Insertion of molecular oxygen into a palladium(II) methyl bond: a radical chain mechanism involving palladium(III) intermediates.

Science.gov (United States)

Boisvert, Luc; Denney, Melanie C; Hanson, Susan Kloek; Goldberg, Karen I

2009-11-04

The reaction of (bipy)PdMe(2) (1) (bipy = 2,2'-bipyridine) with molecular oxygen results in the formation of the palladium(II) methylperoxide complex (bipy)PdMe(OOMe) (2). The identity of the product 2 has been confirmed by independent synthesis. Results of kinetic studies of this unprecedented oxygen insertion reaction into a palladium alkyl bond support the involvement of a radical chain mechanism. Reproducible rates, attained in the presence of the radical initiator 2,2'-azobis(2-methylpropionitrile) (AIBN), reveal that the reaction is overall first-order (one-half-order in both [1] and [AIBN], and zero-order in [O(2)]). The unusual rate law (half-order in [1]) implies that the reaction proceeds by a mechanism that differs significantly from those for organic autoxidations and for the recently reported examples of insertion of O(2) into Pd(II) hydride bonds. The mechanism for the autoxidation of 1 is more closely related to that found for the autoxidation of main group and early transition metal alkyl complexes. Notably, the chain propagation is proposed to proceed via a stepwise associative homolytic substitution at the Pd center of 1 with formation of a pentacoordinate Pd(III) intermediate.

v-Ha-ras oncogene insertion: A model for tumor progression of human small cell lung cancer

International Nuclear Information System (INIS)

Mabry, M.; Nakagawa, Toshitaro; Nelkin, B.D.; McDowell, E.; Gesell, M.; Eggleston, J.C.; Casero, R.A. Jr.; Baylin, S.B.

1988-01-01

Small cell lung cancer (SCLC) manifests a range of phenotypes in culture that may be important in understanding its relationship to non-SCLCs and to tumor progression events in patients. Most SCLC-derived cell lines, termed classic SCLC lines, have properties similar to SCLC tumors in patients. To delineate further the relationships between these phenotypes and the molecular events involved, the authors inserted the v-Ha-ras gene in SCLC cell lines with (biochemical variant) and without (classic) an amplified c-myc gene. These two SCLC subtypes had markedly different phenotypic responses to similar levels of expression of v-Ha-ras RNA. No biochemical or morphologic changes were observed in classic SCLC cells. In contrast, in biochemical variant SCLC cells, v-Ha-ras expression induced features typical of large cell undifferentiated lung carcinoma. Expression of v-Ha-ras in biochemical variant SCLC cells directly demonstrates that important transitions can occur between phenotypes of human lung cancer cells and that these may play a critical role in tumor progression events in patients. The finding provide a model system to study molecular events involved in tumor progression steps within a series of related tumor types

Comparison of four techniques of nasogastric tube insertion in anaesthetised, intubated patients: A randomized controlled trial

Directory of Open Access Journals (Sweden)

Mohan Chandra Mandal

2014-01-01

Full Text Available Background and Aims: Insertion of nasogastric tubes (NGTs in anaesthetised, intubated patients with a conventional method is sometimes difficult. Different techniques of NGT insertion have been tried with varying degree of success. The aim of this prospective, randomised, open-label study was to evaluate three modified techniques of NGT insertion comparing with the conventional method in respect of success rate, time taken for insertion and the adverse events. Methods: In the operation theatre of general surgery, the patients were randomly allocated into four groups: Group C (control group, n = 54, Group W (ureteral guide wire group, n = 54, Group F (neck flexion with lateral pressure, n = 54 and Group R (reverse Sellick′s manoeuvre, n = 54. The number of attempts for successful NGT insertion, time taken for insertion and adverse events were noted. Results: All the three modified techniques were found more successful than the conventional method on the first attempt. The least time taken for insertion was noted in the reverse Sellick′s method. However, on intergroup analysis, neck flexion and reverse Sellick′s methods were comparable but significantly faster than the other two methods with respect to time taken for insertion. Conclusion: Reverse Sellick′s manoeuver, neck flexion with lateral neck pressure and guide wire-assisted techniques are all better alternatives to the conventional method for successful, quick and reliable NGT insertion with permissible adverse events in anaesthetised, intubated adult patients. Further studies after eliminating major limitations of the present study are warranted to establish the superiority of any one of these modified techniques.

Inertial confinement fusion target insertion concepts for the National Ignition Facility

International Nuclear Information System (INIS)

Laughon, G.J.; Schultz, K.R.

1996-01-01

The National Ignition Facility (NIF) will be used to demonstrate fusion ignition in a laboratory environment in order to support development of inertial fusion as a potential fusion energy source for civilian use. However, target insertion must first be addressed before inertial fusion can become a practical energy source. Since target insertion systems currently utilized are not suitable for multiple shots in quick succession, insertion concepts involving free-falling and artificially accelerated targets are developed and evaluated against a set of predetermined guidelines. It is shown that a system involving a fast retraction positioner would be suitable. 5 refs., 4 figs

Probabilistic analysis of canister inserts for spent nuclear fuel

International Nuclear Information System (INIS)

Dillstroem, Peter

2005-10-01

In this study, probabilistic analysis of canister inserts for spent nuclear fuel has been performed. The main conclusions are: 1. For the baseline case, the probability of failure is insignificant (∼ 2x10 -9 ). This is the case even though several conservative assumptions have been made both in underlying deterministic analysis and in the probabilistic analysis. 2. The initiation event dominates (over the local collapse event) when the external pressure is below the baseline case (p = 44 MPa). The local collapse event dominates when the external pressure is above the baseline case. 3. The local collapse event is strongly dependent of the assumed external pressure. 4. The analysis of collapse only considers the first local collapse event, total collapse of the insert will occur at a much higher pressure. 5. The resulting probabilities are more dependent on the assumption regarding the eccentricity of the cassette than the assumption regarding outer corner radius of the profiles for steel section cassette. The results indicate that the maximum allowed eccentricity should not be larger than 5 mm. 6. The probability of initiation of crack growth is calculated using a defect distribution where one assumes the existence of one crack-like defect. A simple scaling argument can be applied to consider the number of defects through the thickness

: Principles of safety measures of sports events organizers without the involvement of police

OpenAIRE

Buchalová, Kateřina

2013-01-01

Title: Principles of safety measures of sports events organizers without the involvement of police Objectives: The aim of this thesis is a description of security measures at sporting events organizers. Methods: The thesis theoretical style is focused on searching for available sources of study and research, and writing their summary comparing safety measures of the organizers. Results: This work describes the activities of the organizers of sports events and precautions that must be provided...

The Ontology of Vaccine Adverse Events (OVAE) and its usage in representing and analyzing adverse events associated with US-licensed human vaccines.

Science.gov (United States)

Marcos, Erica; Zhao, Bin; He, Yongqun

2013-11-26

Licensed human vaccines can induce various adverse events (AE) in vaccinated patients. Due to the involvement of the whole immune system and complex immunological reactions after vaccination, it is difficult to identify the relations among vaccines, adverse events, and human populations in different age groups. Many known vaccine adverse events (VAEs) have been recorded in the package inserts of US-licensed commercial vaccine products. To better represent and analyze VAEs, we developed the Ontology of Vaccine Adverse Events (OVAE) as an extension of the Ontology of Adverse Events (OAE) and the Vaccine Ontology (VO). Like OAE and VO, OVAE is aligned with the Basic Formal Ontology (BFO). The commercial vaccines and adverse events in OVAE are imported from VO and OAE, respectively. A new population term 'human vaccinee population' is generated and used to define VAE occurrence. An OVAE design pattern is developed to link vaccine, adverse event, vaccinee population, age range, and VAE occurrence. OVAE has been used to represent and classify the adverse events recorded in package insert documents of commercial vaccines licensed by the USA Food and Drug Administration (FDA). OVAE currently includes over 1,300 terms, including 87 distinct types of VAEs associated with 63 human vaccines licensed in the USA. For each vaccine, occurrence rates for every VAE in different age groups have been logically represented in OVAE. SPARQL scripts were developed to query and analyze the OVAE knowledge base data. To demonstrate the usage of OVAE, the top 10 vaccines accompanying with the highest numbers of VAEs and the top 10 VAEs most frequently observed among vaccines were identified and analyzed. Asserted and inferred ontology hierarchies classify VAEs in different levels of AE groups. Different VAE occurrences in different age groups were also analyzed. The ontology-based data representation and integration using the FDA-approved information from the vaccine package insert documents

Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

Science.gov (United States)

Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

2009-08-26

Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

Probabilistic analysis of canister inserts for spent nuclear fuel

Energy Technology Data Exchange (ETDEWEB)

Dillstroem, Peter [Det Norske Veritas, Stockholm (Sweden)

2005-10-01

In this study, probabilistic analysis of canister inserts for spent nuclear fuel has been performed. The main conclusions are: 1. For the baseline case, the probability of failure is insignificant ({approx} 2x10{sup -9}). This is the case even though several conservative assumptions have been made both in underlying deterministic analysis and in the probabilistic analysis. 2. The initiation event dominates (over the local collapse event) when the external pressure is below the baseline case (p = 44 MPa). The local collapse event dominates when the external pressure is above the baseline case. 3. The local collapse event is strongly dependent of the assumed external pressure. 4. The analysis of collapse only considers the first local collapse event, total collapse of the insert will occur at a much higher pressure. 5. The resulting probabilities are more dependent on the assumption regarding the eccentricity of the cassette than the assumption regarding outer corner radius of the profiles for steel section cassette. The results indicate that the maximum allowed eccentricity should not be larger than 5 mm. 6. The probability of initiation of crack growth is calculated using a defect distribution where one assumes the existence of one crack-like defect. A simple scaling argument can be applied to consider the number of defects through the thickness.

Evaluation of a high resolution silicon PET insert module

Energy Technology Data Exchange (ETDEWEB)

Grkovski, Milan, E-mail: milan.grkovski@ijs.si [Jožef Stefan Institute, Ljubljana (Slovenia); Memorial Sloan Kettering Cancer Center, New York, NY (United States); Brzezinski, Karol [IFIC/CSIC, Valencia (Spain); Cindro, Vladimir [Jožef Stefan Institute, Ljubljana (Slovenia); Clinthorne, Neal H. [University of Michigan, Ann Arbor, MI (United States); Kagan, Harris [Ohio State University, Columbus, OH (United States); Lacasta, Carlos [IFIC/CSIC, Valencia (Spain); Mikuž, Marko [Jožef Stefan Institute, Ljubljana (Slovenia); Solaz, Carles [IFIC/CSIC, Valencia (Spain); Studen, Andrej [Jožef Stefan Institute, Ljubljana (Slovenia); Weilhammer, Peter [Ohio State University, Columbus, OH (United States); Žontar, Dejan [Jožef Stefan Institute, Ljubljana (Slovenia)

2015-07-11

Conventional PET systems can be augmented with additional detectors placed in close proximity of the region of interest. We developed a high resolution PET insert module to evaluate the added benefit of such a combination. The insert module consists of two back-to-back 1 mm thick silicon sensors, each segmented into 1040 1 mm{sup 2} pads arranged in a 40 by 26 array. A set of 16 VATAGP7.1 ASICs and a custom assembled data acquisition board were used to read out the signal from the insert module. Data were acquired in slice (2D) geometry with a Jaszczak phantom (rod diameters of 1.2–4.8 mm) filled with {sup 18}F-FDG and the images were reconstructed with ML-EM method. Both data with full and limited angular coverage from the insert module were considered and three types of coincidence events were combined. The ratio of high-resolution data that substantially improves quality of the reconstructed image for the region near the surface of the insert module was estimated to be about 4%. Results from our previous studies suggest that such ratio could be achieved at a moderate technological expense by using an equivalent of two insert modules (an effective sensor thickness of 4 mm)

Technical investigation of a pyrophoric event involving corrosion products from HEU ZPPR fuel plates

International Nuclear Information System (INIS)

Totemeier, T. C.

2000-01-01

A pyrophoric event recently occurred which involved corrosion products collected from highly-enriched uranium (HEU) fuel plates used in the Zero Power Physics Reactor (ZPPR). This paper summarizes the event and its background, and presents the results of an investigation into its source and mechanism. The investigation focused on characterization of corrosion product samples similar to those involved in the event using thermo-gravimetric analysis (TGA). Burning curve TGA tests were performed to measure the ignition temperature and hydride fractions of corrosion products in several different conditions to assess the effects of passivation treatment and long-term storage on chemical reactivity. The hydride fraction and ignition temperature of the corrosion products were found to be strongly dependent on the corrosion extent of the source metal. The results indicate that the energy source for the event was a considerable quantity of uranium hydride present in the corrosion products, but the specific ignition mechanism could not be identified

Sequence and structural analysis of the chitinase insertion domain reveals two conserved motifs involved in chitin-binding.

Directory of Open Access Journals (Sweden)

Hai Li

2010-01-01

Full Text Available Chitinases are prevalent in life and are found in species including archaea, bacteria, fungi, plants, and animals. They break down chitin, which is the second most abundant carbohydrate in nature after cellulose. Hence, they are important for maintaining a balance between carbon and nitrogen trapped as insoluble chitin in biomass. Chitinases are classified into two families, 18 and 19 glycoside hydrolases. In addition to a catalytic domain, which is a triosephosphate isomerase barrel, many family 18 chitinases contain another module, i.e., chitinase insertion domain. While numerous studies focus on the biological role of the catalytic domain in chitinase activity, the function of the chitinase insertion domain is not completely understood. Bioinformatics offers an important avenue in which to facilitate understanding the role of residues within the chitinase insertion domain in chitinase function.Twenty-seven chitinase insertion domain sequences, which include four experimentally determined structures and span five kingdoms, were aligned and analyzed using a modified sequence entropy parameter. Thirty-two positions with conserved residues were identified. The role of these conserved residues was explored by conducting a structural analysis of a number of holo-enzymes. Hydrogen bonding and van der Waals calculations revealed a distinct subset of four conserved residues constituting two sequence motifs that interact with oligosaccharides. The other conserved residues may be key to the structure, folding, and stability of this domain.Sequence and structural studies of the chitinase insertion domains conducted within the framework of evolution identified four conserved residues which clearly interact with the substrates. Furthermore, evolutionary studies propose a link between the appearance of the chitinase insertion domain and the function of family 18 chitinases in the subfamily A.

Classification system for reporting events involving human malfunctions

DEFF Research Database (Denmark)

Rasmussen, Jens; Pedersen, O.M.; Mancini, G.

1981-01-01

The report describes a set of categories for reporting indus-trial incidents and events involving human malfunction. The classification system aims at ensuring information adequate for improvement of human work situations and man-machine interface systems and for attempts to quantify "human error......" rates. The classification system has a multifacetted non-hierarchical struc-ture and its compatibility with Isprals ERDS classification is described. The collection of the information in general and for quantification purposes are discussed. 24 categories, 12 of which being human factors oriented......, are listed with their respective subcategories, and comments are given. Underlying models of human data processes and their typical malfunc-tions and of a human decision sequence are described....

Classification system for reporting events involving human malfunctions

International Nuclear Information System (INIS)

Rasmussen, J.; Pedersen, O.M.; Mancini, G.; Carnino, A.; Griffon, M.; Gagnolet, P.

1981-03-01

The report describes a set of categories for reporting industrial incidents and events involving human malfunction. The classification system aims at ensuring information adequate for improvement of human work situations and man-machine interface systems and for attempts to quantify ''human error'' rates. The classification system has a multifacetted non-hierarchial structure and its compatibility with Ispra's ERDS classification is described. The collection of the information in general and for quantification purposes are discussed. 24 categories, 12 of which being human factors oriented, are listed with their respective subcategories, and comments are given. Underlying models of human data processes and their typical malfunctions and of a human decision sequence are described. (author)

Predictors of Venous Thromboembolic Events Associated with Central Venous Port Insertion in Cancer Patients

Directory of Open Access Journals (Sweden)

Christine Hohl Moinat

2014-01-01

Full Text Available Insertion of central venous port (CVP catheter in the cancer population is associated with increased incidence of venous thromboembolic events (VTE. However, trials have shown limited benefit of antithrombotic treatment to prevent catheter-related venous thrombosis. This prospective observational cohort study was designed to assess the incidence of VTE closely related to CVP implantation in patients with cancer and undergoing chemotherapy, and to identify a high risk subgroup of patients. Between February 2006 and December 2011, 1097 consecutive cancer patients with first CVP implantation were included. Catheter-related VTE were defined as deep venous thrombosis in the arm, with or without pulmonary embolism (PE, or isolated PE. The incidence of CVP-associated VTE was 5.9% (IC95 4.4–7.3% at 3 months, and 11.3% (IC95 9.4–13.2% at 12 months. The incidence of any VTE was 7.6% (IC95 6.0–9.3% at 3 months, and 15.3% (IC95 13.1–17.6% at 12 months. High Khorana risk score and lung cancer were significant predictors of 3 month VTE. In conclusion, this large cohort study of patients with first CVP catheter implantation confirms the high incidence of VTE associated with the CVP implantation and allow identifying high risk patients who may benefit from thromboprophylaxis.

Issues in Informal Education: Event-Based Science Communication Involving Planetaria and the Internet

Science.gov (United States)

Adams, M.; Gallagher, D. L.; Whitt, A.; Six, N. Frank (Technical Monitor)

2002-01-01

For the past four years the Science Directorate at Marshall Space Flight Center has carried out a diverse program of science communication through the web resources on the Internet. The program includes extended stories about NAS.4 science, a curriculum resource for teachers tied to national education standards, on-line activities for students, and webcasts of real-time events. Events have involved meteor showers, solar eclipses, natural very low frequency radio emissions, and amateur balloon flights. In some cases broadcasts accommodate active feedback and questions from Internet participants. We give here, examples of events, problems, and lessons learned from these activities.

Regulatory perspective on incomplete control rod insertions

International Nuclear Information System (INIS)

Chatterton, M.

1997-01-01

The incomplete control rod insertions experienced at South Texas Unit 1 and Wolf Creek are of safety concern to the NRC staff because they represent potential precursors to loss of shutdown margin. Even before it was determined if these events were caused by the control rods or by the fuel there was an apparent correlation of the problem with high burnup fuel. It was determined that there was also a correlation between high burnup and high drag forces as well as with rod drop time histories and lack of rod recoil. The NRC staff initial actions were aimed at getting a perspective on the magnitude of the problem as far as the number of plants and the amount of fuel that could be involved, as well as the safety significance in terms of shutdown margin. As tests have been performed and data has been analyzed the focus has shifted more toward understanding the problem and the ways to eliminate it. At this time the staff's understanding of the phenomena is that it was a combination of factors including burnup, power history and temperature. The problem appears to be very sensitive to these factors, the interaction of which is not clearly understood. The model developed by Westinghouse provides a possible explanation but there is not sufficient data to establish confidence levels and sensitivity studies involving the key parameters have not been done. While several fixes to the problem have been discussed, no definitive fixes have been proposed. Without complete understanding of the phenomena, or fixes that clearly eliminate the problem the safety concern remains. The safety significance depends on the amount of shutdown margin lost due to incomplete insertion of the control rods. Were the control rods to stick high in the core, the reactor could not be shutdown by the control rods and other means such as emergency boration would be required

123I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome

International Nuclear Information System (INIS)

Horiguchi, Yoriko; Morita, Yukiko; Tsurikisawa, Naomi; Akiyama, Kazuo

2011-01-01

In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether 123 I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. 123 I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using 123 I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M ≤ 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP ≤ 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. 123 I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)

Direct random insertion mutagenesis of Helicobacter pylori

NARCIS (Netherlands)

de Jonge, Ramon; Bakker, Dennis; van Vliet, Arnoud H. M.; Kuipers, Ernst J.; Vandenbroucke-Grauls, Christina M. J. E.; Kusters, Johannes G.

2003-01-01

Random insertion mutagenesis is a widely used technique for the identification of bacterial virulence genes. Most strategies for random mutagenesis involve cloning in Escherichia coli for passage of plasmids or for phenotypic selection. This can result in biased selection due to restriction or

Direct random insertion mutagenesis of Helicobacter pylori.

NARCIS (Netherlands)

Jonge, de R.; Bakker, D.; Vliet, van AH; Kuipers, E.J.; Vandenbroucke-Grauls, C.M.J.E.; Kusters, J.G.

2003-01-01

Random insertion mutagenesis is a widely used technique for the identification of bacterial virulence genes. Most strategies for random mutagenesis involve cloning in Escherichia coli for passage of plasmids or for phenotypic selection. This can result in biased selection due to restriction or

Dynamic insertion analysis of control rods of BWR under seismic excitation

International Nuclear Information System (INIS)

Nakagawa, Masaki; Koide, Yuichi; Fukushi, Naoki; Ishigaki, Hirokuni; Okumura, Kazue

2007-01-01

The dynamic insertion characteristics of the control rods for the boiling water reactors under the seismic excitation are investigated using non-linear analytical models. The control rod insertion capability is one of the most important items for the safety of nuclear power plants under the seismic events. Predicting the control rod insertion behavior during the earthquake is important in the course of the control rod seismic design. We developed the analytical models using the finite element method (FEM). The effect of the interaction force between the control rod and the fuel assemblies is considered in the non-linear analysis. This interaction force courses the resistance force to the control rod during its insertion behavior. The validity of analytical methods was confirmed by comparing the analytical results with the experimental ones. Using the analytical models, the effects of input seismic motion and structural parameters of the control rods and the fuel assemblies, such as the thickness of the channel box, on the insertion time are investigated. These analytical methods can predict insertion time of the control rod, and are useful for the seismic design of the control rod assemblies. (author)

The pseudo-harmonics method: an application involving perturbations caused by control rod insertion in PWR reactors

International Nuclear Information System (INIS)

Claro, L.H.; Alvim, A.C.M.; Thome, Z.D.

1988-08-01

The objective of this work is to stydy the effect of intense perturbations, such as control rod insertion in the core of PWR reactors, through a perturbation approach consisting of a modified version of the pseudo-harmonics method. A typical one-dimensional PWR reactor model was used as a reference state, from which two perturbations were imposed, simulation gray and black control rod insertion. In the first case, eigenvalue convergence was achieved with the eighth order of approximation approximation and perturbed fluxes and eigenvalue estimates agreed very well with direct calculation results. The second case tested represents a very intense localized perturbation. Oscillation in keff were observed er of approximation increased and the method failed to converge. Results obtained indicate that the pseudo-harmonics method can be used to compute 2 group fluxes and fundamental eigenvalue of perturbated states resulting from gray control rod insertion in PWR reactors. The method is limited, however, by perturbation intensity, as other perturbation methods are. (author) [pt

Complications after implantation of a new-generation insertable cardiac monitor

DEFF Research Database (Denmark)

Diederichsen, Søren Zöga; Haugan, Ketil Jørgen; Højberg, Søren

2017-01-01

BACKGROUND: Insertable cardiac monitors (ICM) are leadless devices utilized in long-term monitoring of the heart rhythm. The implantation procedure of the new-generation ICMs is minimally invasive, but little experience exists regarding complications. We thus aimed to investigate adverse events (AE...

Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis.

Science.gov (United States)

Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming

2012-05-01

Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Application of declarative modeling approaches for external events

International Nuclear Information System (INIS)

Anoba, R.C.

2005-01-01

Probabilistic Safety Assessments (PSAs) are increasingly being used as a tool for supporting the acceptability of design, procurement, construction, operation, and maintenance activities at Nuclear Power Plants. Since the issuance of Generic Letter 88-20 and subsequent IPE/IPEEE assessments, the NRC has issued several Regulatory Guides such as RG 1.174 to describe the use of PSA in risk-informed regulation activities. Most PSA have the capability to address internal events including internal floods. As the more demands are being placed for using the PSA to support risk-informed applications, there has been a growing need to integrate other eternal events (Seismic, Fire, etc.) into the logic models. Most external events involve spatial dependencies and usually impact the logic models at the component level. Therefore, manual insertion of external events impacts into a complex integrated fault tree model may be too cumbersome for routine uses of the PSA. Within the past year, a declarative modeling approach has been developed to automate the injection of external events into the PSA. The intent of this paper is to introduce the concept of declarative modeling in the context of external event applications. A declarative modeling approach involves the definition of rules for injection of external event impacts into the fault tree logic. A software tool such as the EPRI's XInit program can be used to interpret the pre-defined rules and automatically inject external event elements into the PSA. The injection process can easily be repeated, as required, to address plant changes, sensitivity issues, changes in boundary conditions, etc. External event elements may include fire initiating events, seismic initiating events, seismic fragilities, fire-induced hot short events, special human failure events, etc. This approach has been applied at a number of US nuclear power plants including a nuclear power plant in Romania. (authors)

Classification system for reporting events involving human malfunctions

International Nuclear Information System (INIS)

Rasmussen, J.; Pedersen, O.M.; Mancini, G.

1981-01-01

The report describes a set of categories for reporting industrial incidents and events involving human malfunction. The classification system aims at ensuring information adequate for improvement of human work situations and man-machine interface systems and for attempts to quantify ''human error'' rates. The classification system has a multifacetted non-hierarchical structure and its compatibility with Ispra's ERDS classification is described. The collection of the information in general and for quantification purposes are discussed. 24 categories, 12 of which being human factors-oriented, are listed with their respective subcategories, and comments are given. Underlying models of human data process and their typical malfuntions and of a human decision sequence are described. The work reported is a joint contribution to the CSNI Group of Experts on Human Error Data and Assessment

Acute changes associated with electrode insertion measured with optical coherence microscopy

Science.gov (United States)

Hammer, Daniel X.; Lozzi, Andrea; Boretsky, Adam; Agrawal, Anant; Welle, Cristin G.

2016-03-01

Despite advances in functional neural imaging, penetrating microelectrodes provide the most direct interface for the extraction of neural signals from the nervous system and are a critical component of many high degree-of-freedom braincomputer interface devices. Electrode insertion is a traumatic event that elicits a complex neuroinflammatory response. In this investigation we applied optical coherence microscopy (OCM), particularly optical coherence angiography (OCA), to characterize the immediate tissue response during microelectrode insertion. Microelectrodes of varying dimension and footprint (one-, two-, and four-shank) were inserted into mouse motor cortex beneath a window after craniotomy surgery. The microelectrodes were inserted in 3-4 steps at 15-20°, with approximately 250 μm linear insertion distance for each step. Before insertion and between each step, OCM datasets were collected, including for quantitative capillary velocimetry. A cohort of control animals without microelectrode insertion was also imaged over a similar time period (2-3 hours). Mechanical tissue deformation was observed in all the experimental animals. The quantitative angiography results varied across animals, and were not correlated with device dimensions. In some cases, localized flow drop-out was observed in a small region surrounding the electrode, while in other instances a global disruption in flow occurred, perhaps as a result of large vessel compression caused by mechanical pressure. OCM is a tool that can be used in various neurophotonics applications, including quantification of the neuroinflammatory response to penetrating electrode insertion.

Velamentous and Furcate Cord Insertion with Placenta Accreta in an IVF Pregnancy with Unicornuate Uterus

Directory of Open Access Journals (Sweden)

Mehmet Tunç Canda

2013-01-01

Full Text Available Velamentous and furcate cord insertion with concomitant placenta accreta is a very rare and life-threatening event of pregnancy for both the mother and the fetus. Obstetricians should be cautious about umbilical cord insertion and placental adherence abnormalities in pregnancies conceived by assisted reproductive technologies (ART particularly in women with Müllerian anomalies.

Genomic rearrangements by LINE-1 insertion-mediated deletion in the human and chimpanzee lineages.

Science.gov (United States)

Han, Kyudong; Sen, Shurjo K; Wang, Jianxin; Callinan, Pauline A; Lee, Jungnam; Cordaux, Richard; Liang, Ping; Batzer, Mark A

2005-01-01

Long INterspersed Elements (LINE-1s or L1s) are abundant non-LTR retrotransposons in mammalian genomes that are capable of insertional mutagenesis. They have been associated with target site deletions upon insertion in cell culture studies of retrotransposition. Here, we report 50 deletion events in the human and chimpanzee genomes directly linked to the insertion of L1 elements, resulting in the loss of approximately 18 kb of sequence from the human genome and approximately 15 kb from the chimpanzee genome. Our data suggest that during the primate radiation, L1 insertions may have deleted up to 7.5 Mb of target genomic sequences. While the results of our in vivo analysis differ from those of previous cell culture assays of L1 insertion-mediated deletions in terms of the size and rate of sequence deletion, evolutionary factors can reconcile the differences. We report a pattern of genomic deletion sizes similar to those created during the retrotransposition of Alu elements. Our study provides support for the existence of different mechanisms for small and large L1-mediated deletions, and we present a model for the correlation of L1 element size and the corresponding deletion size. In addition, we show that internal rearrangements can modify L1 structure during retrotransposition events associated with large deletions.

Method of inserting fuel rod

International Nuclear Information System (INIS)

Kamimoto, Shuji; Imoo, Makoto; Tsuchida, Kenji.

1991-01-01

The present invention concerns a method of inserting a fuel rod upon automatic assembling, automatic dismantling and reassembling of a fuel assembly in a light water moderated reactor, as well as a device and components used therefor. That is, a fuel rod is inserted reliably to an aimed point of insertion by surrounding the periphery of the fuel rod to be inserted with guide rods, and thereby suppressing the movement of the fuel rod during insertion. Alternatively, a fuel rod is inserted reliably to a point of insertion by inserting guide rods at the periphery of the point of insertion for the fuel rod to be inserted thereby surrounding the point of insertion with the guide rods or fuel rods. By utilizing fuel rods already present in the fuel assembly as the guide rods described above, the fuel rod can be inserted reliably to the point of insertion with no additional devices. Dummy fuel rods are previously inserted in a fuel assembly which are then utilized as the above-mentioned guide rods to accurately insert the fuel rod to the point of insertion. (I.S.)

First two barrel ECAL supermodules inserted in CMS HCAL

CERN Multimedia

K.Bell

2006-01-01

The first two barrel "supermodules" for the CMS Electromagnetic Calorimeter (ECAL) have been inserted into the barrel hadron calorimeter (HCAL) in the experimental hall (called SX5) in Cessy in preparation for the forthcoming magnet test and cosmic challenge (MTCC). Each of the two supermodules contains 1700 lead tungstate crystals in glass-fibre alveolar support structures, with associated avalanche photodiodes (APDs, for scintillation light detection), electronics and cooling system. The barrel ECAL will consist of 36 supermodules, many of which have already been produced (see CERN Bulletin 17-18, 2006). Team from CMS ECAL, CMS Integration and CEA-DAPNIA were involved in the insertion, with the production/integration of the supermodules themselves involving many technicians, engineers and physicists from many institutes. From left to right: Olivier Teller, Maf Alidra and Lucien Veillet.

Lattice insertions for POPAE

International Nuclear Information System (INIS)

Cho, Y.; Crosbie, E.A.; Diebold, R.; Johnson, D.E.; Ohnuma, S.; Ruggiero, A.G.; Teng, L.C.

1977-01-01

Four types of insertions are described for the six 200-m straight sections of POPAE. All have dispersion matched to zero. (1) Injection-ejection insertion--This has proper high-β values and phase advances for horizontal injection and vertical ejection. (2) Phase-adjust insertion--The phase advance in this insertion is adjustable over a range of approximately 100 0 . (3) General-purpose insertion--The β* is adjustable from 2.5. to 200 m and the crossing angle is adjustable from 0 to 11 mrad. (4) High-luminosity insertion--This gives an even lower β + of meter

Insertional Mutagenesis for Genes involved in Otic/Vestibular Development and Function in Xenopus Tropicalis

Science.gov (United States)

Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)

2002-01-01

Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.

Status of transport events involving radioactive materials which occurred in France between 1999 and 2011

International Nuclear Information System (INIS)

2013-01-01

This report presents transport events involving radioactive materials, occurred on French territory from 1999 to 2011, listed in the IRSN's database. 1,304 events have been recorded. For each of them, many parameters have been collected and analysed from information listed in the notifications and reports of the events sent by users (type of event, purpose, package design, level on the INES scale...). The numbers of events notified in 2010 and 2011 are slightly higher than the average of 100 events per year. The two main causes of notification concern documentation errors (in transport documents or labeling) and handling mishaps. The downward trend of frequency of package or conveyance contaminations has been confirmed. A short description of the outstanding events occurred in 2010 and 2011 is proposed. This synthesis also gives an outline of the actions recommended by IRSN to avoid recurrence of the notified events and improve the safety of the transports of radioactive materials

Predictors for cecal insertion time: the impact of abdominal visceral fat measured by computed tomography.

Science.gov (United States)

Nagata, Naoyoshi; Sakamoto, Kayo; Arai, Tomohiro; Niikura, Ryota; Shimbo, Takuro; Shinozaki, Masafumi; Noda, Mitsuhiko; Uemura, Naomi

2014-10-01

Several factors affect the risk for longer cecal insertion time. The aim of this study was to identify the predictors of longer insertion time and to evaluate the effect of visceral fat measured by CT. This is a retrospective observational study. Outpatients for colorectal cancer screening who underwent colonoscopies and CT were enrolled. Computed tomography was performed in individuals who requested cancer screening and in those with GI bleeding. Information on obesity indices (BMI, visceral adipose tissue, and subcutaneous adipose tissue area), constipation score, history of abdominal surgery, poor preparation, fellow involvement, diverticulosis, patient discomfort, and the amount of sedation used was collected. The cecal insertion rate was 95.2% (899/944), and 899 patients were analyzed. Multiple regression analysis showed that female sex, lower BMI, lower visceral adipose tissue area, lower subcutaneous adipose tissue area, higher constipation score, history of surgery, poor bowel preparation, and fellow involvement were independently associated with longer insertion time. When obesity indices were considered simultaneously, smaller subcutaneous adipose tissue area (p = 0.038), but not lower BMI (p = 0.802) or smaller visceral adipose tissue area (p = 0.856), was associated with longer insertion time; the other aforementioned factors remained associated with longer insertion time. In the subanalysis of normal-weight patients (BMI abdominal fat, female sex, constipation, history of abdominal surgery, poor preparation, and fellow involvement were predictors of longer cecal insertion time. Among the obesity indices, high subcutaneous fat accumulation was the best predictive factor for easier passage of the colonoscope, even when body weight was normal.

Insertion Modeling and Its Applications

OpenAIRE

Alexander Letichevsky; Oleksandr Letychevskyi; Vladimir Peschanenko

2016-01-01

The paper relates to the theoretical and practical aspects of insertion modeling. Insertion modeling is a theory of agents and environments interaction where an environment is considered as agent with a special insertion function. The main notions of insertion modeling are presented. Insertion Modeling System is described as a tool for development of different kinds of insertion machines. The research and industrial applications of Insertion Modeling System are presented.

{sup 123}I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome

Energy Technology Data Exchange (ETDEWEB)

Horiguchi, Yoriko; Morita, Yukiko [National Hospital Organization Sagamihara National Hospital, Department of Cardiology, Sagamihara City, Kanagawa (Japan); Tsurikisawa, Naomi; Akiyama, Kazuo [National Hospital Organization Sagamihara National Hospital, Clinical Research Centre for Allergy and Rheumatology, Sagamihara City, Kanagawa (Japan)

2011-02-15

In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. {sup 123}I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using {sup 123}I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M {<=} 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP {<=} 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. {sup 123}I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)

Task types and error types involved in the human-related unplanned reactor trip events

International Nuclear Information System (INIS)

Kim, Jae Whan; Park, Jin Kyun

2008-01-01

In this paper, the contribution of task types and error types involved in the human-related unplanned reactor trip events that have occurred between 1986 and 2006 in Korean nuclear power plants are analysed in order to establish a strategy for reducing the human-related unplanned reactor trips. Classification systems for the task types, error modes, and cognitive functions are developed or adopted from the currently available taxonomies, and the relevant information is extracted from the event reports or judged on the basis of an event description. According to the analyses from this study, the contributions of the task types are as follows: corrective maintenance (25.7%), planned maintenance (22.8%), planned operation (19.8%), periodic preventive maintenance (14.9%), response to a transient (9.9%), and design/manufacturing/installation (6.9%). According to the analysis of the error modes, error modes such as control failure (22.2%), wrong object (18.5%), omission (14.8%), wrong action (11.1%), and inadequate (8.3%) take up about 75% of the total unplanned trip events. The analysis of the cognitive functions involved in the events indicated that the planning function had the highest contribution (46.7%) to the human actions leading to unplanned reactor trips. This analysis concludes that in order to significantly reduce human-induced or human-related unplanned reactor trips, an aide system (in support of maintenance personnel) for evaluating possible (negative) impacts of planned actions or erroneous actions as well as an appropriate human error prediction technique, should be developed

Task types and error types involved in the human-related unplanned reactor trip events

Energy Technology Data Exchange (ETDEWEB)

Kim, Jae Whan; Park, Jin Kyun [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2008-12-15

In this paper, the contribution of task types and error types involved in the human-related unplanned reactor trip events that have occurred between 1986 and 2006 in Korean nuclear power plants are analysed in order to establish a strategy for reducing the human-related unplanned reactor trips. Classification systems for the task types, error modes, and cognitive functions are developed or adopted from the currently available taxonomies, and the relevant information is extracted from the event reports or judged on the basis of an event description. According to the analyses from this study, the contributions of the task types are as follows: corrective maintenance (25.7%), planned maintenance (22.8%), planned operation (19.8%), periodic preventive maintenance (14.9%), response to a transient (9.9%), and design/manufacturing/installation (6.9%). According to the analysis of the error modes, error modes such as control failure (22.2%), wrong object (18.5%), omission (14.8%), wrong action (11.1%), and inadequate (8.3%) take up about 75% of the total unplanned trip events. The analysis of the cognitive functions involved in the events indicated that the planning function had the highest contribution (46.7%) to the human actions leading to unplanned reactor trips. This analysis concludes that in order to significantly reduce human-induced or human-related unplanned reactor trips, an aide system (in support of maintenance personnel) for evaluating possible (negative) impacts of planned actions or erroneous actions as well as an appropriate human error prediction technique, should be developed.

COMPARATIVE STUDY OF EARLY POSTPARTUM IUCD INSERTION TO INTERVAL IUCD INSERTION

Directory of Open Access Journals (Sweden)

Shibani Devi

2016-07-01

Full Text Available INTRODUCTION According to National Family Health Survey-3, Indian women have 13% unmet need for contraception and according to District Level Household & Facility Survey-3, it is 21.3% in the postpartum period. Postpartum intrauterine contraceptive device insertion - both immediately post-placental delivery and somewhat later, but within 48 hours after delivery are options which merit consideration as the woman is likely to have a high motivation for accepting contraception and the healthcare centre provides a convenient setting for insertion of IUCD. AIM Comparison of efficacy and complications of IUCD insertions in post-placental with interval period: 6-month followup. METHOD This perspective study was conducted among 100 women: - 50 women had IUCD inserted within 10 minutes of placental delivery and 50 had insertion more than 6 weeks after delivery. They were followed till 6 months post insertion and were compared regarding early and late complications, continuation rates and expulsion rates. RESULT At the end of six months, we found higher occurrence of lower abdominal pain, heavy menstrual bleeding in case of interval insertion as compared to post-placental insertion which was statistically significant (p value-0.04 & 0.007 respectively. However, the expulsion rates of post-placental IUCD were somewhat elevated (14% compared to interval insertions (2%. Continuation rates at the end of 6 months in both the groups were 82% and 86% respectively which is comparable. CONCLUSION Post-placental IUCD is thus found to be an ideal method to meet the unmet need of postpartum women as it is easily accessible and convenient for both women and their health care providers, is associated with less discomfort and fewer side effects and allow women to obtain safe, long acting, highly effective contraception while still in the health care system.

Live insertion method used for main renewal

International Nuclear Information System (INIS)

Solkowitz, M.

1992-01-01

Baltimore Gas and Electric's pilot project using the live insertion method to replace a cast iron main provided excellent results. Its use on Eastern Avenue, a major state highway, was cost effective, provided gas service to customers during the work, required relatively short construction time and resulted in only minor traffic disruptions. Gas service transfers to the new main were done at customer convenience and resulted in outages of only a few hours per customer. This paper reports that the project involved inserting a 6-in. plastic line inside an existing 10-in. cast iron main. Miller Pipeline Corp., Indianapolis, supplier of the Insertec left-angle R right-angle live insertion method was contracted for the job. Miller technicians assisted BG and E forces by providing a load analysis of the main, a pushing machine and related supplies, foaming equipment and pipe cutting tools. Company forces were responsible for all preparatory work, including opening all excavations, installing bypasses, and fusing and testing the plastic pipe. Service transfers and renewals were also completed by company employees

Role of the import motor in insertion of transmembrane segments by the mitochondrial TIM23 complex.

Science.gov (United States)

Popov-Čeleketić, Dušan; Waegemann, Karin; Mapa, Koyeli; Neupert, Walter; Mokranjac, Dejana

2011-06-01

The TIM23 complex mediates translocation of proteins across, and their lateral insertion into, the mitochondrial inner membrane. Translocation of proteins requires both the membrane-embedded core of the complex and its ATP-dependent import motor. Insertion of some proteins, however, occurs in the absence of ATP, questioning the need for the import motor during lateral insertion. We show here that the import motor associates with laterally inserted proteins even when its ATPase activity is not required. Furthermore, our results suggest a role for the import motor in lateral insertion. Thus, the import motor is involved in ATP-dependent translocation and ATP-independent lateral insertion.

Two large-scale analyses of Ty1 LTR-retrotransposon de novo insertion events indicate that Ty1 targets nucleosomal DNA near the H2A/H2B interface

Directory of Open Access Journals (Sweden)

Bridier-Nahmias Antoine

2012-12-01

Full Text Available Abstract Background Over the years, a number of reports have revealed that Ty1 integration occurs in a 1-kb window upstream of Pol III-transcribed genes with an approximate 80-bp periodicity between each integration hotspot and that this targeting requires active Pol III transcription at the site of integration. However, the molecular bases of Ty1 targeting are still not understood. Findings The publications by Baller et al. and Mularoni et al. in the April issue of Genome Res. report the first high-throughput sequencing analysis of Ty1 de novo insertion events. Their observations converge to the same conclusion, that Ty1 targets a specific surface of the nucleosome at he H2A/H2B interface. Conclusion This discovery is important, and should help identifying factor(s involved in Ty1 targeting. Recent data on transposable elements and retroviruses integration site choice obtained by large-scale analyses indicate that transcription and chromatin structure play an important role in this process. The studies reported in this commentary add a new evidence of the importance of chromatin in integration selectivity that should be of interest for everyone interested in transposable elements integration.

Control and initial operation of the Fermilab BO low β insertion

International Nuclear Information System (INIS)

Finley, D.A.; Johnson, R.P.; Willeke, F.

1985-06-01

The operation of the Fermilab BO low β insertion involves the coordinated control of the 4 strings of quadrupoles of the insertion itself along with several magnetic correction elements (20 dipoles for the closed orbit, 2 quad circuits for betatron tunes, 1 skew quad circuit for coupling, and 2 sextupole circuits for chromaticity). When the beam is stored at high energy, these elements must correct the errors induced by the strong superconducting quadrupoles of the insertion as the optics are smoothly changed from the fixed target configuration to the low β state. The techniques and control programs for these manipulations and initial tests using a single coasting beam are described. 6 refs., 4 figs

Chest tube insertion

Science.gov (United States)

Chest drainage tube insertion; Insertion of tube into chest; Tube thoracostomy; Pericardial drain ... Be careful there are no kinks in your tube. The drainage system should always sit upright and be placed ...

Fra COP15 til Copenhagen Fashion Week:Involvering af brugere i udvikling af event applikationer

OpenAIRE

Sørensen, Lene Tolstrup

2010-01-01

Mobile application has become an important parameter when it comes to presenting possibilities for small handheld devices such as mobile phones. One of the trends within mobile application development is applications for special events such as sports, conferences and TV shows. The purpose of this paper is to present and discuss the challenges of developing event applications with a strong involvement of users. The concepts and characteristics of the Living Lab approach has been used to develo...

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

Science.gov (United States)

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Experimental insertions

International Nuclear Information System (INIS)

Sandweiss, J.; Kycia, T.F.

1975-01-01

A discussion is given of the eight identical experimental insertions for the planned ISABELLE storage rings. Four sets of quadrupole doublets are used to match the β functions in the insertions to the values in the cells, and the total free space available at the crossing point is 40 meters. An asymmetric beam energy operation is planned, which will be useful in a number of experiments

Observations on rotating needle insertions using a brachytherapy robot

International Nuclear Information System (INIS)

Meltsner, M A; Ferrier, N J; Thomadsen, B R

2007-01-01

A robot designed for prostate brachytherapy implantations has the potential to greatly improve treatment success. Much of the research in robotic surgery focuses on measuring accuracy. However, there exist many factors that must be optimized before an analysis of needle placement accuracy can be determined. Some of these parameters include choice of the needle type, insertion velocity, usefulness of the rotating needle and rotation speed. These parameters may affect the force at which the needle interacts with the tissue. A reduction in force has been shown to decrease the compression of the prostate and potentially increase the accuracy of seed position. Rotating the needle as it is inserted may reduce frictional forces while increasing accuracy. However, needle rotations are considered to increase tissue damage due to the drilling nature of the insertion. We explore many of the factors involved in optimizing a brachytherapy robot, and the potential effects each parameter may have on the procedure. We also investigate the interaction of rotating needles in gel and suggest the rotate-cannula-only method of conical needle insertion to minimize any tissue damage while still maintaining the benefits of reduced force and increased accuracy

Essure insert expulsion after 3-month hysterosalpingogram confirmation of bilateral tubal occlusion and bilateral correct placement: case report.

Science.gov (United States)

Garcia, Amy L; Lewis, Rae M; Sloan, Anita Lee

2013-01-01

Essure hysteroscopic sterilization is an effective permanent contraception option for women, with a 99.83% effectiveness rate. To date, more than 600,000 Essure procedures have been performed worldwide. This case report describes bilateral Essure insert placement, after which the left insert was subsequently expelled after hysterosalpingogram (HSG)-confirmed correct bilateral insert placement and bilateral tubal occlusion. Although insert expulsion has been reported before a 3-month post-procedure HSG, this is the first published report of expulsion after a confirmatory 3-month post-procedure HSG. Because there now exists documentation of Essure insert expulsion after a 3-month confirmatory HSG, physicians and patients should be informed of this rare occurrence. Further investigation into the causes of such an event is warranted. Copyright © 2013 AAGL. Published by Elsevier Inc. All rights reserved.

Analyses of Design Extended Condition Events for the Prototype Gen-IV SFR

International Nuclear Information System (INIS)

Choi, Chiwoong; Jeong, Taekyung; Lee, Kwilim; Jeong, Jaeho; Ha, Kwiseok

2015-01-01

In this study, the sensitivity tests are conducted. In the case of the UTOP event, a sensitivity test for the reactivity insertion amount and rate were conducted. This analysis can give a requirement for margin of control rod stop system (CRSS). For example, the CRSS in the PRISM designed based on the 0.4 $ reactivity insertion, which is analyzed with safety analysis of UTOP event. Moreover, the sensitivity tests for weighting factor in the core radial expansion reactivity feedback model were also carried out for all ATWS events. Currently, the reactivity feedback model for the PGSFR is not validated yet. However, the reactivity feedback models in the MARS-LMR are validating with various plant-based data including EBR-II SHRT. The ATWS events for the PGSFR classified in the design extended condition including UTOP, ULOF, and ULOHS are analyzed with MARS-LMR. In this study, the sensitivity tests for reactivity insertion amount and rate in the UTOP event are conducted. The reactivity insertion amount is obviously an influential parameter. The reactivity insertion amount can give a requirement for design of the CRSS, therefore, this sensitivity result is very important to the CRSS. In addition, sensitivity tests for the weighting factor in the radial expansion reactivity model are carried out. The weighting factor for a grid plate, W GP , which means contribution of feedback in the grid plate is changed for all unprotected events. The grid plate expansion is governed by a core inlet temperature. As the W GP is increased, the power in the UTOP and the ULOF is increased, however, the power in the ULOHS is decreased. The higher power during transient means lower reactivity feedback and smaller expansion. Thus, the core outlet temperature rise is dominant in the UTOP and ULOF events, however, the core inlet temperature rise is dominant in the ULOHS. Therefore, the grid plate expansion in the ULOHS is predominant

Gold-Catalyzed Formal C-C Bond Insertion Reaction of 2-Aryl-2-diazoesters with 1,3-Diketones.

Science.gov (United States)

Ren, Yuan-Yuan; Chen, Mo; Li, Ke; Zhu, Shou-Fei

2018-06-29

The transition-metal-catalyzed formal C-C bond insertion reaction of diazo compounds with monocarbonyl compounds is well established, but the related reaction of 1,3-diketones instead gives C-H bond insertion products. Herein, we report a protocol for a gold-catalyzed formal C-C bond insertion reaction of 2-aryl-2-diazoesters with 1,3-diketones, which provides efficient access to polycarbonyl compounds with an all-carbon quaternary center. The aryl ester moiety plays a crucial role in the unusual chemoselectivity, and the addition of a Brønsted acid to the reaction mixture improves the yield of the C-C bond insertion product. A reaction mechanism involving cyclopropanation of a gold carbenoid with an enolate and ring-opening of the resulting donor-acceptor-type cyclopropane intermediate is proposed. This mechanism differs from that of the traditional Lewis-acid-catalyzed C-C bond insertion reaction of diazo compounds with monocarbonyl compounds, which involves a rearrangement of a zwitterion intermediate as a key step. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Insertion device and method for accurate and repeatable target insertion

Science.gov (United States)

Gubeli, III, Joseph F.; Shinn, Michelle D.; Bevins, Michael E.; Dillon-Townes, Lawrence; Neil, George R.

2017-07-04

The present invention discloses a device and a method for inserting and positioning a target within a free electron laser, particle accelerator, or other such device that generates or utilizes a beam of energy or particles. The system includes a three-point registration mechanism that insures angular and translational accuracy and repeatability of positioning upon multiple insertions within the same structure.

Hysteroscopic Essure Inserts for Permanent Contraception: Extended Follow-Up Results of a Phase III Multicenter International Study.

Science.gov (United States)

Chudnoff, Scott G; Nichols, John E; Levie, Mark

2015-01-01

To describe safety, tolerability, and effectiveness results through 5 years of follow-up of a Phase III trial with Essure inserts. Multicenter, nonrandomized, single-arm international study (Canadian Task Force classification II-3). Thirteen clinical study centers in the United States, Europe, and Australia. A total of 518 previously fertile women seeking permanent contraception. The objective of the hysteroscopic sterilization procedure was bilateral Essure insert placement (ESS205 model) and tubal occlusion. Women with satisfactory device location and tube occlusion (based on modified hysterosalpingography [HSG]) were instructed to discontinue alternative contraception and to rely on Essure inserts for permanent contraception. The primary endpoint for the Phase III study was the rate of pregnancies occurring during the first year of relying (i.e., HSG-confirmed occlusion) on the Essure inserts for permanent contraception (i.e., 12 months after HSG). For the full 5 years of follow-up (5 years total of relying on the Essure inserts for contraception), the endpoints of interest were safety, prevention of pregnancy, and satisfaction. No pregnancies were reported among women relying on the Essure inserts who completed the full 5 years of follow-up. As of December 5, 2007, 449 women with successful bilateral placement relying on the Essure inserts contributed a total 24 942 woman-months of follow-up for assessing effectiveness. Overall, the Essure inserts were generally well tolerated, with participant comfort rated as "good" to "excellent" by 99% of women (382 of 385) after 5 years of use. Similarly, overall satisfaction was rated as "somewhat" to "very satisfied" by 98% of women (376 of 384) after 5 years of use. The majority of adverse events reported during the 5 years of follow-up were rated as either "mild" or "moderate" in severity. Three severe events (abdominal pain with very heavy periods and irregular menstrual bleeding) were reported in 2 subjects during

Presence of extensive Wolbachia symbiont insertions discovered in the genome of its host Glossina morsitans morsitans.

Directory of Open Access Journals (Sweden)

Corey Brelsfoard

2014-04-01

Full Text Available Tsetse flies (Glossina spp. are the cyclical vectors of Trypanosoma spp., which are unicellular parasites responsible for multiple diseases, including nagana in livestock and sleeping sickness in humans in Africa. Glossina species, including Glossina morsitans morsitans (Gmm, for which the Whole Genome Sequence (WGS is now available, have established symbiotic associations with three endosymbionts: Wigglesworthia glossinidia, Sodalis glossinidius and Wolbachia pipientis (Wolbachia. The presence of Wolbachia in both natural and laboratory populations of Glossina species, including the presence of horizontal gene transfer (HGT events in a laboratory colony of Gmm, has already been shown. We herein report on the draft genome sequence of the cytoplasmic Wolbachia endosymbiont (cytWol associated with Gmm. By in silico and molecular and cytogenetic analysis, we discovered and validated the presence of multiple insertions of Wolbachia (chrWol in the host Gmm genome. We identified at least two large insertions of chrWol, 527,507 and 484,123 bp in size, from Gmm WGS data. Southern hybridizations confirmed the presence of Wolbachia insertions in Gmm genome, and FISH revealed multiple insertions located on the two sex chromosomes (X and Y, as well as on the supernumerary B-chromosomes. We compare the chrWol insertions to the cytWol draft genome in an attempt to clarify the evolutionary history of the HGT events. We discuss our findings in light of the evolution of Wolbachia infections in the tsetse fly and their potential impacts on the control of tsetse populations and trypanosomiasis.

Adverse Events Involving Radiation Oncology Medical Devices: Comprehensive Analysis of US Food and Drug Administration Data, 1991 to 2015

International Nuclear Information System (INIS)

Connor, Michael J.; Marshall, Deborah C.; Moiseenko, Vitali; Moore, Kevin; Cervino, Laura; Atwood, Todd; Sanghvi, Parag; Mundt, Arno J.; Pawlicki, Todd; Recht, Abram; Hattangadi-Gluth, Jona A.

2017-01-01

Purpose: Radiation oncology relies on rapidly evolving technology and highly complex processes. The US Food and Drug Administration collects reports of adverse events related to medical devices. We sought to characterize all events involving radiation oncology devices (RODs) from the US Food and Drug Administration's postmarket surveillance Manufacturer and User Facility Device Experience (MAUDE) database, comparing these with non–radiation oncology devices. Methods and Materials: MAUDE data on RODs from 1991 to 2015 were sorted into 4 product categories (external beam, brachytherapy, planning systems, and simulation systems) and 5 device problem categories (software, mechanical, electrical, user error, and dose delivery impact). Outcomes included whether the device was evaluated by the manufacturer, adverse event type, remedial action, problem code, device age, and time since 510(k) approval. Descriptive statistics were performed with linear regression of time-series data. Results for RODs were compared with those for other devices by the Pearson χ"2 test for categorical data and 2-sample Kolmogorov-Smirnov test for distributions. Results: There were 4234 ROD and 4,985,698 other device adverse event reports. Adverse event reports increased over time, and events involving RODs peaked in 2011. Most ROD reports involved external beam therapy (50.8%), followed by brachytherapy (24.9%) and treatment planning systems (21.6%). The top problem types were software (30.4%), mechanical (20.9%), and user error (20.4%). RODs differed significantly from other devices in each outcome (P<.001). RODs were more likely to be evaluated by the manufacturer after an event (46.9% vs 33.0%) but less likely to be recalled (10.5% vs 37.9%) (P<.001). Device age and time since 510(k) approval were shorter among RODs (P<.001). Conclusions: Compared with other devices, RODs may experience adverse events sooner after manufacture and market approval. Close postmarket surveillance, improved

Adverse Events Involving Radiation Oncology Medical Devices: Comprehensive Analysis of US Food and Drug Administration Data, 1991 to 2015

Energy Technology Data Exchange (ETDEWEB)

Connor, Michael J. [Department of Radiation Medicine and Applied Sciences, University of California San Diego, La Jolla, California (United States); Department of Radiation Oncology, University of California Irvine School of Medicine, Irvine, California (United States); Marshall, Deborah C.; Moiseenko, Vitali; Moore, Kevin; Cervino, Laura; Atwood, Todd; Sanghvi, Parag; Mundt, Arno J.; Pawlicki, Todd [Department of Radiation Medicine and Applied Sciences, University of California San Diego, La Jolla, California (United States); Recht, Abram [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts (United States); Hattangadi-Gluth, Jona A., E-mail: jhattangadi@ucsd.edu [Department of Radiation Medicine and Applied Sciences, University of California San Diego, La Jolla, California (United States)

2017-01-01

Purpose: Radiation oncology relies on rapidly evolving technology and highly complex processes. The US Food and Drug Administration collects reports of adverse events related to medical devices. We sought to characterize all events involving radiation oncology devices (RODs) from the US Food and Drug Administration's postmarket surveillance Manufacturer and User Facility Device Experience (MAUDE) database, comparing these with non–radiation oncology devices. Methods and Materials: MAUDE data on RODs from 1991 to 2015 were sorted into 4 product categories (external beam, brachytherapy, planning systems, and simulation systems) and 5 device problem categories (software, mechanical, electrical, user error, and dose delivery impact). Outcomes included whether the device was evaluated by the manufacturer, adverse event type, remedial action, problem code, device age, and time since 510(k) approval. Descriptive statistics were performed with linear regression of time-series data. Results for RODs were compared with those for other devices by the Pearson χ{sup 2} test for categorical data and 2-sample Kolmogorov-Smirnov test for distributions. Results: There were 4234 ROD and 4,985,698 other device adverse event reports. Adverse event reports increased over time, and events involving RODs peaked in 2011. Most ROD reports involved external beam therapy (50.8%), followed by brachytherapy (24.9%) and treatment planning systems (21.6%). The top problem types were software (30.4%), mechanical (20.9%), and user error (20.4%). RODs differed significantly from other devices in each outcome (P<.001). RODs were more likely to be evaluated by the manufacturer after an event (46.9% vs 33.0%) but less likely to be recalled (10.5% vs 37.9%) (P<.001). Device age and time since 510(k) approval were shorter among RODs (P<.001). Conclusions: Compared with other devices, RODs may experience adverse events sooner after manufacture and market approval. Close postmarket surveillance

An update on insertable cardiac monitors

DEFF Research Database (Denmark)

Olsen, Flemming J; Biering-Sørensen, Tor; Krieger, Derk W

2015-01-01

Continuous cardiac rhythm monitoring has undergone compelling progress over the past decades. Cardiac monitoring has emerged from 12-lead electrocardiograms being performed at the discretion of the treating physician to in-hospital telemetry, Holter monitoring, prolonged external event monitoring...... turning point in the field of arrhythmia management. However, their role in the detection of paroxysmal atrial fibrillation after cryptogenic strokes has yet to evolve. This will be the main focus of this review. Issues surrounding patient selection, clinical relevance and determination of cost......-effectiveness for prolonged cardiac monitoring require further studies. Furthermore, insertable cardiac monitoring has not only the potential to augment diagnostic capabilities but also to improve the management of paroxysmal atrial fibrillation....

Facility target insert shielding assessment

Energy Technology Data Exchange (ETDEWEB)

Mocko, Michal [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2015-10-06

Main objective of this report is to assess the basic shielding requirements for the vertical target insert and retrieval port. We used the baseline design for the vertical target insert in our calculations. The insert sits in the 12”-diameter cylindrical shaft extending from the service alley in the top floor of the facility all the way down to the target location. The target retrieval mechanism is a long rod with the target assembly attached and running the entire length of the vertical shaft. The insert also houses the helium cooling supply and return lines each with 2” diameter. In the present study we focused on calculating the neutron and photon dose rate fields on top of the target insert/retrieval mechanism in the service alley. Additionally, we studied a few prototypical configurations of the shielding layers in the vertical insert as well as on the top.

Automatic insertion of simulated microcalcification clusters in a software breast phantom

Science.gov (United States)

Shankla, Varsha; Pokrajac, David D.; Weinstein, Susan P.; DeLeo, Michael; Tuite, Catherine; Roth, Robyn; Conant, Emily F.; Maidment, Andrew D.; Bakic, Predrag R.

2014-03-01

An automated method has been developed to insert realistic clusters of simulated microcalcifications (MCs) into computer models of breast anatomy. This algorithm has been developed as part of a virtual clinical trial (VCT) software pipeline, which includes the simulation of breast anatomy, mechanical compression, image acquisition, image processing, display and interpretation. An automated insertion method has value in VCTs involving large numbers of images. The insertion method was designed to support various insertion placement strategies, governed by probability distribution functions (pdf). The pdf can be predicated on histological or biological models of tumor growth, or estimated from the locations of actual calcification clusters. To validate the automated insertion method, a 2-AFC observer study was designed to compare two placement strategies, undirected and directed. The undirected strategy could place a MC cluster anywhere within the phantom volume. The directed strategy placed MC clusters within fibroglandular tissue on the assumption that calcifications originate from epithelial breast tissue. Three radiologists were asked to select between two simulated phantom images, one from each placement strategy. Furthermore, questions were posed to probe the rationale behind the observer's selection. The radiologists found the resulting cluster placement to be realistic in 92% of cases, validating the automated insertion method. There was a significant preference for the cluster to be positioned on a background of adipose or mixed adipose/fibroglandular tissues. Based upon these results, this automated lesion placement method will be included in our VCT simulation pipeline.

Feeding tube insertion - gastrostomy

Science.gov (United States)

... this page: //medlineplus.gov/ency/article/002937.htm Feeding tube insertion - gastrostomy To use the sharing features on this page, please enable JavaScript. A gastrostomy feeding tube insertion is the placement of a feeding ...

Decline of Low-Frequency Hearing in People With Ski-Slope Hearing Loss; Implications for Electrode Array Insertion.

Science.gov (United States)

Schuurbiers, Jasper; Dingemanse, Gertjan; Metselaar, Mick

2017-12-01

The decline of low-frequency hearing in people with ski-slope hearing loss varies and might depend on etiology. People with ski-sloping hearing loss might benefit from cochlear implantation with preservation of residual hearing. To reduce the risk of losing low-frequency hearing after implantation, the electrode-array can be inserted partially up to the desired frequency. That, however, obstructs electrical stimulation of lower frequencies. To decide between complete or partial insertion, knowledge regarding the natural decline of low-frequency hearing is helpful. Patients with at least two ski-slope audiograms over time were selected. We calculated progression at lower frequencies for 320 patients. Etiologies for hearing loss were retrieved from medical records. Progression of hearing loss was analyzed separately for patients with uni- and bilateral hearing losses. Relative progression of hearing loss was obtained by comparing progression to a reference group. Average progression of PTA was 1.73 dB/yr and was not significantly different in the bilateral and unilateral group. Etiologies that did not show significantly more progression compared with the reference group could be identified as single or short-lasting pathologic events, whereas long-lasting conditions had significant more progression of PTA. Patients with a ski-slope hearing loss that was caused by a single or short-lasting event have low progression rate and are viable for partial insertion to minimize the risk of damaging residual low-frequency hearing. In the absence of such an event, complete insertion should be considered because faster than normal deterioration of low-frequency hearing over time will probably limit the advantage of preservation of residual hearing.

Comparison of conventional Injection Mould Inserts to Additively Manufactured Inserts using Life Cycle Assessment

DEFF Research Database (Denmark)

Hofstätter, Thomas; Bey, Niki; Mischkot, Michael

2016-01-01

Polymer Additive Manufacturing can be used to produce soft tooling inserts for injection moulding. Compared to conventional tooling, the energy and time consumption during production are significantly lower. As the life time of such inserts is significantly shorter than the life time of traditional...... of their potential environmental impact and yield throughout the development and pilot phase. Insert geometry is particularly advantageous for pilot production and small production sizes. In this research, Life Cycle Assessment is used to compare the environmental impact of soft tooling by Additive Manufacturing...... (using Digital Light Processing) and three traditional methods for the manufacture of inserts (milling of brass, steel, and aluminium) for injection moulds during the pre-production phase....

Use of the Hadoop structured storage tools for the ATLAS EventIndex event catalogue

CERN Document Server

Favareto, Andrea; The ATLAS collaboration; Cardenas Zarate, Simon Ernesto; Cranshaw, Jack; Fernandez Casani, Alvaro; Gallas, Elizabeth; Gonzalez de la Hoz, Santiago; Hrivnac, Julius; Malon, David; Prokoshin, Fedor; Salt, Jose; Sanchez, Javier; Toebbicke, Rainer; Yuan, Ruijun; Garcia Montoro, Carlos

2015-01-01

The ATLAS experiment collects billions of events per year of data-taking, and processes them to make them available for physics analysis in several different formats. An even larger amount of events is in addition simulated according to physics and detector models and then reconstructed and analysed to be compared to real events. The EventIndex is a catalogue of all events in each production stage; it includes for each event a few identification parameters, some basic non-mutable information coming from the online system, and the references to the files that contain the event in each format (plus the internal pointers to the event within each file for quick retrieval). Each EventIndex record is logically simple but the system has to hold many tens of billions of records, all equally important. The Hadoop technology was selected at the start of the EventIndex project development in 2012 and proved to be robust and flexible to accommodate this kind of information; both the insertion times and query response tim...

Evaluation of PET Imaging Resolution Using 350 mu{m} Pixelated CZT as a VP-PET Insert Detector

Science.gov (United States)

Yin, Yongzhi; Chen, Ximeng; Li, Chongzheng; Wu, Heyu; Komarov, Sergey; Guo, Qingzhen; Krawczynski, Henric; Meng, Ling-Jian; Tai, Yuan-Chuan

2014-02-01

A cadmium-zinc-telluride (CZT) detector with 350 μm pitch pixels was studied in high-resolution positron emission tomography (PET) imaging applications. The PET imaging system was based on coincidence detection between a CZT detector and a lutetium oxyorthosilicate (LSO)-based Inveon PET detector in virtual-pinhole PET geometry. The LSO detector is a 20 ×20 array, with 1.6 mm pitches, and 10 mm thickness. The CZT detector uses ac 20 ×20 ×5 mm substrate, with 350 μm pitch pixelated anodes and a coplanar cathode. A NEMA NU4 Na-22 point source of 250 μm in diameter was imaged by this system. Experiments show that the image resolution of single-pixel photopeak events was 590 μm FWHM while the image resolution of double-pixel photopeak events was 640 μm FWHM. The inclusion of double-pixel full-energy events increased the sensitivity of the imaging system. To validate the imaging experiment, we conducted a Monte Carlo (MC) simulation for the same PET system in Geant4 Application for Emission Tomography. We defined LSO detectors as a scanner ring and 350 μm pixelated CZT detectors as an insert ring. GATE simulated coincidence data were sorted into an insert-scanner sinogram and reconstructed. The image resolution of MC-simulated data (which did not factor in positron range and acolinearity effect) was 460 μm at FWHM for single-pixel events. The image resolutions of experimental data, MC simulated data, and theoretical calculation are all close to 500 μm FWHM when the proposed 350 μm pixelated CZT detector is used as a PET insert. The interpolation algorithm for the charge sharing events was also investigated. The PET image that was reconstructed using the interpolation algorithm shows improved image resolution compared with the image resolution without interpolation algorithm.

Data Insertion in Bitcoin's Blockchain

Directory of Open Access Journals (Sweden)

Andrew Sward

2018-04-01

Full Text Available This paper provides the first comprehensive survey of methods for inserting arbitrary data into Bitcoin’s blockchain. Historical methods of data insertion are described, along with lesser-known techniques that are optimized for efficiency. Insertion methods are compared on the basis of efficiency, cost, convenience of data reconstruction, permanence, and potentially negative impact on the Bitcoin ecosystem.

Variables decreasing tip movement of peripherally inserted central catheters in pediatric patients.

Science.gov (United States)

Gnannt, Ralph; Connolly, Bairbre L; Parra, Dimitri A; Amaral, Joao; Moineddin, Rahim; Thakor, Avnesh S

2016-10-01

The position of the tip of a peripherally inserted central catheter (PICC) is crucial; malposition can lead to malfunction of the line or life-threatening events (e.g., arrhythmias, perforation). To determine what factors other than arm position and accessed vein might influence the tip position of a PICC. Inclusion criteria were upper limb PICC placement, body weight central tip movement in rib units. We included 112 children who received a PICC (42 girls/70 boys, mean age 31±13 months, mean weight 6.5±4.9 kg). The overall range of central tip movement was -1 to +4 rib units (mean +0.8±0.7 rib units). Silicone PICCs moved significantly less than polyurethane PICCs (Pcentral tip movement of a PICC (P>0.05). Silicone PICCs and PICCs inserted into the cephalic vein move less than PICCs made of polyurethane and PICCs inserted into the brachial and basilic veins. These findings might assist operators in deciding which PICC to place in children in a given clinical context.

A Comparative study of early postpartum IUCD insertion to interval IUCD insertion at Tertiary Care Centre

OpenAIRE

Roopal, Dr.; Bisht, Vandana

2018-01-01

Background: A Comparative study of early postpartum IUCD insertion to interval IUCD insertion at Tertiary Care Centre.Methods: This prospective study was conducted among 100 women at tertiary care centre, Haldwani, Nainital. Patients were divided in to two groups. Group A (n=50)-post placental insertion within 10 minutes of delivery of placenta. Group B (n=50)-Interval insertion after 6 weeks of delivery. Both groups were compared in terms of pain abdomen, bleeding, missing thread, expulsion,...

Multi-species sequence comparison reveals dynamic evolution of the elastin gene that has involved purifying selection and lineage-specific insertions/deletions

Directory of Open Access Journals (Sweden)

Green Eric D

2004-05-01

Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.

The critical events for motor-sensory temporal recalibration

Directory of Open Access Journals (Sweden)

Derek Henry Arnold

2012-08-01

Full Text Available Determining if we, or another agent, were responsible for a sensory event can require an accurate sense of timing. Our sense of appropriate timing relationships must, however, be malleable as there is a variable delay between the physical timing of an event and when sensory signals concerning that event are encoded in the brain. One dramatic demonstration of such malleability involves having people repeatedly press a button thereby causing a beep. If a delay is inserted between button presses and beeps, when it is subsequently taken away beeps can seem to precede the button presses that caused them. For this to occur it is important that people feel they were responsible for instigating the beeps. In terms of their timing, as yet it is not clear what combination of events is important for motor-sensory temporal recalibration. Here, by introducing ballistic reaches of short or longer extent before a button press, we varied the delay between the intention to act and the sensory consequence of that action. This manipulation failed to modulate recalibration magnitude. By contrast, introducing a similarly lengthened delay between button presses and consequent beeps eliminated recalibration. Thus it would seem that the critical timing relationship for motor-sensory temporal recalibration is between tactile signals relating to the completion of an action and the subsequent auditory percept.

Sensitivity Tests for the Unprotected Events of the Prototype Gen-IV SFR

Energy Technology Data Exchange (ETDEWEB)

Choi, Chiwoong; Lee, Kwilim; Jeong, Jaeho; Yu, Jin; An, Sangjun; Lee, Seung Won; Chang, Wonpyo; Ha, Kwiseok [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2014-10-15

Unprotected Transient Over Power, (UTOP), Unprotected Loss Of Flow (ULOF), and Unprotected Loss Of Heat Sink (ULOHS) are selected as ATWS events. Among these accidents, the ULOF event shows the lowest clad temperature. However, the ULOHS event showed the highest peak clad temperature, due to the positive CRDL/RV expansion reactivity feedback and insufficient DHRS capacity. In this study, the sensitivity tests are conducted. In the case of the UTOP event, a sensitivity test for the reactivity insertion amount and rate were conducted. This analysis can give a requirement for margin of control rod stop system (CRSS). Currently, the reactivity feedback model for the PGSFR is not validated yet. However, the reactivity feedback models in the MARS-LMR are validating with various plant-based data including EBR-II SHRT. The ATWS events for the PGSFR classified in the design extended condition including UTOP, ULOF, and ULOHS are analyzed with MARS-LMR. In this study, the sensitivity tests for reactivity insertion amount and rate in the UTOP event are conducted. The reactivity insertion amount is obviously an influential parameter. The reactivity insertion amount can give a requirement for design of the CRSS, therefore, this sensitivity result is very important to the CRSS. In addition, sensitivity tests for the weighting factor in the radial expansion reactivity model are carried out. The weighting factor for a grid plate, W{sub GP}, which means contribution of feedback in the grid plate is changed for all unprotected events. The grid plate expansion is governed by a core inlet temperature. As the W{sub GP} is increased, the power in the UTOP and the ULOF is increased, however, the power in the ULOHS is decreased. The higher power during transient means lower reactivity feedback and smaller expansion. Thus, the core outlet temperature rise is dominant in the UTOP and ULOF events, however, the core inlet temperature rise is dominant in the ULOHS. Therefore, the grid plate

Folding and membrane insertion of the pore-forming peptide gramicidin occur as a concerted process.

Science.gov (United States)

Hicks, Matthew R; Damianoglou, Angeliki; Rodger, Alison; Dafforn, Timothy R

2008-11-07

Many antibiotic peptides function by binding and inserting into membranes. Understanding this process provides an insight into the fundamentals of both membrane protein folding and antibiotic peptide function. For the first time, in this work, flow-aligned linear dichroism (LD) is used to study the folding of the antibiotic peptide gramicidin. LD provides insight into the combined processes of peptide folding and insertion and has the advantage over other similar techniques of being insensitive to off-membrane aggregation events. By combining LD data with conventional measurements of protein fluorescence and circular dichroism, the mechanism of gramicidin insertion is elucidated. The mechanism consists of five separately assignable steps that include formation of a water-insoluble gramicidin aggregate, dissociation from the aggregate, partitioning of peptide to the membrane surface, oligomerisation on the surface and concerted insertion and folding of the peptide to the double-helical form of gramicidin. Measurement of the rates of each step shows that although changes in the fluorescence signal cease 10 s after the initiation of the process, the insertion of the peptide into the membrane is actually not complete for a further 60 min. This last membrane insertion phase is only apparent by measurement of LD and circular dichroism signal changes. In summary, this study demonstrates the importance of multi-technique approaches, including LD, in studies of membrane protein folding.

Interface Promoted Reversible Mg Insertion in Nanostructured Tin-Antimony Alloys

Energy Technology Data Exchange (ETDEWEB)

Cheng, Yingwen; Shao, Yuyan; Parent, Lucas R.; Sushko, Maria L.; Li, Guosheng; Sushko, Petr; Browning, Nigel D.; Wang, Chong M.; Liu, Jun

2015-11-11

This paper demonstrates intermetallic compounds SnSb are highly active materials for reversibly hosting Mg ions. Compared with monometallic Sn and Sb, SnSb alloy exhibited exceptionally high reversible capacity (420 mAh/g), excellent rate capability and good cyclic stability. Mg insertion into pristine SnSb involves an activation process to complete, which induces particle breakdown and results in phase segregation to Sn-rich and Sb-rich phases. Both experimental analysis and DFT simulation suggest that the Sn-rich phase is particularly active and provides most of the capacity whereas the Sb-rich phase is not as active, and the interface between these two phases play a key role in promoting the formation and stabilization of the cubic Sn phase that is more favorable for fast and reversible Mg insertion. We further show that activated SnSb alloy has good compatibility with simple Mg electrolytes. Overall, this work could provide new approaches for designing materials capable of reversible Mg ion insertion and new opportunities for understanding Mg electrochemistry.

Incidence of upper limb venous thrombosis associated with peripherally inserted central catheters (PICC).

Science.gov (United States)

Abdullah, B J J; Mohammad, N; Sangkar, J V; Abd Aziz, Y F; Gan, G G; Goh, K Y; Benedict, I

2005-07-01

The objective of this study was to prospectively determine the incidence of venous thrombosis (VT) in the upper limbs in patients with peripherally inserted central catheters (PICC). We prospectively investigated the incidence of VT in the upper limbs of 26 patients who had PICC inserted. The inclusion criteria were all patients who had a PICC inserted, whilst the exclusion criterion was the inability to perform a venogram (allergies, previous contrast medium reaction and inability of gaining venous access). Both valved and non-valved catheters were evaluated. Prior to removal of the PICC, an upper limb venogram was performed. The number of segments involved with VT were determined. The duration of central venous catheterization was classified as; less than 6 days, between 6 days and 14 days and more than 14 days. VT was confirmed in 38.5% (10/26) of the patients. The majority 85.7% (12/14) were complete occlusive thrombi and the majority of VT only involved one segment. There was no statistical correlation between the site of insertion of the PICC and the location of VT. Neither was there any observed correlation between the occurrence of VT with the patient's history of hypertension, hypercholesterolaemia, coronary artery disease, diabetes mellitus, cardiac insufficiency, smoking or cancer. There was also no statistical correlation with the size of the catheter. In conclusion, PICCs are associated with a significant risk of upper extremity deep vein thrombosis (UEVT).

The kinetics of porous insertion electrodes

Energy Technology Data Exchange (ETDEWEB)

Atlung, S; West, K [British Columbia Univ., Vancouver (Canada)

1989-05-01

The principles of porous electrodes are discussed as well as the discharge of the insertion compound, the working potential, transport in the electrolyte, the time dependence of the electrolyte concentration, and modeling of the porous electrode. The simulation of a TiS2 porous electrode and the composite insertion electrode are considered as well. The influence of electrode thickness and porosity in a typical porous TiS2 electrode is revealed. It is shown that the use of insertion compounds as battery electrodes is limited by the requirement that the inserted ion must be distributed in the interior of the insertion compound particle. 15 refs.

ALS insertion devices

International Nuclear Information System (INIS)

Hoyer, E.; Chin, J.; Halbach, K.; Hassenzahl, W.V.; Humphries, D.; Kincaid, B.; Lancaster, H.; Plate, D.

1990-11-01

The Advanced Light Source (ALS), the first US third generation synchrotron radiation source, is currently under construction at the Lawrence Berkeley Laboratory. The low-emittance, 1.5 GeV electron storage ring and the insertion devices are specifically designed to produce high brightness beams in the UV to soft X-Ray range. The planned initial complement of insertion devices includes four 4.6 m long undulators, with period lengths of 3.9 cm, 5.0 cm (2) and 8.0 cm, and a 2.9 m long wiggler of 16 cm period length. Undulator design is well advanced and fabrication has begun on the 5.0 cm and 8.0 cm period length undulators. This paper discusses ALS insertion device requirements; general design philosophy; and design of the magnetic structure, support structure/drive systems, control system and vacuum system. 18 refs., 9 figs., 5 tabs

Water molecule-enhanced CO2 insertion in lanthanide coordination polymers

International Nuclear Information System (INIS)

Luo Liushan; Huang Xiaoyuan; Wang Ning; Wu Hongyan; Chen Wenbin; Feng Zihao; Zhu Huiping; Peng Xiaoling; Li Yongxian; Huang Ling; Yue Shantang; Liu Yingliang

2009-01-01

Two new lanthanide coordination polymers H 2 N(CH 3 ) 2 .[Eu III 2 (L 1 ) 3 (L 2 )] (1, L 1 =isophthalic acid dianion, L 2 =formic acid anion) and [La III (2,5-PDC)(L 2 )](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L 2 ) is not contained in the stating materials, but arises from the water molecule-enhanced CO 2 insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO 2 insertion resulting in the formation of formic anion and dimethylammonium cation were synthesized under solvothermal conditions.

Percutaneous Ureteral stent insertion

Energy Technology Data Exchange (ETDEWEB)

Yoon, Yup; Sung, Dong Wook; Choi, Woo Suk; Lee, Dong Ho; Ko, Young Tae; Lee, Sun Wha; Lim, Jae Hoon [Kyung Hee University Hospital, Seoul (Korea, Republic of)

1990-10-15

Percutaneous ureteral stent insertion is a treatment of permanent or temporary urinary diversion to maintain continuity and function of the obstructed and injured ureter. We performed 31 cases of percutaneous double pig tall ureteral stent insertion in 21 patients, included 13 patients with malignant ureteral obstruction and eight patients with injured ureter as well as benign inflammatory stricture. Satisfactory resulted was obtained in all patients but one, who need percutaneous nephrostomy on week later for urinary diversion. No significant complication was encountered. The authors concluded that percutaneous ureteral stent insertion, an interventional procedure alternative to urologic retrograde method, is an effective method for urinary diversion.

A paternally transmitted complex chromosomal rearrangement (CCR) involving chromosomes 2, 6, and 18 includes eight breakpoints and five insertional translocations (ITs) through three generations.

Science.gov (United States)

Gruchy, Nicolas; Barreau, Morgane; Kessler, Ketty; Gourdier, Dominique; Leporrier, Nathalie

2010-01-01

Complex chromosomal rearrangements (CCRs) are uncommon and mainly occur de novo. We report here on a familial CCR involving chromosomes 2, 6, and 18. The propositus is a boy first referred because of growth delays, hypotonia, and facial anomalies, suggestive of deletion 18q syndrome. However, a cytogenetic family study disclosed a balanced CCR in three generations, which was detailed by FISH using BAC clones, and consisted of eight breakpoints with five insertional translocations (ITs). The propositus had a cryptic 18q deletion and a 6p duplication. Paternal transmission of this CCR was observed through three generations without meiotic recombination. Our investigation allowed us to provide porosities counseling and management of prenatal diagnosis for propositus cousin who carries this particular CCR.

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

Science.gov (United States)

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

Science.gov (United States)

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

[Peripherally inserted central catheter antibiotic therapy for cystic fibrosis patients].

Science.gov (United States)

Betegnie, A-L; Cracowski, C; Bedouch, P; Segond, C; Robein-Dobremez, M-J; Pin, I; Allenet, B

2014-11-01

Peripherally inserted central catheters (PICC) are more and more used for intravenous antibiotic infusions in cystic fibrosis (CF) patients in the Grenoble area (France). The aim of this study was to assess the use of this technique in this indication. 1. Retrospective evaluation of 102 consecutive PICC insertions over 3years and the incidence of adverse events during the therapy. 2. Prospective evaluation of 12 patient's satisfaction and their nurses over a 3-month period. 3. Comparative analysis of single domiciliary treatment costs using PICC versus peripheral catheter (PC). 102 PICC insertions were attempted in 31 patients. Seven failures and 7 complications occurred during the treatment requiring removal of the PICC, i.e. an overall success rate of 86.2% (88/102). Pain during PICC introduction was 4.2/10 (visual analogical scale). Mean satisfaction levels during therapy were 9.3/10 for patients and 8.7/10 for nurses. Compared with PC, all the patients said that PICC was "more comfortable". Differential costs of treatment with PC and with PICC at home were estimated at 57.15€ and 590.16€ respectively. PICC is an alternative to CP for intravenous antibiotherapy in CF patients, providing better safety and comfort. PICC use should be promoted in this indication. Copyright © 2013 SPLF. Published by Elsevier Masson SAS. All rights reserved.

ISABELLE insertion quadrupoles

International Nuclear Information System (INIS)

Kaugerts, J.; Polk, I.; Sampson, W.; Dahl, P.F.

1979-01-01

Beam focussing and control at the beam intersection regions of ISABELLE is accomplished by a number of superconducting insertion quadrupoles. These magnets differ from the standard ISABELLE quadrupoles in various ways. In particular, the requirements of limited space near the intersections and aperture for beam extraction impose constraints on their configuration. To achieve optimum beam focussing and provide tuning flexibility calls for stronger quadrupole trim windings than those in the standard quadrupoles. The magnetic and mechanical design of the insertion quadrupoles and their associated correction and steering windings to accomplish the above tasks is presented

Sequential cooling insert for turbine stator vane

Science.gov (United States)

Jones, Russel B

2017-04-04

A sequential flow cooling insert for a turbine stator vane of a small gas turbine engine, where the impingement cooling insert is formed as a single piece from a metal additive manufacturing process such as 3D metal printing, and where the insert includes a plurality of rows of radial extending impingement cooling air holes alternating with rows of radial extending return air holes on a pressure side wall, and where the insert includes a plurality of rows of chordwise extending second impingement cooling air holes on a suction side wall. The insert includes alternating rows of radial extending cooling air supply channels and return air channels that form a series of impingement cooling on the pressure side followed by the suction side of the insert.

Fuel insert shuffler

International Nuclear Information System (INIS)

Naser, J.; Colley, R.; Gaiser, J.; Brookmire, T.; Engle, S.

1987-01-01

The potential for the use of expert systems in the nuclear power industry is widely recognized. The benefits of such systems include consistency of reasoning during off-normal situations when humans are under great stress, the reduction of time required to perform certain functions and the retention of human expertise in performing specialized functions. As the potential benefits are more and more demonstrated and realized, the development of expert systems becomes a necessary part of the nuclear power industry. The development of the fuel insert shuffle expert system is used as a case study. In fact, it shows that the potential benefits are realizable. Currently, the development of the insert shuffle plan requires three to four man-weeks of effort. Further modifications to this plan are sometimes required dur to either changes in the desired core load pattern or damaged fuel assemblies or inserts. These changes generally require two to four man-days of effort and could be stressful if they are critical path items on the outage schedule

TRACKER INSERTED INTO YB0 & HEAVY LOWERING COMPLETED

CERN Multimedia

      The Tracker travelled very smoothly from Meyrin to Point 5 during the early hours of December 13th. Lowered later the same day, insertion was completed 18th December. The intense campaign of Tracker connections, involving 980 pipes, 2330 cables and 3623 fibre ribbons, has since begun and is making good progress. The final large element of CMS YE-1 was lowered gently into the cavern on January 22nd. This marks the end of fourteen months of heavy lowering operations.  

[Effects of slow twisting needle insertion and tubing needle insertion at Neiguan (PC 6) on cardiovascular function: a comparative study].

Science.gov (United States)

Ning, Shaoli; Zhao, Lihua; Xu, Lingjun; Huang, Yu; Pang, Yong; Huang, Dingjian

2016-01-01

To compare the effects between slow twisting needle insertion and tubing needle insertion. With cross-over design, 100 healthy young subjects (half male and half female) aged from 19 to 23 years were randomly divided into two groups by random digital table, 50 cases in each one. At the first stage, subjects in the group A were treated with slow twisting needle insertion while, subjects in,the group B were treated with tubing needle insertion. One week later, the procedure of second stage was performed alternately. The needle was inserted into Neiguan (PC 6) with two methods by one acupuncturist. The needle was retained for 5 min before removal. Five min before needle insertion as well as needle withdrawal and 30 min after needle withdrawal, ZXG-E automatic cardiovascular diagnostic apparatus was used to test cardiovascular function. At the tim of needle withdrawal, slow twisting needle insertion could improve effect work of kinetics (EWK), effective blood volume (BV) and reduce elastic expansion coefficient of blood vessel (FEK) and left ventricular spray blood impedance (VER), which was significantly different from tubing needle insertion (all P 0.05). The slow twisting needle insertion is significantly superior to tubing needle insertion on lowering vascular tension and VER, improving EWK and BV.

Chest tube insertion - series (image)

Science.gov (United States)

Chest tubes are inserted to drain blood, fluid, or air and allow full expansion of the lungs. The tube is placed in the pleural space. The area where the tube will be inserted is numbed (local anesthesia). The patient may also be sedated. The chest ...

Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower.

Science.gov (United States)

Reddemann, Antje; Horn, Renate

2018-03-11

Cytoplasmic male sterility (CMS) systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6 , atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5' coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231 . The first 53 bp of orf288 are identical to the 5' end of atp9 . Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9 . These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

Lithium insertion in nanostructured titanates

NARCIS (Netherlands)

Borghols, W.J.H.

2010-01-01

Upon nano-sizing of insertion compounds several significant changes in Li-insertion behavior have been observed for sizes below approximately 50 nm. Although the origins of the phenomena are interrelated, the changes can be divided in three main observations. (1) The formation of new phases, leading

Technical note: Computer-manufactured inserts for prosthetic sockets.

Science.gov (United States)

Sanders, Joan E; McLean, Jake B; Cagle, John C; Gardner, David W; Allyn, Katheryn J

2016-08-01

The objective of this research was to use computer-aided design software and a tabletop 3-D additive manufacturing system to design and fabricate custom plastic inserts for trans-tibial prosthesis users. Shape quality of inserts was tested right after they were inserted into participant's test sockets and again after four weeks of wear. Inserts remained properly positioned and intact throughout testing. Right after insertion the inserts caused the socket to be slightly under-sized, by a mean of 0.11mm, approximately 55% of the thickness of a nylon sheath. After four weeks of wear the under-sizing was less, averaging 0.03mm, approximately 15% of the thickness of a nylon sheath. Thus the inserts settled into the sockets over time. If existing prosthetic design software packages were enhanced to conduct insert design and to automatically generate fabrication files for manufacturing, then computer manufactured inserts may offer advantages over traditional methods in terms of speed of fabrication, ease of design, modification, and record keeping. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.

Test manufacture of a canister insert

International Nuclear Information System (INIS)

Raiko, H.

2004-11-01

This report describes the insert-manufacturing test of a disposal canister for spent nuclear fuel that was made by Metso Paper Oy, Jyvaeskylae Foundry, in 2003 on contract for Posiva Oy. The test manufacture was a part of the co-operation development programme of encapsulation technology between SKB AB and Posiva Oy. Insert casting was specified according to the current manufacturing specifications of SKB. The canister insert was of BWR-type with integral bottom. This was the first trial manufacture of this type of insert in Finland and, in total, the second test manufacture of insert by Metso Paper. The result fulfilled all the requirements but the material mechanical properties and metallurgical structure of the cast material. The measured tensile strength, ultimate strength and elongation at rupture were lower than specified. The reason for this was revealed in the metallurgical investigation of the cast material. The nodulizing of the graphite was not occurred during the casting process according to the requirements. (orig.)

Concepts for stereoselective acrylate insertion

KAUST Repository

Neuwald, Boris

2013-01-23

Various phosphinesulfonato ligands and the corresponding palladium complexes [{((PaO)PdMeCl)-μ-M}n] ([{( X1-Cl)-μ-M}n], (PaO) = κ2- P,O-Ar2PC6H4SO2O) with symmetric (Ar = 2-MeOC6H4, 2-CF3C6H4, 2,6-(MeO)2C6H3, 2,6-(iPrO)2C 6H3, 2-(2′,6′-(MeO)2C 6H3)C6H4) and asymmetric substituted phosphorus atoms (Ar1 = 2,6-(MeO)2C6H 3, Ar2 = 2′-(2,6-(MeO)2C 6H3)C6H4; Ar1 = 2,6-(MeO)2C6H3, Ar2 = 2-cHexOC 6H4) were synthesized. Analyses of molecular motions and dynamics by variable temperature NMR studies and line shape analysis were performed for the free ligands and the complexes. The highest barriers of ΔGa = 44-64 kJ/mol were assigned to an aryl rotation process, and the flexibility of the ligand framework was found to be a key obstacle to a more effective stereocontrol. An increase of steric bulk at the aryl substituents raises the motional barriers but diminishes insertion rates and regioselectivity. The stereoselectivity of the first and the second methyl acrylate (MA) insertion into the Pd-Me bond of in situ generated complexes X1 was investigated by NMR and DFT methods. The substitution pattern of the ligand clearly affects the first MA insertion, resulting in a stereoselectivity of up to 6:1 for complexes with an asymmetric substituted phosphorus. In the consecutive insertion, the stereoselectivity is diminished in all cases. DFT analysis of the corresponding insertion transition states revealed that a selectivity for the first insertion with asymmetric (P aO) complexes is diminished in the consecutive insertions due to uncooperatively working enantiomorphic and chain end stereocontrol. From these observations, further concepts are developed. © 2012 American Chemical Society.

Method Of Wire Insertion For Electric Machine Stators

Science.gov (United States)

Brown, David L; Stabel, Gerald R; Lawrence, Robert Anthony

2005-02-08

A method of inserting coils in slots of a stator is provided. The method includes interleaving a first set of first phase windings and a first set of second phase windings on an insertion tool. The method also includes activating the insertion tool to radially insert the first set of first phase windings and the first set of second phase windings in the slots of the stator. In one embodiment, interleaving the first set of first phase windings and the first set of second phase windings on the insertion tool includes forming the first set of first phase windings in first phase openings defined in the insertion tool, and forming the first set of second phase windings in second phase openings defined in the insertion tool.

Insertion profiles of 4 headless compression screws.

Science.gov (United States)

Hart, Adam; Harvey, Edward J; Lefebvre, Louis-Philippe; Barthelat, Francois; Rabiei, Reza; Martineau, Paul A

2013-09-01

In practice, the surgeon must rely on screw position (insertion depth) and tactile feedback from the screwdriver (insertion torque) to gauge compression. In this study, we identified the relationship between interfragmentary compression and these 2 factors. The Acutrak Standard, Acutrak Mini, Synthes 3.0, and Herbert-Whipple implants were tested using a polyurethane foam scaphoid model. A specialized testing jig simultaneously measured compression force, insertion torque, and insertion depth at half-screw-turn intervals until failure occurred. The peak compression occurs at an insertion depth of -3.1 mm, -2.8 mm, 0.9 mm, and 1.5 mm for the Acutrak Mini, Acutrak Standard, Herbert-Whipple, and Synthes screws respectively (insertion depth is positive when the screw is proud above the bone and negative when buried). The compression and insertion torque at a depth of -2 mm were found to be 113 ± 18 N and 0.348 ± 0.052 Nm for the Acutrak Standard, 104 ± 15 N and 0.175 ± 0.008 Nm for the Acutrak Mini, 78 ± 9 N and 0.245 ± 0.006 Nm for the Herbert-Whipple, and 67 ± 2N, 0.233 ± 0.010 Nm for the Synthes headless compression screws. All 4 screws generated a sizable amount of compression (> 60 N) over a wide range of insertion depths. The compression at the commonly recommended insertion depth of -2 mm was not significantly different between screws; thus, implant selection should not be based on compression profile alone. Conically shaped screws (Acutrak) generated their peak compression when they were fully buried in the foam whereas the shanked screws (Synthes and Herbert-Whipple) reached peak compression before they were fully inserted. Because insertion torque correlated poorly with compression, surgeons should avoid using tactile judgment of torque as a proxy for compression. Knowledge of the insertion profile may improve our understanding of the implants, provide a better basis for comparing screws, and enable the surgeon to optimize compression. Copyright �

Barriers and Facilitators to Central Venous Catheter Insertion: A Qualitative Study.

Science.gov (United States)

Cameron, Kenzie A; Cohen, Elaine R; Hertz, Joelle R; Wayne, Diane B; Mitra, Debi; Barsuk, Jeffrey H

2018-03-14

The aims of the study were to identify perceived barriers and facilitators to central venous catheter (CVC) insertion among healthcare providers and to understand the extent to which an existing Simulation-Based Mastery Learning (SBML) program may address barriers and leverage facilitators. Providers participating in a CVC insertion SBML train-the-trainer program, in addition to intensive care unit nurse managers, were purposively sampled from Veterans Administration Medical Centers located in geographically diverse areas. We conducted semistructured interviews to assess perceptions of barriers and facilitators to CVC insertion. Deidentified transcripts were analyzed using a grounded theory approach and the constant comparative method. We subsequently mapped identified barriers and facilitators to our SBML curriculum to determine whether or not the curriculum addresses these factors. We interviewed 28 providers at six Veterans Administration Medical Centers, identifying the following five overarching factors of perceived barriers to CVC insertion: (1) equipment, (2) personnel/staff, (3) setting or organizational context, (4) patient or provider, and (5) time-related barriers. Three overarching factors of facilitators emerged: (1) equipment, (2) personnel, and (3) setting or organizational context facilitators. The SBML curriculum seems to address most identified barriers, while leveraging many facilitators; building on the commonly identified facilitator of nursing staff contribution by expanding the curriculum to explicitly include nurse involvement could improve team efficiency and organizational culture of safety. Many identified facilitators (e.g., ability to use ultrasound, personnel confidence/competence) were also identified as barriers. Evidence-based SBML programs have the potential to amplify these facilitators while addressing the barriers by providing an opportunity to practice and master CVC insertion skills.

How to Cope with the Rare Human Error Events Involved with organizational Factors in Nuclear Power Plants

Energy Technology Data Exchange (ETDEWEB)

Kim, Sa Kil; Luo, Meiling; Lee, Yong Hee [Korea Atomic Research Institute, Daejeon (Korea, Republic of)

2014-10-15

The current human error guidelines (e.g. US DOD handbooks, US NRC Guidelines) are representative tools to prevent human errors. These tools, however, have limits that they do not adapt all operating situations and circumstances such as design base events. In other words, these tools are only adapted foreseeable standardized operating situations and circumstances. In this study, our research team proposed an evidence-based approach such as UK's safety case to coping with the rare human error events such as TMI, Chernobyl, Fukushima accidents. These accidents are representative events involved with rare human errors. Our research team defined the 'rare human errors' as the follow three characterized events; Extremely low frequency Extremely high complicated structure Extremely serious damage of human life and property A safety case is a structured argument, supported by evidence, intended to justify that a system is acceptably safe. The definition by UK defense standard 00-56 issue 4 states that such an evidence-based approach can be contrast with a prescriptive approach to safety certification, which require safety to be justified using a prescribed process. Safety managements and safety regulatory activities based on safety case are effective to control organizational factors in terms of integrated safety management. Especially safety issues relevant with public acceptance are useful to provide practical evidences to the public reasonably. European Union including UK has developed the concept of engineered safety management system to deal with public acceptance using the safety case. In Korea nuclear industry, the Korean Atomic Research Institute has firstly performed a basic research to adapt the safety case in the field of radioactive waste according to the IAEA SSG-23(KAERI/TR-4497, 4531). Excepting the radioactive waste, there is no try to adapt the safety case yet. Most incidents and accidents involved human during operating NPPs have a tendency

How to Cope with the Rare Human Error Events Involved with organizational Factors in Nuclear Power Plants

International Nuclear Information System (INIS)

Kim, Sa Kil; Luo, Meiling; Lee, Yong Hee

2014-01-01

The current human error guidelines (e.g. US DOD handbooks, US NRC Guidelines) are representative tools to prevent human errors. These tools, however, have limits that they do not adapt all operating situations and circumstances such as design base events. In other words, these tools are only adapted foreseeable standardized operating situations and circumstances. In this study, our research team proposed an evidence-based approach such as UK's safety case to coping with the rare human error events such as TMI, Chernobyl, Fukushima accidents. These accidents are representative events involved with rare human errors. Our research team defined the 'rare human errors' as the follow three characterized events; Extremely low frequency Extremely high complicated structure Extremely serious damage of human life and property A safety case is a structured argument, supported by evidence, intended to justify that a system is acceptably safe. The definition by UK defense standard 00-56 issue 4 states that such an evidence-based approach can be contrast with a prescriptive approach to safety certification, which require safety to be justified using a prescribed process. Safety managements and safety regulatory activities based on safety case are effective to control organizational factors in terms of integrated safety management. Especially safety issues relevant with public acceptance are useful to provide practical evidences to the public reasonably. European Union including UK has developed the concept of engineered safety management system to deal with public acceptance using the safety case. In Korea nuclear industry, the Korean Atomic Research Institute has firstly performed a basic research to adapt the safety case in the field of radioactive waste according to the IAEA SSG-23(KAERI/TR-4497, 4531). Excepting the radioactive waste, there is no try to adapt the safety case yet. Most incidents and accidents involved human during operating NPPs have a tendency

Viral fitness does not correlate with three genotype displacement events involving infectious hematopoietic necrosis virus

Science.gov (United States)

Kell, Alison M.; Wargo, Andrew R.; Kurath, Gael

2014-01-01

Viral genotype displacement events are characterized by the replacement of a previously dominant virus genotype by a novel genotype of the same virus species in a given geographic region. We examine here the fitness of three pairs of infectious hematopoietic necrosis virus (IHNV) genotypes involved in three major genotype displacement events in Washington state over the last 30 years to determine whether increased virus fitness correlates with displacement. Fitness was assessed using in vivo assays to measure viral replication in single infection, simultaneous co-infection, and sequential superinfection in the natural host, steelhead trout. In addition, virion stability of each genotype was measured in freshwater and seawater environments at various temperatures. By these methods, we found no correlation between increased viral fitness and displacement in the field. These results suggest that other pressures likely exist in the field with important consequences for IHNV evolution.

Field errors in hybrid insertion devices

International Nuclear Information System (INIS)

Schlueter, R.D.

1995-02-01

Hybrid magnet theory as applied to the error analyses used in the design of Advanced Light Source (ALS) insertion devices is reviewed. Sources of field errors in hybrid insertion devices are discussed

Field errors in hybrid insertion devices

Energy Technology Data Exchange (ETDEWEB)

Schlueter, R.D. [Lawrence Berkeley Lab., CA (United States)

1995-02-01

Hybrid magnet theory as applied to the error analyses used in the design of Advanced Light Source (ALS) insertion devices is reviewed. Sources of field errors in hybrid insertion devices are discussed.

Insertion mechanics of bioinspired needles into soft tissues.

Science.gov (United States)

Sahlabadi, Mohammad; Khodaei, Seyedvahid; Jezler, Kyle; Hutapea, Parsaoran

2017-12-22

Most studies to date confirm that any increase in the needle insertion force increases the damage to the tissue. When it comes to brain tissue, even minor damage can cause a long-lasting traumatic brain injury. Thus there is a great demand for innovative minimally invasive needles among the medical community. In our previous studies a novel bioinspired needle design with specially designed barbs was used to perform insertion tests into Polyvinyl chloride (PVC) tissue-mimicking gels, in which it decreased the insertion force by as much as 25%. In this work, bioinspired needles were designed using a CAD software, and were then manufactured using a 3 D printer. The insertion tests into bovine brain and liver were then performed to further investigate the performance of our bioinspired needles in real tissues. Our results show that there was a 10-25% decrease in the insertion force for insertions into bovine brain, and a 35-45% reduction in the insertion force for insertions into bovine liver using the proposed bioinspired needles. The reduction in the insertion force is due to the decrease in the friction force of the bioinspired needle with the bovine tissues, and its results are consistent with our previous results.

Cassini-Huygens Nears Saturn Orbit Insertion

Science.gov (United States)

Showstack, Randy

2004-06-01

After nearly 7 years and a 3.5-billion-km, circuitous journey from Earth, the $3-billion Cassini-Huygens mission to Saturn and Titan-an international effort by NASA, the European Space Agency, and the Italian Space Agency-now is just days away from its critical Saturn orbit insertion. Scheduled for 30 June, this will begin the 4-years part of the mission to study the Saturnian system. At a 3 June briefing at NASA headquarters in Washington, D.C., Robert Mitchell, the Cassini program manager with the Jet Propulsion Laboratory in Pasadena, California, said that scientists involved with the program are feeling excited, relieved, and also a bit anxious as the Cassini-Huygens spacecraft draws near to the ringed planet and its system.

Anterior transarticular C1-C2 fixation with contralateral screw insertion: a report of two cases and technical note.

Science.gov (United States)

Lvov, Ivan; Grin, Andrey; Kaykov, Aleksandr; Smirnov, Vladimir; Krylov, Vladimir

2017-08-08

Anterior transarticular fixation of the C1-C2 vertebrae is a well-known technique that involves screw insertion through the body of the C2 vertebra into the lateral masses of the atlas through an anterior transcervical approach. Meanwhile, contralateral screw insertion has been previously described only in anatomical studies. We describe two case reports of the clinical application of this new technique. In Case 1, the patient was diagnosed with an unstable C1 fracture. The clinical features of the case did not allow for any type of posterior atlantoaxial fusion, Halo immobilization, or routine anterior fixation using the Reindl and Koller techniques. The possible manner of screw insertion into the anterior third of the right lateral mass was via a contralateral trajectory, which was performed in this case. Case 2 involved a patient with neglected posteriorly dislocated dens fracture who could not lie in the prone position due to concomitant cardiac pathology. Reduction of atlantoaxial dislocation was insufficient, even after scar tissue resection at the fracture, while transdental fusion was not possible. Considering the success of the previous case, atlantoaxial fixation was performed through the small approach, using the Reindl technique and contralateral screw insertion. These two cases demonstrate the potential of anterior transarticular fixation of C1-C2 vertebrae in cases where posterior atlantoaxial fusion is not achievable. This type of fixation can be performed through a single approach if one screw is inserted using the Reindl technique and another is inserted via a contralateral trajectory.

Insertion device and beam line plans for the Advanced Photon Source: A report and recommendations by the Insertion Device and Beam Line Planning Committee

International Nuclear Information System (INIS)

1988-02-01

In the 7-GeV Advanced Photon Source (APS) Conceptual Design Report (CDR), fifteen complete experimental beam lines were specified in order to establish a representative technical and cost base for the components involved. In order to optimize the composition of the insertion devices and the beam line, these funds are considered a ''Trust Fund.'' The present report evaluates the optimization for the distribution of these funds so that the short- and long-term research programs will be most productive, making the facility more attractive from the user's point of view. It is recommended that part of the ''Trust Fund'' be used for the construction of the insertion devices, the front-end components, and the first-optics, minimizing the cost to potential users of completing a beam line. In addition, the possibility of cost savings resulting from replication and standardization of high multiplicity components (such as IDs, front ends, and first-optics instrumentation) is addressed. 2 refs., 5 tabs

Agitation within Mk-42 insert caused by air sparge

International Nuclear Information System (INIS)

Ramsey, C.J.

1991-01-01

Dissolution of Rocky Flats Pu alloys and Pu metal using a ''nested insert'' configuration (One Well Insert (S-3352) inside the Mk-42 Insert) will require a Nuclear Safety Study, a major assumption of which will be that the annular dissolver is well-mixed. The ''well-mixed'' assumption was theoretically and experimentally supported for alloy dissolution using the Three Well Insert, but the present situation differs significantly. In the former case, the insert was directly exposed to the agitation induced by air sparging; in the case under consideration, the One Well Insert would be shielded by the Mk-42 Insert. In an effort to determine if the ''nested insert'' approach should be pursued, the past studies and technical literature have been surveyed and an attempt made to predict the extent of mixing and bulk circulation for a ''nested insert'' configuration in the presence of air sparging

Differences in Work-Related Adverse Events by Sex and Industry in Cases Involving Compensation for Mental Disorders and Suicide in Japan From 2010 to 2014.

Science.gov (United States)

Yamauchi, Takashi; Sasaki, Takeshi; Yoshikawa, Toru; Matsumoto, Shun; Takahashi, Masaya; Suka, Machi; Yanagisawa, Hiroyuki

2018-04-01

This study aimed to clarify whether work-related adverse events in cases involving compensation for mental disorders and suicide differ by sex and industry using a database containing all relevant cases reported from 2010 to 2014 in Japan. A total of 1362 eligible cases involving compensation for mental disorders (422 females and 940 males) were analyzed. Among males, 55.7% of cases were attributed to "long working hours." In both sexes, the frequencies of cases attributed to "long working hours" and other events differed significantly by industry. Among cases involving compensation for suicide, 71.4% were attributed to "long working hours." The frequency distribution of work-related adverse events differed significantly by sex and industry. These differences should be taken into consideration in the development of industry-specific preventive measures for occupational mental disorders.

Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower

Directory of Open Access Journals (Sweden)

Antje Reddemann

2018-03-01

Full Text Available Cytoplasmic male sterility (CMS systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6, atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5′ coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231. The first 53 bp of orf288 are identical to the 5′ end of atp9. Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9. These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

Clinical information in drug package inserts in India

Directory of Open Access Journals (Sweden)

Shivkar Y

2009-01-01

Full Text Available Background: It is widely recognized that accurate and reliable product information is essential for the safe and effective use of medications. Pharmaceutical companies are the primary source of most drug information, including package inserts. Package inserts are printed leaflets accompanying marketed drug products and contain information approved by the regulatory agencies. Studies on package inserts in India, in 1996, had shown that crucial information was often missing and they lacked uniformity. Aim: To assess the presentation and completeness of clinically important information provided in the currently available package inserts in India. Materials and Methods: Package inserts accompanying allopathic drug products marketed by pharmaceutical companies in India were collected. These package inserts were analyzed for the content of clinically important information in various sections. Statistical Analysis: The results were expressed as absolute numbers and percentages. Results: Preliminary analyses revealed that most package inserts did contain information under headings, such as, therapeutic indications, contraindications, undesirable effects, etc., listed in the Drugs and Cosmetics Rules 1945. The findings indicated considerable improvement in package inserts since 1996. However, on critical evaluation it was revealed that clinically important information was not well presented and was often incomplete. Information with regard to pediatric and geriatric use was present in only 44% and 13% of the package inserts, respectively. Only five of the inserts had information on the most frequent adverse drug reactions associated with the drug. Also, information on interactions and overdosage was often missing. Conclusion: Although the package inserts appear to have improved over the past decade there is still a definite need to further refine the clinical information contained, to minimize the risks to patients. This could be brought about by self

Reactivity insertion accident analysis

International Nuclear Information System (INIS)

Moreira, J.M.L.; Nakata, H.; Yorihaz, H.

1990-04-01

The correct prediction of postulated accidents is the fundamental requirement for the reactor licensing procedures. Accident sequences and severity of their consequences depend upon the analysis which rely on analytical tools which must be validated against known experimental results. Present work presents a systematic approach to analyse and estimate the reactivity insertion accident sequences. The methodology is based on the CINETHICA code which solves the point-kinetics/thermohydraulic coupled equations with weighted temperature feedback. Comparison against SPERT experimental results shows good agreement for the step insertion accidents. (author) [pt

Sample vial inserts: A better approach for sampling heterogeneous slurry samples in the SRS Defense Waste Processing Facility

International Nuclear Information System (INIS)

Coleman, C.J.; Goode, S.R.

1996-01-01

A convenient and effective new approach for analyzing DWPF samples involves the use of inserts with volumes of 1.5--3 ml placed in the neck of 14 ml sample vials. The inserts have rims that conform to the rim of the vials so that they sit straight and stable in the vial. The DWPF tank sampling system fills the pre-weighed insert rather than the entire vial, so the vial functions only as the insert holder. The shielded cell operator then removes the vial cap and decants the insert containing the sample into a plastic bottle, crucible, etc., for analysis. Inert materials such as Teflon, plastic, and zirconium are used for the insert so it is unnecessary to separate the insert from the sample for most analyses. The key technique advantage of using inserts to take DWPF samples versus filling sample vials is that it provides a convenient and almost foolproof way of obtaining and handling small volumes of slurry samples in a shielded cell without corrupting the sample. Since the insert allows the entire sample to be analyzed, this approach eliminates the errors inherent with subsampling heterogeneous slurries that comprise DWPF samples. Slurry samples can then be analyzed with confidence. Analysis times are dramatically reduced by eliminating the drying and vitrification steps normally used to produce a homogeneous solid sample. Direct dissolution and elemental analysis of slurry samples are achieved in 8 hours or less compared with 40 hours for analysis of vitrified slurry samples. Comparison of samples taken in inserts versus full vials indicate that the insert does not significantly affect sample composition

Turbine airfoil having near-wall cooling insert

Science.gov (United States)

Martin, Jr., Nicholas F.; Wiebe, David J.

2017-09-12

A turbine airfoil is provided with at least one insert positioned in a cavity in an airfoil interior. The insert extends along a span-wise extent of the turbine airfoil and includes first and second opposite faces. A first near-wall cooling channel is defined between the first face and a pressure sidewall of an airfoil outer wall. A second near-wall cooling channel is defined between the second face and a suction sidewall of the airfoil outer wall. The insert is configured to occupy an inactive volume in the airfoil interior so as to displace a coolant flow in the cavity toward the first and second near-wall cooling channels. A locating feature engages the insert with the outer wall for supporting the insert in position. The locating feature is configured to control flow of the coolant through the first or second near-wall cooling channel.

Insertion devices at the advanced photon source

International Nuclear Information System (INIS)

Moog, E.R.

1996-01-01

The insertion devices being installed at the Advanced Photon Source cause the stored particle beam to wiggle, emitting x-rays with each wiggle. These x-rays combine to make an intense beam of radiation. Both wiggler and undulator types of insertion devices are being installed; the characteristics of the radiation produced by these two types of insertion devices are discussed, along with the reasons for those characteristics

Experimental testing of exchangeable cutting inserts cutting ability

OpenAIRE

Čep, Robert; Janásek, Adam; Čepová, Lenka; Petrů, Jana; Hlavatý, Ivo; Car, Zlatan; Hatala, Michal

2013-01-01

The article deals with experimental testing of the cutting ability of exchangeable cutting inserts. Eleven types of exchangeable cutting inserts from five different manufacturers were tested. The tested cutting inserts were of the same shape and were different especially in material and coating types. The main aim was both to select a suitable test for determination of the cutting ability of exchangeable cutting inserts and to design such testing procedure that could make it possible...

Safeguards Summary Event List (SSEL)

International Nuclear Information System (INIS)

1991-07-01

The Safeguards Summary Event List (SSEL) provides brief summaries of several hundred safeguards-related events involving nuclear material or facilities regulated by the US Nuclear Regulatory Commission (NRC). Because of public interest, the Miscellaneous category includes a few events which involve either source material, byproduct material, or natural uranium which are exempt from safeguards requirements. Events are described under the categories of bomb-related, intrusion, missing and/or allegedly stolen, transportation, tampering/vandalism, arson, firearms, radiological sabotage, nonradiological sabotage, pre-1990 alcohol and drugs (involving reactor operators, security force members, or management persons), and miscellaneous. The information contained in the event descriptions is derived primarily from official NRC reporting channels

Inserting Phase Change Lines into Microsoft Excel® Graphs.

Science.gov (United States)

Dubuque, Erick M

2015-10-01

Microsoft Excel® is a popular graphing tool used by behavior analysts to visually display data. However, this program is not always friendly to the graphing conventions used by behavior analysts. For example, adding phase change lines has typically been a cumbersome process involving the insertion of line objects that do not move when new data is added to a graph. The purpose of this article is to describe a novel way to add phase change lines that move when new data is added and when graphs are resized.

Risk factors for development of complication following peripherally inserted central

Directory of Open Access Journals (Sweden)

Hakan Aydın

2014-03-01

Full Text Available Objectives: Peripherally inserted central venous catheters (PICCs are inserted into central veins through the upper extremity veins. In this retrospective study, we aimed to evaluate PICC procedures, related complications, their causes and factors influencing the success of the procedure during anaesthesia Methods: ‘Central Venous Catheterization Forms’ filled out for 850 patients in whom a PICC was inserted by residents during general anaesthesia between November 2009 and March 2013 in the operating room of Uludag University Medical Faculty Hospital were retrospectively analysed. Results: A total of 1174 procedures were evaluated. The most preferred vein for the first attempt was the right basilic vein (32.7%. Difficulty (more than two attempts with the PICC procedure was correlated with the patient’s age (p30 kg/m² (p<0.05, resident with less than 4 years of training (p=0.001, number of PICC attempts ≥2 (p<0.001, more than one resident involved in the catheterization procedure (p<0.001 and previous failed PICC procedures (p<0.001. Conclusion: We conclude that catheterization should be performed under the surveillance of a staff keeping in mind the risks of complications. In the case of failure following 2 attempts, the procedure should be handed over to a more experienced staff member. J Clin Exp Invest 2014; 5 (1: 29-35

RelocaTE2: a high resolution transposable element insertion site mapping tool for population resequencing

Directory of Open Access Journals (Sweden)

Jinfeng Chen

2017-01-01

Full Text Available Background Transposable element (TE polymorphisms are important components of population genetic variation. The functional impacts of TEs in gene regulation and generating genetic diversity have been observed in multiple species, but the frequency and magnitude of TE variation is under appreciated. Inexpensive and deep sequencing technology has made it affordable to apply population genetic methods to whole genomes with methods that identify single nucleotide and insertion/deletion polymorphisms. However, identifying TE polymorphisms, particularly transposition events or non-reference insertion sites can be challenging due to the repetitive nature of these sequences, which hamper both the sensitivity and specificity of analysis tools. Methods We have developed the tool RelocaTE2 for identification of TE insertion sites at high sensitivity and specificity. RelocaTE2 searches for known TE sequences in whole genome sequencing reads from second generation sequencing platforms such as Illumina. These sequence reads are used as seeds to pinpoint chromosome locations where TEs have transposed. RelocaTE2 detects target site duplication (TSD of TE insertions allowing it to report TE polymorphism loci with single base pair precision. Results and Discussion The performance of RelocaTE2 is evaluated using both simulated and real sequence data. RelocaTE2 demonstrate high level of sensitivity and specificity, particularly when the sequence coverage is not shallow. In comparison to other tools tested, RelocaTE2 achieves the best balance between sensitivity and specificity. In particular, RelocaTE2 performs best in prediction of TSDs for TE insertions. Even in highly repetitive regions, such as those tested on rice chromosome 4, RelocaTE2 is able to report up to 95% of simulated TE insertions with less than 0.1% false positive rate using 10-fold genome coverage resequencing data. RelocaTE2 provides a robust solution to identify TE insertion sites and can be

A united event grand canonical Monte Carlo study of partially doped polyaniline

Energy Technology Data Exchange (ETDEWEB)

Byshkin, M. S., E-mail: mbyshkin@unisa.it, E-mail: gmilano@unisa.it; Correa, A. [Modeling Lab for Nanostructure and Catalysis, Dipartimento di Chimica e Biologia and NANOMATES, University of Salerno, 84084, via Ponte don Melillo, Fisciano Salerno (Italy); Buonocore, F. [ENEA Casaccia Research Center, Via Anguillarese 301, 00123 Rome (Italy); Di Matteo, A. [STMicroelectronics, Via Remo de Feo, 1 80022 Arzano, Naples (Italy); IMAST Scarl Piazza Bovio 22, 80133 Naples (Italy); Milano, G., E-mail: mbyshkin@unisa.it, E-mail: gmilano@unisa.it [Modeling Lab for Nanostructure and Catalysis, Dipartimento di Chimica e Biologia and NANOMATES, University of Salerno, 84084, via Ponte don Melillo, Fisciano Salerno (Italy); IMAST Scarl Piazza Bovio 22, 80133 Naples (Italy)

2013-12-28

A Grand Canonical Monte Carlo scheme, based on united events combining protonation/deprotonation and insertion/deletion of HCl molecules is proposed for the generation of polyaniline structures at intermediate doping levels between 0% (PANI EB) and 100% (PANI ES). A procedure based on this scheme and subsequent structure relaxations using molecular dynamics is described and validated. Using the proposed scheme and the corresponding procedure, atomistic models of amorphous PANI-HCl structures were generated and studied at different doping levels. Density, structure factors, and solubility parameters were calculated. Their values agree well with available experimental data. The interactions of HCl with PANI have been studied and distribution of their energies has been analyzed. The procedure has also been extended to the generation of PANI models including adsorbed water and the effect of inclusion of water molecules on PANI properties has also been modeled and discussed. The protocol described here is general and the proposed United Event Grand Canonical Monte Carlo scheme can be easily extended to similar polymeric materials used in gas sensing and to other systems involving adsorption and chemical reactions steps.

Ocular inserts - Advancement in therapy of eye diseases

Directory of Open Access Journals (Sweden)

Anita Kumari

2010-01-01

Full Text Available The ocular insert represents a significant advancement in the therapy of eye disease. Ocular inserts are defined as sterile, thin, multilayered, drug-impregnated, solid or semisolid consistency devices placed into the cul-de-sac or conjuctival sac, whose size and shape are especially designed for ophthalmic application. They are composed of a polymeric support that may or may not contain a drug. The drug can later be incorporated as dispersion or a solution in the polymeric support. They offer several advantages as increased ocular residence and sustained release of medication into the eye. The insert includes a body portion sized to position within a lachrymal canaliculus of the eyelid. The inserts are classified according to their solubility as insoluble, soluble, or bioerodible inserts. The release of drug from the insert depends upon the diffusion, osmosis, and bioerosion of the drug, and this article is an attempt to present a brief about this newer drug delivery system.

Report on converging insert moulding with µ-IM

DEFF Research Database (Denmark)

Islam, Aminul

moulding with µ-IM  Task 5.2.1 and COTECH demonstrator: guide line for 5PRC production based on the concept of Task 5.2.1 Information and results provided by this deliverable will be directly used for one of the COTECH demonstrators production which will call for convergent insert moulding with µ......Task 5.2.1 deals with the technical feasibility of converging the state-of-the-art µ IM process with insert moulding to offer a wide range of multi-material µ components. The main objective of this deliverable is to summarize state-of-the-art information and to make the guideline needed...... for the convergence. In particular the following aspects are summed up in the deliverable:  Need for converging insert moulding with µ-IM  Objectives and expected outcome from task 5.2.1  State-of-the-art micro insert moulding and different scenario of micro insert moulding  Challenges ahead of converging insert...

Machinability and scratch wear resistance of carbon-coated WC inserts

Energy Technology Data Exchange (ETDEWEB)

Pazhanivel, B., E-mail: palcecri@yahoo.co.in; Kumar, T. Prem; Sozhan, G.

2015-03-15

Highlights: • Cemented WC inserts were coated with carbon by CVD. • The deposits were either loosely held MWCNTs or adherent carbides. • Co-efficient of friction (ramp load; 1–13 N); 0.2 and 0.1 μ, respectively, for the uncoated and carbide-coated inserts. • The carbide-coated insert exhibited better machinability and surface finish than a commercial TiCN-coated insert. - Abstract: In this work, cemented tungsten carbide (WC) inserts were coated with nanocarbons/carbides by chemical vapor deposition (CVD) and their machinability and scratch wear resistance were investigated. The hardness and surface conditions of the WC substrate were studied before and after coating. The CVD-generated nanocarbons on the insert surfaces were examined by SEM, FE-SEM and TEM. The electron microscopic images revealed that the carbons generated were multi-walled carbon nanotubes (MWCNTs) or carbides depending on the experimental conditions. In both the cases, the cutting edges of the inserts had dense deposits. Scratch wear test with the coated inserts showed that the co-efficient of friction was 0.1 μ as against 0.2 μ for the uncoated inserts under a ramp load of 1–13 N. The machinability characteristics of commercially available TiCN-coated inserts and the carbon-coated WC inserts were compared by using a CNC machine and a Rapid I vision inspection system. It was found that the carbide-coated inserts exhibited machinability with better surface finish comparable to that of the TiCN-coated inserts while the MWCNT-coated inserts showed inferior adhesion properties.

Node insertion in Coalescence Fractal Interpolation Function

International Nuclear Information System (INIS)

Prasad, Srijanani Anurag

2013-01-01

The Iterated Function System (IFS) used in the construction of Coalescence Hidden-variable Fractal Interpolation Function (CHFIF) depends on the interpolation data. The insertion of a new point in a given set of interpolation data is called the problem of node insertion. In this paper, the effect of insertion of new point on the related IFS and the Coalescence Fractal Interpolation Function is studied. Smoothness and Fractal Dimension of a CHFIF obtained with a node are also discussed

Test manufacture of the canister insert 135

International Nuclear Information System (INIS)

Raiko, H.

2005-10-01

This report describes the insert-manufacturing test of a disposal canister for spent nuclear fuel that was made by Metso Foundries Jyvaeskylae Oy, in June 2004 on contract for Posiva Oy. The test manufacture was a part of the co-operation development programme of encapsulation technology between SKB AB and Posiva Oy. Insert casting was specified according to the current manufacturing specifications of SKB. The canister insert was of BWR-type with integral bottom. This was the second trial manufacture of this type of insert in Finland and, in total, the third test manufacture of insert by Metso Foundries Jyvaeskylae Oy. The result fulfilled all the requirements but the material mechanical properties of the cast material. The measured ultimate strength and elongation at rupture were lower than specified in the upper part of the cast. The reason for this was revealed in the metallurgical investigation of the cast material. The cast contained slag (dross). Avoiding the dross formation will be the most demanding challenge of the forthcoming development of the cast procedure. (orig.)

Templated sequence insertion polymorphisms in the human genome

Science.gov (United States)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

Insertion Loss of Personal Protective Clothing

International Nuclear Information System (INIS)

Shull, D.J.

1999-01-01

The use of personal protective clothing that covers the head is a common practice in many industries. Such personal protective clothing will impact the sound pressure level and the frequency content of sounds to which the wearer will be exposed. The use of such clothing, then, may impact speech and alarm audibility. A measure of the impact of such clothing is its insertion loss. Insertion loss measurements were performed on four types of personal protective clothing in use by Westinghouse Savannah River Company personnel which utilize cloth and plastic hood configurations to protect the head. All clothing configurations tested at least partially cover the ears. The measurements revealed that insertion loss of the items tested was notable at frequencies above 1000 Hz only and was a function of material stiffness and acoustic flanking paths to the ear. Further, an estimate of the clothing's noise reduction rating reveals poor performance in that regard, even though the insertion loss of the test articles was significant at frequencies at and above 1000 Hz.'

Forward genetic screening for regulators involved in cholesterol synthesis using validation-based insertional mutagenesis.

Directory of Open Access Journals (Sweden)

Wei Jiang

Full Text Available Somatic cell genetics is a powerful approach for unraveling the regulatory mechanism of cholesterol metabolism. However, it is difficult to identify the mutant gene(s due to cells are usually mutagenized chemically or physically. To identify important genes controlling cholesterol biosynthesis, an unbiased forward genetics approach named validation-based insertional mutagenesis (VBIM system was used to isolate and characterize the 25-hydroxycholesterol (25-HC-resistant and SR-12813-resistant mutants. Here we report that five mutant cell lines were isolated. Among which, four sterol-resistant mutants either contain a truncated NH2-terminal domain of sterol regulatory element-binding protein (SREBP-2 terminating at amino acids (aa 400, or harbor an overexpressed SREBP cleavage-activating protein (SCAP. Besides, one SR-12813 resistant mutant was identified to contain a truncated COOH-terminal catalytic domain of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase. This study demonstrates that the VBIM system can be a powerful tool to screen novel regulatory genes in cholesterol biosynthesis.

Insertable fluid flow passage bridgepiece and method

Science.gov (United States)

Jones, Daniel O.

2000-01-01

A fluid flow passage bridgepiece for insertion into an open-face fluid flow channel of a fluid flow plate is provided. The bridgepiece provides a sealed passage from a columnar fluid flow manifold to the flow channel, thereby preventing undesirable leakage into and out of the columnar fluid flow manifold. When deployed in the various fluid flow plates that are used in a Proton Exchange Membrane (PEM) fuel cell, bridgepieces of this invention prevent mixing of reactant gases, leakage of coolant or humidification water, and occlusion of the fluid flow channel by gasket material. The invention also provides a fluid flow plate assembly including an insertable bridgepiece, a fluid flow plate adapted for use with an insertable bridgepiece, and a method of manufacturing a fluid flow plate with an insertable fluid flow passage bridgepiece.

Development of collimator insert for linac based stereotactic irradiation

International Nuclear Information System (INIS)

Singh, I.R.R.; Brindha, S.; Ravindran, B.P.; Rajshekhar, V.

1999-01-01

The aim of this study is to develop collimator inserts of various sizes which are either not commercially available or are expensive to import. The dosimetry parameters such as tissue maximum ratio (TMR), off-axis ratio (OAR) and output factor of the developed collimator insert are compared with that of the commercial collimator insert (Radionics). In order to check the suitability of the collimator insert developed locally for clinical use and to standardize the method of development, a collimator insert of 15 mm identical to the one supplied by Radionics is developed with low-melting alloy (Cerrobend). Moreover for the clinical use of the developed collimator insert, certain acceptance tests are performed which include a collimator concentricity test, beam size check and radiation leakage test. The dose verification is carried out with a thermoluminescent dosimeter ( 7 LiF rods) and an FBX chemical dosimeter in a human-head-shaped Perspex phantom filled with water. The variation between the calculated and measured dose is found to be within +2.4% for 7 LiF rods and -2.0% for the FBX chemical dosimeter thus ensuring the suitability of the developed collimator insert for clinical use. This has encouraged us to standardize the method adapted to develop the collimator insert and to develop collimator inserts of different field sizes. (author)

Utility of T-DNA insertion mutagenesis in arabidopsis for crop improvement

Energy Technology Data Exchange (ETDEWEB)

Feldmann, K A [Arizona Univ., Tucson, AZ (United States). Dept. of Plant Sciences

1995-11-01

T-DNA insertion mutagenesis in Arabidopsis is an efficient and expedient method for isolating genes that may have agronomic importance in crop plants. More than 14,000 transformants, with an average of 1.5 inserts per transformant, have been generated in the laboratory at the University of Arizona, Tucson, United States of America. Assuming that the genome of Arabidopsis is 100 Mb and that insertion is random, there is a greater than 50% probability that any particular gene has been tagged in this population. These transformed lines have been screened for any visible alteration in phenotype. In addition, they have been screened under numerous selective regimes such as cold tolerance, auxin and ethylene resistance or sensitivity, and nitrate utilization, among many others. Twenty per cent of these transformants segregate for some type of mutation. Approximately 40% of these are due to T-DNA insertion. Genes have already been cloned from various developmental and biochemical pathways, including flower, root and trichome morphology, light and ethylene regulated growth, fatty acid desaturation and epicuticular wax (EW) production. Some of the isolated genes are being introduced into agronomic species in an attempt to improve specific traits. For example, two genes important in EW production have been introduced into Brassica oleracea (broccoli) to modify the nature of the EW such that engineered plants will show greater resistance to herbivorous insects. Similarly, genes involved in fatty acid desaturation, male sterility, height or nitrogen metabolism, to mention only a few, could also be utilized to improve certain crop traits via genetic engineering. Several of these examples are described. (author). 57 refs, 1 fig., 2 tabs.

Bioinspired microneedle insertion for deep and precise skin penetration with low force: Why the application of mechanophysical stimuli should be considered.

Science.gov (United States)

Kim, Jonghun; Park, Sungmin; Nam, Gyungmok; Choi, Young; Woo, Seungpyo; Yoon, Sang-Hee

2018-02-01

A mosquito is known to precisely and easily insert its proboscis to the human skin by pressing down a labium and vibrating a fascicle bundle. Its advanced skin-piercing mechanisms indicate that skin resistance to the insertion of needle-like objects can be changed by the application of mechanophysical stimuli. Here, we characterize the effect of the application of mechanophysical stimuli on skin resistance to microneedle insertion to find clues for inserting a microneedle in a deep and precise fashion with low force. Microneedles with a diameter of 60-140µm are inserted at a velocity of 0.1-2.0mm/s to full-thickness porcine skins while either uniaxial/equibiaxial stretch of 0-20% or mechanical vibration at a frequency of 1 to 1000Hz and an amplitude of 1-10µm is applied to the skins as static or dynamic mechanophysical stimulus, respectively. The values of force and depth at two events of skin puncture and maximum penetration are measured to explore changes in skin resistance induced by the application of external stimuli. The static mechanophysical stimulus applied to the skin mainly affects the precision of microneedle insertion; the application of dynamic mechanophysical stimulus controls the value and deviation of skin resistance to microneedle insertion. The application of mechanophysical stimuli, inspired from a mosquito, therefore allows a microneedle to be deeply and easily inserted to the skin in a controlled way. The findings will have broad impacts on microneedle-mediated applications and lead to an in-depth understanding of skin biomechanics. Copyright © 2017 Elsevier Ltd. All rights reserved.

Single-copy insertion of transgenes in Caenorhabditis elegans

DEFF Research Database (Denmark)

Frøkjaer-Jensen, Christian; Davis, M Wayne; Hopkins, Christopher E

2008-01-01

developed a method that inserts a single copy of a transgene into a defined site. Mobilization of a Mos1 transposon generates a double-strand break in noncoding DNA. The break is repaired by copying DNA from an extrachromosomal template into the chromosomal site. Homozygous single-copy insertions can...... be obtained in less than 2 weeks by injecting approximately 20 worms. We have successfully inserted transgenes as long as 9 kb and verified that single copies are inserted at the targeted site. Single-copy transgenes are expressed at endogenous levels and can be expressed in the female and male germlines....

Laparoscopic insertion of the Moss feeding tube.

Science.gov (United States)

Albrink, M H; Hagan, K; Rosemurgy, A S

1993-12-01

Placement of enteral feeding tubes is an important part of a surgeon's skill base. Surgical insertion of feeding tubes has been performed safely for many years with very few modifications. With the recent surge in interest and applicability of other laparoscopic procedures, it is well within the skills of the average laparoscopic surgeon to insert feeding tubes. We describe herein a simple technique for the insertion of the Moss feeding tube. The procedure described has a minimum of invasion, along with simplicity, safety, and accuracy.

Safeguards summary event list (SSEL)

International Nuclear Information System (INIS)

1989-07-01

The Safeguards Summary Event List (SSEL) provides brief summaries of several hundred safeguards-related events involving nuclear material or facilities regulated by the US Nuclear Regulatory Commission (NRC). Because of public interest, also included are events reported involving byproduct material which is exempt from safeguards requirements. Events are described under the categories of bomb-related, intrusion, missing and/or allegedly stolen, transportation, tampering/vandalism, arson, firearms, radiological sabotage, nonradiological sabotage, alcohol and drugs, and miscellaneous. The information contained in the event descriptions is derived primarily from official NRC reporting channels

Safeguards Summary Event List (SSEL)

International Nuclear Information System (INIS)

Fadden, M.; Yardumian, J.

1993-07-01

The Safeguards Summary Event List provides brief summaries of hundreds of safeguards-related events involving nuclear material or facilities regulated by the US Nuclear Regulatory Commission. Events are described under the categories: Bomb-related, Intrusion, Missing/Allegedly Stolen, Transportation-related, Tampering/Vandalism, Arson, Firearms-related, Radiological Sabotage, Non-radiological Sabotage, and Miscellaneous. Because of the public interest, the Miscellaneous category also includes events reported involving source material, byproduct material, and natural uranium, which are exempt from safeguards requirements. Information in the event descriptions was obtained from official NRC sources

The Correlation between Insertion Depth of Prodisc-C Artificial Disc and Postoperative Kyphotic Deformity: Clinical Importance of Insertion Depth of Artificial Disc.

Science.gov (United States)

Lee, Do-Youl; Kim, Se-Hoon; Suh, Jung-Keun; Cho, Tai-Hyoung; Chung, Yong-Gu

2012-09-01

This study was designed to investigate the correlation between insertion depth of artificial disc and postoperative kyphotic deformity after Prodisc-C total disc replacement surgery, and the range of artificial disc insertion depth which is effective in preventing postoperative whole cervical or segmental kyphotic deformity. A retrospective radiological analysis was performed in 50 patients who had undergone single level total disc replacement surgery. Records were reviewed to obtain demographic data. Preoperative and postoperative radiographs were assessed to determine C2-7 Cobb's angle and segmental angle and to investigate postoperative kyphotic deformity. A formula was introduced to calculate insertion depth of Prodisc-C artificial disc. Statistical analysis was performed to search the correlation between insertion depth of Prodisc-C artificial disc and postoperative kyphotic deformity, and to estimate insertion depth of Prodisc-C artificial disc to prevent postoperative kyphotic deformity. In this study no significant statistical correlation was observed between insertion depth of Prodisc-C artificial disc and postoperative kyphotic deformity regarding C2-7 Cobb's angle. Statistical correlation between insertion depth of Prodisc-C artificial disc and postoperative kyphotic deformity was observed regarding segmental angle (p<0.05). It failed to estimate proper insertion depth of Prodisc-C artificial disc effective in preventing postoperative kyphotic deformity. Postoperative segmental kyphotic deformity is associated with insertion depth of Prodisc-C artificial disc. Anterior located artificial disc leads to lordotic segmental angle and posterior located artificial disc leads to kyphotic segmental angle postoperatively. But C2-7 Cobb's angle is not affected by artificial disc location after the surgery.

HTS Insert Magnet Design Study

CERN Document Server

Devaux, M; Fleiter, J; Fazilleau, P; Lécrevisse, T; Pes, C; Rey, J-M; Rifflet, J-M; Sorbi, M; Stenvall, A; Tixador, P; Volpini, G

2011-01-01

Future accelerator magnets will need to reach higher field in the range of 20 T. This field level is very difficult to reach using only Low Temperature Superconductor materials whereas High Temperature Superconductors (HTS) provide interesting opportunities. High current densities and stress levels are needed to design such magnets. YBCO superconductor indeed carries large current densities under high magnetic field and provides good mechanical properties especially when produced using the IBAD approach. The HFM EUCARD program studies the design and the realization of an HTS insert of 6 T inside a Nb$_{3}$Sn dipole of 13T at 4.2 K. In the2HTS insert, engineering current densities higher than 250 MA/m under 19 T are required to fulfill the specifications. The stress level is also very severe. YBCO IBAD tapes theoretically meet these challenges from presented measurements. The insert protection is also a critical because HTS materials show low quench propagation velocities and the coupling with the Nb$_{3}$Sn m...

Neutron absorber inserts for 55-gal drums

International Nuclear Information System (INIS)

Wilson, R.E.; Kim, Y.S.; Toffer, H.

2000-01-01

Transport and temporary storage of more than 200 g of fissile material in 55-gal drums at the Rocky Flats Environmental Technology Site (RFETS) have received significant attention during the cleanup mission. This paper discusses successful applications and results of extensive computer studies. Interim storage and movement of fissile material in excess of standard drum limits (200 g) in a safe configuration have been accomplished using special drum inserts. Such inserts have constrained the contents of a drum to two 4-ell bottles. The content of the bottles was limited to 600 g Pu or U in solution or a total of 1200 g for the entire drum. The inserts were a simple design constructed of stainless steel, forming a vertical cylindrical pipe into which two bottles, one on top of the other, could be centered in the drum. The remaining drum volume was configured to preclude any additional bottle placement external to the vertical cylinder. Such inserts in drums were successfully used in moving high-concentration solution from one building to another for chemical processing. Concern about the knowledge of fissile material concentration in bottles prompted another study for drum inserts. The past practice had been to load up to fourteen 4-ell bottles into 55-gal drums, provided the fissile material concentration was < 6 g fissile/ell, and the total drum contents of 200 g fissile was not exceeded. Only one determination of the solution concentration was needed. An extensive safety analysis concluded that a single measurement of bottle content could not ensure compliance with double-contingency-criterion requirements. A second determination of the bottle contents was required before bottles could be placed in a 55-gal drum. Al alternative to a dual-measurement protocol, which is for bolstering administrative control, was to develop an engineered safety feature that would eliminate expensive tests and administrative decisions. A drum insert design was evaluated that would

Z-2 Threaded Insert Design and Testing

Science.gov (United States)

Ross, Amy; Rhodes, Richard; Jones, Robert J.; Graziosi, David; Ferl, Jinny; Sweeny, Mitch; Scarborough, Stephen

2016-01-01

NASA's Z-2 prototype space suit contains several components fabricated from an advanced hybrid composite laminate consisting of IM10 carbon fiber and fiber glass. One requirement was to have removable, replaceable helicoil inserts to which other suit components would be fastened. An approach utilizing bonded in inserts with helicoils inside of them was implemented. During initial assembly, cracking sounds were heard followed by the lifting of one of the blind inserts out of its hole when the screws were torqued. A failure investigation was initiated to understand the mechanism of the failure. Ultimately, it was determined that the pre-tension caused by torqueing the fasteners is a much larger force than induced from the pressure loads of the suit which was not considered in the insert design. Bolt tension is determined by dividing the torque on the screw by a k value multiplied by the thread diameter of the bolt. The k value is a factor that accounts for friction in the system. A common value used for k for a non-lubricated screw is 0.2. The k value can go down by as much as 0.1 if the screw is lubricated which means for the same torque, a much larger tension could be placed on the bolt and insert. This paper summarizes the failure investigation that was performed to identify the root cause of the suit failure and details how the insert design was modified to resist a higher pull out tension.

Bulkhead insert for an internal combustion engine

Science.gov (United States)

Maki, Clifford E.; Chottiner, Jeffrey Eliot; Williams, Rick L.; Thibault, Mark W.; Ervin, James Douglas; Boileau, James Maurice; McKeough, Bryan

2017-08-01

An engine includes a cylinder block defining at least one main bearing bulkhead adjacent to a cylinder, and a crankshaft rotatably housed within the block by a main bearing. A bulkhead insert has a cap portion, and an insert portion provided within the bulkhead. The insert portion has having first and second end regions connected by first and second straps. Each strap having a flanged beam cross section. The first and second ends of the insert portion are configured to connect a main bearing cap column to a cylinder head column. Each of the first and second end regions define at least one protrusion having a surface substantially normal to engine combustion and reactive loads. The cap portion is configured to mate with the first end region at the main bearing cap column and support the main bearing.

Lithium insertion mechanism in SnS2

International Nuclear Information System (INIS)

Lefebvre-Devos, I.; Olivier-Fourcade, J.; Jumas, J.C.; Lavela, P.

2000-01-01

We study lithium insertion in SnS 2 by means of 119 Sn Moessbauer spectroscopy, x-ray absorption spectroscopy at Sn L I,III , and S K edges, and theoretical electronic structures (calculated in the density-functional theory framework). An insertion mechanism is derived according to the Li amount. It shows the influence of the SnS 2 -layered structure on the Sn reduction, particularly the possibility of an intermediate oxidation state between Sn IV and Sn II , which is not observed during Li insertion in three-dimensional sulfides

A Novel 2.3 Mb Microduplication of 9q34.3 Inserted into 19q13.4 in a Patient with Learning Disabilities

Directory of Open Access Journals (Sweden)

Shalinder Singh

2012-01-01

Full Text Available Insertional translocations in which a duplicated region of one chromosome is inserted into another chromosome are very rare. We report a 16.5-year-old girl with a terminal duplication at 9q34.3 of paternal origin inserted into 19q13.4. Chromosomal analysis revealed the karyotype 46,XX,der(19ins(19;9(q13.4;q34.3q34.3pat. Cytogenetic microarray analysis (CMA identified a ~2.3Mb duplication of 9q, which was confirmed by Fluorescence in situ hybridisation (FISH. The duplication at 9q34.3 is the smallest among the cases reported so far. The proband exhibits similar clinical features to those previously reported cases with larger duplication events.

Testing Cessation Messages for Cigarette Package Inserts: Findings from a Best/Worst Discrete Choice Experiment

Directory of Open Access Journals (Sweden)

James F. Thrasher

2018-02-01

Full Text Available This study assessed smokers’ responses to different smoking cessation topics and imagery for cigarette package inserts. Adult smokers from Canada (n = 1000 participated in three discrete choice experiments (DCEs: DCE 1 assessed five cessation benefit topics and five imagery types; DCE 2 assessed five messages with tips to improve cessation success and five imagery types; DCE 3 assessed four reproductive health benefits of cessation topics and four imagery types. In each DCE, participants evaluated four or five sets of four inserts, selecting the most and least motivating (DCEs 1 & 3 or helpful (DCE 2 for quitting. Linear mixed models regressed choices on insert and smoker characteristics. For DCE 1, the most motivating messages involved novel disease topics and imagery of younger women. For DCE 2, topics of social support, stress reduction and nicotine replacement therapy were selected as most helpful, with no differences by imagery type. For DCE 3, imagery influenced choices more than topic, with imagery of a family or a mom and baby selected as most motivating. Statistically significant interactions for all three experiments indicated that the influence of imagery type on choices depended on the message topic. Messages to promote smoking cessation through cigarette pack inserts should consider specific combinations of message topic and imagery.

Fracture of Reduced-Diameter Zirconia Dental Implants Following Repeated Insertion.

Science.gov (United States)

Karl, Matthias; Scherg, Stefan; Grobecker-Karl, Tanja

Achievement of high insertion torque values indicating good primary stability is a goal during dental implant placement. The objective of this study was to evaluate whether or not two-piece implants made from zirconia ceramic may be damaged as a result of torque application. A total of 10 two-piece zirconia implants were repeatedly inserted into polyurethane foam material with increasing density and decreasing osteotomy size. The insertion torque applied was measured, and implants were checked for fractures by applying the fluorescent penetrant method. Weibull probability of failure was calculated based on the recorded insertion torque values. Catastrophic failures could be seen in five of the implants from two different batches at insertion torques ranging from 46.0 to 70.5 Ncm, while the remaining implants (all belonging to one batch) survived. Weibull probability of failure seems to be low at the manufacturer-recommended maximum insertion torque of 35 Ncm. Chipping fractures at the thread tips as well as tool marks were the only otherwise observed irregularities. While high insertion torques may be desirable for immediate loading protocols, zirconia implants may fracture when manufacturer-recommended insertion torques are exceeded. Evaluating bone quality prior to implant insertion may be useful.

Germ line transformation of the yellow fever mosquito, Aedes aegypti, mediated by transpositional insertion of a piggyBac vector.

Science.gov (United States)

Lobo, N F; Hua-Van, A; Li, X; Nolen, B M; Fraser, M J

2002-04-01

Mosquito-vectored diseases such as yellow fever and dengue fever continue to have a substantial impact on human populations world-wide. Novel strategies for control of these mosquito vectored diseases can arise through the development of reliable systems for genetic manipulation of the insect vector. A piggyBac vector marked with the Drosophila melanogaster cinnabar (cn) gene was used to transform the white-eyed khw strain of Aedes aegypti. Microinjection of preblastoderm embryos resulted in four families of cinnabar transformed insects. An overall transformation frequency of 4%, with a range of 0% to as high as 13% for individual experiments, was achieved when using a heat-shock induced transposase providing helper plasmid. Southern hybridizations indicated multiple insertion events in three of four transgenic lines, while the presence of duplicated target TTAA sites at either ends of individual insertions confirmed characteristic piggyBac transposition events in these three transgenic lines. The transgenic phenotype has remained stable for more than twenty generations. The transformations effected using the piggyBac element establish the potential of this element as a germ-line transformation vector for Aedine mosquitoes.

Correlation between extension-block K-wire insertion angle and postoperative extension loss in mallet finger fracture.

Science.gov (United States)

Lee, S K; Kim, Y H; Moon, K H; Choy, W S

2018-02-01

Extension-block pinning represents a simple and reliable surgical technique. Although this procedure is commonly performed successfully, some patients develop postoperative extension loss. To date, the relationship between extension-block Kirschner wire (K-wire) insertion angle and postoperative extension loss in mallet finger fracture remains unclear. We aimed to clarify this relationship and further evaluate how various operative and non-operative factors affect postoperative extension loss after extension-block pinning for mallet finger fracture. A retrospective study was conducted to investigate a relationship between extension block K-wire insertion angle and postoperative extension loss. The inclusion criteria were: (1) a dorsal intra-articular fracture fragment involving 30% of the base of the distal phalanx with or without volar subluxation of the distal phalanx; and (2) block K-wire insertion angle and fixation angle of the distal interphalangeal (DIP) joint were assessed using lateral radiograph at immediate postoperative time. Postoperative extension loss was assessed by using lateral radiograph at latest follow-up. Extension-block K-wire insertion angle was defined as the acute angle between extension block K-wire and longitudinal axis of middle phalangeal head. DIP joint fixation angle was defined as the acute angle between the distal phalanx and middle phalanx longitudinal axes. Seventy-five patients were included. The correlation analysis revealed that extension-block K-wire insertion angle had a negative correlation with postoperative extension loss, whereas fracture size and time to operation had a positive correlation (correlation coefficient for extension block K-wire angle: -0.66, facture size: +0.67, time to operation: +0.60). When stratifying patients in terms of negative and positive fixation angle of the DIP joint, the independent t-test showed that mean postoperative extension loss is -3.67° and +4.54° (DIP joint fixation angles of block

Analysis of Task Types and Error Types of the Human Actions Involved in the Human-related Unplanned Reactor Trip Events

International Nuclear Information System (INIS)

Kim, Jae Whan; Park, Jin Kyun; Jung, Won Dea

2008-02-01

This report provides the task types and error types involved in the unplanned reactor trip events that have occurred during 1986 - 2006. The events that were caused by the secondary system of the nuclear power plants amount to 67 %, and the remaining 33 % was by the primary system. The contribution of the activities of the plant personnel was identified as the following order: corrective maintenance (25.7 %), planned maintenance (22.8 %), planned operation (19.8 %), periodic preventive maintenance (14.9 %), response to a transient (9.9 %), and design/manufacturing/installation (9.9%). According to the analysis of error modes, the error modes such as control failure (22.2 %), wrong object (18.5 %), omission (14.8 %), wrong action (11.1 %), and inadequate (8.3 %) take up about 75 % of all the unplanned trip events. The analysis of the cognitive functions involved showed that the planning function makes the highest contribution to the human actions leading to unplanned reactor trips, and it is followed by the observation function (23.4%), the execution function (17.8 %), and the interpretation function (10.3 %). The results of this report are to be used as important bases for development of the error reduction measures or development of the error mode prediction system for the test and maintenance tasks in nuclear power plants

Analysis of Task Types and Error Types of the Human Actions Involved in the Human-related Unplanned Reactor Trip Events

Energy Technology Data Exchange (ETDEWEB)

Kim, Jae Whan; Park, Jin Kyun; Jung, Won Dea

2008-02-15

This report provides the task types and error types involved in the unplanned reactor trip events that have occurred during 1986 - 2006. The events that were caused by the secondary system of the nuclear power plants amount to 67 %, and the remaining 33 % was by the primary system. The contribution of the activities of the plant personnel was identified as the following order: corrective maintenance (25.7 %), planned maintenance (22.8 %), planned operation (19.8 %), periodic preventive maintenance (14.9 %), response to a transient (9.9 %), and design/manufacturing/installation (9.9%). According to the analysis of error modes, the error modes such as control failure (22.2 %), wrong object (18.5 %), omission (14.8 %), wrong action (11.1 %), and inadequate (8.3 %) take up about 75 % of all the unplanned trip events. The analysis of the cognitive functions involved showed that the planning function makes the highest contribution to the human actions leading to unplanned reactor trips, and it is followed by the observation function (23.4%), the execution function (17.8 %), and the interpretation function (10.3 %). The results of this report are to be used as important bases for development of the error reduction measures or development of the error mode prediction system for the test and maintenance tasks in nuclear power plants.

The impact of being involved in a medical adverse event on GP's (General Physicians) professional behavior in an ambulatory healthcare fund

NARCIS (Netherlands)

Manor, Orly

2017-01-01

Assurance behavior: performing unnecessary tests so as to deter patients from filing complaints or medical malpractice suits Avoidance behavior: choosing to behave in a way that prevents recurrence of an unpleasant stimulus This thesis examines the impact of involvement in a medical adverse event on

Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

Directory of Open Access Journals (Sweden)

Bingfu Guo

2016-07-01

Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

Verification of the numerical model of insert-type joint of scaffolding in relation to experimental research

Science.gov (United States)

Pieńko, Michał; Błazik-Borowa, Ewa

2018-01-01

This paper presents the problem of comparing the results of computer simulations with the results of laboratory tests. The subject of the study was the insert-type joint of scaffolding loaded with a bending moment. The research was carried out on the real elements of the scaffolding. Due to the complexity of the connection different friction coefficients and depths of wedge insertion were taken into account in the analysis. The aim of conducting the series of analyses was to determine the sensitivity of the model to the mentioned characteristics. Since laboratory tests were carried out on the real samples, there were no preparations of surface involved in the load transfer. This approach caused many problems with the clear definition of the nature of work of individual node elements during the load. The analysis consist of two stages: the stage in which the connection is defined (the wedge is inserted into the rosette), and the loading stage (the node is loaded by the bending moment).

SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

Science.gov (United States)

Singer, Maxine; Winocour, Ernest

2011-04-10

The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

Single photon image from PET with insertable collimator for boron neutron capture therapy

International Nuclear Information System (INIS)

Jung, Jooyoung; Suh, Tae Suk; Hong, Key Jo

2014-01-01

Boron neutron capture therapy (BNCT) is a radiation therapy technique for treating deep-seated brain tumors by irradiation with a thermal neutron in which boron-labelled low molecular weight compounds. Once completed, a single photon emission computed tomography (SPECT) scan is conducted to investigate for the region of therapy using an isotope exclusive to SPECT. In the case of an existing PET/SPECT combination system, at least two types of isotopes should be used for each scan with their purposes. Recently, researchers examined the effects of PET/SPECT dual modality on animal imaging systems. They reported that the PET/SPECT combination system was effective for simultaneous achievement of a single event and coincidence. The aim of our proposed system is to confirm the feasibility of extraction of two types of images from one PET module with an insertable collimator for brain tumor treatment during the BNCT. We attempted to acquire the PET and SPECT images simultaneously using only PET without an additional isotope. Single photon images were acquired using an insertable collimator on a PET detector

Identifying transposon insertions and their effects from RNA-sequencing data.

Science.gov (United States)

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The supermodule insertion tool of the CMS electromagnetic calorimeter and the first trial insertion of a supermodule.

CERN Multimedia

Maximilien Brice

2006-01-01

The first trial insertion of a complete Electromagnetic Calorimeter (ECAL) "supermodule" (1700 lead-tungstate crystals, with support structures, light detectors (avalanche photodiodes), readout electronics and cooling system) was performed on 1st March. This delicate operation - sliding a 2-tonne 3m-long object onto support rails (in real life these are attached to the barrel hadron calorimeter (HCAL)) - made use of a custom designed "squirrel cage". The rotatable squirrel cage allows the insertion of any supermodule into any of the 18 positions, including very fine (sub-mm) adjustments. The first supermodule will be inserted into the real HCAL later this month in preparation for the "magnet test and cosmic-ray challenge" (MTCC). In the first image the supermodule is in the centre and the alignment disks are highlighted by the flash.

Recurrence, submicroscopic complexity, and potential clinical relevance of copy gains detected by array CGH that are shown to be unbalanced insertions by FISH.

Science.gov (United States)

Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G

2011-04-01

Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.

LOFT voltage insertion calibaration program

International Nuclear Information System (INIS)

Tillitt, D.N.; Miyasaki, F.S.

1975-08-01

The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

Insertion compounds of transition-metal and uranium oxides

International Nuclear Information System (INIS)

Chippindale, A.M.; Dickens, P.G.; Powell, A.V.

1991-01-01

Several transition-metal and actinide oxides, in which the metal occurs in a high oxidation state, have open covalent structures and are capable of incorporating alkali and other electropositive metals under mild conditions to form insertion compounds A x MO n . These are solids which have several features in common: Over a range of compositions, A x MO n exists as one or more stable or metastable phases in which the structure of the parent oxide MO n is largely retained and the insertion element A is accommodated interstitially. Insertion is accompanied by a redox process A=A i . + e - M in which M is reduced and the electronic properties of the parent oxide change to those typical of a mixed-valence compound. The insertion process xA + MO n = A x MO n can be reversed, at least to some extent, by chemical or electrochemical reaction, with retention of structure (topotactic reaction). This review concentrates on methods of synthesis, characterisation, crystal structure and thermochemistry of these insertion compounds. It updates and extends previous work. (author)

Treatment of hilar cholangiocarcinoma with inserting biliary double stents

International Nuclear Information System (INIS)

Jia Guangzhi; Zhang Zidong; Wang Xuejing; Yin Hua; Li Jianming

2004-01-01

Objective: To investigate the inserting technique of biliary double stents in treating hilar cholangiocarcinoma. Methods: 6 patients with hilar cholangiocarcinoma (Bismuth IV) were treated by percutaneous transhepatic insertion of biliary stents. Double stents were inserted in each patient. Different inserting methods were adopted according to the branch angles formed by left and right hepatic ducts. Results: The jaundice of all patients alleviated or disappeared obviously after stent implantation. The average difference between post-and pre-operation in the serum total bilirubin level was (104 ± 29) μmol/L (P<0.01). Stent obstruction was found in 2 cases after 4 and 6 months respectively. Conclusion: Double stents implantation is effective for the treatment of hilar cholangiocarcinoma. Beware of the angulation between main hepatic duct and adopting different inserting methods. (authors)

The effect of increased CRA trip insertion times for TMI

International Nuclear Information System (INIS)

Irani, A.; Link, J.; Trikouos, N.

1996-01-01

In recent years, testing of control rod assembly (CRA) drop times at TMI has resulted in a few rods that have failed to meet the Technical Specification (TS) acceptance criteria of 1.66 seconds to 3/4 inserted. Crud deposition was determined to be the cause of the slow rod insertion times. Corrective actions included increasing lithium concentration and increasing the frequency and extent of exercising the control rod drive mechanisms. However, after one cycle of operation, it was determined that these measures were not fully successful in retarding the crud buildup. Consequently, the safety significance of rods potentially having a longer drop time than the TS limit was evaluated. The analyses in Chapter 14 of the TMI FSAR demonstrate the ability of the plant to mitigate the consequences of postulated accidents without undue hazard to the health and safety of the public. To determine the safety consequences of the longer rod drop times, a reanalysis of some limiting accidents had to be done using the RETRAN, RELAP5 and TRAC computer codes. The safety evaluation concluded that a 3.0 second rod drop time would be acceptable because all of the event acceptance criteria were met. A permanent resolution of the problem is the replacement of the existing thermal barriers with new open flow path thermal barriers. Thermal barriers on half the CRAs at TMI have been replaced to date

Spacecraft-to-Earth Communications for Juno and Mars Science Laboratory Critical Events

Science.gov (United States)

Soriano, Melissa; Finley, Susan; Jongeling, Andre; Fort, David; Goodhart, Charles; Rogstad, David; Navarro, Robert

2012-01-01

Deep Space communications typically utilize closed loop receivers and Binary Phase Shift Keying (BPSK) or Quadrature Phase Shift Keying (QPSK). Critical spacecraft events include orbit insertion and entry, descent, and landing.---Low gain antennas--> low signal -to-noise-ratio.---High dynamics such as parachute deployment or spin --> Doppler shift. During critical events, open loop receivers and Multiple Frequency Shift Keying (MFSK) used. Entry, Descent, Landing (EDL) Data Analysis (EDA) system detects tones in real-time.

A new specifically designed forceps for chest drain insertion.

LENUS (Irish Health Repository)

Andrews, Emmet

2012-02-03

Insertion of a chest drain can be associated with serious complications. It is recommended that the drain is inserted with blunt dissection through the chest wall but there is no specific instrument to aid this task. We describe a new reusable forceps that has been designed specifically to facilitate the insertion of chest drains.A feasibility study of its use in patients who required a chest drain as part of elective cardiothoracic operations was undertaken. The primary end-point was successful and accurate placement of the drain. The operators also completed a questionnaire rating defined aspects of the procedure. The new instrument was used to insert the chest drain in 30 patients (19 male, 11 female; median age 61.5 years (range 16-81 years)). The drain was inserted successfully without the trocar in all cases and there were no complications. Use of the instrument rated as significantly easier relative to experience of previous techniques in all specified aspects. The new device can be used to insert intercostal chest drains safely and efficiently without using the trocar or any other instrument.

Methanol Formation via Oxygen Insertion Chemistry in Ices

Science.gov (United States)

Bergner, Jennifer B.; Öberg, Karin I.; Rajappan, Mahesh

2017-08-01

We present experimental constraints on the insertion of oxygen atoms into methane to form methanol in astrophysical ice analogs. In gas-phase and theoretical studies this process has previously been demonstrated to have a very low or nonexistent energy barrier, but the energetics and mechanisms have not yet been characterized in the solid state. We use a deuterium UV lamp filtered by a sapphire window to selectively dissociate O2 within a mixture of O2:CH4 and observe efficient production of CH3OH via O(1D) insertion. CH3OH growth curves are fit with a kinetic model, and we observe no temperature dependence of the reaction rate constant at temperatures below the oxygen desorption temperature of 25 K. Through an analysis of side products we determine the branching ratio of ice-phase oxygen insertion into CH4: ˜65% of insertions lead to CH3OH, with the remainder leading instead to H2CO formation. There is no evidence for CH3 or OH radical formation, indicating that the fragmentation is not an important channel and that insertions typically lead to increased chemical complexity. CH3OH formation from O2 and CH4 diluted in a CO-dominated ice similarly shows no temperature dependence, consistent with expectations that insertion proceeds with a small or nonexistent barrier. Oxygen insertion chemistry in ices should therefore be efficient under low-temperature ISM-like conditions and could provide an important channel to complex organic molecule formation on grain surfaces in cold interstellar regions such as cloud cores and protoplanetary disk midplanes.

Methanol Formation via Oxygen Insertion Chemistry in Ices

Energy Technology Data Exchange (ETDEWEB)

Bergner, Jennifer B. [Harvard University Department of Chemistry and Chemical Biology, 10 Oxford Street, Cambridge, MA 02138 (United States); Öberg, Karin I.; Rajappan, Mahesh [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

2017-08-10

We present experimental constraints on the insertion of oxygen atoms into methane to form methanol in astrophysical ice analogs. In gas-phase and theoretical studies this process has previously been demonstrated to have a very low or nonexistent energy barrier, but the energetics and mechanisms have not yet been characterized in the solid state. We use a deuterium UV lamp filtered by a sapphire window to selectively dissociate O{sub 2} within a mixture of O{sub 2}:CH{sub 4} and observe efficient production of CH{sub 3}OH via O({sup 1}D) insertion. CH{sub 3}OH growth curves are fit with a kinetic model, and we observe no temperature dependence of the reaction rate constant at temperatures below the oxygen desorption temperature of 25 K. Through an analysis of side products we determine the branching ratio of ice-phase oxygen insertion into CH{sub 4}: ∼65% of insertions lead to CH{sub 3}OH, with the remainder leading instead to H{sub 2}CO formation. There is no evidence for CH{sub 3} or OH radical formation, indicating that the fragmentation is not an important channel and that insertions typically lead to increased chemical complexity. CH{sub 3}OH formation from O{sub 2} and CH{sub 4} diluted in a CO-dominated ice similarly shows no temperature dependence, consistent with expectations that insertion proceeds with a small or nonexistent barrier. Oxygen insertion chemistry in ices should therefore be efficient under low-temperature ISM-like conditions and could provide an important channel to complex organic molecule formation on grain surfaces in cold interstellar regions such as cloud cores and protoplanetary disk midplanes.

Test manufacturing of copper canisters with cast inserts. Assessment report

Energy Technology Data Exchange (ETDEWEB)

Andersson, C.G

1998-08-01

The current design of canisters for the deep repository for spent nuclear fuel consists of an outer corrosion-protective copper casing in the form of a tubular section with lid and bottom and an inner pressure-resistant insert. The insert is designed to be manufactured by casting and inside are channels in which the fuel assemblies are to be placed. Over the last years, a number of full-scale manufacturing tests of all canister components have been carried out. The purpose has been to determine and develop the best manufacturing technique and to establish long-term contacts with the best suppliers of material and technology. Part of the work has involved the developing and implementing of a quality assurance system in accordance with ISO 9001, covering the whole chain from suppliers of material up to and including the delivery of assembled canisters. This report consists of a description of the design of the canister together with current drawings and complementary technical specifications stipulating, among other things, requirements placed on different materials. The different manufacturing methods that have been used are also described and commented on in both text and illustrations. For the manufacturing of copper tubes, the roll-forming of rolled plate to tube halves and longitudinal welding is a method that has been tested on a relatively large number of tubes by now, and that probably can be developed into a functioning production method. However, the very promising outcome of performed tests on seamless tube manufacturing, has resulted in a change in direction in tube manufacturing, focusing on continued testing of extrusion as well as pierce and draw processing in the immediate future. In connection with ongoing operations, new manufacturing tests of tubes with less material thickness will be carried out. Test manufacturing of cast inserts has resulted in the choice of nodular iron as material in the continued work. This improvement in design has resulted

Test manufacturing of copper canisters with cast inserts. Assessment report

International Nuclear Information System (INIS)

Andersson, C.G.

1998-08-01

The current design of canisters for the deep repository for spent nuclear fuel consists of an outer corrosion-protective copper casing in the form of a tubular section with lid and bottom and an inner pressure-resistant insert. The insert is designed to be manufactured by casting and inside are channels in which the fuel assemblies are to be placed. Over the last years, a number of full-scale manufacturing tests of all canister components have been carried out. The purpose has been to determine and develop the best manufacturing technique and to establish long-term contacts with the best suppliers of material and technology. Part of the work has involved the developing and implementing of a quality assurance system in accordance with ISO 9001, covering the whole chain from suppliers of material up to and including the delivery of assembled canisters. This report consists of a description of the design of the canister together with current drawings and complementary technical specifications stipulating, among other things, requirements placed on different materials. The different manufacturing methods that have been used are also described and commented on in both text and illustrations. For the manufacturing of copper tubes, the roll-forming of rolled plate to tube halves and longitudinal welding is a method that has been tested on a relatively large number of tubes by now, and that probably can be developed into a functioning production method. However, the very promising outcome of performed tests on seamless tube manufacturing, has resulted in a change in direction in tube manufacturing, focusing on continued testing of extrusion as well as pierce and draw processing in the immediate future. In connection with ongoing operations, new manufacturing tests of tubes with less material thickness will be carried out. Test manufacturing of cast inserts has resulted in the choice of nodular iron as material in the continued work. This improvement in design has resulted

Lithium Insertion In Silicon Nanowires: An ab Initio Study

KAUST Repository

Zhang, Qianfan

2010-09-08

The ultrahigh specific lithium ion storage capacity of Si nanowires (SiNWs) has been demonstrated recently and has opened up exciting opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains a challenge, and as a result, understanding of the fundamental interaction and microscopic dynamics during lithium insertion is still lacking. This paper focuses on the study of single Li atom insertion into SiNWs with different sizes and axis orientations by using full ab initio calculations. We show that the binding energy of interstitial Li increases as the SiNW diameter grows. The binding energies at different insertion sites, which can be classified as surface, intermediate, and core sites, are quite different. We find that surface sites are energetically the most favorable insertion positions and that intermediate sites are the most unfavorable insertion positions. Compared with the other growth directions, the [110] SiNWs with different diameters always present the highest binding energies on various insertion locations, which indicates that [110] SiNWs are more favorable by Li doping. Furthermore, we study Li diffusion inside SiNWs. The results show that the Li surface diffusion has a much higher chance to occur than the surface to core diffusion, which is consistent with the experimental observation that the Li insertion in SiNWs is layer by layer from surface to inner region. After overcoming a large barrier crossing surface-to-intermediate region, the diffusion toward center has a higher possibility to occur than the inverse process. © 2010 American Chemical Society.

A role for hedgehog signaling in the differentiation of the insertion site of the patellar tendon in the mouse.

Directory of Open Access Journals (Sweden)

Chia-Feng Liu

Full Text Available Tendons are typically composed of two histologically different regions: the midsubstance and insertion site. We previously showed that Gli1, a downstream effector of the hedgehog (Hh signaling pathway, is expressed only in the insertion site of the mouse patellar tendon during its differentiation. To test for a functional role of Hh signaling, we targeted the Smoothened (Smo gene in vivo using a Cre/Lox system. Constitutive activation of the Hh pathway in the mid-substance caused molecular markers of the insertion site, e.g. type II collagen, to be ectopically expressed or up-regulated in the midsubstance. This was confirmed using a novel organ culture method in vitro. Conversely, when Smo was excised in the scleraxis-positive cell population, the development of the fibrocartilaginous insertion site was affected. Whole transcriptome analysis revealed that the expression of genes involved in chondrogenesis and mineralization was down-regulated in the insertion site, and expression of insertion site markers was decreased. Biomechanical testing of murine adult patellar tendon, which developed in the absence of Hh signaling, showed impairment of tendon structural properties (lower linear stiffness and greater displacement and material properties (greater strain, although the linear modulus of the mutant group was not significantly lower than controls. These studies provide new insights into the role of Hh signaling during tendon development.

Insertion in Persian

Science.gov (United States)

Kambuziya, Aliyeh Kord-e Zafaranlu; Dehghan, Masoud

2011-01-01

This paper investigates epenthesis process in Persian to catch some results in relating to vowel and consonant insertion in Persian lexicon. This survey has a close relationship to the description of epenthetic consonants and the conditions in which these consonants are used. Since no word in Persian may begin with a vowel, so that hiatus can't be…

Evaluating the patient experience after implantation of a 0.4 mg sustained release dexamethasone intracanalicular insert (Dextenza™): results of a qualitative survey.

Science.gov (United States)

Gira, Joseph P; Sampson, Reginald; Silverstein, Steven M; Walters, Thomas R; Metzinger, Jamie Lynne; Talamo, Jonathan H

2017-01-01

The purpose of this study is to evaluate the patient experience of sustained release dexamethasone intracanalicular insert (Dextenza™) following cataract surgery as part of a Phase III clinical trial program. This cross-sectional, qualitative evaluation involved individual interviews lasting approximately 45 minutes. Patients from four US investigational study sites who had previously received an insert were enrolled. There were no predesignated end points; this was a qualitative survey seeking a deeper understanding of patient experience. Twenty-five patients were interviewed. Most patients (92%) reported the highest level of satisfaction grade with regard to overall product satisfaction. All patients described the insert as comfortable. Most patients (96%) described their overall experience with the insert as very convenient or extremely convenient. Twenty-two of 23 (96%) participants rated their experience with the insert as "very" or "extremely convenient", compared to previous topical therapy, and 88% of patients stated that if they were to undergo cataract surgery again, they would request the insert. When asked if they would recommend the insert to family members or friends, 92% stated they would. The survey found that 84% of participants would be willing to pay more for the insert than for eye drop therapy. The dexamethasone insert was found by patients to be highly favorable with regard to overall satisfaction, convenience, and comfort. The insert was well received and largely preferred over topical therapy alternatives following surgery. More extensive evaluation of the patient experience is warranted, and future studies should help inform design of the next generation of sustained release drug delivery systems.

A novel and facile decay path of Criegee intermediates by intramolecular insertion reactions via roaming transition states

International Nuclear Information System (INIS)

Nguyen, Trong-Nghia; Putikam, Raghunath; Lin, M. C.

2015-01-01

We have discovered a new and highly competitive product channel in the unimolecular decay process for small Criegee intermediates, CH 2 OO and anti/syn-CH 3 C(H)OO, occurring by intramolecular insertion reactions via a roaming-like transition state (TS) based on quantum-chemical calculations. Our results show that in the decomposition of CH 2 OO and anti-CH 3 C(H)OO, the predominant paths directly produce cis-HC(O)OH and syn-CH 3 C(O)OH acids with >110 kcal/mol exothermicities via loose roaming-like insertion TSs involving the terminal O atom and the neighboring C–H bonds. For syn-CH 3 C(H)OO, the major decomposition channel occurs by abstraction of a H atom from the CH 3 group by the terminal O atom producing CH 2 C(H)O–OH. At 298 K, the intramolecular insertion process in CH 2 OO was found to be 600 times faster than the commonly assumed ring-closing reaction

Prospects of zero Schottky barrier height in a graphene-inserted MoS2-metal interface

Science.gov (United States)

Chanana, Anuja; Mahapatra, Santanu

2016-01-01

A low Schottky barrier height (SBH) at source/drain contact is essential for achieving high drive current in atomic layer MoS2-channel-based field effect transistors. Approaches such as choosing metals with appropriate work functions and chemical doping are employed previously to improve the carrier injection from the contact electrodes to the channel and to mitigate the SBH between the MoS2 and metal. Recent experiments demonstrate significant SBH reduction when graphene layer is inserted between metal slab (Ti and Ni) and MoS2. However, the physical or chemical origin of this phenomenon is not yet clearly understood. In this work, density functional theory simulations are performed, employing pseudopotentials with very high basis sets to get insights of the charge transfer between metal and monolayer MoS2 through the inserted graphene layer. Our atomistic simulations on 16 different interfaces involving five different metals (Ti, Ag, Ru, Au, and Pt) reveal that (i) such a decrease in SBH is not consistent among various metals, rather an increase in SBH is observed in case of Au and Pt; (ii) unlike MoS2-metal interface, the projected dispersion of MoS2 remains preserved in any MoS2-graphene-metal system with shift in the bands on the energy axis. (iii) A proper choice of metal (e.g., Ru) may exhibit ohmic nature in a graphene-inserted MoS2-metal contact. These understandings would provide a direction in developing high-performance transistors involving heteroatomic layers as contact electrodes.

Emergency communication and information issues in terrorist events involving radioactive materials.

Science.gov (United States)

Becker, Steven M

2004-01-01

With the threat posed by terrorism involving radioactive materials now high on the nation's agenda, local, state, and federal agencies are moving to enhance preparedness and response capabilities. Crucial to these efforts is the development of effective risk communication strategies. This article reports findings from an ongoing study of risk communication issues in nuclear/radiological terrorism situations. It is part of a larger CDC-funded effort that aims to better understand communication challenges associated with weapons of mass destruction terrorism incidents. Presented here are formative research findings from 16 focus groups (n = 163) in which a multi-part, hypothetical radioactive materials terrorism situation was discussed. Twelve of the focus groups were carried out with members of the general public (drawn from a variety of ethnic backgrounds and geographic locations), and four groups were composed of first responders, hospital emergency department personnel, and public health professionals. One aim of the focus groups was to elicit detailed information on people's knowledge, views, perceptions, reactions, and concerns related to a nuclear/radiological terrorism event, and to better understand people's specific information needs and preferred information sources. A second aim was to pretest draft informational materials prepared by CDC and NIOSH. Key findings for the public and professional groups are presented, and the implications of the research for developing messages in radiological/nuclear terrorism situations are explored.

Insert Design and Manufacturing for Foam-Core Composite Sandwich Structures

Science.gov (United States)

Lares, Alan

Sandwich structures have been used in the aerospace industry for many years. The high strength to weight ratios that are possible with sandwich constructions makes them desirable for airframe applications. While sandwich structures are effective at handling distributed loads such as aerodynamic forces, they are prone to damage from concentrated loads at joints or due to impact. This is due to the relatively thin face-sheets and soft core materials typically found in sandwich structures. Carleton University's Uninhabited Aerial Vehicle (UAV) Project Team has designed and manufactured a UAV (GeoSury II Prototype) which features an all composite sandwich structure fuselage structure. The purpose of the aircraft is to conduct geomagnetic surveys. The GeoSury II Prototype serves as the test bed for many areas of research in advancing UAV technologies. Those areas of research include: low cost composite materials manufacturing, geomagnetic data acquisition, obstacle detection, autonomous operations and magnetic signature control. In this thesis work a methodology for designing and manufacturing inserts for foam-core sandwich structures was developed. The results of this research work enables a designer wishing to design a foam-core sandwich airframe structure, a means of quickly manufacturing optimized inserts for the safe introduction of discrete loads into the airframe. The previous GeoSury II Prototype insert designs (v.1 & v.2) were performance tested to establish a benchmark with which to compare future insert designs. Several designs and materials were considered for the new v.3 inserts. A plug and sleeve design was selected, due to its ability to effectively transfer the required loads to the sandwich structure. The insert material was chosen to be epoxy, reinforced with chopped carbon fibre. This material was chosen for its combination of strength, low mass and also compatibility with the face-sheet material. The v.3 insert assembly is 60% lighter than the

Somatically Acquired LINE-1 Insertions in Normal Esophagus Undergo Clonal Expansion in Esophageal Squamous Cell Carcinoma.

Science.gov (United States)

Doucet-O'Hare, Tara T; Sharma, Reema; Rodić, Nemanja; Anders, Robert A; Burns, Kathleen H; Kazazian, Haig H

2016-09-01

Squamous cell carcinoma of the esophagus (SCC) is the most common form of esophageal cancer in the world and is typically diagnosed at an advanced stage when successful treatment is challenging. Understanding the mutational profile of this cancer may identify new treatment strategies. Because somatic retrotransposition has been shown in tumors of the gastrointestinal system, we focused on LINE-1 (L1) mobilization as a source of genetic instability in this cancer. We hypothesized that retrotransposition is ongoing in SCC patients. The expression of L1 encoded proteins is necessary for retrotransposition to occur; therefore, we evaluated the expression of L1 open reading frame 1 protein (ORF1p). Using immunohistochemistry, we detected ORF1p expression in all four SCC cases evaluated. Using L1-seq, we identified and validated 74 somatic insertions in eight tumors of the nine evaluated. Of these, 12 insertions appeared to be somatic, not genetically inherited, and sub-clonal (i.e., present in less than one copy per genome equivalent) in the adjacent normal esophagus (NE), while clonal in the tumor. Our results indicate that L1 retrotransposition is active in SCC of the esophagus and that insertion events are present in histologically NE that expands clonally in the subsequent tumor. © 2016 WILEY PERIODICALS, INC.

Incidence of thrombosis in children with tunneled central venous access devices versus peripherally inserted central catheters (PICCs).

Science.gov (United States)

Kanin, Maralee; Young, Guy

2013-11-01

The recent proliferation of deep vein thrombosis in children has been attributed to the increased use of central venous catheters, specifically tunneled lines and peripherally inserted central catheters. A formal comparison of the incidence rate for deep vein thrombosis between tunneled lines and peripherally inserted central catheters has not been undertaken. Children inclusion. Data were extracted from the hospital discharge database which includes data on all procedures and up to 20 diagnoses per admission. Diagnoses and procedures were identified by International Classification of Disease, Ninth Revision coding. Patients were excluded if they received more than one central line. Data collected included type of central line, deep vein thrombosis event, and underlying medical illnesses classified according to chronic complex conditions. Over the seven year study period there was an overall rate of 73 deep vein thromboses per 10,000 hospital discharges. Of the 6915 eligible subjects, 181 had a deep vein thrombosis for an overall incidence rate of 2.6%. There were 152 thrombi (2.6%) in subjects with peripherally inserted central catheters and 29 thrombi (3.1%) in subjects with tunneled lines [OR=.83 (0.55, 1.29), p=0.38]. Despite the relative ease and simplicity of use of peripherally inserted central catheters leading to a substantial rise in their use, this study demonstrates that such lines pose a substantial risk for venous thrombosis and no difference in incidence was detected between such lines and tunneled lines. © 2013.

Patterns of transposable element expression and insertion in cancer

Directory of Open Access Journals (Sweden)

Evan A Clayton

2016-11-01

Full Text Available Human transposable element (TE activity in somatic tissues causes mutations that can contribute to tumorigenesis. Indeed, TE insertion mutations have been implicated in the etiology of a number of different cancer types. Nevertheless, the full extent of somatic TE activity, along with its relationship to tumorigenesis, have yet to be fully explored. Recent developments in bioinformatics software make it possible to analyze TE expression levels and TE insertional activity directly from transcriptome (RNA-seq and whole genome (DNA-seq next-generation sequence data. We applied these new sequence analysis techniques to matched normal and primary tumor patient samples from the Cancer Genome Atlas (TCGA in order to analyze the patterns of TE expression and insertion for three cancer types: breast invasive carcinoma, head and neck squamous cell carcinoma, and lung adenocarcinoma. Our analysis focused on the three most abundant families of active human TEs: Alu, SVA and L1. We found evidence for high levels of somatic TE activity for these three families in normal and cancer samples across diverse tissue types. Abundant transcripts for all three TE families were detected in both normal and cancer tissues along with an average of ~80 unique TE insertions per individual patient/tissue. We observed an increase in L1 transcript expression and L1 insertional activity in primary tumor samples for all three cancer types. Tumor-specific TE insertions are enriched for private mutations, consistent with a potentially causal role in tumorigenesis. We used genome feature analysis to investigate two specific cases of putative cancer-causing TE mutations in further detail. An Alu insertion in an upstream enhancer of the CBL tumor suppressor gene is associated with down-regulation of the gene in a single breast cancer patient, and an L1 insertion in the first exon of the BAALC gene also disrupts its expression in head and neck squamous cell carcinoma. Our results are

E2LEMI:Energy-Efficient Logic Encryption Using Multiplexer Insertion

Directory of Open Access Journals (Sweden)

Qutaiba Alasad

2017-02-01

Full Text Available Due to the outsourcing of chip manufacturing, countermeasures against Integrated Circuit (IC piracy, reverse engineering, IC overbuilding and hardware Trojans (HTs become a hot research topic. To protect an IC from these attacks, logic encryption techniques have been considered as a low-cost defense mechanism. In this paper, our proposal is to insert the multiplexer (MUX with two cases: (i we randomly insert MUXs equal to half of the output bit number (half MUX insertions; and (ii we insert MUXs equal to the number of output bits (full MUX insertions. Hamming distance is adopted as a security evaluation. We also measure the delay, power and area overheads with the proposed technique.

Nature of unstable insertional mutations and reversions at the cut locus of Drosophila melanogaster: Molecular mechanism for transpositional memory

International Nuclear Information System (INIS)

Mizrokhi, L.Yu.; Georgieva, S.G.; Obolenkova, L.A.; Priimyagi, A.F.; Gerasimova, T.I.; Il'in, Yu.V.

1988-01-01

A segment of the cut locus containing an mdg4 insertion as a result of ct MR and ct MRp10 mutations was cloned. Clones were obtained for the phenotypically different ct MR2 and ct MRpN10 mutants and for stable and unstable revertants. All mutations studied are associated with mdg4 insertion at an identical nucleotide sequence of the cut locus, the same site at which mdg4 is inserted at the ct 6 allele. The ct MRpN line differs from ct MR2 in that the mobile element jockey (3 kbp) is inserted in mdg4. Jockey is represented by about 1,000 copies per genome; it is homogeneous and lacks long terminal repeats (LTRs). In stable ct + reversions, mdg4 is completely excised. In unstable ct + reversions, in which there is a high degree of reverse directed transposition of mdg4 to the cut locus, an LTR of mdg4 is preserved at the site of the mutation. It is a sequence along which new copies of mdg4 or jockey-containing mdg4 are inserted into the genome. The authors discuss a molecular mechanism for transpositional memory involving homologous recombination of the remnant LTR and circular extrachromosomal copies of mdg4

Radiological Tenckhoff catheter insertion for peritoneal dialysis: A cost-effective approach.

Science.gov (United States)

Lee, James; Mott, Nigel; Mahmood, Usman; Clouston, John; Summers, Kara; Nicholas, Pauline; Gois, Pedro Henrique França; Ranganathan, Dwarakanathan

2018-04-01

Radiological insertion of Tenckhoff catheters can be an alternative option for peritoneal dialysis access creation, as compared to surgical catheter insertion. This study will review the outcomes and complications of radiological Tenckhoff catheter insertion in a metropolitan renal service and compare costs between surgical and radiological insertion. Data were collected prospectively for all patients who had a Tenckhoff catheter insertion for peritoneal dialysis (PD) under radiological guidance at our hospital from May 2014 to November 2016. The type of catheter used and complications, including peri-catheter leak, exit site infection and peritonitis were reviewed. Follow-up data were also collected at points 3, 6 and 12 months from catheter insertion. Costing data were obtained from Queensland Health Electronic Reporting System (QHERS) data, average staff salaries and consumable contract price lists. In the 30-month evaluation period, 70 catheters were inserted. Two patients had an unsuccessful procedure due to the presence of abdominal adhesions. Seven patients had an episode of peri-catheter leak, and four patients had an exit site infection following catheter insertion. Peritonitis was observed in nine patients during the study period. The majority of patients (90%) remained on peritoneal dialysis at 3-month follow-up. The average costs of surgical and radiological insertion were noted to be AUD$7788.34 and AUD$1597.35, respectively. Radiological Tenckhoff catheter insertion for peritoneal dialysis appears to be an attractive and cost-effective option given less waiting periods for the procedure, the relatively low cost of insertion and comparable rates of complications. © 2017 The Royal Australian and New Zealand College of Radiologists.

The Composite Insertion Electrode

DEFF Research Database (Denmark)

Atlung, Sven; Zachau-Christiansen, Birgit; West, Keld

1984-01-01

The specific energy obtainable by discharge of porous insertion electrodes is limited by electrolyte depletion in thepores. This can be overcome using a solid ion conductor as electrolyte. The term "composite" is used to distinguishthese electrodes from porous electrodes with liquid electrolyte...

Additive Manufacturing for Highly Efficient Window Inserts CRADA Report

Energy Technology Data Exchange (ETDEWEB)

Roschli, Alex C. [ORNL; Chesser, Phillip C. [ORNL; Love, Lonnie J. [ORNL

2018-04-01

ORNL partnered with the Mackinac Technology Company to demonstrate how additive manufacturing can be used to create highly energy efficient window inserts for retrofit in pre-existing buildings. Many early iterations of the window inserts were fabricated using carbon fiber reinforced thermoplastics and polycarbonate films as a stand in for the low-e coated films produced by the Mackinac Technology Company. After demonstration of the proof of concept, i.e. custom window inserts with tensioned film, the materials used for the manufacture of the frames was more closely examined. Hollow particle-filled syntactic foam and low-density polymer composites formed by expandable microspheres were explored as the materials used to additively manufacture the frames of the inserts. It was concluded that low-cost retrofit window inserts in custom sizes could be easily fabricated using large scale additive manufacturing. Furthermore, the syntactic and expanded foams developed and tested satisfy the mechanical performance requirements for the application.

Effects of organizational safety practices and perceived safety climate on PPE usage, engineering controls, and adverse events involving liquid antineoplastic drugs among nurses.

Science.gov (United States)

DeJoy, David M; Smith, Todd D; Woldu, Henok; Dyal, Mari-Amanda; Steege, Andrea L; Boiano, James M

2017-07-01

Antineoplastic drugs pose risks to the healthcare workers who handle them. This fact notwithstanding, adherence to safe handling guidelines remains inconsistent and often poor. This study examined the effects of pertinent organizational safety practices and perceived safety climate on the use of personal protective equipment, engineering controls, and adverse events (spill/leak or skin contact) involving liquid antineoplastic drugs. Data for this study came from the 2011 National Institute for Occupational Safety and Health (NIOSH) Health and Safety Practices Survey of Healthcare Workers which included a sample of approximately 1,800 nurses who had administered liquid antineoplastic drugs during the past seven days. Regression modeling was used to examine predictors of personal protective equipment use, engineering controls, and adverse events involving antineoplastic drugs. Approximately 14% of nurses reported experiencing an adverse event while administering antineoplastic drugs during the previous week. Usage of recommended engineering controls and personal protective equipment was quite variable. Usage of both was better in non-profit and government settings, when workers were more familiar with safe handling guidelines, and when perceived management commitment to safety was higher. Usage was poorer in the absence of specific safety handling procedures. The odds of adverse events increased with number of antineoplastic drugs treatments and when antineoplastic drugs were administered more days of the week. The odds of such events were significantly lower when the use of engineering controls and personal protective equipment was greater and when more precautionary measures were in place. Greater levels of management commitment to safety and perceived risk were also related to lower odds of adverse events. These results point to the value of implementing a comprehensive health and safety program that utilizes available hazard controls and effectively communicates

OAE: The Ontology of Adverse Events.

Science.gov (United States)

He, Yongqun; Sarntivijai, Sirarat; Lin, Yu; Xiang, Zuoshuang; Guo, Abra; Zhang, Shelley; Jagannathan, Desikan; Toldo, Luca; Tao, Cui; Smith, Barry

2014-01-01

A medical intervention is a medical procedure or application intended to relieve or prevent illness or injury. Examples of medical interventions include vaccination and drug administration. After a medical intervention, adverse events (AEs) may occur which lie outside the intended consequences of the intervention. The representation and analysis of AEs are critical to the improvement of public health. The Ontology of Adverse Events (OAE), previously named Adverse Event Ontology (AEO), is a community-driven ontology developed to standardize and integrate data relating to AEs arising subsequent to medical interventions, as well as to support computer-assisted reasoning. OAE has over 3,000 terms with unique identifiers, including terms imported from existing ontologies and more than 1,800 OAE-specific terms. In OAE, the term 'adverse event' denotes a pathological bodily process in a patient that occurs after a medical intervention. Causal adverse events are defined by OAE as those events that are causal consequences of a medical intervention. OAE represents various adverse events based on patient anatomic regions and clinical outcomes, including symptoms, signs, and abnormal processes. OAE has been used in the analysis of several different sorts of vaccine and drug adverse event data. For example, using the data extracted from the Vaccine Adverse Event Reporting System (VAERS), OAE was used to analyse vaccine adverse events associated with the administrations of different types of influenza vaccines. OAE has also been used to represent and classify the vaccine adverse events cited in package inserts of FDA-licensed human vaccines in the USA. OAE is a biomedical ontology that logically defines and classifies various adverse events occurring after medical interventions. OAE has successfully been applied in several adverse event studies. The OAE ontological framework provides a platform for systematic representation and analysis of adverse events and of the factors (e

[Effects of message and personal involvement on risk perception and acceptance].

Science.gov (United States)

Masuchi, A; Takigawa, T

1999-10-01

The present study analyzed people's risk perception regarding driving a car with studded or non-studded winter tires. Subjects were 252 residents of Sapporo, where a recent municipal ordinance prohibited studded tires, allowing only non-studded ones. Questionnaire data were examined concerning (1) the relationship between risk perception and its acceptance, (2) the effect of an inserted message, which was either positive or negative about the use of non-studded tires, and (3) the role of personal involvement, assessed with Personal Involvement Inventory (Zaichkowsky, 1985), regarding winter driving. Results were as follows: (1) The use of non-studded tires was favorably judged because of social benefit, but subjects hesitated to choose them because of a higher perceived possibility of an accident. (2) The inserted message had significant effects on benefit evaluation and perceived accident possibility. The effects were weaker for drivers who had experienced driving a car with studded tires. And (3) personal involvement had a weak correlation with risk judgements of the present study.

Safety and Effectiveness of Percutaneously Inserted Peritoneal Ports Compared to Surgically Inserted Ports in a Retrospective Study of 87 Patients with Ovarian Carcinoma over a 10-Year Period

International Nuclear Information System (INIS)

Woodley-Cook, Joel; Tarulli, Emidio; Tan, Kong T.; Rajan, Dheeraj K.; Simons, Martin E.

2016-01-01

PurposePlacement of peritoneal ports has become a favorable technique for direct chemotherapy infusion in treating peritoneal metastases from ovarian cancer. We aim to outline an approach to the percutaneous insertion of peritoneal ports and to characterize success and complication rates compared to surgically inserted ports.Materials and MethodsRetrospective analysis was collected from 87 patients who had peritoneal port insertion (28 inserted surgically and 59 percutaneously) for treatment of peritoneal metastases from ovarian cancer from July 2004 to July 2014. Complications were classified according to the SIR Clinical Practice Guidelines as major or minor.ResultsTechnical success rates for surgically and percutaneously inserted ports were 100 and 96.7 %, respectively (p = 0.44), with the two percutaneous failures successful at a later date. There were no major complications in either group. Minor complication rates for surgically versus percutaneously inserted ports were 46.4 versus 22.0 %, respectively (p = 0.02). The infection rate for surgically inserted versus percutaneously inserted ports was 14.3 and 0 %, respectively (p = 0.002). The relative risk of developing a complication from percutaneous peritoneal port insertion without ascites was 3.4 (p = 0.04). For percutaneously inserted ports, the mean in-room procedure time was 81 ± 1.3 min and mean fluoroscopy time was 5.0 ± 4.5 min.ConclusionPercutaneously inserted peritoneal ports are a safe alternative to surgically inserted ports, demonstrating similar technical success and lower complication rates.

Safety and Effectiveness of Percutaneously Inserted Peritoneal Ports Compared to Surgically Inserted Ports in a Retrospective Study of 87 Patients with Ovarian Carcinoma over a 10-Year Period

Energy Technology Data Exchange (ETDEWEB)

Woodley-Cook, Joel, E-mail: jwoodleycook@gmail.com [The Scarborough Hospital, Vascular and Interventional Radiology, Department of Diagnostic Imaging (Canada); Tarulli, Emidio; Tan, Kong T.; Rajan, Dheeraj K.; Simons, Martin E. [University of Toronto, Vascular and Interventional Radiology, Department of Medical Imaging, University Health Network (Canada)

2016-11-15

PurposePlacement of peritoneal ports has become a favorable technique for direct chemotherapy infusion in treating peritoneal metastases from ovarian cancer. We aim to outline an approach to the percutaneous insertion of peritoneal ports and to characterize success and complication rates compared to surgically inserted ports.Materials and MethodsRetrospective analysis was collected from 87 patients who had peritoneal port insertion (28 inserted surgically and 59 percutaneously) for treatment of peritoneal metastases from ovarian cancer from July 2004 to July 2014. Complications were classified according to the SIR Clinical Practice Guidelines as major or minor.ResultsTechnical success rates for surgically and percutaneously inserted ports were 100 and 96.7 %, respectively (p = 0.44), with the two percutaneous failures successful at a later date. There were no major complications in either group. Minor complication rates for surgically versus percutaneously inserted ports were 46.4 versus 22.0 %, respectively (p = 0.02). The infection rate for surgically inserted versus percutaneously inserted ports was 14.3 and 0 %, respectively (p = 0.002). The relative risk of developing a complication from percutaneous peritoneal port insertion without ascites was 3.4 (p = 0.04). For percutaneously inserted ports, the mean in-room procedure time was 81 ± 1.3 min and mean fluoroscopy time was 5.0 ± 4.5 min.ConclusionPercutaneously inserted peritoneal ports are a safe alternative to surgically inserted ports, demonstrating similar technical success and lower complication rates.

Ulysses: accurate detection of low-frequency structural variations in large insert-size sequencing libraries.

Science.gov (United States)

Gillet-Markowska, Alexandre; Richard, Hugues; Fischer, Gilles; Lafontaine, Ingrid

2015-03-15

The detection of structural variations (SVs) in short-range Paired-End (PE) libraries remains challenging because SV breakpoints can involve large dispersed repeated sequences, or carry inherent complexity, hardly resolvable with classical PE sequencing data. In contrast, large insert-size sequencing libraries (Mate-Pair libraries) provide higher physical coverage of the genome and give access to repeat-containing regions. They can thus theoretically overcome previous limitations as they are becoming routinely accessible. Nevertheless, broad insert size distributions and high rates of chimerical sequences are usually associated to this type of libraries, which makes the accurate annotation of SV challenging. Here, we present Ulysses, a tool that achieves drastically higher detection accuracy than existing tools, both on simulated and real mate-pair sequencing datasets from the 1000 Human Genome project. Ulysses achieves high specificity over the complete spectrum of variants by assessing, in a principled manner, the statistical significance of each possible variant (duplications, deletions, translocations, insertions and inversions) against an explicit model for the generation of experimental noise. This statistical model proves particularly useful for the detection of low frequency variants. SV detection performed on a large insert Mate-Pair library from a breast cancer sample revealed a high level of somatic duplications in the tumor and, to a lesser extent, in the blood sample as well. Altogether, these results show that Ulysses is a valuable tool for the characterization of somatic mosaicism in human tissues and in cancer genomes. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Safeguards summary event list (SSEL)

International Nuclear Information System (INIS)

Davidson, J.J.; MacMurdy, P.H.

1980-12-01

The List contains nine categories of events involving NRC licensed material or licensees. It is deliberately broad in scope for two main reasons. First, the list is designed to serve as a reference document. It is as complete and accurate as possible. Second, the list is intended to provide as broad a perspective of the nature of licensee-related events as possible. The nine categories of events are as follows: bomb-related events; intrusion events; missing and/or allegedly stolen events; transportation-related events; vandalism events; arson events; firearms-related events; sabotage events; and miscellaneous events

An active interlock system for the NSLS x-ray ring insertion devices

International Nuclear Information System (INIS)

Nawrocky, R.J.; Biscardi, R.; Dabrowski, J.; Flannigan, J.; Ramamoorthy, S.; Rothman, J.; Smith, J.; So, I.; Thomas, M.; Decker, G.

1991-01-01

This paper describes the design and operation of an active interlock system which has been installed in the NSLS X-ray electron storage ing to protect the vacuum chamber from thermal damage by mis-steered high power photon beams from insertion devices (IDs). the system employs active beam position detectors to monitor beam motion in the ID straight sections and solid state logic circuitry to ''dump'' the stored beam in the event of a fault condition by interrupting the rf. To ensure a high degree of reliability, redundancy and continuous automatic checking has been incorporated into the design. Overall system integrity is checked periodically with beam at safe levels of beam current. 2 refs., 3 figs

Enhancement of heat transfer using varying width twisted tape inserts

African Journals Online (AJOL)

user

enhancement of heat transfer with twisted tape inserts as compared to plain ... studies for heat transfer and pressure drop of laminar flow in horizontal tubes ... flow in rectangular and square plain ducts and ducts with twisted-tape inserts .... presence of the insert in the pipe causes resistance to flow and increases turbulence.

SUPRAPATELLAR VERSUS INFRAPATELLAR TIBIAL NAIL INSERTION- A PROSPECTIVE, RANDOMISED CONTROL PILOT STUDY

Directory of Open Access Journals (Sweden)

Sreekumar K

2017-06-01

Full Text Available BACKGROUND The standard for treating tibial shaft fractures are by intramedullary nails currently. After the procedure, one of the most frequent complication is knee pain, after consolidation even more chronically. Chronic knee pain can affect more than 50% of the cases, which was said by most authors. Alternative routes of inserting the nail is used, which includes by means of lateral patellar paratendon, medial patellar paratendon or transtendon to avoid the symptom. The aim of the study is to study the clinical and functional outcomes of suprapatellar versus infrapatellar tibial nail insertion. MATERIALS AND METHODS This is a prospective study, which was done from January 2014 to February 2015 and 50 patients who were skeletally mature were selected and randomised into IP and SP nail insertion groups. They were also given informed consent and only after they agreed, they were taken into the study. The technique of nail insertion was revealed to both the surgeon and the patient at that time. Exclusion Criteria- Pregnant women, patients with intra-articular involvement, periprosthetic fractures, nonunions, ipsilateral injuries, previous knee injuries, history of gout, rheumatoid, osteoarthritis, spinal injury and incarceration. SP insertion was performed percutaneously with the help of a special cannula system. RESULTS A total of 50 patients were selected in this study. 31 SP and 19 IP. 10 SP and 2 IP did not show up for follow up examinations, so only 38 patients were present for 12 months. At last, there were 21 SP and 17 IP patients. The time from when the index procedure was done to follow up was 14.6 months, i.e. it ranged from 12-28 months. 12 were males and 9 were females with suprapatellar, 9 were males and 8 were females in infrapatellar. Average age of suprapatellar was 42 and that of infrapatellar was 44. Open fractures were 5 and closed fractures were 33. VAS score was 0.78 in suprapatellar and 1.87 in infrapatellar. Data analysis

Lithium Insertion in LixMn2O4, 0

DEFF Research Database (Denmark)

West, Keld; Zachau-Christiansen, Birgit; Skaarup, Steen

1996-01-01

The electrochemical lithium insertion properties of highly crystalline LixMn2O4 are investigated in the approximate lithium insertion range 0 ... of the lithium insertion/extraction reactions is better at the higher voltages (versus Li/Li+), and particularly at the 4 V plateau. The lithium insertion/extraction reaction at the 1 V plateau although essentially reversible is associated with a significant voltage hysteresis....

The study on diamond-coated insert by DC plasma jet CVD

International Nuclear Information System (INIS)

Zhou Kesong; Dai Mingjiang; Song Jinbing; Kuang Tongchun; Liu Zhengyi

2001-01-01

Diamond coating were deposited on cemented carbide inserts by DC plasma jet CVD. The cemented carbide inserts were pretreated by methods including chemical etching of Co, Ar/H 2 plasma etching. The characteristics of diamond film, interface structure, adhesion strength and film stress were analysized by different methods such as SEM, XRD, Raman spectrum etc. A comparing experiment of cutting Al - 22 % Si alloy was carried out with diamond-coated cemented carbide inserts and uncoated cemented carbide inserts. The results show that the diamond-coated cemented carbide insert has a great advantage for cutting abrasive high content Al - Si alloy. (author)

Agrobacterium-mediated insertional mutagenesis in the mycorrhizal fungus Laccaria bicolor.

Science.gov (United States)

Stephan, B I; Alvarez Crespo, M C; Kemppainen, M J; Pardo, A G

2017-05-01

Agrobacterium-mediated gene transfer (AMT) is extensively employed as a tool in fungal functional genomics and accordingly, in previous studies we used AMT on a dikaryotic strain of the ectomycorrhizal basidiomycete Laccaria bicolor. The interest in this fungus derives from its capacity to establish a symbiosis with tree roots, thereby playing a major role in nutrient cycling of forest ecosystems. The ectomycorrhizal symbiosis is a highly complex interaction involving many genes from both partners. To advance in the functional characterization of fungal genes, AMT was used on a monokaryotic L. bicolor. A collection of over 1200 transgenic strains was produced, of which 200 randomly selected strains were analyzed for their genomic T-DNA insertion patterns. By means of insertional mutagenesis, a number of transgenic strains were obtained displaying differential growth features. Moreover, mating with a compatible strain resulted in dikaryons that retained altered phenotypic features of the transgenic monokaryon. The analysis of the T-DNA integration pattern revealed mostly similar results to those reported in earlier studies, confirming the usefulness of AMT on different genetic backgrounds of L. bicolor. Taken together, our studies display the great versatility and potentiality of AMT as a tool for the genetic characterization of L. bicolor.

Analysis of generic insertions made of two symmetric triplets

CERN Document Server

D'Amico, T E

1998-01-01

This paper reports on the study undertaken to explore the capabilities of a symmetric triplet to achieve the optics constraints required by the inner triplet of an insertion and more generally of a co mplete insertion made of two symmetric triplets to match a double focus to a FODO lattice. It is based on analytical treatment formulating a number of constraints equal to the parameters available. Th is thorough and systematic analysis made it possible to establish for an inner triplet as well as for a complete insertion the existence of solutions and to explicitly find out all the solutions, with out resorting to unguided numerical searches. As a by-product, a lattice transformer, made of a single triplet, that matches two different FODO cells has been singled out and studied in details. The r esults should be profitable in a number of cases. Here, the method is applied to an insertion of the type of an experimental LHC insertion in order to investigate its domain of validity and tunability .

DICOM involving XML path-tag

Science.gov (United States)

Zeng, Qiang; Yao, Zhihong; Liu, Lei

2011-03-01

Digital Imaging and Communications in Medicine (DICOM) is a standard for handling, storing, printing, and transmitting information in medical imaging. XML (Extensible Markup Language) is a set of rules for encoding documents in machine-readable form which has become more and more popular. The combination of these two is very necessary and promising. Using XML tags instead of numeric labels in DICOM files will effectively increase the readability and enhance the clear hierarchical structure of DICOM files. However, due to the fact that the XML tags rely heavily on the orders of the tags, the strong data dependency has a lot of influence on the flexibility of inserting and exchanging data. In order to improve the extensibility and sharing of DICOM files, this paper introduces XML Path-Tag to DICOM. When a DICOM file is converted to XML format, adding simple Path-Tag into the DICOM file in place of complex tags will keep the flexibility of a DICOM file while inserting data elements and give full play to the advantages of the structure and readability of an XML file. Our method can solve the weak readability problem of DICOM files and the tedious work of inserting data into an XML file. In addition, we set up a conversion engine that can transform among traditional DICOM files, XML-DCM and XML-DCM files involving XML Path-Tag efficiently.

Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

Energy Technology Data Exchange (ETDEWEB)

Taylor, Ronald C. [Case Western Reserve Univ., Cleveland, OH (United States)

1991-11-01

This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

Energy Technology Data Exchange (ETDEWEB)

Taylor, R.C.

1991-11-01

This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

Sorting genomes by reciprocal translocations, insertions, and deletions.

Science.gov (United States)

Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

2010-01-01

The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

Insertion and deletion polymorphisms of the ancient AluS family in the human genome.

Science.gov (United States)

Kryatova, Maria S; Steranka, Jared P; Burns, Kathleen H; Payer, Lindsay M

2017-01-01

Polymorphic Alu elements account for 17% of structural variants in the human genome. The majority of these belong to the youngest AluY subfamilies, and most structural variant discovery efforts have focused on identifying Alu polymorphisms from these currently retrotranspositionally active subfamilies. In this report we analyze polymorphisms from the evolutionarily older AluS subfamily, whose peak activity was tens of millions of years ago. We annotate the AluS polymorphisms, assess their likely mechanism of origin, and evaluate their contribution to structural variation in the human genome. Of 52 previously reported polymorphic AluS elements ascertained for this study, 48 were confirmed to belong to the AluS subfamily using high stringency subfamily classification criteria. Of these, the majority (77%, 37/48) appear to be deletion polymorphisms. Two polymorphic AluS elements (4%) have features of non-classical Alu insertions and one polymorphic AluS element (2%) likely inserted by a mechanism involving internal priming. Seven AluS polymorphisms (15%) appear to have arisen by the classical target-primed reverse transcription (TPRT) retrotransposition mechanism. These seven TPRT products are 3' intact with 3' poly-A tails, and are flanked by target site duplications; L1 ORF2p endonuclease cleavage sites were also observed, providing additional evidence that these are L1 ORF2p endonuclease-mediated TPRT insertions. Further sequence analysis showed strong conservation of both the RNA polymerase III promoter and SRP9/14 binding sites, important for mediating transcription and interaction with retrotransposition machinery, respectively. This conservation of functional features implies that some of these are fairly recent insertions since they have not diverged significantly from their respective retrotranspositionally competent source elements. Of the polymorphic AluS elements evaluated in this report, 15% (7/48) have features consistent with TPRT-mediated insertion

INEX 5 - General information. INEX 5 Exercise on Notification, Communication and Interfaces Related to Catastrophic Events Involving Radiation or Radiological Materials

International Nuclear Information System (INIS)

Okyar, Halil Burcin; Lazo, Ted

2014-01-01

The INEX series of international nuclear emergency exercises, organised under the OECD Nuclear Energy Agency (NEA), has proven successful in testing, investigating and improving the arrangements for responding to nuclear accidents and radiological emergencies at the national and international level. Previous INEX exercises focussed largely on national and international aspects of early phase management of emergencies at nuclear power plants and more recently, in INEX 4, on issues in consequence management and transition to recovery in response to malicious acts involving the release of radioactive materials in an urban setting. Since the events at the Fukushima Nuclear Power Plant, it has been recognised that notification, communication, and identifying and obtaining resources during catastrophic events can be difficult and the need for established protocols, policies, and procedures among and between country entities is critical for minimizing negative impacts. Therefore, the benefit and goal of INEX 5 is to provide a basis for enhancing national and international emergency management arrangements related to notification, communication and obtaining resources through the exchange of exercise outcomes and experiences from participating countries, in order to identify good practice and common issues to be addressed. INEX 5 will address emergency management aspects of notification, communication and interfaces between and among country and international organizations. INEX 5 is set up as a table top exercise with three levels of discussion for participants (prior to a release, recognizing/validating a release, and impacts to the radiological event from a catastrophic natural event). Countries can develop additional materials to expand this table top to a full field exercise if preferred. Prior to initiation of the table top, participants will be provided clear guidance about how the exercise will be conducted. Because this exercise may involve government agencies and

Artist concept illustrating key events on day by day basis during Apollo 9

Science.gov (United States)

1969-01-01

Artist concept illustrating key events on day by day basis during Apollo 9 mission. First photograph illustrates activities on the first day of the mission, including flight crew preparation, orbital insertion, 103 north mile orbit, separations, docking and docked Service Propulsion System Burn (19792); Second day events include landmark tracking, pitch maneuver, yaw-roll maneuver, and high apogee orbits (19793); Third day events include crew transfer and Lunar Module system evaluation (19794); Fourth day events include use of camera, day-night extravehicular activity, use of golden slippers, and television over Texas and Louisiana (19795); Fifth day events include vehicles undocked, Lunar Module burns for rendezvous, maximum separation, ascent propulsion system burn, formation flying and docking, and Lunar Module jettison ascent burn (19796); Sixth thru ninth day events include service propulsion system burns and landmark sightings, photograph special tests (19797); Tenth day events i

Installation of the LHC experimental insertions

CERN Document Server

Bartolome-Jimenez, S

2004-01-01

The installation of the LHC experimental insertions, and particularly the installation of the low-beta quadrupoles, raises many technical challenges due to the stringent alignment specifications and to the difficulty of access in very confined areas. The compact layout with many lattice elements, vacuum components, beam control instrumentation and the presence of shielding does not allow for any improvisation in the installation procedure. This paper reviews all the constraints that need to be taken into account when installing the experimental insertions. It describes the chronological sequence of installation and discusses the technical solutions that have been adopted.

INSTALLATION OF THE LHC EXPERIMENTAL INSERTIONS

CERN Document Server

Bartolome-Jimenez, S

2004-01-01

The installation of the LHC experimental insertions, and particularly the installation of the Low-Beta quadrupoles, raises many technical challenges due to the stringent alignment specifications and to the difficulty of access in very confined areas. The compact layout with many lattice elements, vacuum components, beam control instrumentation and the presence of shielding does not allow for any improvisation in the installation procedure. This paper reviews all the constraints that need to be taken into account when installing the experimental insertions. It describes the chronological sequence of installation and discusses the technical solutions that have been adopted.

Peripherally inserted central catheters. Guidewire versus nonguidewire use: a comparative study.

Science.gov (United States)

Loughran, S C; Edwards, S; McClure, S

1992-01-01

To date, no research articles have been published that explore the practice of using guidewires for placement of peripherally inserted central catheters. The literature contains speculations regarding the pros and cons of guidewire use. However, no studies to date have compared patient outcomes when peripherally inserted central catheter lines are inserted with and without guidewires. To examine the use of guidewires for peripherally inserted central lines, a comparative study was conducted at two acute care facilities, one using guidewires for insertion and one inserting peripherally inserted central catheter lines without guidewires. 109 catheters were studied between January 1, 1990 and January 1, 1991. The primary focus of this study was to examine whether guidewire use places patients at higher risk for catheter-related complications, particularly phlebitis. No significant differences in phlebitis rates between the two study sites were found. Other catheter-related and noncatheter-related complications were similar between the two facilities. The results of this study do not support the belief that guidewire use increases complication rates.

Integrated Initiating Event Performance Indicators

International Nuclear Information System (INIS)

S. A. Eide; Dale M. Rasmuson; Corwin L. Atwood

2005-01-01

The U.S. Nuclear Regulatory Commission Industry Trends Program (ITP) collects and analyses industry-wide data, assesses the safety significance of results, and communicates results to Congress and other stakeholders. This paper outlines potential enhancements in the ITP to comprehensively cover the Initiating Events Cornerstone of Safety. Future work will address other cornerstones of safety. The proposed Tier 1 activity involves collecting data on ten categories of risk-significant initiating events, trending the results, and comparing early performance with prediction limits (allowable numbers of events, above which NRC action may occur). Tier 1 results would be used to monitor industry performance at the level of individual categories of initiating events. The proposed Tier 2 activity involves integrating the information for individual categories of initiating events into a single risk-based indicator, termed the Baseline Risk Index for Initiating Events or BRIIE. The BRIIE would be evaluated yearly and compared against a threshold. BRIIE results would be reported to Congress on a yearly basis

Characterization of uranium corrosion products involved in the March 13, 1998 fuel manufacturing facility pyrophoric event

International Nuclear Information System (INIS)

Totemeier, T.C.

1999-01-01

Uranium metal corrosion products from ZPPR fuel plates involved in the March 13, 1998 pyrophoric event in the Fuel Manufacturing Facility at Argonne National Laboratory-West were characterized using thermo-gravimetric analysis, X-ray diffraction, and BET gas sorption techniques. Characterization was performed on corrosion products in several different conditions: immediately after separation from the source metal, after low-temperature passivation, after passivation and extended vault storage, and after burning in the pyrophoric event. The ignition temperatures and hydride fractions of the corrosion product were strongly dependent on corrosion extent. Corrosion products from plates with corrosion extents less than 0.7% did not ignite in TGA testing, while products from plates with corrosion extents greater than 1.2% consistently ignited. Corrosion extent is defined as mass of corrosion products divided by the total mass of uranium. The hydride fraction increased with corrosion extent. There was little change in corrosion product properties after low-temperature passivation or vault storage. The burned products were not reactive and contained no hydride; the principal constituents were UO 2 and U 3 O 7 . The source of the event was a considerable quantity of reactive hydride present in the corrosion products. No specific ignition mechanism could be conclusively identified. The most likely initiator was a static discharge in the corrosion product from the 14th can as it was poured into the consolidation can. The available evidence does not support scenarios in which the powder in the consolidation can slowly self-heated to the ignition point, or in which the powder in the 14th can was improperly passivated

Characterization of uranium corrosion products involved in the March 13, 1998 fuel manufacturing facility pyrophoric event.

Energy Technology Data Exchange (ETDEWEB)

Totemeier, T.C.

1999-04-26

Uranium metal corrosion products from ZPPR fuel plates involved in the March 13, 1998 pyrophoric event in the Fuel Manufacturing Facility at Argonne National Laboratory-West were characterized using thermo-gravimetric analysis, X-ray diffraction, and BET gas sorption techniques. Characterization was performed on corrosion products in several different conditions: immediately after separation from the source metal, after low-temperature passivation, after passivation and extended vault storage, and after burning in the pyrophoric event. The ignition temperatures and hydride fractions of the corrosion product were strongly dependent on corrosion extent. Corrosion products from plates with corrosion extents less than 0.7% did not ignite in TGA testing, while products from plates with corrosion extents greater than 1.2% consistently ignited. Corrosion extent is defined as mass of corrosion products divided by the total mass of uranium. The hydride fraction increased with corrosion extent. There was little change in corrosion product properties after low-temperature passivation or vault storage. The burned products were not reactive and contained no hydride; the principal constituents were UO{sub 2} and U{sub 3}O{sub 7}. The source of the event was a considerable quantity of reactive hydride present in the corrosion products. No specific ignition mechanism could be conclusively identified. The most likely initiator was a static discharge in the corrosion product from the 14th can as it was poured into the consolidation can. The available evidence does not support scenarios in which the powder in the consolidation can slowly self-heated to the ignition point, or in which the powder in the 14th can was improperly passivated.

A novel and facile decay path of Criegee intermediates by intramolecular insertion reactions via roaming transition states

Energy Technology Data Exchange (ETDEWEB)

Nguyen, Trong-Nghia [Department of Applied Chemistry and Institute of Molecular Science, National Chiao Tung University, Hsinchu 30010, Taiwan (China); Department of Physical Chemistry, Hanoi University of Science and Technology, Hanoi (Viet Nam); Putikam, Raghunath; Lin, M. C., E-mail: chemmcl@emory.edu [Department of Applied Chemistry and Institute of Molecular Science, National Chiao Tung University, Hsinchu 30010, Taiwan (China)

2015-03-28

We have discovered a new and highly competitive product channel in the unimolecular decay process for small Criegee intermediates, CH{sub 2}OO and anti/syn-CH{sub 3}C(H)OO, occurring by intramolecular insertion reactions via a roaming-like transition state (TS) based on quantum-chemical calculations. Our results show that in the decomposition of CH{sub 2}OO and anti-CH{sub 3}C(H)OO, the predominant paths directly produce cis-HC(O)OH and syn-CH{sub 3}C(O)OH acids with >110 kcal/mol exothermicities via loose roaming-like insertion TSs involving the terminal O atom and the neighboring C–H bonds. For syn-CH{sub 3}C(H)OO, the major decomposition channel occurs by abstraction of a H atom from the CH{sub 3} group by the terminal O atom producing CH{sub 2}C(H)O–OH. At 298 K, the intramolecular insertion process in CH{sub 2}OO was found to be 600 times faster than the commonly assumed ring-closing reaction.

Generation of comprehensive transposon insertion mutant library for the model archaeon, Haloferax volcanii, and its use for gene discovery.

Science.gov (United States)

Kiljunen, Saija; Pajunen, Maria I; Dilks, Kieran; Storf, Stefanie; Pohlschroder, Mechthild; Savilahti, Harri

2014-12-09

Archaea share fundamental properties with bacteria and eukaryotes. Yet, they also possess unique attributes, which largely remain poorly characterized. Haloferax volcanii is an aerobic, moderately halophilic archaeon that can be grown in defined media. It serves as an excellent archaeal model organism to study the molecular mechanisms of biological processes and cellular responses to changes in the environment. Studies on haloarchaea have been impeded by the lack of efficient genetic screens that would facilitate the identification of protein functions and respective metabolic pathways. Here, we devised an insertion mutagenesis strategy that combined Mu in vitro DNA transposition and homologous-recombination-based gene targeting in H. volcanii. We generated an insertion mutant library, in which the clones contained a single genomic insertion. From the library, we isolated pigmentation-defective and auxotrophic mutants, and the respective insertions pinpointed a number of genes previously known to be involved in carotenoid and amino acid biosynthesis pathways, thus validating the performance of the methodologies used. We also identified mutants that had a transposon insertion in a gene encoding a protein of unknown or putative function, demonstrating that novel roles for non-annotated genes could be assigned. We have generated, for the first time, a random genomic insertion mutant library for a halophilic archaeon and used it for efficient gene discovery. The library will facilitate the identification of non-essential genes behind any specific biochemical pathway. It represents a significant step towards achieving a more complete understanding of the unique characteristics of halophilic archaea.

Insertion device calculations with mathematica

Energy Technology Data Exchange (ETDEWEB)

Carr, R. [Stanford Synchrotron Radiation Lab., CA (United States); Lidia, S. [Univ. of California, Davis, CA (United States)

1995-02-01

The design of accelerator insertion devices such as wigglers and undulators has usually been aided by numerical modeling on digital computers, using code in high level languages like Fortran. In the present era, there are higher level programming environments like IDL{reg_sign}, MatLab{reg_sign}, and Mathematica{reg_sign} in which these calculations may be performed by writing much less code, and in which standard mathematical techniques are very easily used. The authors present a suite of standard insertion device modeling routines in Mathematica to illustrate the new techniques. These routines include a simple way to generate magnetic fields using blocks of CSEM materials, trajectory solutions from the Lorentz force equations for given magnetic fields, Bessel function calculations of radiation for wigglers and undulators and general radiation calculations for undulators.

A nurse led peripherally inserted central catheter line insertion service is effective with radiological support

International Nuclear Information System (INIS)

Barber, Jonathan M.; Booth, Doris M.; King, Julia A.; Chakraverty, Sam

2002-01-01

AIM: Peripherally inserted central catheters (PICC) are increasingly used as a route of chemotherapy administration. Our aims were to assess a collaborative approach to PICC placement, with radiological support for a nurse led line insertion service in a minority of cases, and to determine whether PICC provided a safe and reliable method of chemotherapy administration. MATERIALS AND METHODS: Prospective data on 100 consecutive patients undergoing PICC placement for chemotherapy were collected. Lines were inserted by ward based nurses or under ultrasound guidance by radiologists. End points were successful completion of treatment or patient death. RESULTS: One hundred and forty-four lines were placed for 118 courses of chemotherapy. 107 (74%) were placed by nurses and 37 (26%) by radiologists. Ninety-five percent of patients completed therapy with either one or two lines. Seventy percent of lines were removed on achieving the primary end points. In two additional patients PICC could not be placed radiologically. Twelve patients were unable to complete treatment with PICC alone, nine of these required an alternative administration route. The catheter related sepsis rate was 4.9%. CONCLUSION: The majority of PICC can be successfully placed by trained nurses, reserving image guidance only for more difficult cases. PICC have an acceptable complication profile, and decrease the need for tunnelled central lines. Barber, J.M. et al. (2002)

Remifentanil for the insertion and removal of long-term central venous access during monitored anesthesia care.

LENUS (Irish Health Repository)

Burlacu, Crina L

2012-02-01

STUDY OBJECTIVE: To determine the analgesic efficacy of three different rates of remifentanil infusion in patients undergoing insertion or removal of long-term central venous access devices during monitored anesthesia care and local anesthetic field infiltration. DESIGN: Double-blinded, randomized, controlled study. SETTING: Operating theatre of an University hospital. PATIENTS: 44 unpremedicated, ASA physical status 1 and 2 patients, aged 18-65 years, undergoing insertion or removal of a Port-a-Cath or Hickman catheter. INTERVENTIONS: Patients sedated with a propofol target-controlled infusion were randomly allocated to three groups: Group R25 (n = 14), Group R50 (n = 15), and Group R75 (n = 15), to receive remifentanil 0.025, 0.05, and 0.075 mug\\/kg\\/min, respectively. Rescue remifentanil 0.5 mug\\/kg was administered for pain scores > 3. The remifentanil infusion rate was maintained constant unless respiratory and\\/or cardiovascular unwanted events occurred, whereupon the rate was adjusted in 0.01 mug\\/kg\\/min decrements as necessary. MEASUREMENTS: Pain scores (primary outcome), sedation, and movement scores (secondary outcomes) were assessed during local anesthetic infiltration of the anterior chest wall and 5 other procedural steps. MAIN RESULTS: All infusion rates had equal analgesic efficacy, as shown by comparable pain scores, number of rescue boluses, and number of patients requiring rescue analgesia. Excessive sedation was associated with the highest remifentanil rate such that Group R75 patients were significantly more sedated than Groups R25 or R50 at selective procedural steps (P < 0.05). More Group R75 patients (6\\/15) required remifentanil rate reduction than did patients from Group R50 (1\\/15) or Group R25 (0\\/14), P < 0.01, most commonly because of respiratory depression. CONCLUSIONS: For the insertion or removal of long-term central venous access devices, all three remifentanil infusion rates proved to be equally analgesic

Bedside prediction of right subclavian venous catheter insertion length

Directory of Open Access Journals (Sweden)

Yoon Ji Choi

2014-12-01

Full Text Available Background and objective: The present study aimed to evaluate whether right subclavian vein (SCV catheter insertion depth can be predicted reliably by the distances from the SCV insertion site to the ipsilateral clavicular notch directly (denoted as I-IC, via the top of the SCV arch, or via the clavicle (denoted as I-T-IC and I-C-IC, respectively. Method: In total, 70 SCV catheterizations were studied. The I-IC, I-T-IC, and I-C-IC distances in each case were measured after ultrasound-guided SCV catheter insertion. The actual length of the catheter between the insertion site and the ipsilateral clavicular notch, denoted as L, was calculated by using chest X-ray. Results: L differed from the I-T-IC, I-C-IC, and I-IC distances by 0.14±0.53, 2.19±1.17, and -0.45 ±0.68 cm, respectively. The mean I-T-IC distance was the most similar to the mean L (intraclass correlation coefficient = 0.89. The mean I-IC was significantly shorter than L, while the mean I-C-IC was significantly longer. Linear regression analysis provided the following formula: Predicted SCV catheter insertion length (cm = -0.037 + 0.036 × Height (cm + 0.903 × I-T-IC (cm (adjusted r2 =0.64. Conclusion: The I-T-IC distance may be a reliable bedside predictor of the optimal insertion length for a right SCV cannulation.

Modeling insertional mutagenesis using gene length and expression in murine embryonic stem cells.

Directory of Open Access Journals (Sweden)

Alex S Nord

2007-07-01

Full Text Available High-throughput mutagenesis of the mammalian genome is a powerful means to facilitate analysis of gene function. Gene trapping in embryonic stem cells (ESCs is the most widely used form of insertional mutagenesis in mammals. However, the rules governing its efficiency are not fully understood, and the effects of vector design on the likelihood of gene-trapping events have not been tested on a genome-wide scale.In this study, we used public gene-trap data to model gene-trap likelihood. Using the association of gene length and gene expression with gene-trap likelihood, we constructed spline-based regression models that characterize which genes are susceptible and which genes are resistant to gene-trapping techniques. We report results for three classes of gene-trap vectors, showing that both length and expression are significant determinants of trap likelihood for all vectors. Using our models, we also quantitatively identified hotspots of gene-trap activity, which represent loci where the high likelihood of vector insertion is controlled by factors other than length and expression. These formalized statistical models describe a high proportion of the variance in the likelihood of a gene being trapped by expression-dependent vectors and a lower, but still significant, proportion of the variance for vectors that are predicted to be independent of endogenous gene expression.The findings of significant expression and length effects reported here further the understanding of the determinants of vector insertion. Results from this analysis can be applied to help identify other important determinants of this important biological phenomenon and could assist planning of large-scale mutagenesis efforts.

High-Resolution Tracking Asymmetric Lithium Insertion and Extraction and Local Structure Ordering in SnS2.

Science.gov (United States)

Gao, Peng; Wang, Liping; Zhang, Yu-Yang; Huang, Yuan; Liao, Lei; Sutter, Peter; Liu, Kaihui; Yu, Dapeng; Wang, En-Ge

2016-09-14

In the rechargeable lithium ion batteries, the rate capability and energy efficiency are largely governed by the lithium ion transport dynamics and phase transition pathways in electrodes. Real-time and atomic-scale tracking of fully reversible lithium insertion and extraction processes in electrodes, which would ultimately lead to mechanistic understanding of how the electrodes function and why they fail, is highly desirable but very challenging. Here, we track lithium insertion and extraction in the van der Waals interactions dominated SnS2 by in situ high-resolution TEM method. We find that the lithium insertion occurs via a fast two-phase reaction to form expanded and defective LiSnS2, while the lithium extraction initially involves heterogeneous nucleation of intermediate superstructure Li0.5SnS2 domains with a 1-4 nm size. Density functional theory calculations indicate that the Li0.5SnS2 is kinetically favored and structurally stable. The asymmetric reaction pathways may supply enlightening insights into the mechanistic understanding of the underlying electrochemistry in the layered electrode materials and also suggest possible alternatives to the accepted explanation of the origins of voltage hysteresis in the intercalation electrode materials.

Central venous catheter insertion problem solving using intravenous catheter: technical communication

Directory of Open Access Journals (Sweden)

Alemohammad M

2013-02-01

Full Text Available Insertion of central venous catheter is an accepted method for hemodynamic monitor-ring, drug and fluid administration, intravenous access, hemodialysis and applying cardiac pace-maker in hospitalized patients. This procedure can be associated with severe complications. The aim of this article is to provide a practical approach to prevent catheter malposition in states that the guide wire will not pass freely.During central venous insertion in internal jugular vein using modified seldinger technique, when after venous insertion, the passage of the guide wire shows difficulties and don’t pass freely, insertion of an intravenous cannula over the wire and re-insertion of the wire can help to prevent malposition of the wire and the catheter. Use of an intravenous cannula over the guide, in situations that the guide wire cannot pass freely among the needle inserted in internal jugular vein, and re-insertion of the guide can probably prevent or reduce the tissue or vascular trauma and the associated complica-tions. This simple maneuver can be helpful in difficult cases especially in cardiac surgery patients who receive high dose heparin and it is necessary to avoid traumatize-tion of carotid artery.

Mutational analyses of the signals involved in the subcellular location of DSCR1

Directory of Open Access Journals (Sweden)

Henrique-Silva Flávio

2002-09-01

Full Text Available Abstract Background Down syndrome is the most frequent genetic disorder in humans. Rare cases involving partial trisomy of chromosome 21 allowed a small chromosomal region common to all carriers, called Down Syndrome Critical Region (DSCR, to be determined. The DSCR1 gene was identified in this region and is expressed preferentially in the brain, heart and skeletal muscle. Recent studies have shown that DSCR1 belongs to a family of proteins that binds and inhibits calcineurin, a serine-threonine phosphatase. The work reported on herein consisted of a study of the subcellular location of DSCR1 and DSCR1-mutated forms by fusion with a green fluorescent protein, using various cell lines, including human. Results The protein's location was preferentially nuclear, independently of the isoform, cell line and insertion in the GFP's N- or C-terminal. A segment in the C-terminal, which is important in the location of the protein, was identified by deletion. On the other hand, site-directed mutational analyses have indicated the involvement of some serine and threonine residues in this event. Conclusion In this paper, we discuss the identification of amino acids which can be important for subcellular location of DSCR1. The involvement of residues that are prone to phosphorylation suggests that the location and function of DSCR1 may be regulated by kinases and/or phosphatases.

App-assisted external ventricular drain insertion.

Science.gov (United States)

Eftekhar, Behzad

2016-09-01

The freehand technique for insertion of an external ventricular drain (EVD) is based on fixed anatomical landmarks and does not take individual variations into consideration. A patient-tailored approach based on augmented-reality techniques using devices such as smartphones can address this shortcoming. The Sina neurosurgical assist (Sina) is an Android mobile device application (app) that was designed and developed to be used as a simple intraoperative neurosurgical planning aid. It overlaps the patient's images from previously performed CT or MRI studies on the image seen through the device camera. The device is held by an assistant who aligns the images and provides information about the relative position of the target and EVD to the surgeon who is performing EVD insertion. This app can be used to provide guidance and continuous monitoring during EVD placement. The author describes the technique of Sina-assisted EVD insertion into the frontal horn of the lateral ventricle and reports on its clinical application in 5 cases as well as the results of ex vivo studies of ease of use and precision. The technique has potential for further development and use with other augmented-reality devices.

Insertion of reactivity (RIA) without scram in the reactor core IEA-R1 using code PARET

International Nuclear Information System (INIS)

Alves, Urias F.; Castrillo, Lazara S.; Lima, Fernando A.

2013-01-01

The modeling and analysis thermo hydraulics of a research reactor with MTR type fuel elements - Material Testing Reactor - was performed using the code PARET (Program for the Analysis of Reactor Transients) when in the system some external event is introduced that changed the reactivity in the reactor core. Transients of Reactivity Insertion of 0.5 , 1.5 and 2.0$/ 0.7s in the brazilian reactor IEA-R1 will be presented, and will be shown under what conditions it is possible to ensure the safe operation of its nucleus. (author)

Fuel assembly insertion system

International Nuclear Information System (INIS)

Barkhurst, D.J.

1987-01-01

This patent describes a nuclear reactor facility having fuel bundles: a system for the insertion of a fuel bundle into a position where vertically arranged fuel bundles surround and are adjacent the system comprising, in combination, separate and individual centering devices secured to and disposed on top of each fuel bundle adjacent the position. Each such centering device has a generally box-like cap configuration on the upper end of each fuel bundle and includes: a top wall; first and second side walls, each secured along and upper edge to the top wall; a rear plate attached along opposite vertical edges to the first and second side walls; a front inclined wall joined along an upper edge to the top to the wall and attached along opposite vertical edges first and second side walls; pad means secured to the lower edge of the first and second side walls, the front inclined wall and the rear plate for mounting each centering device on top of an associated fuel bundle; pin means carried by at least two of the pad means engageable with an associated aperature for locating and laterally fixing each centering device on top of its respective fuel bundle. Each front inclined wall of each of the centering devices is orientated on top of its respective fuel bundle to slope upwardly and away from the position where upon downward insertion of a fuel bundle any contact between the lower end of the fuel bundle inserted with a front inclined wall of a centering device will laterally deflect the fuel bundle. Each centering device further includes a central socket means secured to the top wall, and an elongated handling pole pivotally attached to the socket

Safeguards Summary Event List (SSEL)

International Nuclear Information System (INIS)

1983-02-01

The Safeguards Summary Event List (SSEL) provides brief summaries of several hundred safeguards-related events involving nuclear material or facilities regulated by the US Nuclear Regulatory Commission (NRC). Events are described under the categories of bomb-related, intrusion, missing and/or allegedly stolen, transportation, vandalism, arson, firearms, radiological sabotage and miscellaneous. The information contained in the event descriptions is derived primarily from official NRC reporting channels

Safeguards Summary Event List (SSEL)

International Nuclear Information System (INIS)

1982-07-01

The Safeguards Summary Event List (SSEL) provides brief summaries of several hundred safeguards-related events involving nuclear material or facilities regulated by the US Nuclear Regulatory Commission (NRC). Events are described under the categories of bomb-related, intrusion, missing and/or allegedly stolen, transportation, vandalism, arson, firearms, sabotage and miscellaneous. The information contained in the event descriptions is derived primarily from official NRC reporting channels

Comparing performance of mothers using simplified mid-upper arm circumference (MUAC) classification devices with an improved MUAC insertion tape in Isiolo County, Kenya

DEFF Research Database (Denmark)

Grant, Angeline; Njiru, James; Okoth, Edgar

2018-01-01

to a "gold standard" classification (the mean of three measurements taken by a research assistant using the MUAC insertion tape).  Results: The sensitivity of mother/caregiver classifications was high for all devices (>93% for severe acute malnutrition (SAM), defined by MUAC 90% for global...... acute malnutrition (GAM), defined by MUAC classification was higher using the MUAC insertion tape (100% sensitivity for SAM and 99% sensitivity for GAM) than using "Click-MUAC" devices. Younden's J for SAM classification, and sensitivity for GAM......Background: A novel approach for improving community case-detection of acute malnutrition involves mothers/caregivers screening their children for acute malnutrition using a mid-upper arm circumference (MUAC) insertion tape. The objective of this study was to test three simple MUAC classification...

Mastery learning improves students skills in inserting intravenous access: a pre-post-study.

Science.gov (United States)

Friederichs, Hendrik; Brouwer, Britta; Marschall, Bernhard; Weissenstein, Anne

2016-01-01

Inserting peripheral venous catheters (PVCs) has been identified as a core competency for medical students. Because the performance - even of hygienic standards - of both students and novice physicians is frequently inadequate, medical faculties must focus on competence-based learning objectives and deliberate practice, features that are combined in mastery learning. Our aim was to determine the competency of students in inserting PVCs before and after an educational intervention. This study comprised a skills assessment with pre- and post-tests of a group of third-year students who received a simulation-based intervention. A newly established curriculum involved one hour of practice at inserting PVCs on simulators. Students were required to pass a test (total 21 points, pass mark 20 points) developed on the concept of mastery learning. An unannounced follow-up test was performed one week (8 days) after the intervention. The simulation center of the medical faculty in Muenster. Third-year students who received the intervention. One hundred and nine complete data sets were obtained from 133 students (82.5%). Most students (97.2%) passed the test after the intervention (mean score increase from 15.56 to 20.50, Pstudents' performance after one week (8 days): only 74.5% of participants passed this retest (mean score reduction from 20.50 to 20.06, Plearning is an effective form of teaching practical skills to medical students, allowing a thorough preparation for the challenges of daily clinical practice.

Characterization of T-DNA insertion mutants with decreased virulence in the entomopathogenic fungus Beauveria bassiana JEF-007.

Science.gov (United States)

Kim, Sihyeon; Lee, Se Jin; Nai, Yu-Shin; Yu, Jeong Seon; Lee, Mi Rong; Yang, Yi-Ting; Kim, Jae Su

2016-10-01

The bean bug, Riptortus pedestris, is a major agricultural pest that reduces crop quality and value. Chemical pesticides have contributed to pest management, but resistance to these chemicals has significantly limited their use. Alternative strategies with different modes of action, such as entomopathogenic fungi, are therefore of great interest. Herein, we explored how entomopathogenic fungi can potentially be used to control the bean bug and focused on identifying virulence-related genes. Beauveria bassiana (JEF isolates) were assayed against bean bugs under laboratory conditions. One isolate, JEF-007, showed >80 % virulence by both spray and contact exposure methods. Agrobacterium tumefaciens-mediated transformation (AtMT) of JEF-007 generated 249 random transformants, two of which (B1-06 and C1-49) showed significantly reduced virulence against Tenebrio molitor and R. pedestris immatures. Both species were used for rapid screening of virulence-reduced mutants. The two transformants had different morphologies, conidial production, and thermotolerance than the wild type. To determine the localization of the randomly inserted T-DNA, thermal asymmetric interlaced (TAIL) PCR was conducted and analysis of the two clones found multiple T-DNA insertions (two in B1-06 and three in C1-49). Genes encoding complex I intermediate-associated protein 30 (CIA30) and the autophagy protein (Atg22) were possibly disrupted by the T-DNA insertion and might be involved in the virulence. This work provides a strong platform for future functional genetic studies of bean bug-pathogenic B. bassiana. The genes putatively involved in fungal virulence should be experimentally validated by knockdown in future studies.

Mammographic and Ultrasonographic Findings of the Chemoport Insertion Site

International Nuclear Information System (INIS)

Kim, Seun Jung; Kang, Bong Joo; Cha, Eun Suk; Park, Hye Jung; Kim, Sung Hun; Choi, Jae Jeong; Lee, Ji Hye

2010-01-01

To describe mammographic and ultrasonographic findings of previous chemoport insertion sites. We included patients who had abnormal findings at chemoport insertion sites on mammography and ultrasonography from 224 patients who underwent chemoport insertion and breast imaging at our institution between January, 2005, and December, 2007. Abnormal findings were identified in 16 mammographies and 14 ultrasonographies in 10 patients. The mean age was 50.9 years and the age range was from 44 to 67 years. Abnormal findings on mammography and ultrasonography were retrospectively analyzed according to ACR/BI-RADS. All cases were followed up with imaging studies for 2 years to confirm changes after chemoport insertion. Of the abnormal findings identified on mammography, focal asymmetry (7/16) was the most common. Other abnormal findings included mass (6/16), skin retraction (2/16), residual chemoport tip (1/16), and trabecular thickening (1/16). Of the abnormal findings seen on ultrasonography, skin thickening (12/14) was the most common. Other abnormal findings included mass (5/14), diffuse increased echogenicity of subcutaneous tissue (1/14), and a localized skin nodule (1/14). Abnormal findings on mammography and ultrasonography were located in the upper outer quadrant in 5 patients, upper inner quadrant in 3 patients, and mid upper portion in 1 patient. In 1 patient, the abnormal finding was only identified in the mediolateral oblique view of her mammography. Radiologists should be aware of potential abnormal findings on mammography and ultrasonography following chemoport insertion. In particular, ultrasonography is a very useful modality for detecting skin complications after chemoport insertion

Controlled acrylate insertion regioselectivity in diazaphospholidine- sulfonato palladium(II) complexes

KAUST Repository

Wucher, Philipp

2012-12-24

Diazaphospholidine-sulfonato Pd(II) complexes [{κ2-P,O-(N- Ar2C2H4N2P)C6H 4SO3}PdMe(L)] 1-L (L = dmso, pyridine, lutidine, or μ-LiCl(solvent); 1a: Ar = Ph, 1b: Ar = 2-MeC6H4, 1c: Ar = 2-MeOC6H4, 1d: Ar = 2,4,6-Me3C 6H2, 1e: Ar = 2,6-iPr2C6H 3, 1f: Ar = 2,6-(p-tolyl)2C6H3) were prepared and structurally characterized. The regioselectivity of methyl acrylate (MA) insertion into the Pd-Me bond is entirely inverted from >93% 1,2-insertion for bulky substituents (1d-f, yielding the insertion products [(P̂O)Pd{κ2-C,O-CH2CHMeC(O)OMe], 12) to the usual electronically controlled 2,1-insertion (>95%) for the less bulky Ar = Ph (1a, yielding the insertion product [(P̂O)Pd{κ2-C,O- CHEtC(O)OMe], 11, and β-H elimination product methyl crotonate). DFT studies underline that this is due to a more favorable insertion transition state (2,1- favored by 12 kJ mol-1 over 1,2- for 1a) vs destabilization of the 2,1-insertion transition state in 1d,e. By contrast, MA insertion into the novel isolated and structurally characterized hydride and deuteride complexes [{κ2-P,O-(N-Ar2C 2H4N2P)C6H4SO 3}PdR(lutidine)] (Ar = 2,6-iPr2C6H3; 9e: R = H, 10e: R = D) occurs 2,1-selectively. This is due to the insertion occurring from the isomer with the P-donor and the olefin in trans arrangement, rather than the insertion into the alkyl from the cis isomer in which the olefin is in proximity to the bulky diazaphospholidine. 1a-f are precursors to active catalysts for ethylene polymerization to highly linear polyethylene with M n up to 35 000 g mol-1. In copolymerization experiments, norbornene was incorporated in up to 6.1 mol % into the polyethylene backbone. © 2012 American Chemical Society.

Effects on Subtalar Joint Stress Distribution After Cannulated Screw Insertion at Different Positions and Directions.

Science.gov (United States)

Yuan, Cheng-song; Chen, Wan; Chen, Chen; Yang, Guang-hua; Hu, Chao; Tang, Kang-lai

2015-01-01

We investigated the effects on subtalar joint stress distribution after cannulated screw insertion at different positions and directions. After establishing a 3-dimensional geometric model of a normal subtalar joint, we analyzed the most ideal cannulated screw insertion position and approach for subtalar joint stress distribution and compared the differences in loading stress, antirotary strength, and anti-inversion/eversion strength among lateral-medial antiparallel screw insertion, traditional screw insertion, and ideal cannulated screw insertion. The screw insertion approach allowing the most uniform subtalar joint loading stress distribution was lateral screw insertion near the border of the talar neck plus medial screw insertion close to the ankle joint. For stress distribution uniformity, antirotary strength, and anti-inversion/eversion strength, lateral-medial antiparallel screw insertion was superior to traditional double-screw insertion. Compared with ideal cannulated screw insertion, slightly poorer stress distribution uniformity and better antirotary strength and anti-inversion/eversion strength were observed for lateral-medial antiparallel screw insertion. Traditional single-screw insertion was better than double-screw insertion for stress distribution uniformity but worse for anti-rotary strength and anti-inversion/eversion strength. Lateral-medial antiparallel screw insertion was slightly worse for stress distribution uniformity than was ideal cannulated screw insertion but superior to traditional screw insertion. It was better than both ideal cannulated screw insertion and traditional screw insertion for anti-rotary strength and anti-inversion/eversion strength. Lateral-medial antiparallel screw insertion is an approach with simple localization, convenient operation, and good safety. Copyright © 2015 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Effects of Rotational Motion in Robotic Needle Insertion

Science.gov (United States)

Ramezanpour, H.; Yousefi, H.; Rezaei, M.; Rostami, M.

2015-01-01

Background Robotic needle insertion in biological tissues has been known as one the most applicable procedures in sampling, robotic injection and different medical therapies and operations. Objective In this paper, we would like to investigate the effects of angular velocity in soft tissue insertion procedure by considering force-displacement diagram. Non-homogenous camel liver can be exploited as a tissue sample under standard compression test with Zwick/Roell device employing 1-D axial load-cell. Methods Effects of rotational motion were studied by running needle insertion experiments in 5, 50 and 200 mm/min in two types of with or without rotational velocity of 50, 150 and 300 rpm. On further steps with deeper penetrations, friction force of the insertion procedure in needle shaft was acquired by a definite thickness of the tissue. Results Designed mechanism of fixture for providing different frequencies of rotational motion is available in this work. Results for comparison of different force graphs were also provided. Conclusion Derived force-displacement graphs showed a significant difference between two procedures; however, tissue bleeding and disorganized micro-structure would be among unavoidable results. PMID:26688800

Automatic needle insertion diminishes pain during growth hormone injection

DEFF Research Database (Denmark)

Main, K M; Jørgensen, J T; Hertel, N T

1995-01-01

prototype pens for GH administration, providing either manual or automatic sc needle insertion, using a combined visual analogue/facial scale and a five-item scale in 18 children. With the automatic pen there was a significantly lower maximum pain score compared with the manual pen (median 28.5 versus 52.......0 mm) as well as a lower mean pain score (mean 13.7 versus 23.5 mm). The five-item scale revealed that automatic needle insertion was significantly less painful than manual insertion and 13 patients chose to continue treatment with the automatic pen. In conclusion, pain during GH injection can...

Testing and development of an OWC MRI compatible PET insert front-end

Energy Technology Data Exchange (ETDEWEB)

Konstantinou, G.; Ali, W.; Chil, R.; Cossu, G.; Ciaramella, E.; Vaquero, J.J.

2016-07-01

We present the design and development of a positron emission tomography (PET) detector module that could be used inside magnetic resonance imager (MRI). Critical factors compromising this combination have been studied and different solutions have been offered. Our design divides the detector module in two sections: one is the insert front-end that is placed inside the MRI and that comprises of a scintillator, a silicon photomultiplier and minimum analog electronics. The analog pulses are sent to the second section, the back-end digitalization and reconstruction module. The analog link is implemented using optical wireless communication (OWC) techniques. In this work we study how such a setting retains all the necessary characteristics for the detection and characterization of gamma scintillation events, providing sufficient communication quality with low consumption and minimizing the need for space. Possible multiplexing schemes for achieving the necessary transmission with less communication channels are also proposed and studied. A series of tests and measurements on different settings demonstrate the viability of this technique. When fully developed, it can provide a cost effective alternative for the industrial production of a flexible and customizable modular PET detector insert that can be applied to pre-existing small animal or human MRI settings, only minimally affecting the size of the MRI bore, without compromising the PET signal quality. (Author)

Unilateral versus bilateral stent insertion for malignant hilar biliary obstruction.

Science.gov (United States)

Chang, Gang; Xia, Feng-Fei; Li, Hong-Fu; Niu, Su; Xu, Yuan-Shun

2017-11-01

To determine the clinical efficiency and long-term outcomes between unilateral and bilateral stent insertion in patients with malignant hilar biliary obstruction. From August 2012 to February 2016, 63 consecutive patients with malignant hilar biliary obstruction were treated with unilateral or bilateral stent insertion at our center. The bilateral stents were inserted using the side-by-side technique. The clinical efficiency and long-term outcomes were compared between the two groups. Unilateral and bilateral stent insertions were successfully performed in 31 of 33 and 27 of 30 patients, respectively (P = 0.912). No procedure-related complication occurred. Clinical success was achieved in 29 of 31 patients in the unilateral stent group and in 26 of 27 patients in the bilateral stent group (P = 0.637). During the follow-up, re-obstruction of stent occurred in five patients in the unilateral stent group and in three patients in the bilateral stent group (P = 0.58). The significant differences were not observed in the stent patency time (368 vs. 387 days, P = 0.685) and survival (200 vs. 198 days, P = 0.751) between two groups. Based on the univariate and multivariate analyses, the independent risk factors for decreasing the survival time included higher Eastern Cooperative Oncology Group performance status (P = 0.018), higher alanine aminotransferase level (P = 0.009), and absence of anticancer treatment after stent insertion (P = 0.002). Compared to bilateral stent insertion for malignant hilar biliary obstruction, unilateral stent insertion can provide comparable clinical efficiency and long-term outcomes.

Compact insert design for cryogenic pressure vessels

Energy Technology Data Exchange (ETDEWEB)

Aceves, Salvador M.; Ledesma-Orozco, Elias Rigoberto; Espinosa-Loza, Francisco; Petitpas, Guillaume; Switzer, Vernon A.

2017-06-14

A pressure vessel apparatus for cryogenic capable storage of hydrogen or other cryogenic gases at high pressure includes an insert with a parallel inlet duct, a perpendicular inlet duct connected to the parallel inlet. The perpendicular inlet duct and the parallel inlet duct connect the interior cavity with the external components. The insert also includes a parallel outlet duct and a perpendicular outlet duct connected to the parallel outlet duct. The perpendicular outlet duct and the parallel outlet duct connect the interior cavity with the external components.

Safeguards Summary Event List (SSEL)

International Nuclear Information System (INIS)

1984-03-01

The Safeguards Summary Event List (SSEL) provides brief summaries of several hundred safeguards-related events involving nuclear material or facilities regulated by the U.S. Nuclear Regulatory Commission (NRC). Events are described under the categories of bomb-related, intrusion, missing and/or allegedly stolen, transportation, tampering/vandalism, arson, firearms, radiological sabotage and miscellaneous. The information contained in the event descriptions is derived primarily from official NRC reporting channels

Design and testing of microfabricated surgical tools for large animal probe insertion

Energy Technology Data Exchange (ETDEWEB)

Jorgensen, Shelly [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2016-08-05

Neural probes provide therapeutic stimulation for neuropsychiatric disorders or record neural activity to investigate the workings of the brain. Researchers utilize 6 mm long temporary silicon stiffeners attached with biodissolvable adhesive to insert flexible neural probes into rat brains, but increasing the probe length fivefold makes inserting large animal probes a significant challenge because of an increased potential for buckling. This study compared the insertion success rates of 6 mm and 30 mm long silicon stiffeners that were 80 μm wide and 30 μm thick, and ascertained the material thickness and modulus of elasticity that would provide successful insertion for a 30 mm probe. Using a microdrive, stiffeners were inserted into an agarose brain phantom at controlled insertion speeds while being video-recorded. Twenty-five percent of the 30 mm silicon stiffeners fully inserted at speeds approximately four times higher than the target rate of 0.13 mm/s, while 100 percent of the 6 mm silicon stiffeners inserted successfully at target speed. Critical buckling loads (P_cr) were calculated for the 6 mm and 30 mm silicon stiffeners, and for 30 mm diamond and tungsten stiffeners, with thicknesses varying from 30-80 μm. Increasing the thickness of the material by 10 μm, 20 μm and 30 μm improved the P_cr by 2.4, 4.7 and 8.2 times, respectively, independent of the material, and substituting diamond for silicon multiplied the buckling capacity by 5.0 times. Stiffeners made of silicon for large animal probe insertion are not strong enough to withstand buckling upon insertion without a significant increase in thickness. Replacing silicon with diamond and increasing the thickness of the stiffener to 50 μm would afford a stiffener with the same P_cr capacity as the 6 mm silicon stiffener that had a 100 percent insertion success rate. Experiments should continue with diamond to determine a minimum thickness that will ensure successful

Extra-anatomical complications of antegrade double-J insertion

Directory of Open Access Journals (Sweden)

A R Rao

2011-01-01

Full Text Available Introduction: Insertion of a double-J (JJ stent is a common procedure often carried out in the retrograde route by the urologists and the antegrade route by the radiologists. Reported complications include stent migration, encrustation, and fracture. Extra-anatomic placement of an antegrade JJ stent is a rare but infrequently recognized complication. Materials and Methods: We performed a retrospective audit of 165 antegrade JJ stent insertions performed over three consecutive years by a single interventional radiologist. All renal units were hydronephrotic at the time of nephrostomy. All procedures were performed under local anaesthetic with antibiotic prophylaxis. Results: Antegrade stent insertion was carried out simultaneously at the time of nephrostomy in 55 of the 165 cases (33%. The remainder were inserted at a mean of 2 weeks following decompression. In five (3% patients, who had delayed antegrade stenting following nephrostomy, the procedure was complicated by silent ureteric perforation and an extra-anatomic placement of the stent. These complications had delayed manifestations, which included two retroperitoneal abscesses, a pelvic urinoma, a case each of ureterorectal fistula, and ureterovaginal fistula. Risk factors for ureteric perforation include previous pelvic malignancy, pelvic surgery, pelvic radiation, and a history of ureteric manipulation. Conclusion: Antegrade ureteric JJ stenting is a procedure not without complications. Extra-anatomic placement of the antegrade stent is a hitherto the infrequently reported complication but needs a high index of suspicion to be diagnosed. Risk factors for ureteric perforation at the time of stent insertion have to be considered to prevent this potential complication.

Modeling, simulation, and optimal initiation planning for needle insertion into the liver.

Science.gov (United States)

Sharifi Sedeh, R; Ahmadian, M T; Janabi-Sharifi, F

2010-04-01

Needle insertion simulation and planning systems (SPSs) will play an important role in diminishing inappropriate insertions into soft tissues and resultant complications. Difficulties in SPS development are due in large part to the computational requirements of the extensive calculations in finite element (FE) models of tissue. For clinical feasibility, the computational speed of SPSs must be improved. At the same time, a realistic model of tissue properties that reflects large and velocity-dependent deformations must be employed. The purpose of this study is to address the aforementioned difficulties by presenting a cost-effective SPS platform for needle insertions into the liver. The study was constrained to planar (2D) cases, but can be extended to 3D insertions. To accommodate large and velocity-dependent deformations, a hyperviscoelastic model was devised to produce an FE model of liver tissue. Material constants were identified by a genetic algorithm applied to the experimental results of unconfined compressions of bovine liver. The approach for SPS involves B-spline interpolations of sample data generated from the FE model of liver. Two interpolation-based models are introduced to approximate puncture times and to approximate the coordinates of FE model nodes interacting with the needle tip as a function of the needle initiation pose; the latter was also a function of postpuncture time. A real-time simulation framework is provided, and its computational benefit is highlighted by comparing its performance with the FE method. A planning algorithm for optimal needle initiation was designed, and its effectiveness was evaluated by analyzing its accuracy in reaching a random set of targets at different resolutions of sampled data using the FE model. The proposed simulation framework can easily surpass haptic rates (>500 Hz), even with a high pose resolution level ( approximately 30). The computational time required to update the coordinates of the node at the

An image guidance system for positioning robotic cochlear implant insertion tools

Science.gov (United States)

Bruns, Trevor L.; Webster, Robert J.

2017-03-01

Cochlear implants must be inserted carefully to avoid damaging the delicate anatomical structures of the inner ear. This has motivated several approaches to improve the safety and efficacy of electrode array insertion by automating the process with specialized robotic or manual insertion tools. When such tools are used, they must be positioned at the entry point to the cochlea and aligned with the desired entry vector. This paper presents an image guidance system capable of accurately positioning a cochlear implant insertion tool. An optical tracking system localizes the insertion tool in physical space while a graphical user interface incorporates this with patient- specific anatomical data to provide error information to the surgeon in real-time. Guided by this interface, novice users successfully aligned the tool with an mean accuracy of 0.31 mm.

Ultrasonic Guided Insertion of Central Venous Catheter in Infants ...

African Journals Online (AJOL)

Background/Purpose: ultrasound is licensed for application of regional blocks and insertion of vascular access. We aimed to compare ultrasonic guided (USG) and anatomical landmark technique (ALT) for insertion of central venous catheter (CVC) as regard success rate and rate of complications in infants and children.

How ticks get under your skin: insertion mechanics of the feeding apparatus of Ixodes ricinus ticks

Science.gov (United States)

Richter, Dania; Matuschka, Franz-Rainer; Spielman, Andrew; Mahadevan, L.

2013-01-01

The tick Ixodes ricinus uses its mouthparts to penetrate the skin of its host and to remain attached for about a week, during which time Lyme disease spirochaetes may pass from the tick to the host. To understand how the tick achieves both tasks, penetration and attachment, with the same set of implements, we recorded the insertion events by cinematography, interpreted the mouthparts’ function by scanning electron microscopy and identified their points of articulation by confocal microscopy. Our structural dynamic observations suggest that the process of insertion and attachment occurs via a ratchet-like mechanism with two distinct stages. Initially, the two telescoping chelicerae pierce the skin and, by moving alternately, generate a toehold. Subsequently, a breaststroke-like motion, effected by simultaneous flexure and retraction of both chelicerae, pulls in the barbed hypostome. This combination of a flexible, dynamic mechanical ratchet and a static holdfast thus allows the tick to solve the problem of how to penetrate skin and also remain stuck for long periods of time. PMID:24174106

Simulation study of a depth-encoding positron emission tomography detector inserting horizontal-striped glass between crystal layers

Science.gov (United States)

Kim, Kyu Bom; Choi, Yong; Kang, Jihoon

2017-10-01

This study introduces a depth-encoding positron emission tomography (PET) detector inserting a horizontal-striped glass between the pixilated scintillation crystal layers. This design allows light spreading so that scintillation photons can travel only through the X direction and allows alteration in the light distribution so that it can generate a unique pattern diagram of the two-dimensional (2-D) flood histogram that identifies depth position as well as X-Y position of γ-ray interaction. A Monte Carlo simulation was conducted for the assessment of the depth of interaction (DOI)-PET detector. The traced light distribution for each event was converted into the 2-D flood histogram. Light loss caused by inserting the horizontal-striped glass between the crystal layers was estimated. Applicable weighting factors were examined for each DOI-PET detector. No considerable degradation of light loss was observed. The flood histogram, without overlapping of each crystal position, can be generated for the DOI detector based on each crystal block by inserting the horizontal-striped glass with a thickness of >1 mm and the modified resistive charge division networks with applicable weighting factors. This study demonstrated that the proposed DOI-PET detector can extract the three-dimensional γ-ray interaction position without considerable performance degradations of the PET detector from the 2-D flood histogram.

Fireplace insert and its parameters depend on the used glazing

Science.gov (United States)

Papučík, Štefan; Čaja, Alexander

2016-06-01

The contribution deals with the analysis of the impact of using double glass to change the performance and emission parameters of the fireplace insert. Conventional fireplace inserts are equipped with heat-resistant glass, which is resistant to high temperatures. For this type of inserts are required to be radiant constituent maximized. Prevailing part of heat is into the interior gets just by radiation through the glazed part. The hot water fireplace inserts is the requirement that the radiant constituent to the environment to a minimum. Therefore, instead of a single glass using double glazing which is intended to reduce this part of heat transfer. The temperature in the furnace is increased, and transmitted most of the heat into the water.

Facile construction of a random protein domain insertion library using an engineered transposon.

Science.gov (United States)

Shah, Vandan; Pierre, Brennal; Kim, Jin Ryoun

2013-01-15

Insertional fusion between multiple protein domains represents a novel means of creating integrated functionalities. Currently, there is no robust guideline for selection of insertion sites ensuring the desired functional outcome of insertional fusion. Therefore, construction and testing of random domain insertion libraries, in which a host protein domain is randomly inserted into a guest protein domain, significantly benefit extensive exploration of sequence spaces for insertion sites. Short peptide residues are usually introduced between protein domains to alleviate structural conflicts, and the interdomain linker residues may affect the functional outcome of protein insertion complexes. Unfortunately, optimal control of interdomain linker residues is not always available in conventional methods used to construct random domain insertion libraries. Moreover, most conventional methods employ blunt-end rather than sticky-end ligation between host and guest DNA fragments, thus lowering library construction efficiency. Here, we report the facile construction of random domain insertion libraries using an engineered transposon. We show that random domain insertion with optimal control of interdomain linker residues was possible with our engineered transposon-based method. In addition, our method employs sticky-end rather than blunt-end ligation between host and guest DNA fragments, thus allowing for facile construction of relatively large sized libraries. Copyright © 2012 Elsevier Inc. All rights reserved.

TEMAC, Top Event Sensitivity Analysis

International Nuclear Information System (INIS)

Iman, R.L.; Shortencarier, M.J.

1988-01-01

1 - Description of program or function: TEMAC is designed to permit the user to easily estimate risk and to perform sensitivity and uncertainty analyses with a Boolean expression such as produced by the SETS computer program. SETS produces a mathematical representation of a fault tree used to model system unavailability. In the terminology of the TEMAC program, such a mathematical representation is referred to as a top event. The analysis of risk involves the estimation of the magnitude of risk, the sensitivity of risk estimates to base event probabilities and initiating event frequencies, and the quantification of the uncertainty in the risk estimates. 2 - Method of solution: Sensitivity and uncertainty analyses associated with top events involve mathematical operations on the corresponding Boolean expression for the top event, as well as repeated evaluations of the top event in a Monte Carlo fashion. TEMAC employs a general matrix approach which provides a convenient general form for Boolean expressions, is computationally efficient, and allows large problems to be analyzed. 3 - Restrictions on the complexity of the problem - Maxima of: 4000 cut sets, 500 events, 500 values in a Monte Carlo sample, 16 characters in an event name. These restrictions are implemented through the FORTRAN 77 PARAMATER statement

Symplectic models for general insertion devices

International Nuclear Information System (INIS)

Wu, Y.; Forest, E.; Robin, D. S.; Nishimura, H.; Wolski, A.; Litvinenko, V. N.

2001-01-01

A variety of insertion devices (IDs), wigglers and undulators, linearly or elliptically polarized,are widely used as high brightness radiation sources at the modern light source rings. Long and high-field wigglers have also been proposed as the main source of radiation damping at next generation damping rings. As a result, it becomes increasingly important to understand the impact of IDs on the charged particle dynamics in the storage ring. In this paper, we report our recent development of a general explicit symplectic model for IDs with the paraxial ray approximation. High-order explicit symplectic integrators are developed to study real-world insertion devices with a number of wiggler harmonics and arbitrary polarizations

Study of pH (low) insertion peptides (pHLIPs) interaction with lipid bilayer of membrane

Science.gov (United States)

Weerakkody, Dhammika

. Understanding the molecular events that occur when a peptide inserts across a membrane, folds, or exits from it and unfolds provides crucial information for the development of new drug delivery agents, as well as improving our understanding of the first step of membrane-associate protein folding. The promise of exploiting tumor acidosis as a cancer biomarker has not been fully realized in clinical practice, even though the acidity has been a known property since the work of Otto Warburg nearly a century ago. The problem has been to find a practical way to target acidity. pHLIP reversibly folds and inserts across membranes in response to pH changes, and this discovery has led to a novel way to target acidic tissue. Steady state biophysical studies have revealed the molecular mechanism of pHLIP action, which is based on the increase of hydrophobicity of carboxyl groups when they become protonated under mildly acidic conditions, leading to peptide insertion into a membrane. It has been shown that pHLIP can target acidic tissue and selectively translocate polar, cell-impermeable molecules across membranes in response to low extracellular pH. As noted in the Molecular Imaging and Contrast Agent Database (MICAD) at NCBI, a pHLIP labeled with a fluorescent dye, or a PET- and SPECT- agents (64Cu-DOTA, 18F, 99Tc) is a marker for in vivo acidity. All prior studies in vivo were carried out with the WT-pHLIP sequence and showed that a good contrast and tumor to blood ratio can be achieved only more than 24 hours after pHLIP injection, when it has accumulated in the tumor and largely cleared from the blood. However, for the use of pHLIP-based radioactive imaging agents in the clinic, a more rapid background signal reduction is absolutely essential. We have conducted research in order to address this important need, to tune tumor targeting properties, and to broaden our understanding of the molecular mechanism of pHLIP action. A family of 16 pHLIP variants has been designed based on chemical

RERTR-12 Insertion 1 Irradiation Summary Report

International Nuclear Information System (INIS)

Perez, D.M.; Lillo, M.A.; Chang, G.S.; Woolstenhulme, N.E.; Roth, G.A.; Wachs, D.M.

2012-01-01

The Reduced Enrichment for Research and Test Reactor (RERTR) experiment RERTR-12 was designed to provide comprehensive information on the performance of uranium-molybdenum (U-Mo) based monolithic fuels for research reactor applications. RERTR-12 insertion 1 includes the capsules irradiated during the first two irradiation cycles. These capsules include Z, X1, X2 and X3 capsules. The following report summarizes the life of the RERTR-12 insertion 1 experiment through end of irradiation, including as-run neutronic analysis results, thermal analysis results and hydraulic testing results.

RERTR-12 Insertion 2 Irradiation Summary Report

International Nuclear Information System (INIS)

Perez, D.M.; Chang, G.S.; Wachs, D.M.; Roth, G.A.; Woolstenhulme, N.E.

2012-01-01

The Reduced Enrichment for Research and Test Reactor (RERTR) experiment RERTR-12 was designed to provide comprehensive information on the performance of uranium-molybdenum (U-Mo) based monolithic fuels for research reactor applications.1 RERTR-12 insertion 2 includes the capsules irradiated during the last three irradiation cycles. These capsules include Z, Y1, Y2 and Y3 type capsules. The following report summarizes the life of the RERTR-12 insertion 2 experiment through end of irradiation, including as-run neutronic analysis results, thermal analysis results and hydraulic testing results.

Summary of experimental insertions workshop

International Nuclear Information System (INIS)

Sandweiss, J.; Month, M.

1976-01-01

An ISABELLE workshop of the summer 1976 series, which was held at Brookhaven August 16--20, focused on the design and utilization of the experimental insertions. The goals of the workshop are outlined, and a few general remarks about the results are presented

Unicortical self-drilling external fixator pins reduce thermal effects during pin insertion.

Science.gov (United States)

Greinwald, Markus; Varady, Patrick A; Augat, Peter

2017-12-14

External fixation is associated with the risk of pin loosening and pin infection potentially associated to thermal bone necrosis during pin insertion. This study aims to investigate if the use of external fixator systems with unicortical pins reduces the heat production during pin insertion compared to fixators with bicortical pins. Porcine bone specimens were employed to determine bone temperatures during insertion of fixator pins. Two thermographic cameras were used for a simultaneous temperature measurement on the bone surface (top view) and a bone cross-section (front view). Self-drilling unicortical and bicortical pins were inserted at different rotational speeds: (30-600) rpm. Maximum and mean temperatures of the emerging bone debris, bone surface and bone cross-section were analyzed. Maximum temperatures of up to 77 ± 26 °C were measured during pin insertion in the emerging debris and up to 42 ± 2 °C on the bone surface. Temperatures of the emerging debris increased with increasing rotational speeds. Bicortical pin insertion generated significantly higher temperatures at low insertion speed (30 rpm) CONCLUSION: The insertion of external fixator pins can generate a considerable amount of heat around the pins, primarily emerging from bone debris and at higher insertion speeds. Our findings suggest that unicortical, self-drilling fixator pins have a decreased risk for thermal damage, both to the surrounding tissue and to the bone itself.

The first LHC insertion quadrupole

CERN Multimedia

2004-01-01

An important milestone was reached in December 2003 at the CERN Magnet Assembly Facility. The team from the Accelerator Technology - Magnet and Electrical Systems group, AT-MEL, completed the first special superconducting quadrupole for the LHC insertions which house the experiments and major collider systems. The magnet is 8 metres long and contains two matching quadrupole magnets and an orbit corrector, a dipole magnet, used to correct errors in quadrupole alignment. All were tested in liquid helium and reached the ultimate performance criteria required for the LHC. After insertion in the cryostat, the superconducting magnet will be installed as the Q9 quadrupole in sector 7-8, the first sector of the LHC to be put in place in 2004. Members of the quadrupole team, from the AT-MEL group, gathered around the Q9 quadrupole at its inauguration on 12 December 2003 in building 181.

Spontaneous insertion of GPI anchors into cholesterol-rich membrane domains

Directory of Open Access Journals (Sweden)

Jing Li

2018-05-01

Full Text Available GPI-Anchored proteins (GPI-APs can be exogenously transferred onto bilayer membranes both in vivo and in vitro, while the mechanism by which this transfer process occurs is unknown. In this work, we used atomistic molecular dynamics simulations and free energy calculations to characterize the essential influence of cholesterol on insertion of the GPI anchors into plasma membranes. We demonstrate, both dynamically and energetically, that in the presence of cholesterol, the tails of GPI anchors are able to penetrate inside the core of the lipid membrane spontaneously with a three-step mechanism, while in the absence of cholesterol no spontaneous insertion was observed. We ascribe the failure of insertion to the strong thermal fluctuation of lipid molecules in cholesterol-free bilayer, which generates a repulsive force in entropic origin. In the presence of cholesterol, however, the fluctuation of lipids is strongly reduced, thus decreasing the barrier for the anchor insertion. Based on this observation, we propose a hypothesis that addition of cholesterol creates vertical creases in membranes for the insertion of acyl chains. Moreover, we find that the GPI anchor could also spontaneously inserted into the boundary between cholesterol-rich and cholesterol-depleted domains. Our results shed light on the mechanism of cholesterol-mediated interaction between membrane proteins with acyl chain and plasma membranes in living cells.

Spontaneous insertion of GPI anchors into cholesterol-rich membrane domains

Science.gov (United States)

Li, Jing; Liu, Xiuhua; Tian, Falin; Yue, Tongtao; Zhang, Xianren; Cao, Dapeng

2018-05-01

GPI-Anchored proteins (GPI-APs) can be exogenously transferred onto bilayer membranes both in vivo and in vitro, while the mechanism by which this transfer process occurs is unknown. In this work, we used atomistic molecular dynamics simulations and free energy calculations to characterize the essential influence of cholesterol on insertion of the GPI anchors into plasma membranes. We demonstrate, both dynamically and energetically, that in the presence of cholesterol, the tails of GPI anchors are able to penetrate inside the core of the lipid membrane spontaneously with a three-step mechanism, while in the absence of cholesterol no spontaneous insertion was observed. We ascribe the failure of insertion to the strong thermal fluctuation of lipid molecules in cholesterol-free bilayer, which generates a repulsive force in entropic origin. In the presence of cholesterol, however, the fluctuation of lipids is strongly reduced, thus decreasing the barrier for the anchor insertion. Based on this observation, we propose a hypothesis that addition of cholesterol creates vertical creases in membranes for the insertion of acyl chains. Moreover, we find that the GPI anchor could also spontaneously inserted into the boundary between cholesterol-rich and cholesterol-depleted domains. Our results shed light on the mechanism of cholesterol-mediated interaction between membrane proteins with acyl chain and plasma membranes in living cells.

Ex vivo rabbit cornea diffusion studies with a soluble insert of moxifloxacin.

Science.gov (United States)

Sebastián-Morelló, María; Calatayud-Pascual, María Aracely; Rodilla, Vicent; Balaguer-Fernández, Cristina; López-Castellano, Alicia

2018-02-01

The objective of this research was to develop and evaluate an ocular insert for the controlled drug delivery of moxifloxacin which could perhaps be used in the treatment of corneal keratitis or even bacterial endophthalmitis. We have evaluated the ex vivo ocular diffusion of moxifloxacin through rabbit cornea, both fresh and preserved under different conditions. Histological studies were also carried out. Subsequently, drug matrix inserts were prepared using bioadhesive polymers. The inserts were evaluated for their physicochemical parameters. Ophthalmic ex vivo permeation of moxifloxacin was carried out with the most promising insert. The formulate insert was thin and provided higher ocular diffusion than commercial formulations. Ocular diffusion studies revealed significant differences between fresh and frozen corneas. Histological examinations also showed differences in the thickness of stroma between fresh and frozen corneas. The ophthalmic insert we have developed allows a larger quantity of moxifloxacin to permeate through the cornea than existing commercial formulations of the drug. Ocular delivery of moxifloxacin with this insert could be a new approach for the treatment of eye diseases.

Metallographic study of reconstitution welding in inserts of 1 cm3

International Nuclear Information System (INIS)

Romero C, J.; Garcia R, R.; Fernandez T, F.; Perez R, N.; Rocamontes A, M.

2007-01-01

In this article, the welding metallographic study carried out in Charpy test tubes reconstituted with notch in 'V', used in the surveillance programs of the vessel in nucleo electric plants is described. Inserts of 1 cm 3 are used, where the inserts are usually rectangular of minimum 18 millimeters of length. The importance of using inserts of 1 cm 3 is that the mechanical properties can be measured in another direction of the vessel steel, when changing the direction or sense of the notch in 'V' or the face where this notch is made in the insert. (Author)

Using variable transformations to perform common event analysis

International Nuclear Information System (INIS)

Worrell, R.B.

1977-01-01

Any analytical method for studying the effect of common events on the behavior of a system is considered as being a form of common event analysis. The particular common events that are involved often represent quite different phenomena, and this has led to the development of different kinds of common event analysis. For example, common mode failure analysis, common cause analysis, critical location analysis, etc., are all different kinds of common event analysis for which the common events involved represent different phenomena. However, the problem that must be solved for each of these different kinds of common event analysis is essentially the same: Determine the effect of common events on the behavior of a system. Thus, a technique that is useful in achieving one kind of common event analysis is often useful in achieving other kinds of common event analysis

Blind bedside insertion of small bowel feeding tubes.

LENUS (Irish Health Repository)

Duggan, SN

2009-12-01

The use of Naso-Jejunal (NJ) feeding is limited by difficulty in feeding tube placement. Patients have traditionally required transfer to Endoscopy or Radiology for insertion of small bowel feeding tubes, with clear resource implications. We hypothesised that the adoption of a simple bedside procedure would be effective and reduce cost. Clinical nutrition and nurse specialist personnel were trained in the 10\\/10\\/10 method of blind bedside NJ insertion.

Second harmonic sound field after insertion of a biological tissue sample

Science.gov (United States)

Zhang, Dong; Gong, Xiu-Fen; Zhang, Bo

2002-01-01

Second harmonic sound field after inserting a biological tissue sample is investigated by theory and experiment. The sample is inserted perpendicular to the sound axis, whose acoustical properties are different from those of surrounding medium (distilled water). By using the superposition of Gaussian beams and the KZK equation in quasilinear and parabolic approximations, the second harmonic field after insertion of the sample can be derived analytically and expressed as a linear combination of self- and cross-interaction of the Gaussian beams. Egg white, egg yolk, porcine liver, and porcine fat are used as the samples and inserted in the sound field radiated from a 2 MHz uniformly excited focusing source. Axial normalized sound pressure curves of the second harmonic wave before and after inserting the sample are measured and compared with the theoretical results calculated with 10 items of Gaussian beam functions.

Multiple Evolutionary Events Involved in Maintaining Homologs of Resistance to Powdery Mildew 8 in Brassica napus.

Science.gov (United States)

Li, Qin; Li, Jing; Sun, Jin-Long; Ma, Xian-Feng; Wang, Ting-Ting; Berkey, Robert; Yang, Hui; Niu, Ying-Ze; Fan, Jing; Li, Yan; Xiao, Shunyuan; Wang, Wen-Ming

2016-01-01

The Resistance to Powdery Mildew 8 (RPW8) locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs) in Brassica rapa and three in Brassica oleracea (BoHRs). Brassica napus (Bn) is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs). It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here, we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion, and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

Public Outreach Guerilla Style: Just Add Science to Existing Events

Science.gov (United States)

Gelderman, Richard

2016-01-01

We report on a campaign to use the visual appeal of astronomy as a gateway drug to inject public outreach into settings where people aren't expecting an encounter with science. Our inspiration came from the team at guerillascience.org, who have earned a reputation for creating, at sites around the world, "experiences and events that are unexpected, thought-provoking, but, above all, that delight and entertain." Our goal is to insert astronomy into existing festivals of music, culture, and art; county and state fairs; sporting events; and local farmer's markets. With volunteers and near-zero budgets, we have been able to meaningfully engage with audience members who would never willingly attend an event advertised as science related. By purposefully relating astronomy to the non-science aspects of the event that caused the audience members to attend, new learning experiences are created that alter the often negative pre-conceived notions about science that many of them held before our encounter.

Event data collection and database development during plant shutdown and low power operations at domestic and foreign reactors

International Nuclear Information System (INIS)

Kim, T. Y.; Park, J. H.; Han, S. J.; Im, H. K.; Jang, S. C.

2003-01-01

To reduce conservatism and to obtain completeness for Low Power and ShutDown(LPSD) PSA of nuclear plants, total of 625 event data have collected during shutdown and low power operations which have occurred during about 30 years at nuclear power plants of USA and European countries including 2 domestic events. To utilize efficiently these event data, a database program which is called LEDB (Low power and shutdown Event Database) was developed and all the event data collected were inserted in that program. By reviewing and analyzing these event data various way, a lot of very useful insights and ideas for preventing similar events from reoccurrence in domestic nuclear power plants can be obtained

Wireless cardiac action potential transmission with ultrasonically inserted silicon microprobes

International Nuclear Information System (INIS)

Shen, C J; Ramkumar, A; Lal, A; Gilmour, R F Jr

2011-01-01

This paper reports on the integration of ultrasonically inserted horn-shaped cardiac probes with wireless transmission of 3D cardiac action potential measurement for applications in ex vivo preparations such as monitoring the onset of ventricular fibrillation. Ultrasonically inserted silicon horn probes permit reduced penetration force during insertion, allowing silicon, a brittle material, to penetrate cardiac tissue. The probes also allow recording from multiple sites that are lithographically defined. An application-specific integrated circuit has been designed with a 40 dB amplifying stage and a frequency modulating oscillator at 95 MHz to wirelessly transmit the recorded action potentials. This ultrasonically inserted microprobe wireless system demonstrates the initial results in wireless monitoring of 3D action potential propagation, and the extraction of parameters of interest including the action potential duration and diastolic interval

Event Investigation

International Nuclear Information System (INIS)

Korosec, D.

2000-01-01

The events in the nuclear industry are investigated from the license point of view and from the regulatory side too. It is well known the importance of the event investigation. One of the main goals of such investigation is to prevent the circumstances leading to the event and the consequences of the event. The protection of the nuclear workers against nuclear hazard, and the protection of general public against dangerous effects of an event could be achieved by systematic approach to the event investigation. Both, the nuclear safety regulatory body and the licensee shall ensure that operational significant events are investigated in a systematic and technically sound manner to gather information pertaining to the probable causes of the event. One of the results should be appropriate feedback regarding the lessons of the experience to the regulatory body, nuclear industry and general public. In the present paper a general description of systematic approach to the event investigation is presented. The systematic approach to the event investigation works best where cooperation is present among the different divisions of the nuclear facility or regulatory body. By involving management and supervisors the safety office can usually improve their efforts in the whole process. The end result shall be a program which serves to prevent events and reduce the time and efforts solving the root cause which initiated each event. Selection of the proper method for the investigation and an adequate review of the findings and conclusions lead to the higher level of the overall nuclear safety. (author)

Accident sequence precursor events with age-related contributors

Energy Technology Data Exchange (ETDEWEB)

Murphy, G.A.; Kohn, W.E.

1995-12-31

The Accident Sequence Precursor (ASP) Program at ORNL analyzed about 14.000 Licensee Event Reports (LERs) filed by US nuclear power plants 1987--1993. There were 193 events identified as precursors to potential severe core accident sequences. These are reported in G/CR-4674. Volumes 7 through 20. Under the NRC Nuclear Plant Aging Research program, the authors evaluated these events to determine the extent to which component aging played a role. Events were selected that involved age-related equipment degradation that initiated an event or contributed to an event sequence. For the 7-year period, ORNL identified 36 events that involved aging degradation as a contributor to an ASP event. Except for 1992, the percentage of age-related events within the total number of ASP events over the 7-year period ({approximately}19%) appears fairly consistent up to 1991. No correlation between plant ape and number of precursor events was found. A summary list of the age-related events is presented in the report.

BIM-Mediated Membrane Insertion of the BAK Pore Domain Is an Essential Requirement for Apoptosis

Directory of Open Access Journals (Sweden)

Kathrin Weber

2013-10-01

Full Text Available BAK activation represents a key step during apoptosis, but how it converts into a mitochondria-permeabilizing pore remains unclear. By further delineating the structural rearrangements involved, we reveal that BAK activation progresses through a series of independent steps: BH3-domain exposure, N-terminal change, oligomerization, and membrane insertion. Employing a “BCL-XL-addiction” model, we show that neutralization of BCL-XL by the BH3 mimetic ABT-737 resulted in death only when cells were reconstituted with BCL-XL:BAK, but not BCL-2/ BCL-XL:BIM complexes. Although this resembles the indirect model, release of BAK from BCL-XL did not result in spontaneous adoption of the pore conformation. Commitment to apoptosis required association of the direct activator BIM with oligomeric BAK promoting its conversion to a membrane-inserted pore. The sequential nature of this cascade provides multiple opportunities for other BCL-2 proteins to interfere with or promote BAK activation and unites aspects of the indirect and direct activation models.

Nursing care as a predictor of phlebitis related to insertion of a peripheral venous cannula in emergency departments: findings from a prospective study.

Science.gov (United States)

Palese, A; Ambrosi, E; Fabris, F; Guarnier, A; Barelli, P; Zambiasi, P; Allegrini, E; Bazoli, L; Casson, P; Marin, M; Padovan, M; Picogna, M; Taddia, P; Salmaso, D; Chiari, P; Marognolli, O; Canzan, F; Saiani, L

2016-03-01

To date, few studies have investigated the occurrence of phlebitis related to insertion of a peripheral venous cannula (PVC) in an emergency department (ED). To describe the natural history of ED-inserted PVC site use; the occurrence and severity of PVC-related phlebitis; and associations with patient, PVC and nursing care factors. A prospective study was undertaken of 1262 patients treated as urgent cases in EDs who remained in a medical unit for at least 24h. The first PVC inserted was observed daily until its removal; phlebitis was measured using the Visual Infusion Phlebitis Scale. Data on patient, PVC, nursing care and organizational variables were collected, and a time-to-event analysis was performed. The prevalence of PVC-related phlebitis was 31%. The cumulative incidence (78/391) was almost 20% three days after insertion, and reached >50% (231/391) five days after insertion. Being in a specialized hospital [hazard ratio (HR) 0.583, 95% confidence interval (CI) 0.366-0.928] and receiving more nursing care (HR 0.988, 95% CI 0.983-0.993) were protective against PVC-related phlebitis at all time points. Missed nursing care increased the incidence of PVC-related phlebitis by approximately 4% (HR 1.038, 95% CI 1.001-1.077). Missed nursing care and expertise of the nurses caring for the patient after PVC insertion affected the incidence of phlebitis; receiving more nursing care and being in a specialized hospital were associated with lower risk of PVC-related phlebitis. These are modifiable risk factors of phlebitis, suggesting areas for intervention at both hospital and unit level. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Evolution-based Virtual Content Insertion with Visually Virtual Interactions in Videos

Science.gov (United States)

Chang, Chia-Hu; Wu, Ja-Ling

With the development of content-based multimedia analysis, virtual content insertion has been widely used and studied for video enrichment and multimedia advertising. However, how to automatically insert a user-selected virtual content into personal videos in a less-intrusive manner, with an attractive representation, is a challenging problem. In this chapter, we present an evolution-based virtual content insertion system which can insert virtual contents into videos with evolved animations according to predefined behaviors emulating the characteristics of evolutionary biology. The videos are considered not only as carriers of message conveyed by the virtual content but also as the environment in which the lifelike virtual contents live. Thus, the inserted virtual content will be affected by the videos to trigger a series of artificial evolutions and evolve its appearances and behaviors while interacting with video contents. By inserting virtual contents into videos through the system, users can easily create entertaining storylines and turn their personal videos into visually appealing ones. In addition, it would bring a new opportunity to increase the advertising revenue for video assets of the media industry and online video-sharing websites.

The Icsbp locus is a common proviral insertion site in mature B-cell lymphomas/plasmacytomas induced by exogenous murine leukemia virus

International Nuclear Information System (INIS)

Ma Shiliang; Sorensen, Annette Balle; Kunder, Sandra; Sorensen, Karina Dalsgaard; Quintanilla-Martinez, Leticia; Morris, David W.; Schmidt, Joerg; Pedersen, Finn Skou

2006-01-01

ICSBP (interferon consensus sequence binding protein)/IRF8 (interferon regulatory factor 8) is an interferon gamma-inducible transcription factor expressed predominantly in hematopoietic cells, and down-regulation of this factor has been observed in chronic myelogenous leukemia and acute myeloid leukemia in man. By screening about 1200 murine leukemia virus (MLV)-induced lymphomas, we found proviral insertions at the Icsbp locus in 14 tumors, 13 of which were mature B-cell lymphomas or plasmacytomas. Only one was a T-cell lymphoma, although such tumors constituted about half of the samples screened. This indicates that the Icsbp locus can play a specific role in the development of mature B-lineage malignancies. Two proviral insertions in the last Icsbp exon were found to act by a poly(A)-insertion mechanism. The remaining insertions were found within or outside Icsbp. Since our results showed expression of Icsbp RNA and protein in all end-stage tumor samples, a simple tumor suppressor function of ICSBP is not likely. Interestingly, proviral insertions at Icsbp have not been reported from previous extensive screenings of mature B-cell lymphomas induced by endogenous MLVs. We propose that ICSBP might be involved in an early modulation of an immune response to exogenous MLVs that might also play a role in proliferation of the mature B-cell lymphomas

Development and comparison of projection and image space 3D nodule insertion techniques

Science.gov (United States)

Robins, Marthony; Solomon, Justin; Sahbaee, Pooyan; Samei, Ehsan

2016-04-01

This study aimed to develop and compare two methods of inserting computerized virtual lesions into CT datasets. 24 physical (synthetic) nodules of three sizes and four morphologies were inserted into an anthropomorphic chest phantom (LUNGMAN, KYOTO KAGAKU). The phantom was scanned (Somatom Definition Flash, Siemens Healthcare) with and without nodules present, and images were reconstructed with filtered back projection and iterative reconstruction (SAFIRE) at 0.6 mm slice thickness using a standard thoracic CT protocol at multiple dose settings. Virtual 3D CAD models based on the physical nodules were virtually inserted (accounting for the system MTF) into the nodule-free CT data using two techniques. These techniques include projection-based and image-based insertion. Nodule volumes were estimated using a commercial segmentation tool (iNtuition, TeraRecon, Inc.). Differences were tested using paired t-tests and R2 goodness of fit between the virtually and physically inserted nodules. Both insertion techniques resulted in nodule volumes very similar to the real nodules (values were all <0.97 for both insertion techniques. These data imply that these techniques can confidently be used as a means of inserting virtual nodules in CT datasets. These techniques can be instrumental in building hybrid CT datasets composed of patient images with virtually inserted nodules.

Characterisation of protein stability in rod-insert vaginal rings.

Science.gov (United States)

Pattani, Aditya; Lowry, Deborah; Curran, Rhonda M; McGrath, Stephanie; Kett, Vicky L; Andrews, Gavin P; Malcolm, R Karl

2012-07-01

A major goal in vaccine development is elimination of the 'cold chain', the transport and storage system for maintenance and distribution of the vaccine product. This is particularly pertinent to liquid formulation of vaccines. We have previously described the rod-insert vaginal ring (RiR) device, comprising an elastomeric body into which are inserted lyophilised, rod-shaped, solid drug dosage forms, and having potential for sustained mucosal delivery of biomacromolecules, such as HIV envelope protein-based vaccine candidates. Given the solid, lyophilised nature of these insert dosage forms, we hypothesised that antigen stability may be significantly increased compared with more conventional solubilised vaginal gel format. In this study, we prepared and tested vaginal ring devices fitted with lyophilised rod inserts containing the model antigen bovine serum albumin (BSA). Both the RiRs and the gels that were freeze-dried to prepare the inserts were evaluated for BSA stability using PAGE, turbidimetry, microbial load, MALDI-TOF and qualitative precipitate solubility measurements. When stored at 4 °C, but not when stored at 40 °C/75% RH, the RiR formulation offered protection against structural and conformational changes to BSA. The insert also retained matrix integrity and release characteristics. The results demonstrate that lypophilised gels can provide relative protection against degradation at lower temperatures compared to semi-solid gels. The major mechanism of degradation at 40 °C/75% RH was shown to be protein aggregation. Finally, in a preliminary study, we found that addition of trehalose to the formulation significantly reduces the rate of BSA degradation compared to the original formulation when stored at 40 °C/75% RH. Establishing the mechanism of degradation, and finding that degradation is decelerated in the presence of trehalose, will help inform further development of RiRs specifically and polymer based freeze-dried systems in general. Copyright

Insertion and crossing region design

International Nuclear Information System (INIS)

Wienands, U.; Beloshitsky, P.

2001-01-01

This article is the summary of the 5-afternoon tutorial on insertions for circular machines. Roughly half the course (Part 1) was spent discussing interaction regions, We start by recapitulating basic beam optics including building blocks. This provides the tools to analyze the basic structure of interaction regions and explore the parameter space. This simple example is then successively refined and made more realistic. Examples of realized interaction regions for both hadron and electron machines are shown and their salient features and differences explained. A brief discussion of solenoid-decoupling brings Part 1 to a close. In Part 2 we discussed various utility sections. Dispersion suppressors are presented in detail discussing the principles as well as the practical implementation of flexible suppressors using LEP as an example. Injection schemes, both single-turn and multi-turn stacking, are presented in depth. The matching of wiggler and undulator insertions and a discussion of the impact of these devices on beam parameters closes out Part 2

Mastery learning improves students skills in inserting intravenous access: a pre-post-study

Directory of Open Access Journals (Sweden)

Friederichs, Hendrik

2016-08-01

Full Text Available Objective: Inserting peripheral venous catheters (PVCs has been identified as a core competency for medical students. Because the performance – even of hygienic standards – of both students and novice physicians is frequently inadequate, medical faculties must focus on competence-based learning objectives and deliberate practice, features that are combined in mastery learning. Our aim was to determine the competency of students in inserting PVCs before and after an educational intervention. Design: This study comprised a skills assessment with pre- and post-tests of a group of third-year students who received a simulation-based intervention. A newly established curriculum involved one hour of practice at inserting PVCs on simulators. Students were required to pass a test (total 21 points, pass mark 20 points developed on the concept of mastery learning. An unannounced follow-up test was performed one week (8 days after the intervention.Setting: The simulation center of the medical faculty in Muenster.Participants: Third-year students who received the intervention.Results: One hundred and nine complete data sets were obtained from 133 students (82.5%. Most students (97.2% passed the test after the intervention (mean score increase from 15.56 to 20.50, <0.001. There was a significant decrease in students’ performance after one week (8 days: only 74.5% of participants passed this retest (mean score reduction from 20.50 to 20.06, <0.001. Conclusion: Mastery learning is an effective form of teaching practical skills to medical students, allowing a thorough preparation for the challenges of daily clinical practice.

ALS insertion device block measurement and inspection

International Nuclear Information System (INIS)

Marks, S.; Carrieri, J.; Cook, C.; Hassenzahl, W.V.; Hoyer, E.; Plate, D.

1991-05-01

The performance specifications for ALS insertion devices require detailed knowledge and strict control of the Nd-Fe-B permanent magnet blocks incorporated in these devices. This paper describes the measurement and inspection apparatus and the procedures designed to qualify and characterize these blocks. A detailed description of a new, automated Helmholtz coil facility for measurement of the three components of magnetic moment is included. Physical block inspection and magnetic moment measurement procedures are described. Together they provide a basis for qualifying blocks and for specifying placement of blocks within an insertion devices' magnetic structures. 1 ref., 4 figs

Master-slave robotic system for needle indentation and insertion.

Science.gov (United States)

Shin, Jaehyun; Zhong, Yongmin; Gu, Chengfan

2017-12-01

Bilateral control of a master-slave robotic system is a challenging issue in robotic-assisted minimally invasive surgery. It requires the knowledge on contact interaction between a surgical (slave) robot and soft tissues. This paper presents a master-slave robotic system for needle indentation and insertion. This master-slave robotic system is able to characterize the contact interaction between the robotic needle and soft tissues. A bilateral controller is implemented using a linear motor for robotic needle indentation and insertion. A new nonlinear state observer is developed to online monitor the contact interaction with soft tissues. Experimental results demonstrate the efficacy of the proposed master-slave robotic system for robotic needle indentation and needle insertion.

Probabilistic analysis and material characterisation of canister insert for spent nuclear fuel. Summary report

Energy Technology Data Exchange (ETDEWEB)

Andersson, Claes-Goeran [Swedish Nuclear Fuel and Waste Management Co., Stockholm (Sweden); Andersson, Mats; Erixon, Bo [AaF Industriteknik, Stockholm (Sweden); Bjoerkegren, Lars-Erik [Swedish Foundry Association, Stockholm (Sweden); Dillstroem, Peter [DNV Technology, Stockholm (Sweden); Minnebo, Philip

2005-11-15

stresses are spatially very limited provided that the requirements for the eccentricity and corner radius of the cassette are met. 3. The probability of fracture by crack growth in regions with tensile stresses dominates at external pressures under 44 MPa. Local plastic collapse dominates at higher pressure. 4. The analysis of plastic collapse only considers the first local collapse event. A total collapse of the insert will occur at a much higher pressure. 5. The tensile tests of the material in the three inserts gave a considerable spread mainly in the elongation values. Low elongation could be attributed to the presence of slag inclusions and areas with low nodularity (roundness) of the graphite and in some case areas with high pearlite content. As the production methods improve, the failure probability will be further reduced.

Improved efficiency of nanoneedle insertion by modification with a cell-puncturing protein

Science.gov (United States)

Ryu, Seunghwan; Matsumoto, Yuta; Matsumoto, Takahiro; Ueno, Takafumi; Silberberg, Yaron R.; Nakamura, Chikashi

2018-03-01

An atomic force microscope (AFM) probe etched into an ultra-sharp cylindrical shape (a nanoneedle) can be inserted into a living cell and mechanical responses of the insertion process are represented as force-distance curves using AFM. A probe-molecule-functionalized nanoneedle can be used to detect intracellular molecules of interest in situ. The insertion efficiencies of nanoneedles vary among cell types due to the cortex structures of cells, and some cell types, such as mouse fibroblast Balb/3T3 cells, show extremely low efficacy of insertion. We addressed this issue by using a cell membrane puncturing protein from bacteriophage T4 (gp5), a needle-like protein that spontaneously penetrates through the cell membrane. Gp5 was immobilized onto a nanoneedle surface. The insertion efficiency of the functionalized nanoneedle increased by over 15% compared to the non-functionalized control. Gp5-modification is a versatile approach in cell manipulation techniques for the insertion of other types of nanostructures into cells.

Breaking the regioselectivity rule for acrylate insertion in the Mizoroki-Heck reaction.

Science.gov (United States)

Wucher, Philipp; Caporaso, Lucia; Roesle, Philipp; Ragone, Francesco; Cavallo, Luigi; Mecking, Stefan; Göttker-Schnetmann, Inigo

2011-05-31

In modern methods for the preparation of small molecules and polymers, the insertion of substrate carbon-carbon double bonds into metal-carbon bonds is a fundamental step of paramount importance. This issue is illustrated by Mizoroki-Heck coupling as the most prominent example in organic synthesis and also by catalytic insertion polymerization. For unsymmetric substrates H(2)C = CHX the regioselectivity of insertion is decisive for the nature of the product formed. Electron-deficient olefins insert selectively in a 2,1-fashion for electronic reasons. A means for controlling this regioselectivity is lacking to date. In a combined experimental and theoretical study, we now report that, by destabilizing the transition state of 2,1-insertion via steric interactions, the regioselectivity of methyl acrylate insertion into palladium-methyl and phenyl bonds can be inverted entirely to yield the opposite "regioirregular" products in stoichiometric reactions. Insights from these experiments will aid the rational design of complexes which enable a catalytic and regioirregular Mizoroki-Heck reaction of electron-deficient olefins.

Marketing research for organizers of sports events

Directory of Open Access Journals (Sweden)

Gašović Milan

2012-01-01

Full Text Available Marketing research, which provide the data and the information for the decision making process, are essential for organizers of sport events, especially to the organizers of the most significant ones. The mentioned marketing research involves: research of the local market, visitors satisfaction research, evaluation of sponsorship effectiveness, research of the sport events economic influence on the local community or host cities, event host attitudes examination-local population and so on. The marketing research process, for the sport event organizers of needs, involves several steps, such as: goal definition, choice of the research method, research instruments determination, interviewer education, information gathering, data processing, data report, conclusions.

Evaluating the patient experience after implantation of a 0.4 mg sustained release dexamethasone intracanalicular insert (DextenzaTM: results of a qualitative survey

Directory of Open Access Journals (Sweden)

Gira JP

2017-03-01

Full Text Available Joseph P Gira,1 Reginald Sampson,2 Steven M Silverstein,3 Thomas R Walters,4 Jamie Lynne Metzinger,5 Jonathan H Talamo5 1Ophthalmology Consultants, St Louis, MO, 2Montebello Medical Center, Inc., Montebello, CA, 3Silverstein Eye Centers, Kansas City, MO, 4Texan Eye, Austin, TX, 5Ocular Therapeutix, Inc., Bedford, MA, USA Purpose: The purpose of this study is to evaluate the patient experience of sustained release dexamethasone intracanalicular insert (Dextenza™ following cataract surgery as part of a Phase III clinical trial program. Methods: This cross-sectional, qualitative evaluation involved individual interviews lasting approximately 45 minutes. Patients from four US investigational study sites who had previously received an insert were enrolled. There were no predesignated end points; this was a qualitative survey seeking a deeper understanding of patient experience. Results: Twenty-five patients were interviewed. Most patients (92% reported the highest level of satisfaction grade with regard to overall product satisfaction. All patients described the insert as comfortable. Most patients (96% described their overall experience with the insert as very convenient or extremely convenient. Twenty-two of 23 (96% participants rated their experience with the insert as “very” or “extremely convenient”, compared to previous topical therapy, and 88% of patients stated that if they were to undergo cataract surgery again, they would request the insert. When asked if they would recommend the insert to family members or friends, 92% stated they would. The survey found that 84% of participants would be willing to pay more for the insert than for eye drop therapy. Conclusion: The dexamethasone insert was found by patients to be highly favorable with regard to overall satisfaction, convenience, and comfort. The insert was well received and largely preferred over topical therapy alternatives following surgery. More extensive evaluation of the

Pain from copper intrauterine device insertion: randomized trial of prophylactic ibuprofen.

Science.gov (United States)

Hubacher, David; Reyes, Veronica; Lillo, Sonia; Zepeda, Ana; Chen, Pai-Lien; Croxatto, Horacio

2006-11-01

This study was undertaken to determine whether 400 mg of prophylactic ibuprofen can alleviate pain from insertion of an intrauterine device (IUD) and to measure level of pain with improved techniques. We conducted a randomized, double-blind, placebo-controlled trial of 2019 first-time IUD users: 1008 women received placebo and 1011 women received 400 mg of ibuprofen. Participants took the single tablet at least 45 minutes before IUD insertion. Immediately after insertion, participants recorded level of pain by using a 10-cm visual analog scale, with the value of 10 meaning "worst imaginable pain." Median level of pain was 1.0 for both ibuprofen and placebo participants; rank test statistics confirmed no difference. Some subgroups of women experienced higher pain (eg, nulliparous women), but ibuprofen still had no important impact on level of pain. Even among first-time users, pain from IUD insertion is generally low. Prophylactic ibuprofen as used in this protocol does not reduce IUD insertion pain.

Internal Fiber Structure of a High-Performing, Additively Manufactured Injection Molding Insert

DEFF Research Database (Denmark)

Hofstätter, Thomas; Baier, Sina; Trinderup, Camilla H.

A standard mold is equipped with additively manufactured inserts in a rectangular shape produced with vat photo polymerization. While the lifetime compared to conventional materials such as brass, steel, and aluminum is reduced, the prototyping and design phase can be shortened significantly...... by using flexible and cost-effective additive manufacturing technologies. Higher production volumes still exceed the capability of additively manufactured inserts, which are overruled by the stronger performance of less-flexible but mechanically advanced materials. In this contribution, the internal...... structure of a high-performing, fiber-reinforced injection molding insert has been analyzed. The insert reached a statistically proven and reproducible lifetime of 4,500 shots, which significantly outperforms any other previously published additively manufactured inserts. Computer tomography, tensile tests...

Verification of Triple Modular Redundancy Insertion for Reliable and Trusted Systems

Science.gov (United States)

Berg, Melanie; LaBel, Kenneth

2016-01-01

If a system is required to be protected using triple modular redundancy (TMR), improper insertion can jeopardize the reliability and security of the system. Due to the complexity of the verification process and the complexity of digital designs, there are currently no available techniques that can provide complete and reliable confirmation of TMR insertion. We propose a method for TMR insertion verification that satisfies the process for reliable and trusted systems.

The Nucleoid Binding Protein H-NS Biases Genome-Wide Transposon Insertion Landscapes

Directory of Open Access Journals (Sweden)

Satoshi Kimura

2016-08-01

Full Text Available Transposon insertion sequencing (TIS; also known as TnSeq is a potent approach commonly used to comprehensively define the genetic loci that contribute to bacterial fitness in diverse environments. A key presumption underlying analyses of TIS datasets is that loci with a low frequency of transposon insertions contribute to fitness. However, it is not known whether factors such as nucleoid binding proteins can alter the frequency of transposon insertion and thus whether TIS output may systematically reflect factors that are independent of the role of the loci in fitness. Here, we investigated whether the histone-like nucleoid structuring (H-NS protein, which preferentially associates with AT-rich sequences, modulates the frequency of Mariner transposon insertion in the Vibrio cholerae genome, using comparative analysis of TIS results from wild-type (wt and Δhns V. cholerae strains. These analyses were overlaid on gene classification based on GC content as well as on extant genome-wide identification of H-NS binding loci. Our analyses revealed a significant dearth of insertions within AT-rich loci in wt V. cholerae that was not apparent in the Δhns insertion library. Additionally, we observed a striking correlation between genetic loci that are overrepresented in the Δhns insertion library relative to their insertion frequency in wt V. cholerae and loci previously found to physically interact with H-NS. Collectively, our findings reveal that factors other than genetic fitness can systematically modulate the frequency of transposon insertions in TIS studies and add a cautionary note to interpretation of TIS data, particularly for AT-rich sequences.

Clinical outcome of narrow diameter implants inserted into allografts

Directory of Open Access Journals (Sweden)

Maurizio Franco

2009-08-01

Full Text Available OBJECTIVE: Narrow diameter implants (NDI (i.e. diameter <3.75 mm are a potential solution for specific clinical situations, such as reduced interradicular bone, thin alveolar crest and replacement of teeth with small cervical diameter. NDI have been available in clinical practice since the 1990s, but only few studies have analyzed their clinical outcome and no study have investigated NDI inserted in fresh-frozen bone (FFB grafts. Thus, a retrospective study on a series of NDI placed in homologue FFB was designed to evaluate their clinical outcome. MATERIAL AND METHODS: In the period between December 2003 and December 2006, 36 patients (22 females and 14 males, mean age 53 years with FFB grafts were selected and 94 different NDI were inserted. The mean follow-up was 25 months. To evaluate the effect of several host-, surgery-, and implant-related factors, marginal bone loss (MBL was considered an indicator of success rate (SCR. The Kaplan Meier algorithm and Cox regression were used. RESULTS: Only 5 out of 94 implants were lost (i.e. survival rate - SVR 95.7% and no differences were detected among the studied variables. On the contrary, the Cox regression showed that the graft site (i.e. maxilla reduced MBL. CONCLUSIONS: NDI inserted in FFB have a high SVR and SCR similar to those reported in previous studies on regular and NDI inserted in non-grafted jaws. Homologue FFB is a valuable material in the insertion of NDI.

Method for reducing x-ray background signals from insertion device x-ray beam position monitors

Directory of Open Access Journals (Sweden)

Glenn Decker

1999-11-01

Full Text Available A method is described that provides a solution to the long-standing problem of stray radiation-induced signals on photoemission-based x-ray beam position monitors (BPMs located on insertion device x-ray beam lines. The method involves the introduction of a chicane into the accelerator lattice that directs unwanted x radiation away from the photosensitive x-ray BPM blades. This technique has been implemented at the Advanced Photon Source, and experimental confirmation of the technique is provided.

ATLAS insertable B-layer

Czech Academy of Sciences Publication Activity Database

Marčišovský, Michal

2011-01-01

Roč. 633, č. 1 (2011), "S224"-"S225" ISSN 0168-9002. [International workshop on radiation imaging detectors /11./. Praha, 26.06.2009-02.07.2009] R&D Projects: GA MŠk LA08015; GA MŠk LA08032 Institutional research plan: CEZ:AV0Z10100502 Keywords : ATLAS * pixel detector * insertable B-layer Subject RIV: BF - Elementary Particles and High Energy Physics Impact factor: 1.207, year: 2011

Alternative method for predicting optimal insertion depth of the laryngeal tube in children.

Science.gov (United States)

Kim, J T; Jeon, S Y; Kim, C S; Kim, S D; Kim, H S

2007-11-01

Little information is available about the accuracy of the teeth mark on the laryngeal tube (LT) as a guide to correct placement in children. The aim of this crossover study was to evaluate three methods for optimal insertion depth of the size (#) 2 tube in children weighing 12-25 kg. In 24 children, the LT #2 was consecutively inserted by three different methods: (A) until the thick teeth mark on the tube was aligned with the upper incisors, (B) until resistance was felt, and (C) by inserting to a depth, previously measured, of the curved distance between the cricoid cartilage and the upper incisor. In each case, the depth of insertion, the degree of effective ventilation, the presence of leakage, and the fibreoptic view were assessed. Insertion based on the teeth mark led to a shorter insertion depth and a greater incidence of inadequate ventilation compared with the other two methods. There was no difference in the adequacy of ventilation between methods B and C. The vocal cords were more easily identified with methods B (62.5%) and C (75%) than with method A (12.5%). Insertion of the LT #2 aligned with the teeth mark can result in a shallow insertion depth and inadequate ventilation. The measured distance from the cricoid cartilage to the upper incisor offers alternative guidance for correct LT insertion.

Preprocedural ultrasound examination versus manual palpation for thoracic epidural catheter insertion

Directory of Open Access Journals (Sweden)

Ahmed M Hasanin

2017-01-01

Conclusion: Preprocedural ultrasound imaging increased the incidence of first pass success in thoracic epidural catheter insertion and reduced the catheter insertion time compared to manual palpation method.

Inserts thermal coupling analysis in hexagonal honeycomb plates used for satellite structural design

International Nuclear Information System (INIS)

Boudjemai, A.; Mankour, A.; Salem, H.; Amri, R.; Hocine, R.; Chouchaoui, B.

2014-01-01

Mechanical joints and fasteners are essential elements in joining structural components in mechanical systems. The thermal coupling effect between the adjacent inserts depends to a great extent on the thermal properties of the inserts and the clearance. In this paper the Finite-Element Method (FEM) has been employed to study the insert thermal coupling behaviour of the hexagonal honeycomb panel. Fully coupled thermal analysis was conducted in order to predict thermal coupling phenomena caused by the adjacent inserts under extreme thermal loading conditions. Detailed finite elements models for a honeycomb panel are developed in this study including the insert joints. New approach of the adhesive joint is modelled. Thermal simulations showed that the adjacent inserts cause thermal interference and the adjacent inserts are highly sensitive to the effect of high temperatures. The clearance and thermal interference between the adjacent inserts have an important influence on the satellite equipments (such as the electronics box), which can cause the satellite equipments failures. The results of the model presented in this analysis are significant in the preliminary satellites structural dimensioning which present an effective approach of development by reducing the cost and the time of analysis. - Highlights: •In this work we perform thermal analysis of honeycomb plates using finite element method. •Detailed finite elements models for honeycomb panel are developed in this study including the insert joints. •New approach of the adhesive joint is modelled. •The adjacent inserts cause the thermal interference. •We conclude that this work will help in the analysis and the design of complex satellite structures

Lineage-specific expansions of retroviral insertions within the genomes of African great apes but not humans and orangutans.

Directory of Open Access Journals (Sweden)

Chris T Yohn

2005-04-01

Full Text Available Retroviral infections of the germline have the potential to episodically alter gene function and genome structure during the course of evolution. Horizontal transmissions between species have been proposed, but little evidence exists for such events in the human/great ape lineage of evolution. Based on analysis of finished BAC chimpanzee genome sequence, we characterize a retroviral element (Pan troglodytes endogenous retrovirus 1 [PTERV1] that has become integrated in the germline of African great ape and Old World monkey species but is absent from humans and Asian ape genomes. We unambiguously map 287 retroviral integration sites and determine that approximately 95.8% of the insertions occur at non-orthologous regions between closely related species. Phylogenetic analysis of the endogenous retrovirus reveals that the gorilla and chimpanzee elements share a monophyletic origin with a subset of the Old World monkey retroviral elements, but that the average sequence divergence exceeds neutral expectation for a strictly nuclear inherited DNA molecule. Within the chimpanzee, there is a significant integration bias against genes, with only 14 of these insertions mapping within intronic regions. Six out of ten of these genes, for which there are expression data, show significant differences in transcript expression between human and chimpanzee. Our data are consistent with a retroviral infection that bombarded the genomes of chimpanzees and gorillas independently and concurrently, 3-4 million years ago. We speculate on the potential impact of such recent events on the evolution of humans and great apes.

Load beam unit replaceable inserts for dry coal extrusion pumps

Science.gov (United States)

Saunders, Timothy; Brady, John D.

2012-11-13

A track assembly for a particulate material extrusion pump according to an exemplary aspect of the present disclosure includes a link assembly with a roller bearing. An insert mounted to a load beam located such that the roller bearing contacts the insert.

Swirl flow analysis in a helical wire inserted tube using CFD code

International Nuclear Information System (INIS)

Park, Yusun; Chang, Soon Heung

2010-01-01

An analysis on the two-phase flow in a helical wire inserted tube using commercial CFD code, CFX11.0, was performed in bubbly flow and annular flow regions. The analysis method was validated with the experimental results of Takeshima. Bubbly and annular flows in a 10 mm inner diameter tube with varying pitch lengths and inserted wire diameters were simulated using the same analysis methods after validation. The geometry range of p/D was 1-4 and e/D was 0.08-0.12. The results show that the inserted wire with a larger diameter increased swirl flow generation. An increasing swirl flow was seen as the pitch length increased. Regarding pressure loss, smaller pitch lengths and inserted wires with larger diameters resulted in larger pressure loss. The average liquid film thickness increased as the pitch length and the diameter of the inserted wire increased in the annular flow region. Both in the bubbly flow and annular flow regions, the effect of pitch length on swirl flow generation and pressure loss was more significant than that of the inserted wire diameters. Pitch length is a more dominant factor than inserted wire diameter for the design of the swirl flow generator in small diameter tubes.

Transdiaphragmatic Approach to Attenuate Porto-Azygos Shunts Inserting in the Thorax.

Science.gov (United States)

Or, Matan; Kitshoff, Adriaan; Devriendt, Nausikaa; De Ridder, Marianne; Quist-Rybachuk, Galena; de Rooster, Hilde

2016-11-01

To describe the surgical technique and document the application of a transdiaphragmatic approach to attenuate porto-azygos shunts inserting in the thoracic section of the azygos vein. Cadaveric study and prospective case series. Canine cadavers (n=6) and client-owned dogs with porto-azygos shunts inserting in the thoracic section of the azygos vein (n=9). In the cadavers, the azygos vein was filled with aqueous latex. Landmarks were established for creating a safe transdiaphragmatic approach to the caudal intrathoracic portion of the azygos vein. In the clinical cases, porto-azygos communication was diagnosed by trans-splenic portal scintigraphy. All shunts were attenuated close to their insertion site via ventral midline celiotomy and a transdiaphragmatic approach to the shunt. Perioperative complications were recorded. A 3-5 cm incision, 0.5-1 cm ventral and lateral to the level of the aortic hiatus, was made in the pars lumbalis part of the diaphragm. Stay sutures at both sides of the diaphragmatic incision were placed to open up the incision and a retractor was used to push the esophagus away from the aorta. Intrathoracic insertion of the shunt was confirmed intraoperative. Exposure of the shunt insertion site at the azygos vein was excellent in all clinical cases. No intraoperative or postoperative complications were encountered. If thoracic attenuation of a porto-azygos shunt is considered, a transdiaphragmatic approach exposes the insertion site for shunt attenuation. This approach is straightforward, without unnecessary abdominal organ manipulation, and since attenuates at the insertion, avoids missing additional contributing branches. © Copyright 2016 by The American College of Veterinary Surgeons.

Utility Bill Insert for Wastewater Services

Science.gov (United States)

Intended for use by wastewater and water supply utilities, one side of the utility bill insert has information for customers that discharge to sanitary sewer systems; the other side is for customers with septic systems.

[The ISP (Safe Insertion of PICCs) protocol: a bundle of 8 recommendations to minimize the complications related to the peripherally inserted central venous catheters (PICC)].

Science.gov (United States)

Emoli, Alessandro; Cappuccio, Serena; Marche, Bruno; Musarò, Andrea; Scoppettuolo, Giancarlo; Pittiruti, Mauro

2014-01-01

The ISP (Safe Insertion of PICCs) protocol: a bundle of 8 recommendations to minimize the complications related to the peripherally inserted central venous catheters (PICC). The insertion of a peripherally inserted central venous catheter (PICC) is not without risks. The Italian Group for the Study of Long-Term Central Venous Access Devices (GAVeCeLT) has developed a protocol (SIP: Safe Implantation of PICCs) with the aim of minimizing the risks which may be associated with the placement of PICCs. The protocol is based on recommendations available in the literature and on the main clinical practice guidelines. The SIP protocol, a bundle of evidence-based recommendations, it is is easy to use, inexpensive, and cost-effective. If routinely used and carefully inplemented, it greatly reduces complications such as failure of venipuncture, accidental arterial puncture, damage of median nerve, infection and catheter related venous thrombosis.

Seamless lesion insertion in digital mammography: methodology and reader study

Science.gov (United States)

Pezeshk, Aria; Petrick, Nicholas; Sahiner, Berkman

2016-03-01

Collection of large repositories of clinical images containing verified cancer locations is costly and time consuming due to difficulties associated with both the accumulation of data and establishment of the ground truth. This problem poses a significant challenge to the development of machine learning algorithms that require large amounts of data to properly train and avoid overfitting. In this paper we expand the methods in our previous publications by making several modifications that significantly increase the speed of our insertion algorithms, thereby allowing them to be used for inserting lesions that are much larger in size. These algorithms have been incorporated into an image composition tool that we have made publicly available. This tool allows users to modify or supplement existing datasets by seamlessly inserting a real breast mass or micro-calcification cluster extracted from a source digital mammogram into a different location on another mammogram. We demonstrate examples of the performance of this tool on clinical cases taken from the University of South Florida Digital Database for Screening Mammography (DDSM). Finally, we report the results of a reader study evaluating the realism of inserted lesions compared to clinical lesions. Analysis of the radiologist scores in the study using receiver operating characteristic (ROC) methodology indicates that inserted lesions cannot be reliably distinguished from clinical lesions.

Guide tube insert assembly for use in a nuclear reactor

International Nuclear Information System (INIS)

Hopkins, R.J.; Land, J.T.

1992-01-01

This patent describes an internals assembly for a nuclear reactor of the type including an upper support plate and an upper core plate, each having apertures for conducting control rod assemblies into an out of fuel assemblies with the apertures of the upper support plate being aligned with the apertures of the upper core plate, a guide tube insert assembly comprising: an elongated tubular body extending between at least one of the aligned apertures formed in the upper support plate and the upper core plate; guide plates within the elongated tubular body, each of the guide plates having a planar surface extending substantially perpendicular to an axial direction of the tubular body; at least one interconnecting means for interconnecting the guide plates into a guide tube insert assembly such that the guide plates are simultaneously mountable within and removable from the elongated body, and the periphery of each of the guide plates is spaced apart from the inner walls of the elongated tubular body at every point when the insert assembly is mounted within the tubular body, and a stabilizing means for securing the lowermost guide plate of the guide tube insert assembly within the elongated tubular body to prevent rotational and lateral movement between the guide tube insert assembly and the tubular body

Hospital deaths and adverse events in Brazil

Directory of Open Access Journals (Sweden)

Pavão Ana Luiza B

2011-09-01

Full Text Available Abstract Background Adverse events are considered a major international problem related to the performance of health systems. Evaluating the occurrence of adverse events involves, as any other outcome measure, determining the extent to which the observed differences can be attributed to the patient's risk factors or to variations in the treatment process, and this in turn highlights the importance of measuring differences in the severity of the cases. The current study aims to evaluate the association between deaths and adverse events, adjusted according to patient risk factors. Methods The study is based on a random sample of 1103 patient charts from hospitalizations in the year 2003 in 3 teaching hospitals in the state of Rio de Janeiro, Brazil. The methodology involved a retrospective review of patient charts in two stages - screening phase and evaluation phase. Logistic regression was used to evaluate the relationship between hospital deaths and adverse events. Results The overall mortality rate was 8.5%, while the rate related to the occurrence of an adverse event was 2.9% (32/1103 and that related to preventable adverse events was 2.3% (25/1103. Among the 94 deaths analyzed, 34% were related to cases involving adverse events, and 26.6% of deaths occurred in cases whose adverse events were considered preventable. The models tested showed good discriminatory capacity. The unadjusted odds ratio (OR 11.43 and the odds ratio adjusted for patient risk factors (OR 8.23 between death and preventable adverse event were high. Conclusions Despite discussions in the literature regarding the limitations of evaluating preventable adverse events based on peer review, the results presented here emphasize that adverse events are not only prevalent, but are associated with serious harm and even death. These results also highlight the importance of risk adjustment and multivariate models in the study of adverse events.

Insertion of liquid crystal molecules into hydrocarbon monolayers

Energy Technology Data Exchange (ETDEWEB)

Popov, Piotr, E-mail: ppopov@kent.edu; Mann, Elizabeth K. [Department of Physics, Kent State University, Kent, Ohio 44242 (United States); Lacks, Daniel J. [Department of Chemical Engineering, Case Western Reserve University, Cleveland, Ohio 44106 (United States); Jákli, Antal [Liquid Crystal Institute, Kent State University, Kent, Ohio 44242-0001 (United States)

2014-08-07

Atomistic molecular dynamics simulations were carried out to investigate the molecular mechanisms of vertical surface alignment of liquid crystals. We study the insertion of nCB (4-Cyano-4{sup ′}-n-biphenyl) molecules with n = 0,…,6 into a bent-core liquid crystal monolayer that was recently found to provide good vertical alignment for liquid crystals. The results suggest a complex-free energy landscape for the liquid crystal within the layer. The preferred insertion direction of the nCB molecules (core or tail first) varies with n, which can be explained by entropic considerations. The role of the dipole moments was found to be negligible. As vertical alignment is the leading form of present day liquid crystal displays (LCD), these results will help guide improvement of the LCD technology, as well as lend insight into the more general problem of insertion of biological and other molecules into lipid and surfactant layers.

HB+ inserted into the CMS Solenoid

CERN Multimedia

Tejinder S. Virdee, CERN

2006-01-01

The first half of the barrel hadron calorimeter (HB+) has been inserted into the superconducting solenoid of CMS, in preparation for the magnet test and cosmic challenge. The operation went smoothly, lasting a couple of days.

High aspect ratio catalytic reactor and catalyst inserts therefor

Science.gov (United States)

Lin, Jiefeng; Kelly, Sean M.

2018-04-10

The present invention relates to high efficient tubular catalytic steam reforming reactor configured from about 0.2 inch to about 2 inch inside diameter high temperature metal alloy tube or pipe and loaded with a plurality of rolled catalyst inserts comprising metallic monoliths. The catalyst insert substrate is formed from a single metal foil without a central supporting structure in the form of a spiral monolith. The single metal foil is treated to have 3-dimensional surface features that provide mechanical support and establish open gas channels between each of the rolled layers. This unique geometry accelerates gas mixing and heat transfer and provides a high catalytic active surface area. The small diameter, high aspect ratio tubular catalytic steam reforming reactors loaded with rolled catalyst inserts can be arranged in a multi-pass non-vertical parallel configuration thermally coupled with a heat source to carry out steam reforming of hydrocarbon-containing feeds. The rolled catalyst inserts are self-supported on the reactor wall and enable efficient heat transfer from the reactor wall to the reactor interior, and lower pressure drop than known particulate catalysts. The heat source can be oxygen transport membrane reactors.

Family of pH-Low-Insertion-Peptides (pHLIPs)

Science.gov (United States)

Weerakkody, Dhammika; Moshnikova, Anna; Moshnikova, Valentina; Thakur, Mak; Rossi, Bethany; Engelman, Donald; Andreev, Oleg; Reshetnyak, Yana

2012-02-01

pHLIP (pH (Low) Insertion Peptide) is a novel delivery system for targeting of acidic diseased tissue such as solid tumors, sites of inflammation, arthritis and other pathological states. The molecular mechanism of pHLIP action is based on pH-dependent insertion and folding of pHLIP in membrane. We performed sequence variation and investigated 16 pHLIP variants with main goals of understanding the main principles of peptide-lipid interactions and tune delivery capability of pHLIP. The biophysical studies including thermodynamics and kinetics of the peptides interaction with a lipid bilayer of liposomes and cellular membranes were carried out. We found that peptides association to membrane at neutral and low pH could be modulated by 3-4 times. The apparent pK of transition from surface bound to membrane-inserted state could be tuned from 6.5 to 4.5. The rate of peptide's insertion across a bilayer could be enhanced 100 times compared to parent pHLIP. As a result, blood clearance and tumor targeting were modulated in a significant degree. The work is supported by NIH grants CA133890 to OAA, DME, YRK.

Event Boundaries in Memory and Cognition.

Science.gov (United States)

Radvansky, Gabriel A; Zacks, Jeffrey M

2017-10-01

Research on event cognition is rapidly developing and is revealing fundamental aspects of human cognition. In this paper, we review recent and current work that is driving this field forward. We first outline the Event Horizon Model, which broadly describes the impact of event boundaries on cognition and memory. Then, we address recent work on event segmentation, the role of event cognition in working memory and long-term memory, including event model updating, and long term retention. Throughout we also consider how event cognition varies across individuals and groups of people and consider the neural mechanisms involved.

Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

Science.gov (United States)

Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

2017-11-01

In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

Innovations in Air Insertion (Involving Parachutes)

Science.gov (United States)

2008-03-01

loadings and different trim. .........48 Figure 16. Thermal being radiated from a ploughed field.50 Figure 17. A series of ridges can amplify a wave and...Crews," MHQ: The Quarterly Journal of Military History 10, no. Autumn 1998 (1998), 99. 5 Niedermeyer was killed in March of 1922 did parachutes...was killed on a 1998 wing suit jump, the cause was not wing suit related but rather the result of an easily preventable rigging

Forward and reverse genetics: The LORE1 retrotransposon insertion mutants

DEFF Research Database (Denmark)

Fukai, Eigo; Malolepszy, Anna; Sandal, Niels Nørgaard

2014-01-01

The endogenous Lotus retrotransposon 1 (LORE1) transposes in the germ line of Lotus japonicus plants that carry an active element. This feature of LORE1 has been exploited for generation of a large non-transgenic insertion mutant population, where insertions have been annotated using next-generat...

Research on the Influence of Orthopaedic Inserts on Pressure Distribution in the Foot

Directory of Open Access Journals (Sweden)

Ignas Rutulys

2011-02-01

Full Text Available The article examines the influence of individual orthopaedic inserts on pressure distribution in the foot. Feet deformations, types of orthopaedic inserts, materials and pressure in the foot testing methods are discussed. Experimental computer measurements of pressure in the foot before and after the use of inserts have been done. During research, the inserts made of different kinds of materials selected according to human weight, pathology, skin sensitivity and many other reasons has been used. It has been determinated that orthopaedic inserts have a more noticeable impact on children whose feet is adjusted easier if compared with those of adults.Article in Lithuanian

Customizable engineered blood vessels using 3D printed inserts.

Science.gov (United States)

Pinnock, Cameron B; Meier, Elizabeth M; Joshi, Neeraj N; Wu, Bin; Lam, Mai T

2016-04-15

Current techniques for tissue engineering blood vessels are not customizable for vascular size variation and vessel wall thickness. These critical parameters vary widely between the different arteries in the human body, and the ability to engineer vessels of varying sizes could increase capabilities for disease modeling and treatment options. We present an innovative method for producing customizable, tissue engineered, self-organizing vascular constructs by replicating a major structural component of blood vessels - the smooth muscle layer, or tunica media. We utilize a unique system combining 3D printed plate inserts to control construct size and shape, and cell sheets supported by a temporary fibrin hydrogel to encourage cellular self-organization into a tubular form resembling a natural artery. To form the vascular construct, 3D printed inserts are adhered to tissue culture plates, fibrin hydrogel is deposited around the inserts, and human aortic smooth muscle cells are then seeded atop the fibrin hydrogel. The gel, aided by the innate contractile properties of the smooth muscle cells, aggregates towards the center post insert, creating a tissue ring of smooth muscle cells. These rings are then stacked into the final tubular construct. Our methodology is robust, easily repeatable and allows for customization of cellular composition, vessel wall thickness, and length of the vessel construct merely by varying the size of the 3D printed inserts. This platform has potential for facilitating more accurate modeling of vascular pathology, serving as a drug discovery tool, or for vessel repair in disease treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

Mismatch analysis of humeral nailing. Antegrade versus retrograde insertion

International Nuclear Information System (INIS)

Mahaisavariya, B.; Jiamwatthanachai, P.; Aroonjarattham, P.; Aroonjarattham, K.; Wongcumchang, M.; Sitthiseripratip, K.

2011-01-01

Closed humeral nailing is now considered an alternative treatment for humeral-shaft fracture. The nail can be inserted with either the antegrade or retrograde method. We investigated and compared the problem of geometric mismatch of the humeral nail to the humerus between the two methods of insertion. The study was performed using virtual simulation based on computed tomography (CT) data of 76 Thai cadaveric humeri and the commonly used Russell-Taylor humeral nail 8 mm in diameter and 220 mm long. Mismatch of the nail to the intact humerus was analyzed and compared between the antegrade and retrograde nailing approaches. The results showed: the diameter of the medullary canal averaged 7.9-13.8 mm; the minimal reaming diameter to accommodate virtual nail insertion averaged 8.8-14.8 mm for the antegrade and 8.8-29.3 mm for the retrograde approach; the minimal reaming thickness of the inner cortex averaged 0.1-1.5 mm for the antegrade and 0.1-9.9 mm for the retrograde approach; the percentages of cortical bone removed prior to nail insertion were 3.8-107.1% and 3.8-1,287.6% for the antegrade and retrograde approaches, respectively; the eccentricity of the nail-medullary canal center were 0.4-3.4 and 0.4-10.6 mm for the antegrade and retrograde approaches, respectively. Less mismatching occurred with antegrade nailing than with the retrograde approach. Retrograde nailing requires excessive reaming at the distal part of the humerus to accommodate nail insertion. This may create bone weakness and the risk of supracondylar fracture. (author)

Different frontal involvement in ALS and PLS revealed by Stroop event-related potentials and reaction times

Directory of Open Access Journals (Sweden)

Ninfa eAmato

2013-12-01

Full Text Available BACKGROUND: A growing body of evidence suggests a link between cognitive and pathological changes in amyotrophic lateral sclerosis (ALS and in frontotemporal lobar dementia (FTLD. Cognitive deficits have been investigated much less extensively in primary lateral sclerosis (PLS than in ALS. OBJECTIVE: to investigate bioelectrical activity to Stroop test, assessing frontal function, in ALS, PLS and control groups. METHODS: 32 non-demented ALS patients, 10 non-demented PLS patients and 27 healthy subjects were included. Twenty-nine electroencephalography (EEG channels with binaural reference were recorded during covert Stroop task performance, involving mental discrimination of the stimuli and not vocal or motor response. Group effects on event related potentials (ERPs latency were analyzed using statistical multivariate analysis. Topographic analysis was performed using low resolution brain electromagnetic tomography (LORETA. RESULTS: ALS patients committed more errors in the execution of the task but they were not slower, whereas PLS patients did not show reduced accuracy, despite a slowing of reaction times (RTs. The main ERP components were delayed in ALS, but not in PLS, compared with controls. Moreover, RTs speed but not ERP latency correlated with clinical scores. ALS had decreased frontotemporal activity in the P2, P3 and N4 time windows compared to controls. CONCLUSION: These findings suggest a different pattern of psychophysiological involvement in ALS compared with PLS. The former is increasingly recognized to be a multisystems disorder, with a spectrum of executive and behavioural impairments reflecting frontotemporal dysfunction. The latter seems to mainly involve the motor system, with largely spared cognitive functions. Moreover, our results suggest that the covert version of the Stroop task used in the present study, may be useful to assess cognitive state in the very advanced stage of the disease, when other cognitive tasks are not

Manganese oxide octahedral molecular sieves as insertion electrodes for rechargeable Mg batteries

KAUST Repository

Rasul, Shahid

2013-11-01

Magnesium has been inserted electrochemically into manganese oxide octahedral molecular sieves (OMS-5 MnO2) at room temperature. Discharge/charge profiles show that a large amount of Mg, i.e., 0.37 Mg/Mn can be inserted electrochemically using 1 M Mg(ClO4)2/AN electrolyte when OMS-5 is prepared in presence of acetylene black. X-ray diffraction analysis and discharge/charge profiles verify that a solid state solution reaction takes place upon Mg insertion into the host lattice with concurrent reduction of Mn4+ to Mn2+. However, upon each reduction of Mn by Mg insertion and resultant dissolution into electrolyte, decrease in the active compound occurs consequently. A low intrinsic electronic conductivity of OMS-5 was suggested to play a vital role in Mg insertion into the host. © 2013 Elsevier Ltd.

Manganese oxide octahedral molecular sieves as insertion electrodes for rechargeable Mg batteries

KAUST Repository

Rasul, Shahid; Suzuki, Shinya; Yamaguchi, Shu; Miyayama, Masaru

2013-01-01

Magnesium has been inserted electrochemically into manganese oxide octahedral molecular sieves (OMS-5 MnO2) at room temperature. Discharge/charge profiles show that a large amount of Mg, i.e., 0.37 Mg/Mn can be inserted electrochemically using 1 M Mg(ClO4)2/AN electrolyte when OMS-5 is prepared in presence of acetylene black. X-ray diffraction analysis and discharge/charge profiles verify that a solid state solution reaction takes place upon Mg insertion into the host lattice with concurrent reduction of Mn4+ to Mn2+. However, upon each reduction of Mn by Mg insertion and resultant dissolution into electrolyte, decrease in the active compound occurs consequently. A low intrinsic electronic conductivity of OMS-5 was suggested to play a vital role in Mg insertion into the host. © 2013 Elsevier Ltd.

Rhodium catalyzed regioselective arene homologation of aryl urea via double C-H bond activation and migratory insertion of alkyne

Institute of Scientific and Technical Information of China (English)

Yan Wang; Hao Zhou; Ke Xu; Mei-Hua Shen; Hua-Dong Xu

2017-01-01

A convenient rhodium catalyzed oxidative arene homologation of aniline derivatives with symmetrical or unsymmetrical alkynes using Cu(OAc)2 as oxidant is described.Urea group is shown to be effective as a directing group for initial ortho C-H activation.Two migratory insertion events of alkyne into Rh-C bond occur successively,both with complete regioselectivity.This method is particularly useful for synthesis of polyarenes with different substituents,which has not been reported with conventional protocol.A mechanism has been proposed to explain the observed data.

Does insertion of intramuscular electromyographic electrodes alter motor behavior during locomotion?

Science.gov (United States)

Armour Smith, Jo; Kulig, Kornelia

2015-06-01

Intramuscular electromyography (EMG) is commonly used to quantify activity in the trunk musculature. However, it is unclear if the discomfort or fear of pain associated with insertion of intramuscular EMG electrodes results in altered motor behavior. This study examined whether intramuscular EMG affects locomotor speed and trunk motion, and examined the anticipated and actual pain associated with electrode insertion in healthy individuals and individuals with a history of low back pain (LBP). Before and after insertion of intramuscular electrodes into the lumbar and thoracic paraspinals, participants performed multiple repetitions of a walking turn at self-selected and controlled average speed. Low levels of anticipated and actual pain were reported in both groups. Self-selected locomotor speed was significantly increased following insertion of the electrodes. At the controlled speed, the amplitude of sagittal plane lumbo-pelvic motion decreased significantly post-insertion, but the extent of this change was the same in both groups. Lumbo-pelvic motion in the frontal and axial planes and thoraco-lumbar motion in all planes were not affected by the insertions. This study demonstrates that intramuscular EMG is an appropriate methodology to selectively quantify the activation patterns of the individual muscles in the paraspinal group, both in healthy individuals and individuals with a history of LBP. Copyright © 2015 Elsevier Ltd. All rights reserved.

Composition and structure of porcine digital flexor tendon-bone insertion tissues.

Science.gov (United States)

Chandrasekaran, Sandhya; Pankow, Mark; Peters, Kara; Huang, Hsiao-Ying Shadow

2017-11-01

Tendon-bone insertion is a functionally graded tissue, transitioning from 200 MPa tensile modulus at the tendon end to 20 GPa tensile modulus at the bone, across just a few hundred micrometers. In this study, we examine the porcine digital flexor tendon insertion tissue to provide a quantitative description of its collagen orientation and mineral concentration by using Fast Fourier Transform (FFT) based image analysis and mass spectrometry, respectively. Histological results revealed uniformity in global collagen orientation at all depths, indicative of mechanical anisotropy, although at mid-depth, the highest fiber density, least amount of dispersion, and least cellular circularity were evident. Collagen orientation distribution obtained through 2D FFT of histological imaging data from fluorescent microscopy agreed with past measurements based on polarized light microscopy. Results revealed global fiber orientation across the tendon-bone insertion to be preserved along direction of physiologic tension. Gradation in the fiber distribution orientation index across the insertion was reflective of a decrease in anisotropy from the tendon to the bone. We provided elemental maps across the fibrocartilage for its organic and inorganic constituents through time-of-flight secondary ion mass spectrometry (TOF-SIMS). The apatite intensity distribution from the tendon to bone was shown to follow a linear trend, supporting past results based on Raman microprobe analysis. The merit of this study lies in the image-based simplified approach to fiber distribution quantification and in the high spatial resolution of the compositional analysis. In conjunction with the mechanical properties of the insertion tissue, fiber, and mineral distribution results for the insertion from this may potentially be incorporated into the development of a structural constitutive approach toward computational modeling. Characterizing the properties of the native insertion tissue would provide the

Life Cycle Assessment of Fiber-Reinforced Additive Manufacturing for Injection Molding Insert Production

DEFF Research Database (Denmark)

Hofstätter, Thomas; Stotz, Philippe Maurice; Bey, Niki

2017-01-01

Additively manufactured (AM) injection molding (IM) inserts have proved to be capable to substitute conventionally manufactured metal inserts with polymer-based insert enforced with short, virgin, unseized carbon fibers (CFs). It has been shown that the implementation of AM technology resulted......, this contribution provides a comparison of environmental performance of conventionally vs. additively manufactured inserts in a full life cycle perspective indicated in Figure 1, including materials, production, use and end-of-life (EoL) stages....

Insertion of linear 8.4 μm diameter 16 channel carbon fiber electrode arrays for single unit recordings

Science.gov (United States)

Patel, Paras R.; Na, Kyounghwan; Zhang, Huanan; Kozai, Takashi D. Y.; Kotov, Nicholas A.; Yoon, Euisik; Chestek, Cynthia A.

2016-01-01

Objective Single carbon fiber electrodes (d=8.4 μm) insulated with parylene-c and functionalized with PEDOT:pTS have been shown to record single unit activity but manual implantation of these devices with forceps can be difficult. Without an improvement in the insertion method any increase in the channel count by fabricating carbon fiber arrays would be impractical. In this study, we utilize a water soluble coating and structural backbones that allow us to create, implant, and record from fully functionalized arrays of carbon fibers with ~150 μm pitch. Approach Two approaches were tested for the insertion of carbon fiber arrays. The first method used a PEG coating that temporarily stiffened the fibers while leaving a small portion at the tip exposed. The small exposed portion (500 μm – 1 mm) readily penetrated the brain allowing for an insertion that did not require the handling of each fiber by forceps. The second method involved the fabrication of silicon support structures with individual shanks spaced 150 μm apart. Each shank consisted of a small groove that held an individual carbon fiber. Main results Our results showed that the PEG coating allowed for the chronic implantation of carbon fiber arrays in 5 rats with unit activity detected at 31 days post-implant. The silicon support structures recorded single unit activity in 3 acute rat surgeries. In one of those surgeries a stacked device with 3 layers of silicon support structures and carbon fibers was built and shown to readily insert into the brain with unit activity on select sites. Significance From these studies we have found that carbon fibers spaced at ~150 μm readily insert into the brain. This greatly increases the recording density of chronic neural probes and paves the way for even higher density devices that have a minimal scarring response. PMID:26035638

The influence of solid particles density on parameters of multijet insert

Directory of Open Access Journals (Sweden)

Z. Niedźwiedzki

2008-10-01

Full Text Available Some dependences between solid particles density, chosen geometry and exploitation parameters of multijet inserts and developmentof laminar motion in continuous multijet sedimentation process, are presented in this paper. Results are obtained from the analysis of the multijet sedimentation model considering development of laminar motion of the suspension in the multijet insert conduit of the settling tank. The range of the researches covered, in particular, quantities necessary for designing inserts of multijet settling tanks finding application in purifying suspended solids in casting processes. Discussed problem has practical and cognitive meanings and is a base for more efficient designing multijet settling tanks inserts applied in iron and steel industry. Application of most efficient construction and exploitation parameters allows designing devices of lower dimensions what is especially advantageous in casting works.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Discrete event simulation for petroleum transfers involving harbors, refineries and pipelines

Energy Technology Data Exchange (ETDEWEB)

Martins, Marcella S.R.; Lueders, Ricardo; Delgado, Myriam R.B.S. [Universidade Tecnologica Federal do Parana (UTFPR), Curitiba, PR (Brazil)

2009-07-01

Nowadays a great effort has been spent by companies to improve their logistics in terms of programming of events that affect production and distribution of products. In this case, simulation can be a valuable tool for evaluating different behaviors. The objective of this work is to build a discrete event simulation model for scheduling of operational activities in complexes containing one harbor and two refineries interconnected by a pipeline infrastructure. The model was developed in Arena package, based on three sub-models that control pier allocation, loading of tanks, and transfers to refineries through pipelines. Preliminary results obtained for a given control policy, show that profit can be calculated by taking into account many parameters such as oil costs on ships, pier using, over-stay of ships and interface costs. Such problem has already been considered in the literature but using different strategies. All these factors should be considered in a real-world operation where decision making tools are necessary to obtain high returns. (author)

Multicenter surgical experience evaluation on the Mid-Scala electrode and insertion tools.

Science.gov (United States)

Gazibegovic, Dzemal; Bero, Eva M

2017-02-01

The HiFocus Mid-Scala electrode is intended to improve hearing for individuals with severe-to-profound hearing loss by providing extended electrical coverage of the cochlea while minimizing trauma related to insertion. The electrode is appropriate for use with a wide range of surgical techniques, including either a cochleostomy or round window insertion, and the use of either a free-hand or tool-assisted approach. The objective of this survey was to evaluate how the HiFocus Mid-Scala electrode and insertion tools was used across a population of cochlear implant recipients of differing ages, audiologic profiles, and anatomical characteristics. The intent was to understand the type and frequency of surgical techniques applicable with the electrode, and to provide guidelines for clinical practice. Two questionnaires were completed by surgeons at implant centres located in the United States, Europe, and Asia. Before any surgeries were conducted, surgeons completed a questionnaire that assessed their overall cochlear implant surgical practice and preferences. Following each HiFocus Mid-Scala electrode insertion, surgeons completed a questionnaire that summarized their experience during that surgical procedure. Questionnaires were completed by 32 surgeons from 16 centres for a total of 143 surgeries (112 adults, 31 children). Most surgeons (62 %) preferred to insert the electrode via the round window or an extended round window compared with a cochleostomy (16 %), whereas the remaining 22 % indicated that they made an insertion choice based on presenting anatomy. Sixty-nine percent preferred a free-hand approach over using insertion tools. In 32 procedures, surgeons elected to deviate from an intended round window insertion to either an extended round window or cochleostomy approach.

Archive-cup insert for liquid-metal sampling

International Nuclear Information System (INIS)

Nelson, P.A.; Kolba, V.M.; Filewicz, E.C.; Holmes, J.T.

1975-01-01

An insert for collecting liquid-metal samples within a vertical casing including an elongated housing with an upper and a lower overflow seal of annular shape is described. The lower seal includes a centrally located pedestal on which a sample cup is disposed. Liquid metal enters the annulus of the upper seal and overflows into the cup which fills and overflows into the lower seal. Liquid-metal overflow from the lower seal is discharged from the insert. On cooling, the liquid metal trapped within the seals solidifies to hermetically isolate the metal sample within the cup. The device is particularly applicable for use with sampling systems on liquid metal-cooled reactors. (U.S.)

Lesion insertion in the projection domain: Methods and initial results

International Nuclear Information System (INIS)

Chen, Baiyu; Leng, Shuai; Yu, Lifeng; Yu, Zhicong; Ma, Chi; McCollough, Cynthia

2015-01-01

Purpose: To perform task-based image quality assessment in CT, it is desirable to have a large number of realistic patient images with known diagnostic truth. One effective way of achieving this objective is to create hybrid images that combine patient images with inserted lesions. Because conventional hybrid images generated in the image domain fails to reflect the impact of scan and reconstruction parameters on lesion appearance, this study explored a projection-domain approach. Methods: Lesions were segmented from patient images and forward projected to acquire lesion projections. The forward-projection geometry was designed according to a commercial CT scanner and accommodated both axial and helical modes with various focal spot movement patterns. The energy employed by the commercial CT scanner for beam hardening correction was measured and used for the forward projection. The lesion projections were inserted into patient projections decoded from commercial CT projection data. The combined projections were formatted to match those of commercial CT raw data, loaded onto a commercial CT scanner, and reconstructed to create the hybrid images. Two validations were performed. First, to validate the accuracy of the forward-projection geometry, images were reconstructed from the forward projections of a virtual ACR phantom and compared to physically acquired ACR phantom images in terms of CT number accuracy and high-contrast resolution. Second, to validate the realism of the lesion in hybrid images, liver lesions were segmented from patient images and inserted back into the same patients, each at a new location specified by a radiologist. The inserted lesions were compared to the original lesions and visually assessed for realism by two experienced radiologists in a blinded fashion. Results: For the validation of the forward-projection geometry, the images reconstructed from the forward projections of the virtual ACR phantom were consistent with the images physically

Lesion insertion in the projection domain: Methods and initial results

Energy Technology Data Exchange (ETDEWEB)

Chen, Baiyu; Leng, Shuai; Yu, Lifeng; Yu, Zhicong; Ma, Chi; McCollough, Cynthia, E-mail: mccollough.cynthia@mayo.edu [Department of Radiology, Mayo Clinic, Rochester, Minnesota 55905 (United States)

2015-12-15

Purpose: To perform task-based image quality assessment in CT, it is desirable to have a large number of realistic patient images with known diagnostic truth. One effective way of achieving this objective is to create hybrid images that combine patient images with inserted lesions. Because conventional hybrid images generated in the image domain fails to reflect the impact of scan and reconstruction parameters on lesion appearance, this study explored a projection-domain approach. Methods: Lesions were segmented from patient images and forward projected to acquire lesion projections. The forward-projection geometry was designed according to a commercial CT scanner and accommodated both axial and helical modes with various focal spot movement patterns. The energy employed by the commercial CT scanner for beam hardening correction was measured and used for the forward projection. The lesion projections were inserted into patient projections decoded from commercial CT projection data. The combined projections were formatted to match those of commercial CT raw data, loaded onto a commercial CT scanner, and reconstructed to create the hybrid images. Two validations were performed. First, to validate the accuracy of the forward-projection geometry, images were reconstructed from the forward projections of a virtual ACR phantom and compared to physically acquired ACR phantom images in terms of CT number accuracy and high-contrast resolution. Second, to validate the realism of the lesion in hybrid images, liver lesions were segmented from patient images and inserted back into the same patients, each at a new location specified by a radiologist. The inserted lesions were compared to the original lesions and visually assessed for realism by two experienced radiologists in a blinded fashion. Results: For the validation of the forward-projection geometry, the images reconstructed from the forward projections of the virtual ACR phantom were consistent with the images physically

Lesion insertion in the projection domain: Methods and initial results.

Science.gov (United States)

Chen, Baiyu; Leng, Shuai; Yu, Lifeng; Yu, Zhicong; Ma, Chi; McCollough, Cynthia

2015-12-01

To perform task-based image quality assessment in CT, it is desirable to have a large number of realistic patient images with known diagnostic truth. One effective way of achieving this objective is to create hybrid images that combine patient images with inserted lesions. Because conventional hybrid images generated in the image domain fails to reflect the impact of scan and reconstruction parameters on lesion appearance, this study explored a projection-domain approach. Lesions were segmented from patient images and forward projected to acquire lesion projections. The forward-projection geometry was designed according to a commercial CT scanner and accommodated both axial and helical modes with various focal spot movement patterns. The energy employed by the commercial CT scanner for beam hardening correction was measured and used for the forward projection. The lesion projections were inserted into patient projections decoded from commercial CT projection data. The combined projections were formatted to match those of commercial CT raw data, loaded onto a commercial CT scanner, and reconstructed to create the hybrid images. Two validations were performed. First, to validate the accuracy of the forward-projection geometry, images were reconstructed from the forward projections of a virtual ACR phantom and compared to physically acquired ACR phantom images in terms of CT number accuracy and high-contrast resolution. Second, to validate the realism of the lesion in hybrid images, liver lesions were segmented from patient images and inserted back into the same patients, each at a new location specified by a radiologist. The inserted lesions were compared to the original lesions and visually assessed for realism by two experienced radiologists in a blinded fashion. For the validation of the forward-projection geometry, the images reconstructed from the forward projections of the virtual ACR phantom were consistent with the images physically acquired for the ACR

Safeguards Summary Event List (SSEL), pre-NRC through December 31, 1989

International Nuclear Information System (INIS)

1990-07-01

The Safeguards Summary Event List (SSEL) provides brief summaries of several hundred safeguards-related events involving nuclear material or facilities regulated by the US Nuclear Regulatory Commission (NRC). Because of public interest, the Miscellaneous category includes a few events which involve either source material, byproduct material, or natural uranium which are exempt from safeguards requirements. Events are described under the categories of bomb-related, intrusion, missing and/or allegedly stolen, transportation, tampering/vandalism, arson, firearms, radiological sabotage, nonradiological sabotage, alcohol and drugs (involving reactor operators, security force members, or management persons), and miscellaneous. The information contained in the event descriptions is derived primarily from official NRC reporting channels

Naringenin Regulates Expression of Genes Involved in Cell Wall Synthesis in Herbaspirillum seropedicae▿

Science.gov (United States)

Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.

2011-01-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805

Naringenin regulates expression of genes involved in cell wall synthesis in Herbaspirillum seropedicae.

Science.gov (United States)

Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A

2011-03-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.

Oxidation promotes insertion of the CLIC1 chloride intracellular channel into the membrane.

Science.gov (United States)

Goodchild, Sophia C; Howell, Michael W; Cordina, Nicole M; Littler, Dene R; Breit, Samuel N; Curmi, Paul M G; Brown, Louise Jennifer

2009-12-01

Members of the chloride intracellular channel (CLIC) family exist primarily as soluble proteins but can also auto-insert into cellular membranes to form ion channels. While little is known about the process of CLIC membrane insertion, a unique feature of mammalian CLIC1 is its ability to undergo a dramatic structural metamorphosis between a monomeric glutathione-S-transferase homolog and an all-helical dimer upon oxidation in solution. Whether this oxidation-induced metamorphosis facilitates CLIC1 membrane insertion is unclear. In this work, we have sought to characterise the role of oxidation in the process of CLIC1 membrane insertion. We examined how redox conditions modify the ability of CLIC1 to associate with and insert into the membrane using fluorescence quenching studies and a sucrose-loaded vesicle sedimentation assay to measure membrane binding. Our results suggest that oxidation of monomeric CLIC1, in the presence of membranes, promotes insertion into the bilayer more effectively than the oxidised CLIC1 dimer.

Commissioning of the ATLAS Insertable B-Layer and first operation experience

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00439451; Dobos, Daniel; Rembser, Christoph

Todays research in particle physics offers a wide field of opportunities for scientists from a variety of different subjects. Discoveries can only be made, with hundreds up to thousands of people working together in collaborations. Designing high precision detectors that can be up to several stories tall, followed by production, construction, commissioning and successful operation is only achievable with the combined effort of skilled and experienced detector physicists and engineers, while the vast amount of data recorded with those detectors calls for specialists in data analysis which are able to find the needle in a haystack or in other words the higgs in a sea of underground events. One of the biggest science collaborations worldwide is the ATLAS collaboration with more than 5000 members from around 180 institutes. ATLAS is one of four big particle physics experiments at the LHC. Its tracking system has been upgraded with a new innermost layer, referred to as Insertable B-Layer (IBL), in 2014. This thesi...

Variation in the insertion of the palmaris longus tendon

Science.gov (United States)

Sunil, Vinutha; Rajanna, Shubha; Gitanjali; Kadaba, Jayanthi

2015-01-01

The palmaris longus is harvested as a tendon graft in various surgical procedures. We herein report the variations in the insertion of the palmaris longus tendon. During a routine dissection, a rare variation in the insertion of the palmaris longus tendon was observed. In the left forearm, the palmaris longus tendon bifurcated, while in the right forearm, the palmaris longus tendon trifurcated, giving rise to an accessory muscle, which passed superficial to the ulnar artery and ulnar nerve. The accessory muscle was supplied by a deep branch of the ulnar nerve, and the ulnar artery was observed to be tortuous. During reconstructive surgeries, surgeons should bear in mind the accessory muscle. Also, since the palmaris longus muscle provides a very useful graft in tendon surgery, every surgeon should be aware of the variations in the insertion of the palmaris longus tendon. PMID:25640108

Precision grid and hand motion for accurate needle insertion in brachytherapy

International Nuclear Information System (INIS)

McGill, Carl S.; Schwartz, Jonathon A.; Moore, Jason Z.; McLaughlin, Patrick W.; Shih, Albert J.

2011-01-01

Purpose: In prostate brachytherapy, a grid is used to guide a needle tip toward a preplanned location within the tissue. During insertion, the needle deflects en route resulting in target misplacement. In this paper, 18-gauge needle insertion experiments into phantom were performed to test effects of three parameters, which include the clearance between the grid hole and needle, the thickness of the grid, and the needle insertion speed. Measurement apparatus that consisted of two datum surfaces and digital depth gauge was developed to quantify needle deflections. Methods: The gauge repeatability and reproducibility (GR and R) test was performed on the measurement apparatus, and it proved to be capable of measuring a 2 mm tolerance from the target. Replicated experiments were performed on a 2 3 factorial design (three parameters at two levels) and analysis included averages and standard deviation along with an analysis of variance (ANOVA) to find significant single and two-way interaction factors. Results: Results showed that grid with tight clearance hole and slow needle speed increased precision and accuracy of needle insertion. The tight grid was vital to enhance precision and accuracy of needle insertion for both slow and fast insertion speed; additionally, at slow speed the tight, thick grid improved needle precision and accuracy. Conclusions: In summary, the tight grid is important, regardless of speed. The grid design, which shows the capability to reduce the needle deflection in brachytherapy procedures, can potentially be implemented in the brachytherapy procedure.

Quantification of Tissue Trauma following Insulin Pen Needle Insertions in Skin

DEFF Research Database (Denmark)

Jensen, Casper Bo; Larsen, Rasmus; Vestergaard, Jacob Schack

Objective: Within the field of pen needle development, most research on needle design revolves around mechanical tensile testing and patient statements. Only little has been published on the actual biological skin response to needle insertions. The objective of this study was to develop a computa......Objective: Within the field of pen needle development, most research on needle design revolves around mechanical tensile testing and patient statements. Only little has been published on the actual biological skin response to needle insertions. The objective of this study was to develop...... a computational method to quantify tissue trauma based on skin bleeding and immune response. Method: Two common sized pen needles of 28G (0.36mm) and 32G (0.23mm) were inserted into skin of sedated LYD pigs prior to termination. Four pigs were included and a total of 32 randomized needle insertions were conducted...... diameter. Conclusion: A computational and quantitative method has been developed to assess tissue trauma following insulin pen needle insertions. Application of the method is tested by conduction of a needle diameter study. The obtained quantitative measures of tissue trauma correlate positively to needle...

Angiotensin-converting enzyme insertion/deletion gene ...

Indian Academy of Sciences (India)

Angiotensin-converting enzyme insertion/deletion gene polymorphism in cystic fibrosis patients. Sabrine Oueslati Sondess Hadj Fredj Hajer Siala Amina Bibi Hajer Aloulou Lamia Boughamoura Khadija Boussetta Sihem Barsaoui Taieb Messaoud. Research Note Volume 95 Issue 1 March 2016 pp 193-196 ...

Angiotensin Converting Enzyme Insertion/Deletion Gene ...

African Journals Online (AJOL)

Angiotensin Converting Enzyme Insertion/Deletion Gene Polymorphism: An Observational Study among Diabetic Hypertensive Subjects in Malaysia. ... Methods: The pharmacological effect of ACE inhibition on mean arterial pressure (MAP) and glomerular filtration rate (GFR) were observed among a total of 62 subjects for ...

Hardening device, by inserts, of electronic component against radiation

International Nuclear Information System (INIS)

Val, C.

1987-01-01

The hardening device includes at least two materials, one with high atomic number with respect to the other. One of these materials is set as inserts in a layer of the other material. The hardening device is then made by stacking of such layers, the insert density varying from one layer to the other, making thus vary the atomic number resulting from the hardening device along its thickness, following a predefined law [fr

Otological Findings Ten Years after Myringotomy with Tympanostomy Tube Insertion

Directory of Open Access Journals (Sweden)

Ali Goljanian Tabrizi

2011-01-01

Full Text Available Introduction: To study the long-term complications of tympanostomy tube insertion in young children 10 years after surgery.   Materials and Methods: In September 2011, the medical records of all patients who had undergone myringotomy with tympanostomy tube insertion between February 2000 and March 2001 at the two general hospitals of Isfahan University of Medical Sciences were studied. Of the 98 patients who fulfilled the inclusion criteria, 82 patients agreed to participate and were enrolled in the study. The complications of the operation were evaluated in these patients.   Results: Of the 164 ears that were operated on, myringosclerosis was found in 17.1%, atrophy of the tympanic membrane in 1.2%, permanent perforation of the tympanic membrane in 0.6% and tympanic membrane atelectasis in 0.6%. None of the patients developed cholesteatoma as a complication of tympanostomy tube insertion.   Conclusion:  Considering the low risk of serious complications after 10 years, tympanostomy tube insertion is a safe and effective treatment option in the treatment of otitis media with effusion.

A comparison of buffered lidocaine versus ELA-Max before peripheral intravenous catheter insertions in children.

Science.gov (United States)

Luhmann, Janet; Hurt, Sarah; Shootman, Mario; Kennedy, Robert

2004-03-01

Peripheral intravenous catheter (PIV) insertion is a common, painful experience for many children in the pediatric emergency department. Although local anesthetics such as injected buffered lidocaine have been shown to be effective at reducing pain and anxiety associated with PIV insertion, they are not routinely used. ELA-Max, a topical local anesthetic, has the advantage of needle-free administration but has not been compared with buffered lidocaine for PIV insertion. To compare the reduction of pain and anxiety during PIV insertion provided by subcutaneous buffered 1% lidocaine or topical ELA-Max in children. A randomized trial in children 4 to 17 years old undergoing PIV insertion with 22-gauge catheters was conducted. Children received either buffered lidocaine or ELA-Max. Buffered lidocaine was administered by using 30-gauge needles to inject 0.1 to 0.2 mL subcutaneously just before PIV insertion. ELA-Max was applied to the skin and occluded with Tegaderm 30 minutes before PIV insertion. Self-reported Visual Analog Scale (VAS) questionnaires (rating on a scale of 1-10; 1 = no pain, anxiety) were completed by patients and their parents before PIV insertion to assess baseline perceptions about pain and anxiety associated with PIV insertion and immediately after PIV insertion to assess pain and anxiety associated with the experience. After PIV insertion, the nurse who inserted the PIV also completed a VAS questionnaire assessing technical difficulty and satisfaction with the local anesthesia. A blinded observer also completed a VAS questionnaire to assess pain and anxiety associated with the PIV insertion. Data were analyzed by using chi2 and t tests. Sixty-nine subjects were enrolled, and questionnaires were competed by all (mean age: 12.1 +/- 4.5 years; 61% female). There were no differences for buffered lidocaine and ELA-Max groups in age, gender, race, prior IV experience, or baseline pain and anxiety. There were no significant differences between buffered

Multiple evolutionary events involved in maintaining homologs of Resistance to Powdery Mildew 8 in Brassica napus

Directory of Open Access Journals (Sweden)

Qin Li

2016-07-01

Full Text Available The Resistance to Powdery Mildew 8 (RPW8 locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs in Brassica rapa and three in B. oleracea (BoHRs. B. napus (Bn is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs. It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane (EHM encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

Low insertion loss SOI microring resonator integrated with nano-taper couplers

DEFF Research Database (Denmark)

Pu, Minhao; Frandsen, Lars Hagedorn; Ou, Haiyan

2009-01-01

We demonstrate a microring resonator working at TM mode integrated with nano-taper couplers with 3.6dB total insertion loss. The measured insertion loss of the nano-taper coupler was only 1.3dB for TM mode....

Verification of Triple Modular Redundancy (TMR) Insertion for Reliable and Trusted Systems

Science.gov (United States)

Berg, Melanie; LaBel, Kenneth A.

2016-01-01

We propose a method for TMR insertion verification that satisfies the process for reliable and trusted systems. If a system is expected to be protected using TMR, improper insertion can jeopardize the reliability and security of the system. Due to the complexity of the verification process, there are currently no available techniques that can provide complete and reliable confirmation of TMR insertion. This manuscript addresses the challenge of confirming that TMR has been inserted without corruption of functionality and with correct application of the expected TMR topology. The proposed verification method combines the usage of existing formal analysis tools with a novel search-detect-and-verify tool. Field programmable gate array (FPGA),Triple Modular Redundancy (TMR),Verification, Trust, Reliability,

Organization of public authorities in France for the event of an incident or accident involving nuclear safety: Simulation of a nuclear crisis

International Nuclear Information System (INIS)

Cartigny, J.; Majorel, Y.

1986-01-01

The French nuclear safety regulations lay down the action to be taken in the event of an incident or accident involving the types of radiological hazard that could arise in a nuclear installation or during the transport of radioactive material. The organization established for this purpose is designed to ensure that the technical measures taken by the authorities responsible for nuclear safety, radiation protection, public order and public safety are fully effective. The Interministerial Nuclear Safety Committee (Comite interministeriel de la securite nucleaire), which reports to the Prime Minister, co-ordinates the measures taken by the public authorities. The public authorities and the operators together organize exercises designed to verify the whole complex of measures foreseen in the event of an incident or accident. These exercises, which have been carried out in a systematic manner in France for some years, are based on scenarios which are as realistic as possible and enable the following objectives to be achieved: (1) analysis of the crisis apparatus (ORSECRAD plans, individual intervention plans, information conventions); (2) uncovering gaps or inadequacies; (3) arrangements for interchange of information between the various participants whose responsibilities involve them in the emergency; and (4) allowance for the information requirements of the media and the population. The information drawn from these exercises enables the various procedures to be improved step by step. (author)

Scala vestibuli insertion in cochlear implantation: a valuable alternative for cases with obstructed scala tympani.

Science.gov (United States)

Kiefer, J; Weber, A; Pfennigdorff, T; von Ilberg, C

2000-01-01

Insertion of a sufficient number of electrodes is important for a successful use of cochlear implants. We investigated the results of scala vestibuli insertion for cochlear implantation in cases of obstructed scala tympani. In a series of 200 cochlear implantations, scala vestibuli insertion was successfully performed in 4 cases with obstruction of the scala tympani. Etiologies included a temporal bone fracture, severe otosclerosis and malformations of the cochlea. The maximum insertion depth obtained via the scala vestibuli was 30 mm. Postoperative results were comparable to patients in whom conventional scala tympani insertion was performed. No adverse effects related to the site of insertion were observed. Scala vestibuli insertion offers a valuable alternative in cases of obstructed scala tympani that can be employed for a variety of etiologies. Copyright 2000 S. Karger AG, Basel

Indentation and needle insertion properties of the human eye.

Science.gov (United States)

Matthews, A; Hutnik, C; Hill, K; Newson, T; Chan, T; Campbell, G

2014-07-01

Characterization of the biomechanical properties of the human eye has a number of potential utilities. One novel purpose is to provide the basis for development of suitable tissue-mimicking material. The purpose of this study was to determine the indentation and needle insertion characteristics on human eye globes and tissue strips. An indenter assessed the elastic response of human eye globes and tissue strips under increasing compressive loads. Needle insertion determined the force (N) needed to penetrate various areas of the eye wall. The results demonstrated that globes underwent slightly greater indentation at the midline than at the central cornea, and corneal strips indented twofold more than scleral strips, although neither difference was significant (P=0.400 and P=0.100, respectively). Significant differences were observed among various areas of needle insertion (Phuman eye construct with potential utility as a model for use in ophthalmology research and surgical teaching.

Effect of Needle Aspiration of Pneumothorax on Subsequent Chest Drain Insertion in Newborns

DEFF Research Database (Denmark)

Murphy, Madeleine C; Heiring, Christian; Doglioni, Nicoletta

2018-01-01

Importance: Treatment options for a symptomatic pneumothorax in newborns include needle aspiration (NA) and chest drain (CD) insertion. There is little consensus as to the preferred treatment, reflecting a lack of evidence from clinical trials. Objective: To investigate whether treating pneumotho......Importance: Treatment options for a symptomatic pneumothorax in newborns include needle aspiration (NA) and chest drain (CD) insertion. There is little consensus as to the preferred treatment, reflecting a lack of evidence from clinical trials. Objective: To investigate whether treating...... was 5 tertiary European neonatal intensive care units. Infants receiving respiratory support (endotracheal ventilation, continuous positive airway pressure, or supplemental oxygen >40%) who had a pneumothorax on CR that clinicians deemed needed treatment were eligible for inclusion. Interventions...... was inserted if clinicians deemed that the response was inadequate. For CD insertion, a drain was inserted between the ribs and was left in situ. Main Outcomes and Measures: The primary outcome was whether a CD was inserted on the side of the pneumothorax within 6 hours of diagnosis. Results: A total of 76...

Effect of insertion depth on helical antenna performance in a muscle-equivalent phantom

Energy Technology Data Exchange (ETDEWEB)

Reeves, J W; Meeson, S; Birch, M J [Department of Clinical Physics, Royal London Hospital, 56-76 Ashfield Street, London, E1 1BB (United Kingdom)

2005-06-21

Barrett's oesophagus is considered to increase the risk of cancer 30 fold. A set of helical microwave antennas was designed to investigate their potential use in the thermal therapy of Barrett's oesophagus. For treatment, a balloon filled with muscle-equivalent material encapsulates the antenna. The effects of insertion depth and coil-spacing on the thermal distribution produced by the antennas (20-35 mm) were characterized. The 35 mm helical antenna, with a coil-spacing of 3.6 mm resulted in uniform heating for an insertion depth of 40 mm. It was observed that the resultant temperature distribution produced, by the antennas, was dependent on the insertion depth within the phantom. For all antennas studied, deeper insertion resulted in two high intensity regions, approximately 1/4 and 3/4 along the antenna length. In contrast, shallow insertion resulted in predominant tip heating with undesirable heating at the phantom entry point. However, by manipulating the coil-spacing of the helix, uniform temperature profiles were achieved for a range of insertion depths.

Intraoperative insertion torque of lumbar pedicle screw and postoperative radiographic evaluation. Short-term observation

International Nuclear Information System (INIS)

Mizuno, Koichi; Shinomiya, Kenichi; Otani, Kazuyuki

2005-01-01

The correlation between the insertion torque of a lumbar pedicle screw and the mechanical stability of the screw in the bone has been mentioned in in vitro studies. The purpose of this study was to confirm the factors affecting the insertion torque of such screws in vivo. Also, the contribution of insertion torque to the initial stability of the fusion area was to be analyzed in vivo. A series of 23 cases representing 50 lumbar vertebrae were included in this study, in which we examined bone mineral density using quantitative computed tomography (CT) prior to operation. Two screw shapes were utilized, with the insertion torque for each screw measured at two points in time. The correlation between insertion torque and mineral density was investigated. Screw positions were confirmed on postoperative CT scans, and the effect of the screw thread cutting into the cortex bone was investigated. Radiographic changes at three points during a period of 3 months were also measured, and we then evaluated the interrelations between these changes and insertion torque. Furthermore, the relation between insertion torque and instability at 3 months was investigated. Correlations of insertion torque and bone mineral density depended on screw shape. There was no correlation found with mineral density in the case of cylindrical screws. Insertion torque was not affected by the screw thread cutting into the cortex of bone. As for postoperative alignment changes, no definitive trends could be ascertained, and no interrelations with torque and alignment changes were observed. There is a possibility that insertion torque was related to early-stage stability, but no statistical relation could be determined. (author)

Radiation dose measurements of the insertion devices using radiachromic film dosimeters

International Nuclear Information System (INIS)

Alderman, J.; Semones, E.; Job, P. K.

2004-01-01

The Advanced Photon Source (APS) uses Nd-Fe-B permanent magnets in the insertion devices to produce x-rays for scientific research [1,2]. Earlier investigations have exhibited varying degrees of demagnetization of these magnets [3] due to irradiation from electron beams [4,5,6], 60 Co γ-rays [5], and high-energy neutrons [7,8]. Radiation-induced demagnetization has been observed in the APS insertion devices [9] and was first measured in December of 2001. Partial demagnetization has also been observed in insertion devices at the European Synchrotron Radiation Facility (ESRF) [4,6], where Nd-Fe-B permanent magnets are also used. Growing concern for the lifetime of APS insertion devices, as well as the permanent magnets that will be used in next-generation, high-power light sources, like the FEL [10,11], resulted from the partial demagnetization observations made at both facilities. This concern in relation to radiation-induced demagnetization spurred a long-term project to measure and analyze the absorbed doses received by the APS insertion devices. The project required a reliable photon high-dose dosimetry technique capable of measuring absorbed doses greater than 10 6 rad, which was not readily available at the APS. Through a collaboration with the National Institute of Standards and Technology (NIST), one such technique using radiachromic films was considered, tested, and calibrated at the APS. This consequently led to the implementation of radiachromic film dosimetry for measuring the absorbed doses received by the insertion devices for each of the APS runs

Additive manufacturing for the production of inserts for micro injection moulding

DEFF Research Database (Denmark)

Mischkot, Michael; Hansen, Hans Nørgaard; Pedersen, David Bue

2015-01-01

The production of inserts for micro injection moulding using additive manufacturing technology has the potential to greatly improve the efficiency of pilot production and reduce overall time to market. In this work, Digital Light Processing (DLP) was used to produce micro injection moulding inserts...

Evolution of Additively Manufactured Injection Molding Inserts Investigated by Thermal Simulations

DEFF Research Database (Denmark)

Hofstätter, Thomas; Pedersen, David B.; Tosello, Guido

Injection molding using inserts from vat polymerization, an additive manufacturing technology, has been investigated for pilot production and rapid prototyping purposes throughout the past years. A standard mold is equipped with additively manufactured inserts in a rectangular shape of (20 x 20 x 2...

Utilization of next generation sequencing for analyzing transgenic insertions in plum

Science.gov (United States)

When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

Folding and insertion thermodynamics of the transmembrane WALP peptide

International Nuclear Information System (INIS)

Bereau, Tristan; Bennett, W. F. Drew; Pfaendtner, Jim; Deserno, Markus; Karttunen, Mikko

2015-01-01

The anchor of most integral membrane proteins consists of one or several helices spanning the lipid bilayer. The WALP peptide, GWW(LA) n (L)WWA, is a common model helix to study the fundamentals of protein insertion and folding, as well as helix-helix association in the membrane. Its structural properties have been illuminated in a large number of experimental and simulation studies. In this combined coarse-grained and atomistic simulation study, we probe the thermodynamics of a single WALP peptide, focusing on both the insertion across the water-membrane interface, as well as folding in both water and a membrane. The potential of mean force characterizing the peptide’s insertion into the membrane shows qualitatively similar behavior across peptides and three force fields. However, the Martini force field exhibits a pronounced secondary minimum for an adsorbed interfacial state, which may even become the global minimum—in contrast to both atomistic simulations and the alternative PLUM force field. Even though the two coarse-grained models reproduce the free energy of insertion of individual amino acids side chains, they both underestimate its corresponding value for the full peptide (as compared with atomistic simulations), hinting at cooperative physics beyond the residue level. Folding of WALP in the two environments indicates the helix as the most stable structure, though with different relative stabilities and chain-length dependence

Folding and insertion thermodynamics of the transmembrane WALP peptide

Energy Technology Data Exchange (ETDEWEB)

Bereau, Tristan, E-mail: bereau@mpip-mainz.mpg.de [Max Planck Institute for Polymer Research, Ackermannweg 10, 55128 Mainz (Germany); Bennett, W. F. Drew [Department of Chemistry, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Pfaendtner, Jim [Department of Chemical Engineering, University of Washington, Seattle, Washington 98195 (United States); Deserno, Markus [Department of Physics, Carnegie Mellon University, Pittsburgh, Pennsylvania 15213 (United States); Karttunen, Mikko [Department of Mathematics and Computer Science & Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, MetaForum, 5600 MB Eindhoven (Netherlands)

2015-12-28

The anchor of most integral membrane proteins consists of one or several helices spanning the lipid bilayer. The WALP peptide, GWW(LA){sub n} (L)WWA, is a common model helix to study the fundamentals of protein insertion and folding, as well as helix-helix association in the membrane. Its structural properties have been illuminated in a large number of experimental and simulation studies. In this combined coarse-grained and atomistic simulation study, we probe the thermodynamics of a single WALP peptide, focusing on both the insertion across the water-membrane interface, as well as folding in both water and a membrane. The potential of mean force characterizing the peptide’s insertion into the membrane shows qualitatively similar behavior across peptides and three force fields. However, the Martini force field exhibits a pronounced secondary minimum for an adsorbed interfacial state, which may even become the global minimum—in contrast to both atomistic simulations and the alternative PLUM force field. Even though the two coarse-grained models reproduce the free energy of insertion of individual amino acids side chains, they both underestimate its corresponding value for the full peptide (as compared with atomistic simulations), hinting at cooperative physics beyond the residue level. Folding of WALP in the two environments indicates the helix as the most stable structure, though with different relative stabilities and chain-length dependence.

The strategic use of inserts in the Brazilian presidential elections

Directory of Open Access Journals (Sweden)

Felipe Borba

2012-01-01

Full Text Available The aim of this article is to analyze the communication strategies of presidential candidates during the elections held in 2006 and 2010. The focus is on the strategic component of electoral inserts and the methodology consists of investigating how candidates choose to distribute these inserts in the programming of television networks. The results indicate that the candidates pursue different strategies influenced basically by three variables: electoral legislation, their standing in polls and the difference of resources available. In parallel, the article debates the role of the regulation of electoral advertising and how this set of rules influences the level of information of campaigns, the occurrence of attacks, and party strategies. Overall, 2,993 electoral inserts were examined.

Stent insertion in patients with malignant biliary obstruction: problems of the Hanaro stent

Energy Technology Data Exchange (ETDEWEB)

Kwon, Jae Hyun; Seong, Chang Kyu; Shin, Tae Beom; Kim, Yong Joo [School of Medicine, Kyungpook National Univ., Daegu (Korea, Republic of); Jung, Gyoo Sik [School of Medicine, Kosin National Univ., Pusan (Korea, Republic of); Park, Byeung Ho [School of Medicine, Donga National Univ., Pusan (Korea, Republic of)

2002-07-01

To investigate the problems of the Hanaro stent (Solco Intermed, Seoul, Korea) when used in the palliative treatment of patients with inoperable malignant biliary obstruction. Between January 2000 and May 2001, the treatment of 46 patients with malignant biliary obstruction involved percutaneous placement of the Hanaro stent. Five patients encountered problems during removal of the stent's introduction system. The causes of obstruction were pancreatic carcinoma (n=2), cholangiocarcinoma (n=2), and gastric carcinoma with biliary invasion (n=1). In one patient, percutaneous transhepatic cholangiography and stent insertion were performed as a one-step procedure, while the others underwent conventional percutaneous transhepatic biliary drainage for at least two days prior to stent insertion. A self-expandable Hanaro stent, 8-10 mm in deameter and 50-100 mm in lengh, and made from a strand of nitinol wire, was used in all cases. Among the five patients who encountered problems, breakage of the olive tip occourred in three, upward displacement of the stent in two, and improper expansion of the distal portion of the stent, unrelated with the obstruction site, in one. The broken olive tip was pushed to the duodenum in two cases and to the peripheral intrahepatic duct in one. Where the stent migrated during withdrawal of its introduction system, an additional stent was inserted. In one case, the migrated stent was positioned near the liver capsule and the drainage catheter could not be removed. Although the number of patients in this study was limited, some difficulties were encountered in withdrawing the stent's introduction system. To prevent the occurrence of this unusual complication, the stent should be appropriately expansile, and shape in the olive tip should be considered.

Inserts for nuclear fuel elements

International Nuclear Information System (INIS)

Cragg, P.J.

1982-01-01

An insert for a nuclear fuel pin which comprises a strip. The strip carries notches, which enable a coding arrangement to be carried on the strip. The notches may be of differing sizes and the coding on the strip includes identification and identification checking data. Each notch on the strip may give rise to a signal pulse which is counted by a detector to avoid errors. (author)

Human-specific HERV-K insertion causes genomic variations in the human genome.

Directory of Open Access Journals (Sweden)

Wonseok Shin

Full Text Available Human endogenous retroviruses (HERV sequences account for about 8% of the human genome. Through comparative genomics and literature mining, we identified a total of 29 human-specific HERV-K insertions. We characterized them focusing on their structure and flanking sequence. The results showed that four of the human-specific HERV-K insertions deleted human genomic sequences via non-classical insertion mechanisms. Interestingly, two of the human-specific HERV-K insertion loci contained two HERV-K internals and three LTR elements, a pattern which could be explained by LTR-LTR ectopic recombination or template switching. In addition, we conducted a polymorphic test and observed that twelve out of the 29 elements are polymorphic in the human population. In conclusion, human-specific HERV-K elements have inserted into human genome since the divergence of human and chimpanzee, causing human genomic changes. Thus, we believe that human-specific HERV-K activity has contributed to the genomic divergence between humans and chimpanzees, as well as within the human population.

Involvement and necessity of the Cpx regulon in the event of aberrant β-barrel outer membrane protein assembly

Science.gov (United States)

Gerken, Henri; Leiser, Owen P.; Bennion, Drew; Misra, Rajeev

2010-01-01

Summary The Cpx and σE regulons help maintain outer membrane integrity; the Cpx pathway monitors the biogenesis of cell surface structures, such as pili, while the σE pathway monitors the biogenesis of β-barrel outer membrane proteins (OMPs). In this study we revealed the importance of the Cpx regulon in the event of β-barrel OMP mis-assembly, by utilizing mutants expressing either a defective β-barrel OMP assembly machinery (Bam) or assembly defective β-barrel OMPs. Analysis of specific mRNAs showed that ΔcpxR bam double mutants failed to induce degP expression beyond the wild type level, despite activation of the σE pathway. The synthetic conditional lethal phenotype of ΔcpxR in mutant Bam or β-barrel OMP backgrounds was reversed by wild type DegP expressed from a heterologous plasmid promoter. Consistent with the involvement of the Cpx regulon in the event of aberrant β-barrel OMP assembly, the expression of cpxP, the archetypal member of the cpx regulon, was upregulated in defective Bam backgrounds or in cells expressing a single assembly-defective β-barrel OMP species. Together, these results showed that both the Cpx and σE regulons are required to reduce envelope stress caused by aberrant β-barrel OMP assembly, with the Cpx regulon principally contributing by controlling degP expression. PMID:20487295

Estimating Rates of Fault Insertion and Test Effectiveness in Software Systems

Science.gov (United States)

Nikora, A.; Munson, J.

1998-01-01

In developing a software system, we would like to estimate the total number of faults inserted into a software system, the residual fault content of that system at any given time, and the efficacy of the testing activity in executing the code containing the newly inserted faults.

Patients Comprehension of Pharmaceutical Package Inserts ...

African Journals Online (AJOL)

Tropical Journal of Pharmaceutical Research December 2015; 14 (12): ... Available online at http://www.tjpr.org ... patients/consumers about PPI. ... the perception of outpatients of Karachi about ... Do you store the medication at the temperature specified in the package insert ... drugs available in local market of Pakistan was.

Tissue-engineering strategies for the tendon/ligament-to-bone insertion.

Science.gov (United States)

Smith, Lester; Xia, Younan; Galatz, Leesa M; Genin, Guy M; Thomopoulos, Stavros

2012-01-01

Injuries to connective tissues are painful and disabling and result in costly medical expenses. These injuries often require reattachment of an unmineralized connective tissue to bone. The uninjured tendon/ligament-to-bone insertion (enthesis) is a functionally graded material that exhibits a gradual transition from soft tissue (i.e., tendon or ligament) to hard tissue (i.e., mineralized bone) through a fibrocartilaginous transition region. This transition is believed to facilitate force transmission between the two dissimilar tissues by ameliorating potentially damaging interfacial stress concentrations. The transition region is impaired or lost upon tendon/ligament injury and is not regenerated following surgical repair or natural healing, exposing the tissue to risk of reinjury. The need to regenerate a robust tendon-to-bone insertion has led a number of tissue engineering repair strategies. This review treats the tendon-to-bone insertion site as a tissue structure whose primary role is mechanical and discusses current and emerging strategies for engineering the tendon/ligament-to-bone insertion in this context. The focus lies on strategies for producing mechanical structures that can guide and subsequently sustain a graded tissue structure and the associated cell populations.

Effects of lithium insertion on thermal conductivity of silicon nanowires

International Nuclear Information System (INIS)

Xu, Wen; Zhang, Gang; Li, Baowen

2015-01-01

Recently, silicon nanowires (SiNWs) have been applied as high-performance Li battery anodes, since they can overcome the pulverization and mechanical fracture during lithiation. Although thermal stability is one of the most important parameters that determine safety of Li batteries, thermal conductivity of SiNWs with Li insertion remains unclear. In this letter, using molecular dynamics simulations, we study room temperature thermal conductivity of SiNWs with Li insertion. It is found that compared with the pristine SiNW, there is as much as 60% reduction in thermal conductivity with 10% concentration of inserted Li atoms, while under the same impurity concentration the reduction in thermal conductivity of the mass-disordered SiNW is only 30%. With lattice dynamics calculations and normal mode decomposition, it is revealed that the phonon lifetimes in SiNWs decrease greatly due to strong scattering of phonons by vibrational modes of Li atoms, especially for those high frequency phonons. The observed strong phonon scattering phenomenon in Li-inserted SiNWs is similar to the phonon rattling effect. Our study serves as an exploration of thermal properties of SiNWs as Li battery anodes or weakly coupled with impurity atoms

A proposal for a drug information database and text templates for generating package inserts

Directory of Open Access Journals (Sweden)

Okuya R

2013-07-01

Full Text Available Ryo Okuya,1 Masaomi Kimura,2 Michiko Ohkura,2 Fumito Tsuchiya3 1Graduate School of Engineering and Science, 2Faculty of Engineering, Shibaura Institute of Technology, Tokyo, 3School of Pharmacy, International University of Health and Welfare, Tokyo, Japan Abstract: To prevent prescription errors caused by information systems, a database to store complete and accurate drug information in a user-friendly format is needed. In previous studies, the primary method for obtaining data stored in a database is to extract drug information from package inserts by employing pattern matching or more sophisticated methods such as text mining. However, it is difficult to obtain a complete database because there is no strict rule concerning expressions used to describe drug information in package inserts. The authors' strategy was to first build a database and then automatically generate package inserts by embedding data in the database using templates. To create this database, the support of pharmaceutical companies to input accurate data is required. It is expected that this system will work, because these companies can earn merit for newly developed drugs to decrease the effort to create package inserts from scratch. This study designed the table schemata for the database and text templates to generate the package inserts. To handle the variety of drug-specific information in the package inserts, this information in drug composition descriptions was replaced with labels and the replacement descriptions utilizing cluster analysis were analyzed. To improve the method by which frequently repeated ingredient information and/or supplementary information are stored, the method was modified by introducing repeat tags in the templates to indicate repetition and improving the insertion of data into the database. The validity of this method was confirmed by inputting the drug information described in existing package inserts and checking that the method could

Dopo il Grande Evento: politiche “utili” per la mobilità Beyond the Mega Events: “Useful” Policies for Urban Mobility

Directory of Open Access Journals (Sweden)

Andrea Ceudech

2008-08-01

areas on which setting up the structures for the event. Only in few cases the works realized for the events have been inserted in a wider requalification or regeneration than programme involving the whole city and have been used as tools to achieve a stable improvement of the urban quality, above all regarding mobility. On the base of such considerations some aspects and key-points of urban mobility policies are highlighted in order to achieve real advantages to the community once the mega event is finished.

Response to events involving the inadvertent movement or illicit trafficking of radioactive materials

International Nuclear Information System (INIS)

2002-09-01

of Understanding (MOU) (1998) to promote co-operation at the international level in order to improve the control of radioactive materials. At the time of the drafting of this report, a similar MOU between the IAEA and the International Criminal Police Organization (INTERPOL) is pending. There are a number of measures that must be undertaken by States to combat the illicit trafficking and inadvertent movements of radioactive materials. These measures are, generally, shared between the regulatory and law enforcement agencies as part of a State's national arrangements. One of these measures is monitoring for radioactive materials at borders. This Technical Document (TECDOC) provides information to front-line officers on response to events involving the detection of inadvertent movement or illicit trafficking of radioactive materials. The emphasis in this publication is on operational and tactical response measures. These may entail a multi-agency response, particularly at the tactical level. Detailed scientific information has been kept to a minimum as it is recognized that the majority of law enforcement personnel will not have the background necessary to use such information effectively. The prime objective of this TECDOC is to provide Member States with practical information for use by emergency response and law enforcement personnel involved in dealing with incidents of inadvertent movement or illicit trafficking of radioactive materials. The purpose of the response is to regain control of the relevant radioactive materials so that the risk of harm to people and the environment is mitigated. This information is aimed primarily at police, customs and other law enforcement officers who may become involved in incidents concerning inadvertent movement or illicit trafficking of radioactive materials. Effective inter-agency co-operation can only be achieved if personnel who are not normally involved with radiological emergencies are aware of the issues associated with

Response to events involving the inadvertent movement or illicit trafficking of radioactive materials

International Nuclear Information System (INIS)

2004-08-01

of Understanding (MOU) (1998) to promote co-operation at the international level in order to improve the control of radioactive materials. At the time of the drafting of this report, a similar MOU between the IAEA and the International Criminal Police Organization (INTERPOL) is pending. There are a number of measures that must be undertaken by States to combat the illicit trafficking and inadvertent movements of radioactive materials. These measures are, generally, shared between the regulatory and law enforcement agencies as part of a State's national arrangements. One of these measures is monitoring for radioactive materials at borders. This Technical Document (TECDOC) provides information to front-line officers on response to events involving the detection of inadvertent movement or illicit trafficking of radioactive materials. The emphasis in this publication is on operational and tactical response measures. These may entail a multi-agency response, particularly at the tactical level. Detailed scientific information has been kept to a minimum as it is recognized that the majority of law enforcement personnel will not have the background necessary to use such information effectively. The prime objective of this TECDOC is to provide Member States with practical information for use by emergency response and law enforcement personnel involved in dealing with incidents of inadvertent movement or illicit trafficking of radioactive materials. The purpose of the response is to regain control of the relevant radioactive materials so that the risk of harm to people and the environment is mitigated. This information is aimed primarily at police, customs and other law enforcement officers who may become involved in incidents concerning inadvertent movement or illicit trafficking of radioactive materials. Effective inter-agency co-operation can only be achieved if personnel who are not normally involved with radiological emergencies are aware of the issues associated with

Response to events involving the inadvertent movement or illicit trafficking of radioactive materials

International Nuclear Information System (INIS)

2002-08-01

of Understanding (MOU) (1998) to promote co-operation at the international level in order to improve the control of radioactive materials. At the time of the drafting of this report, a similar MOU between the IAEA and the International Criminal Police Organization (INTERPOL) is pending. There are a number of measures that must be undertaken by States to combat the illicit trafficking and inadvertent movements of radioactive materials. These measures are, generally, shared between the regulatory and law enforcement agencies as part of a State's national arrangements. One of these measures is monitoring for radioactive materials at borders. This Technical Document (TECDOC) provides information to front-line officers on response to events involving the detection of inadvertent movement or illicit trafficking of radioactive materials. The emphasis in this publication is on operational and tactical response measures. These may entail a multi-agency response, particularly at the tactical level. Detailed scientific information has been kept to a minimum as it is recognized that the majority of law enforcement personnel will not have the background necessary to use such information effectively. The prime objective of this TECDOC is to provide Member States with practical information for use by emergency response and law enforcement personnel involved in dealing with incidents of inadvertent movement or illicit trafficking of radioactive materials. The purpose of the response is to regain control of the relevant radioactive materials so that the risk of harm to people and the environment is mitigated. This information is aimed primarily at police, customs and other law enforcement officers who may become involved in incidents concerning inadvertent movement or illicit trafficking of radioactive materials. Effective inter-agency co-operation can only be achieved if personnel who are not normally involved with radiological emergencies are aware of the issues associated with

Response to events involving the inadvertent movement or illicit trafficking of radioactive materials

International Nuclear Information System (INIS)

2003-08-01

of Understanding (MOU) (1998) to promote co-operation at the international level in order to improve the control of radioactive materials. At the time of the drafting of this report, a similar MOU between the IAEA and the International Criminal Police Organization (INTERPOL) is pending. There are a number of measures that must be undertaken by States to combat the illicit trafficking and inadvertent movements of radioactive materials. These measures are, generally, shared between the regulatory and law enforcement agencies as part of a State's national arrangements. One of these measures is monitoring for radioactive materials at borders. This Technical Document (TECDOC) provides information to front-line officers on response to events involving the detection of inadvertent movement or illicit trafficking of radioactive materials. The emphasis in this publication is on operational and tactical response measures. These may entail a multi-agency response, particularly at the tactical level. Detailed scientific information has been kept to a minimum as it is recognized that the majority of law enforcement personnel will not have the background necessary to use such information effectively. The prime objective of this TECDOC is to provide Member States with practical information for use by emergency response and law enforcement personnel involved in dealing with incidents of inadvertent movement or illicit trafficking of radioactive materials. The purpose of the response is to regain control of the relevant radioactive materials so that the risk of harm to people and the environment is mitigated. This information is aimed primarily at police, customs and other law enforcement officers who may become involved in incidents concerning inadvertent movement or illicit trafficking of radioactive materials. Effective inter-agency co-operation can only be achieved if personnel who are not normally involved with radiological emergencies are aware of the issues associated with

Rescuing Alu: recovery of new inserts shows LINE-1 preserves Alu activity through A-tail expansion.

Directory of Open Access Journals (Sweden)

Bradley J Wagstaff

Full Text Available Alu elements are trans-mobilized by the autonomous non-LTR retroelement, LINE-1 (L1. Alu-induced insertion mutagenesis contributes to about 0.1% human genetic disease and is responsible for the majority of the documented instances of human retroelement insertion-induced disease. Here we introduce a SINE recovery method that provides a complementary approach for comprehensive analysis of the impact and biological mechanisms of Alu retrotransposition. Using this approach, we recovered 226 de novo tagged Alu inserts in HeLa cells. Our analysis reveals that in human cells marked Alu inserts driven by either exogenously supplied full length L1 or ORF2 protein are indistinguishable. Four percent of de novo Alu inserts were associated with genomic deletions and rearrangements and lacked the hallmarks of retrotransposition. In contrast to L1 inserts, 5' truncations of Alu inserts are rare, as most of the recovered inserts (96.5% are full length. De novo Alus show a random pattern of insertion across chromosomes, but further characterization revealed an Alu insertion bias exists favoring insertion near other SINEs, highly conserved elements, with almost 60% landing within genes. De novo Alu inserts show no evidence of RNA editing. Priming for reverse transcription rarely occurred within the first 20 bp (most 5' of the A-tail. The A-tails of recovered inserts show significant expansion, with many at least doubling in length. Sequence manipulation of the construct led to the demonstration that the A-tail expansion likely occurs during insertion due to slippage by the L1 ORF2 protein. We postulate that the A-tail expansion directly impacts Alu evolution by reintroducing new active source elements to counteract the natural loss of active Alus and minimizing Alu extinction.

The Effectiveness of Self-Expandable Metallic Stent Insertion in Treating Right-Sided Colonic Obstruction: A Comparison between SEMS and Decompression Tube Placement and an Investigation of the Safety and Difficulties of SEMS Insertion in Right Colons

Directory of Open Access Journals (Sweden)

Rintaro Moroi

2014-01-01

Full Text Available Objectives. Self-expandable metallic stent (SEMS is widely used to treat malignant colonic obstruction. However, most reports about SEMS insertion have concentrated on the left colon. This study aimed to (1 investigate the effectiveness of SEMS insertion compared with conventional decompression tube for right-sided colonic obstruction and (2 compare the safety and technical success of SEMS insertion between left- and right-sided colonic obstructions. Methods. The data from thirty-seven patients who underwent SEMS or conventional decompression tube placement for malignant colonic obstruction in our hospital were analyzed retrospectively. Technical and clinical success, complications, and technical difficulties were analyzed. We compared the results between SEMS insertion and decompression tube placement in right colons and the outcomes of SEMS insertion between right- and left-sided colonic obstructions. Results. For right colons, the clinical success rate of SEMS insertion (100% was significantly higher than that of decompression tube placement (55.9%. Concerning SEMS insertion, the technical difficulty and safety of SEMS insertion were similar between right- and left-sided colonic obstructions. Conclusion. SEMS insertion for right-sided colon is significantly more effective than conventional decompression tube placement, and this procedure was safer and less technically challenging than expected. SEMS insertion should be considered for treating right-sided malignant colonic obstruction.

Contingency Trajectory Design for a Lunar Orbit Insertion Maneuver Failure by the LADEE Spacecraft

Science.gov (United States)

Genova, A. L.

2014-01-01

This paper presents results from a contingency trajectory analysis performed for the Lunar Atmosphere & Dust Environment Explorer (LADEE) mission in the event of a missed lunar-orbit insertion (LOI) maneuver by the LADEE spacecraft. The effects of varying solar perturbations in the vicinity of the weak stability boundary (WSB) in the Sun-Earth system on the trajectory design are analyzed and discussed. It is shown that geocentric recovery trajectory options existed for the LADEE spacecraft, depending on the spacecraft's recovery time to perform an Earth escape-prevention maneuver after the hypothetical LOI maneuver failure and subsequent path traveled through the Sun-Earth WSB. If Earth-escape occurred, a heliocentric recovery option existed, but with reduced science capacapability for the spacecraft in an eccentric, not circular near-equatorial retrograde lunar orbit.

Effect of One versus Two Drain Insertion on Postoperative Seroma Formation after Modified Radical Mastectomy

Directory of Open Access Journals (Sweden)

farzaneh ebrahimifard

2016-04-01

Full Text Available Background: Modified radical mastectomy (MRM is still one of globally accepted surgical techniques for breast cancer and in some selected patient is the gold standard type of surgery. The most frequent complication of this procedure is seroma under skin flaps or in the axilla as reported as much as 30% in some studies. The use of closed suction drainage system to reduce the incidence of this complication has been routinely accepted by surgeons; however, length of catheter stay and the number of catheters inserted in the wound are still controversial. The present study compares the results of single versus double drain insertion in patients undergoing MRM for breast cancer.Materials and Methods: The study was conducted on 100 women with breast cancer who were candidate for MRM surgery during 2007-2010 referred to Modarres hospital, Tehran, Iran as a randomized group matched controlled trial.Results: There was no significant difference between the two groups in terms of age, BMI, and tumor weight (P=0.406 (Table 1. Similarly, the difference between the two groups was insignificant in tumor size (T and number of lymph nodes involved (P=0.145. There was no significant difference between the two groups in timing of axillary drain removal (P=0.064. No significant differences were observed between the two groups in mean aspirated fluid (P=0.071 and mean aspirated sera (P=0.484 after removal of drains.Conclusion: This study revealed one drain insertion in MRM surgery is as effective as two drain and probably less morbidity and cost.

Chromaticity correction in the TRISTAN phase I main ring with two types of insertion

International Nuclear Information System (INIS)

Wu, Yingzhi; Egawa, Kazumi.

1984-07-01

The TRISTAN main ring now under construction has four insertions. Besides the normal modes in which the four insertions have the same optics, the TRISTAN main ring will be operated in somewhat more complicated configurations with insertions having different optics. This report will consider chromaticity corrections using six families of sextupoles for the TRISTAN main ring with two different insertion types; opposite insertions have the same optics. The strength of correcting sextupoles is determined mainly using the W-correction method. The program PATRICIA is used to track the trajectories of test particles over 800 turns. The results show that the correction scheme adopted allows adequately large amplitudes of betatron and synchrotron oscillations. (author)

A study of the suitability of ferrite for use in low-field insertion devices

Energy Technology Data Exchange (ETDEWEB)

Johnson, K.; Hassenzahl, W.V.

1995-02-01

Most insertion devices built to date use rare-earth permanent-magnet materials, which have a high remanent field and are more expensive than many other permanent-magnet materials. Low-field insertion devices could use less-expensive, lower performance magnetic materials if they had suitable magnetic characteristics. These materials must be resistant to demagnetization during construction and operation of the insertion device, have uniform magnetization, possess low minor-axis magnetic moments, and have small minor field components on the surfaces. This paper describes an investigation to determine if ferrite possesses magnetic qualities suitable for insertion device applications. The type of ferrite investigated, MMPA Ceramic 8 from Stackpole Inc., was found to be acceptable for insertion device applications.

Perforation of the Esophagus Secondary to Insertion of Covered Wallstent Endoprostheses

International Nuclear Information System (INIS)

Farrugia, Mark; Morgan, Robert A.; Latham, Jennifer A.; Glynos, Michael; Mason, Robert C.; Adam, Andreas

1997-01-01

Perforation of the esophagus is a very rare complication of metallic esophageal stent insertion. Two cases are presented in which esophageal perforations were caused by the sharp ends of metallic stents impinging on the esophageal wall. In retrospect, both perforations might have been prevented by additional stent insertion

Insert Modifications Improve Access to Artificial Red-Cockaded Woodpecker Next Cavities

Science.gov (United States)

John W. Edwards; Ernest E. Stevens; Charles A. Dachelet

1997-01-01

A designfor a modified, artificial Red-cockaded Woodpecker(Picoides borealis) cavity insert is presented. This modification allowed eggs and young to be inspected easily, removed, and replaced throughout the nesting period. Modifications to cavity inserts are best done before installation, but can be easily retrofitted in existing artificial cavities...

A note on the insertion of rumen cannulae in pregnant ewes

African Journals Online (AJOL)

Modifications to a simple and rapid technique for the insertion of rumen cannulae in sheep are described. The modified technique, executed in three phases, was developed to facilitate the fistula- tion and insertion of rumen cannulae in pregnant ewes, especially during late pregnancy. Wysigings van 'n eenvoudige en ...

the clinical anatomy of the insertion of the rotator cuff tendons

African Journals Online (AJOL)

2016-09-07

Sep 7, 2016 ... The rotator cuff (RC) insertions according to most anatomical texts are described as being separate. However, clear fusion of the RC tendon fibres exist with prior studies showing an interdigitation forming a common, continuous insertion onto and around the lesser- and greater tubercles (LT & GT).

Fixation of the Achilles tendon insertion using suture button technology.

Science.gov (United States)

Fanter, Nathan J; Davis, Edward W; Baker, Champ L

2012-09-01

In the operative treatment of Achilles insertional tendinopathy, no guidelines exist concerning which form of fixation of the Achilles tendon insertion is superior. Transcalcaneal drill pin passage does not place any major plantar structures at risk, and the addition of a Krackow stitch and suture button to the fixation technique provides a significant increase in ultimate load to failure in Achilles tendon insertional repairs. Controlled laboratory study. The Achilles tendon insertions in 6 fresh-frozen cadaveric ankles were detached, and transcalcaneal drill pins were passed. Plantar dissection took place to evaluate the drill pin relationship to the plantar fascia, lateral plantar nerve and artery, flexor digitorum longus tendon, and master knot of Henry. The Achilles tendons were then repaired with a double-row suture anchor construct alone or with a suture button and Krackow stitch added to the double-row suture anchor construct. The repairs were then tested to maximum load to failure at 20 mm/min. The mode of failure was recorded, and the mean maximum load to failure was assessed using the Student t test for distributions with equal variance. Transcalcaneal drill pin passage did not place any selected anatomic structures at risk. The mean maximum load to failure for the suture bridge group was 239.2 N; it was 391.4 N for the group with the suture button (P = .014). The lateral plantar artery was the structure placed at greatest risk from drill pin placement, with a mean distance of 22.7 mm (range, 16.5-29.2 mm) between the pin and artery. In this laboratory study, transcalcaneal drill pin passage appeared to be anatomically safe, and the use of suture button technology with a Krackow stitch for Achilles tendon insertional repair significantly increased repair strength. Achilles tendon insertional repair with suture button fixation and a Krackow stitch may facilitate the earlier institution of postoperative rehabilitation and improve clinical outcomes.

Validation of a Low Cost, Disposable, and Ultrasound-guided Suprapubic Catheter Insertion Trainer.

Science.gov (United States)

Nonde, James; Adam, Ahmed; Laher, Abdullah Ebrahim

2018-02-27

To validate the newly designed ultrasound-guided suprapubic catheter insertion trainer (US-SCIT) model against the real life experience by enrolling participants with prior confidence in the technique of US-guided suprapubic catheter (SPC) insertion. The US-SCIT was self-constructed from common disposables and equipment found in the emergency department. A validation questionnaire was completed by all participants after SPC insertion on the US-SCIT model. Fifty participants enrolled in the study. Each participant had reported confidence in the SPC insertion technique, prior to participation in this study. There were 13 "super-users" (>65 previous successful real life SPC insertions) in the study. The total material cost per US-SCIT unit was 1.71 USD. The US-SCIT's value in understanding the principals of US-guided SPC insertion had a mean score of 8.86 (standard deviation [SD] 1.03), whereas its value in simulating contextual anatomy had a mean score of 8.26 (SD 1.48). The mean score of the model's ability to provide realistic sensory feedback was 8.12 (SD 1.78), whereas that of realism of initial urine outflow was 9.06 (SD 1.20). Simulation with the model compared well with real life SPC insertion, with a mean score of 8.30 (SD1.48). The US-SCIT model performed well in various spheres developed to assess its ability to simulate real life SPC insertion. We are confident that this low-cost, validated, US compatible SPC trainer, constructed from common material present in the ED, will be a valuable learning asset to trainees across the globe. Copyright © 2018 Elsevier Inc. All rights reserved.

Assessment of Insert Sizes and Adapter Content in Fastq Data from NexteraXT Libraries

Directory of Open Access Journals (Sweden)

Frances Susan Turner

2014-01-01

Full Text Available The Illumina NexteraXT transposon protocol is a cost effective way to generate paired end libraries. However the resulting insert size is highly sensitive to the concentration of DNA used, and the variation of insert sizes is often large. One consequence of this is some fragments may have an insert shorter than the length of a single read, particularly where the library is designed to produce overlapping paired end reads in order to produce longer continuous sequences. Such small insert sizes mean fewer longer reads, and also result in the presence of adapter at the end of the read. Here is presented a protocol to use publicly available tools to identify read pairs with small insert sizes and so likely to contain adapter, to check the sequence of the adapter, and remove adapter sequence from the reads. This protocol does not require a reference genome or prior knowledge of the sequence to be trimmed. Whilst the presence of fragments with small insert sizes may be a particular problem for NexteraXT libraries, the principle can be applied to any Illumina dataset in which the presence of such small inserts is suspected.

Adverse events associated with pediatric exposures to dextromethorphan.

Science.gov (United States)

Paul, Ian M; Reynolds, Kate M; Kauffman, Ralph E; Banner, William; Bond, G Randall; Palmer, Robert B; Burnham, Randy I; Green, Jody L

2017-01-01

Dextromethorphan is the most common over-the-counter (OTC) antitussive medication. We sought to characterize adverse events associated with dextromethorphan in children dextromethorphan with ≥1 adverse event from multiple U.S. sources (National Poison Data System, FDA Adverse Event Reporting System, manufacturer safety reports, news/media, medical literature) reported between 2008 and 2014. An expert panel determined the relationship between exposure and adverse events, estimated dose ingested, intent of exposure, and identified contributing factors to exposure. 1716 cases contained ≥1 adverse event deemed at least potentially related to dextromethorphan; 1417 were single product exposures. 773/1417 (55%) involved only one single-ingredient dextromethorphan product (dextromethorphan-only). Among dextromethorphan-only cases, 3% followed ingestion of a therapeutic dose; 78% followed an overdose. 69% involved unsupervised self-administration and 60% occurred in children dextromethorphan-only ingestion. Adverse events were predominantly associated with overdose, most commonly affecting the central nervous and autonomic systems.

Impact of Fixed-Bearing and Mobile-Bearing Tibial Insert in Unicondylar Knee Arthroplasty

Directory of Open Access Journals (Sweden)

Mehmet Faruk Çatma

2016-06-01

Full Text Available INTRODUCTION: The aim of the study is to investigate the impact of fixed or mobile-bearing tibial inserts on patellofemoral arthrosis and evaluate which one to be preferred for patients with patellofemoral arthrosis. METHODS: Operated in our clinic between January 2009 and February 2013, 33 with patellofemoral arthritis together with anteromedial compartment arthritis were included in the study. Patellofemoral joints of patients were evaluated according to the scoring system defined by Fulkerson-Shea. RESULTS: Unicondylar knee arthroplasty with fixed-bearing tibial insertsand 22 (66,6% (male: 3, female: 19 and unicondylar knee arthroplasty with mobile-bearing tibial inserts 11 (33,9 % (male: 2, female: 9 were implanted.Average knee flexion was found to be 116,5 (100-135 degrees in 22 patients with mobile-bearing tibial inserts, and 114,5 (95-135 in 11 patients with fixed-bearing tibial inserts. DISCUSSION AND CONCLUSION: Patellofemoral arthrosis is an important factor for unicondylar knee arthroplasty prognosis and one of the determinants of patient satisfaction. Significantly less patellofemoral complaints were seen with UKA with fixed-bearing tibial insert compared to mobile-bearing tibial insert.

Using PATIMDB to create bacterial transposon insertion mutant libraries.

Science.gov (United States)

Urbach, Jonathan M; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M

2009-04-01

PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software.

Acquisition of a novel eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site confers intracellular cleavage of an H7N7 influenza virus hemagglutinin

International Nuclear Information System (INIS)

Hamilton, Brian S.; Sun, Xiangjie; Chung, Changik; Whittaker, Gary R.

2012-01-01

A critical feature of highly pathogenic avian influenza viruses (H5N1 and H7N7) is the efficient intracellular cleavage of the hemagglutinin (HA) protein. H7N7 viruses also exist in equine species, and a unique feature of the equine H7N7 HA is the presence of an eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site. Here, we show that three histidine residues within the unique insertion of the equine H7N7 HA are essential for intracellular cleavage. An asparagine residue within the insertion-derived glycosylation site was also found to be essential for intracellular cleavage. The presence of the histidine residues also appear to be involved in triggering fusion, since mutation of the histidine residues resulted in a destabilizing effect. Importantly, the addition of a tetrabasic site and the eleven amino acid insertion conferred efficient intracellular cleavage to the HA of an H7N3 low pathogenicity avian influenza virus. Our studies show that acquisition of the eleven amino acid insertion offers an alternative mechanism for intracellular cleavage of influenza HA.

Acquisition of a novel eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site confers intracellular cleavage of an H7N7 influenza virus hemagglutinin

Energy Technology Data Exchange (ETDEWEB)

Hamilton, Brian S.; Sun, Xiangjie; Chung, Changik [Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca NY 14853 (United States); New York Center of Excellence for Influenza Research and Surveillance, University of Rochester Medical Center, Rochester NY 14627 (United States); Whittaker, Gary R., E-mail: grw7@cornell.edu [Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca NY 14853 (United States); New York Center of Excellence for Influenza Research and Surveillance, University of Rochester Medical Center, Rochester NY 14627 (United States)

2012-12-05

A critical feature of highly pathogenic avian influenza viruses (H5N1 and H7N7) is the efficient intracellular cleavage of the hemagglutinin (HA) protein. H7N7 viruses also exist in equine species, and a unique feature of the equine H7N7 HA is the presence of an eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site. Here, we show that three histidine residues within the unique insertion of the equine H7N7 HA are essential for intracellular cleavage. An asparagine residue within the insertion-derived glycosylation site was also found to be essential for intracellular cleavage. The presence of the histidine residues also appear to be involved in triggering fusion, since mutation of the histidine residues resulted in a destabilizing effect. Importantly, the addition of a tetrabasic site and the eleven amino acid insertion conferred efficient intracellular cleavage to the HA of an H7N3 low pathogenicity avian influenza virus. Our studies show that acquisition of the eleven amino acid insertion offers an alternative mechanism for intracellular cleavage of influenza HA.

Titanium Insertion into CO Bonds in Anionic Ti-CO2 Complexes.

Science.gov (United States)

Dodson, Leah G; Thompson, Michael C; Weber, J Mathias

2018-03-22

We explore the structures of [Ti(CO 2 ) y ] - cluster anions using infrared photodissociation spectroscopy and quantum chemistry calculations. The existence of spectral signatures of metal carbonyl CO stretching modes shows that insertion of titanium atoms into C-O bonds represents an important reaction during the formation of these clusters. In addition to carbonyl groups, the infrared spectra show that the titanium center is coordinated to oxalato, carbonato, and oxo ligands, which form along with the metal carbonyls. The presence of a metal oxalato ligand promotes C-O bond insertion in these systems. These results highlight the affinity of titanium for C-O bond insertion processes.

Vacuum guidelines for ISA insertions

International Nuclear Information System (INIS)

Edwards, D. Jr.

1976-01-01

Vacuum requirements place design restrictions on the ISA insertions. The vacuum tube diameter, given a distance L between pumps, is determined by the desorption of molecules from the wall under the impact of ions created by the beam, whereas the thickness of the tube must be sufficient to prevent collapse. In addition, the entire vacuum chamber must be able to be baked out at approximately 200 0 C

Ring insertions as light sources

International Nuclear Information System (INIS)

Green, G.K.

1975-01-01

Bending magnets can be inserted in the long straight sections of electron storage rings to produce synchrotron radiation. If the design is carefully proportioned, the bending magnets create only a small perturbation of the properties of the ring. The resulting spectra have favorable optical properties as sources for spectroscopy and diffraction studies. The characteristics of the source are discussed, and the geometrical requirements of the magnets are presented

Maize transformation technology development for commercial event generation

Science.gov (United States)

Que, Qiudeng; Elumalai, Sivamani; Li, Xianggan; Zhong, Heng; Nalapalli, Samson; Schweiner, Michael; Fei, Xiaoyin; Nuccio, Michael; Kelliher, Timothy; Gu, Weining; Chen, Zhongying; Chilton, Mary-Dell M.

2014-01-01

Maize is an important food and feed crop in many countries. It is also one of the most important target crops for the application of biotechnology. Currently, there are more biotech traits available on the market in maize than in any other crop. Generation of transgenic events is a crucial step in the development of biotech traits. For commercial applications, a high throughput transformation system producing a large number of high quality events in an elite genetic background is highly desirable. There has been tremendous progress in Agrobacterium-mediated maize transformation since the publication of the Ishida et al. (1996) paper and the technology has been widely adopted for transgenic event production by many labs around the world. We will review general efforts in establishing efficient maize transformation technologies useful for transgenic event production in trait research and development. The review will also discuss transformation systems used for generating commercial maize trait events currently on the market. As the number of traits is increasing steadily and two or more modes of action are used to control key pests, new tools are needed to efficiently transform vectors containing multiple trait genes. We will review general guidelines for assembling binary vectors for commercial transformation. Approaches to increase transformation efficiency and gene expression of large gene stack vectors will be discussed. Finally, recent studies of targeted genome modification and transgene insertion using different site-directed nuclease technologies will be reviewed. PMID:25140170

Maize transformation technology development for commercial event generation.

Science.gov (United States)

Que, Qiudeng; Elumalai, Sivamani; Li, Xianggan; Zhong, Heng; Nalapalli, Samson; Schweiner, Michael; Fei, Xiaoyin; Nuccio, Michael; Kelliher, Timothy; Gu, Weining; Chen, Zhongying; Chilton, Mary-Dell M

2014-01-01

Maize is an important food and feed crop in many countries. It is also one of the most important target crops for the application of biotechnology. Currently, there are more biotech traits available on the market in maize than in any other crop. Generation of transgenic events is a crucial step in the development of biotech traits. For commercial applications, a high throughput transformation system producing a large number of high quality events in an elite genetic background is highly desirable. There has been tremendous progress in Agrobacterium-mediated maize transformation since the publication of the Ishida et al. (1996) paper and the technology has been widely adopted for transgenic event production by many labs around the world. We will review general efforts in establishing efficient maize transformation technologies useful for transgenic event production in trait research and development. The review will also discuss transformation systems used for generating commercial maize trait events currently on the market. As the number of traits is increasing steadily and two or more modes of action are used to control key pests, new tools are needed to efficiently transform vectors containing multiple trait genes. We will review general guidelines for assembling binary vectors for commercial transformation. Approaches to increase transformation efficiency and gene expression of large gene stack vectors will be discussed. Finally, recent studies of targeted genome modification and transgene insertion using different site-directed nuclease technologies will be reviewed.

Histopathologic Consideration of Fiducial Gold Markers Inserted for Real-Time Tumor-Tracking Radiotherapy Against Lung Cancer

International Nuclear Information System (INIS)

Imura, Mikado; Yamazaki, Koichi; Kubota, Kanako C.; Itoh, Tomoo; Onimaru, Rikiya; Cho, Yasushi; Hida, Yasuhiro; Kaga, Kichizo; Onodera, Yuya; Ogura, Shigeaki; Dosaka-Akita, Hirotoshi; Shirato, Hiroki; Nishimura, Masaharu

2008-01-01

Purpose: Internal fiducial gold markers, safely inserted with bronchoscopy, have been used in real-time tumor-tracking radiotherapy for lung cancer. We investigated the histopathologic findings at several points after the insertion of the gold markers. Methods and Materials: Sixteen gold markers were inserted for preoperative marking in 7 patients who subsequently underwent partial resection of tumors by video-assisted thoracoscopic surgery within 7 days. Results: Fibrotic changes and hyperplasia of type 2 pneumocytes around the markers were seen 5 or 7 days after insertion, and fibrin exudation without fibrosis was detected 1 or 2 days after insertion. Conclusions: Because fibroblastic changes start approximately 5 days after gold marker insertion, real-time tumor-tracking radiotherapy should be started >5 days after gold marker insertion

Comparing insertion libraries in two Pseudomonas aeruginosa strains to assess gene essentiality.

Science.gov (United States)

Liberati, Nicole T; Urbach, Jonathan M; Thurber, Tara K; Wu, Gang; Ausubel, Frederick M

2008-01-01

Putative essential genes can be identified by comparing orthologs not disrupted in multiple near-saturated transposon insertion mutation libraries in related strains of the same bacterial species. Methods for identifying all orthologs between two bacterial strains and putative essential orthologs are described. In addition, protocols detailing near-saturation transposon insertion mutagenesis of bacteria are presented, including (1) conjugation-mediated mutagenesis, (2) automated colony picking and liquid handling of mutant cultures, and (3) arbitrary polymerase chain reaction amplification and sequencing of genomic DNA adjacent to transposon insertion sites.

A new robotic needle insertion method to minimise attendant prostate motion

International Nuclear Information System (INIS)

Lagerburg, Vera; Moerland, Marinus A.; Vulpen, Marco van; Lagendijk, Jan J.W.

2006-01-01

Background and purpose: The purpose of this study is to investigate the efficacy of a new needle insertion method (tapping instead of pushing) in reducing attendant tissue motion. This can be useful in applications where tissue motion due to needle insertion is problematic such as e.g. MRI-guided prostate brachytherapy and breast biopsies. In this study we will focus on prostate motion due to needle insertion. Material and methods: Prostate motion due to needle insertion was measured in 30 patients, who were transperineally implanted with fiducial gold markers for position verification in prostate intensity modulated radiotherapy. In total 32 needles were manually pushed into the prostate and 29 were tapped with a prototype robotic system. The prostate motion in the cranio-caudal direction was measured on the video record of the ultrasound images. Differences in prostate motion between the two needle insertion methods were analysed making use of SPSS. Results: The mean prostate motion was 5.6 mm (range 0.3-21.6) when the needle was pushed and 0.9 mm (range 0-2.0) when the needle was tapped into the prostate (p < 0.001). Conclusion: Prostate motion was significantly less when the needle was tapped into the prostate compared to when the needle was pushed. This result is important for the development of a tapping, MRI-guided, prostate implant robotic system

Deep round window insertion versus standard approach in cochlear implant surgery.

Science.gov (United States)

Nordfalk, Karl Fredrik; Rasmussen, Kjell; Bunne, Marie; Jablonski, Greg Eigner

2016-01-01

The aim of this study was to compare the outcomes of vestibular tests and the residual hearing of patients who have undergone full insertion cochlear implant surgery using the round window approach with a hearing preservation protocol (RW-HP) or the standard cochleostomy approach (SCA) without hearing preservation. A prospective study of 34 adults who underwent unilateral cochlear implantation was carried out. One group was operated using the RW-HP (n = 17) approach with Med-El +Flex(SOFT) electrode array with full insertion, while the control group underwent a more conventional SCA surgery (n = 17) with shorter perimodiolar electrodes. Assessments of residual hearing, cervical vestibular-evoked myogenic potentials (cVEMP), videonystagmography, subjective visual vertical/horizontal (SVH/SVV) were performed before and after surgery. There was a significantly (p < 0.05) greater number of subjects who exhibited complete or partial hearing preservation in the deep insertion RW-HP group (9/17) compared to the SCA group (2/15). A higher degree of vestibular loss but a lower degree of vertigo symptoms could be seen in the RW-HP group, but the differences were not statistically significant. It is possible to preserve residual hearing to a certain extent also with deep insertion. Full insertion with hearing preservation was less harmful to residual hearing particularly at 125 Hz (p < 0.05), than was the standard cochleostomy approach.

The effect of implant design and bone quality on insertion torque, resonance frequency analysis, and insertion energy during implant placement in low or low- to medium-density bone.

Science.gov (United States)

Wang, Tong-Mei; Lee, Ming-Shu; Wang, Juo-Song; Lin, Li-Deh

2015-01-01

This study investigated the effect of implant design and bone quality on insertion torque (IT), implant stability quotient (ISQ), and insertion energy (IE) by monitoring the continuous change in IT and ISQ while implants were inserted in artificial bone blocks that simulate bone of poor or poor-to-medium quality. Polyurethane foam blocks (Sawbones) of 0.16 g/cm³ and 0.32 g/cm³ were respectively used to simulate low density and low- to medium-density cancellous bone. In addition, some test blocks were laminated with a 1-mm 0.80 g/cm³ polyurethane layer to simulate cancellous bone with a thin cortical layer. Four different implants (Nobel Biocare Mk III-3.75, Mk III-4.0, Mk IV-4.0, and NobelActive-4.3) were placed into the different test blocks in accordance with the manufacturer's instructions. The IT and ISQ were recorded at every 0.5-mm of inserted length during implant insertion, and IE was calculated from the torque curve. The peak IT (PIT), final IT (FIT), IE, and final ISQ values were statistically analyzed. All implants showed increasing ISQ values when the implant was inserted more deeply. In contrast to the ISQ, implants with different designs showed dissimilar IT curve patterns during the insertion. All implants showed a significant increase in the PIT, FIT, IE, and ISQ when the test-block density increased or when the 1-mm laminated layer was present. Tapered implants showed FIT or PIT values of more than 40 Ncm for all of the laminated test blocks and for the nonlaminated test blocks of low to medium density. Parallel-wall implants did not exhibit PIT or FIT values of more than 40 Ncm for all of the test blocks. NobelActive-4.3 showed a significantly higher FIT, but a significantly lower IE, than Mk IV-4.0. While the existence of cortical bone or implant designs significantly affects the dynamic IT profiles during implant insertion, it does not affect the ISQ to a similar extent. Certain implant designs are more suitable than others if high IT is

A randomized, double-blind comparison study of EMLA and ELA-Max for topical anesthesia in children undergoing intravenous insertion.

Science.gov (United States)

Koh, Jeffrey L; Harrison, Dale; Myers, Robert; Dembinski, Robert; Turner, Helen; McGraw, Terrence

2004-12-01

Topical anesthetics may help reduce discomfort associated with procedures involving needle-puncture, such as intravenous (i.v.) insertions, in children. EMLA cream has become a common, noninvasive therapy for topical anesthesia in children. ELA-Max is a recently introduced topical anesthetic cream marketed as being as effective in producing topical anesthesia after a 30-min application as EMLA is after a 60-min application. The purpose of this research was to compare ELA-Max at 30 min with EMLA at 60 min for providing topical anesthesia for i.v. insertions in children. Sixty children, ages 8-17 years, requiring an i.v. were randomized to receive either the 30 min application of ELA-Max (n = 30) or the 60 min application of EMLA (n = 30). Children rated any pain associated with the i.v. insertion using a 100-mm Visual Analog Scale (VAS). The anesthesiologist assessed the presence of blanching at the site and rated the difficulty of placing the i.v. There was no clinically or statistically significant difference in pain ratings (P = 0.87) between the ELA-Max (mean = 25.7) and the EMLA (mean = 26.8) groups. ELA-Max caused significantly (P = 0.04) less blanching than EMLA, however there was no difference in the anesthesiologists' rating of the difficulty of the i.v. placement between the groups (P = 0.73). Results from this study support the claim that a 30-min application of ELA-Max (with occlusion) is as effective as a 60-min application of EMLA (with occlusion) for producing topical anesthesia for i.v. insertion in children.

Insertion forces and intracochlear trauma in temporal bone specimens implanted with a straight atraumatic electrode array.

Science.gov (United States)

Mirsalehi, Marjan; Rau, Thomas S; Harbach, Lenka; Hügl, Silke; Mohebbi, Saleh; Lenarz, Thomas; Majdani, Omid

2017-05-01

The aim of the study was to evaluate insertion forces during manual insertion of a straight atraumatic electrode in human temporal bones, and post-implantation histologic evaluation of the samples to determine whether violation of intracochlear structures is related to insertion forces. In order to minimize intracochlear trauma and preserve residual hearing during cochlear implantation, knowledge of the insertion forces is necessary. Ten fresh frozen human temporal bones were prepared with canal wall down mastoidectomy. All samples were mounted on a one-axis force sensor. Insertion of a 16-mm straight atraumatic electrode was performed from different angles to induce "traumatic" insertion. Histologic evaluation was performed in order to evaluate intracochlear trauma. In 4 of 10 samples, dislocation of the electrode into scala vestibuli was observed. The mean insertion force for all 10 procedures was 0.003 ± 0.005 N. Insertion forces measured around the site of dislocation to scala vestibuli in 3 of 4 samples were significantly higher than insertion forces at the same location of the cochleae measured in samples without trauma (p straight atraumatic electrode is lower than reported by other studies using longer electrodes. Based on our study, insertion forces leading to basilar membrane trauma may be lower than the previously reported direct rupture forces.

Thermohydraulic performance comparision of compound inserts for a turbulent flow through a circular tube

Directory of Open Access Journals (Sweden)

Kapse Arvind A.

2017-01-01

Full Text Available Heat transfer and pressure drop characteristics of three different passive inserts are experimentally investigated for individual and compound insertion. Insert cross-section is altered along the length of test section for compound insertion. Test runs were conducted in a concentric circular tube in tube heat exchanger in the Reynolds number range of 8000 to 32000 with water as a working fluid. Enhancements in Nusselt number and friction factors are reported to be in the range of 38-234% and 55-524%, respectively, over plain tube. The average performance ratios based on equal pumping power are also reported and found in the range of 0.63-1.53. Based on experimental results, optimum combination for compound insertion is proposed.

Readability assessment of package inserts of biological medicinal products from the European medicines agency website.

Science.gov (United States)

Piñero-López, Ma Ángeles; Modamio, Pilar; Lastra, Cecilia F; Mariño, Eduardo L

2014-07-01

Package inserts that accompany medicines are a common source of information aimed at patients and should match patient abilities in terms of readability. Our objective was to determine the degree of readability of the package inserts for biological medicinal products commercially available in 2007 and compare them with the readability of the same package inserts in 2010. A total of 33 package inserts were selected and classified into five groups according to the type of medicine: monoclonal antibody-based products, cytokines, therapeutic enzymes, recombinant blood factors and other blood-related products, and recombinant hormones. The package inserts were downloaded from the European Medicines Agency website in 2007 and 2010. Readability was evaluated for the entire text of five of the six sections of the package inserts and for the 'Annex' when there was one. Three readability formulas were used: SMOG (Simple Measure of Gobbledygook) grade, Flesh-Kincaid grade level, and Szigriszt's perspicuity index. No significant differences were found between the readability results for the 2007 package inserts and those from 2010 according to any of the three readability indices studied (p>0.05). However, there were significant differences (preadability scores of the sections of the package inserts in both 2007 and 2010. The readability of the package inserts was above the recommended sixth grade reading level (ages 11-12) and may lead to difficulties of understanding for people with limited literacy. All the sections should be easy to read and, therefore, the readability of the medicine package inserts studied should be improved.

Control Rod Withdrawal Events Analyses for the Prototype Gen-IV SFR

Energy Technology Data Exchange (ETDEWEB)

Choi, Chiwoong; Ha, Kwiseo; Jeong, Taekyeong; Jeong, Jaeho; Chang, Wonpyo; Lee, Seungwon; An, Sangjun; Lee, Kwilim [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2016-10-15

To confirm the limiting condition, based on the maximum allowable reactivity insertion of 0.3 $, three cases from the end of cycle (EOC) are selected. In addition, assuming the failure of CRSS by earthquake, additional cases is defined at beginning of cycle (BOC). When the CRW occurs, the reactor can be protected by plant protection system (PPS). In this study, PPS mechanism is sequentially studied for all initiating events. For design basis accidents (DBA), the reactor can be scrammed by reactor protection system (RPS). The first and seconds RPS signals are checked during transients. When RPS is failed, so called as anticipated transient without scram (ATWS), the reactor will be protected by diverse protection system (DPS). In this study, in order to analyze various initiating events related control rod withdrawal, four kinds of operating condition is defined. TOP events are analyzed using MARS-LMR. The influence of various plant protection system such as RPS and DPS are investigated.

Trending analysis of precursor events

International Nuclear Information System (INIS)

Watanabe, Norio

1998-01-01

The Accident Sequence Precursor (ASP) Program of United States Nuclear Regulatory Commission (U.S.NRC) identifies and categorizes operational events at nuclear power plants in terms of the potential for core damage. The ASP analysis has been performed on yearly basis and the results have been published in the annual reports. This paper describes the trends in initiating events and dominant sequences for 459 precursors identified in the ASP Program during the 1969-94 period and also discusses a comparison with dominant sequences predicted in the past Probabilistic Risk Assessment (PRA) studies. These trends were examined for three time periods, 1969-81, 1984-87 and 1988-94. Although the different models had been used in the ASP analyses for these three periods, the distribution of precursors by dominant sequences show similar trends to each other. For example, the sequences involving loss of both main and auxiliary feedwater were identified in many PWR events and those involving loss of both high and low coolant injection were found in many BWR events. Also, it was found that these dominant sequences were comparable to those determined to be dominant in the predictions by the past PRAs. As well, a list of the 459 precursors identified are provided in Appendix, indicating initiating event types, unavailable systems, dominant sequences, conditional core damage probabilities, and so on. (author)

Aspects of insertion in random trees

NARCIS (Netherlands)

Bagchi, Arunabha; Reingold, E.M.

1982-01-01

A method formulated by Yao and used by Brown has yielded bounds on the fraction of nodes with specified properties in trees bult by a sequence of random internal nodes in a random tree built by binary search and insertion, and show that in such a tree about bounds better than those now known. We

TECHNOLOGY OF EDUCATIONAL EVENTS DESIGNING

Directory of Open Access Journals (Sweden)

N. V. Volkova

2017-01-01

Full Text Available The aim of the article is to prove and disclose the essence of the author’s technology of educational events designing.Methodology and methods of research. Methodological basis of work is humanitarian approach. The method of pedagogical modeling was used for the model development of educational events influence on pedagogical activity formation. The content analysis of texts descriptions, case-study method, expert estimations of event projects were applied as the main methods of efficiency confirmation of the technology of educational events design.Results and scientific novelty. The characteristics of an educational event are emphasized by means of an empirical way: opening (what a person opens for himself; generation (a result of a personal action; and participation in creation of something "new" (new communications, relations and experience. The structure of technology of educational events design including work with concepts (an educational event, substantial and procedural components is presented. The technology of educational events designing is considered as the process of the well-grounded choice of designing technologies, mutual activity, pedagogical communication, components of educational activity: contents, methods, means, and organizational forms depending on educational aims due to age-specific peculiarities of participants of the educational event. The main conditions providing successful use of the technology are the involvement into joint cognitive activity of all its participants and importance of the events for each of them that qualitatively change the nature of a cognitive process and generate real transformations of the reality.Practical significance. The author’s experience in teaching testifies to introduction of the module «Technology of Design of Educational Events» into the basic educational subject-module «Design Competence of the Teacher» (degree program «Pedagogical Education», considering this module as

Impact of hydrogen insertion on vehicular natural gas

Energy Technology Data Exchange (ETDEWEB)

Strangueto, Karina Maretti; Silva, Ennio Peres da [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Fac. of Mechanical Engineering. Energy Dept.], Email: karinakms@fem.unicamp.br

2010-07-01

This article aims to analyze the possibility of insertion of hydrogen in the vehicular natural gas or even the insertion of the hydrogen in the compressed natural gas used in Brazil. For the production of this hydrogen, the spilled turbinable energy from Itaipu would be harnessed. The calculation of production can be extended to other power plants which are close to the natural gas pipelines, where the hydrogen would be introduced. Then, it was analyzed the consumption of natural gas in vehicles in Brazil, the regulation of transportation, the sales of compressed natural gas to fuelling station, the specifications that the piped gas should follow to be sold, and how much hydrogen could be accepted in the mix. (author)

Placement of a peripherally inserted central catheter into the azygous vein

Energy Technology Data Exchange (ETDEWEB)

Franklin, Iain, E-mail: iain.franklin@health.qld.gov.au; Gilmore, Christopher [The Prince Charles Hospital, Brisbane, Queensland (Australia)

2015-06-15

Peripherally inserted central catheters (PICC) are used for a variety of infusion therapies. They are indicated in patients requiring long-term venous access. Incorrect positioning of the insertion of a PICC line is one of the known complications when inserting the device in clinical practice. Radiographers once performing imaging will commonly check if the tip of a PICC has entered the superior vena cava. This case study will report on a lesser known incorrect placement of a PICC line into the azygous vein and how this can be detected on radiographic imaging. This outcome for the patient can be detrimental as it has an increased risk of perforation, thrombus, and fistula formation.

Targeted gene insertion for molecular medicine.

Science.gov (United States)

Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

2008-11-01

Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

Nontraumatic tibial polyethylene insert cone fracture in mobile-bearing posterior-stabilized total knee arthroplasty

Directory of Open Access Journals (Sweden)

Yohei Tanikake

2016-12-01

Full Text Available A 72-year-old male patient underwent mobile-bearing posterior-stabilized total knee arthroplasty for osteoarthritis. He experienced a nontraumatic polyethylene tibial insert cone fracture 27 months after surgery. Scanning electron microscopy of the fracture surface of the tibial insert cone suggested progress of ductile breaking from the posterior toward the anterior of the cone due to repeated longitudinal bending stress, leading to fatigue breaking at the anterior side of the cone, followed by the tibial insert cone fracture at the anterior side of the cone, resulting in fracture at the base of the cone. This analysis shows the risk of tibial insert cone fracture due to longitudinal stress in mobile-bearing posterior-stabilized total knee arthroplasty in which an insert is designed to highly conform to the femoral component.

Evaluation of advanced automatic PET segmentation methods using nonspherical thin-wall inserts

International Nuclear Information System (INIS)

Berthon, B.; Marshall, C.; Evans, M.; Spezi, E.

2014-01-01

Purpose: The use of positron emission tomography (PET) within radiotherapy treatment planning requires the availability of reliable and accurate segmentation tools. PET automatic segmentation (PET-AS) methods have been recommended for the delineation of tumors, but there is still a lack of thorough validation and cross-comparison of such methods using clinically relevant data. In particular, studies validating PET segmentation tools mainly use phantoms with thick plastic walls inserts of simple spherical geometry and have not specifically investigated the effect of the target object geometry on the delineation accuracy. Our work therefore aimed at generating clinically realistic data using nonspherical thin-wall plastic inserts, for the evaluation and comparison of a set of eight promising PET-AS approaches. Methods: Sixteen nonspherical inserts were manufactured with a plastic wall of 0.18 mm and scanned within a custom plastic phantom. These included ellipsoids and toroids derived with different volumes, as well as tubes, pear- and drop-shaped inserts with different aspect ratios. A set of six spheres of volumes ranging from 0.5 to 102 ml was used for a baseline study. A selection of eight PET-AS methods, written in house, was applied to the images obtained. The methods represented promising segmentation approaches such as adaptive iterative thresholding, region-growing, clustering and gradient-based schemes. The delineation accuracy was measured in terms of overlap with the computed tomography reference contour, using the dice similarity coefficient (DSC), and error in dimensions. Results: The delineation accuracy was lower for nonspherical inserts than for spheres of the same volume in 88% cases. Slice-by-slice gradient-based methods, showed particularly lower DSC for tori (DSC 0.76 except for tori) but showed the largest errors in the recovery of pears and drops dimensions (higher than 10% and 30% of the true length, respectively). Large errors were visible

The Effect of Insertion Technique on Temperatures for Standard and Self-Drilling External Fixation Pins.

Science.gov (United States)

Manoogian, Sarah; Lee, Adam K; Widmaier, James C

2017-08-01

No studies have assessed the effects of parameters associated with insertion temperature in modern self-drilling external fixation pins. The current study assessed how varying the presence of irrigation, insertion speed, and force impacted the insertion temperatures of 2 types of standard and self-drilling external fixation half pins. Seventy tests were conducted with 10 trials for 4 conditions on self-drilling pins, and 3 conditions for standard pins. Each test used a thermocouple inside the pin to measure temperature rise during insertion. Adding irrigation to the standard pin insertion significantly lowered the maximum temperature (P drilling pin tests dropped average rise in temperature from 151.3 ± 21.6°C to 124.1 ± 15.3°C (P = 0.005). When the self-drilling pin insertion was decreased considerably from 360 to 60 rpm, the temperature decreased significantly from 151.3 ± 21.6°C to 109.6 ± 14.0°C (P drilling pin temperature increase was not significant. The standard pin had lower peak temperatures than the self-drilling pin for all conditions. Moreover, slowing down the insertion speed and adding irrigation helped mitigate the temperature increase of both pin types during insertion.

A quality assurance investigation of CLABSI events: are there exceptions to never?

Science.gov (United States)

Strickler, Samantha; Gupta, Rohit R; Doucette, John T; Kohli-Seth, Roopa

2018-01-01

In the USA, central line associated blood stream infections (CLABSIs) have been designated as 'never events', prompting initiatives towards a 'zero CLABSIs' standard. We propose that there are cascading risk factors predisposing certain patient cohorts to higher CLABSIs rates. A retrospective review of all CLABSI infections over a 12-month period was undertaken. Risk factors examined included catheter type, insertion site and parenteral nutrition (PN) status. Additional factors analysed included acute kidney injury (AKI), chronic kidney disease (CKD) and hospital-acquired infections (HAIs). Thirty-four CLABSIs were identified in 33 adult patients (median age = 57 years). Temporary central venous catheters accounted for 12 (35%), peripherally inserted central catheters for five (14.7%), and permanent catheters for 17 CLABSIs (50%); the median duration from insertion was 15 days (interquartile range = 9-26). Among patient factors, immunosuppression and hyperglycaemia were the most common (n = 19, 55%), followed by PN and CKD (n = 17, 50.0%), AKI (n = 16, 47.1%) and HAIs (n = 13, 38.2%). A majority of patients with CLABSIs (n = 20 58.8%) had at least three risk factors. These findings reflect the complexity of CLABSIs with multiple patient and hospital factors influencing incidence. It suggests the need for further studies to re-calibrate the zero CLABSI model towards one with greater relevance.

Distal insertions of the semimembranosus tendon: MR imaging with anatomic correlation

Energy Technology Data Exchange (ETDEWEB)

Maeseneer, Michel de [Universitair Ziekenhuis Brussel, Department of Radiology, Jette, Brussels (Belgium); Vrije Universiteit Brussel, Department of Experimental Anatomy, Brussels (Belgium); Shahabpour, Maryam; Milants, Annemieke; Ridder, Filip de; Mey, Johan de [Universitair Ziekenhuis Brussel, Department of Radiology, Jette, Brussels (Belgium); Lenchik, Leon [Wake Forest University, Department of Radiology, Winston-Salem, NC (United States); Cattrysse, Erik [Vrije Universiteit Brussel, Department of Experimental Anatomy, Brussels (Belgium)

2014-06-15

The purpose of this study is to investigate the distal insertions of the semimembranosus tendon with MR imaging, correlated with findings in cadavers. Four fresh cadaveric specimens were studied with 3-T MR imaging. Sequences included proton density (PD) sequences (TE, 13; TR, 4957; FOV, 170 x 170; matrix, 424 x 413; NA, 2; slice thickness, 2.5 mm) in the axial, coronal, and sagittal planes and 3D fast field echo (FFE) sequences (TR 9.4; TE 6.9; FOV, 159 x 105; matrix, 200 x 211; NA, 2; slice thickness, 0.57 mm). One specimen was dissected and three specimens were sectioned with a bandsaw in the axial, coronal, and sagittal plane. The sections were photographed and correlated with MR images. To standardize the analysis, the semimembranosus muscle and tendon were assessed at seven levels for the axial sections, and at three levels for the coronal and sagittal sections. Anatomic dissection revealed six insertions of the distal semimembranosus tendon: direct arm, anterior arm, posterior oblique ligament extension, oblique popliteal ligament extension, distal tibial expansion (popliteus aponeurosis), and meniscal arm. Axial MR images showed five of six insertions: direct arm, anterior arm, oblique popliteal ligament extension, posterior oblique ligament extension, and distal tibial expansion. Sagittal MR images showed four of six insertions: direct arm, anterior arm, oblique popliteal ligament arm, and distal tibial expansion. Sagittal MR images were ideal for showing the direct arm insertion, but were less optimal than the axial images for showing the other insertions. The anterior arm was seen but volume averaging was present with the gracilis tendon. Coronal MR images optimally revealed the anterior arm, although magic angle artifact was present at its posterior aspect. The common semimembranosus tendon and meniscal arm were also well depicted. The division in anterior arm, direct arm, and oblique popliteal ligament arm was poorly seen on coronal images due to

Genome-wide LORE1 retrotransposon mutagenesis and high-throughput insertion detection in Lotus japonicus

DEFF Research Database (Denmark)

Urbanski, Dorian Fabian; Malolepszy, Anna; Stougaard, Jens

2012-01-01

Insertion mutants facilitate functional analysis of genes, but for most plant species it has been difficult to identify a suitable mutagen and to establish large populations for reverse genetics. The main challenge is developing efficient high-throughput procedures for both mutagenesis and insert......Insertion mutants facilitate functional analysis of genes, but for most plant species it has been difficult to identify a suitable mutagen and to establish large populations for reverse genetics. The main challenge is developing efficient high-throughput procedures for both mutagenesis...... plants. The identified insertions showed that the endogenous LORE1 retrotransposon is well suited for insertion mutagenesis due to its homogenous gene targeting and exonic insertion preference. Since LORE1 transposition occurs in the germline, harvesting seeds from a single founder line and cultivating...... progeny generates a complete mutant population. This ease of LORE1 mutagenesis combined with the efficient FSTpoolit protocol, which exploits 2D pooling, Illumina sequencing, and automated data analysis, allows highly cost-efficient development of a comprehensive reverse genetic resource....

A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.

Science.gov (United States)

Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui

2009-04-01

Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.

Internal carotid artery rupture caused by carotid shunt insertion.

Science.gov (United States)

Illuminati, Giulio; Caliò, Francesco G; Pizzardi, Giulia; Vietri, Francesco

2015-01-01

Shunting is a well-accepted method of maintaining cerebral perfusion during carotid endarterectomy (CEA). Nonetheless, shunt insertion may lead to complications including arterial dissection, embolization, and thrombosis. We present a complication of shunt insertion consisting of arterial wall rupture, not reported previously. A 78-year-old woman underwent CEA combined with coronary artery bypass grafting (CABG). At the time of shunt insertion an arterial rupture at the distal tip of the shunt was detected and was repaired via a small saphenous vein patch. Eversion CEA and subsequent CABG completed the procedure whose postoperative course was uneventful. Shunting during combined CEA-CABG may be advisable to assure cerebral protection from possible hypoperfusion due to potential hemodynamic instability of patients with severe coronary artery disease. Awareness and prompt management of possible shunt-related complications, including the newly reported one, may contribute to limiting their harmful effect. Arterial wall rupture is a possible, previously not reported, shunt-related complication to be aware of when performing CEA. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Suicide and Murder-Suicide Involving Aircraft.

Science.gov (United States)

Kenedi, Christopher; Friedman, Susan Hatters; Watson, Dougal; Preitner, Claude

2016-04-01

This is a systematic review of suicide and homicide-suicide events involving aircraft. In aeromedical literature and in the media, these very different events are both described as pilot suicide, but in psychiatry they are considered separate events with distinct risk factors. Medical databases, internet search engines, and aviation safety databases were searched in a systematic way to obtain relevant cases. Relevant articles were searched for additional references. There were 65 cases of pilot suicide and 6 cases of passengers who jumped from aircraft found. There were also 18 cases of homicide-suicide found involving 732 deaths. Pilots perpetrated 13 homicide-suicide events. Compared to non-aviation samples, a large percentage of pilot suicides in this study were homicide-suicides (17%). Homicide-suicide events occur extremely rarely. However, their impact in terms of the proportion of deaths is significant when compared to deaths from accidents. There is evidence of clustering where pilot suicides occur after by media reports of suicide or homicide-suicide. Five of six homicide-suicide events by pilots of commercial airliners occurred after they were left alone in the cockpit. This, along with a sixth incident in which active intervention by a Japan Air crew saved 147 lives, suggests that having two flight members in the cockpit is potentially protective. No single factor was associated with the risk for suicide or homicide-suicide. Factors associated with both events included legal and financial crises, occupational conflict, mental illness, and relationship stressors. Drugs and/or alcohol played a role in almost half of suicides, but not in homicide-suicides.

Study of the mechanical stability of the ATLAS Insertable B-Layer

CERN Document Server

The ATLAS collaboration

2015-01-01

During the commissioning and alignment of the ATLAS Insertable B-Layer (IBL) using cosmic-ray data, a mechanical distortion of the IBL was observed. This distortion is caused by a difference in the coefficients of thermal expansion of the IBL stave components. The results of a preliminary study of the mechanical stability of the IBL are presented in this note. The qualitative properties of the distortion are confirmed using a 3D finite element analysis. Using cosmic-ray data collected in March 2015, the magnitude of the distortion is found to depend linearly on the operating temperature of the IBL, with a gradient of $\\sim10~{\\rm \\mu m/K}$. The peak-to-peak temperature variation of the IBL staves is measured to be less than 0.2 K during the same cosmic-ray run. The expected bias to the transverse impact parameter $(d_{0})$ of charged tracks under a temperature variation of 0.2 K is evaluated to be $\\sim 1~{\\rm \\mu m}$ using $Z\\rightarrow{\\mu^+\\mu^-}$ events from a Mote Carlo simulation of proton-proton collis...

Simple New Screw Insertion Technique without Extraction for Broken Pedicle Screws.

Science.gov (United States)

Kil, Jin-Sang; Park, Jong-Tae

2018-05-01

Spinal transpedicular screw fixation is widely performed. Broken pedicle screw rates range from 3%-7.1%. Several techniques have been described for extraction of broken pedicle screws. However, most of these techniques require special instruments. We describe a simple, modified technique for management of broken pedicle screws without extraction. No special instruments or drilling in an adjacent pedicle are required. We used a high-speed air drill with a round burr. With C-arm fluoroscopy guidance, the distal fragment of a broken pedicle screw was palpated using free-hand technique through the screw entry hole. A high-speed air drill with a round burr (not a diamond burr) was inserted through the hole. Drilling began slowly and continued until enough space was obtained for new screw insertion. Using this space, we performed new pedicle screw fixation medially alongside the distal fragment of the broken pedicle screw. We performed the insertion with a previously used entry hole and pathway in the pedicle. The same size pedicle screw was used. Three patients were treated with this modified technique. New screw insertion was successful in all cases after partial drilling of the distal broken pedicle screw fragment. There were no complications, such as screw loosening, dural tears, or root injury. We describe a simple, modified technique for management of broken pedicle screws without extraction. This technique is recommended in patients who require insertion of a new screw. Copyright © 2017. Published by Elsevier Inc.

Low voltage aluminium anodes. Optimization of the insert-anode bond

Energy Technology Data Exchange (ETDEWEB)

Le Guyader, Herve; Debout, Valerie; Grolleau, Anne-Marie [DCN Cherbourg, Departement 2EI, Place Bruat, BP 440, 50104 Cherbourg-Octeville (France); Pautasso, Jean-Pierre [DGA/CTA 16 bis, avenue Prieur de la Cote D' Or, 94 114 Arcueil Cedex (France)

2004-07-01

Zinc or Al/Zn/In sacrificial anodes are widely used to protect submerged marine structures from corrosion. Their Open Circuit Potential range from - 1 V vs. Ag/AgCl for Zn anodes to -1.1 V vs. Ag/AgCl for Al/Zn/In. These potentials are sufficiently electronegative as to reduce the threshold for stress corrosion cracking and/or hydrogen embrittlement, KISCC, especially in the presence of high strength alloys. In the 90's, an extensive research programme was initiated by DGA/DCN to implement a new low voltage material. Laboratory and full scale marine tests performed on industrial castings, as previously reported, led to the development of a new patented Al- 0.1%Ga alloy having a working potential of - 0.80 to - 0.83 V vs. Ag/AgCl. This alloy was also evaluated at full scale at the Naval Research Laboratory anode qualification site in Key West, Fl, and gave satisfactory results. Around 500 cylindrical AlGa anodes were then installed on a submerged marine structure replacing the classical zinc anode. A first inspection, carried out after a few months of service, showed that some of the anodes had not operated as expected, which led to further investigations. The examinations performed indicated that the problem was due to a bad metallurgical compatibility between the insert and the sacrificial materials inducing a poor bond between the anode and the plain rod insert. Progressive loss of contact between the anode and the structure to be protected was then induced by penetration of sea water and corrosion at the anode-insert interface. This phenomenon was aggravated by seawater pressure. Additional studies were therefore launched with two aims: (1) find temporary remedies for the anodes already installed on the structure; (2) correct the anode original design and/or manufacturing process to achieve the maximum performance on new anodes lots. This paper describes the various solutions investigated to improve the insert-anode bond: design of the anode, rugosity and

HIV evolution in early infection: selection pressures, patterns of insertion and deletion, and the impact of apobec

Energy Technology Data Exchange (ETDEWEB)

Korber, Bette [Los Alamos National Laboratory; Bhattacharya, Tanmoy [Los Alamos National Laboratory; Giorgi, Elena [Los Alamos National Laboratory; Gaschen, B [Los Alamos National Laboratory; Daniels, M [Los Alamos National Laboratory

2009-01-01

The pattern of viral diversification in newly infected individuals provides information about the host environment and immune responses typically experienced by the newly transmitted virus. For example, sites that tend to evolve rapidly across multiple early-infection patients could be involved in enabling escape from common early immune responses, represent adaptation for rapid growth in a newly infected host, or reversion from less fit forms of the virus that were selected for immune escape in previous hosts. Here we investigated the diversification of HIV -I env coding sequences in 81 very early B SUbtype infections previously shown to have resulted from transmission or expansion of single viruses (n=78) or two closely related viruses (n=3). In these cases the sequence of the infecting virus can be estimated accurately, enabling inference of both the direction of substitutions as well as distinction between insertion and deletion events. By integrating information across multiple acutely infected hosts, we find evidence of adaptive evolution of HIV-1 envand identified a subset of codon sites that diversified more rapidly than can be explained by a model of neutral evolution. Of 24 such rapidly diversifying sites, 14 were either (i) clustered and embedded in CTL epitopes that were verified experimentally or predicted based on the individual's HLA or (ii) in a nucleotide context indicative of APOBEC mediated G-to-A substitutions, despite having excluded heavily hypermutated sequences prior to the analysis. In several cases, a rapidly evolving site was both embedded in an APOBEC motif and in a CTL epitope, suggesting that APOBEC may facilitate early immune escape. Ten rapidly diversifying sites could not be explained by CTL escape or APOBEC hypermutation, including the most frequently mutated site, in the fusion peptide of gp4l. We also examined the distribution, extent, and sequence context of insertions and deletions and provide evidence that the length

The impact of emotional involvement on online service buying decisions: an event-related potentials perspective.

Science.gov (United States)

Zhao, Meina; Wang, Jing; Han, Weiwei

2015-12-02

When examining a buying process, changes in human brain signals and their event-related potential (ERP) components can be considered a reflection of the consumers' emotions. In this experiment, participants were shown 12 products and related services that were available for purchase. After recording ERP components, we used a questionnaire to measure the individuals' emotional involvement toward the services (i.e. the same services shown in the stimuli) of the 12 products to measure the emotional valence of the services. The emotional ERP components and the late positive potential (LPP) were elicited under the service conditions and distributed over the left frontal regions. We determined that the services may evoke an LPP and that services with a high emotional value may evoke a larger LPP, which suggests that positive emotion may be measured using the LPP amplitude in the left frontal regions. This result helps elucidate whether positive emotions are stimulated during the product-service system decision-making process and helps understand the emotional valences of different services. Our analysis of the emotional motivation of the consumer suggests that the LPP may be useful as an emotional indicator for measuring consumers' evaluation of services that provides a neural view of product-service system buying decisions.

Safety of achilles detachment and reattachment using a standard midline approach to insertional enthesophytes.

Science.gov (United States)

McAlister, Jeffrey E; Hyer, Christopher F

2015-01-01

Detachment with reattachment of the Achilles tendon is a common surgery for debridement of retrocalcaneal exostosis, bursitis, and other insertional pathologic entities. The technique involves a midline skin incision on the posterior Achilles to the tendon. The distal Achilles attachment is removed in a U-shaped manner, leaving the medial and lateral flares, but exposing the posterior spur. This midline approach provides excellent exposure and allows for rapid and efficient surgical debridement. The tendon is reapproximated and repaired with a suture anchor to facilitate fixation to the posterior calcaneus. Some surgeons have expressed concerned that the rupture risk could be increased in the postoperative period using this technique. The present study was a retrospective medical record review of 98 patients (100 feet) who had undergone a midline approach with Achilles reattachment after insertional Achilles debridement during a 3-year period. The demographic and comorbidity data were collected and analyzed. The outcome measures were postoperative rupture and the need for revision surgery. The mean age was 51.9 years, and the patients included 59 females (60.2%) and 39 males (39.8%). The complications included 4 rupture or avulsion revisions (4.0%) and 2 recurrent pain and tendinitis revisions (2.0%). The most common repeat repair procedure included hardware removal and a flexor hallucis longus transfer or augmentation. Nine patients (9.0%) had wound complications, 7 (77.8%) of which necessitated incision and drainage. The midline approach with Achilles detachment and reattachment is a safe and effective method of surgical treatment of insertional Achilles pathologic entities. The low reoperation rate of 4.0% will allow foot and ankle surgeons to safely rely on this approach. Copyright © 2015 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Assessing traumatic event exposure: general issues and preliminary findings for the Stressful Life Events Screening Questionnaire.

Science.gov (United States)

Goodman, L A; Corcoran, C; Turner, K; Yuan, N; Green, B L

1998-07-01

This article reviews the psychometric properties of the Stressful Life Events Screening Questionnaire (SLESQ), a recently developed trauma history screening measure, and discusses the complexities involved in assessing trauma exposure. There are relatively few general measures of exposure to a variety of types of traumatic events, and most of those that exist have not been subjected to rigorous psychometric evaluation. The SLESQ showed good test-retest reliability, with a median kappa of .73, adequate convergent validity (with a lengthier interview) with a median kappa of .64, and good discrimination between Criterion A and non-Criterion A events. The discussion addresses some of the challenges of assessing traumatic event exposure along the dimensions of defining traumatic events, assessment methodologies, reporting consistency, and incident validation.

Design and preliminary analysis of a vaginal inserter for speculum-free cervical cancer screening.

Directory of Open Access Journals (Sweden)

Mercy Nyamewaa Asiedu

Full Text Available Cervical cancer screening usually requires use of a speculum to provide a clear view of the cervix. The speculum is one potential barrier to screening due to fear of pain, discomfort and embarrassment. The aim of this paper is to present and demonstrate the feasibility of a tampon-sized inserter and the POCkeT Colposcope, a miniature pen sized-colposcope, for comfortable, speculum-free and potentially self-colposcopy.We explored different designs using 3D computer-aided design (CAD software and performed mechanical testing simulations on each. Designs were rapid prototyped and tested using a custom vaginal phantom across a range of vaginal pressures and uterine tilts to select an optimal design. Two final designs were tested with fifteen volunteers to assess cervix visualization, comfort and usability compared to the speculum and the optimal design, the curved-tip inserter, was selected for testing in volunteers.We present a vaginal inserter as an alternative to the standard speculum for use with the POCkeT Colposcope. The device has a slim tubular body with a funnel-like curved tip measuring approximately 2.5 cm in diameter. The inserter has a channel through which a 2 megapixel (MP mini camera with LED illumination fits to enable image capture. Mechanical finite element testing simulations with an applied pressure of 15 cm H2O indicated a high factor of safety (90.9 for the inserter. Testing of the device with a custom vaginal phantom, across a range of supine vaginal pressures and uterine tilts (retroverted, anteverted and sideverted, demonstrated image capture with a visual area comparable to the speculum for a normal/axial positioned uteri and significantly better than the speculum for anteverted and sideverted uteri (p<0.00001. Volunteer studies with self-insertion and physician-assisted cervix image capture showed adequate cervix visualization for 83% of patients. In addition, questionnaire responses from volunteers indicated a 92

A multiple objective magnet sorting algorithm for the ALS insertion devices

International Nuclear Information System (INIS)

Humphries, D.; Goetz, F.; Kownacki, P.; Marks, S.; Schlueter, R.

1994-07-01

Insertion devices for the Advanced Light Source (ALS) incorporate large numbers of permanent magnets which have a variety of magnetization orientation errors. These orientation errors can produce field errors which affect both the spectral brightness of the insertion devices and the storage ring electron beam dynamics. A perturbation study was carried out to quantify the effects of orientation errors acting in a hybrid magnetic structure. The results of this study were used to develop a multiple stage sorting algorithm which minimizes undesirable integrated field errors and essentially eliminates pole excitation errors. When applied to a measured magnet population for an existing insertion device, an order of magnitude reduction in integrated field errors was achieved while maintaining near zero pole excitation errors

Human Kinematics of Cochlear Implant Surgery: An Investigation of Insertion Micro-Motions and Speed Limitations.

Science.gov (United States)

Kesler, Kyle; Dillon, Neal P; Fichera, Loris; Labadie, Robert F

2017-09-01

Objectives Document human motions associated with cochlear implant electrode insertion at different speeds and determine the lower limit of continuous insertion speed by a human. Study Design Observational. Setting Academic medical center. Subjects and Methods Cochlear implant forceps were coupled to a frame containing reflective fiducials, which enabled optical tracking of the forceps' tip position in real time. Otolaryngologists (n = 14) performed mock electrode insertions at different speeds based on recommendations from the literature: "fast" (96 mm/min), "stable" (as slow as possible without stopping), and "slow" (15 mm/min). For each insertion, the following metrics were calculated from the tracked position data: percentage of time at prescribed speed, percentage of time the surgeon stopped moving forward, and number of direction reversals (ie, going from forward to backward motion). Results Fast insertion trials resulted in better adherence to the prescribed speed (45.4% of the overall time), no motion interruptions, and no reversals, as compared with slow insertions (18.6% of time at prescribed speed, 15.7% stopped time, and an average of 18.6 reversals per trial). These differences were statistically significant for all metrics ( P implant electrode at 15 mm/min is not feasible for human operators. The lower limit of continuous forward insertion is 52 mm/min on average. Guidelines on manual insertion kinematics should consider this practical limit of human motion.

The SUN protein Mps3 is required for spindle pole body insertion into the nuclear membrane and nuclear envelope homeostasis.

Directory of Open Access Journals (Sweden)

Jennifer M Friederichs

2011-11-01

Full Text Available The budding yeast spindle pole body (SPB is anchored in the nuclear envelope so that it can simultaneously nucleate both nuclear and cytoplasmic microtubules. During SPB duplication, the newly formed SPB is inserted into the nuclear membrane. The mechanism of SPB insertion is poorly understood but likely involves the action of integral membrane proteins to mediate changes in the nuclear envelope itself, such as fusion of the inner and outer nuclear membranes. Analysis of the functional domains of the budding yeast SUN protein and SPB component Mps3 revealed that most regions are not essential for growth or SPB duplication under wild-type conditions. However, a novel dominant allele in the P-loop region, MPS3-G186K, displays defects in multiple steps in SPB duplication, including SPB insertion, indicating a previously unknown role for Mps3 in this step of SPB assembly. Characterization of the MPS3-G186K mutant by electron microscopy revealed severe over-proliferation of the inner nuclear membrane, which could be rescued by altering the characteristics of the nuclear envelope using both chemical and genetic methods. Lipid profiling revealed that cells lacking MPS3 contain abnormal amounts of certain types of polar and neutral lipids, and deletion or mutation of MPS3 can suppress growth defects associated with inhibition of sterol biosynthesis, suggesting that Mps3 directly affects lipid homeostasis. Therefore, we propose that Mps3 facilitates insertion of SPBs in the nuclear membrane by modulating nuclear envelope composition.

The characteristics of laser welded magnesium alloy using silver nanoparticles as insert material

International Nuclear Information System (INIS)

Ishak, M.; Maekawa, K.; Yamasaki, K.

2012-01-01

Highlights: ► Ag nanoparticles are used as insert material for welding Mg alloy with laser. ► We examine the microstructure and mechanical properties of welded Mg alloys. ► Nananoparticle promote grain refinement to the weld structure. ► Finer nanoparticle produces high weld efficiency and mechanical properties. - Abstract: This paper describes the characteristics of the laser welding of thin-sheet magnesium alloys using silver (Ag) nanoparticles as an insert material. The experiment was conducted using nanoparticles with 5 nm and 100 nm diameters that were welded with a Nd:YAG laser. The microstructure and mechanical properties of the specimens welded using inserts with different sizes of nanoparticles and without an insert material, were examined. Electron probe micro-analyzer (EPMA) analysis was conducted to confirm the existence of Ag in the welded area. The introduction of the Ag nanoparticle insert promoted large area of fine grain and broadened the acceptable range of scanning speed parameters compared to welds without an insert. Welds with 5 nm nanoparticles yielded the highest fracture load of up to 818 N while the lowest fracture load was found for weld specimens with 100 nm nanoparticles. This lower fracture load was due to larger voids and a smaller throat length, which contributed to a lower fracture load when using larger nanoparticles.

Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

Science.gov (United States)

Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

2013-08-01

An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

A Wrapping Method for Inserting Titanium Micro-Mesh Implants in the Reconstruction of Blowout Fractures

Directory of Open Access Journals (Sweden)

Tae Joon Choi

2016-01-01

Full Text Available Titanium micro-mesh implants are widely used in orbital wall reconstructions because they have several advantageous characteristics. However, the rough and irregular marginal spurs of the cut edges of the titanium mesh sheet impede the efficacious and minimally traumatic insertion of the implant, because these spurs may catch or hook the orbital soft tissue, skin, or conjunctiva during the insertion procedure. In order to prevent this problem, we developed an easy method of inserting a titanium micro-mesh, in which it is wrapped with the aseptic transparent plastic film that is used to pack surgical instruments or is attached to one side of the inner suture package. Fifty-four patients underwent orbital wall reconstruction using a transconjunctival or transcutaneous approach. The wrapped implant was easily inserted without catching or injuring the orbital soft tissue, skin, or conjunctiva. In most cases, the implant was inserted in one attempt. Postoperative computed tomographic scans showed excellent placement of the titanium micro-mesh and adequate anatomic reconstruction of the orbital walls. This wrapping insertion method may be useful for making the insertion of titanium micro-mesh implants in the reconstruction of orbital wall fractures easier and less traumatic.

Root cause of incomplete control rod insertions at Westinghouse reactors

International Nuclear Information System (INIS)

Ray, S.

1997-01-01

Within the past year, incomplete RCCA insertions have been observed on high burnup fuel assemblies at two Westinghouse PWRs. Initial tests at the Wolf Creek site indicated that the direct cause of the incomplete insertions observed at Wolf Creek was excessive fuel assembly thimble tube distortion. Westinghouse committed to the NRC to perform a root cause analysis by the end of August, 1996. The root cause analysis process used by Westinghouse included testing at ten sites to obtain drag, growth and other characteristics of high burnup fuel assemblies. It also included testing at the Westinghouse hot cell of two of the Wolf Creek incomplete insertion assemblies. A mechanical model was developed to calculate the response of fuel assemblies when subjected to compressive loads. Detailed manufacturing reviews were conducted to determine if this was a manufacturing related issue. In addition, a review of available worldwide experience was performed. Based on the above, it was concluded that the thimble tube distortion observed on the Wolf Creek incomplete insertion assemblies was caused by unusual fuel assembly growth over and above what would typically be expected as a result of irradiation exposure. It was determined that the unusual growth component is a combination of growth due to oxide accumulation and accelerated growth, and would only be expected in high temperature plants on fuel assemblies that see long residence times and high power duties

Surprisingly facile CO2 insertion into cobalt alkoxide bonds: A theoretical investigation

Directory of Open Access Journals (Sweden)

Willem K. Offermans

2015-07-01

Full Text Available Exploiting carbon dioxide as co-monomer with epoxides in the production of polycarbonates is economically highly attractive. More effective catalysts for this reaction are intensively being sought. To promote better understanding of the catalytic pathways, this study uses density functional theory calculations to elucidate the reaction step of CO2 insertion into cobalt(III–alkoxide bonds, which is also the central step of metal catalysed carboxylation reactions. It was found that CO2 insertion into the cobalt(III–alkoxide bond of [(2-hydroxyethoxyCoIII(salen(L] complexes (salen = N,N”-bis(salicyliden-1,6-diaminophenyl is exothermic, whereby the exothermicity depends on the trans-ligand L. The more electron-donating this ligand is, the more exothermic the insertion step is. Interestingly, we found that the activation barrier decreases with increasing exothermicity of the CO2 insertion. Hereby, a linear Brønsted–Evans–Polanyi relationship was found between the activation energy and the reaction energy.

Lysenin Toxin Membrane Insertion Is pH-Dependent but Independent of Neighboring Lysenins.

Science.gov (United States)

Munguira, Ignacio L B; Takahashi, Hirohide; Casuso, Ignacio; Scheuring, Simon

2017-11-07

Pore-forming toxins form a family of proteins that act as virulence factors of pathogenic bacteria, but similar proteins are found in all kingdoms of life, including the vertebrate immune system. They are secreted as soluble monomers that oligomerize on target membranes in the so-called prepore state; after activation, they insert into the membrane and adopt the pore state. Lysenin is a pore-forming toxin from the earthworm Eisenida foetida, of which both the soluble and membrane-inserted structures are solved. However, the activation and membrane-insertion mechanisms have remained elusive. Here, we used high-speed atomic force microscopy to directly visualize the membrane-insertion mechanism. Changing the environmental pH from pH 7.5 to below pH 6.0 favored membrane insertion. We detected a short α-helix in the soluble structure that comprised three glutamic acids (Glu92, Glu94, and Glu97) that we hypothesized may represent a pH-sensor (as in similar toxins, e.g., Listeriolysin). Mutant lysenin still can form pores, but mutating these glutamic acids to glutamines rendered the toxin pH-insensitive. On the other hand, toxins in the pore state did not favor insertion of neighboring prepores; indeed, pore insertion breaks the hexagonal ordered domains of prepores and separates from neighboring molecules in the membrane. pH-dependent activation of toxins may represent a common feature of pore-forming toxins. High-speed atomic force microscopy with single-molecule resolution at high temporal resolution and the possibility of exchanging buffers during the experiments presents itself as a unique tool for the study of toxin-state conversion. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The insertion/deletion polymorphism of angiotensin-converting ...

African Journals Online (AJOL)

The association between type 2 diabetes mellitus (T2DM) and essential hypertension (EH) is not well understood. Both conditions result from an interaction of multiple genetic (ethnic) and environmental (geographical) factors. One possible genetic determinant is the angiotensin-converting enzyme (ACE) insertion/deletion ...

Development of acceptance criteria and damage tolerance analyzes of the ductile iron insert

International Nuclear Information System (INIS)

Dillstroem, Peter; Alverlind, Lars; Andersson, Magnus

2010-01-01

SKB intends to qualify a test system for detection and sizing of defects deemed to be relevant to the ductile iron insert. In support of this qualification, a damage tolerance analysis indicating the current qualification targets, given assumed damage and failure modes. This report describes the damage tolerance analyzes of different types of defects that are considered relevant of the ductile iron insert. The results are reported separately for each test area (zone) and type of insert (BWRs and PWRs)

SEQUENCING OF FLAX LIS-1 INSERTION SITE IN THE ALBIDUM GENOTYPE

Directory of Open Access Journals (Sweden)

Jana Žiarovská

2012-12-01

Full Text Available The paper presents a methodology of identifying the insertion site of LIS-1-1 (Linum Insertion Sequence 1 element in flax Albidum variety when growing under the in vitro combined with environmental stress conditions. Abiotic stress was induced by a reduced nutrient content in a growth medium. The LIS-1 insertion site amplification was reaLIS-1ed using the forward LIS-L: 5'-GGG CAG TTT AAC TGT AAC GAA - 3 'and revers LIS-R: 5'-GCT TGG ATT TAG ACT TGG CAA C - 3' primers by PCR. PCR product was sequenced by direct sequencing method to proove the nucleotide sequence for matching with database LIS-1 sequence. A comparison has been matched with the sequence of the amplified segment in the database for all nucleotides except the 11-position in the 5'-3 ' direction, where instead of the three adenine pair is a couple in the Albidum variety. Changes caused by mobile elements or insertion sequences result in common flax in variability that can be used for the purposes of development of effective marker identification or environment based markers development.

Safeguards Summary Event List (SSEL), January 1, 1990--December 31, 1991

International Nuclear Information System (INIS)

Yardumian, J.; Fadden, M.

1992-07-01

The Safeguards Summary Event List (SSEL), Vol. 2, provides brief summaries of several hundred safeguards-related events involving nuclear material or facilities regulated by the US Nuclear Regulatory Commission (NRC) which occurred and were reported from January 1, 1990 through December 31, 1991. Because of public interest, the Miscellaneous category includes a few events which involve either source material, byproduct material, or natural uranium which are exempt from safeguards requirements. Events are described under the categories of bomb-related, intrusion, missing and/or allegedly stolen, transportation, tampering/vandalism, arson, firearms, radiological sabotage, nonradiological sabotage, and miscellaneous. The information contained in the event descriptions is derived primarily from official NRC reporting channels