings together a multidisciplinary group of experts to increase understanding of the ways in which systems perspectives may influence laser and photonic innovations and application integration.By bringing together chapters from leading scientists and technologists, ind

Design Integration - a theroretical and empirical study of design integration in small and medium sized Danish companies

DEFF Research Database (Denmark)

Erichsen, Pia Geisby

er drivkræft. Afhandlingen bidrager til design management feltet med en ny måde at tale om og forstå design integration. Yderligere bidrager den med ny viden omkring dynamikken omkring design integration. Sidst men ikke mindst biddrager den til, at designledelseskonsulenter samt små og mellemstore...... organisatorisk kontekst?’ - blev søgt besvaret gennem to litteraturstudier af henholdsvis design management og design. Litteraturstudiet af design management gav imidlertid kun begrænsede svar på spørgsmålet ’hvad er design?’. Designfeltet derimod kunne give et mere nuanceret svar, hvilket resulterede i en ny...... blev det identificeret, at det var relevant, at se på barrierer og drivkræfter et dynamisk perspektiv. Via observationsstudiet blev designtrappen identificeret som relevant i forhold til forskningsspørgsmålet, men modellen havde også nogle indbyggede barrierer, hvorfor der blev søgt efter andre...

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Power management techniques for integrated circuit design

CERN Document Server

Chen, Ke-Horng

2016-01-01

This book begins with the premise that energy demands are directing scientists towards ever-greener methods of power management, so highly integrated power control ICs (integrated chip/circuit) are increasingly in demand for further reducing power consumption. * A timely and comprehensive reference guide for IC designers dealing with the increasingly widespread demand for integrated low power management * Includes new topics such as LED lighting, fast transient response, DVS-tracking and design with advanced technology nodes * Leading author (Chen) is an active and renowned contributor to the power management IC design field, and has extensive industry experience * Accompanying website includes presentation files with book illustrations, lecture notes, simulation circuits, solution manuals, instructors manuals, and program downloads.

Human Integration Design Processes (HIDP)

Science.gov (United States)

Boyer, Jennifer

2014-01-01

The purpose of the Human Integration Design Processes (HIDP) document is to provide human-systems integration design processes, including methodologies and best practices that NASA has used to meet human systems and human rating requirements for developing crewed spacecraft. HIDP content is framed around human-centered design methodologies and processes in support of human-system integration requirements and human rating. NASA-STD-3001, Space Flight Human-System Standard, is a two-volume set of National Aeronautics and Space Administration (NASA) Agency-level standards established by the Office of the Chief Health and Medical Officer, directed at minimizing health and performance risks for flight crews in human space flight programs. Volume 1 of NASA-STD-3001, Crew Health, sets standards for fitness for duty, space flight permissible exposure limits, permissible outcome limits, levels of medical care, medical diagnosis, intervention, treatment and care, and countermeasures. Volume 2 of NASASTD- 3001, Human Factors, Habitability, and Environmental Health, focuses on human physical and cognitive capabilities and limitations and defines standards for spacecraft (including orbiters, habitats, and suits), internal environments, facilities, payloads, and related equipment, hardware, and software with which the crew interfaces during space operations. The NASA Procedural Requirements (NPR) 8705.2B, Human-Rating Requirements for Space Systems, specifies the Agency's human-rating processes, procedures, and requirements. The HIDP was written to share NASA's knowledge of processes directed toward achieving human certification of a spacecraft through implementation of human-systems integration requirements. Although the HIDP speaks directly to implementation of NASA-STD-3001 and NPR 8705.2B requirements, the human-centered design, evaluation, and design processes described in this document can be applied to any set of human-systems requirements and are independent of reference

Argentinean integrated small reactor design and scale economy analysis of integrated reactor

International Nuclear Information System (INIS)

Florido, P. C.; Bergallo, J. E.; Ishida, M. V.

2000-01-01

This paper describes the design of CAREM, which is Argentinean integrated small reactor project and the scale economy analysis results of integrated reactor. CAREM project consists on the development, design and construction of a small nuclear power plant. CAREM is an advanced reactor conceived with new generation design solutions and standing on the large experience accumulated in the safe operation of Light Water Reactors. The CAREM is an indirect cycle reactor with some distinctive and characteristic features that greatly simplify the reactor and also contribute to a highly level of safety: integrated primary cooling system, self pressurized, primary cooling by natural circulation and safety system relying on passive features. For a fully doupled economic evaluation of integrated reactors done by IREP (Integrated Reactor Evaluation Program) code transferred to IAEA, CAREM have been used as a reference point. The results shows that integrated reactors become competitive with power larger than 200MWe with Argentinean cheapest electricity option. Due to reactor pressure vessel construction limit, low pressure drop steam generator are used to reach power output of 200MWe for natural circulation. For forced circulation, 300MWe can be achieved. (author)

Advanced Concept Architecture Design and Integrated Analysis (ACADIA)

Science.gov (United States)

2017-11-03

1 Advanced Concept Architecture Design and Integrated Analysis (ACADIA) Submitted to the National Institute of Aerospace (NIA) on...Research Report 20161001 - 20161030 Advanced Concept Architecture Design and Integrated Analysis (ACADIA) W911NF-16-2-0229 8504Cedric Justin, Youngjun

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Three Course Connections: Integrated Event Design

Science.gov (United States)

Johnson, Corey W.; Pate, Joseph A.

2013-01-01

Integrated Event Design (IED) capitalizes on three distinct courses to achieve a blended course delivery: Event Management, Research and Evaluation (for undergraduate students), and Experiential Education (for graduate students). Through the use of an event management company metaphor that fully integrates the diverse curricular concepts, course…

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

Science.gov (United States)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

KAUST Repository

Mastan, Shaik G.

2011-05-10

Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

International Nuclear Information System (INIS)

D. S. Lucas

2004-01-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

Designing interaction behaviour in service-oriented enterprise application integration

NARCIS (Netherlands)

Dirgahayu, T.; Quartel, Dick; van Sinderen, Marten J.

In this paper we present an approach for designing interaction behaviour in service-oriented enterprise application integration. The approach enables business analysts to actively participate in the design of an integration solution. In this way, we expect that the solution meets its integration

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

Science.gov (United States)

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

Integrating Thermal Tools Into the Mechanical Design Process

Science.gov (United States)

Tsuyuki, Glenn T.; Siebes, Georg; Novak, Keith S.; Kinsella, Gary M.

1999-01-01

The intent of mechanical design is to deliver a hardware product that meets or exceeds customer expectations, while reducing cycle time and cost. To this end, an integrated mechanical design process enables the idea of parallel development (concurrent engineering). This represents a shift from the traditional mechanical design process. With such a concurrent process, there are significant issues that have to be identified and addressed before re-engineering the mechanical design process to facilitate concurrent engineering. These issues also assist in the integration and re-engineering of the thermal design sub-process since it resides within the entire mechanical design process. With these issues in mind, a thermal design sub-process can be re-defined in a manner that has a higher probability of acceptance, thus enabling an integrated mechanical design process. However, the actual implementation is not always problem-free. Experience in applying the thermal design sub-process to actual situations provides the evidence for improvement, but more importantly, for judging the viability and feasibility of the sub-process.

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

Directory of Open Access Journals (Sweden)

Hamidreza Monavari

2013-12-01

Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Development of mechanical design technology for integral reactor

Energy Technology Data Exchange (ETDEWEB)

Park, Keun Bae; Choi, Suhn; Kim, Kang Soo; Kim, Tae Wan; Jeong, Kyeong Hoon; Lee, Gyu Mahn

1999-03-01

While Korean nuclear reactor strategy seems to remain focused on the large capacity power generation, it is expected that demand of small and medium size reactor will arise for multi-purpose application such as small capacity power generation, co-generation and sea water desalination. With this in mind, an integral reactor SMART is under development. Design concepts, system layout and types of equipment of integral reactor are significantly different from those of loop type reactor. Conceptual design development of mechanical structures of integral reactor SMART is completed through the first stage of the project. Efforts were endeavored for the establishment of design basis and evaluation of applicable codes and standards. Design and functional requirements of major structural components were setup, and three dimensional structural modelling of SMART reactor vessel assembly was prepared. Also, maintenance and repair scheme as well as preliminary fabricability evaluation were carried out. Since small integral reactor technology includes sensitive technologies and know-how's, it is hard to achieve systematic and comprehensive technology transfer from nuclear-advanced countries. Thus, it is necessary to develop the related design technology and to verify the adopted methodologies through test and experiments in order to assure the structural integrity of reactor system. (author)

Development of mechanical design technology for integral reactor

International Nuclear Information System (INIS)

Park, Keun Bae; Choi, Suhn; Kim, Kang Soo; Kim, Tae Wan; Jeong, Kyeong Hoon; Lee, Gyu Mahn

1999-03-01

While Korean nuclear reactor strategy seems to remain focused on the large capacity power generation, it is expected that demand of small and medium size reactor will arise for multi-purpose application such as small capacity power generation, co-generation and sea water desalination. With this in mind, an integral reactor SMART is under development. Design concepts, system layout and types of equipment of integral reactor are significantly different from those of loop type reactor. Conceptual design development of mechanical structures of integral reactor SMART is completed through the first stage of the project. Efforts were endeavored for the establishment of design basis and evaluation of applicable codes and standards. Design and functional requirements of major structural components were set up, and three dimensional structural modelling of SMART reactor vessel assembly was prepared. Also, maintenance and repair scheme as well as preliminary fabricability evaluation were carried out. Since small integral reactor technology includes sensitive technologies and know-how's, it is hard to achieve systematic and comprehensive technology transfer from nuclear-advanced countries. Thus, it is necessary to develop the related design technology and to verify the adopted methodologies through test and experiments in order to assure the structural integrity of reactor system. (author)

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Development of integrated platform for computational material design

Energy Technology Data Exchange (ETDEWEB)

Kiyoshi, Matsubara; Kumi, Itai; Nobutaka, Nishikawa; Akifumi, Kato [Center for Computational Science and Engineering, Fuji Research Institute Corporation (Japan); Hideaki, Koike [Advance Soft Corporation (Japan)

2003-07-01

The goal of our project is to design and develop a problem-solving environment (PSE) that will help computational scientists and engineers develop large complicated application software and simulate complex phenomena by using networking and parallel computing. The integrated platform, which is designed for PSE in the Japanese national project of Frontier Simulation Software for Industrial Science, is defined by supporting the entire range of problem solving activity from program formulation and data setup to numerical simulation, data management, and visualization. A special feature of our integrated platform is based on a new architecture called TASK FLOW. It integrates the computational resources such as hardware and software on the network and supports complex and large-scale simulation. This concept is applied to computational material design and the project 'comprehensive research for modeling, analysis, control, and design of large-scale complex system considering properties of human being'. Moreover this system will provide the best solution for developing large and complicated software and simulating complex and large-scaled phenomena in computational science and engineering. A prototype has already been developed and the validation and verification of an integrated platform will be scheduled by using the prototype in 2003. In the validation and verification, fluid-structure coupling analysis system for designing an industrial machine will be developed on the integrated platform. As other examples of validation and verification, integrated platform for quantum chemistry and bio-mechanical system are planned.

Development of integrated platform for computational material design

International Nuclear Information System (INIS)

Kiyoshi, Matsubara; Kumi, Itai; Nobutaka, Nishikawa; Akifumi, Kato; Hideaki, Koike

2003-01-01

The goal of our project is to design and develop a problem-solving environment (PSE) that will help computational scientists and engineers develop large complicated application software and simulate complex phenomena by using networking and parallel computing. The integrated platform, which is designed for PSE in the Japanese national project of Frontier Simulation Software for Industrial Science, is defined by supporting the entire range of problem solving activity from program formulation and data setup to numerical simulation, data management, and visualization. A special feature of our integrated platform is based on a new architecture called TASK FLOW. It integrates the computational resources such as hardware and software on the network and supports complex and large-scale simulation. This concept is applied to computational material design and the project 'comprehensive research for modeling, analysis, control, and design of large-scale complex system considering properties of human being'. Moreover this system will provide the best solution for developing large and complicated software and simulating complex and large-scaled phenomena in computational science and engineering. A prototype has already been developed and the validation and verification of an integrated platform will be scheduled by using the prototype in 2003. In the validation and verification, fluid-structure coupling analysis system for designing an industrial machine will be developed on the integrated platform. As other examples of validation and verification, integrated platform for quantum chemistry and bio-mechanical system are planned

Bringing service design to manufacturing companies: integrating PSS and service design approaches

DEFF Research Database (Denmark)

Costa, Nina; Patrício, Lia; Morelli, Nicola

2018-01-01

in a manufacturing industry. This paper details how the application supports the design of product–service system solutions from the exploration to the implementation stages, highlighting the physical evidence of service, and contributes to advance design research at the intersection of PSS and Service Design.......Manufacturing companies increasingly try to innovate in their offers to consumers by creating more complete solutions that combine product and service components. However, shifting from a product-centric perspective to a solution-oriented perspective is challenging. The present study adopted...... a design research methodology and built on Service-Dominant logic, integrating the human-oriented perspective of Service Design with an organizational network-oriented perspective of Product–Service System. It creates a new Integrative PSS approach, evolves design models, and provides an application...

User's guide to designing and mounting lenses and mirrors

International Nuclear Information System (INIS)

Kowalskie, B.J.

1978-01-01

The guidebook is a practitioner-oriented supplement to standard texts in optics and mechanical engineering. It reflects practical experience with the oftentimes troublesome aspects of effectively integrating optical components with mechanical hardware. Accordingly, its focus is on the techniques, assumptions, and levels of design sophistication needed for a wide variety of sizes and optical surface quality levels. It is intended to be a primer for engineers, designers, and draftsmen already familiar with some of the problems encountered in mounting optical components and who are responsible for developing components for high-energy laser systems

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Human-Centered Design as an Integrating Discipline

Directory of Open Access Journals (Sweden)

Guy André Boy

2017-02-01

Full Text Available What is research today? Good research has to be indexed within appropriate mechanisms to be visible, considered and finally useful. These mechanisms are based on quantitative research methods and codes that are often very academic. Consequently, they impose rigorous constraints on the way results should be obtained and presented. In addition, everything people learn in academia needs to be graded. This leads to standard packaging of what should be learned and results in making people executants and not creators nor inventors. In other words, this academic standardization precludes freedom for innovation. This paper proposes Human-Centered Design (HCD as a solution to override these limitations and roadblocks. HCD involves expertise, experience, participation, modeling and simulation, complexity analysis and qualitative research. What is education today? Education is organized in silos with little attempt to integrate individual academic disciplines. Large system integration is almost never learned in engineering schools, and Human- Systems Integration (HSI even less. Instead, real-life problemsolving requires integration skills. What is design research? We often hear that design has nothing to do with research, and conversely. Putting design and research together, as complementary disciplines, contributes to combine creativity, rigorous demonstration and validation. This is somehow what HCD is about.

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Integrating Safeguards and Security with Safety into Design

International Nuclear Information System (INIS)

Bean, Robert S.; Hockert, John W.; Hebditch, David J.

2009-01-01

There is a need to minimize security risks, proliferation hazards, and safety risks in the design of new nuclear facilities in a global environment of nuclear power expansion, while improving the synergy of major design features and raising operational efficiency. In 2008, the U.S. Department of Energy (DOE), National Nuclear Security Administration (NNSA) launched the Next Generation Safeguards Initiative (NGSI) covering many safeguards areas. One of these, launched by NNSA with support of the DOE Office of Nuclear Energy, was a multi-laboratory project, led by the Idaho National Laboratory (INL), to develop safeguards by design. The proposed Safeguards-by-Design (SBD) process has been developed as a structured approach to ensure the timely, efficient, and cost effective integration of international safeguards and other nonproliferation barriers with national material control and accountability, physical security, and safety objectives into the overall design process for the nuclear facility lifecycle. A graded, iterative process was developed to integrate these areas throughout the project phases. It identified activities, deliverables, interfaces, and hold points covering both domestic regulatory requirements and international safeguards using the DOE regulatory environment as exemplar to provide a framework and guidance for project management and integration of safety with security during design. Further work, reported in this paper, created a generalized SBD process which could also be employed within the licensed nuclear industry and internationally for design of new facilities. Several tools for integrating safeguards, safety, and security into design are discussed here. SBD appears complementary to the EFCOG TROSSI process for security and safety integration created in 2006, which focuses on standardized upgrades to enable existing DOE facilities to meet a more severe design basis threat. A collaborative approach is suggested.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Denilce Meneses Lopes

2010-01-01

Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

Integration of Design and Control through Model Analysis

DEFF Research Database (Denmark)

Russel, Boris Mariboe; Henriksen, Jens Peter; Jørgensen, Sten Bay

2002-01-01

A systematic computer aided analysis of the process model is proposed as a pre-solution step for integration of design and control problems. The process model equations are classified in terms of balance equations, constitutive equations and conditional equations. Analysis of the phenomena models...... (structure selection) issues for the integrated problems are considered. (C) 2002 Elsevier Science Ltd. All rights reserved....... representing the constitutive equations identify the relationships between the important process and design variables, which help to understand, define and address some of the issues related to integration of design and control. Furthermore, the analysis is able to identify a set of process (control) variables...

Building Integrated Design Practice under the Concept of Sustainable Development

Science.gov (United States)

Liu, Xuexin

2018-03-01

With the continuous development of social economy, people are more demanding for architecture. Some advanced design concepts are gradually applied to the design of buildings. Under the concept of sustainable development, building integration design has also been widely used to promote the rapid development of architectural design. Integrated design concepts and sustainable development concepts play an important role to meet people’s requirements. This article will explore the concept of sustainable development under the concept of integrated architectural design and practice analysis, propose appropriate measures.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

Science.gov (United States)

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Integration of MGDS design into the licensing process

International Nuclear Information System (INIS)

1997-12-01

This paper presents an overview of how the Mined Geologic Disposal System (MGDS) design for a potential repository is integrated into the licensing process. The integration process employs a two-told approach: (1) ensure that the MGDS design complies with applicable Nuclear Regulatory Commission (NRC) licensing requirements, and (2) ensure that the MGDS design is appropriately reflected in a license application that is acceptable to the NRC for performing acceptance and compliance reviews

An Integrated Design Process

DEFF Research Database (Denmark)

Petersen, Mads Dines; Knudstrup, Mary-Ann

2010-01-01

Present paper is placed in the discussion about how sustainable measures are integrated in the design process by architectural offices. It presents results from interviews with four leading Danish architectural offices working with sustainable architecture and their experiences with it, as well...... as the requirements they meet in terms of how to approach the design process – especially focused on the early stages like a competition. The interviews focus on their experiences with working in multidisciplinary teams and using digital tools to support their work with sustainable issues. The interviews show...... the environmental measures cannot be discarded due to extra costs....

A primer on pseudorandom generators

CERN Document Server

Goldreich, Oded

2010-01-01

A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

Integrated aerodynamic-structural design of a forward-swept transport wing

Science.gov (United States)

Haftka, Raphael T.; Grossman, Bernard; Kao, Pi-Jen; Polen, David M.; Sobieszczanski-Sobieski, Jaroslaw

1989-01-01

The introduction of composite materials is having a profound effect on aircraft design. Since these materials permit the designer to tailor material properties to improve structural, aerodynamic and acoustic performance, they require an integrated multidisciplinary design process. Futhermore, because of the complexity of the design process, numerical optimization methods are required. The utilization of integrated multidisciplinary design procedures for improving aircraft design is not currently feasible because of software coordination problems and the enormous computational burden. Even with the expected rapid growth of supercomputers and parallel architectures, these tasks will not be practical without the development of efficient methods for cross-disciplinary sensitivities and efficient optimization procedures. The present research is part of an on-going effort which is focused on the processes of simultaneous aerodynamic and structural wing design as a prototype for design integration. A sequence of integrated wing design procedures has been developed in order to investigate various aspects of the design process.

Integrated plant information technology design support functionality

International Nuclear Information System (INIS)

Kim, Yeon Seung; Kim, Dae Jin; Barber, P. W.; Goland, D.

1996-06-01

This technical report was written as a result of Integrated Plant Information System (IPIS) feasibility study on CANDU 9 project which had been carried out from January, 1994 to March, 1994 at AECL (Atomic Energy Canada Limited) in Canada. From 1987, AECL had done endeavour to change engineering work process from paper based work process to computer based work process through CANDU 3 project. Even though AECL had a lot of good results form computerizing the Process Engineering, Instrumentation Control and Electrical Engineering, Mechanical Engineering, Computer Aided Design and Drafting, and Document Management System, but there remains the problem of information isolation and integration. On this feasibility study, IPIS design support functionality guideline was suggested by evaluating current AECL CAE tools, analyzing computer aided engineering task and work flow, investigating request for implementing integrated computer aided engineering and describing Korean request for future CANDU design including CANDU 9. 6 figs. (Author)

Integrated plant information technology design support functionality

Energy Technology Data Exchange (ETDEWEB)

Kim, Yeon Seung; Kim, Dae Jin [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of); Barber, P W; Goland, D [Atomic Energy Canada Ltd., (Canada)

1996-06-01

This technical report was written as a result of Integrated Plant Information System (IPIS) feasibility study on CANDU 9 project which had been carried out from January, 1994 to March, 1994 at AECL (Atomic Energy Canada Limited) in Canada. From 1987, AECL had done endeavour to change engineering work process from paper based work process to computer based work process through CANDU 3 project. Even though AECL had a lot of good results form computerizing the Process Engineering, Instrumentation Control and Electrical Engineering, Mechanical Engineering, Computer Aided Design and Drafting, and Document Management System, but there remains the problem of information isolation and integration. On this feasibility study, IPIS design support functionality guideline was suggested by evaluating current AECL CAE tools, analyzing computer aided engineering task and work flow, investigating request for implementing integrated computer aided engineering and describing Korean request for future CANDU design including CANDU 9. 6 figs. (Author).

An analog integrated circuit design laboratory

OpenAIRE

Mondragon-Torres, A.F.; Mayhugh, Jr.; Pineda de Gyvez, J.; Silva-Martinez, J.; Sanchez-Sinencio, E.

2003-01-01

We present the structure of an analog integrated circuit design laboratory to instruct at both, senior undergraduate and entry graduate levels. The teaching material includes: a laboratory manual with analog circuit design theory, pre-laboratory exercises and circuit design specifications; a reference web page with step by step instructions and examples; the use of mathematical tools for automation and analysis; and state of the art CAD design tools in use by industry. Upon completion of the ...

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Man-machine design integration

Energy Technology Data Exchange (ETDEWEB)

Carrera, J.P. [Westinghouse Electric Corp., Monroeville, PA (United States). Nuclear Technology Div.; Haentjens, J. [Westinghouse Electric Corp., Brussels (Belgium). Nuclear Technology Div.

1995-12-31

The presentation overviews the bases for Man-Machine Interface (MMI) designs that are part of three other presentations during the same conference: Advanced Alarm Management System, Functional Displays and System for Emergency Procedure Execution Monitoring. The MMD group history, team and goals are summarized to give some context to the core of the MMD philosophy and integration. (10 refs., 5 figs.).

Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2012-03-01

Full Text Available The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG4, (TCC5 and (CA7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi.

Designing Integrated Product- Service System Solutions in Manufacturing Industries

DEFF Research Database (Denmark)

Costa, Nina; Patrício, Lia; Morelli, Nicola

2015-01-01

Manufacturing firms are increasingly evolving towards the design of integrated product-service solutions but servitization literature does not provide specific guidance on how to design these integrated solutions. Building upon ProductService System (PSS) and Service Design (SD) approaches...... how it brings new insights to manufacturing companies moving to a service, value cocreation perspective....

Design of analog integrated circuits and systems

CERN Document Server

Laker, Kenneth R

1994-01-01

This text is designed for senior or graduate level courses in analog integrated circuits or design of analog integrated circuits. This book combines consideration of CMOS and bipolar circuits into a unified treatment. Also included are CMOS-bipolar circuits made possible by BiCMOS technology. The text progresses from MOS and bipolar device modelling to simple one and two transistor building block circuits. The final two chapters present a unified coverage of sample-data and continuous-time signal processing systems.

Design of an integrated I and C system

International Nuclear Information System (INIS)

Lee, C. K.; Oh, I. S.; Kim, D. H.

2004-08-01

The final goal of this project is to develop an integrated I and C systems, and through this project the localized equipment and systems being developed should secure the safety, the reliability, their applicability and technical competitiveness. As well, the technical interfaces among sub-projects should be maintained for integration. The results of this project are as following ; 1. Development of an integrated I and C system architecture: Development of the design concepts for KNICS and the design requirements for each I and C system, Development of the design requirements of control systems based on DCS, Design of the communication systems, Design of the interface signals among systems and analysis of traffic load for networks, Conceptual design of measuring and monitoring systems, Review of the structure of computer systems for information processing, Development of architectures for each system and KOICS 2. Technological integration and management of projects: Development of evaluation criteria for DCS and network systems, Evaluation of the DCS prototype, Design review of KNICS protection system, Review of the functions and design requirements of I and C systems in NPP, Analysis of the I and C system H/W in NPP and the APR1400 I and C system design, Review of the technology criteria and the regulatory trend for licensing issues, Extracting items for preparing the technical description of I and C systems, a part of proposal to invitation to bid (ITB), Planning for KNICS to be of practical use The results of this project will be applied as design bases during the development of 2nd phase KNICS. As well it is expected that the results of this project will be finally applied for the technical self-reliance of component design and manufacturing of NPP I and C systems

Integrating sustainability in interior design studio

OpenAIRE

Karslı, Umut Tuğlu

2013-01-01

Teaching methods on concept of sustainability are frequently searched in the interior architecture education. The purpose of this study is to propose a model for integrating sustainability in interior design studio. In this context, the first part of the research defines relationship between sustainability and interior architecture and determines sustainable interior design principles. In the second part, an interior design studio model is proposed and principles determined in the first part ...

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

Integrating conceptualizations of experience into the interaction design process

DEFF Research Database (Denmark)

Dalsgaard, Peter

2010-01-01

From a design perspective, the increasing awareness of experiential aspects of interactive systems prompts the question of how conceptualizations of experience can inform and potentially be integrated into the interaction design process. This paper presents one approach to integrating theoretical...

Integrating rock mechanics issues with repository design through design process principles and methodology

International Nuclear Information System (INIS)

Bieniawski, Z.T.

1996-01-01

A good designer needs not only knowledge for designing (technical know-how that is used to generate alternative design solutions) but also must have knowledge about designing (appropriate principles and systematic methodology to follow). Concepts such as open-quotes design for manufactureclose quotes or open-quotes concurrent engineeringclose quotes are widely used in the industry. In the field of rock engineering, only limited attention has been paid to the design process because design of structures in rock masses presents unique challenges to the designers as a result of the uncertainties inherent in characterization of geologic media. However, a stage has now been reached where we are be able to sufficiently characterize rock masses for engineering purposes and identify the rock mechanics issues involved but are still lacking engineering design principles and methodology to maximize our design performance. This paper discusses the principles and methodology of the engineering design process directed to integrating site characterization activities with design, construction and performance of an underground repository. Using the latest information from the Yucca Mountain Project on geology, rock mechanics and starter tunnel design, the current lack of integration is pointed out and it is shown how rock mechanics issues can be effectively interwoven with repository design through a systematic design process methodology leading to improved repository performance. In essence, the design process is seen as the use of design principles within an integrating design methodology, leading to innovative problem solving. In particular, a new concept of open-quotes Design for Constructibility and Performanceclose quotes is introduced. This is discussed with respect to ten rock mechanics issues identified for repository design and performance

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Behavioural design: A process for integrating behaviour change and design

DEFF Research Database (Denmark)

Cash, Philip; Hartlev, Charlotte Gram; Durazo, Christine Boysen

2017-01-01

Nudge, persuasion, and the influencing of human behaviour through design are increasingly important topics in design research and in the wider public consciousness. However, current theoretical approaches to behaviour change have yet to be operationalized this in design process support....... Specifically, there are few empirically grounded processes supporting designers in realising behaviour change projects. In response to this, 20 design projects from a case company are analysed in order to distil a core process for behavioural design. Results show a number of process stages and activities...... associated with project success, pointing to a new perspective on the traditional design process, and allowing designers to integrate key insights from behaviour change theory. Using this foundation we propose the Behavioural Design process....

Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

CERN Document Server

Barrett, Steven F

2012-01-01

This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

A Survey of Applications and Research in Integrated Design Systems Technology

Science.gov (United States)

1998-01-01

The initial part of the study was begun with a combination of literature searches, World Wide Web searches, and contacts with individuals and companies who were known to members of our team to have an interest in topics that seemed to be related to our study. There is a long list of such topics, such as concurrent engineering, design for manufacture, life-cycle engineering, systems engineering, systems integration, systems design, design systems, integrated product and process approaches, enterprise integration, integrated product realization, and similar terms. These all capture, at least in part, the flavor of what we describe here as integrated design systems. An inhibiting factor in this inquiry was the absence of agreed terminology for the study of integrated design systems. It is common for the term to be applied to what are essentially augmented Computer-Aided Design (CAD) systems, which are integrated only to the extent that agreements have been reached to attach proprietary extensions to proprietary CAD programs. It is also common for some to use the term integrated design systems to mean a system that applies only, or mainly, to the design phase of a product life cycle. It is likewise common for many of the terms listed earlier to be used as synonyms for integrated design systems. We tried to avoid this ambiguity by adopting the definition of integrated design systems that is implied in the introductory notes that we provided to our contacts, cited earlier. We thus arrived at this definition: Integrated Design Systems refers to the integration of the different tools and processes that comprise the engineering, of complex systems. It takes a broad view of the engineering of systems, to include consideration of the entire product realization process and the product life cycle. An important aspect of integrated design systems is the extent to which they integrate existing, "islands of automation" into a comprehensive design and product realization

Integrated Design Validation: Combining Simulation and Formal Verification for Digital Integrated Circuits

Directory of Open Access Journals (Sweden)

Lun Li

2006-04-01

Full Text Available The correct design of complex hardware continues to challenge engineers. Bugs in a design that are not uncovered in early design stages can be extremely expensive. Simulation is a predominantly used tool to validate a design in industry. Formal verification overcomes the weakness of exhaustive simulation by applying mathematical methodologies to validate a design. The work described here focuses upon a technique that integrates the best characteristics of both simulation and formal verification methods to provide an effective design validation tool, referred as Integrated Design Validation (IDV. The novelty in this approach consists of three components, circuit complexity analysis, partitioning based on design hierarchy, and coverage analysis. The circuit complexity analyzer and partitioning decompose a large design into sub-components and feed sub-components to different verification and/or simulation tools based upon known existing strengths of modern verification and simulation tools. The coverage analysis unit computes the coverage of design validation and improves the coverage by further partitioning. Various simulation and verification tools comprising IDV are evaluated and an example is used to illustrate the overall validation process. The overall process successfully validates the example to a high coverage rate within a short time. The experimental result shows that our approach is a very promising design validation method.

Radiological controls integrated into design

Energy Technology Data Exchange (ETDEWEB)

Kindred, G.W. [Cleveland Electric Illuminating Co., Perry, OH (United States)

1995-03-01

Radiological controls are required by law in the design of commercial nuclear power reactor facilities. These controls can be relatively minor or significant, relative to cost. To ensure that radiological controls are designed into a project, the health physicist (radiological engineer) must be involved from the beginning. This is especially true regarding keeping costs down. For every radiological engineer at a nuclear power plant there must be fifty engineers of other disciplines. The radiological engineer cannot be an expert on every discipline of engineering. However, he must be knowledgeable to the degree of how a design will impact the facility from a radiological perspective. This paper will address how to effectively perform radiological analyses with the goal of radiological controls integrated into the design package.

Design optimization of radiation-hardened CMOS integrated circuits

International Nuclear Information System (INIS)

1975-01-01

Ionizing-radiation-induced threshold voltage shifts in CMOS integrated circuits will drastically degrade circuit performance unless the design parameters related to the fabrication process are properly chosen. To formulate an approach to CMOS design optimization, experimentally observed analytical relationships showing strong dependences between threshold voltage shifts and silicon dioxide thickness are utilized. These measurements were made using radiation-hardened aluminum-gate CMOS inverter circuits and have been corroborated by independent data taken from MOS capacitor structures. Knowledge of these relationships allows one to define ranges of acceptable CMOS design parameters based upon radiation-hardening capabilities and post-irradiation performance specifications. Furthermore, they permit actual design optimization of CMOS integrated circuits which results in optimum pre- and post-irradiation performance with respect to speed, noise margins, and quiescent power consumption. Theoretical and experimental results of these procedures, the applications of which can mean the difference between failure and success of a CMOS integrated circuit in a radiation environment, are presented

Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

Science.gov (United States)

Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

2012-04-27

To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

Availability objectives integration to design. The CIDEM approach

International Nuclear Information System (INIS)

Degrave, C.; Martin-Onraet, M.

1994-01-01

Considering the operation experience feedback from its nuclear park and from foreign parks, and considering new approaches and design tools such as concurrent engineering, total quality, etc., EDF (Electricite de France) has decided to start the CIDEM approach (integration of availability, operating experience feedback and maintenance into design), an analytical and systematical study process for new projects (REP2000 (or PWR2000)), in order to optimize as much as possible the design phase while integrating maintenance, availability and safety objectives, with the view of a minimized kWh cost. This process, already used in other industries, employs concepts such as RAM (Reliability Availability Maintainability), RCM (Reliability Centered Maintenance) and ILS (Integrated Logistic Support). The availability and maintenance scheduling studies for the REP2000 project are detailed. 10 fig., 6 tab

Three-dimensional integrated circuit design

CERN Document Server

Xie, Yuan; Sapatnekar, Sachin S

2009-01-01

This book presents an overview of the field of 3D IC design, with an emphasis on electronic design automation (EDA) tools and algorithms that can enable the adoption of 3D ICs, and the architectural implementation and potential for future 3D system design. The aim of this book is to provide the reader with a complete understanding of: the promise of 3D ICs in building novel systems that enable the chip industry to continue along the path of performance scaling, the state of the art in fabrication technologies for 3D integration, the most prominent 3D-specific EDA challenges, along with solutio

Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

DEFF Research Database (Denmark)

Huang, Yili; Zeng, Yanhua; Lu, Hang

2016-01-01

Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

Directory of Open Access Journals (Sweden)

Alejandro Gonzalez-Martinez

2015-01-01

Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

The Integrated Design Process (IDP)

DEFF Research Database (Denmark)

Hansen, Hanne Tine Ring; Knudstrup, Mary-Ann

2005-01-01

the different parameters and products can interact, and which consequences this would have on a project. The IDP does not ensure aesthetic or sustainable solutions, but it enables the designer to control the many parameters that must be considered and integrated in the project when creating more holistic...

Requirements of Integrated Design Teams While Evaluating Advanced Energy Retrofit Design Options in Immersive Virtual Environments

Directory of Open Access Journals (Sweden)

Xue Yang

2015-12-01

Full Text Available One of the significant ways to save energy use in buildings is to implement advanced energy retrofits in existing buildings. Improving energy performance of buildings through advanced energy retrofitting requires a clear understanding of the cost and energy implications of design alternatives from various engineering disciplines when different retrofit options are considered. The communication of retrofit design alternatives and their energy implications is essential in the decision-making process, as it affects the final retrofit selections and hence the energy efficiency of the retrofitted buildings. The objective of the research presented here was to identify a generic list of information requirements that are needed to be shared and collectively analyzed by integrated design teams during advanced energy retrofit design review meetings held in immersive settings. While identifying such requirements, the authors used an immersive environment based iterative requirements elicitation approach. The technology was used as a means to better identify the information requirements of integrated design teams to be analyzed as a group. This paper provides findings on information requirements of integrated design teams when evaluating retrofit options in immersive virtual environments. The information requirements were identified through interactions with sixteen experts in design and energy modeling domain, and validated with another group of participants consisting of six design experts who were experienced in integrated design processes. Industry practitioners can use the findings in deciding on what information to share with integrated design team members during design review meetings that utilize immersive virtual environments.

An integrated design experience on a wet-tree production semisubmersible

Energy Technology Data Exchange (ETDEWEB)

Fales, Raymond P.; Lee, Craig; Chen Xiang; Zhengquan Zhou [ABB FPS Houston, TX (United States)

2004-07-01

The semisubmersible platform has been a reliable work platform for the offshore oil and gas industry for over 40 years. The Semisubmersible is a very mature concept with hundreds of examples in use. Traditionally during the design phase, the motions have been developed to suit the independent services, drilling, offshore operations or production. However, recently with the move to ultra-deep water depths and the use of Steel Catenary Risers (SCRs), the design of Semisubmersible has to be considered as an integrated floating production system, to satisfy all the requirements from platform global performance, SCRs strength and fatigue, mooring, topside payload and layout, hull strength, deck structure, marine system layout, stability, fabrication and installation. These requirements usually conflict each other. As such it is imperative to consider them together, adjusting the design parameters during design loops to obtain an optimal design product. This paper will describe the integrated design process used and the optimal design principles applied to satisfy these conflicting requirements and provide an example of a wet-tree production semisubmersible integrated design. Particular emphasis will be on global performance, SCR design, deck structure arrangement options, fabrication and integration. (author)

The computational design of Geological Disposal Technology Integration System

International Nuclear Information System (INIS)

Ishihara, Yoshinao; Iwamoto, Hiroshi; Kobayashi, Shigeki; Neyama, Atsushi; Endo, Shuji; Shindo, Tomonori

2002-03-01

In order to develop 'Geological Disposal Technology Integration System' that is intended to systematize as knowledge base for fundamental study, the computational design of an indispensable database and image processing function to 'Geological Disposal Technology Integration System' was done, the prototype was made for trial purposes, and the function was confirmed. (1) Database of Integration System which systematized necessary information and relating information as an examination of a whole of repository composition and managed were constructed, and the system function was constructed as a system composed of image processing, analytical information management, the repository component management, and the system security function. (2) The range of the data treated with this system and information was examined, the design examination of the database structure was done, and the design examination of the image processing function of the data preserved in an integrated database was done. (3) The prototype of the database concerning a basic function, the system operation interface, and the image processing function was manufactured to verify the feasibility of the 'Geological Disposal Technology Integration System' based on the result of the design examination and the function was confirmed. (author)

Integrating computer programs for engineering analysis and design

Science.gov (United States)

Wilhite, A. W.; Crisp, V. K.; Johnson, S. C.

1983-01-01

The design of a third-generation system for integrating computer programs for engineering and design has been developed for the Aerospace Vehicle Interactive Design (AVID) system. This system consists of an engineering data management system, program interface software, a user interface, and a geometry system. A relational information system (ARIS) was developed specifically for the computer-aided engineering system. It is used for a repository of design data that are communicated between analysis programs, for a dictionary that describes these design data, for a directory that describes the analysis programs, and for other system functions. A method is described for interfacing independent analysis programs into a loosely-coupled design system. This method emphasizes an interactive extension of analysis techniques and manipulation of design data. Also, integrity mechanisms exist to maintain database correctness for multidisciplinary design tasks by an individual or a team of specialists. Finally, a prototype user interface program has been developed to aid in system utilization.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

Science.gov (United States)

Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

1996-04-15

A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

An integrability primer for the gauge-gravity correspondence. An introduction

Energy Technology Data Exchange (ETDEWEB)

Bombardelli, Diego [Torino Univ. (Italy). Dipartimento di Fisica; Bologna Univ. (Italy). Dipt. die Fisica e Astronomia; INFN, Torino (Italy); INFN, Bologna (Italy); Cagnazzo, Alessandra [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany). Gruppe Theorie; Stockholm Univ. (Sweden); KTH Royal Institute of Technology, Stockholm (Sweden). Nordita; Frassek, Rouven; Szecsenyi, I.M. [Durham Univ. (United Kingdom). Dept. of Mathematical Sciences; Levkovich-Maslyuk, Fedor [King' s College London (United Kingdom). Mathematics Dept.; Loebbert, F. [Humboldt-Univ., Berlin (Germany). Inst. fuer Physik; Negro, Stefano [Paris 06 Univ., Sorbonne Univs., PSL Research Univ., CNRS UMR 8549 (France). LPTENS, Ecole Normale Superieure; Sfondrini, A. [ETH Zuerich (Switzerland). Inst. fuer Theoretische Physik; Tongeren, S.J. van [Humboldt-Univ., Berlin (Germany). Inst. fuer Physik; Humboldt-Univ., Berlin (Germany). Inst. fuer Mathematik; Torrielli, A. [Surrey Univ., Guildford (United Kingdom). Dept. of Mathematics

2016-12-15

We introduce a series of articles reviewing various aspects of integrable models relevant to the AdS/CFT correspondence. Topics covered in these reviews are: classical integrability, Yangian symmetry, factorized scattering, the Bethe ansatz, the thermodynamic Bethe ansatz, and integrable structures in (conformal) quantum field theory. In the present article we highlight how these concepts have found application in AdS/CFT, and provide a brief overview of the material contained in this series.

An integrability primer for the gauge-gravity correspondence. An introduction

International Nuclear Information System (INIS)

Bombardelli, Diego; Cagnazzo, Alessandra; Stockholm Univ.; KTH Royal Institute of Technology, Stockholm; Frassek, Rouven; Szecsenyi, I.M.; Levkovich-Maslyuk, Fedor; Loebbert, F.; Negro, Stefano; Sfondrini, A.; Tongeren, S.J. van; Humboldt-Univ., Berlin; Torrielli, A.

2016-12-01

We introduce a series of articles reviewing various aspects of integrable models relevant to the AdS/CFT correspondence. Topics covered in these reviews are: classical integrability, Yangian symmetry, factorized scattering, the Bethe ansatz, the thermodynamic Bethe ansatz, and integrable structures in (conformal) quantum field theory. In the present article we highlight how these concepts have found application in AdS/CFT, and provide a brief overview of the material contained in this series.

System 80+ integrated design of a complete plant

International Nuclear Information System (INIS)

Turk, R.S.; Stamm, S.L.; Fox, W.A.

1992-01-01

In 1985, ABB-Combustion Engineering Nuclear Power (ABB-CENP) and elements of Duke Power Company [now Duke Engineering ampersand Services (DE ampersand S)] joined forces under the aegis of the Electric Power Research Institute (EPRI) Advanced Light Water Reactor (ALWR) Program to develop, with the sponsoring utilities, the design requirements for the next generation of nuclear power plants. With support from the US Department of Energy, ABB-CENP and DE ampersand S again teamed up the following year to initiate a project to design and license the System 80+ standard plant design, an advanced pressurized water reactor that meets these utility requirements. A distinguishing feature of the System 80+ standard design is that it is an essentially complete plant, predesigned and prelicensed to ensure rapid and economical construction. This is in stark contrast to typical prior conduct, where the reactor vendor offered only the nuclear steam supply system and the plant was built on a design-as-you-go basis with constant pressure to release individual elements of the plant design for construction or procurement as soon as possible. Now, however, the design process can be integrated over the total plant, ensuring that the goals set for ALWRs can be met. This integrated design process is manifested in several ways: (1) broad-based participation during the design process by involving designers, analysts, suppliers, constructors, and operators; (2) use of probabilistic risk assessment (PRA) as a design tool to aid in evaluating design features on a total-plant basis; (3) application of human factors engineering methods to a total plant distributed control system to improve the human-machine interface in the design; and (4) use of computer-aided design to enhance assessment of interactions and impacts of all aspects of the total plant. Each of these aspects of integrated plant design is discussed in this paper

Development of mechanical design technology for integral reactor

International Nuclear Information System (INIS)

Park, Keun Bae; Choi, Suhn; Kim, Kang Soo; Kim, Tae Wan; Jeong, Kyeong Hoon; Lee, Gyu Mahn; Kim, Jong Wook; Choi, Woo Seok

2002-03-01

This report is the final documentation of the 'Development of Mechanical Design Technology for Integral Reactor' which describes the design activities including reactor vessel assembly structural modelling, normal operation and transient analysis, preparation of design specification, major component stress analysis, evaluation of structural integrity, review of fabricability, maintenance and repair scheme, etc. To establish the design requirements and applicable codes and standards, each GDC criterion was reviewed regarding the SMART structural characteristics and design status, and then the applicability and point of issues were evaluated. To accomodate the result of the core optimization program, modification of pressure vessel and reactor internal components were carried out. SG nozzles were rearranged to penetrate the pressure vessel wall instead of the annular cover. Coolant flow path through the MCP impeller was revised and the adjacent structures were modified. Dynamic analysis model was developed reflecting all the structural changes to perform the seismic and BLPB analysis. Fracture mechanics evaluation on the structural integrity of the reactor pressure vessel was also conducted. Besides, equipment maintenance and replacement plan including the refueling scheme was discussed to confirm the embodiment of SMART through construction and operation

Integrated magnetics design for HF-link power converters

Energy Technology Data Exchange (ETDEWEB)

Ljusev, P.; Andersen, Michael A.E.

2005-07-01

This paper deals with the design of integrated magnetics for HF-link converters, where the two integrated magnetic components on the same core do not necessarily belong to the same voltage loop. Depending on the specific HF-link converter topology, the proposed integrated magnetics can either alleviate the derivation of independent auxiliary supply voltages from the main transformer or integrate other magnetic structures, thus saving board space and cutting costs. (au)

High-frequency analog integrated circuit design

CERN Document Server

1995-01-01

To learn more about designing analog integrated circuits (ICs) at microwave frequencies using GaAs materials, turn to this text and reference. It addresses GaAs MESFET-based IC processing. Describes the newfound ability to apply silicon analog design techniques to reliable GaAs materials and devices which, until now, was only available through technical papers scattered throughout hundred of articles in dozens of professional journals.

Design and control of integrated chromatography column sequences.

Science.gov (United States)

Andersson, Niklas; Löfgren, Anton; Olofsson, Marianne; Sellberg, Anton; Nilsson, Bernt; Tiainen, Peter

2017-07-01

To increase the productivity in biopharmaceutical production, a natural step is to introduce integrated continuous biomanufacturing which leads to fewer buffer and storage tanks, smaller sizes of integrated unit operations, and full automation of the operation. The main contribution of this work is to illustrate a methodology for design and control of a downstream process based on integrated column sequences. For small scale production, for example, pre-clinical studies, integrated column sequences can be implemented on a single chromatography system. This makes for a very efficient drug development platform. The proposed methodology is composed of four steps and is governed by a set of tools, that is presented, that makes the transition from batch separations to a complete integrated separation sequence as easy as possible. This methodology, its associated tools and the physical implementation is presented and illustrated on a case study where the target protein is separated from impurities through an integrated four column sequence. This article shows that the design and control of an integrated column sequence was successfully implemented for a tertiary protein separation problem. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:923-930, 2017. © 2017 American Institute of Chemical Engineers.

An integrated computer aided system for integrated design of chemical processes

DEFF Research Database (Denmark)

Gani, Rafiqul; Hytoft, Glen; Jaksland, Cecilia

1997-01-01

In this paper, an Integrated Computer Aided System (ICAS), which is particularly suitable for solving problems related to integrated design of chemical processes; is presented. ICAS features include a model generator (generation of problem specific models including model simplification and model ...... form the basis for the toolboxes. The available features of ICAS are highlighted through a case study involving the separation of binary azeotropic mixtures. (C) 1997 Elsevier Science Ltd....

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Nuclear integrated database and design advancement system

International Nuclear Information System (INIS)

Ha, Jae Joo; Jeong, Kwang Sub; Kim, Seung Hwan; Choi, Sun Young.

1997-01-01

The objective of NuIDEAS is to computerize design processes through an integrated database by eliminating the current work style of delivering hardcopy documents and drawings. The major research contents of NuIDEAS are the advancement of design processes by computerization, the establishment of design database and 3 dimensional visualization of design data. KSNP (Korea Standard Nuclear Power Plant) is the target of legacy database and 3 dimensional model, so that can be utilized in the next plant design. In the first year, the blueprint of NuIDEAS is proposed, and its prototype is developed by applying the rapidly revolutionizing computer technology. The major results of the first year research were to establish the architecture of the integrated database ensuring data consistency, and to build design database of reactor coolant system and heavy components. Also various softwares were developed to search, share and utilize the data through networks, and the detailed 3 dimensional CAD models of nuclear fuel and heavy components were constructed, and walk-through simulation using the models are developed. This report contains the major additions and modifications to the object oriented database and associated program, using methods and Javascript.. (author). 36 refs., 1 tab., 32 figs

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Integrated cost estimation methodology to support high-performance building design

Energy Technology Data Exchange (ETDEWEB)

Vaidya, Prasad; Greden, Lara; Eijadi, David; McDougall, Tom [The Weidt Group, Minnetonka (United States); Cole, Ray [Axiom Engineers, Monterey (United States)

2007-07-01

Design teams evaluating the performance of energy conservation measures (ECMs) calculate energy savings rigorously with established modelling protocols, accounting for the interaction between various measures. However, incremental cost calculations do not have a similar rigor. Often there is no recognition of cost reductions with integrated design, nor is there assessment of cost interactions amongst measures. This lack of rigor feeds the notion that high-performance buildings cost more, creating a barrier for design teams pursuing aggressive high-performance outcomes. This study proposes an alternative integrated methodology to arrive at a lower perceived incremental cost for improved energy performance. The methodology is based on the use of energy simulations as means towards integrated design and cost estimation. Various points along the spectrum of integration are identified and characterized by the amount of design effort invested, the scheduling of effort, and relative energy performance of the resultant design. It includes a study of the interactions between building system parameters as they relate to capital costs. Several cost interactions amongst energy measures are found to be significant.The value of this approach is demonstrated with alternatives in a case study that shows the differences between perceived costs for energy measures along various points on the integration spectrum. These alternatives show design tradeoffs and identify how decisions would have been different with a standard costing approach. Areas of further research to make the methodology more robust are identified. Policy measures to encourage the integrated approach and reduce the barriers towards improved energy performance are discussed.

On the logistics effects of integrated product and package design

DEFF Research Database (Denmark)

Bramklev, Caroline; Hansen, Claus Thorp

2007-01-01

obtaining error-free deliveries, saving costs and avoiding quality problems. Thus, the authors of this paper see a challenge in developing the theory and methodology for Integrated Product and Package Design. In this paper we take a first step in this direction. Firstly, we have carried out a broad review...... of literature, which shows that there is a need for research into Integrated Product and Package Design. Secondly, we have analysed three cases from industrial practice, which show that a conscious and integrated design of product and package has positive logistics effects, whereas neglecting this issue might...... result in higher costs and quality problems. On the basis of these cases we have made an initial cross-case analysis, which indicates that it is possible to develop the terminology and methodology for Integrated Product and Package Design....

Open architecture design and approach for the Integrated Sensor Architecture (ISA)

Science.gov (United States)

Moulton, Christine L.; Krzywicki, Alan T.; Hepp, Jared J.; Harrell, John; Kogut, Michael

2015-05-01

Integrated Sensor Architecture (ISA) is designed in response to stovepiped integration approaches. The design, based on the principles of Service Oriented Architectures (SOA) and Open Architectures, addresses the problem of integration, and is not designed for specific sensors or systems. The use of SOA and Open Architecture approaches has led to a flexible, extensible architecture. Using these approaches, and supported with common data formats, open protocol specifications, and Department of Defense Architecture Framework (DoDAF) system architecture documents, an integration-focused architecture has been developed. ISA can help move the Department of Defense (DoD) from costly stovepipe solutions to a more cost-effective plug-and-play design to support interoperability.

Integration process of theoretical courses with design studios in undergraduate education: Case studies of architecture and interior design studios

Directory of Open Access Journals (Sweden)

Ozmehmet Ecehan

2016-01-01

Full Text Available The formulations of studios are the most critical problem of design studies, because the foundation of further architectural education is based on these design studios. This paper focuses on discussions of studiobased design learning systems and curriculum developments on integral design studios that aims significant and innovative frameworks. In this context, integrated design studios are the newest approaches of architectural education. In this education system every studio has its own integral course. Integral courses give support to the design studios. This support can be either theoretical or practical. Knowledge that is related with the context of the design studio can be explained in this integrated course in some cases, in some cases as simulation program can be explained in some parts of the course. The support of the integral courses to the studios must be evaluated deeply. This paper presents the positive parts and negative parts of the new integral studio approach in this context. By this way, strong and weak parts of this education system is put forward.

A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

Directory of Open Access Journals (Sweden)

Andrés Alvarado

Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Design and evaluation of an integrated safeguards system: principles

International Nuclear Information System (INIS)

Markin, J.T.; Coulter, C.A.; Gutmacher, R.G.; Whitty, W.J.

1984-01-01

An integrated safeguards system is defined as a collection of safeguards activities in which system components are coordinated to meet safeguards objectives efficiently within constraints imposed by safeguards resources, facility operations, potential adversaries, and regulatory requirements. This paper describes principles for designing and evaluating an integrated safeguards system that consists of four parts: a problem definition phase that specifies resources and constraints composing the problem boundary values, a system analysis/synthesis phase that describes how to select and integrate safeguards activities for efficient attainment of system objectives, a system evaluation/optimization phase that defines measures of safeguards performance and develops methods for evaluating them, and a decision-making phase that develops principles for selecting admissible designs and preference-ordering designs

Analog integrated circuits design for processing physiological signals.

Science.gov (United States)

Li, Yan; Poon, Carmen C Y; Zhang, Yuan-Ting

2010-01-01

Analog integrated circuits (ICs) designed for processing physiological signals are important building blocks of wearable and implantable medical devices used for health monitoring or restoring lost body functions. Due to the nature of physiological signals and the corresponding application scenarios, the ICs designed for these applications should have low power consumption, low cutoff frequency, and low input-referred noise. In this paper, techniques for designing the analog front-end circuits with these three characteristics will be reviewed, including subthreshold circuits, bulk-driven MOSFETs, floating gate MOSFETs, and log-domain circuits to reduce power consumption; methods for designing fully integrated low cutoff frequency circuits; as well as chopper stabilization (CHS) and other techniques that can be used to achieve a high signal-to-noise performance. Novel applications using these techniques will also be discussed.

Teaching Process Design through Integrated Process Synthesis

Science.gov (United States)

Metzger, Matthew J.; Glasser, Benjamin J.; Patel, Bilal; Hildebrandt, Diane; Glasser, David

2012-01-01

The design course is an integral part of chemical engineering education. A novel approach to the design course was recently introduced at the University of the Witwatersrand, Johannesburg, South Africa. The course aimed to introduce students to systematic tools and techniques for setting and evaluating performance targets for processes, as well as…

Ground Vehicle System Integration (GVSI) and Design Optimization Model

National Research Council Canada - National Science Library

Horton, William

1996-01-01

This report documents the Ground Vehicle System Integration (GVSI) and Design Optimization Model GVSI is a top-level analysis tool designed to support engineering tradeoff studies and vehicle design optimization efforts...

In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

Science.gov (United States)

Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

2017-01-01

The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

Integrated energy design of the building envelope

Energy Technology Data Exchange (ETDEWEB)

Vraa Nielsen, M.

2012-07-01

This thesis describes the outcome of the PhD project Integrated energy design of the building envelope carried out through a combination of scientific dissemination reported through peer-reviewed journals and a wide range of affiliated projects involved in at an architectural firm. The research project analysed how the implementation of technical knowledge early in the building design process can quantify the effect of a building's facades on its energy efficiency and indoor climate and thereby facilitate a more qualified design development. The project was structured in the following way: 1) the importance of integrating knowledge in the early stages of design, and how it can be done; 2) understanding the facade's typology; and 3) the complex notion of comfort. The project touched not only on the technical capabilities and requirements governing facade design, but also the process by which it takes place. This was done by applying the methodology of Integrated Energy Design (IED) and analysing its applicability in the design of facades. A major part of the project was an actual engagement in the architectural process to test out incorporating a consciousness about energy and comfort as part of a more holistic performance evaluation. The research project illustrates the great potential in taking passive properties into account through a geometrical optimisation inherent in the development of the architectural concept. It demonstrates that integration of technical knowledge at the early stages of design not only can qualify the geometrical processing, but also facilitate the design development of the facade. Thereby a more holistic performance optimisation can be obtained through parameters such as overall facade geometry and orientation, functional organisation, room height and depth, facade layout, window geometry and transparency, design of the window aperture, etc. Through the wide range of affiliated project involved in at the architectural firm over

Design Considerations for Proposed Fermilab Integrable RCS

Energy Technology Data Exchange (ETDEWEB)

Eldred, Jeffrey [Fermilab; Valishev, Alexander

2017-03-02

Integrable optics is an innovation in particle accelerator design that provides strong nonlinear focusing while avoiding parametric resonances. One promising application of integrable optics is to overcome the traditional limits on accelerator intensity imposed by betatron tune-spread and collective instabilities. The efficacy of high-intensity integrable accelerators will be undergo comprehensive testing over the next several years at the Fermilab Integrable Optics Test Accelerator (IOTA) and the University of Maryland Electron Ring (UMER). We propose an integrable Rapid-Cycling Synchrotron (iRCS) as a replacement for the Fermilab Booster to achieve multi-MW beam power for the Fermilab high-energy neutrino program. We provide a overview of the machine parameters and discuss an approach to lattice optimization. Integrable optics requires arcs with integer-pi phase advance followed by drifts with matched beta functions. We provide an example integrable lattice with features of a modern RCS - long dispersion-free drifts, low momentum compaction, superperiodicity, chromaticity correction, separate-function magnets, and bounded beta functions.

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

Approaches to Integrated Building Design Environments

DEFF Research Database (Denmark)

Bagger-Petersen, Susanne C; Andersen, Tom

1996-01-01

This report discusses functional requirements and specification which needs to be defined and fulfilled to initiate development of an integrated building design environment. The purpose is to outline specifications for further discussion and development. The report documents the first phase...... in an ongoing project at the Technical University of Denmark. The overall project objective is to provide a theoretically well-founded prototype of an integrated IT-system which can serve as a device of feedback from practice and as a test-bed for the developed concept and architecture....

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Design and evaluation of an integrated safeguards system: principles

International Nuclear Information System (INIS)

Markin, J.T.; Coulter, C.A.; Gutmacher, R.G.; Whitty, W.J.

1984-07-01

An integrated safeguards system is defined as a collection of safeguards activities in which system components are coordinated to meet safeguards objectives efficiently within constraints imposed by safeguards resources, facility operations, potential adversaries, and regulatory requirements. This paper describes principles for designing and evaluating an integrated safeguards system that consists of four parts: (1) a problem definition phase that specifies resources and constraints composing the problem boundary values; (2) a system analysis/synthesis phase that describes how to select and integrate safeguards activities for efficient attainment of system objectives; (3) a system evaluation/optimization phase that defines measures of safeguards performance and develops methods for evaluating them; and (4) a decision-making phase that develops principles for selecting admissible designs and preference-ordering designs. 6 references, 4 figures, 5 tables

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

A design approach for integrating thermoelectric devices using topology optimization

International Nuclear Information System (INIS)

Soprani, S.; Haertel, J.H.K.; Lazarov, B.S.; Sigmund, O.; Engelbrecht, K.

2016-01-01

Highlights: • The integration of a thermoelectric (TE) cooler into a robotic tool is optimized. • Topology optimization is suggested as design tool for TE integrated systems. • A 3D optimization technique using temperature dependent TE properties is presented. • The sensitivity of the optimization process to the boundary conditions is studied. • A working prototype is constructed and compared to the model results. - Abstract: Efficient operation of thermoelectric devices strongly relies on the thermal integration into the energy conversion system in which they operate. Effective thermal integration reduces the temperature differences between the thermoelectric module and its thermal reservoirs, allowing the system to operate more efficiently. This work proposes and experimentally demonstrates a topology optimization approach as a design tool for efficient integration of thermoelectric modules into systems with specific design constraints. The approach allows thermal layout optimization of thermoelectric systems for different operating conditions and objective functions, such as temperature span, efficiency, and power recovery rate. As a specific application, the integration of a thermoelectric cooler into the electronics section of a downhole oil well intervention tool is investigated, with the objective of minimizing the temperature of the cooled electronics. Several challenges are addressed: ensuring effective heat transfer from the load, minimizing the thermal resistances within the integrated system, maximizing the thermal protection of the cooled zone, and enhancing the conduction of the rejected heat to the oil well. The design method incorporates temperature dependent properties of the thermoelectric device and other materials. The 3D topology optimization model developed in this work was used to design a thermoelectric system, complete with insulation and heat sink, that was produced and tested. Good agreement between experimental results and

Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

Science.gov (United States)

Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

2007-04-01

Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

Implementing Clinical Research Using Factorial Designs: A Primer.

Science.gov (United States)

Baker, Timothy B; Smith, Stevens S; Bolt, Daniel M; Loh, Wei-Yin; Mermelstein, Robin; Fiore, Michael C; Piper, Megan E; Collins, Linda M

2017-07-01

Factorial experiments have rarely been used in the development or evaluation of clinical interventions. However, factorial designs offer advantages over randomized controlled trial designs, the latter being much more frequently used in such research. Factorial designs are highly efficient (permitting evaluation of multiple intervention components with good statistical power) and present the opportunity to detect interactions amongst intervention components. Such advantages have led methodologists to advocate for the greater use of factorial designs in research on clinical interventions (Collins, Dziak, & Li, 2009). However, researchers considering the use of such designs in clinical research face a series of choices that have consequential implications for the interpretability and value of the experimental results. These choices include: whether to use a factorial design, selection of the number and type of factors to include, how to address the compatibility of the different factors included, whether and how to avoid confounds between the type and number of interventions a participant receives, and how to interpret interactions. The use of factorial designs in clinical intervention research poses choices that differ from those typically considered in randomized clinical trial designs. However, the great information yield of the former encourages clinical researchers' increased and careful execution of such designs. Copyright © 2017. Published by Elsevier Ltd.

CopperCore Service Integration, Integrating IMS Learning Design and IMS Question and Test Interoperability

NARCIS (Netherlands)

Vogten, Hubert; Martens, Harrie; Nadolski, Rob; Tattersall, Colin; Van Rosmalen, Peter; Koper, Rob

2006-01-01

Vogten, H., Martens, H., Nadolski, R., Tattersall, C., Rosmalen, van, P., Koper, R., (2006). CopperCore Service Integration, Integrating IMS Learning Design and IMS Question and Test Interoperability. Proceedings of the 6th IEEE International Conference on Advanced Learning Technologies (pp.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

Science.gov (United States)

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

CMOS analog integrated circuit design technology; CMOS anarogu IC sekkei gijutsu

Energy Technology Data Exchange (ETDEWEB)

Fujimoto, H.; Fujisawa, A. [Fuji Electric Co. Ltd., Tokyo (Japan)

2000-08-10

In the field of the LSI (large scale integrated circuit) in rapid progress toward high integration and advanced functions, CAD (computer-aided design) technology has become indispensable to LSI development within a short period. Fuji Electric has developed design technologies and automatic design system to develop high-quality analog ICs (integrated circuits), including power supply ICs. within a short period. This paper describes CMOS (complementary metal-oxide semiconductor) analog macro cell, circuit simulation, automatic routing, and backannotation technologies. (author)

Implementing Integrated Multicultural Instructional Design in Management Education

Science.gov (United States)

Schultz, Jennifer L.; Higbee, Jeanne L.

2011-01-01

This purpose of this paper is to summarize the principles of integrated multicultural instructional design (IMID; Higbee, Goff, & Schultz, in press; Higbee, Schultz, & Goff, 2010) and present specific strategies for incorporating IMID in management education. The primary goal of IMID is to promote the integration of multicultural content…

Using historical perspective in designing discovery learning on Integral for undergraduate students

Science.gov (United States)

Abadi; Fiangga, S.

2018-01-01

In the course of Integral Calculus, to be able to calculate an integral of a given function is becoming the main idea in the teaching beside the ability in implementing the application of integral. The students tend to be unable to understand the conceptual idea of what is integration actually. One of the promising perspectives that can be used to invite students to discover the idea of integral is the History and Pedagogy Mathematics (HPM). The method of exhaustion and indivisible appear in the discussion on the early history of area measurement. This paper study will discuss the designed learning activities based on the method of exhaustion and indivisible in providing the undergraduate student’s discovery materials for integral using design research. The designed learning activities were conducted into design experiment that consists of three phases, i.e., preliminary, design experimental, and teaching experiment. The teaching experiment phase was conducted in two cycles for refinement purpose. The finding suggests that the implementation of the method of exhaustion and indivisible enable students to reinvent the idea of integral by using the concept of derivative.

Integrated structure/control design - Present methodology and future opportunities

Science.gov (United States)

Weisshaar, T. A.; Newsom, J. R.; Zeiler, T. A.; Gilbert, M. G.

1986-01-01

Attention is given to current methodology applied to the integration of the optimal design process for structures and controls. Multilevel linear decomposition techniques proved to be most effective in organizing the computational efforts necessary for ISCD (integrated structures and control design) tasks. With the development of large orbiting space structures and actively controlled, high performance aircraft, there will be more situations in which this concept can be applied.

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

Evaluation of the shear bond strength of lingual brackets manufactured by three different processes using two different adhesive primers: An in vitro study

Directory of Open Access Journals (Sweden)

Shrinivas Ashtekar

2016-01-01

Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.

Design structure for in-system redundant array repair in integrated circuits

Science.gov (United States)

Bright, Arthur A.; Crumley, Paul G.; Dombrowa, Marc; Douskey, Steven M.; Haring, Rudolf A.; Oakland, Steven F.; Quellette, Michael R.; Strissel, Scott A.

2008-11-25

A design structure for repairing an integrated circuit during operation of the integrated circuit. The integrated circuit comprising of a multitude of memory arrays and a fuse box holding control data for controlling redundancy logic of the arrays. The design structure provides the integrated circuit with a control data selector for passing the control data from the fuse box to the memory arrays; providing a source of alternate control data, external of the integrated circuit; and connecting the source of alternate control data to the control data selector. The design structure further passes the alternate control data from the source thereof, through the control data selector and to the memory arrays to control the redundancy logic of the memory arrays.

Integrated seismic design of structure and control systems

CERN Document Server

Castaldo, Paolo

2014-01-01

The structural optimization procedure presented in this book makes it possible to achieve seismic protection through integrated structural/control system design. In particular, it is explained how slender structural systems with a high seismic performance can be achieved through inclusion of viscous and viscoelastic dampers as an integral part of the system. Readers are provided with essential introductory information on passive structural control and passive energy dissipation systems. Dynamic analyses of both single and multiple degree of freedom systems are performed in order to verify the achievement of pre-assigned performance targets, and it is explained how the optimal integrated design methodology, also relevant to retrofitting of existing buildings, should be applied. The book illustrates how structural control research is opening up new possibilities in structural forms and configurations without compromising structural performance.

TOWARDS TOTAL INTEGRATION IN DESIGN STUDIO

Directory of Open Access Journals (Sweden)

Shireesh A Deshpande

2010-07-01

Full Text Available Transmission of knowledge has been defined as “bringing the right knowledge by the right route at the right time to the right places.” In this context there is need to analyze the various pedagogical shifts associated with the decisive process of transmission and transaction of knowledge in design studio. Critical understanding of the importance of tangential knowledge and its integration within the design studio, leading to a comprehensive whole, is a significant aspect to be properly evolved and nourished in the studio. It can be argued that knowledge is not a substitute for architectural imagination but inadequate knowledge would handicap the general level of design. Being satisfied to manipulate formal configurations does not provide insights into the human experience. If the different types of knowledge that architecture requires are ignored, the profession will lose its credibility in the eyes of society. With the body of knowledge expanding diversely with the escalating wants of the user, and to further sustain the built environment with further progression, it’s quite certain to have an innovative design process that has a feel of antecedents yet is nourished by rationalism. Architectural Design is to an extent the yield of a creative process brought out through a refined approach, skill, and dexterity to suit the purpose. The assessors, the jury, or the teacher has created an aura of mystique around good design, without much explaining what good design is. Architectural education involves application of a theory of knowledge – what is known and how it is to be known. Nothing is taught unless it is learnt (Bono. Does the key to these issues lie in shifting from conventional mode to Total Integration Mode of Education?

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Systematic Optimization-Based Integrated Chemical Product–Process Design Framework

DEFF Research Database (Denmark)

Cignitti, Stefano; Mansouri, Seyed Soheil; Woodley, John M.

2018-01-01

An integrated optimization-based framework for product and process design is proposed. The framework uses a set of methods and tools to obtain the optimal product–process design solution given a set of economic and environmental sustainability targets. The methods and tools required are property...... of the framework is demonstrated through three case studies: (i) refrigeration cycle unit for R134a replacement, (ii) a mixed working fluid design problem for R134a replacement, and (iii) pure solvent design for water-acetic acid LLE extraction. Through the application of the framework it is demonstrated that all...... prediction through group contributions, unless supported with a database, computer-aided molecular and mixture/blend design for generation of novel as well as existing products and mathematical programming for formulating and solving multiscale integrated process–product design problems. The application...

Grid integration impacts on wind turbine design and development

DEFF Research Database (Denmark)

Hansen, Anca Daniela; Cutululis, Nicolaos Antonio; Sørensen, Poul Ejnar

2009-01-01

This paper presents an overall perspective on contemporary issues like wind power plants and grid integration. The purpose is to present and discuss the impacts of emerging new grid connection requirements on modern wind turbines. The grid integration issue has caused several new challenges......, the grid integration aspect has also an effect on wind turbines' role in the power system, on wind turbine technologies' survival on the market, as well as on the wind turbines' loads. Over the last years, it became obviously, that there it is an increasing need for design and research of wind turbines...... to the wind turbine design and development. The survival of different wind turbine concepts and controls is strongly conditioned by their ability to comply with stringent grid connection requirements, imposed by utility companies. Beside its impact on the mechanical design and control of wind turbines...

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

Science.gov (United States)

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Design Process for Integrated Concepts with Responsive Building Elements

DEFF Research Database (Denmark)

Aa, Van der A.; Heiselberg, Per

2008-01-01

An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

Achieving integration in mixed methods designs-principles and practices.

Science.gov (United States)

Fetters, Michael D; Curry, Leslie A; Creswell, John W

2013-12-01

Mixed methods research offers powerful tools for investigating complex processes and systems in health and health care. This article describes integration principles and practices at three levels in mixed methods research and provides illustrative examples. Integration at the study design level occurs through three basic mixed method designs-exploratory sequential, explanatory sequential, and convergent-and through four advanced frameworks-multistage, intervention, case study, and participatory. Integration at the methods level occurs through four approaches. In connecting, one database links to the other through sampling. With building, one database informs the data collection approach of the other. When merging, the two databases are brought together for analysis. With embedding, data collection and analysis link at multiple points. Integration at the interpretation and reporting level occurs through narrative, data transformation, and joint display. The fit of integration describes the extent the qualitative and quantitative findings cohere. Understanding these principles and practices of integration can help health services researchers leverage the strengths of mixed methods. © Health Research and Educational Trust.

Integrated Design Process in Problem-Based Learning

DEFF Research Database (Denmark)

Knudstrup, Mary-Ann

2004-01-01

This article reports and reflects on the learning achievements and the educational experiences in connection with the first years of the curriculum in Architecture at Aalborg University ?s Civil Engineer Education in Architecture & Design. In the article I will focus on the learning activity and ...... the students need in order to concentrate, mobilize creativity and find the personal design language which is a precondition for making good architecture....... and the method that are developed during the semester when working with an Integrated Design Process combining architecture, design, functional aspects, energy consumption, indoor environment, technology, and construction. I will emphasize the importance of working with different tools in the design process, e...

Design of integral shutters for the beamlines at the Advanced Photon Source

International Nuclear Information System (INIS)

Chang, J.; Shu, D.; Nian, H.L.; Kuzay, T.M.; Job, P.K.

1994-01-01

An integral shutter is a device that integrates a white-beam stop, monochromatic-beam (mono-beam) shutters, a safety stop, and a collimator into one assembly to save space in the photon beamline. Various integral shutters have been developed as standard components for the beamlines at the Advanced Photon Source. The integral shutters are designed to be operated in white-beam mode or mono-beam mode. With regard to safety, each mode of operation is secured by locking certain devices in their up or down positions. Some of the components of the integral shutters share designs similar to the front-end shutters or fixed masks. Design details of the integral shutters are presented

Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

Science.gov (United States)

Rockne, Karl J; Strand, Stuart E

2003-09-01

Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

454-Pyrosequencing analysis of bacterial communities from autotrophic nitrogen removal bioreactors utilizing universal primers : Effect of annealing temperature

NARCIS (Netherlands)

Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S

AP1000 design and construction integration

International Nuclear Information System (INIS)

Winters, James W.; Clelland, Jill A.

2004-01-01

Construction costs of commercial nuclear generating plants must be reduced in order to expand the future use of nuclear energy. Two of the drivers of plant construction costs are the cost of financing during the construction duration and the substantial amount of skilled craft labor hours needed on site during construction. The application of information technology (IT) has been used to understand and reduce both of these drivers by establishing parallel construction paths using modules and integrating construction sequence review into the design process. In a program sponsored by EPRI, Westinghouse has modeled the construction of AP1000 in '4D' to show its viability, to improve its logic, to improve the plant design for constructibility and overall to reduce time and risk in the construction schedule. The design of most of AP1000 was constrained to be a duplicate of AP600 except where components required expansion for the higher power level. As a result, the construction schedule for AP1000 is as mature and as robust as that for AP600. Two areas important to the construction of AP1000 did require some design work because they could not remain the same as AP1000. First, the turbine building had to be redesigned to accommodate the larger turbine and its support systems. Again, as much of the AP600 design and philosophy as possible was retained. The building required enlargement and the basemat, foundations, steel structure and structural modules required modification. As concrete, steel, and equipment were defined by the designers, they were matched to the original AP600 turbine building schedule. This forced designers to assemble files to be consistent with building assembly activities and to think about constructibility as they defined the final design. Second, the reinforcement structure within the concrete under and supporting the containment vessel required detail design. Westinghouse was fortunate to have the constructor Obayashi of Japan recommend a detailed

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

An Integrated Methodology for Emulsified Formulated Product Design

DEFF Research Database (Denmark)

Mattei, Michele

are mixed together to determine the desired emulsified product. They are still mainly designed and analysed through trial - and - error based exper- imental techniques, therefore a systematic approach , integrating model-based as well a s experiment - based techniques, for design of these products could......The consumer oriented chemical based products are used every day by millions of people. They are structured products constituted of numerous chemicals, and many of them, especially household and personal care products, are emulsions where active ingredients, solvents, additives and surfactants...... significantly reduce both time and cost connected to product development by doing only the necessary experi- ments , and ensuring chances for innovation . The main contribution of this project i s the development of an integrated methodology for the design of emulsified formulated products. The methodology...

Novel integrated design framework for radio frequency quadrupoles

International Nuclear Information System (INIS)

Jolly, Simon; Easton, Matthew; Lawrie, Scott; Letchford, Alan; Pozimski, Jürgen; Savage, Peter

2014-01-01

A novel design framework for Radio Frequency Quadrupoles (RFQs), developed as part of the design of the FETS RFQ, is presented. This framework integrates several previously disparate steps in the design of RFQs, including the beam dynamics design, mechanical design, electromagnetic, thermal and mechanical modelling and beam dynamics simulations. Each stage of the design process is described in detail, including the various software options and reasons for the final software suite selected. Results are given for each of these steps, describing how each stage affects the overall design process, with an emphasis on the resulting design choices for the FETS RFQ

The design of a compact integral medium size PWR

International Nuclear Information System (INIS)

Shirvan, Koroush; Hejzlar, Pavel; Kazimi, Mujid S.

2012-01-01

Highlights: ► We model the IRIS reactor in RELAP5 and VIPRE codes. ► We use Printed Circuit Heat Exchangers and internally and externally cooled fuel pins in IRIS. ► We increase the IRIS power by 50% and demonstrate adequate safety performance. ► We show significant potential gain in economics for any integral PWR reactor design. - Abstract: Integral reactors have been proposed in recent years as a means to eliminate loss of coolant events, and reduce the number of large vessels of a nuclear power plant. In this paper the focus on how to further increase the power that can be derived from a given vessel volume. The example is applied to the International Reactor Innovative and Secure (IRIS), a medium size, light water reactor rated at 1000 MWt. The IRIS is an integral design containing all pumps and steam generators along with a traditional PWR core inside the reactor vessel. IRIS was designed with 8 Once-Through Helically Coiled Steam Generators (OTHSG), located above the core, in an annular region between the riser and the pressure vessel wall. This work examines ideas to increase its power output in the same vessel size while maintaining or improving the safety margins. The combination of Printed Circuit Heat Exchangers (PCHE) and Internally and EXternally cooled Annular Fuel (IXAF) is proposed to implement such improvement in otherwise the reference IRIS design. Safety implications of such steam generator and fuel design changes for the same reactor size are examined, under both steady state and transients, using the RELAP5 and VIPRE codes. It is found that the IRIS reactor power can be increased by 50% by using the PCHE and IXAF. The proposed design is found to be less expensive per unit electric power produced, these improvements and analyses can be applied to any integral reactor design.

Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

Science.gov (United States)

Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

2015-01-01

Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Model-Based Integrated Process Design and Controller Design of Chemical Processes

DEFF Research Database (Denmark)

Abd Hamid, Mohd Kamaruddin Bin

that is typically formulated as a mathematical programming (optimization with constraints) problem is solved by the so-called reverse approach by decomposing it into four sequential hierarchical sub-problems: (i) pre-analysis, (ii) design analysis, (iii) controller design analysis, and (iv) final selection......This thesis describes the development and application of a new systematic modelbased methodology for performing integrated process design and controller design (IPDC) of chemical processes. The new methodology is simple to apply, easy to visualize and efficient to solve. Here, the IPDC problem...... are ordered according to the defined performance criteria (objective function). The final selected design is then verified through rigorous simulation. In the pre-analysis sub-problem, the concepts of attainable region and driving force are used to locate the optimal process-controller design solution...

The Exploration of Green Architecture Design Integration Teaching Mode

Science.gov (United States)

Shuang, Liang; Yibin, Han

2016-01-01

With the deepening of the concept of green building design, the course of university education gradually exposed many problems in the teaching of architectural design theory; based on the existing mode of teaching and combined with the needs of architectural design practice it proposed the "integrated" method of green building design. It…

Barriers and Challenges in the Integrated Design Process Approcach

DEFF Research Database (Denmark)

Knudstrup, Mary-Ann

2006-01-01

ABSTRACT: In the future, it will be a huge challenge to make sustainable building design by using a more holistic and innovative approach in order to be able to decrease or reduce the use of energy for heating and cooling in new building projects. This is seen in the perspective of the Kyoto agre....... It also describes the barriers and the challenges that must be overcome when trying to cross the borders between the two fields of engineering and architecture to design sustainable architecture....... agreement for reducing the global heating. This paper will briefly present the method of the Integrated Design Process, IDP [1]. It describes the background and means for developing a new method for designing integrated architecture in an interdisciplinary approach between architecture and engineering...

Assessment of fungal diversity in deep-sea sediments by multiple primer approach

Digital Repository Service at National Institute of Oceanography (India)

Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification DNA Signatures

Directory of Open Access Journals (Sweden)

Gardner Shea N

2011-06-01

Full Text Available Abstract Background We developed an extendable open-source Loop-mediated isothermal AMPlification (LAMP signature design program called LAVA (LAMP Assay Versatile Analysis. LAVA was created in response to limitations of existing LAMP signature programs. Results LAVA identifies combinations of six primer regions for basic LAMP signatures, or combinations of eight primer regions for LAMP signatures with loop primers, which can be used as LAMP signatures. The identified primers are conserved among target organism sequences. Primer combinations are optimized based on lengths, melting temperatures, and spacing among primer sites. We compare LAMP signature candidates for Staphylococcus aureus created both by LAVA and by PrimerExplorer. We also include signatures from a sample run targeting all strains of Mycobacterium tuberculosis. Conclusions We have designed and demonstrated new software for identifying signature candidates appropriate for LAMP assays. The software is available for download at http://lava-dna.googlecode.com/.

Innovative Comparison of Transient Ignition Temperature at the Booster Interface, New Stainless Steel Pyrovalve Primer Chamber Assembly "V" (PCA) Design Versus the Current Aluminum "Y" PCA Design

Science.gov (United States)

Saulsberry, Regor L.; McDougle, Stephen H.; Garcia,Roberto; Johnson, Kenneth L.; Sipes, William; Rickman, Steven; Hosangadi, Ashvin

2011-01-01

An assessment of four spacecraft pyrovalve anomalies that occurred during ground testing was conducted by the NASA Engineering & Safety Center (NESC) in 2008. In all four cases, a common aluminum (Al) primer chamber assembly (PCA) was used with dual NASA Standard Initiators (NSIs) and the nearly simultaneous (separated by less than 80 microseconds) firing of both initiators failed to ignite the booster charge. The results of the assessment and associated test program were reported in AIAA Paper AIAA-2008-4798, NESC Independent Assessment of Pyrovalve Ground Test Anomalies. As a result of the four Al PCA anomalies, and the test results and findings of the NESC assessment, the Mars Science Laboratory (MSL) project team decided to make changes to the PCA. The material for the PCA body was changed from aluminum (Al) to stainless steel (SS) to avoid melting, distortion, and potential leakage of the NSI flow passages when the device functioned. The flow passages, which were interconnected in a Y-shaped configuration (Y-PCA) in the original design, were changed to a V-shaped configuration (V-PCA). The V-shape was used to more efficiently transfer energy from the NSIs to the booster. Development and qualification testing of the new design clearly demonstrated faster booster ignition times compared to the legacy AL Y-PCA design. However, the final NESC assessment report recommended that the SS V-PCA be experimentally characterized and quantitatively compared to the Al Y-PCA design. This data was deemed important for properly evaluating the design options for future NASA projects. This test program has successfully quantified the improvement of the SS V-PCA over the Al Y-PCA. A phase B of the project was also conducted and evaluated the effect of firing command skew and enlargement of flame channels to further assist spacecraft applications.

Formative Assessment Design for PDA Integrated Ecology Observation

Science.gov (United States)

Hung, Pi-Hsia; Lin, Yu-Fen; Hwang, Gwo-Jen

2010-01-01

Ubiquitous computing and mobile technologies provide a new perspective for designing innovative outdoor learning experiences. The purpose of this study is to propose a formative assessment design for integrating PDAs into ecology observations. Three learning activities were conducted in this study. An action research approach was applied to…

Design for human factors (DfHF): a grounded theory for integrating human factors into production design processes.

Science.gov (United States)

Village, Judy; Searcy, Cory; Salustri, Filipo; Patrick Neumann, W

2015-01-01

The 'design for human factors' grounded theory explains 'how' human factors (HF) went from a reactive, after-injury programme in safety, to being proactively integrated into each step of the production design process. In this longitudinal case study collaboration with engineers and HF Specialists in a large electronics manufacturer, qualitative data (e.g. meetings, interviews, observations and reflections) were analysed using a grounded theory methodology. The central tenet in the theory is that when HF Specialists acclimated to the engineering process, language and tools, and strategically aligned HF to the design and business goals of the organisation, HF became a means to improve business performance. This led to engineers 'pulling' HF Specialists onto their team. HF targets were adopted into engineering tools to communicate HF concerns quantitatively, drive continuous improvement, visibly demonstrate change and lead to benchmarking. Senior management held engineers accountable for HF as a key performance indicator, thus integrating HF into the production design process. Practitioner Summary: Research and practice lack explanations about how HF can be integrated early in design of production systems. This three-year case study and the theory derived demonstrate how ergonomists changed their focus to align with design and business goals to integrate HF into the design process.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

Directory of Open Access Journals (Sweden)

Elif Çepni

2012-01-01

Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

Application of Sensitivity Analysis in Design of Integrated Building Concepts

DEFF Research Database (Denmark)

Heiselberg, Per; Brohus, Henrik; Hesselholt, Allan Tind

2007-01-01

analysis makes it possible to identify the most important parameters in relation to building performance and to focus design and optimization of integrated building concepts on these fewer, but most important parameters. The sensitivity analyses will typically be performed at a reasonably early stage...... the design requirements and objectives. In the design of integrated building concepts it is beneficial to identify the most important design parameters in order to more efficiently develop alternative design solutions or more efficiently perform an optimization of the building performance. The sensitivity...

Integrated computer aided design simulation and manufacture

OpenAIRE

Diko, Faek

1989-01-01

Computer Aided Design (CAD) and Computer Aided Manufacture (CAM) have been investigated and developed since twenty years as standalone systems. A large number of very powerful but independent packages have been developed for Computer Aided Design,Aanlysis and Manufacture. However, in most cases these packages have poor facility for communicating with other packages. Recently attempts have been made to develop integrated CAD/CAM systems and many software companies a...

A design approach for integrating thermoelectric devices using topology optimization

DEFF Research Database (Denmark)

Soprani, Stefano; Haertel, Jan Hendrik Klaas; Lazarov, Boyan Stefanov

2016-01-01

Efficient operation of thermoelectric devices strongly relies on the thermal integration into the energy conversion system in which they operate. Effective thermal integration reduces the temperature differences between the thermoelectric module and its thermal reservoirs, allowing the system...... to operate more efficiently. This work proposes and experimentally demonstrates a topology optimization approach as a design tool for efficient integration of thermoelectric modules into systems with specific design constraints. The approach allows thermal layout optimization of thermoelectric systems...... for different operating conditions and objective functions, such as temperature span, efficiency, and power recoveryrate. As a specific application, the integration of a thermoelectric cooler into the electronics section ofa downhole oil well intervention tool is investigated, with the objective of minimizing...

Integrating IMS Learning Design and IMS Question and Test Interoperability using CopperCore Service Integration

NARCIS (Netherlands)

Vogten, Hubert; Martens, Harrie; Nadolski, Rob; Tattersall, Colin; Van Rosmalen, Peter; Koper, Rob

2006-01-01

Please, cite this publication as: Vogten, H., Martens, H., Nadolski, R., Tattersall, C., van Rosmalen, P., & Koper, R. (2006). Integrating IMS Learning Design and IMS Question and Test Interoperability using CopperCore Service Integration. Proceedings of International Workshop in Learning Networks

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

DEFF Research Database (Denmark)

Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

2005-01-01

Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes

Directory of Open Access Journals (Sweden)

Mostafa Bakhshi

2017-07-01

Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.

A Novel Analog Integrated Circuit Design Course Covering Design, Layout, and Resulting Chip Measurement

Science.gov (United States)

Lin, Wei-Liang; Cheng, Wang-Chuan; Wu, Chen-Hao; Wu, Hai-Ming; Wu, Chang-Yu; Ho, Kuan-Hsuan; Chan, Chueh-An

2010-01-01

This work describes a novel, first-year graduate-level analog integrated circuit (IC) design course. The course teaches students analog circuit design; an external manufacturer then produces their designs in three different silicon chips. The students, working in pairs, then test these chips to verify their success. All work is completed within…

Sustainable Design Re-Examined: Integrated Approach to Knowledge Creation for Sustainable Interior Design

Science.gov (United States)

Lee, Young S.

2014-01-01

The article focuses on a systematic approach to the instructional framework to incorporate three aspects of sustainable design. It also aims to provide an instruction model for sustainable design stressing a collective effort to advance knowledge creation as a community. It develops a framework conjoining the concept of integrated process in…

Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

Science.gov (United States)

Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

2016-10-01

The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

3D Integration of MEMS and IC: Design, technology and simulations

OpenAIRE

Schjølberg-Henriksen, Kari

2009-01-01

* 3D integration: Opportunities and trends* e-CUBES: Tire pressure monitoring system (TPMS)* Package design including thermo-mechanical modeling* Technology development* Sensor packaging concept* Gold stud bump bonding* Device characterization and testing* Summary and outlook 3D Integration of MEMS and IC: Design, technology and simulations

Analysis of the capability to effectively design complementary metal oxide semiconductor integrated circuits

Science.gov (United States)

McConkey, M. L.

1984-12-01

A complete CMOS/BULK design cycle has been implemented and fully tested to evaluate its effectiveness and a viable set of computer-aided design tools for the layout, verification, and simulation of CMOS/BULK integrated circuits. This design cycle is good for p-well, n-well, or twin-well structures, although current fabrication technique available limit this to p-well only. BANE, an integrated layout program from Stanford, is at the center of this design cycle and was shown to be simple to use in the layout of CMOS integrated circuits (it can be also used to layout NMOS integrated circuits). A flowchart was developed showing the design cycle from initial layout, through design verification, and to circuit simulation using NETLIST, PRESIM, and RNL from the University of Washington. A CMOS/BULK library was designed and includes logic gates that were designed and completely tested by following this flowchart. Also designed was an arithmetic logic unit as a more complex test of the CMOS/BULK design cycle.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

An integrated 3D design, modeling and analysis resource for SSC detector systems

International Nuclear Information System (INIS)

DiGiacomo, N.J.; Adams, T.; Anderson, M.K.; Davis, M.; Easom, B.; Gliozzi, J.; Hale, W.M.; Hupp, J.; Killian, K.; Krohn, M.; Leitch, R.; Lajczok, M.; Mason, L.; Mitchell, J.; Pohlen, J.; Wright, T.

1989-01-01

Integrated computer aided engineering and design (CAE/CAD) is having a significant impact on the way design, modeling and analysis is performed, from system concept exploration and definition through final design and integration. Experience with integrated CAE/CAD in high technology projects of scale and scope similar to SSC detectors leads them to propose an integrated computer-based design, modeling and analysis resource aimed specifically at SSC detector system development. The resource architecture emphasizes value-added contact with data and efficient design, modeling and analysis of components, sub-systems or systems with fidelity appropriate to the task. They begin with a general examination of the design, modeling and analysis cycle in high technology projects, emphasizing the transition from the classical islands of automation to the integrated CAE/CAD-based approach. They follow this with a discussion of lessons learned from various attempts to design and implement integrated CAE/CAD systems in scientific and engineering organizations. They then consider the requirements for design, modeling and analysis during SSC detector development, and describe an appropriate resource architecture. They close with a report on the status of the resource and present some results that are indicative of its performance. 10 refs., 7 figs

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong; Qian, Pei-Yuan

2009-01-01

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

Simulation of integrated beam experiment designs

International Nuclear Information System (INIS)

Grote, D.P.; Sharp, W.M.

2004-01-01

Simulation of designs of an Integrated Beam Experiment (IBX) class accelerator have been carried out. These simulations are an important tool for validating such designs. Issues such as envelope mismatch and emittance growth can be examined in a self-consistent manner, including the details of injection, accelerator transitions, long-term transport, and longitudinal compression. The simulations are three-dimensional and time-dependent, and begin at the source. They continue up through the end of the acceleration region, at which point the data is passed on to a separate simulation of the drift compression. Results are be presented

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Safety design integrated in the Building Delivery System

DEFF Research Database (Denmark)

Jørgensen, Kirsten

2012-01-01

phases of the building delivery system by using the principle of the lean construction modelling. The method for the research was to go through the lean construction building delivery system step by step and create a normative description of what to do, when to do and how to do to fully integration...... of safety in each process. The group of participants who created the description had a high experience in a combination of research, safety and health in general and especial in construction and knowledge of the lean construction processes both from the clients perspective as well as from the designers...... and the consultants. The result is a concept and guideline including control schemes for how to integrate safety design in the lean construction building delivery system including what to do and when. The concept has been tested in an educational context and found useful by the designers. The practical value...

Challenges and opportunities in integration of design and control

DEFF Research Database (Denmark)

Huusom, Jakob Kjøbsted

2015-01-01

Process synthesis and design of plant operation are related topics but current industrial practice solves these problems sequentially. The implication of this sequential strategy may result in design of processing systems which are very hard to control. This paper presents a discussion on drivers...... for an integrated approach and outlines the challenges in formulation of such a multi-objective synthesis problem. This discussion is viewed in relation to some of the changing trends in the industry. Significant results have been published which in different ways seek to handle the integrated problem. Further...

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

Science.gov (United States)

Elkins, Kelly M.; Kadunc, Raelynn E.

2012-01-01

In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

GLobal Integrated Design Environment

Science.gov (United States)

Kunkel, Matthew; McGuire, Melissa; Smith, David A.; Gefert, Leon P.

2011-01-01

The GLobal Integrated Design Environment (GLIDE) is a collaborative engineering application built to resolve the design session issues of real-time passing of data between multiple discipline experts in a collaborative environment. Utilizing Web protocols and multiple programming languages, GLIDE allows engineers to use the applications to which they are accustomed in this case, Excel to send and receive datasets via the Internet to a database-driven Web server. Traditionally, a collaborative design session consists of one or more engineers representing each discipline meeting together in a single location. The discipline leads exchange parameters and iterate through their respective processes to converge on an acceptable dataset. In cases in which the engineers are unable to meet, their parameters are passed via e-mail, telephone, facsimile, or even postal mail. The result of this slow process of data exchange would elongate a design session to weeks or even months. While the iterative process remains in place, software can now exchange parameters securely and efficiently, while at the same time allowing for much more information about a design session to be made available. GLIDE is written in a compilation of several programming languages, including REALbasic, PHP, and Microsoft Visual Basic. GLIDE client installers are available to download for both Microsoft Windows and Macintosh systems. The GLIDE client software is compatible with Microsoft Excel 2000 or later on Windows systems, and with Microsoft Excel X or later on Macintosh systems. GLIDE follows the Client-Server paradigm, transferring encrypted and compressed data via standard Web protocols. Currently, the engineers use Excel as a front end to the GLIDE Client, as many of their custom tools run in Excel.

Contribution to the center and integrability problems in planar vector fields

OpenAIRE

Santallusia Esvert, Xavier

2017-01-01

Aquesta tesi consta d'un primer capítol introductori, set capítols amb diferents resultats i una bibliografia. El primer capítol conté la definició i els resultats previs necessaris per abordar la resta de la memòria. El capítol 2 i 3 estan molt relacionats. En el primer es descriu un mètode alternatiu per al còmput de les constants de Poincaré--Liapunov. A diferència de mètodes anteriors, el mètode presentat no requereix el càlcul d'integrals i d'ona de forma explícita les constants de P...

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Integrating ergonomics into engineering design: The role of objects

DEFF Research Database (Denmark)

Hall-Andersen, Lene Bjerg; Broberg, Ole

2014-01-01

The objective of this study was to explore the role of objects in integrating ergonomic knowledge in engineering design processes. An engineering design case was analyzed using the theoretical concepts of boundary objects and intermediary objects: Boundary objects facilitate collaboration between...

An approach to integrated design based componet software and OLE-technology

DEFF Research Database (Denmark)

Bagger-Petersen, Susanne C; Emborg, Jørgen; Andersen, Tom

1996-01-01

The paper reports on a prototype developed as to demonstrate the (dis)abilities of the OLE-standard to integrate different design-applications to a CAD-syste.......The paper reports on a prototype developed as to demonstrate the (dis)abilities of the OLE-standard to integrate different design-applications to a CAD-syste....

Conceptual design of main coolant pump for integral reactor SMART

Energy Technology Data Exchange (ETDEWEB)

Park, Jin Seok; Kim, Jong In; Kim, Min Hwan [Korea Atomic Energy Research Institute, Taejon (Korea)

1999-12-01

The conceptual design for MCP to be installed in the integral reactor SMART was carried out. Canned motor pump was adopted in the conceptual design of MCP. Three-dimensional modeling was performed to visualize the conceptual design of the MCP and to check interferences between the parts. The theoretical design procedure for the impeller was developed. The procedures for the flow field and structural analysis of impeller was also developed to assess the design validity and to verify its structural integrity. A computer program to analyze the dynamic characteristics of the rotor shaft of MCP was developed. The rotational speed sensor was designed and its performance test was conducted to verify the possibility of operation. A prototypes of the canned motor was manufactured and tested to confirm the validity of the design concept. The MCP design concept was also investigated for fabricability by establishing the manufacturing procedures. 41 refs., 96 figs., 10 tabs. (Author)

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Safeguards-by-Design: An Element of 3S Integration

International Nuclear Information System (INIS)

Bean, R.S.; Bjornard, T.A.; Hebdich, D.J.

2009-01-01

In 2008, the '20/20 Vision for the Future' background report by the IAEA Director General identified the possibility of integrating certain activities related to safeguards, safety, and security. Later in the year, the independent Commission report prepared at the request of the IAEA Director General noted that the Agency's's roles in nuclear safeguards, safety, and security (3S) complement and can mutually reinforce each other. Safeguards-by-design (SBD) is a practical measure that strengthens 3S integration, especially for the stage of nuclear facility design and construction, but also with ramifications for other stages of the facility life-cycle. This paper describes the SBD concept, with examples for diverse regulatory environments, being developed in the U.S under the U.S. Department of Energy (DOE) Next Generation Safeguards Initiative and the Advanced Fuel Cycle Initiative. This is compared with related international SBD work performed in the recent IAEA workshop on 'Facility Design and Plant Operation Features that Facilitate the Implementation of IAEA Safeguards'. Potential future directions for further development of SBD and its integration within 3S are identified.

On the Integration of Digital Design and Analysis Tools

DEFF Research Database (Denmark)

Klitgaard, Jens; Kirkegaard, Poul Henning

2006-01-01

The aim of this research is to look into integrated digital design and analysis tools in order to find out if it is suited for use by architects and designers or only by specialists and technicians - and if not, then to look at what can be done to make them more available to architects and design...

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Integrated Energy Design of the Building Envelope

DEFF Research Database (Denmark)

Nielsen, Martin Vraa

This thesis describes the outcome of the PhD project Integrated energy design of the building envelope carried out through a combination of scientific dissemination reported through peer-reviewed journals and a wide range of affiliated projects involved in at an architectural firm. The research...

Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

Directory of Open Access Journals (Sweden)

Modesto Redrejo-Rodríguez

2017-11-01

Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

Science.gov (United States)

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

Science.gov (United States)

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Implications of intelligent, integrated microsystems for product design and development

International Nuclear Information System (INIS)

MYERS, DAVID R.; MCWHORTER, PAUL J.

2000-01-01

Intelligent, integrated microsystems combine some or all of the functions of sensing, processing information, actuation, and communication within a single integrated package, and preferably upon a single silicon chip. As the elements of these highly integrated solutions interact strongly with each other, the microsystem can be neither designed nor fabricated piecemeal, in contrast to the more familiar assembled products. Driven by technological imperatives, microsystems will best be developed by multi-disciplinary teams, most likely within the flatter, less hierarchical organizations. Standardization of design and process tools around a single, dominant technology will expedite economically viable operation under a common production infrastructure. The production base for intelligent, integrated microsystems has elements in common with the mathematical theory of chaos. Similar to chaos theory, the development of microsystems technology will be strongly dependent on, and optimized to, the initial product requirements that will drive standardization--thereby further rewarding early entrants to integrated microsystem technology

Integration of Design and Control Through Model Analysis

DEFF Research Database (Denmark)

Russel, Boris Mariboe; Henriksen, Jens Peter; Jørgensen, Sten Bay

2000-01-01

of the phenomena models representing the process model identify the relationships between the important process and design variables, which help to understand, define and address some of the issues related to integration of design and control issues. The model analysis is highlighted through examples involving...... processes with mass and/or energy recycle. (C) 2000 Elsevier Science Ltd. All rights reserved....

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Global design of an active integrated antenna for millimeter wave

OpenAIRE

Marzolf, Eric; Drissi, M’hamed

2001-01-01

An active integrated antenna working in the millimeter wave has been realized in a monolithic process. The concept of active integrated antenna is first introduced, then the design of the integrated circuit based on a global approach, following electromagnetic and circuit simulations, is presented. The obtained performances of the active antenna are discussed and compared to a passive one.

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Developing an Integrated Design Strategy for Chip Layout Optimization

NARCIS (Netherlands)

Wits, Wessel Willems; Jauregui Becker, Juan Manuel; van Vliet, Frank Edward; te Riele, G.J.

2011-01-01

This paper presents an integrated design strategy for chip layout optimization. The strategy couples both electric and thermal aspects during the conceptual design phase to improve chip performances; thermal management being one of the major topics. The layout of the chip circuitry is optimized

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

ITER design, integration and assembly studies assisted by virtual reality

Energy Technology Data Exchange (ETDEWEB)

Keller, D., E-mail: delphine.keller@cea.fr [CEA, IRFM, F-13108 St-Paul-Lez-Durance (France); ITER Organization, Route de Vinon-sur-Verdon, F-13115 St-Paul-Lez-Durance (France); Doceul, L.; Ferlay, F.; Jiolat, G. [CEA, IRFM, F-13108 St-Paul-Lez-Durance (France); Cordier, J.J.; Kuehn, I.; Manfreo, B.; Reich, J. [ITER Organization, Route de Vinon-sur-Verdon, F-13115 St-Paul-Lez-Durance (France)

2013-10-15

Highlights: ► VR technologies applied to Fusion enable to better and faster understand integration issues. ► Problems are solved and validated on a numerical mock up. ► Integration and accessibility issues can be identified in the earliest design. ► VR technologies are very helpful for assembly and maintenance operation simulations. ► New tools for real time simulations of hands-on operations are currently under development. -- Abstract: In a project like ITER where schedule, resources and cost is continuously optimized, emphasis has to be put on developing long lead items first while keeping other designs very low in definition. Hence, at a particular stage of the project, several components have to coexist in the integrated system while handling different level of maturity. Therefore, all the difficulty consists in managing the interfaces between all these components and to minimize the risk of design changes on the most advanced components. As a future exploitant, ITER is in charge of managing these interfaces and to ensure that maintenance of especially safety important class components (SIC) is feasible. These operation and maintenance constraints have to be taken into account since the earliest design of the components itselves. In this context, CEA IRFM is taking the benefit of using its virtual reality (VR) platform and simulation tools to assist ITER Organization in improving the efficiency of the inconsistencies identification and the machine sub-system design optimization. Currently, two contracts are on-going: the first one concerns the cryostat and in-vessel components; the second one concerns the overall Tokamak (TKM) and diagnostic buildings. This paper describes how VR tools applied to fusion and especially to ITER can help design and Integration with taking into account assembly and maintenance requirements at early stage in the design of complex systems.

ITER design, integration and assembly studies assisted by virtual reality

International Nuclear Information System (INIS)

Keller, D.; Doceul, L.; Ferlay, F.; Jiolat, G.; Cordier, J.J.; Kuehn, I.; Manfreo, B.; Reich, J.

2013-01-01

Highlights: ► VR technologies applied to Fusion enable to better and faster understand integration issues. ► Problems are solved and validated on a numerical mock up. ► Integration and accessibility issues can be identified in the earliest design. ► VR technologies are very helpful for assembly and maintenance operation simulations. ► New tools for real time simulations of hands-on operations are currently under development. -- Abstract: In a project like ITER where schedule, resources and cost is continuously optimized, emphasis has to be put on developing long lead items first while keeping other designs very low in definition. Hence, at a particular stage of the project, several components have to coexist in the integrated system while handling different level of maturity. Therefore, all the difficulty consists in managing the interfaces between all these components and to minimize the risk of design changes on the most advanced components. As a future exploitant, ITER is in charge of managing these interfaces and to ensure that maintenance of especially safety important class components (SIC) is feasible. These operation and maintenance constraints have to be taken into account since the earliest design of the components itselves. In this context, CEA IRFM is taking the benefit of using its virtual reality (VR) platform and simulation tools to assist ITER Organization in improving the efficiency of the inconsistencies identification and the machine sub-system design optimization. Currently, two contracts are on-going: the first one concerns the cryostat and in-vessel components; the second one concerns the overall Tokamak (TKM) and diagnostic buildings. This paper describes how VR tools applied to fusion and especially to ITER can help design and Integration with taking into account assembly and maintenance requirements at early stage in the design of complex systems

CMOS analog integrated circuits high-speed and power-efficient design

CERN Document Server

Ndjountche, Tertulien

2011-01-01

High-speed, power-efficient analog integrated circuits can be used as standalone devices or to interface modern digital signal processors and micro-controllers in various applications, including multimedia, communication, instrumentation, and control systems. New architectures and low device geometry of complementary metaloxidesemiconductor (CMOS) technologies have accelerated the movement toward system on a chip design, which merges analog circuits with digital, and radio-frequency components. CMOS: Analog Integrated Circuits: High-Speed and Power-Efficient Design describes the important tren

Integration of Airfoil Design during the design of new blades

Energy Technology Data Exchange (ETDEWEB)

Sartori, L.; Bottasso, L.; Croce, A. [Politecnico di Milano, Milan (Italy); Grasso, F. [ECN Wind Power, Petten (Netherlands)

2013-09-15

Despite the fact that the design of a new blade is a multidisciplinary task, often the different disciplines are combined together at later stage. Looking at the aerodynamic design, it is common practice design/select the airfoils first and then design the blade in terms of chord and twist based on the initial selection of the airfoils. Although this approach is quite diffused, it limits the potentialities of obtaining optimal performance. The present work is focused on investigating the benefits of designing the external shape of the blade including the airfoil shapes together with chord and twist. To accomplish this, a design approach has been developed, where an advanced gradient based optimization algorithm is able to control the shape of the blade. The airfoils described in the work are the NACA 4 digits, while the chord distribution and the twist distribution are described through Bezier curves. In this way, the complexity of the problem is limited while a versatile geometrical description is kept. After the details of the optimization scheme are illustrated, several numerical examples are shown, demonstrating the advantages in terms of performance and development time of integrating the design of the airfoils during the optimization of the blade.

Automated Design Tools for Integrated Mixed-Signal Microsystems (NeoCAD)

National Research Council Canada - National Science Library

Petre, P; Visher, J; Shringarpure, R; Valley, F; Swaminathan, M

2005-01-01

Automated design tools and integrated design flow methodologies were developed that demonstrated more than an order- of-magnitude reduction in cycle time and cost for mixed signal (digital/analoglRF...

National Ignition Facility system design requirements NIF integrated computer controls SDR004

International Nuclear Information System (INIS)

Bliss, E.

1996-01-01

This System Design Requirement document establishes the performance, design, development, and test requirements for the NIF Integrated Computer Control System. The Integrated Computer Control System (ICCS) is covered in NIF WBS element 1.5. This document responds directly to the requirements detailed in the NIF Functional Requirements/Primary Criteria, and is supported by subsystem design requirements documents for each major ICCS Subsystem

Trends in integrated circuit design for particle physics experiments

International Nuclear Information System (INIS)

Atkin, E V

2017-01-01

Integrated circuits are one of the key complex units available to designers of multichannel detector setups. A whole number of factors makes Application Specific Integrated Circuits (ASICs) valuable for Particle Physics and Astrophysics experiments. Among them the most important ones are: integration scale, low power dissipation, radiation tolerance. In order to make possible future experiments in the intensity, cosmic, and energy frontiers today ASICs should provide new level of functionality at a new set of constraints and trade-offs, like low-noise high-dynamic range amplification and pulse shaping, high-speed waveform sampling, low power digitization, fast digital data processing, serialization and data transmission. All integrated circuits, necessary for physical instrumentation, should be radiation tolerant at an earlier not reached level (hundreds of Mrad) of total ionizing dose and allow minute almost 3D assemblies. The paper is based on literary source analysis and presents an overview of the state of the art and trends in nowadays chip design, using partially own ASIC lab experience. That shows a next stage of ising micro- and nanoelectronics in physical instrumentation. (paper)

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Study on integrated design and analysis platform of NPP

International Nuclear Information System (INIS)

Lu Dongsen; Gao Zuying; Zhou Zhiwei

2001-01-01

Many calculation software have been developed to nuclear system's design and safety analysis, such as structure design software, fuel design and manage software, thermal hydraulic analysis software, severe accident simulation software, etc. This study integrates those software to a platform, develops visual modeling tool for Retran, NGFM90. And in this platform, a distribution calculation method is also provided for couple calculation between different software. The study will improve the design and analysis of NPP

Integrated CAE system for nuclear power plants. Development of piping design check system

International Nuclear Information System (INIS)

Narikawa, Noboru; Sato, Teruaki

1994-01-01

Toshiba Corporation has developed and operated the integrated CAE system for nuclear power plants, the core of which is the engineering data base to manage accurately and efficiently enormous amount of data on machinery, equipment and piping. As the first step of putting knowledge base system to practical use, piping design check system has been developed. By automatically checking up piping design, this system aims at the prevention of overlooking mistakes, efficient design works and the overall quality improvement of design. This system is based on the thought that it supports designers, and final decision is made by designers. This system is composed of the integrated data base, a two-dimensional CAD system and three-dimensional CAD system. The piping design check system is one of the application systems of the integrated CAE system. Object-oriented programming is the base of the piping design check system, and design knowledge and CAD data are necessary. As to the method of realizing the check system, the flow of piping design, the checkup functions, the checkup of interference and attribute base, and the integration of the system are explained. (K.I)

DESIGN ANALYSIS OF ELECTRICAL MACHINES THROUGH INTEGRATED NUMERICAL APPROACH

Directory of Open Access Journals (Sweden)

ARAVIND C.V.

2016-02-01

Full Text Available An integrated design platform for the newer type of machines is presented in this work. The machine parameters are evaluated out using developed modelling tool. With the machine parameters, the machine is modelled using computer aided tool. The designed machine is brought to simulation tool to perform electromagnetic and electromechanical analysis. In the simulation, conditions setting are performed to setup the materials, meshes, rotational speed and the excitation circuit. Electromagnetic analysis is carried out to predict the behavior of the machine based on the movement of flux in the machines. Besides, electromechanical analysis is carried out to analyse the speed-torque characteristic, the current-torque characteristic and the phase angle-torque characteristic. After all the results are analysed, the designed machine is used to generate S block function that is compatible with MATLAB/SIMULINK tool for the dynamic operational characteristics. This allows the integration of existing drive system into the new machines designed in the modelling tool. An example of the machine design is presented to validate the usage of such a tool.

A new integrated microwave SQUID circuit design

International Nuclear Information System (INIS)

Erne, S.N.; Finnegan, T.F.

1980-01-01

In this paper we consider the design and operation of a planar thin-film rf-SQUID circuit which can be realized via microwave-integrated-circuit (MIC) techniques and which differs substantially from pervious microwave SQUID configurations involving either mechanical point-contact or cylindrical thin-film micro-bridge geometries. (orig.)

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

Adopting De Novo Programming Approach on IC Design Service Firms Resources Integration

Directory of Open Access Journals (Sweden)

James K. C. Chen

2014-01-01

Full Text Available The semiconductor industry has very important position in computer industry, ICT field, and new electronic technology developing. The IC design service is one of key factor of semiconductor industry development. There are more than 365 IC design service firms have been established around Hsinchu Science Park in Taiwan. Building an efficient planning model for IC design service firm resources integrating is very interest issue. This study aims to construct a planning model for IC design service firm implementation resources integration. This study uses the De Novo programming as an approach of criteria alternative to achieve optimal resource allocation on IC design firm. Results show the IC design service firm should conduct open innovation concept and utilizes design outsourcing obtains cost down and enhance IC design service business performance. This plan model of De Novo programming is not only for IC design service firm and also can apply to the other industrial implementation strategic alliance/integrating resource. This plan model is a universal model for the others industries field.

Designing Critique for Knowledge Integration

Science.gov (United States)

Sato, Mie Elissa

Generating explanations is central to science and has the potential to have a powerful impact on students' conceptual understanding in science instruction. However, improving conceptual understanding by generating explanations is a fraught affair: students may struggle with the sense of false clarity that may arise from generating explanations, fail to detect gaps in their understanding, and dismiss salient information that contradict their beliefs. Critiquing explanations has the potential to counteract these pitfalls by exposing students to alternative ideas to contrast with their own. This dissertation seeks to clarify how to design critique in technology-enhanced science instruction to support students in revising their explanations about scientific phenomena, and in doing so, refining their conceptual understanding. Using the Knowledge Integration framework, I revised two technology-enhanced curriculum units, Plate Tectonics and Global Climate Change, in a design partnership between teachers, researchers, and technologists. I conducted a series of studies with sixth-grade students to investigate the conditions under which guided critique of explanations can support revision. The pilot critique study investigated the impact of the revised Plate Tectonics unit on students' understanding of convection, as well as of a preliminary design of critique where students generated and applied their own criteria for what makes a good explanation in science. The guidance study explored how incorporating a complex selection task that features meta-explanatory criteria into critique supports students in distinguishing among different criteria, as well as how students use peer or expert guidance on their initial explanation during revision. The critique study investigated how designing critique with a complex selection task that features plausible alternative ideas and giving guidance on students' critiques support students in distinguishing among a range of relevant ideas

Packaging for consumer electronic products : The need for integrating design and engineering

NARCIS (Netherlands)

Wever, R.; Boks, C.; Stevels, A.

2008-01-01

From the perspective of a multinational corporation producing durable consumer goods sustainable packaging is packaging that fulfils the right functionalities in the most efficient way. In order to achieve this, an integral design process is required. Such an integral approach to the design of

Exploring Alternatives for Representing and Accessing Design Knowledge About Enterprise Integration

Science.gov (United States)

Umapathy, Karthikeyan; Purao, Sandeep

Enterprise integration refers to solutions that facilitate meaningful interactions among heterogeneous legacy applications. The scale, complexity and specificity of most enterprise integration efforts mean that design knowledge for enterprise integration has resisted codification. Important exceptions to this include: use of Business Process Models (BPM) to understand integration requirements; and Enterprise Integration Patterns (EIP), which present designers with abstract descriptions of recurring design tactics for integrating applications. The two, however, can be at odds. BPM encourages the control flow perspective; whereas EIP codifies an operational perspective. Mapping between the two to develop coherent solutions, therefore, tends to be problematic. To bridge the gap, we suggest an approach that builds on the theory of speech acts. We develop essential components of such an approach, including a re-representation of EIP as structures of speech acts, a characterization of tasks in BPM with action types, and a mapping between speech acts and action types. These components are accompanied by inference rules that produce a mapping between sets of tasks in a business process and structures of speech acts to allow reasoning on identification of appropriate EIPs for given set of tasks. We demonstrate usefulness of the proposed approach by application to industry cases.

An integral design of NHR-200

International Nuclear Information System (INIS)

Xue Dazhi; Li Jicai; Chang Dafeng

1997-01-01

Nuclear heating application has received a wide attention in China due to the favourable economic and environmental aspects. The Nuclear Heating Plant NHR-200 is seen to provide the required energy for district heating, industrial processes and seawater desalination for many sites in China and possibly abroad. The paper summarizes the technical description of the plant and give its main characteristics related to the integral design approach. (author)

Parametric design and analysis framework with integrated dynamic models

DEFF Research Database (Denmark)

Negendahl, Kristoffer

2014-01-01

of building energy and indoor environment, are generally confined to late in the design process. Consequence based design is a framework intended for the early design stage. It involves interdisciplinary expertise that secures validity and quality assurance with a simulationist while sustaining autonomous...... control with the building designer. Consequence based design is defined by the specific use of integrated dynamic modeling, which includes the parametric capabilities of a scripting tool and building simulation features of a building performance simulation tool. The framework can lead to enhanced...

Designing charge-sensitive preamplifiers based on low-noise analog integrated circuits

International Nuclear Information System (INIS)

Agakhanyan, T.M.

1998-01-01

The methodology for designing charge-sensitive preamplifiers on the low-noise analog integral circuits, including all the stages: the mathematical synthesis with optimization of the intermediate function; the scheme-technical synthesis with parametric optimization of the scheme and analysis of draft projects with the parameter verification is presented. The designing is conducted on the basis of requirements for signal parameters and noise indices of the preamplifier. The system of automated designing of the charge-sensitive preamplifiers on the low-noise analog integral circuits is developed [ru

The GOTTHARD charge integrating readout detector: design and characterization

International Nuclear Information System (INIS)

Mozzanica, A; Bergamaschi, A; Dinapoli, R; Greiffenberg, D; Henrich, B; Johnson, I; Valeria, R; Schmitt, B; Xintian, S; Graafsma, H; Lohmann, M

2012-01-01

A charge integrating readout ASIC (Application Specific Integrated Circuit) for silicon strip sensors has been developed at PSI in collaboration with DESY. The goal of the project is to provide a charge integrating readout system able to cope with the pulsed beam of XFEL machines and at the same time to retain the high dynamic range and single photon resolution performances typical for photon counting systems. The ASIC, designed in IBM 130 nm CMOS technology, takes advantage of its three gain stages with automatic stage selection to achieve a dynamic range of 10000 12 keV photons and a noise better than 300 e.n.c.. The 4 analog outputs of the ASIC are optimized for speed, allowing frame rates higher than 1 MHz, without compromises on linearity and noise performances. This work presents the design features of the ASIC, and reports the characterization results of the chip itself.

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Development of core design and analyses technology for integral reactor

Energy Technology Data Exchange (ETDEWEB)

Zee, Sung Quun; Lee, C. C.; Song, J. S. and others

1999-03-01

Integral reactors are developed for the applications such as sea water desalination, heat energy for various industries, and power sources for large container ships. In order to enhance the inherent and passive safety features, low power density concept is chosen for the integral reactor SMART. Moreover, ultra-longer cycle and boron-free operation concepts are reviewed for better plant economy and simple design of reactor system. Especially, boron-free operation concept brings about large difference in core configurations and reactivity controls from those of the existing large size commercial nuclear power plants and also causes many differences in the safety aspects. The ultimate objectives of this study include detailed core design of a integral reactor, development of the core design system and technology, and finally acquisition of the system design certificate. The goal of the first stage is the conceptual core design, that is, to establish the design bases and requirements suitable for the boron-free concept, to develop a core loading pattern, to analyze the nuclear, thermal and hydraulic characteristics of the core and to perform the core shielding design. Interface data for safety and performance analyses including fuel design data are produced for the relevant design analysis groups. Nuclear, thermal and hydraulic, shielding design and analysis code systems necessary for the core conceptual design are established through modification of the existing design tools and newly developed methodology and code modules. Core safety and performance can be improved by the technology development such as boron-free core optimization, advaned core monitoring and operational aid system. Feasiblity study on the improvement of the core protection and monitoring system will also contribute toward core safety and performance. Both the conceptual core design study and the related technology will provide concrete basis for the next design phase. This study will also

Development of core design and analyses technology for integral reactor

International Nuclear Information System (INIS)

Zee, Sung Quun; Lee, C. C.; Song, J. S. and others

1999-03-01

Integral reactors are developed for the applications such as sea water desalination, heat energy for various industries, and power sources for large container ships. In order to enhance the inherent and passive safety features, low power density concept is chosen for the integral reactor SMART. Moreover, ultra-longer cycle and boron-free operation concepts are reviewed for better plant economy and simple design of reactor system. Especially, boron-free operation concept brings about large difference in core configurations and reactivity controls from those of the existing large size commercial nuclear power plants and also causes many differences in the safety aspects. The ultimate objectives of this study include detailed core design of a integral reactor, development of the core design system and technology, and finally acquisition of the system design certificate. The goal of the first stage is the conceptual core design, that is, to establish the design bases and requirements suitable for the boron-free concept, to develop a core loading pattern, to analyze the nuclear, thermal and hydraulic characteristics of the core and to perform the core shielding design. Interface data for safety and performance analyses including fuel design data are produced for the relevant design analysis groups. Nuclear, thermal and hydraulic, shielding design and analysis code systems necessary for the core conceptual design are established through modification of the existing design tools and newly developed methodology and code modules. Core safety and performance can be improved by the technology development such as boron-free core optimization, advaned core monitoring and operational aid system. Feasiblity study on the improvement of the core protection and monitoring system will also contribute toward core safety and performance. Both the conceptual core design study and the related technology will provide concrete basis for the next design phase. This study will also

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

Integrating ergonomics in design processes: a case study within an engineering consultancy firm.

Science.gov (United States)

Sørensen, Lene Bjerg; Broberg, Ole

2012-01-01

This paper reports on a case study within an engineering consultancy firm, where engineering designers and ergonomists were working together on the design of a new hospital sterile processing plant. The objective of the paper is to gain a better understanding of the premises for integrating ergonomics into engineering design processes and how different factors either promote or limit the integration. Based on a grounded theory approach a model illustrating these factors is developed and different hypotheses about how these factors either promote and/or limit the integration of ergonomics into design processes is presented along with the model.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Design and Integration of Wearable Devices in Textiles

Directory of Open Access Journals (Sweden)

Isabel G. TRINDADE

2014-12-01

Full Text Available In this article, the design, production method, integration and characterization of textile sensors for the continuous monitoring of cardiac and respiration vital signals are presented. Textile electrodes, capacitive and piezoresistive sensors and respective interconnect plate were developed and integrated in elastic and adjustable chest bands, using a 6-needle digital embroidery machine and electrically conductive commercial threads. The signal's waveforms were recorded via PC with a data acquisition module and a LabView program. The signal to noise ratio of textile electrodes, having distinctive surface morphologies, that were either textured or smooth accordingly with the embroidery pattern used, were analyzed with Matlab. The quantitative method indicated differences between the two types of textile electrodes but performances comparable to standard Ag/AgCl gel electrodes. The sensors and interconnect plate were fully realized with the embroidery stitching method with textile fabrics and threads, and have a compact design, are lightweight and washable. The method offers great versatility for custom demand, in terms of sensor design and materials.

Ship Design and Construction. An Integrated University Course

DEFF Research Database (Denmark)

Andersen, Poul; Jensen, Jørgen Juncher

1996-01-01

This paper describes an integrated course in design and construction of merchant ships taught at the Department of Naval Architecture andOffshore Engineering, the Technical University of Denmark. During the course, the students make a preliminary design of a ship of selected type and also design...... its engine room. The teaching combines lectures with laboratory work at the drawing tables and computer terminals. During the summer holiday, sea time on board ships of the relevant types are offered. Experienced naval architects from shipyards and ship consultancies give lectures and instructions...

NSSS Component Control System Design of Integral Reactor

International Nuclear Information System (INIS)

Lee, Joon Koo; Kwon, Ho Je; Jeong, Kwong Il; Park, Heui Youn; Koo, In Soo

2005-01-01

MMIS(Man Machine Interface System) of an integral reactor is composed of a Control Room, Plant Protection System, Control System and Monitoring System which are related with the overall plant operation. MMIS is being developed with a new design concept and digital technology to reduce the Human Factor Error and improve the systems' safety, reliability and availability. And CCS(component control system) is also being developed with a new design concept and digital hardware technology A fully digitalized system and design concept are introduced in the NSSS CCS

Design and development of small and medium integral reactor core

International Nuclear Information System (INIS)

Zee, Sung Quun; Chang, M. H.; Lee, C. C.; Song, J. S.; Cho, B. O.; Kim, K. Y.; Kim, S. J.; Park, S. Y.; Lee, K. B.; Lee, C. H.; Chun, T. H.; Oh, D. S.; In, W. K.; Kim, H. K.; Lee, C. B.; Kang, H. S.; Song, K. N.

1997-07-01

Recently, the role of small and medium size integral reactors is remarkable in the heat applications rather than the electrical generations. Such a range of possible applications requires extensive used of inherent safety features and passive safety systems. It also requires ultra-longer cycle operations for better plant economy. Innovative and evolutionary designs such as boron-free operations and related reactor control methods that are necessary for simple reactor system design are demanded for the small and medium reactor (SMR) design, which are harder for engineers to implement in the current large size nuclear power plants. The goals of this study are to establish preliminary design criteria, to perform the preliminary conceptual design and to develop core specific technology for the core design and analysis for System-integrated Modular Advanced ReacTor (SMART) of 330 MWt power. Based on the design criteria of the commercial PWR's, preliminary design criteria will be set up. Preliminary core design concept is going to be developed for the ultra-longer cycle and boron-free operation and core analysis code system is constructed for SMART. (author). 100 refs., 40 tabs., 92 figs

Integrated head area design of KNGR to reduce refueling outage duration

Energy Technology Data Exchange (ETDEWEB)

Jeong, Woo Tae; Park, Chi Yong; Kim, In Hwan; Kim, Dae Woong [Korea Electric Power Research Institute, Taejon (Korea, Republic of)

1998-12-31

In the design of KNGR (Korea Next Generation Reactor), we believe that economy is one of the most important factors to be considered. Thus, we reviewed and evaluated the consequences of designing the head area into an integrated package from an economical point of view. The refueling outage durations of the nuclear power plants currently in operation in Korea, some having and others not having integrated head package, are compared. This paper discusses the characteristics of head area design and the critical design issues of KNGR head area to evaluate the effect of the head area characteristics on the outage duration. 8 refs., 4 figs. (Author)

Integrated head area design of KNGR to reduce refueling outage duration

Energy Technology Data Exchange (ETDEWEB)

Jeong, Woo Tae; Park, Chi Yong; Kim, In Hwan; Kim, Dae Woong [Korea Electric Power Research Institute, Taejon (Korea, Republic of)

1997-12-31

In the design of KNGR (Korea Next Generation Reactor), we believe that economy is one of the most important factors to be considered. Thus, we reviewed and evaluated the consequences of designing the head area into an integrated package from an economical point of view. The refueling outage durations of the nuclear power plants currently in operation in Korea, some having and others not having integrated head package, are compared. This paper discusses the characteristics of head area design and the critical design issues of KNGR head area to evaluate the effect of the head area characteristics on the outage duration. 8 refs., 4 figs. (Author)

The integrated design of the ITER magnets and their auxiliary systems

International Nuclear Information System (INIS)

Huget, M.

1999-01-01

The magnet system design for the International Thermonuclear Experimental Reactor (ITER) has reached a high degree of integration to meet performance and operation requirements, including reliability and maintainability, in a cost effective manner. This paper identifies the requirements of long inductive burn time, large number of tokamak pulses, operational flexibility for the poloidal field (PF) system, magnet reliability and the cost constraints as the main design drivers. Key features of the magnet system which stem from these design drivers are described, together with interfaces and integration aspects of certain auxiliary systems. (author)

The integrated design of the ITER magnets and their auxiliary systems

International Nuclear Information System (INIS)

Huguet, M.

2001-01-01

The magnet system design for the International Thermonuclear Experimental Reactor (ITER) has reached a high degree of integration to meet performance and operation requirements, including reliability and maintainability, in a cost effective manner. This paper identifies the requirements of long inductive burn time, large number of tokamak pulses, operational flexibility for the poloidal field (PF) system, magnet reliability and the cost constraints as the main design drivers. Key features of the magnet system which stem from these design drivers are described, together with interfaces and integration aspects of certain auxiliary systems. (author)

Integrated Computer-aided Framework for Sustainable Chemical Product Design and Evaluation

DEFF Research Database (Denmark)

Kalakul, Sawitree; Cignitti, Stefano; Zhang, Lei

2016-01-01

This work proposes an integrated model-based framework for chemical product design and evaluation based on which the software, VPPD-Lab (The Virtual Product-Process Design Laboratory) has been developed. The framework allows the following options: (1) design a product using design templates...

Digital integrated circuit design using Verilog and SystemVerilog

CERN Document Server

Mehler, Ronald W

2014-01-01

For those with a basic understanding of digital design, this book teaches the essential skills to design digital integrated circuits using Verilog and the relevant extensions of SystemVerilog. In addition to covering the syntax of Verilog and SystemVerilog, the author provides an appreciation of design challenges and solutions for producing working circuits. The book covers not only the syntax and limitations of HDL coding, but deals extensively with design problems such as partitioning and synchronization, helping you to produce designs that are not only logically correct, but will actually

An ergonomics action research demonstration: integrating human factors into assembly design processes.

Science.gov (United States)

Village, J; Greig, M; Salustri, F; Zolfaghari, S; Neumann, W P

2014-01-01

In action research (AR), the researcher participates 'in' the actions in an organisation, while simultaneously reflecting 'on' the actions to promote learning for both the organisation and the researchers. This paper demonstrates a longitudinal AR collaboration with an electronics manufacturing firm where the goal was to improve the organisation's ability to integrate human factors (HF) proactively into their design processes. During the three-year collaboration, all meetings, workshops, interviews and reflections were digitally recorded and qualitatively analysed to inform new 'actions'. By the end of the collaboration, HF tools with targets and sign-off by the HF specialist were integrated into several stages of the design process, and engineers were held accountable for meeting the HF targets. We conclude that the AR approach combined with targeting multiple initiatives at different stages of the design process helped the organisation find ways to integrate HF into their processes in a sustainable way. Researchers acted as a catalyst to help integrate HF into the engineering design process in a sustainable way. This paper demonstrates how an AR approach can help achieve HF integration, the benefits of using a reflective stance and one method for reporting an AR study.

Use of integral data in the development of design methods for fast reactors

International Nuclear Information System (INIS)

Doncals, R.A.; Lake, J.A.; Paik, N.C.

1978-01-01

The paper describes an LMFBR nuclear design methodology which has been strongly influenced by the availability of integral data, by the expansion of the differential nuclear data base, by improvements in large nuclear design computer codes, and by the specific reactor under consideration. The accuracy of the nuclear data base has been improved as the result of detailed differential measurements as well as extensive integral testing in the ZPR and ZPPR criticals. Due to the increased interest in radial parfait designs, the applicability of the design data and methods to the analysis of heterogeneous LMFBR systems have been explored. The ability of the design data and methods to predict integral parameters in ZPPR is also discussed

Sexual health and religion: a primer for the sexual health clinician (CME).

Science.gov (United States)

Kellogg Spadt, Susan; Rosenbaum, Talli Y; Dweck, Alyssa; Millheiser, Leah; Pillai-Friedman, Sabitha; Krychman, Michael

2014-07-01

Sexual health is an integral part of the multifaceted human experience that is driven both by biological factors and psychological facets. Religion may provide a moral code of conduct or a sexual compass as to sexual norms and behaviors. The aim of this study was to summarize the integration of sexuality and religion. A review of published literature and religious texts was conducted. The integration of religion with country or state politics and laws is a complicated dilemma and will not be discussed in the scope of this article. The extent to which an individual incorporates their religious doctrine into their sexual life is a personal and individualized choice. The sexual medicine health professional will likely encounter a diverse patient population of distinct religious backgrounds, and a primer on religion and sexuality is a much needed adjunctive tool for the clinician. Because religion can influence sexuality and dictate, in part, the behavioral and medical treatments for sexual complaints, the clinician should be familiar with religious guidelines regarding sexuality, and treatment should be customized and individualized. Failure to do so can impact compliance with the therapeutic interventions. Religious awareness also solidifies the therapeutic alliance between clinician and patient as it demonstrates respect and acknowledgment for patient's beliefs and autonomy. © 2014 International Society for Sexual Medicine.

Design criteria of integrated reactors based on transients

International Nuclear Information System (INIS)

Zanocco, P.; Gimenez, M.; Delmastro, D.

1999-01-01

A new tendency in integrated reactors conceptual design is to include safety criteria through accident analysis. In this work, the effect of design parameters in a Loss of Heat Sink transient using design maps is analyzed. Particularly, geometry related parameters and reactivity coefficients are studied. Also the effect of primary relief/safety valve during the transient is evaluated. A design map for valve area vs. coolant density reactivity coefficient is obtained. A computer code (HUARPE) is developed in order to simulate these transients. Coolant, steam dome, pressure vessel structures and core models are implemented. This code is checked against TRAC with satisfactory results. (author)

Design Development and Verification of a System Integrated Modular PWR

International Nuclear Information System (INIS)

Kim, S.-H.; Kim, K. K.; Chang, M. H.; Kang, C. S.; Park, G.-C.

2002-01-01

An advanced PWR with a rated thermal power of 330 MW has been developed at the Korea Atomic Energy Research Institute (KAERI) for a dual purpose: seawater desalination and electricity generation. The conceptual design of SMART ( System-Integrated Modular Advanced ReacTor) with a desalination system was already completed in March of 1999. The basic design for the integrated nuclear desalination system is currently underway and will be finished by March of 2002. The SMART co-generation plant with the MED seawater desalination process is designed to supply forty thousand (40,000) tons of fresh water per day and ninety (90) MW of electricity to an area with approximately a ten thousand (100,000) population or an industrialized complex. This paper describes advanced design features adopted in the SMART design and also introduces the design and engineering verification program. In the beginning stage of the SMART development, top-level requirements for safety and economics were imposed for the SMART design features. To meet the requirements, highly advanced design features enhancing the safety, reliability, performance, and operability are introduced in the SMART design. The SMART consists of proven KOFA (Korea Optimized Fuel Assembly), helical once-through steam generators, a self-controlled pressurizer, control element drive mechanisms, and main coolant pumps in a single pressure vessel. In order to enhance safety characteristics, innovative design features adopted in the SMART system are low core power density, large negative Moderator Temperature Coefficient (MTC), high natural circulation capability and integral arrangement to eliminate large break loss of coolant accident, etc. The progression of emergency situations into accidents is prevented with a number of advanced engineered safety features such as passive residual heat removal system, passive emergency core cooling system, safeguard vessel, and passive containment over-pressure protection. The preliminary

Evaluation of Embedded System Component Utilized in Delivery Integrated Design Project Course

Science.gov (United States)

Junid, Syed Abdul Mutalib Al; Hussaini, Yusnira; Nazmie Osman, Fairul; Razak, Abdul Hadi Abdul; Idros, Mohd Faizul Md; Karimi Halim, Abdul

2018-03-01

This paper reports the evaluation of the embedded system component utilized in delivering the integrated electronic engineering design project course. The evaluation is conducted based on the report project submitted as to fulfil the assessment criteria for the integrated electronic engineering design project course named; engineering system design. Six projects were assessed in this evaluation. The evaluation covers the type of controller, programming language and the number of embedded component utilization as well. From the evaluation, the C-programming based language is the best solution preferred by the students which provide them flexibility in the programming. Moreover, the Analog to Digital converter is intensively used in the projects which include sensors in their proposed design. As a conclusion, in delivering the integrated design project course, the knowledge over the embedded system solution is very important since the high density of the knowledge acquired in accomplishing the project assigned.

Integrated design support systems for conceptual design of a space power reactor

International Nuclear Information System (INIS)

Shimoda, Hiroshi; Yoshikawa, Hidekazu; Takahashi, Makoto; Takeoka, Satoshi; Nagamatsu, Takashi; Ishizaki, Hiroaki

1999-01-01

In the process of conceptual design of large and complex engineering systems such as a nuclear power reactor, there must be various human works by several fields of engineers on each stage of design, analysis and evaluation. In this study, we have rearranged the design information to reduce the human workloads and have studied an efficient method to support the conceptual design works by new information technologies. For this purpose, we have developed two design support environments for conceptual design of a space power reactor as a concrete design target. When constructing an integrated design support environment, VINDS, which employs virtual reality(VR) technology, we focused on visualization of physical structure, functional organization and analysis calculation with full usage of easy perception and direct manipulation of VR. On the other hand, when constructing another asynchronous and distributed design support environment, WINDS, which employs WWW technology, we improved the support functions for cooperative design works among various fields of experts. In this paper, the basic concepts, configurations and functions of the design support environments are first described, then the future improvement is surveyed by their intercomparison. (author)

Integrated design and performance analysis of the KO HCCR TBM for ITER

Energy Technology Data Exchange (ETDEWEB)

Lee, Dong Won, E-mail: dwlee@kaeri.re.kr [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Jin, Hyung Gon; Lee, Eo Hwak; Yoon, Jae Sung; Kim, Suk Kwon; Lee, Cheol Woo [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Ahn, Mu-Young; Cho, Seungyon [National Fusion Research Institute, Daejeon (Korea, Republic of)

2015-10-15

Highlights: • Integrated analysis is performed with the conventional CFD code (ANSYS-CFX). • Overall pressure drop and coolant flow scheme are investigated. • Manifold design is being performed considering flow distribution. - Abstract: To develop tritium breeding technology for a Fusion Reactor, Korea has participated in the Test Blanket Module (TBM) program in ITER. The He Cooled Ceramic Reflector (HCCR) TBM consists of functional components such as First Wall (FW), Breeding Zone (BZ), Side Wall (SW), and Back Manifold (BM) and it was designed based on the separate analyses for each component in 2012. Based on the each component analysis model, the integrated model is prepared and thermal-hydraulic analysis for the HCCR TBM is performed in the present study. The coolant flow distribution from BM and SW to FW and BZ, and resulted structure temperatures are obtained with the integrated model. It is found that the non-uniform flow rate occurs at FW and BZ and it causes excess of the design limit (550 °C) at some region. Based on this integrated model, we will perform the design optimization for obtaining uniform flow distribution for satisfying the design requirements.

Development of core design and analyses technology for integral reactor

International Nuclear Information System (INIS)

Zee, Sung Quun; Lee, C. C.; Kim, K. Y.

2002-03-01

In general, small and medium-sized integral reactors adopt new technology such as passive and inherent safety concepts to minimize the necessity of power source and operator actions, and to provide the automatic measures to cope with any accidents. Specifically, such reactors are often designed with a lower core power density and with soluble boron free concept for system simplification. Those reactors require ultra long cycle operation for higher economical efficiency. This cycle length requirement is one of the important factors in the design of burnable absorbers as well as assurance of shutdown margin. Hence, both computer code system and design methodology based on the today's design technology for the current commercial reactor cores require intensive improvement for the small and medium-sized soluble boron free reactors. New database is also required for the development of this type of reactor core. Under these technical requirements, conceptual design of small integral reactor SMART has been performed since July 1997, and recently completed under the long term nuclear R and D program. Thus, the final objectives of this work is design and development of an integral reactor core and development of necessary indigenous design technology. To reach the goal of the 2nd stage R and D program for basic design of SMART, design bases and requirements adequate for ultra long cycle and soluble boron free concept are established. These bases and requirements are satisfied by the core loading pattern. Based on the core loading pattern, nuclear, and thermal and hydraulic characteristics are analyzed. Also included are fuel performance analysis and development of a core protection and monitoring system that is adequate for the soluble boron free core of an integral reactor. Core shielding design analysis is accomplished, too. Moreover, full scope interface data are produced for reactor safety and performance analyses and other design activities. Nuclear, thermal and

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

High Integrity Can Design Interfaces

International Nuclear Information System (INIS)

Shaber, E.L.

1998-01-01

The National Spent Nuclear Fuel Program is chartered with facilitating the disposition of DOE-owned spent nuclear fuel to allow disposal at a geologic repository. This is done through coordination with the repository program and by assisting DOE Site owners of SNF with needed information, standardized requirements, packaging approaches, etc. The High Integrity Can (HIC) will be manufactured to provide a substitute or barrier enhancement for normal fuel geometry and cladding. The can would be nested inside the DOE standardized canister which is designed to interface with the repository waste package. The HIC approach may provide the following benefits over typical canning approaches for DOE SNF. (a) It allows ready calculation and management of criticality issues for miscellaneous. (b) It segments and further isolates damaged or otherwise problem materials from normal SNF in the repository package. (c) It provides a very long term corrosion barrier. (d) It provides an extra internal pressure barrier for particulates, gaseous fission products, hydrogen, and water vapor. (e) It delays any potential release of fission products to the repository environment. (f) It maintains an additional level of fuel geometry control during design basis accidents, rock-fall, and seismic events. (g) When seal welded, it could provide the additional containment required for shipments involving plutonium content in excess of 20 Ci. (10 CFR 71.63.b) if integrated with an appropriate cask design. Long term corrosion protection is central to the HIC concept. The material selected for the HIC (Hastelloy C-22) has undergone extensive testing for repository service. The most severe theoretical interactions between iron, repository water containing chlorides and other repository construction materials have been tested. These expected chemical species have not been shown capable of corroding the selected HIC material. Therefore, the HIC should provide a significant barrier to DOE SNF dispersal

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

Designing the Distributed Model Integration Framework – DMIF

NARCIS (Netherlands)

Belete, Getachew F.; Voinov, Alexey; Morales, Javier

2017-01-01

We describe and discuss the design and prototype of the Distributed Model Integration Framework (DMIF) that links models deployed on different hardware and software platforms. We used distributed computing and service-oriented development approaches to address the different aspects of

High School Engineering and Technology Education Integration through Design Challenges

Science.gov (United States)

Mentzer, Nathan

2011-01-01

This study contextualized the use of the engineering design process by providing descriptions of how each element in a design process was integrated in an eleventh grade industry and engineering systems course. The guiding research question for this inquiry was: How do students engage in the engineering design process in a course where technology…

The challenge of integrating evidence-based design.

Science.gov (United States)

Martin, Caren S

2009-01-01

This paper discusses the integration of evidence-based design (EBD) into the design process as an innovation, illuminates the significance and progress of the diffusion of this innovation, and identifies EBD advocates and the consequences of meeting the EBD challenge. A free tool for engaging in EBD is explored. Healthcare designers are leading the EBD charge, because their clients depend on it. But not all designers engage in EBD, because it may be beyond the resources of a firm or outside its culture. However, as with other meaningful design innovations, designers who do not practice EBD could fall by the wayside. EBD is a product of the diffusion of the innovation of evidence-based medicine. The academy (i.e., the collective of institutions of higher education), design organizations, design communities, and the media all contribute to the diffusion of EBD. However, the quantity, quality, and understandability of evidence continue to challenge its broad adoption. InformeDesign®, a free, Internet-based tool, presents information to designers in a concise, understandable way. Firms must invest in EBD incrementally as a value-added component of design to meet current and future challenges. It is important for designers to realize that engaging in EBD is not a rejection of creativity, but a means by which to elevate their design solutions. ©2009 VENDOME GROUP, LLC

Integrating design and production planning with knowledge-based inspection planning system

International Nuclear Information System (INIS)

Abbasi, Ghaleb Y.; Ketan, Hussein S.; Adil, Mazen B.

2005-01-01

In this paper an intelligent environment to integrate design and inspection earlier to the design stage. A hybrid knowledge-based approach integrating computer-aided design (CAD) and computer-aided inspection planning (CAIP) was developed, thereafter called computer-aided design and inspection planning (CADIP). CADIP was adopted for automated dimensional inspection planning. Critical functional features were screened based on certain attributes for part features for inspection planning application. Testing the model resulted in minimizing the number of probing vectors associated with the most important features in the inspected prismatic part, significant reduction in inspection costs and release of human labor. In totality, this tends to increase customer satisfaction as a final goal of the developed system. (author)

Hermeneutics framework: integration of design rationale and optimizing software modules

NARCIS (Netherlands)

Aksit, Mehmet; Malakuti Khah Olun Abadi, Somayeh

To tackle the evolution challenges of adaptive systems, this paper argues on the necessity of hermeneutic approaches that help to avoid too early elimination of design alternatives. This visionary paper proposes the Hermeneutics Framework, which computationally integrates a design rationale

IPAD applications to the design, analysis, and/or machining of aerospace structures. [Integrated Program for Aerospace-vehicle Design

Science.gov (United States)

Blackburn, C. L.; Dovi, A. R.; Kurtze, W. L.; Storaasli, O. O.

1981-01-01

A computer software system for the processing and integration of engineering data and programs, called IPAD (Integrated Programs for Aerospace-Vehicle Design), is described. The ability of the system to relieve the engineer of the mundane task of input data preparation is demonstrated by the application of a prototype system to the design, analysis, and/or machining of three simple structures. Future work to further enhance the system's automated data handling and ability to handle larger and more varied design problems are also presented.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Integrated security systems design a complete reference for building enterprise-wide digital security systems