WorldWideScience

Sample records for inorganic zinc-rich primers

  1. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  2. Electrochemical impedance spectroscopy and zero resistance ammeters (ZRA) as tools for studying the behaviour of zinc-rich inorganic coatings

    International Nuclear Information System (INIS)

    Novoa, X.R.; Izquierdo, M.; Merino, P.; Espada, L.

    1989-01-01

    Impedance spectra obtained from zinc-rich inorganic coatings after one year of atmospheric exposure, have been interpreted on the basis of the study of the galvanic couple Zn/Fe, using a potentiostat combined with two ZRA. The area ratio of Zn/Fe is one of the factors conditioning the cathodic protection of iron. When this ratio is locally 1:1 or lower, corrosion spots are detected on iron and the overall impedance spectra shows a 'flattened' shape at low frequencies. The type of atmosphere determines the durability and evolution of the coating's protection mechanism. (author) 9 refs., 13 figs

  3. Improvement of Protective Properties of Top Coatings Applied on Zinc-Rich Primer by 3-Aminopropyl-Triethoxysilan and 2-(Benzothialylthio) Succinic acid

    International Nuclear Information System (INIS)

    Truc, Trinh Anh; Hang, Thi Xuan; Oanh, Vu Ke; Dung, Nguyen Tuan

    2004-01-01

    Corrosion resistance of coating system consisting of zinc-rich primer (ZRP) and topcoat based on polyurethane resin with the presence of 3-aminopropyl-triethoxysilan (APS) and 2-(benzothialylthio) succinic acid (BSA) was studied by electrochemical impedance and wet adhesion. The interface metal/primer/topcoat was analyzed by scanning electronic microscopy. It was found that the presence of APS and BSA improved adhesion and barrier property of the topcoats

  4. Promoting Barrier Performance and Cathodic Protection of Zinc-Rich Epoxy Primer via Single-Layer Graphene

    Directory of Open Access Journals (Sweden)

    Jingrong Liu

    2018-05-01

    Full Text Available The effect of single-layer graphene sheets (Gr on the corrosion protection of zinc-rich epoxy primers (ZRPs was investigated. Scanning electron microscopy (SEM with an energy dispersive spectrometer (EDS were used to characterize morphology and composition of the coatings after immersion for 25 days. The cross-sectional SEM images and X-ray photoelectron spectroscopy (XPS confirmed that the addition of single-layer graphene facilitated assembling of zinc oxides on the interface between the coating and the steel. The open circuit potential (OCP, electrochemical impedance spectroscopy (EIS measurements revealed that both the cathodic protection and barrier performance of the ZRP were enhanced after addition of 0.6 wt. % Gr (Gr0.6-ZRP. In addition, the cathodic protection property of the Gr0.6-ZRP was characterized quantitatively by localized electrochemical impedance spectroscopy (LEIS in the presence of an artificial scratch on the coating. The results demonstrate that moderate amounts of single-layer graphene can significantly improve corrosion resistance of ZRP, due to the barrier protection and cathodic protection effects.

  5. Influence of Silane modified nano silica on the corrosion protection of zinc rich coating

    International Nuclear Information System (INIS)

    Nguyen Thuy Duong; To Thi Xuan Hang; Trinh Anh Truc; Pham Gia Vu; Bui Van Truoc; Thai Hoang

    2015-01-01

    Zinc rich coatings are the best effective primers for corrosion protection of carbon steel in aggressive conditions. For traditional zinc rich primer the zinc content is very high, more than 90 wt.%. The coating adhesion is decreased with the increase of zinc content, so that it is necessary to decrease the zinc content by using additives. In this study the nano silica modified by N-(2-Aminoethyl)-3-aminopropyltrimethoxysilane was prepared and incorporated in zinc rich epoxy coatings containing 85 wt.% zinc powder. The corrosion protection performance of coatings was evaluated by electrochemical impedance spectroscopy. The results obtained show that the presence of nano silica improved corrosion protection of zinc rich epoxy coating and the best protection was obtained with 3 wt.% nano silica. (author)

  6. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  7. Influence of different aggressive media on the protective behaviour of zinc rich paints

    International Nuclear Information System (INIS)

    Abreu, C. M.; Perez, C.; Sanchez, A.; Izquierdo, M.; Novoa, X. R.

    1999-01-01

    The aim of the present work is to determine the influence that different atmospheric agents have in steel protection by zinc rich paints based on inorganic silicate binder. The presence of pollutants in the atmosphere has been simulated by periodical deposition of sulphate and/or chloride solutions on the surface of the samples. With the aim of determining the validity of immersion tests, usually used in these types studies, the samples were kept in a controlled atmosphere at 20 degree centigrade and 60% RH. These exposition conditions could represent a relative dry atmosphere allowing the zinc corrosion. Electrochemical impedance spectroscopy was employed to follow the time evolution of the studied paints. The corresponding impedance spectra were modelled using an electrical equivalent circuit approach. This methodology allows establishing that pollutants as well as weathering conditions define the protecting mechanism of these zinc rich paints. The results show a fast evolution towards a barrier-type protecting mechanism

  8. Electrochemical and anticorrosion performances of zinc-rich and polyaniline powder coatings

    International Nuclear Information System (INIS)

    Meroufel, A.; Deslouis, C.; Touzain, S.

    2008-01-01

    In this work, hydrochloride polyaniline (PANI-Cl) powder was incorporated as a conductive pigment into powder zinc-rich primer (ZRP) formulations in order to enhance the electronic conduction paths between zinc particles inside the coating and the steel substrate (i.e. percolation). Coatings were applied onto steel substrates and immersed in a 3% NaCl solution at ambient temperature. The protective properties and electrochemical behaviour of coatings were investigated by monitoring the free corrosion potential versus time and by using EIS. It was found that corrosion potential remains cathodic and constant for a long time up to 100 days of immersion. From EIS results, it was shown that the coatings exhibit larger impedance values than those observed with liquid or other zinc-rich powder formulations containing carbon black. From Raman spectroscopy results, it may be proposed that zinc particles in contact with PANI-Cl pigments were passivated. Other zinc particles remain still active which ensures the cathodic protection of the substrate. Moreover, coatings exhibit good barrier properties

  9. Review of Specifications for Zinc-Rich Paints,

    Science.gov (United States)

    1979-09-01

    inspected in 1976, the repair inorganic zinc was in very poor condition due to extensive " chicken pox " rusting. The original red lead alkyd and basic...Nebraska H-186 New Hampshire H-188 New Jersey H-189 /y’/9 7’ 𔃼 New Mexico H(-216.0 North Carolina H-217 North Dakota l1- 246 Ohio H-247 Oklahoma H-254...8217l.% 2. Olharfing I r A1 1 1e a £I )II d To be separately packaged in multiples of 0 54 pound of pox der per M . Cnpost vehicle. One 2.70 pound

  10. An investigation of the electrochemical action of the epoxy zinc-rich coatings containing surface modified aluminum nanoparticle

    Energy Technology Data Exchange (ETDEWEB)

    Jalili, M. [Nanomaterials and Nanocoatings Department, Institute for Color Science and Technology (ICST), PO 16765-654, Tehran (Iran, Islamic Republic of); Surface Coatings and Corrosion Department, Institute for Color Science and Technology (ICST), PO 16765-654, Tehran (Iran, Islamic Republic of); Rostami, M. [Nanomaterials and Nanocoatings Department, Institute for Color Science and Technology (ICST), PO 16765-654, Tehran (Iran, Islamic Republic of); Ramezanzadeh, B., E-mail: ramezanzadeh-bh@icrc.ac.ir [Surface Coatings and Corrosion Department, Institute for Color Science and Technology (ICST), PO 16765-654, Tehran (Iran, Islamic Republic of)

    2015-02-15

    Highlights: • Aluminum nanoparticle was modified with amino trimethylene phosphonic acid. • 2 wt% of zinc dust in zinc-rich paint was substituted by aluminum nanoparticles. • Surface modified aluminum nanoparticle improved the cathodic period of protection. • Aluminum nanoparticles enhanced the corrosion protection of the zinc-rich coating. - Abstract: Aluminum nanoparticle was modified with amino trimethylene phosphonic acid (ATMP). The surface characterization of the nanoparticles was done by X-ray photo electron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR) and thermal gravimetric analysis. The influence of the replacement of 2 wt% of zinc dust in the standard zinc-rich epoxy coating by nanoparticles on the electrochemical action of the coating was studied by electrochemical impedance spectroscopy (EIS) and salt spray tests. The morphology and phase composition of the zinc rich paints were evaluated by X-ray diffraction (XRD) and filed-emission scanning electron microscopy (FE-SEM). Results showed that the ATMP molecules successfully adsorbed on the surface of Al nanoparticles. Results obtained from salt spray and electrochemical measurements revealed that the addition of surface modified nanoparticles to the zinc rich coating enhanced its galvanic action and corrosion protection properties.

  11. An investigation of the electrochemical action of the epoxy zinc-rich coatings containing surface modified aluminum nanoparticle

    International Nuclear Information System (INIS)

    Jalili, M.; Rostami, M.; Ramezanzadeh, B.

    2015-01-01

    Highlights: • Aluminum nanoparticle was modified with amino trimethylene phosphonic acid. • 2 wt% of zinc dust in zinc-rich paint was substituted by aluminum nanoparticles. • Surface modified aluminum nanoparticle improved the cathodic period of protection. • Aluminum nanoparticles enhanced the corrosion protection of the zinc-rich coating. - Abstract: Aluminum nanoparticle was modified with amino trimethylene phosphonic acid (ATMP). The surface characterization of the nanoparticles was done by X-ray photo electron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR) and thermal gravimetric analysis. The influence of the replacement of 2 wt% of zinc dust in the standard zinc-rich epoxy coating by nanoparticles on the electrochemical action of the coating was studied by electrochemical impedance spectroscopy (EIS) and salt spray tests. The morphology and phase composition of the zinc rich paints were evaluated by X-ray diffraction (XRD) and filed-emission scanning electron microscopy (FE-SEM). Results showed that the ATMP molecules successfully adsorbed on the surface of Al nanoparticles. Results obtained from salt spray and electrochemical measurements revealed that the addition of surface modified nanoparticles to the zinc rich coating enhanced its galvanic action and corrosion protection properties

  12. An investigation of the electrochemical action of the epoxy zinc-rich coatings containing surface modified aluminum nanoparticle

    Science.gov (United States)

    Jalili, M.; Rostami, M.; Ramezanzadeh, B.

    2015-02-01

    Aluminum nanoparticle was modified with amino trimethylene phosphonic acid (ATMP). The surface characterization of the nanoparticles was done by X-ray photo electron spectroscopy (XPS), Fourier transform infrared spectroscopy (FTIR) and thermal gravimetric analysis. The influence of the replacement of 2 wt% of zinc dust in the standard zinc-rich epoxy coating by nanoparticles on the electrochemical action of the coating was studied by electrochemical impedance spectroscopy (EIS) and salt spray tests. The morphology and phase composition of the zinc rich paints were evaluated by X-ray diffraction (XRD) and filed-emission scanning electron microscopy (FE-SEM). Results showed that the ATMP molecules successfully adsorbed on the surface of Al nanoparticles. Results obtained from salt spray and electrochemical measurements revealed that the addition of surface modified nanoparticles to the zinc rich coating enhanced its galvanic action and corrosion protection properties.

  13. Radiological consequences of zinc-rich filter cake at Hoogovens Steel industry in IJmuiden, Netherlands (a modelled study)

    International Nuclear Information System (INIS)

    Laheij, G.M.H.; Eggink, G.J.

    1996-08-01

    In accordance with the revised Euratom 'basic safety standards', the Member States have to fill in the details of their own radiation protection policy on radionuclides from natural sources. In this framework the radiological consequences of zinc-rich filter cake at a storage facility of the steelplant Hoogovens Staal, in IJmuiden, Netherlands, were investigated in a model study. Also investigated were the consequences of possible transport of the filter cake to a storage facility in the country. The radiation dose was calculated for Hoogovens workers and for members of the population. For workers, the relevant exposure pathways are inhalation of resuspended filter cake, direct ingestion of filter cake and external radiation. Relevant exposure pathways for members of the population are inhalation of resuspended filter cake, ingestion of green vegetables on which resuspended filter cake is deposited and external radiation, which for workers at the storage facility the radiation dose is 7 mSv/a. The radiation dose for drivers during transport and for workers at a C3-storage facility depends strongly on whether the material is immobilized or not. The maximum radiation dose for both the transport and storage is expected to be almost equal to the radiation dose for workers at the storage facility at Hoogovens. For members of the population living around the storage facility at Hoogovens, the radiation dose is 3.6 mSv/a. Here too, the radiation dose at the storage facility depends strongly on whether the material is immobilized or not. During transport no radiation dose above the secondary level of 0.4 mSv/a is expected due to the short exposure times. 23 refs

  14. Investigation of the Degradation Mechanisms of Particulate Reinforced Epoxy Coatings and Zinc-Rich Coatings Under an Erosion and Corrosion Environment for Oil and Gas Industry Applications

    Science.gov (United States)

    Wang, Dailin

    During oil and gas production and transportation, the presence of an oil-sand slurry, together with the presence of CO2, H2S, oxygen, and seawater, create an erosive/abrasive and corrosive environment for the interior surfaces of undersea pipelines transporting oil and gas from offshore platforms. Erosion/wear and corrosion are often synergic processes leading to a much greater material loss of pipeline cross-section than that caused by each individual process alone. Both organic coatings and metallic sacrificial coatings have been widely employed to provide protection to the pipeline steels against corrosion through barrier protection and cathodic protection, and these protection mechanisms have been well studied. However, coating performance under the synergic processes of erosion/wear and corrosion have been much less researched and coating degradation mechanisms when erosion/wear and corrosion are both going on has not been well elucidated. In the work presented in this dissertation, steel panels coated with filler reinforced epoxy coatings and carbon nanotubes (CNTs) reinforced zinc-rich coatings have been evaluated under erosion/wear followed by an exposure to a corrosive environment. Electrochemical tests and material characterization methods have been applied to study the degradation mechanisms of the coatings during the tests and coating degradation mechanisms have been proposed. While organic coatings with a lower amount of filler particles provided better protection in a corrosive environment alone and in solid particle impingement erosion testing alone, organic coatings with a higher amount of filler particles showed better performance during wear testing alone. A higher amount of filler particles was also beneficial in providing protection against wear and corrosion environment, and erosion and corrosion environment. Coating thickness played a significant role in the barrier properties of the coatings under both erosion and corrosion tests. When the

  15. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  16. Proton-conducting beta"-alumina via microwave-assisted synthesis and mechanism of enhanced corrosion prevention of a zinc rich coating with electronic control

    Science.gov (United States)

    Kirby, Brent William

    Proton Conducting beta-alumina via Microwave Assisted Synthesis. The microwave assisted synthesis of proton conducting Mg- and Li-stabilized NH4+/H3O+ beta-alumina from a solution based gel precursor is reported. beta-alumina is a ceramic fast ion conductor containing two-dimensional sheets of mobile cations. Na +-beta-alumina is the most stable at the sintering temperatures (1740°C) reached in a modified microwave oven, and can be ion exchanged to the K+ form and then to the NH4+/H 3O+ form. beta-phase impurity is found to be 20% for Mg-stabilized material and 30-40% for Li-stabilized material. The composition of the proton conducting form produced here is deficient in NH4 + as compared to the target composition (NH4)1.00 (H3O)0.67Mg0.67Al10.33O 17. Average grain conductivity for Li-stabilized material at 150°C is 6.6x10-3 +/- 1.6x10-3 S/cm with 0.29 +/- 0.05 eV activation energy, in agreement with single crystal studies in the literature. Grain boundary conductivity is found to be higher in the Li-stabilized material. A hydrogen bond energy hypothesis is presented to explain these differences. Li-stabilized NH4+/H3O + beta-alumina is demonstrated as a fuel cell electrolyte, producing 28 muA/cm2 of electrical current at 0.5 V. Mechanism of Enhanced Corrosion Prevention of a Zinc Rich Coating with Electronic Control. A corrosion inhibition system consisting of high weight-loading zinc rich coating applied to steel panels is examined. An electronic control unit (ECU) consisting of a battery and a large capacitor in series with the panel is shown to improve corrosion protection upon immersion in 3% NaCl solution. Weekly solution changes to avoid zinc saturation in solution system were necessary to see well differentiated results. The corrosion product, hydrozincite [Zn5(CO3) 2(OH)6] is observed to deposit within the pores of the coating and on the surface as a barrier layer. Simonkolleite [Zn5(OH) 8Cl2·H2O] is found to form in place of the original zinc particles

  17. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  18. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  19. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  20. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  1. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  2. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  3. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  4. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  5. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  6. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  7. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  8. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  9. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  10. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  11. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  12. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  13. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  14. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  16. Marine Casualty Report. Tankship Puerto Rican O.N. 535000, Explosion and Fire in the Pacific Ocean, on 31 October 1984 with Loss of Life.

    Science.gov (United States)

    1985-06-15

    Coast Guard Washington, D.C. 20593 14. Sponsoring Agency Code 15. Supplementary Notes 16. Abstract At approximately 0324, October 31, 1984, the tankship...6C void spaces (3CV and 6CV): one coat of inorganic zinc primer and one coat of PPG Aquapon Zinc Rich Epoxy. c. The coatings in wing tanks IP/S, 2P/S

  17. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  18. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  19. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  20. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  1. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  2. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  3. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  4. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  5. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  6. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. Layered inorganic solids

    Czech Academy of Sciences Publication Activity Database

    Čejka, Jiří; Morris, R. E.; Nachtigall, P.; Roth, Wieslaw Jerzy

    2014-01-01

    Roč. 43, č. 27 (2014), s. 10274-10275 ISSN 1477-9226 Institutional support: RVO:61388955 Keywords : layered inorganic solids * physical chemistry * catalysis Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.197, year: 2014

  8. Inorganic Coatings Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The inorganic Coatings Lab provides expertise to Navy and Joint Service platforms acquisition IPTs to aid in materials and processing choices which balance up-front...

  9. Inorganic and geological materials

    International Nuclear Information System (INIS)

    Dinnin, J.I.

    1975-01-01

    Recently described methods for applied inorganic analysis are reviewed from an interdisciplinary standpoint. Abstracts and periodical literature up to Nov. 1974, are included for consideration. The following areas of interest are covered: general reviews of inorganic analytical techniques; analytical techniques, areas of application, and analysis of individual elements. Selected books, monographs, and review articles on the analytical chemistry of the elements are listed. (416 references.) (U.S.)

  10. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  11. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  12. Inorganic UV filters

    Directory of Open Access Journals (Sweden)

    Eloísa Berbel Manaia

    2013-06-01

    Full Text Available Nowadays, concern over skin cancer has been growing more and more, especially in tropical countries where the incidence of UVA/B radiation is higher. The correct use of sunscreen is the most efficient way to prevent the development of this disease. The ingredients of sunscreen can be organic and/or inorganic sun filters. Inorganic filters present some advantages over organic filters, such as photostability, non-irritability and broad spectrum protection. Nevertheless, inorganic filters have a whitening effect in sunscreen formulations owing to the high refractive index, decreasing their esthetic appeal. Many techniques have been developed to overcome this problem and among them, the use of nanotechnology stands out. The estimated amount of nanomaterial in use must increase from 2000 tons in 2004 to a projected 58000 tons in 2020. In this context, this article aims to analyze critically both the different features of the production of inorganic filters (synthesis routes proposed in recent years and the permeability, the safety and other characteristics of the new generation of inorganic filters.

  13. Inorganic liquid scintillator

    International Nuclear Information System (INIS)

    Pavlicek, Z.; Barta, C.; Jursova, L.

    1986-01-01

    An inorganic liquid scintillator is designed which contains 1 to 30 wt.% of an inorganic molecular compound as the basic active component; the compound contains a cation with an atomic number higher than 47 and a halogen anion. The basic inorganic component is dissolved in water or in an organic solvent in form of non-dissociated molecules or self-complexes in which the bond is preserved between the cation and anion components. The light yield from these scintillators ranges between 70 and 150% of the light yield of a standard organic scintillator based on toluene. They are advantageous in that that they allow to increase the water content in the sample to up to 100%. (M.D.)

  14. Thorium inorganic gels

    International Nuclear Information System (INIS)

    Genet, M.; Brandel, V.

    1988-01-01

    The optimum pH and concentration values of thorium salts and oxoacids or oxoacid salts which lead to transparent and stable inorganic gels have been determined. The isotherm drying process of the gel at 50 0 C leads successively to a partly dehydrated gel, then, to the formation of an unusual liquid phase and, finally to a dry amorphous solid phase which is still transparent. This kind of transparent inorganic gels and amorphous phase can be used as matrices for spectroscopic studies [fr

  15. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  16. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  17. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  18. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  19. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  20. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  1. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  2. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  3. Inorganic Constituents in Coal

    Directory of Open Access Journals (Sweden)

    Rađenović A.

    2006-02-01

    Full Text Available Coal contains not only organic matter but also small amounts of inorganic constituents. More thanone hundred different minerals and virtually every element in the periodic table have been foundin coal. Commonly found group minerals in coal are: major (quartz, pyrite, clays and carbonates,minor, and trace minerals. Coal includes a lot of elements of low mass fraction of the orderof w=0.01 or 0.001 %. They are trace elements connected with organic matter or minerals comprisedin coal. The fractions of trace elements usually decrease when the rank of coal increases.Fractions of the inorganic elements are different, depending on the coal bed and basin. A varietyof analytical methods and techniques can be used to determine the mass fractions, mode ofoccurrence, and distribution of organic constituents in coal. There are many different instrumentalmethods for analysis of coal and coal products but atomic absorption spectroscopy – AAS is theone most commonly used. Fraction and mode of occurrence are one of the main factors that haveinfluence on transformation and separation of inorganic constituents during coal conversion.Coal, as an important world energy source and component for non-fuels usage, will be continuouslyand widely used in the future due to its relatively abundant reserves. However, there is aconflict between the requirements for increased use of coal on the one hand and less pollution onthe other. It’s known that the environmental impacts, due to either coal mining or coal usage, canbe: air, water and land pollution. Although, minor components, inorganic constituents can exert asignificant influence on the economic value, utilization, and environmental impact of the coal.

  4. Inorganic Analytical Chemistry

    DEFF Research Database (Denmark)

    Berg, Rolf W.

    The book is a treatise on inorganic analytical reactions in aqueous solution. It covers about half of the elements in the periodic table, i.e. the most important ones : H, Li, B, C, N, O, Na, Mg, Al, P, S, Cl, K, Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Br, Sr, Mo, Ag, Cd, Sn, Sb, I, Ba, W,...

  5. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  6. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  7. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  8. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  9. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  10. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  11. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  12. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  13. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  14. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  15. Inorganic chemistry and medicine

    International Nuclear Information System (INIS)

    Sadler, P.J.; Guo, Z.

    1999-01-01

    Inorganic chemistry is beginning to have a major impact on medicine. Not only does it offer the prospect of the discovery of truly novel drugs and diagnostic agents, but it promises to make a major contribution to our understanding of the mechanism of action of organic drugs too. Most of this article is concerned with recent developments in medicinal coordination chemistry. The role of metal organic compounds of platinum, titanium, ruthenium, gallium, bismuth, gold, gadolinium, technetium, silver, cobalt in the treatment or diagnosis of common diseases are briefly are examined

  16. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  17. Selective inorganic thin films

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.; Weisenbach, L.A.; Anderson, M.T. [Sandia National Laboratories, Albuquerque, NM (United States)] [and others

    1995-05-01

    This project is developing inorganic thin films as membranes for gas separation applications, and as discriminating coatings for liquid-phase chemical sensors. Our goal is to synthesize these coatings with tailored porosity and surface chemistry on porous substrates and on acoustic and optical sensors. Molecular sieve films offer the possibility of performing separations involving hydrogen, air, and natural gas constituents at elevated temperatures with very high separation factors. We are focusing on improving permeability and molecular sieve properties of crystalline zeolitic membranes made by hydrothermally reacting layered multicomponent sol-gel films deposited on mesoporous substrates. We also used acoustic plate mode (APM) oscillator and surface plasmon resonance (SPR) sensor elements as substrates for sol-gel films, and have both used these modified sensors to determine physical properties of the films and have determined the sensitivity and selectivity of these sensors to aqueous chemical species.

  18. Inorganic Halogen Oxidizer Research

    Science.gov (United States)

    1979-02-16

    Inorganic Chemistry. Vol. 14. No. 9. 1975 Karl 0. Christ¢ (21) L. J. Basile . P. LaBonvillk. J. R. Ferraro, and J. M. Williams. J. Claim. (38) K. 0. Chriae. E... basils of a nonplanar structure of symmetry CI, are revised for six fundamental frequencies. Imalredetle either the 1:2 adduct N 2F4.2SbF5 or the 1:3...8217 in mT are 7 2.1 for B, facility. We aba thank L. K. White and R. L. Belford 111.0 for C, 55.0 for N, and 17100 for F, and the atomic aniso- trop’c

  19. Modern Trends in Inorganic Chemistry

    Indian Academy of Sciences (India)

    Administrator

    The series of symposia on 'Modern Trends in Inorganic Chemistry' (MTIC), which began in 1985 at the Indian Association for Cultivation of Science, Calcutta has evolved into a forum for the Inorganic Chemistry fraternity of the country to meet every two years and discuss the current status and future projections of research in.

  20. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  1. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  2. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  3. Noise resistance applied to the study of zinc rich paints

    International Nuclear Information System (INIS)

    Espada Recarey, L.; Sanchez Bermudez, A.; Urrejola Madrinan, S.; Bouzada Alvela, F.

    2001-01-01

    Electrochemical Noise has been one of the more useful analysis methods to the study the corrosion processes due to the fact that it is simple and cheap. The objective of this work is to check the efficiency of this technique when it is applied to the study of Rich Zinc Paints and specifically the Noise Resistance parameter which is very efficiency to study metal-electrolyte systems. Then this technique was applied to Rich Zinc Paints systems of which we have already information by means of electrochemical impedance spectroscopy. The outcomes of this paper show the efficiency of applying Noise Resistance technique to explain the behavior of this kind of systems. (Author) 18 refs

  4. Inorganic Fullerene-Like Nanoparticles and Inorganic Nanotubes

    Directory of Open Access Journals (Sweden)

    Reshef Tenne

    2014-11-01

    Full Text Available Fullerene-like nanoparticles (inorganic fullerenes; IF and nanotubes of inorganic layered compounds (inorganic nanotubes; INT combine low dimensionality and nanosize, enhancing the performance of corresponding bulk counterparts in their already known applications, as well as opening new fields of their own [1]. This issue gathers articles from the diverse area of materials science and is devoted to fullerene-like nanoparticles and nanotubes of layered sulfides and boron nitride and collects the most current results obtained at the interface between fundamental research and engineering.[...

  5. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  6. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  7. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  8. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  9. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  10. Cancer risk from inorganics

    International Nuclear Information System (INIS)

    Swierenga, S.H.; Gilman, J.P.; McLean, J.R.

    1987-01-01

    Inorganic metals and minerals for which there is evidence of carcinogenicity are identified. The risk of cancer from contact with them in the work place, the general environment, and under conditions of clinical (medical) exposure is discussed. The evidence indicates that minerals and metals most often influence cancer development through their action as cocarcinogens. The relationship between the physical form of mineral fibers, smoking and carcinogenic risk is emphasized. Metals are categorized as established (As, Be, Cr, Ni), suspected (Cd, Pb) and possible carcinogens, based on the existing in vitro, animal experimental and human epidemiological data. Cancer risk and possible modes of action of elements in each class are discussed. Views on mechanisms that may be responsible for the carcinogenicity of metals are updated and analysed. Some specific examples of cancer risks associated with the clinical use of potentially carcinogenic metals and from radioactive pharmaceuticals used in therapy and diagnosis are presented. Questions are raised as to the effectiveness of conventional dosimetry in accurately measuring risk from radiopharmaceuticals. 302 references

  11. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  12. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  13. Inorganic chemistry of earliest sediments

    International Nuclear Information System (INIS)

    Ochiai, E.I.

    1983-01-01

    A number of inorganic elements are now known to be essential to organisms. Chemical evolutionary processes involving carbon, hydrogen, nitrogen and oxygen have been studied intensively and extensively, but the other essential elements have been rather neglected in the studies of chemical and biological evolution. This article attempts to assess the significance of inorganic chemistry in chemical and biological evolutionary processes on the earth. Emphasis is placed on the catalytic effects of inorganic elements and compounds, and also on possible studies on the earliest sediments, especially banded iron formation and stratabound copper from the inorganic point of view in the hope of shedding some light on the evolution of the environment and the biological effects on it. (orig./WL)

  14. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  15. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  16. Essentials of inorganic materials synthesis

    CERN Document Server

    Rao, C N R

    2015-01-01

    This compact handbook describes all the important methods of synthesis employed today for synthesizing inorganic materials. Some features: Focuses on modern inorganic materials with applications in nanotechnology, energy materials, and sustainability Synthesis is a crucial component of materials science and technology; this book provides a simple introduction as well as an updated description of methods Written in a very simple style, providing references to the literature to get details of the methods of preparation when required

  17. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  18. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  19. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  20. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  1. Preparation of inorganic hydrophobic catalysts

    International Nuclear Information System (INIS)

    Yang, Yong; Wang, Heyi; Du, Yang

    2009-04-01

    In order to catalyse the oxidation of tritium gas, two inorganic hydrophobic catalysts are prepared. Under room temperature, the catalysed oxidation ratio of 0.3%-1% (V/V) hydrogen gas in air is higher than 95%. Pt-II inorganic hydrophobic catalysts has obviously better catalysing ability than Pt-PTFE and lower ability than Pt-SDB in H 2 -HTO isotopic exchange, because the pressure resistence of Pt-II is much higher than Pt-SDB, it can be used to the CECE cell of heavy water detritium system. (authors)

  2. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  3. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  4. Molecular modeling of inorganic compounds

    National Research Council Canada - National Science Library

    Comba, Peter; Hambley, Trevor W; Martin, Bodo

    2009-01-01

    ... mechanics to inorganic and coordination compounds. Initially, simple metal complexes were modeled, but recently the field has been extended to include organometallic compounds, catalysis and the interaction of metal ions with biological macromolecules. The application of molecular mechanics to coordination compounds is complicated by the numbe...

  5. Inorganic nanomedicine--part 1.

    Science.gov (United States)

    Sekhon, Bhupinder S; Kamboj, Seema R

    2010-08-01

    Inorganic nanomedicine refers to the use of inorganic or hybrid nanomaterials and nanosized objects to achieve innovative medical breakthroughs for drug and gene discovery and delivery, discovery of biomarkers, and molecular diagnostics. Potential uses for fluorescent quantum dots include cell labeling, biosensing, in vivo imaging, bimodal magnetic-luminescent imaging, and diagnostics. Biocompatible quantum dot conjugates have been used successfully for sentinel lymph node mapping, tumor targeting, tumor angiogenesis imaging, and metastatic cell tracking. Magnetic nanowires applications include biosensing and construction of nucleic acids sensors. Magnetic cell therapy is used for the repair of blood vessels. Magnetic nanoparticles (MNPs) are important for magnetic resonance imaging, drug delivery, cell labeling, and tracking. Superparamagnetic iron oxide nanoparticles are used for hyperthermic treatment of tumors. Multifunctional MNPs applications include drug and gene delivery, medical imaging, and targeted drug delivery. MNPs could have a vital role in developing techniques to simultaneously diagnose, monitor, and treat a wide range of common diseases and injuries. From the clinical editor: This review serves as an update about the current state of inorganic nanomedicine. The use of inorganic/hybrid nanomaterials and nanosized objects has already resulted in innovative medical breakthroughs for drug/gene discovery and delivery, discovery of biomarkers and molecular diagnostics, and is likely to remain one of the most prolific fields of nanomedicine. 2010 Elsevier Inc. All rights reserved.

  6. James Moir as Inorganic Chemist

    African Journals Online (AJOL)

    NICO

    KEYWORDS. Inorganic chemistry, gold, atomic theory, history of chemistry. .... Figure 2 (a) shows Moir's model for the C atom, where the black circles represent the ..... Na filled the hole in the F atom, both becoming ions even in the crystal state ...

  7. Determining Inorganic and Organic Carbon.

    Science.gov (United States)

    Koistinen, Jaana; Sjöblom, Mervi; Spilling, Kristian

    2017-11-21

    Carbon is the element which makes up the major fraction of lipids and carbohydrates, which could be used for making biofuel. It is therefore important to provide enough carbon and also follow the flow into particulate organic carbon and potential loss to dissolved organic forms of carbon. Here we present methods for determining dissolved inorganic carbon, dissolved organic carbon, and particulate organic carbon.

  8. Hybrid polymer-inorganic photovoltaic cells

    NARCIS (Netherlands)

    Beek, W.J.E.; Janssen, R.A.J.; Merhari, L.

    2009-01-01

    Composite materials made from organic conjugated polymers and inorganic semiconductors such as metal oxides attract considerable interest for photovoltaic applications. Hybrid polymer-inorganic solar cells offer the opportunity to combine the beneficial properties of the two materials in charge

  9. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  10. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  11. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  12. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  13. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  14. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  15. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  16. Inorganic, coordination and organometallic compounds

    International Nuclear Information System (INIS)

    Jursik, F.

    1978-01-01

    Separation of cations and anions of inorganic, coordination and metalloorganic compounds by the method of liquid column chromatography is considered. Common scheme of multicomponent cation mixture is suggesteed. Separation conditions, adsrbents, eluents, pH value solution concenstration, elution rate are also suggested. Separation of rare earth elements Cs, Be, Cd, Te, Th, U, Mo, Re, V, Ru, Zr, In compounds is considered as an example of liquid column chromatography application. Data on column chromatography application are summarized in a table

  17. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  18. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  19. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  20. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  1. Accelerated bridge paint test program.

    Science.gov (United States)

    2011-07-06

    The accelerated bridge paint (AB-Paint) program evaluated a new Sherwin-Williams two-coat, : fast-curing paint system. The system is comprised of an organic zinc-rich primer (SW Corothane I : Galvapac One-Pack Zinc-Rich Primer B65 G11) and a polyurea...

  2. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  3. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  4. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  5. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  6. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  7. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  8. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  9. Nomenclature on an inorganic compound

    International Nuclear Information System (INIS)

    1998-10-01

    This book contains eleven chapters : which mention nomenclature of an inorganic compound with introduction and general principle on nomenclature of compound. It gives the description of grammar for nomenclature such as brackets, diagonal line, asterisk, and affix, element, atom and groups of atom, chemical formula, naming by stoichiometry, solid, neutral molecule compound, ion, a substituent, radical and name of salt, oxo acid and anion on introduction and definition of oxo acid, coordination compound like symbol of stereochemistry , boron and hydrogen compound and related compound.

  10. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  11. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  12. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  13. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  14. Heat-resistant inorganic binders.

    Directory of Open Access Journals (Sweden)

    KUDRYAVTSEV Pavel Gennadievich,

    2017-04-01

    Full Text Available The authors consider some aspects of production of inorganic heat-resistant composite materials in which new classes of inorganic binders - the basic salts of various metals – are applied. The possibility to use hydroxochlorides and hydroxonitrates of aluminum, zirconium, chromium and a number of other metals as the binder has been shown. The main products of the thermal decomposition of all types of binders discussed in this paper are nano-dispersed highly refractory oxides. Increased pressure in the manufacture of these materials shifts the position of the minimum of the dependence «production strength – production temperature» in the direction of low temperatures. This effect is caused by decreased film thickness of the binder located between filler particles and hence by increased rate of transfer of the matter to the interface and by facilitated sintering process. Materials based on the systems containing chromium and some other elements in transitional oxidation states are colour. For this reason, they have the worst thermal conductivity under the same heat resistance compared to colorless materials.

  15. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  16. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  17. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  18. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  19. Investigations of inorganic and hybrid inorganic-organic nanostructures

    Science.gov (United States)

    Kam, Kinson Chihang

    This thesis focuses on the exploratory synthesis and characterization of inorganic and hybrid inorganic-organic nanomaterials. In particular, nanostructures of semiconducting nitrides and oxides, and hybrid systems of nanowire-polymer composites and framework materials, are investigated. These materials are characterized by a variety of techniques for structure, composition, morphology, surface area, optical properties, and electrical properties. In the study of inorganic nanomaterials, gallium nitride (GaN), indium oxide (In2O3), and vanadium dioxide (VO2) nanostructures were synthesized using different strategies and their physical properties were examined. GaN nanostructures were obtained from various synthetic routes. Solid-state ammonolysis of metastable gamma-Ga2O 3 nanoparticles was found to be particularly successful; they achieved high surface areas and photoluminescent study showed a blue shift in emission as a result of surface and size defects. Similarly, In2O3 nanostructures were obtained by carbon-assisted solid-state syntheses. The sub-oxidic species, which are generated via a self-catalyzed vapor-liquid-solid mechanism, resulted in 1D nanostructures including nanowires, nanotrees, and nanobouquets upon oxidation. On the other hand, hydrothermal methods were used to obtain VO2 nanorods. After post-thermal treatment, infrared spectroscopy demonstrated that these nanorods exhibit a thermochromic transition with temperature that is higher by ˜10°C compared to the parent material. The thermochromic behavior indicated a semiconductor-to-metal transition associated with a structural transformation from monoclinic to rutile. The hybrid systems, on the other hand, enabled their properties to be tunable. In nanowire-polymer composites, zinc oxide (ZnO) and silver (Ag) nanowires were synthesized and incorporated into polyaniline (PANI) and polypyrrole (PPy) via in-situ and ex-situ polymerization method. The electrical properties of these composites are

  20. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  1. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  2. Medicinal Uses of Inorganic Compounds - 2

    Indian Academy of Sciences (India)

    In the first part of this article, we described medicinal uses of inorganic compounds relating to cancer care, infection and diabetic control, neurological, cardiovascular and in- flammatory diseases. This article contains further infor- mation on the medicinal uses of inorganic compounds as therapeutic and diagnostic in ...

  3. Recent Advances in Bio-inorganic Chemistry

    Indian Academy of Sciences (India)

    Unknown

    Bio-inorganic chemistry has developed rapidly in recent years. A number of laboratories in India have made significant contributions to this area. The motivation in bringing out this special issue on Bio-inorganic. Chemistry is to highlight the recent work emerging from India in this important and fascinating interdisci-.

  4. Attachment of inorganic moieties onto aliphatic polyurethanes

    Directory of Open Access Journals (Sweden)

    Eliane Ayres

    2007-06-01

    Full Text Available Polyurethanes have been used in a series of applications due basically to their versatility in terms of controlling the behavior by altering basically the type of reagents used. However, for more specific and advanced applications, such as in membranes, biomaterials and sensors, well-organized and defined chemical functionalities are necessary. In this work, inorganic functionalities were incorporated into aliphatic polyurethanes (PU having different macromolecular architectures. Polyurethanes were synthesized using a polyether diol and dicyclohexylmethane 4,4' diisocyanate (H12-MDI. Polyurethanes having carboxylic acid groups were also produced by introducing 2,2- bis (hydroxymethyl propionic acid in the polymerization process. Inorganic functionalities were inserted into polyurethanes by reacting isocyanate end capped chains with aminopropyltriethoxysilane followed by tetraethoxysilane. PU having carboxylic acid groups yielded transparent samples after the incorporation of inorganic entities, as an evidence of smaller and better dispersed inorganic entities in the polymer network. FTIR and swelling measurements showed that polyurethanes having carboxylic acid groups had inorganic domains less packed, condensed and cross-linked when compared to polyurethanes with no carboxylic acid groups. Results also suggested that the progressive incorporation of inorganic moieties in both types of polyurethanes occurred in regions previously activated with inorganic functionalities, instead of by the creation of new domains. The temperatures of thermal decomposition and glass transition were also shifted to higher temperatures when inorganic functionalities were incorporated into polyurethanes.

  5. Uptake of inorganic contaminants by pteridophytes

    International Nuclear Information System (INIS)

    Zheng Jiemin; Chen Ziyuan; Tang Shirong; Guangzhou Univ., Guangzhou; Ding Bingyang

    2005-01-01

    The review covers results at home and abroad in terms of uptake of inorganic contaminants by pteridophytes, and suggests pteridophytes' significance in phytoremediation; the mechanisms related to uptake of inorganic contaminants by pteridophytes and some methods and means used for research on the mechanism are also introduced; the authors' viewpoints on future development trends are presented in this paper. (authors)

  6. Ultrasound exfoliation of inorganic analogues of graphene

    Czech Academy of Sciences Publication Activity Database

    Štengl, Václav; Henych, Jiří; Slušná, Michaela; Ecorchard, Petra

    2014-01-01

    Roč. 9, APR (2014), s. 1-14 ISSN 1556-276X R&D Projects: GA ČR(CZ) GA14-05146S Institutional support: RVO:61388980 Keywords : Ultrasound * Exfoliation * Graphene inorganic analogues Subject RIV: CA - Inorganic Chemistry Impact factor: 2.779, year: 2014

  7. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  8. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  9. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  10. Development of cement material using inorganic additives

    International Nuclear Information System (INIS)

    Toyohara, Masumitsu; Satou, Tatsuaki; Wada, Mikio; Ishii, Tomoharu; Matsuo, Kazuaki.

    1997-01-01

    Inorganic admixtures to enhance the fluidity of cement material was developed. These admixtures turned into easy to immobilize the miscellaneous radioactive waste using cement material. It was found that the ζ potential of cement particles was directly proportional to the content of the inorganic admixtures in cement paste and the particles of cement were dispersed at the high ζ potential. The condensed sodium phosphate, which was the main component of the inorganic admixtures, retarded the dissolution of Ca 2+ ion from the cement, and generated the colloids by incorporating dissolved Ca 2+ ion. The cement material containing the inorganic admixtures was found to have the same mechanical strength and adsorption potential of radionuclides in comparison to normal cement materials. It was confirmed that the cement material containing the inorganic admixture was effectively filled gaps of miscellaneous radioactive waste. (author)

  11. Welcome to Inorganics: A New Open Access, Inclusive Forum for Inorganic Chemistry

    Directory of Open Access Journals (Sweden)

    Duncan H. Gregory

    2013-06-01

    Full Text Available One of the beauties of inorganic chemistry is its sheer diversity. Just as chemistry sits at the centre of the sciences, inorganic chemistry sits at the centre of chemistry itself. Inorganic chemists are fortunate in having the entire periodic table at their disposal, providing a palette for the creation of a multitude of rich and diverse compounds and materials from the simplest salts to the most complex of molecular species. It follows that the language of inorganic chemistry can thus be a demanding one, accommodating sub-disciplines with very different perspectives and frames of reference. One could argue that it is the unequivocal breadth of inorganic chemistry that empowers inorganic chemists to work at the interfaces, not just between the traditional Inorganic-Organic-Physical boundaries of the discipline, but in the regions where chemistry borders the other physical and life sciences, engineering and socio-economics. [...

  12. Mercury in the environment : a primer

    Energy Technology Data Exchange (ETDEWEB)

    Lourie, B; Glenn, W [ed.; Ogilvie, K; Everhardus, E; Friesen, K; Rae, S

    2003-06-01

    This report provides an overview of the occurrence and effects of mercury in the environment and its impacts on human health. Low levels of mercury occur naturally everywhere in the environment in plants, animals, rocks and air. Incidental emissions occur when natural mercury is released to the environment through human activity. In Canada, coal burning and metal processing are the two largest point sources of atmospheric mercury emissions. Energy facilities have the option to invest in expensive control technologies for coal plants, or they can generate electricity from alternative energy sources. Energy conservation, however, offers the greatest overall benefits for the environment and the public. Mercury can also be released when products containing mercury (such as electrical switches, thermostats, dental amalgam, and thermometers) are broken while in use, or when they are crushed in garbage trucks and dumped in landfills. Source separation is the best way to reduce waste-related emissions. Once mercury is released to the natural environment, it can be transported long distances through air or watercourses. It is volatile, therefore evaporates readily to the atmosphere where it may do one of three things: it may fall out near the point where it was emitted; it may be transported long distances to some point downwind; or, it may enter the global atmospheric mercury pool where it will circle the globe for a year or more within the Earth's major weather systems before being deposited. Data from Canada's National Pollutant Release Inventory indicates that mercury releases and transfers total 28,674 kg per year. The most critical component of the mercury cycle is the conversion of inorganic forms of mercury to the organic compound methylmercury which is more toxic to humans. Most concern about mercury focuses on lakes and other aquatic ecosystems. Fish in hydroelectric reservoirs have been found to contain elevated methylmercury levels because natural mercury in the

  13. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  14. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  15. Inorganic biomaterials structure, properties and applications

    CERN Document Server

    Zhang, Xiang C

    2014-01-01

    This book provides a practical guide to the use and applications of inorganic biomaterials. It begins by introducing the concept of inorganic biomaterials, which includes bioceramics and bioglass. This concept is further extended to hybrid biomaterials consisting of inorganic and organic materials to mimic natural biomaterials. The book goes on to provide the reader with information on biocompatibility, bioactivity and bioresorbability. The concept of the latter is important because of the increasing role resorbable biomaterials are playing in implant applications. The book also introduces a n

  16. Inorganic elements in sugar samples

    Energy Technology Data Exchange (ETDEWEB)

    Salles, Paulo M.B. de; Campos, Tarcisio P.R. de, E-mail: pauladesalles@yahoo.com.br, E-mail: tprcampos@pq.cnpq.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Menezes, Maria Angela de B.C., E-mail: menezes@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k{sub 0} method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  17. Inorganic elements in sugar samples

    International Nuclear Information System (INIS)

    Salles, Paulo M.B. de; Campos, Tarcisio P.R. de

    2013-01-01

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k 0 method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  18. The quest for inorganic fullerenes

    Energy Technology Data Exchange (ETDEWEB)

    Pietsch, Susanne; Dollinger, Andreas; Strobel, Christoph H.; Ganteför, Gerd, E-mail: gerd.gantefoer@uni-konstanz.de, E-mail: ydkim91@skku.edu [Department of Physics, University of Konstanz, D-78457 Konstanz (Germany); Park, Eun Ji; Kim, Young Dok, E-mail: gerd.gantefoer@uni-konstanz.de, E-mail: ydkim91@skku.edu [Department of Chemistry, Sungkyunkwan University, 440-746 Suwon (Korea, Republic of); Seo, Hyun Ook [Center for Free-Electron Laser Science/DESY, D-22607 Hamburg (Germany); Idrobo, Juan-Carlos [Center for Nanophase Materials Sciences, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Pennycook, Stephen J. [Department of Materials Science and Engineering, National University of Singapore, Singapore 117575 (Singapore)

    2015-10-07

    Experimental results of the search for inorganic fullerenes are presented. Mo{sub n}S{sub m}{sup −} and W{sub n}S{sub m}{sup −} clusters are generated with a pulsed arc cluster ion source equipped with an annealing stage. This is known to enhance fullerene formation in the case of carbon. Analogous to carbon, the mass spectra of the metal chalcogenide clusters produced in this way exhibit a bimodal structure. The species in the first maximum at low mass are known to be platelets. Here, the structure of the species in the second maximum is studied by anion photoelectron spectroscopy, scanning transmission electron microscopy, and scanning tunneling microcopy. All experimental results indicate a two-dimensional structure of these species and disagree with a three-dimensional fullerene-like geometry. A possible explanation for this preference of two-dimensional structures is the ability of a two-element material to saturate the dangling bonds at the edges of a platelet by excess atoms of one element. A platelet consisting of a single element only cannot do this. Accordingly, graphite and boron might be the only materials forming nano-spheres because they are the only single element materials assuming two-dimensional structures.

  19. Inorganic chemically active adsorbents (ICAAs)

    Energy Technology Data Exchange (ETDEWEB)

    Ally, M.R. [Oak Ridge National Lab., TN (United States); Tavlarides, L.

    1997-10-01

    Oak Ridge National Laboratory (ORNL) researchers are developing a technology that combines metal chelation extraction technology and synthesis chemistry. They begin with a ceramic substrate such as alumina, titanium oxide or silica gel because they provide high surface area, high mechanical strength, and radiolytic stability. One preparation method involves silylation to hydrophobize the surface, followed by chemisorption of a suitable chelation agent using vapor deposition. Another route attaches newly designed chelating agents through covalent bonding by the use of coupling agents. These approaches provide stable and selective, inorganic chemically active adsorbents (ICAAs) tailored for removal of metals. The technology has the following advantages over ion exchange: (1) higher mechanical strength, (2) higher resistance to radiation fields, (3) higher selectivity for the desired metal ion, (4) no cation exchange, (5) reduced or no interference from accompanying anions, (6) faster kinetics, and (7) easy and selective regeneration. Target waste streams include metal-containing groundwater/process wastewater at ORNL`s Y-12 Plant (multiple metals), Savannah River Site (SRS), Rocky Flats (multiple metals), and Hanford; aqueous mixed wastes at Idaho National Engineering Laboratory (INEL); and scrubber water generated at SRS and INEL. Focus Areas that will benefit from this research include Mixed Waste, and Subsurface Contaminants.

  20. Biomedical inorganic polymers bioactivity and applications of natural and synthetic polymeric inorganic molecules

    CERN Document Server

    Müller, Werner E G; Schröder, Heinz C; Schroder, Heinz C

    2014-01-01

    In recent years, inorganic polymers have attracted much attention in nano-biomedicine, in particular in the area of regenerative medicine and drug delivery. This growing interest in inorganic polymers has been further accelerated by the development of new synthetic and analytical methods in the field of nanotechnology and nanochemistry. Examples for biomedical inorganic polymers that had been proven to exhibit biomedical effects and/or have been applied in preclinical or clinical trials are polysilicate / silica glass (such as naturally formed "biosilica" and synthetic "bioglass") and inorganic polyphosphate. Some members of the mentioned biomedical inorganic polymers have already been applied e.g. as "bioglass" for bone repair and bone tissue engineering, or they are used in food processing and in dental care (inorganic polyphosphates). However, there are a number of further biological and medicinal properties of these polymers, which have been elucidated in the last few years but not yet been applied for tr...

  1. Nanoscale Organic−Inorganic Hybrid Lubricants

    KAUST Repository

    Kim, Daniel; Archer, Lynden A.

    2011-01-01

    Silica (SiO2) nanoparticles densely grafted with amphiphilic organic chains are used to create a family of organic-inorganic hybrid lubricants. Short sulfonate-functionalized alkylaryl chains covalently tethered to the particles form a dense corona

  2. Room-temperature ductile inorganic semiconductor

    Science.gov (United States)

    Shi, Xun; Chen, Hongyi; Hao, Feng; Liu, Ruiheng; Wang, Tuo; Qiu, Pengfei; Burkhardt, Ulrich; Grin, Yuri; Chen, Lidong

    2018-05-01

    Ductility is common in metals and metal-based alloys, but is rarely observed in inorganic semiconductors and ceramic insulators. In particular, room-temperature ductile inorganic semiconductors were not known until now. Here, we report an inorganic α-Ag2S semiconductor that exhibits extraordinary metal-like ductility with high plastic deformation strains at room temperature. Analysis of the chemical bonding reveals systems of planes with relatively weak atomic interactions in the crystal structure. In combination with irregularly distributed silver-silver and sulfur-silver bonds due to the silver diffusion, they suppress the cleavage of the material, and thus result in unprecedented ductility. This work opens up the possibility of searching for ductile inorganic semiconductors/ceramics for flexible electronic devices.

  3. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  4. Inorganic nanolayers: structure, preparation, and biomedical applications.

    Science.gov (United States)

    Saifullah, Bullo; Hussein, Mohd Zobir B

    2015-01-01

    Hydrotalcite-like compounds are two-dimensional inorganic nanolayers also known as clay minerals or anionic clays or layered double hydroxides/layered hydroxy salts, and have emerged as a single type of material with numerous biomedical applications, such as drug delivery, gene delivery, cosmetics, and biosensing. Inorganic nanolayers are promising materials due to their fascinating properties, such as ease of preparation, ability to intercalate different type of anions (inorganic, organic, biomolecules, and even genes), high thermal stability, delivery of intercalated anions in a sustained manner, high biocompatibility, and easy biodegradation. Inorganic nanolayers have been the focus for researchers over the last decade, resulting in widening application horizons, especially in the field of biomedical science. These nanolayers have been widely applied in drug and gene delivery. They have also been applied in biosensing technology, and most recently in bioimaging science. The suitability of inorganic nanolayers for application in drug delivery, gene delivery, biosensing technology, and bioimaging science makes them ideal materials to be applied for theranostic purposes. In this paper, we review the structure, methods of preparation, and latest advances made by inorganic nanolayers in such biomedical applications as drug delivery, gene delivery, biosensing, and bioimaging.

  5. Salicylate-spectrophotometric determination of inorganic monochloramine

    International Nuclear Information System (INIS)

    Tao Hui; Chen Zhonglin; Li Xing; Yang Yanling; Li Guibai

    2008-01-01

    On the basis of classical Berthelot reaction, a simple salicylate-spectrophotometric method was developed for quantitative determination of inorganic monochloramine in water samples. With the catalysis of disodium pentacyanonitrosylferrate(III), inorganic monochloramine reacts with salicylate in equimolar to produce indophenol compound which has an intense absorption at 703 nm. Parameters that influence method performance, such as pH, dosage of salicylate and nitroprussiate and reaction time, were modified to enhance the method performance. By using this method, inorganic monochloramine can be distinguished from organic chloramines and other inorganic chlorine species, such as free chlorine, dichloramine, and trichloramine. The molar absorptivities of the final products formed by these compounds are below ±3% of inorganic monochloramine, because of the α-N in them have only one exchangeable hydrogen atom, and cannot react with salicylate to produce the indophenol compound. The upper concentrations of typical ions that do not interfere with the inorganic monochloramine determination are also tested to be much higher than that mostly encountered in actual water treatment. Case study demonstrates that the results obtained from this method are lower than DPD-titrimetric method because the organic chloramines formed by chlorination of organic nitrogenous compounds give no response in the newly established method. And the result measured by salicylate-spectrophotometric method is coincident with theoretical calculation

  6. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  7. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  8. Inorganic nanostructure-organic polymer heterostructures useful for thermoelectric devices

    Energy Technology Data Exchange (ETDEWEB)

    See, Kevin C.; Urban, Jeffrey J.; Segalman, Rachel A.; Coates, Nelson E.; Yee, Shannon K.

    2017-11-28

    The present invention provides for an inorganic nanostructure-organic polymer heterostructure, useful as a thermoelectric composite material, comprising (a) an inorganic nanostructure, and (b) an electrically conductive organic polymer disposed on the inorganic nanostructure. Both the inorganic nanostructure and the electrically conductive organic polymer are solution-processable.

  9. Methods for Introducing Inorganic Polymer Concepts throughout the Undergraduate Curriculum

    Science.gov (United States)

    de Lill, Daniel T.; Carraher, Charles E., Jr.

    2017-01-01

    Inorganic polymers can be introduced in a variety of undergraduate courses to discuss concepts related to polymer chemistry. Inorganic polymers such as silicates and polysiloxanes are simple materials that can be incorporated into an introductory or descriptive inorganic course. Polymers based on inorganic carbon, including diamond and graphite,…

  10. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  11. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  12. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  13. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  14. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  15. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  16. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  17. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  18. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  19. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  20. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  1. Foundation Coursework in Undergraduate Inorganic Chemistry: Results from a National Survey of Inorganic Chemistry Faculty

    Science.gov (United States)

    Raker, Jeffrey R.; Reisner, Barbara A.; Smith, Sheila R.; Stewart, Joanne L.; Crane, Johanna L.; Pesterfield, Les; Sobel, Sabrina G.

    2015-01-01

    A national survey of inorganic chemists explored the self-reported topics covered in foundation-level courses in inorganic chemistry at the postsecondary level; the American Chemical Society's Committee on Professional Training defines a foundation course as one at the conclusion of which, "a student should have mastered the vocabulary,…

  2. Intercalation compounds involving inorganic layered structures

    Directory of Open Access Journals (Sweden)

    CONSTANTINO VERA R. L.

    2000-01-01

    Full Text Available Two-dimensional inorganic networks can shown intracrystalline reactivity, i.e., simple ions, large species as Keggin ions, organic species, coordination compounds or organometallics can be incorporated in the interlayer region. The host-guest interaction usually causes changes in their chemical, catalytic, electronic and optical properties. The isolation of materials with interesting properties and making use of soft chemistry routes have given rise the possibility of industrial and technological applications of these compounds. We have been using several synthetic approaches to intercalate porphyrins and phthalocyanines into inorganic materials: smectite clays, layered double hydroxides and layered niobates. The isolated materials have been characterized by elemental and thermal analysis, X-ray diffraction, surface area measurements, scanning electronic microscopy, electronic and resonance Raman spectroscopies and EPR. The degree of layer stacking and the charge density of the matrices as well their acid-base nature were considered in our studies on the interaction between the macrocycles and inorganic hosts.

  3. Industrial inorganic chemistry. 2. rev. ed.

    International Nuclear Information System (INIS)

    Buechner, W.; Schliebs, R.; Winter, G.; Buechel, K.H.

    1986-01-01

    Inorganic chemistry is a branch of considerable economic and technical importance. Apart from supplying the market with metals, fertilizers, building materials, pigments and glass it is one of the major suppliers of process materials to the organic chemical industry. Many modern products of other industrial sectors (video tapes, optical fibers or silicon chips) could not have been developed and manufactured without the achievements of industrial inorganic chemistry. The publication is the first of its kind to give a compact description of the inorganic chemistry sector. A clearly arranged survey facilitates access to production processes, economic aspects, ecological implications, energy consumption and raw material consumption as well as to many other data and facts. Due to its clear arrangement and the combination of technical and economic facts the book is a valuable source of information. (orig./EF) [de

  4. Inorganic Nanoparticles for Multimodal Molecular Imaging

    Directory of Open Access Journals (Sweden)

    Magdalena Swierczewska

    2011-01-01

    Full Text Available Multimodal molecular imaging can offer a synergistic improvement of diagnostic ability over a single imaging modality. Recent development of hybrid imaging systems has profoundly impacted the pool of available multimodal imaging probes. In particular, much interest has been focused on biocompatible, inorganic nanoparticle-based multimodal probes. Inorganic nanoparticles offer exceptional advantages to the field of multimodal imaging owing to their unique characteristics, such as nanometer dimensions, tunable imaging properties, and multifunctionality. Nanoparticles mainly based on iron oxide, quantum dots, gold, and silica have been applied to various imaging modalities to characterize and image specific biologic processes on a molecular level. A combination of nanoparticles and other materials such as biomolecules, polymers, and radiometals continue to increase functionality for in vivo multimodal imaging and therapeutic agents. In this review, we discuss the unique concepts, characteristics, and applications of the various multimodal imaging probes based on inorganic nanoparticles.

  5. Inorganic matter characterization in vegetable biomass feedstocks

    Energy Technology Data Exchange (ETDEWEB)

    Suarez-Garcia, F.; Martinez-Alonso, A.; Fernandez Llorenta, M.; Tascon, J.M.D. [Instituto Nacional del Carbon, CSIC, Oviedo (Spain)

    2002-06-01

    A combination of techniques was used to characterize the inorganic constituents of four types of vegetable biomass: apple pulp, olive cake, olive tree pruning and thistle. Two methods were used to selectively eliminate organic matter: low-temperature oxidation in an oxygen plasma, and medium-temperature oxidation in air. Inorganic species present in the residues were identified by X-ray diffraction and FT-IR spectroscopy. The combination of these techniques allowed one to detect SiO{sub 2}, CaCO{sub 3} and various other Ca-, Mg-, Na- and K-containing phases as inorganic constituents of the studied biomass residues. It is concluded that the oxygen plasma treatment produces sulphates and nitrates that were not present in the starting material. Medium-temperature oxidation does not produce these artificial species but induces some thermal transformations in the mineral constituents of biomass, so that each technique has its own advantages and disadvantages. 27 refs., 6 figs., 3 tabs.

  6. Engineered inorganic core/shell nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mélinon, Patrice, E-mail: patrice.melinon@univ-lyon1.fr [Institut Lumière matière Université Claude Bernard Lyon 1 et CNRS et OMNT, Domaine Scientifique de la Doua, Bâtiment Léon Brillouin, 43 Boulevard du 11 Novembre 1918, F 69622 Villeurbanne (France); Begin-Colin, Sylvie [IPCMS et OMNT, 23 rue du Loess BP 43, 67034 STRASBOURG Cedex 2 (France); Duvail, Jean Luc [IMN UMR 6502 et OMNT Campus Sciences : 2 rue de la Houssinire, BP32229, 44322 Nantes Cedex3 (France); Gauffre, Fabienne [SPM et OMNT : Institut des sciences chimiques de Rennes - UMR 6226, 263 Avenue du General Leclerc, CS 74205, 35042 RENNES Cedex (France); Boime, Nathalie Herlin [IRAMIS-NIMBE, Laboratoire Francis Perrin (CEA CNRS URA 2453) et OMNT, Bat 522, CEA Saclay, 91191 Gif sur Yvette Cedex (France); Ledoux, Gilles [Institut Lumière Matière Université Claude Bernard Lyon 1 et CNRS et OMNT, Domaine Scientifique de la Doua, Bâtiment Alfred Kastler 43 Boulevard du 11 Novembre 1918 F 69622 Villeurbanne (France); Plain, Jérôme [Universit de technologie de Troyes LNIO-ICD, CNRS et OMNT 12 rue Marie Curie - CS 42060 - 10004 Troyes cedex (France); Reiss, Peter [CEA Grenoble, INAC-SPrAM, UMR 5819 CEA-CNRS-UJF et OMNT, Grenoble cedex 9 (France); Silly, Fabien [CEA, IRAMIS, SPEC, TITANS, CNRS 2464 et OMNT, F-91191 Gif sur Yvette (France); Warot-Fonrose, Bénédicte [CEMES-CNRS, Université de Toulouse et OMNT, 29 rue Jeanne Marvig F 31055 Toulouse (France)

    2014-10-20

    It has been for a long time recognized that nanoparticles are of great scientific interest as they are effectively a bridge between bulk materials and atomic structures. At first, size effects occurring in single elements have been studied. More recently, progress in chemical and physical synthesis routes permitted the preparation of more complex structures. Such structures take advantages of new adjustable parameters including stoichiometry, chemical ordering, shape and segregation opening new fields with tailored materials for biology, mechanics, optics magnetism, chemistry catalysis, solar cells and microelectronics. Among them, core/shell structures are a particular class of nanoparticles made with an inorganic core and one or several inorganic shell layer(s). In earlier work, the shell was merely used as a protective coating for the core. More recently, it has been shown that it is possible to tune the physical properties in a larger range than that of each material taken separately. The goal of the present review is to discuss the basic properties of the different types of core/shell nanoparticles including a large variety of heterostructures. We restrict ourselves on all inorganic (on inorganic/inorganic) core/shell structures. In the light of recent developments, the applications of inorganic core/shell particles are found in many fields including biology, chemistry, physics and engineering. In addition to a representative overview of the properties, general concepts based on solid state physics are considered for material selection and for identifying criteria linking the core/shell structure and its resulting properties. Chemical and physical routes for the synthesis and specific methods for the study of core/shell nanoparticle are briefly discussed.

  7. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  8. Development of Inorganic Solar Cells by Nanotechnology

    Institute of Scientific and Technical Information of China (English)

    Yafei Zhang; Huijuan Geng; Zhihua Zhou; Jiang Wu; Zhiming Wang; Yaozhong Zhang; Zhongli Li; Liying Zhang; Zhi Yang; Huey Liang Hwang

    2012-01-01

    Inorganic solar cells, as durable photovoltaic devices for harvesting electric energy from sun light,have received tremendous attention due to the fear of exhausting the earth’s energy resources and damaging the living environment due to greenhouse gases. Some recent developments in nanotechnology have opened up new avenues for more relevant inorganic solar cells produced by new photovoltaic conversion concepts and effective solar energy harvesting nanostructures. In this review, the multiple exciton generation effect solar cells, hot carrier solar cells, one dimensional material constructed asymmetrical schottky barrier arrays, noble nanoparticle induced plasmonic enhancement, and light trapping nanostructured semiconductor solar cells are highlighted.

  9. Separation of fission products using inorganic exchangers

    International Nuclear Information System (INIS)

    Murthy, T.S.; Balasubramanian, K.R.; Rao, K.L.N.; Venkatachalam, R.; Varma, R.N.

    1981-01-01

    This paper describes the separation of long lived fission products like caesium-137, strontium-90 using inorganic exchangers ammonium phosphomolybdate and zirconium antimonate. A revised flow sheet is proposed for the sequential separation of these isotopes using the above two compounds. This is a modification of the earlier scheme developed which involved the use of four inorganic exchangers namely ammonium phosphomolybdate, manganese dioxide, zirconium antimonate and polyantimonic acid. The elution of the adsorbed elements like cerium, strontium, and sodium has been studied and it has been possible to elute these using different eluting agents. (author)

  10. Chronic inorganic mercury induced peripheral neuropathy

    Energy Technology Data Exchange (ETDEWEB)

    Chu, C.-C.; Huang, C.-C.; Ryu, S.-J. [Chang Gung Memorial Hospital and Chang Gung University, Dept. of Neurology, Tapei (Taiwan, Province of China); Wu, T.-N. [Executive Yuan, Dept. of Health, Surveillance and Quarantine Service, Taipei (Taiwan, Province of China)

    1998-12-01

    We report the clinical features, electrophysiological studies, and morphometric analysis of sural nerve pathology in a patient with polyneuropathy due to inorganic mercury intoxication. He developed slowly progressive generalized paralysis of all limbs after 3 months ingestion of herb drugs which contained mercuric sulfate. Electrophysiologic studies revealed axonal polyneuropathy involving both motor and sensory fibers. Sural nerve biopsy demonstrated axonal degeneration with demyelination and a predominant loss of large myelinated fibers. His muscle strength showed only mild improvement after 2 years` follow-up. We concluded that inorganic mercury exposure may induce severe axonal sensorimotor polyneuropathy in humans and that neurological deficits may persist in severe cases. (au) 21 refs.

  11. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  12. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  13. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  15. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  17. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  18. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  19. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  20. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  1. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  2. Simple inorganic complexes but intricate hydrogen bonding ...

    Indian Academy of Sciences (India)

    Administrator

    We are interested in obtaining single crystals of metal-opda complexes because their crystal structures would show complex hydrogen bonding network due to the presence of. –NH2 groups in the opda ligand (hydrogen bonding donor sites) and inorganic anions having mostly oxo groups (hydrogen bonding acceptor sites) ...

  3. Medicinal Uses of Inorganic Compounds - 1

    Indian Academy of Sciences (India)

    Worldwide sales of inorganic drugs are growing rapidly. Although about 26 elements in the periodic table are considered essential for mammalian life, both ... Lithium like alcohol can influence mood. Lithium drugs such as lithium carbonate Li2C03. , are used for the treatment of manic-depressive disorders, most likely ...

  4. Corrosion performance of inorganic coatings in seawater

    NARCIS (Netherlands)

    Zhang, X.; Buter, S.J.; Ferrari, G.M.; Westing, E. van; Kowalski, L.

    2011-01-01

    Inorganic coatings are widely used to protect carbon steel hydraulic cylinder rods from wear and corrosion in aggressive offshore environment. Different types of lay-ers such as Ni/Cr, Al2O3, Cr2O3, TiO2, and Inconel 625 layers were applied to the carbon steels by plasma, High Velocity Oxygen Fuel

  5. Inorganic mass spectrometry of solid samples

    International Nuclear Information System (INIS)

    Adams, F.; Vertes, A.

    1990-01-01

    In this review some recent developments in the field of inorganic mass spectrometry of solids are described with special emphasis on the actual state of understanding of the ionization processes. It concentrates on the common characteristics of methods such as spark source-, laser-, secondary ion-, inductively coupled plasma- and glow discharge mass spectrometry. (orig.)

  6. INORGANIC ELEMENTS AND DISTRIBUTION OF EASTERN OYSTERS.

    Science.gov (United States)

    Fisher, William S. In press. Inorganic Elements and Distribution of Eastern Oysters (Abstract). To be presented at the 96th Annual Meeting (Aquaculture 2004) of the National Shellfisheries Association, 1-5 March 2004, Honolulu, HI. 1 p. (ERL,GB R962). For over a century w...

  7. Serum Calcium, Inorganic Phosphates and some Haematological ...

    African Journals Online (AJOL)

    Objectives: Sickle cell disease has long been associated with bone deformities and pain. Mineral salts such as calcium and inorganic phosphate are critical in bone formation and metabolism. This investigation was designed to study the serum concentration of these minerals as well as some haematological parameters in ...

  8. Studies on inorganic exchanger: zirconium antimonate

    International Nuclear Information System (INIS)

    Dash, A.; Balasubramanian, K.R.

    1992-01-01

    The inorganic exchanger zirconium antimonate has been prepared and its characteristics evaluated. A method has been developed for the separation of 90 Sr and 144 Ce from fission products solution using this exchanger. (author). 23 refs., 18 f igs., 9 tabs

  9. Phytochemical, inorganic and proximate composition-guided ...

    African Journals Online (AJOL)

    Sterols, glycosides and anthraquinone were absent in all samples. The inorganic composition result showed relatively high concentration of potassium (very high for seed), calcium (for bark and leaf), magnesium and sulphur in Avocado samples. The Avocado seed contained relatively high content of moisture, carbohydrate ...

  10. Microbiological disproportionation of inorganic sulfur compounds

    DEFF Research Database (Denmark)

    Finster, Kai

    2008-01-01

    The disproportionation of inorganic sulfur intermediates at moderate temperatures (0-80 °C) is a microbiologically catalyzed chemolithotrophic process in which compounds like elemental sulfur, thiosulfate, and sulfite serve as both electron donor and acceptor, and generate hydrogen sulfide and su...

  11. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  12. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  13. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  14. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  15. Impact of organic and inorganic nanomaterials in the soil microbial community structure

    Energy Technology Data Exchange (ETDEWEB)

    Nogueira, Veronica; Lopes, Isabel [Department of Biology, University of Aveiro, Campus Universitario de Santiago, P-3810-193 Aveiro (Portugal); CESAM (Centre for Environmental and Marine Studies), University of Aveiro, Campus de Santiago 3810-193 Aveiro (Portugal); Rocha-Santos, Teresa [ISEIT/Viseu, Instituto Piaget, Estrada do Alto do Gaio, Galifonge, 3515-776 Lordosa, Viseu (Portugal); Santos, Ana L. [Department of Biology, University of Aveiro, Campus Universitario de Santiago, P-3810-193 Aveiro (Portugal); CESAM (Centre for Environmental and Marine Studies), University of Aveiro, Campus de Santiago 3810-193 Aveiro (Portugal); Rasteiro, Graca M.; Antunes, Filipe [CIEPQPF, Department of Chemical Engineering, Faculty of Science and Technology, Polo II, University of Coimbra, 3030-290 Coimbra (Portugal); Goncalves, Fernando; Soares, Amadeu M.V.M.; Cunha, Angela; Almeida, Adelaide [Department of Biology, University of Aveiro, Campus Universitario de Santiago, P-3810-193 Aveiro (Portugal); CESAM (Centre for Environmental and Marine Studies), University of Aveiro, Campus de Santiago 3810-193 Aveiro (Portugal); Gomes, Newton N.C.M., E-mail: gomesncm@ua.pt [Department of Biology, University of Aveiro, Campus Universitario de Santiago, P-3810-193 Aveiro (Portugal); CESAM (Centre for Environmental and Marine Studies), University of Aveiro, Campus de Santiago 3810-193 Aveiro (Portugal); Pereira, Ruth [Department of Biology, Faculty of Science, University of Porto, Rua do Campo Alegre 4169-007 Porto (Portugal); CESAM (Centre for Environmental and Marine Studies), University of Aveiro, Campus de Santiago 3810-193 Aveiro (Portugal)

    2012-05-01

    In this study the effect of organic and inorganic nanomaterials (NMs) on the structural diversity of the soil microbial community was investigated by Denaturing Gradient Gel Electrophoresis, after amplification with universal primers for the bacterial region V6-V8 of 16S rDNA. The polymers of carboxylmethyl-cellulose (CMC), of hydrophobically modified CMC (HM-CMC), and hydrophobically modified polyethylglycol (HM-PEG); the vesicles of sodium dodecyl sulphate/didodecyl dimethylammonium bromide (SDS/DDAB) and of monoolein/sodium oleate (Mo/NaO); titanium oxide (TiO{sub 2}), titanium silicon oxide (TiSiO{sub 4}), CdSe/ZnS quantum dots, gold nanorods, and Fe/Co magnetic fluid were the NMs tested. Soil samples were incubated, for a period of 30 days, after being spiked with NM suspensions previously characterized by Dynamic Light Scattering (DLS) or by an ultrahigh-resolution scanning electron microscope (SEM). The analysis of similarities (ANOSIM) of DGGE profiles showed that gold nanorods, TiO{sub 2}, CMC, HM-CMC, HM-PEG, and SDS/DDAB have significantly affected the structural diversity of the soil bacterial community. - Highlights: Black-Right-Pointing-Pointer Organic and inorganic nanomaterials on soil microbial community. Black-Right-Pointing-Pointer Structural diversity was investigated by Denaturing Gradient Gel Electrophoresis. Black-Right-Pointing-Pointer All the organic nanomaterials, TiO{sub 2} and gold nanorods significantly affected the structural diversity.

  16. Impact of organic and inorganic nanomaterials in the soil microbial community structure

    International Nuclear Information System (INIS)

    Nogueira, Verónica; Lopes, Isabel; Rocha-Santos, Teresa; Santos, Ana L.; Rasteiro, Graça M.; Antunes, Filipe; Gonçalves, Fernando; Soares, Amadeu M.V.M.; Cunha, Angela; Almeida, Adelaide; Gomes, Newton N.C.M.; Pereira, Ruth

    2012-01-01

    In this study the effect of organic and inorganic nanomaterials (NMs) on the structural diversity of the soil microbial community was investigated by Denaturing Gradient Gel Electrophoresis, after amplification with universal primers for the bacterial region V6–V8 of 16S rDNA. The polymers of carboxylmethyl-cellulose (CMC), of hydrophobically modified CMC (HM-CMC), and hydrophobically modified polyethylglycol (HM-PEG); the vesicles of sodium dodecyl sulphate/didodecyl dimethylammonium bromide (SDS/DDAB) and of monoolein/sodium oleate (Mo/NaO); titanium oxide (TiO 2 ), titanium silicon oxide (TiSiO 4 ), CdSe/ZnS quantum dots, gold nanorods, and Fe/Co magnetic fluid were the NMs tested. Soil samples were incubated, for a period of 30 days, after being spiked with NM suspensions previously characterized by Dynamic Light Scattering (DLS) or by an ultrahigh-resolution scanning electron microscope (SEM). The analysis of similarities (ANOSIM) of DGGE profiles showed that gold nanorods, TiO 2 , CMC, HM-CMC, HM-PEG, and SDS/DDAB have significantly affected the structural diversity of the soil bacterial community. - Highlights: ► Organic and inorganic nanomaterials on soil microbial community. ► Structural diversity was investigated by Denaturing Gradient Gel Electrophoresis. ► All the organic nanomaterials, TiO 2 and gold nanorods significantly affected the structural diversity.

  17. Influence of Organic and Inorganic Sources of Fertilizer on Growth ...

    African Journals Online (AJOL)

    Influence of Organic and Inorganic Sources of Fertilizer on Growth and Leaf Yield of Kale ... Journal of Agriculture, Science and Technology ... fertilizer gave leaf yields comparable to those applied with exclusively inorganic sources of fertilizer.

  18. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  19. Review of progress in soil inorganic carbon research

    Science.gov (United States)

    Bai, S. G.; Jiao, Y.; Yang, W. Z.; Gu, P.; Yang, J.; Liu, L. J.

    2017-12-01

    Soil inorganic carbon is one of the main carbon banks in the near-surface environment, and is the main form of soil carbon library in arid and semi-arid regions, which plays an important role in the global carbon cycle. This paper mainly focuses on the inorganic dynamic process of soil inorganic carbon in soil environment in arid and semi-arid regions, and summarized the composition and source of soil inorganic carbon, influence factors and soil carbon sequestration.

  20. Quantitative method for determination of body inorganic iodine

    International Nuclear Information System (INIS)

    Filatov, A.A.; Tatsievskij, V.A.

    1991-01-01

    An original method of quantitation of body inorganic iodine, based upon a simultaneous administration of a known dose of stable and radioactive iodine with subsequent radiometry of the thyroid was proposed. The calculation is based upon the principle of the dilution of radiactive iodine in human inorganic iodine space. The method permits quantitation of the amount of inorganic iodine with regard to individual features of inorganic space. The method is characterized by simplicity and is not invasive for a patient

  1. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  2. Inorganic component of saliva during fasting and after fast break

    OpenAIRE

    Samad, Rasmidar

    2016-01-01

    Oral health is closely related to salivary components. Saliva consists of water, inorganic and organic materials. Fasting changes one???s meal and drinking time that in turn can affect the environment in oral cavity, including inorganic componenet of saliva. The purpose of this study is to determine the inorganic component of saliva during fasting and after fast break.

  3. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  4. Radwaste issues belong in the inorganic classroom

    International Nuclear Information System (INIS)

    Williams, D.H.

    1991-01-01

    The safe isolation of high level radioactive wastes is a matter of significant importance. This material is derived primarily from spent nuclear fuel and defense weapon production. Every element on the periodic chart is represented. The majority are metallic elements. Over the thousands of years that they are to be isolated the primary chemistry will be oxidation. The mobility and fate of particular inner and outer transition element ions become very important. For that, one must understand their hydrolytic nature, their complexing tendencies and the solubilities of various compounds. This topic could easily serve as a centerpiece for an inorganic chemistry course. At the very least, it demands the attention of every teacher of inorganic chemistry and consideration by those whose research is directed to tangible problems. The discussion includes notes on the abundance and lifetimes of particular radioisotopes. The positive student responses to this approach are also shared

  5. The quest for the ideal inorganic scintillator

    International Nuclear Information System (INIS)

    Derenzo, S.E.; Weber, M.J.; Bourret-Courchesne, E.; Klintenberg, M.K.

    2002-01-01

    The past half century has witnessed the discovery of many new inorganic scintillator materials and numerous advances in our understanding of the basic physical processes governing the transformation of ionizing radiation into scintillation light. Whereas scintillators are available with a good combination of physical properties, none provides the desired combination of stopping power, light output, and decay time. A review of the numerous scintillation mechanisms of known inorganic scintillators reveals why none of them is both bright and fast. The mechanisms of radiative recombination in wide-bandgap direct semiconductors, however, remain relatively unexploited for scintillators. We describe how suitably doped semiconductor scintillators could provide a combination of high light output, short decay time, and linearity of response that approach fundamental limits

  6. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  7. Molten salt battery having inorganic paper separator

    Science.gov (United States)

    Walker, Jr., Robert D.

    1977-01-01

    A high temperature secondary battery comprises an anode containing lithium, a cathode containing a chalcogen or chalcogenide, a molten salt electrolyte containing lithium ions, and a separator comprising a porous sheet comprising a homogenous mixture of 2-20 wt.% chrysotile asbestos fibers and the remainder inorganic material non-reactive with the battery components. The non-reactive material is present as fibers, powder, or a fiber-powder mixture.

  8. Inorganic Materials Division annual report, 1975

    International Nuclear Information System (INIS)

    Duba, A.; Hornady, B.

    1976-01-01

    This compilation lists abstracts of papers, internal reports, and talks presented during 1975 at national and international meetings by members of the Geoscience and Engineering Section, Inorganic Materials Division, Chemistry and Materials Science Department, Lawrence Livermore Laboratory. Titles of talks at university and local meetings are also listed when available. The subjects range from the in situ retorting of coal to the temperature profile of the moon. A subject classification is included

  9. Hydrothermal synthetic strategies of inorganic semiconducting nanostructures.

    Science.gov (United States)

    Shi, Weidong; Song, Shuyan; Zhang, Hongjie

    2013-07-07

    Because of their unique chemical and physical properties, inorganic semiconducting nanostructures have gradually played a pivotal role in a variety of research fields, including electronics, chemical reactivity, energy conversion, and optics. A major feature of these nanostructures is the quantum confinement effect, which strongly depends on their size, shape, crystal structure and polydispersity. Among all developed synthetic methods, the hydrothermal method based on a water system has attracted more and more attention because of its outstanding advantages, such as high yield, simple manipulation, easy control, uniform products, lower air pollution, low energy consumption and so on. Precise control over the hydrothermal synthetic conditions is a key to the success of the preparation of high-quality inorganic semiconducting nanostructures. In this review, only the representative hydrothermal synthetic strategies of inorganic semiconducting nanostructures are selected and discussed. We will introduce the four types of strategies based on exterior reaction system adjustment, namely organic additive- and template-free hydrothermal synthesis, organic additive-assisted hydrothermal synthesis, template-assisted hydrothermal synthesis and substrate-assisted hydrothermal synthesis. In addition, the two strategies based on exterior reaction environment adjustment, including microwave-assisted and magnetic field-assisted hydrothermal synthesis, will be also described. Finally, we conclude and give the future prospects of this research area.

  10. Inorganic particle analysis of dental impression elastomers.

    Science.gov (United States)

    Carlo, Hugo Lemes; Fonseca, Rodrigo Borges; Soares, Carlos José; Correr, Américo Bortolazzo; Correr-Sobrinho, Lourenço; Sinhoreti, Mário Alexandre Coelho

    2010-01-01

    The aim of this study was to determine quantitatively and qualitatively the inorganic particle fraction of commercially available dental elastomers. The inorganic volumetric fraction of two addition silicones (Reprosil Putty/Fluid and Flexitime Easy Putty/Fluid), three condensation silicones (Clonage Putty/Fluid, Optosil Confort/Xantopren VL and Silon APS Putty/Fluid), one polyether (Impregum Soft Light Body) and one polysulfide (Permlastic Light Body) was accessed by weighing a previously determined mass of each material in water before and after burning samples at 600 ºC, during 3 h. Unsettled material samples were soaked in acetone and chloroform for removal of the organic portion. The remaining filler particles were sputter-coated with gold evaluation of their morphology and size, under scanning electron microscopy (SEM). Flexitime Easy Putty was the material with the highest results for volumetric particle fraction, while Impregum Soft had the lowest values. Silon 2 APS Fluid presented the lowest mean filler size values, while Clonage Putty had the highest values. SEM micrographs of the inorganic particles showed several morphologies - lathe-cut, spherical, spherical-like, sticks, and sticks mixed to lathe-cut powder. The results of this study revealed differences in particle characteristics among the elastometic materials that could lead to different results when testing mechanical properties.

  11. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  12. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  13. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  14. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  15. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  16. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  17. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  18. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  19. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  20. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  1. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  2. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  3. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  4. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  5. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  6. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  7. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  8. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  9. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  10. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  11. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  13. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  14. Magnetic field processing of inorganic polymers

    Energy Technology Data Exchange (ETDEWEB)

    Kunerth, D.C.; Peterson, E.S. [Idaho National Engineering Laboratory, Idaho Falls, ID (United States)

    1995-05-01

    The purpose of this project is to investigate, understand, and demonstrate the use of magnetic field processing (MFP) to modify the properties of inorganic-based polymers and to develop the basic technical knowledge required for industrial implementation. Polyphosphazene membranes for chemical separation applications are being emphasized by this project. Previous work demonstrated that magnetic fields, appropriately applied during processing, can be used to beneficially modify membrane morphology. MFP membranes have significantly increased flux capabilities while maintaining the same chemical selectivity as the unprocessed membranes.

  15. Studies on inorganic exchangers - polyantimonic acid

    International Nuclear Information System (INIS)

    Murthy, T.S.; Balasubramanian, K.R.; Ananthakrishnan, M.; Ramani, K.S.; Varma, R.N.

    1976-01-01

    From the detailed experimental investigations carried out, it may be mentioned that the inorganic exchanger polyantimonic acid could be used for effectively separating strontium from fission product waste solutions free from caesium and zirconium at acidities of the order of 2M or so. After thorough washing of the column with 2M HNO 3 acid to remove any residual activity unadsorbed, the strontium can be eluted with a mixture of 1M AgNO 3 +6M HNO 3 at room temperature. The column after regeneration and conditioning can be used for further adsorption and elution up to a maximum of 6 cycles without much deterioration in column characteristics. (author)

  16. Designing an optimally proportional inorganic scintillator

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Jai, E-mail: jai.singh@cdu.edu.au [School of Engineering and IT, B-Purple-12, Faculty of EHSE, Charles Darwin University, NT 0909 (Australia); Koblov, Alexander [School of Engineering and IT, B-Purple-12, Faculty of EHSE, Charles Darwin University, NT 0909 (Australia)

    2012-09-01

    The nonproportionality observed in the light yield of inorganic scintillators is studied theoretically as a function of the rates of bimolecular and Auger quenching processes occurring within the electron track initiated by a gamma- or X-ray photon incident on a scintillator. Assuming a cylindrical track, the influence of the track radius and concentration of excitations created within the track on the scintillator light yield is also studied. Analysing the calculated light yield a guideline for inventing an optimally proportional scintillator with optimal energy resolution is presented.

  17. Designing an optimally proportional inorganic scintillator

    International Nuclear Information System (INIS)

    Singh, Jai; Koblov, Alexander

    2012-01-01

    The nonproportionality observed in the light yield of inorganic scintillators is studied theoretically as a function of the rates of bimolecular and Auger quenching processes occurring within the electron track initiated by a gamma- or X-ray photon incident on a scintillator. Assuming a cylindrical track, the influence of the track radius and concentration of excitations created within the track on the scintillator light yield is also studied. Analysing the calculated light yield a guideline for inventing an optimally proportional scintillator with optimal energy resolution is presented.

  18. Inorganic pyrophosphatases: structural diversity serving the function

    Science.gov (United States)

    Samygina, V. R.

    2016-05-01

    The review is devoted to ubiquitous enzymes, inorganic pyrophosphatases, which are essential in all living organisms. Despite the long history of investigations, these enzymes continue to attract interest. The review focuses on the three-dimensional structures of various representatives of this class of proteins. The structural diversity, the relationship between the structure and some properties of pyrophosphatases and various mechanisms of enzyme action related to the structural diversity of these enzymes are discussed. Interactions of pyrophosphatase with other proteins and possible practical applications are considered. The bibliography includes 56 references.

  19. Inorganic nitrogen in precipitation and atmospheric sediments

    Energy Technology Data Exchange (ETDEWEB)

    Matheson, D H

    1951-01-01

    In an investigation covering 18 months, daily determinations were made of the inorganic nitrogen contained in precipitation and atmospheric sediments collected at Hamilton, Ont. The nitrogen fall for the whole period averaged 5.8 lb. N per acre per year. Sixty-one per cent of the total nitrogen was collected on 25% of the days when precipitation occurred. The balance, occurring on days without precipitation, is attributable solely to the sedimentation of dust. Ammonia nitrogen averaged 56% of the total, but the proportion for individual days varied widely.

  20. IRIS Toxicological Review of Inorganic Arsenic (Cancer) ...

    Science.gov (United States)

    EPA's Science Advisory Board (SAB) conducted a review of the scientific basis supporting the human health cancer hazard and dose-response assessment of inorganic arsenic that will appear on the Integrated Risk Information System (IRIS) database. EPA revised the assessment and is now returning the assessment to the SAB and releasing the document to the public for a focused review of EPA's responses to the SAB recommendations. This draft IRIS health assessment addresses only cancer human health effects that may result from chronic exposure to this chemical.

  1. Inorganic-whisker-reinforced polymer composites synthesis, properties and applications

    CERN Document Server

    Sun, Qiuju

    2015-01-01

    Inorganic-Whisker-Reinforced Polymer Composites: Synthesis, Properties and Applications gives a comprehensive presentation of inorganic microcrystalline fibers, or whiskers, a polymer composite filler. It covers whisker synthesis, surface modification, applications for reinforcing polymer-matrix composites, and analysis of resulting filled polymer composites. It focuses on calcium carbonate whiskers as a primary case study, introducing surface treatment methods for calcium carbonate whiskers and factors that influence them. Along with calcium carbonate, the book discusses potassium titanate and aluminum borate whiskers, which also comprise the new generation of inorganic whiskers. According to research results, composites filled by inorganic whiskers show improved strength, wear-resistance, thermal conductivity, and antistatic properties. It explains the importance of modifying polymer materials for use with inorganic whiskers and describes preparation and evaluation methods of polymers filled with inorganic ...

  2. Human Exposure and Health Effects of Inorganic and Elemental Mercury

    OpenAIRE

    Park, Jung-Duck; Zheng, Wei

    2012-01-01

    Mercury is a toxic and non-essential metal in the human body. Mercury is ubiquitously distributed in the environment, present in natural products, and exists extensively in items encountered in daily life. There are three forms of mercury, i.e., elemental (or metallic) mercury, inorganic mercury compounds, and organic mercury compounds. This review examines the toxicity of elemental mercury and inorganic mercury compounds. Inorganic mercury compounds are water soluble with a bioavailability o...

  3. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  4. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  5. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  6. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  7. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  8. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  9. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  10. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  11. Bio-Based Approaches to Inorganic Material Synthesis (Postprint)

    National Research Council Canada - National Science Library

    Slocik, Joseph M; Stone, Morley O; Naik, Rajesh R

    2007-01-01

    .... Marine sponges create silica spicules also using proteins, termed silicateins. In recent years, our group and others have used biomolecules as templates for the deposition of inorganic materials...

  12. Inorganic Membranes: Preparation and Application for Water Treatment and Desalination

    Science.gov (United States)

    McKay, Gordon; Buekenhoudt, Anita; Motmans, Filip; Khraisheh, Marwan; Atieh, Muataz

    2018-01-01

    Inorganic membrane science and technology is an attractive field of membrane separation technology, which has been dominated by polymer membranes. Recently, the inorganic membrane has been undergoing rapid development and innovation. Inorganic membranes have the advantage of resisting harsh chemical cleaning, high temperature and wear resistance, high chemical stability, long lifetime, and autoclavable. All of these outstanding properties made inorganic membranes good candidates to be used for water treatment and desalination applications. This paper is a state of the art review on the synthesis, development, and application of different inorganic membranes for water and wastewater treatment. The inorganic membranes reviewed in this paper include liquid membranes, dynamic membranes, various ceramic membranes, carbon based membranes, silica membranes, and zeolite membranes. A brief description of the different synthesis routes for the development of inorganic membranes for application in water industry is given and each synthesis rout is critically reviewed and compared. Thereafter, the recent studies on different application of inorganic membrane and their properties for water treatment and desalination in literature are critically summarized. It was reported that inorganic membranes despite their high synthesis cost, showed very promising results with high flux, full salt rejection, and very low or no fouling. PMID:29304024

  13. Inorganic Membranes: Preparation and Application for Water Treatment and Desalination

    Directory of Open Access Journals (Sweden)

    Ahmad Kayvani Fard

    2018-01-01

    Full Text Available Inorganic membrane science and technology is an attractive field of membrane separation technology, which has been dominated by polymer membranes. Recently, the inorganic membrane has been undergoing rapid development and innovation. Inorganic membranes have the advantage of resisting harsh chemical cleaning, high temperature and wear resistance, high chemical stability, long lifetime, and autoclavable. All of these outstanding properties made inorganic membranes good candidates to be used for water treatment and desalination applications. This paper is a state of the art review on the synthesis, development, and application of different inorganic membranes for water and wastewater treatment. The inorganic membranes reviewed in this paper include liquid membranes, dynamic membranes, various ceramic membranes, carbon based membranes, silica membranes, and zeolite membranes. A brief description of the different synthesis routes for the development of inorganic membranes for application in water industry is given and each synthesis rout is critically reviewed and compared. Thereafter, the recent studies on different application of inorganic membrane and their properties for water treatment and desalination in literature are critically summarized. It was reported that inorganic membranes despite their high synthesis cost, showed very promising results with high flux, full salt rejection, and very low or no fouling.

  14. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  15. From stretchable to reconfigurable inorganic electronics

    KAUST Repository

    Nassar, Joanna M.

    2016-05-06

    Today’s state-of-the-art electronics are high performing, energy efficient, multi-functional and cost effective. However, they are also typically rigid and brittle. With the emergence of the Internet of Everything, electronic applications are expanding into previously unexplored areas, like healthcare, smart wearable artifacts, and robotics. One major challenge is the physical asymmetry of target application surfaces, which often cause mechanical stretching, contracting, twisting and other deformations to the application. In this review paper, we explore materials, processes, mechanics and devices that enable physically stretchable and reconfigurable electronics. While the concept of stretchable electronics is commonly used in practice, the notion of physically reconfigurable electronics is still in its infancy. Because organic materials are commonly naturally stretchable and physically deformable, we predominantly focus on electronics made from inorganic materials that have the capacity for physical stretching and reconfiguration while retaining their intended attributes. We emphasize how applications of electronics dictate theory to integration strategy for stretchable and reconfigurable inorganic electronics.

  16. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  17. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  18. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  19. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  20. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  1. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  2. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  3. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  4. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  5. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  6. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  7. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  8. Engineering properties of inorganic polymer concretes (IPCs)

    International Nuclear Information System (INIS)

    Sofi, M.; Deventer, J.S.J. van; Mendis, P.A.; Lukey, G.C.

    2007-01-01

    This paper presents the engineering properties of inorganic polymer concretes (IPCs) with a compressive strength of 50 MPa. The study includes a determination of the modulus of elasticity, Poisson's ratio, compressive strength, and the splitting tensile strength and flexural strength of IPCs, formulated using three different sources of Class-F fly ash. Six IPC mix designs were adopted to evaluate the effects of the inclusion of coarse aggregates and granulated blast furnace slag into the mixes. A total of 90 cylindrical and 24 small beam specimens were investigated, and all tests were carried out pursuant to the relevant Australian Standards. Although some variability between the mixes was observed, the results show that, in most cases, the engineering properties of IPCs compare favorably to those predicted by the relevant Australian Standards for concrete mixtures

  9. Scintillation response of organic and inorganic scintillators

    CERN Document Server

    Papadopoulos, L M

    1999-01-01

    A method to evaluate the scintillation response of organic and inorganic scintillators to different heavy ionizing particles is suggested. A function describing the rate of the energy consumed as fluorescence emission is derived, i.e., the differential response with respect to time. This function is then integrated for each ion and scintillator (anthracene, stilbene and CsI(Tl)) to determine scintillation response. The resulting scintillation responses are compared to the previously reported measured responses. Agreement to within 2.5% is observed when these data are normalized to each other. In addition, conclusions regarding the quenching parameter kB dependence on the type of the particle and the computed values of kB for certain ions are included. (author)

  10. Neutron Diffraction and Inorganic Materials Discovery

    International Nuclear Information System (INIS)

    Rosseinsky, M.J.

    2005-01-01

    Full text: The discovery of complex inorganic materials is an important academic and technological challenge because of the opportunities these systems offer for observation of new phenomena, and the questions they pose for fundamental understanding. This presentation will illustrate the key role of neutron powder diffraction in enabling the discovery of new classes of materials, and in evaluating their properties and the conditions under which they need to be processed to optimise their behaviour in devices for applications. New chemistry is illustrated by the transition metal oxide hydrides, where both structure and ionic mobility required neutron scattering characterisation. The relationship between chemistry, structure and properties will be addressed by considering the difficulties in inducing superconductivity in analogues of magnesium diboride. The role of both neutron and X-ray diffraction in evaluating the processing of microwave dielectric ceramics will be highlighted, with the discovery of new phases shown to be a useful bonus in this type of in-situ study. (author)

  11. Applications of inorganic nanoparticles as therapeutic agents

    Science.gov (United States)

    Kim, Taeho; Hyeon, Taeghwan

    2014-01-01

    During the last decade, various functional nanostructured materials with interesting optical, magnetic, mechanical and chemical properties have been extensively applied to biomedical areas including imaging, diagnosis and therapy. In therapeutics, most research has focused on the application of nanoparticles as potential delivery vehicles for drugs and genes, because nanoparticles in the size range of 2-100 nm can interact with biological systems at the molecular level, and allow targeted delivery and passage through biological barriers. Recent investigations have even revealed that several kinds of nanomaterials are intrinsically therapeutic. Not only can they passively interact with cells, but they can also actively mediate molecular processes to regulate cell functions. This can be seen in the treatment of cancer via anti-angiogenic mechanisms as well as the treatment of neurodegenerative diseases by effectively controlling oxidative stress. This review will present recent applications of inorganic nanoparticles as therapeutic agents in the treatment of disease.

  12. Practical approaches to biological inorganic chemistry

    CERN Document Server

    Louro, Ricardo O

    2012-01-01

    The book reviews the use of spectroscopic and related methods to investigate the complex structures and mechanisms of biological inorganic systems that contain metals. Each chapter presents an overview of the technique including relevant theory, clearly explains what it is and how it works and then presents how the technique is actually used to evaluate biological structures. Practical examples and problems are included to illustrate each technique and to aid understanding. Designed for students and researchers who want to learn both the basics, and more advanced aspects of bioinorganic chemistry. It includes many colour illustrations enable easier visualization of molecular mechanisms and structures. It provides worked examples and problems that are included to illustrate and test the reader's understanding of each technique. It is written by a multi-author team who use and teach the most important techniques used today to analyse complex biological structures.

  13. Carbon dioxide removal with inorganic membranes

    Energy Technology Data Exchange (ETDEWEB)

    Judkins, R.R.; Fain, D.E. [Oak Ridge National Laboratory, TN (United States)

    1993-12-31

    The increasing concentrations of greenhouse gases, particularly carbon dioxide, in the atmosphere has sparked a great deal of interest in the removal of CO{sub 2} from flue gases of fossil fueled plants. Presently, several techniques for the removal of CO{sub 2} are considered to have potential, but are lacking in practicality. For example, amine scrubbing of flue gas streams is potential, but are lacking in practically. For example, amine scrubbing of flue gas streams is effective in removing CO{sub 2}, but costs are high; efficiency suffers; and other acid gases must be removed prior to amine stripping. Membrane systems for CO{sub 2} removal are held in high regard, and inorganic, particularly ceramic, membranes offer the potential for high temperature, thus energy saving, removal.

  14. Inorganic-organic nanocomposites for optical coatings

    Science.gov (United States)

    Schmidt, Helmut K.; Krug, Herbert; Sepeur-Zeitz, Bernhard; Geiter, Elisabeth

    1997-10-01

    The fabrication of nanoparticles by the sol-gel process and their use in polymeric or sol-gel-derived inorganic-organic composite matrices opens up interesting possibilities for designing new optical materials. Two different routes have been chosen for preparing optical nanocomposites: The first is the so-called 'in situ route,' where the nanoparticles are synthesized in a liquid mixture from Zr-alkoxides in a polymerizable system and diffractive gratings were produced by embossing uncured film. The second is the 'separate' preparation route, where a sterically stabilized dry nanoboehmite powder was completely redispersed in an epoxy group-containing matrix and hard coatings with optical quality on polycarbonate were prepared.

  15. Solubility and stability of inorganic carbonates

    International Nuclear Information System (INIS)

    Taylor, P.

    1987-01-01

    The chemistry of inorganic carbonates is reviewed, with emphasis on solubility and hydrolytic stability, in order to identify candidate waste forms for immobilization and disposal of 14 C. At present, CaCO 3 and BaCO 3 are the two most widely favoured wasted forms, primarily because they are the products of proven CO 2 -scrubbing technology. However, they have relatively high solubilities in non-alkaline solutions, necessitating care in selecting and assessing an appropriate disposal environment. Three compounds with better solubility characteristics in near-neutral waters are identified: bismutite, (BiO) 2 CO 3 ; hydrocerussite, Pb 3 (OH) 2 (CO 3 ) 2 ; and rhodochrosite, MnCO 3 . Some of the limitations of each of these alternative waste forms are discussed

  16. Mechanisms of inorganic and organometallic reactions

    CERN Document Server

    The purpose of this series is to provide a continuing critical review of the literature concerned with mechanistic aspects of inorganic and organo­ metallic reactions in solution, with coverage being complete in each volume. The papers discussed are selected on the basis of relevance to the elucidation of reaction mechanisms and many include results of a nonkinetic nature when useful mechanistic information can be deduced. The period of literature covered by this volume is July 1982 through December 1983, and in some instances papers not available for inclusion in the previous volume are also included. Numerical results are usually reported in the units used by the original authors, except where data from different papers are com­ pared and conversion to common units is necessary. As in previous volumes material included covers the major areas of redox processes, reactions of the nonmetallic elements, reaction of inert and labile metal complexes and the reactions of organometallic compounds. While m...

  17. Inorganic phosphate uptake in unicellular eukaryotes.

    Science.gov (United States)

    Dick, Claudia F; Dos-Santos, André L A; Meyer-Fernandes, José R

    2014-07-01

    Inorganic phosphate (Pi) is an essential nutrient for all organisms. The route of Pi utilization begins with Pi transport across the plasma membrane. Here, we analyzed the gene sequences and compared the biochemical profiles, including kinetic and modulator parameters, of Pi transporters in unicellular eukaryotes. The objective of this review is to evaluate the recent findings regarding Pi uptake mechanisms in microorganisms, such as the fungi Neurospora crassa and Saccharomyces cerevisiae and the parasite protozoans Trypanosoma cruzi, Trypanosoma rangeli, Leishmania infantum and Plasmodium falciparum. Pi uptake is the key step of Pi homeostasis and in the subsequent signaling event in eukaryotic microorganisms. Biochemical and structural studies are important for clarifying mechanisms of Pi homeostasis, as well as Pi sensor and downstream pathways, and raise possibilities for future studies in this field. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Characterisation of the inorganic chemistry of surface waters in ...

    African Journals Online (AJOL)

    The main purpose of this study was to determine a simple inorganic chemistry index that can be used for all surface waters in South Africa, in order to characterise the inorganic chemistry of surface waters. Water quality data collected up until 1999 from all sample monitoring stations (2 068 monitoring stations, 364 659 ...

  19. Effect of Inorganic Fertilizer on the Microbial degradation of Diesel ...

    African Journals Online (AJOL)

    The effect of Inorganic Fertilizer (IF) on the microbial degradation of diesel polluted soil in Abeokuta was assessed by collecting Top soil (0 – 15 cm depth) from diesel polluted site of Information and Communication Centre, Federal University of Agriculture, Abeokuta, Nigeria. Inorganic fertilizer was added to the polluted soil ...

  20. Graphene templated Directional Growth of an Inorganic Nanowire

    Science.gov (United States)

    2015-03-23

    14,23–25 have only formed randomly oriented or poorly aligned inorganic nanostructures. Here, we show that inorganic nanowires of gold(I) cyanide can... complex . TEM image simulation from the crystal structure The TEM image simulations are performed using MacTempas and CrystalKit. The imaging

  1. Computer information resources of inorganic chemistry and materials science

    Energy Technology Data Exchange (ETDEWEB)

    Kiselyova, N N; Dudarev, V A; Zemskov, V S [A.A.Baikov Institute of Metallurgy and Materials Science, Russian Academy of Sciences, Moscow (Russian Federation)

    2010-02-28

    Information systems used in inorganic chemistry and materials science are considered. The following basic trends in the development of modern information systems in these areas are highlighted: access to information via the Internet, merging of documental and factual databases, involvement of experts in the evaluation of the data reliability, supplementing databases with information analysis tools on the properties of inorganic substances and materials.

  2. Organometallic-inorganic hybrid electrodes for lithium-ion batteries

    Science.gov (United States)

    Huang, Qian; Lemmon, John P.; Choi, Daiwon; Cosimbescu, Lelia

    2016-09-13

    Disclosed are embodiments of active materials for organometallic and organometallic-inorganic hybrid electrodes and particularly active materials for organometallic and organometallic-inorganic hybrid cathodes for lithium-ion batteries. In certain embodiments the organometallic material comprises a ferrocene polymer.

  3. Synthesis of Porous Inorganic Hollow Fibers without Harmful Solvents

    NARCIS (Netherlands)

    Shukla, Sushumna; de Wit, Patrick; Luiten-Olieman, Maria W.J.; Kappert, Emiel; Nijmeijer, Arian; Benes, Nieck Edwin

    2015-01-01

    A route for the fabrication of porous inorganic hollow fibers with high surface-area-to-volume ratio that avoids harmful solvents is presented. The approach is based on bio-ionic gelation of an aqueous mixture of inorganic particles and sodium alginate during wet spinning. In a subsequent thermal

  4. Computer information resources of inorganic chemistry and materials science

    International Nuclear Information System (INIS)

    Kiselyova, N N; Dudarev, V A; Zemskov, V S

    2010-01-01

    Information systems used in inorganic chemistry and materials science are considered. The following basic trends in the development of modern information systems in these areas are highlighted: access to information via the Internet, merging of documental and factual databases, involvement of experts in the evaluation of the data reliability, supplementing databases with information analysis tools on the properties of inorganic substances and materials.

  5. Rumen microorganisms decrease bioavailability of inorganic selenium supplements

    Science.gov (United States)

    Despite the availaility of selenium (Se)-enriched trace mineral supplements, we have observed low Se status in cattle and sheep offered traditional inorganic Se supplements. Reasons for this may include inadequate intake or low bioavailability of inorganic Se sources. The objective of this study w...

  6. Contamination of Kallar Kahar Lake by Inorganic Elements and ...

    African Journals Online (AJOL)

    The present study was conducted to find out the contamination of Kallar Kahar Lake by inorganic elements and heavy metals and the temporal variation of these chemicals in the lake water. Water samples were collected on monthly basis during December 2001 to November 2002. Concentration of 10 inorganic elements ...

  7. An overview of the bioremediation of inorganic contaminants

    International Nuclear Information System (INIS)

    Bolton, H. Jr.; Gorby, Y.A.

    1995-01-01

    Bioremediation, or the biological treatment of wastes, usually is associated with the remediation of organic contaminants. Similarly, there is an increasing body of literature and expertise in applying biological systems to assist in the bioremediation of soils, sediments, and water contaminated with inorganic compounds including metals, radionuclides, nitrates, and cyanides. Inorganic compounds can be toxic both to humans and to organisms used to remediate these contaminants. However, in contrast to organic contaminants, most inorganic contaminants cannot be degraded, but must be remediated by altering their transport properties. Immobilization, mobilization, or transformation of inorganic contaminants via bioaccumulation, biosorption, oxidation, reduction, methylation, demethylation, metal-organic complexation, ligand degradation, and phytoremediation are the various processes applied in the bioremediation of inorganic compounds. This paper briefly describes these processes, referring to other contributors in this book as examples when possible, and summarize the factors that must be considered when choosing bioremediation as a cleanup technology for inorganics. Understanding the current state of knowledge as well as the limitations for bioremediation of inorganic compounds will assist in identifying and implementing successful remediation strategies at sites containing inorganic contaminants. 79 refs

  8. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  9. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  10. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  11. Zeta potential control in decontamination with inorganic membranes and inorganic adsorbents

    Energy Technology Data Exchange (ETDEWEB)

    Andalaft, E; Vega, R; Correa, M; Araya, R; Loyola, P [Comision Chilena de Energia Nuclear, Santiago (Chile)

    1997-02-01

    The application of some advanced separation processes such as microfiltration and ultrafiltration, electroosmosis and electrodialysis for treating nuclear waste from different aqueous streams is under examination at the Chilean Commission for Nuclear Energy. The application of these techniques can be extended to regular industrial wastes when economically advisable. This report deals mainly with electrodialysis, electroosmosis and adsorption with inorganic materials. Special attention is paid to zeta potential control as a driving factor to electroosmosis. For radioactive contaminants that are present in the form of cations, anions, non-ionic solutions, colloids and suspended matter, appropriate combination of the processes may considerably increase the efficiency of processes used. As an example, colloids and suspended particles may be retained in porous ceramic membranes by nanofiltration, ultrafiltration or microfiltration depending on the particle size of the particles. The control of zeta potential by acting in the solid phase or else on the liquid phase has been studied; a mathematical model to predict electrodialysis data has been developed, and finally, the use of a home-made inorganic adsorbent illustrated. The effect of gamma irradiation on the membranes has also been studied. Properties such as salt retention, water flux and pore size diameter determined on both organic and inorganic membranes before and after irradiation indicate deterioration of the organic membrane. (author). 13 refs, 15 figs, 2 tabs.

  12. Artificial inorganic Biohybrids: the functional combination of microorganisms and cells with inorganic materials.

    Science.gov (United States)

    Holzmeister, Ib; Schamel, Martha; Groll, Jürgen; Gbureck, Uwe; Vorndran, Elke

    2018-04-23

    Biohybrids can be defined as the functional combination of proteins, viable cells or microorganisms with non-biological materials. This article reviews recent findings on the encapsulation of microorganisms and eukaryotic cells in inorganic matrices such as silica gels or cements. The entrapment of biological entities into a support material is of great benefit for processing since the encapsulation matrix protects sensitive cells from shear forces, unfavourable pH changes, or cytotoxic solvents, avoids culture-washout, and simplifies the separation of formed products. After reflecting general aspects of such an immobilization as well as the chemistry of the inorganic matrices, we focused on manufacturing aspects and the application of such biohybrids in biotechnology, medicine as well as in environmental science and for civil engineering purpose. The encapsulation of living cells and microorganisms became an intensively studied and rapidly expanding research field with manifold applications in medicine, bio- and environmental technology, or civil engineering. Here, the use of silica or cements as encapsulation matrices have the advantage of a higher chemical and mechanical resistance towards harsh environmental conditions during processing compared to their polymeric counterparts. In this perspective, the article gives an overview about the inorganic material systems used for cell encapsulation, followed by reviewing the most important applications. The future may lay in a combination of the currently achieved biohybrid systems with additive manufacturing techniques. In a longer perspective, this would enable the direct printing of cell loaded bioreactor components. Copyright © 2018. Published by Elsevier Ltd.

  13. Zeta potential control in decontamination with inorganic membranes and inorganic adsorbents

    International Nuclear Information System (INIS)

    Andalaft, E.; Vega, R.; Correa, M.; Araya, R.; Loyola, P.

    1997-01-01

    The application of some advanced separation processes such as microfiltration and ultrafiltration, electroosmosis and electrodialysis for treating nuclear waste from different aqueous streams is under examination at the Chilean Commission for Nuclear Energy. The application of these techniques can be extended to regular industrial wastes when economically advisable. This report deals mainly with electrodialysis, electroosmosis and adsorption with inorganic materials. Special attention is paid to zeta potential control as a driving factor to electroosmosis. For radioactive contaminants that are present in the form of cations, anions, non-ionic solutions, colloids and suspended matter, appropriate combination of the processes may considerably increase the efficiency of processes used. As an example, colloids and suspended particles may be retained in porous ceramic membranes by nanofiltration, ultrafiltration or microfiltration depending on the particle size of the particles. The control of zeta potential by acting in the solid phase or else on the liquid phase has been studied; a mathematical model to predict electrodialysis data has been developed, and finally, the use of a home-made inorganic adsorbent illustrated. The effect of gamma irradiation on the membranes has also been studied. Properties such as salt retention, water flux and pore size diameter determined on both organic and inorganic membranes before and after irradiation indicate deterioration of the organic membrane. (author). 13 refs, 15 figs, 2 tabs

  14. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  15. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  16. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  17. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  18. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  19. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  20. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  1. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  2. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  3. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  4. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  5. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  6. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  7. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  8. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  9. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  10. Inorganic arsenic levels in baby rice are of concern

    International Nuclear Information System (INIS)

    Meharg, Andrew A.; Sun, Guoxin; Williams, Paul N.; Adomako, Eureka; Deacon, Claire; Zhu, Yong-Guan; Feldmann, Joerg; Raab, Andrea

    2008-01-01

    Inorganic arsenic is a chronic exposure carcinogen. Analysis of UK baby rice revealed a median inorganic arsenic content (n = 17) of 0.11 mg/kg. By plotting inorganic arsenic against total arsenic, it was found that inorganic concentrations increased linearly up to 0.25 mg/kg total arsenic, then plateaued at 0.16 mg/kg at higher total arsenic concentrations. Inorganic arsenic intake by babies (4-12 months) was considered with respect to current dietary ingestion regulations. It was found that 35% of the baby rice samples analysed would be illegal for sale in China which has regulatory limit of 0.15 mg/kg inorganic arsenic. EU and US food regulations on arsenic are non-existent. When baby inorganic arsenic intake from rice was considered, median consumption (expressed as μg/kg/d) was higher than drinking water maximum exposures predicted for adults in these regions when water intake was expressed on a bodyweight basis. - Median consumption of organic arsenic levels for UK babies from baby rice is above threshold considered safe

  11. Inorganic nanolayers: structure, preparation, and biomedical applications

    Directory of Open Access Journals (Sweden)

    Saifullah B

    2015-09-01

    Full Text Available Bullo Saifullah, Mohd Zobir B HusseinMaterials Synthesis and Characterization Laboratory, Institute of Advanced Technology (ITMA, Universiti Putra Malaysia, Serdang, MalaysiaAbstract: Hydrotalcite-like compounds are two-dimensional inorganic nanolayers also known as clay minerals or anionic clays or layered double hydroxides/layered hydroxy salts, and have emerged as a single type of material with numerous biomedical applications, such as drug delivery, gene delivery, cosmetics, and biosensing. Inorganic nanolayers are promising materials due to their fascinating properties, such as ease of preparation, ability to intercalate different type of anions (inorganic, organic, biomolecules, and even genes, high thermal stability, delivery of intercalated anions in a sustained manner, high biocompatibility, and easy biodegradation. Inorganic nanolayers have been the focus for researchers over the last decade, resulting in widening application horizons, especially in the field of biomedical science. These nanolayers have been widely applied in drug and gene delivery. They have also been applied in biosensing technology, and most recently in bioimaging science. The suitability of inorganic nanolayers for application in drug delivery, gene delivery, biosensing technology, and bioimaging science makes them ideal materials to be applied for theranostic purposes. In this paper, we review the structure, methods of preparation, and latest advances made by inorganic nanolayers in such biomedical applications as drug delivery, gene delivery, biosensing, and bioimaging.Keywords: inorganic nanolayers, layered double hydroxides, layered hydroxy salts, drug delivery, biosensors, bioimaging

  12. Hybrid organic-inorganic rotaxanes and molecular shuttles.

    Science.gov (United States)

    Lee, Chin-Fa; Leigh, David A; Pritchard, Robin G; Schultz, David; Teat, Simon J; Timco, Grigore A; Winpenny, Richard E P

    2009-03-19

    The tetravalency of carbon and its ability to form covalent bonds with itself and other elements enables large organic molecules with complex structures, functions and dynamics to be constructed. The varied electronic configurations and bonding patterns of inorganic elements, on the other hand, can impart diverse electronic, magnetic, catalytic and other useful properties to molecular-level structures. Some hybrid organic-inorganic materials that combine features of both chemistries have been developed, most notably metal-organic frameworks, dense and extended organic-inorganic frameworks and coordination polymers. Metal ions have also been incorporated into molecules that contain interlocked subunits, such as rotaxanes and catenanes, and structures in which many inorganic clusters encircle polymer chains have been described. Here we report the synthesis of a series of discrete rotaxane molecules in which inorganic and organic structural units are linked together mechanically at the molecular level. Structural units (dialkyammonium groups) in dumb-bell-shaped organic molecules template the assembly of essentially inorganic 'rings' about 'axles' to form rotaxanes consisting of various numbers of rings and axles. One of the rotaxanes behaves as a 'molecular shuttle': the ring moves between two binding sites on the axle in a large-amplitude motion typical of some synthetic molecular machine systems. The architecture of the rotaxanes ensures that the electronic, magnetic and paramagnetic characteristics of the inorganic rings-properties that could make them suitable as qubits for quantum computers-can influence, and potentially be influenced by, the organic portion of the molecule.

  13. Anticorrosive organic/inorganic hybrid coatings

    Science.gov (United States)

    Gao, Tongzhai

    Organic/inorganic hybrid coating system was developed for anticorrosion applications using polyurea, polyurethane or epoxide as the organic phase and polysiloxane, formed by sol-gel process, as the inorganic phase. Polyurea/polysiloxane hybrid coatings were formulated and moisture cured using HDI isocyanurate, alkoxysilane-functionalized HDI isocyanurate, and tetraethyl orthosilicate (TEOS) oligomers. Two urethanes were prepared using the same components as abovementioned in addition to the oligoesters derived from either cyclohexane diacids (CHDA) and 2-butyl-2-ethyl-1,3-propanediol (BEPD) or adipic acid (AA), isophthalic acid (IPA), 1,6-hexanediol (HD), and trimethylol propane (TMP). Accelerated weathering and outdoor exposure were performed to study the weatherability of the polyurethane/polysiloxane hybrid coating system. FTIR and solid-state 13C NMR revealed that the degradation of the hybrid coatings occurred at the urethane and ester functionalities of the organic phase. DMA and DSC analyses showed the glass transition temperature increased and broadened after weathering. SEM was employed to observe the change of morphology of the hybrid coatings and correlated with the gloss variation after weathering. Rutile TiO2 was formulated into polyurethane/polysiloxane hybrid coatings in order to investigate the effect of pigmentation on the coating properties and the sol-gel precursor. Chemical interaction between the TiO2 and the sol-gel precursor was investigated using solid-state 29Si NMR and XPS. The morphology, mechanical, viscoelastic, thermal properties of the pigmented coatings were evaluated as a function of pigmentation volume concentration (PVC). Using AFM and SEM, the pigment were observed to be well dispersed in the polymer matrix. The thermal stability, the tensile modulus and strength of the coatings were enhanced with increasing PVC, whereas the pull-off adhesion and flexibility were reduced with increasing PVC. Finally, the pigmented coatings were

  14. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  15. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  16. Mechanics and thermal management of stretchable inorganic electronics.

    Science.gov (United States)

    Song, Jizhou; Feng, Xue; Huang, Yonggang

    2016-03-01

    Stretchable electronics enables lots of novel applications ranging from wearable electronics, curvilinear electronics to bio-integrated therapeutic devices that are not possible through conventional electronics that is rigid and flat in nature. One effective strategy to realize stretchable electronics exploits the design of inorganic semiconductor material in a stretchable format on an elastomeric substrate. In this review, we summarize the advances in mechanics and thermal management of stretchable electronics based on inorganic semiconductor materials. The mechanics and thermal models are very helpful in understanding the underlying physics associated with these systems, and they also provide design guidelines for the development of stretchable inorganic electronics.

  17. Mechanics and thermal management of stretchable inorganic electronics

    Science.gov (United States)

    Song, Jizhou; Feng, Xue; Huang, Yonggang

    2016-01-01

    Stretchable electronics enables lots of novel applications ranging from wearable electronics, curvilinear electronics to bio-integrated therapeutic devices that are not possible through conventional electronics that is rigid and flat in nature. One effective strategy to realize stretchable electronics exploits the design of inorganic semiconductor material in a stretchable format on an elastomeric substrate. In this review, we summarize the advances in mechanics and thermal management of stretchable electronics based on inorganic semiconductor materials. The mechanics and thermal models are very helpful in understanding the underlying physics associated with these systems, and they also provide design guidelines for the development of stretchable inorganic electronics. PMID:27547485

  18. Sol-gel processing with inorganic metal salt precursors

    Science.gov (United States)

    Hu, Zhong-Cheng

    2004-10-19

    Methods for sol-gel processing that generally involve mixing together an inorganic metal salt, water, and a water miscible alcohol or other organic solvent, at room temperature with a macromolecular dispersant material, such as hydroxypropyl cellulose (HPC) added. The resulting homogenous solution is incubated at a desired temperature and time to result in a desired product. The methods enable production of high quality sols and gels at lower temperatures than standard methods. The methods enable production of nanosize sols from inorganic metal salts. The methods offer sol-gel processing from inorganic metal salts.

  19. Inorganic and organic radiation chemistry: state and problems

    International Nuclear Information System (INIS)

    Kalyazin, E.P.; Bugaenko, L.T.

    1990-01-01

    Radiation inorganic and organic chemistry is presented on the basis of the general scheme and classification of radiolysis products and elementary processes, by which evolution of radiation-affected substances up to the final radiolysis products takes place. The evolution is traced for the representatives of inorganic and organic compounds. The contribution of radiation inorganic and organic chemistry to radiation technology, radiation materials technology, radiation ecology and medicine, is shown. Tendencies in the development of radiation chemistry and prediction of its certain directions are considered

  20. Simulation of perovskite solar cells with inorganic hole transporting materials

    DEFF Research Database (Denmark)

    Wang, Yan; Xia, Zhonggao; Liu, Yiming

    2015-01-01

    Device modeling organolead halide perovskite solar cells with planar architecture based on inorganic hole transporting materials (HTMs) were performed. A thorough understanding of the role of the inorganic HTMs and the effect of band offset between HTM/absorber layers is indispensable for further...... improvement in power conversion efficiency (PCE). Here, we investigated the effect of band offset between inorganic HTM/absorber layers. The solar cell simulation program adopted in this work is named wxAMPS, an updated version of the AMPS tool (Analysis of Microelectronic and Photonic Structure)....

  1. Survey meter using novel inorganic scintillators

    International Nuclear Information System (INIS)

    Yoshikawa, Akira; Fukuda, Kentaro; Kawaguchi, Noriaki; Kamada, Kei; Fujimoto, Yutaka; Yokota, Yuui; Kurosawa, Shunsuke; Yanagida, Takayuki

    2012-01-01

    Single crystal scintillator materials are widely used for detection of high-energy photons and particles. There is continuous demand for new scintillator materials with higher performance because of increasing number of medical, industrial, security and other applications. This article presents the recent development of three novel inorganic scintillators; Pr-doped Lu 3 Al 5 O 12 (Pr:LuAG), Ce doped Gd 3 (Al, Ga) 5 O 12 (Ce:GAGG) and Ce or Eu-doped 6 LiCaAlF 6 (Ce:LiCAF, Eu:LiCAF). Pr:LuAG shows very interesting scintillation properties including very fast decay time, high light yield and excellent energy resolution. Taking the advantage of these properties, positron emission mammography (PEM) equipped with Pr:LuAG were developed. Ce:GAGG shows very high light yield, which is much higher than that of Ce:LYSO. Survey meter using Ce:GAGG is developed using this scintillator. Ce:LiCAF and Eu:LiCAF were developed for neutron detection. The advantage and disadvantage are discussed comparing with halide scintillators. Eu-doped LiCAF indicated five times higher light yield than that of existing Li-glass. It is expected to be used as the alternative of 3 He. (author)

  2. Inorganic ion exchangers for nuclear waste remediation

    Energy Technology Data Exchange (ETDEWEB)

    Clearfield, A.; Bortun, A.; Bortun, L.; Behrens, E. [Texas A& M Univ., College Station, TX (United States)

    1997-10-01

    The objective of this work is to provide a broad spectrum of inorganic ion exchangers that can be used for a range of applications and separations involving remediation of groundwater and tank wastes. The authors intend to scale-up the most promising exchangers, through partnership with AlliedSignal Inc., to provide samples for testing at various DOE sites. While much of the focus is on exchangers for removal of Cs{sup +} and Sr{sup 2+} from highly alkaline tank wastes, especially at Hanford, the authors have also synthesized exchangers for acid wastes, alkaline wastes, groundwater, and mercury, cobalt, and chromium removal. These exchangers are now available for use at DOE sites. Many of the ion exchangers described here are new, and others are improved versions of previously known exchangers. They are generally one of three types: (1) layered compounds, (2) framework or tunnel compounds, and (3) amorphous exchangers in which a gel exchanger is used to bind a fine powder into a bead for column use. Most of these exchangers can be regenerated and used again.

  3. Protonation of inorganic 5-Fluorocytosine salts

    Science.gov (United States)

    Souza, Matheus S.; da Silva, Cecília C. P.; Almeida, Leonardo R.; Diniz, Luan F.; Andrade, Marcelo B.; Ellena, Javier

    2018-06-01

    5-Fluorocytosine (5-FC) has been widely used for the treatment of fungal infections and recently was found to exert an extraordinary antineoplastic activity in gene directed prodrug therapy. However, despite of its intense use, 5-FC exhibits tabletability issues due its physical instability in humid environments, leading to transition from the anhydrous to monohydrate phase. By considering that salt formation is an interesting strategy to overcome this problem, in this paper crystal engineering approach was applied to the supramolecular synthesis of new 5-FC salts with sulfuric, hydrobromic and methanesulfonic inorganic acids. A total of four structures were obtained, namely 5-FC sulfate monohydrate (1:1:1), 5-FC hydrogen sulfate (1:1), 5-FC mesylate (1:1) and 5-FC hydrobromide (1:1), the last one being a polymorphic form of a structure already reported in the literature. These novel salts were structurally characterized by single crystal X-ray diffraction and its supramolecular organization were analyses by Hirshfeld surface analysis. The vibrational behavior was evaluated by Raman spectroscopy and it was found to be consistent with the crystal structures.

  4. Solid-state NMR of inorganic semiconductors.

    Science.gov (United States)

    Yesinowski, James P

    2012-01-01

    Studies of inorganic semiconductors by solid-state NMR vary widely in terms of the nature of the samples investigated, the techniques employed to observe the NMR signal, and the types of information obtained. Compared with the NMR of diamagnetic non-semiconducting substances, important differences often result from the presence of electron or hole carriers that are the hallmark of semiconductors, and whose theoretical interpretation can be involved. This review aims to provide a broad perspective on the topic for the non-expert by providing: (1) a basic introduction to semiconductor physical concepts relevant to NMR, including common crystal structures and the various methods of making samples; (2) discussions of the NMR spin Hamiltonian, details of some of the NMR techniques and strategies used to make measurements and theoretically predict NMR parameters, and examples of how each of the terms in the Hamiltonian has provided useful information in bulk semiconductors; (3) a discussion of the additional considerations needed to interpret the NMR of nanoscale semiconductors, with selected examples. The area of semiconductor NMR is being revitalized by this interest in nanoscale semiconductors, the great improvements in NMR detection sensitivity and resolution that have occurred, and the current interest in optical pumping and spintronics-related studies. Promising directions for future research will be noted throughout.

  5. Inorganic polymers and materials. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Sneddon, Larry G.

    2001-01-01

    This DOE-sponsored project was focused on the design, synthesis, characterization, and applications of new types of boron and silicon polymers with a goal of attaining processable precursors to advanced ceramic materials of technological importance. This work demonstrated a viable design strategy for the systematic formation of polymeric precursors to ceramics based on the controlled functionalization of preformed polymers with pendant groups of suitable compositions and crosslinking properties. Both the new dipentylamine-polyborazylene and pinacolborane-hydridopolysilazane polymers, unlike the parent polyborazylene and other polyborosilazanes, are stable as melts and can be easily spun into polymer fibers. Subsequent pyrolyses of these polymer fibers then provide excellent routes to BN and SiNCB ceramic fibers. The ease of synthesis of both polymer systems suggests new hybrid polymers with a range of substituents appended to polyborazylene or polysilazane backbones, as well as other types of preceramic polymers, should now be readily achieved, thereby allowing even greater control over polymer and ceramic properties. This control should now enable the systematic tailoring of the polymers and derived ceramics for use in different technological applications. Other major recent achievements include the development of new types of metal-catalyzed methods needed for the polymerization and modification of inorganic monomers and polymers, and the modification studies of polyvinylsiloxane and related polymers with substituents that enable the formation of single source precursors to high-strength, sintered SiC ceramics.

  6. Interfacial Coatings for Inorganic Composite Insulation Systems

    International Nuclear Information System (INIS)

    Hooker, M. W.; Fabian, P. E.; Stewart, M. W.; Grandlienard, S. D.; Kano, K. S.

    2006-01-01

    Inorganic (ceramic) insulation materials are known to have good radiation resistance and desirable electrical and mechanical properties at cryogenic and elevated temperatures. In addition, ceramic materials can withstand the high-temperature reaction cycle used with Nb3Sn superconductor materials, allowing the insulation to be co-processed with the superconductor in a wind-and-react fabrication process. A critical aspect in the manufacture of ceramic-based insulation systems is the deposition of suitable fiber-coating materials that prevent chemical reaction of the fiber and matrix materials, and thus provide a compliant interface between the fiber and matrix, which minimizes the impact of brittle failure of the ceramic matrix. Ceramic insulation produced with CTD-FI-202 fiber interfaces have been found to exhibit very high shear and compressive strengths. However, this material is costly to produce. Thus, the goal of the present work is to evaluate alternative, lower-cost materials and processes. A variety of oxide and polyimide coatings were evaluated, and one commercially available polyimide coating has been shown to provide some improvement as compared to uncoated and de-sized S2 glass

  7. Applications of inorganic Ion-conductor

    Energy Technology Data Exchange (ETDEWEB)

    Fujiki, Yoshinori [Science and Technology Agency, Tokyo (Japan)

    1989-03-01

    Physical properties and application of solid electrolyte, particularly of inorganic solid electrolyte, are described. Ion conductors have been widely used not only for electric power application but also for sensors, gas separators, display elements, Coulomb meters, storage elements, etc. The most extensively used pacemakers now employ Li/I{sub 2}(PVP) primary batteries. Thin film lithium secondary battery has a feature of providing comparatively large electric current, with 2.5 V charging, 1.8 V discharging, and 3 mA.cm{sup {minus}2} short circuit current. The capacity of about 4 mAh per 1 cm{sup 2} electrode has been achieved. The most widely used solid electrolyte for the oxygen sensor is the stabilized ZrO{sub 2}. The relation of air/fuel mix proportion with the change in electromotive force is shown. Although solid electrolyte fuel cell is not yet put to practical use, a result of an experiment is introduced. Brief explanations are made on the oxygen pump, electrochromic display elements, Coulomb meter and voltage storage element. 18 refs., 11 figs., 6 tabs.

  8. Nanoscale Organic−Inorganic Hybrid Lubricants

    KAUST Repository

    Kim, Daniel

    2011-03-15

    Silica (SiO2) nanoparticles densely grafted with amphiphilic organic chains are used to create a family of organic-inorganic hybrid lubricants. Short sulfonate-functionalized alkylaryl chains covalently tethered to the particles form a dense corona brush that stabilizes them against aggregation. When these hybrid particles are dispersed in poly-α-olefin (PAO) oligomers, they form homogeneous nanocomposite fluids at both low and high particle loadings. By varying the volume fraction of the SiO2 nanostructures in the PAO nanocomposites, we show that exceptionally stable hybrid lubricants can be created and that their mechanical properties can be tuned to span the spectrum from simple liquids to complex gels. We further show that these hybrid lubricants simultaneously exhibit lower interfacial friction coefficients, enhanced wear and mechanical properties, and superior thermal stability in comparison with either PAO or its nanocomposites created at low nanoparticle loadings. Profilometry and energy dispersive X-ray spectroscopic analysis of the wear track show that the enhanced wear characteristics in PAO-SiO2 composite lubricants originate from two sources: localization of the SiO2 particles into the wear track and extension of the elastohydrodynamic lubrication regime to Sommerfeld numbers more than an order of magnitude larger than for PAO. © 2011 American Chemical Society.

  9. Efficiency and yield spectra of inorganic scintillates

    International Nuclear Information System (INIS)

    Rodnyi, P.A.

    1998-01-01

    Recent developments in the field of energy loss in inorganic scintillators are reviewed. The main parameters, which control the fundamental limit of the scintillator energy efficiency, are determined. It is shown that together with simple cascade processes one should take into account the production of plasmons to estimate the energy efficiency of scintillators or other phosphors excited by an ionizing radiation. Core-to-valence luminescence related to 5pCs→3pCl transitions is investigated in some chlorides: CsCl, KCl, RbCl, NaCl, KCaCl 3 , RbCaCl 3 . The yield spectra of the crystals in the VUV and X-ray regions are also studied. It is shown that the 4pRb-core states are involved in the process of creation of holes in the 5pCs-core band in Rb-based crystals. The formation of holes in the potassium core band acts as a competing process and suppresses the radiative core-to-valence transitions

  10. A hybrid organic-inorganic perovskite dataset

    Science.gov (United States)

    Kim, Chiho; Huan, Tran Doan; Krishnan, Sridevi; Ramprasad, Rampi

    2017-05-01

    Hybrid organic-inorganic perovskites (HOIPs) have been attracting a great deal of attention due to their versatility of electronic properties and fabrication methods. We prepare a dataset of 1,346 HOIPs, which features 16 organic cations, 3 group-IV cations and 4 halide anions. Using a combination of an atomic structure search method and density functional theory calculations, the optimized structures, the bandgap, the dielectric constant, and the relative energies of the HOIPs are uniformly prepared and validated by comparing with relevant experimental and/or theoretical data. We make the dataset available at Dryad Digital Repository, NoMaD Repository, and Khazana Repository (http://khazana.uconn.edu/), hoping that it could be useful for future data-mining efforts that can explore possible structure-property relationships and phenomenological models. Progressive extension of the dataset is expected as new organic cations become appropriate within the HOIP framework, and as additional properties are calculated for the new compounds found.

  11. Hybrid Organic-Inorganic Perovskite Photodetectors.

    Science.gov (United States)

    Tian, Wei; Zhou, Huanping; Li, Liang

    2017-11-01

    Hybrid organic-inorganic perovskite materials garner enormous attention for a wide range of optoelectronic devices. Due to their attractive optical and electrical properties including high optical absorption coefficient, high carrier mobility, and long carrier diffusion length, perovskites have opened up a great opportunity for high performance photodetectors. This review aims to give a comprehensive summary of the significant results on perovskite-based photodetectors, focusing on the relationship among the perovskite structures, device configurations, and photodetecting performances. An introduction of recent progress in various perovskite structure-based photodetectors is provided. The emphasis is placed on the correlation between the perovskite structure and the device performance. Next, recent developments of bandgap-tunable perovskite and hybrid photodetectors built from perovskite heterostructures are highlighted. Then, effective approaches to enhance the stability of perovskite photodetector are presented, followed by the introduction of flexible and self-powered perovskite photodetectors. Finally, a summary of the previous results is given, and the major challenges that need to be addressed in the future are outlined. A comprehensive summary of the research status on perovskite photodetectors is hoped to push forward the development of this field. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  13. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  14. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  15. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  16. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  17. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  18. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  19. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  20. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  1. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  2. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  3. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  4. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  5. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  6. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  7. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  8. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  9. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  11. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  12. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  13. Chicken fat and inorganic nitrogen source for lipase production by ...

    African Journals Online (AJOL)

    MA41) from Atlantic Forest, using chicken fat and association of organic and inorganic nitrogen sources in submerged fermentation to seek economically attractive bioprocess. A 2-level, 4-factor Central Composite Design (CCD) and response ...

  14. Sol-gel Synthesis of a Biotemplated Inorganic Photocatalyst

    DEFF Research Database (Denmark)

    Boffa, Vittorio; Yue, Yuanzheng; He, Wen

    2012-01-01

    chemistry and photocatalysis, provides an opportunity to teach valuable laboratory skills and to introduce students to the synthesis, isolation, and characterization of inorganic materials. This laboratory activity is adaptable to a range of educational levels and to various instrumental techniques....

  15. Effects of organic and inorganic amendments on soil erodibility

    Directory of Open Access Journals (Sweden)

    Nutullah Özdemir

    2015-10-01

    Full Text Available The objective of the present investigation is to find out the effect of incorporating of various organic and inorganic matter sources such as lime (L, zeolit (Z, polyacrylamide (PAM and biosolid (BS on the instability index. A bulk surface (0–20 cm depth soil sample was taken from Samsun, in northern part of Turkey. Some soil properties were determined as follows; fine in texture, modarete in organic matter content, low in pH and free of alkaline problem. The soil samples were treated with the inorganic and organic materials at four different levels including the control treatments in a randomized factorial block design. The soil samples were incubated for ten weeks. After the incubation period, corn was grown in all pots. The results can be summarized as organic and inorganic matter treatments increased structure stability and decreased soil erodibility. Effectiveness of the treatments varied depending on the types and levels of organic and inorganic materials.

  16. Major inorganic elements in tap water samples in Peninsular Malaysia.

    Science.gov (United States)

    Azrina, A; Khoo, H E; Idris, M A; Amin, I; Razman, M R

    2011-08-01

    Quality drinking water should be free from harmful levels of impurities such as heavy metals and other inorganic elements. Samples of tap water collected from 24 locations in Peninsular Malaysia were determined for inorganic element content. Minerals and heavy metals were analysed by spectroscopy methods, while non-metal elements were analysed using test kits. Minerals and heavy metals determined were sodium, magnesium, potassium, calcium, chromium, manganese, iron, nickel, copper, zinc, arsenic, cadmium and lead while the non-metal elements were fluoride, chloride, nitrate and sulphate. Most of the inorganic elements found in the samples were below the maximum permitted levels recommended by inter-national drinking water standard limits, except for iron and manganese. Iron concentration of tap water from one of the locations was higher than the standard limit. In general, tap water from different parts of Peninsular Malaysia had low concentrations of heavy metals and inorganic elements.

  17. A review of the inorganic and organometallic chemistry of zirconium

    International Nuclear Information System (INIS)

    Kalvins, A.K.

    1985-01-01

    The results of a literature review of the inorganic and organometallic chemistry of zirconium are presented. Compounds with physical and chemical properties compatible with the requirements of an ir laser zirconium isotope separation process have been identified

  18. Surface Chemistry and Spectroscopy of Chromium in Inorganic Oxides

    NARCIS (Netherlands)

    Weckhuysen, B.M.; Wachs, I.E.; Schoonheydt, R.A.

    1996-01-01

    Focuses on the surface chemistry and spectroscopy of chromium in inorganic oxides. Characterization of the molecular structures of chromium; Mechanics of hydrogenation-dehydrogenation reactions; Mobility and reactivity on oxidic surfaces.

  19. Metal oxalate complexes as novel inorganic dopants: Studies on ...

    Indian Academy of Sciences (India)

    Unknown

    UV-visible and IR spectral features not only confirmed the polyaniline doping by complex anions but also substantiated ... MoS3 dopant. Although inorganic metal complexes bear- ... distilled water and then with methanol and acetone until.

  20. Determination of Carboxylic Acids and Water-soluble Inorganic Ions ...

    African Journals Online (AJOL)

    NICO

    radiation balance.4,5 Major water-soluble inorganic ions are associated with atmospheric ... molecular weight carboxylic acids in aerosol samples collected from a rural ... include biomass burning, agriculture, livestock and soil dust. Tropical ...

  1. Inorganic Nanostructured High-Temperature Magnet Wires, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This project will develop a high-temperature tolerant electrically-insulating coating for magnet wires. The Phase I program will result in a flexible, inorganic...

  2. Inorganic-organic hybrid polymers for food packaging

    CSIR Research Space (South Africa)

    Kesavan Pillai, Sreejarani

    2015-09-01

    Full Text Available packaging application. Numerous hybrid inorganic-organic materials have been developed using low temperature sol-gel chemistry, which enables the tailoring of the nanostructure and the resulting material is often multifunctional, offering a wide range...

  3. Annual reports in inorganic and general syntheses 1974

    CERN Document Server

    Niedenzu, Kurt

    1975-01-01

    Annual Reports in Inorganic and General Syntheses-1974 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses the chemistry of simple and complex metal hydrides of main groups I, II, and III, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, lead, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens, and pseudohalogens. The text also describes the chemistry of scandium, yttrium, lanthanides, actinides, titanium, zirconium, hafnium, vanadium, niobium, tantalum, chromium, molybdenum, tungsten, ma

  4. A comparison of organic and inorganic nitrates/nitrites.

    Science.gov (United States)

    Omar, Sami A; Artime, Esther; Webb, Andrew J

    2012-05-15

    Although both organic and inorganic nitrates/nitrites mediate their principal effects via nitric oxide, there are many important differences. Inorganic nitrate and nitrite have simple ionic structures and are produced endogenously and are present in the diet, whereas their organic counterparts are far more complex, and, with the exception of ethyl nitrite, are all medicinally synthesised products. These chemical differences underlie the differences in pharmacokinetic properties allowing for different modalities of administration, particularly of organic nitrates, due to the differences in their bioavailability and metabolic profiles. Whilst the enterosalivary circulation is a key pathway for orally ingested inorganic nitrate, preventing an abrupt effect or toxic levels of nitrite and prolonging the effects, this is not used by organic nitrates. The pharmacodynamic differences are even greater; while organic nitrates have potent acute effects causing vasodilation, inorganic nitrite's effects are more subtle and dependent on certain conditions. However, in chronic use, organic nitrates are considerably limited by the development of tolerance and endothelial dysfunction, whereas inorganic nitrate/nitrite may compensate for diminished endothelial function, and tolerance has not been reported. Also, while inorganic nitrate/nitrite has important cytoprotective effects against ischaemia-reperfusion injury, continuous use of organic nitrates may increase injury. While there are concerns that inorganic nitrate/nitrite may induce carcinogenesis, direct evidence of this in humans is lacking. While organic nitrates may continue to dominate the therapeutic arena, this may well change with the increasing recognition of their limitations, and ongoing discovery of beneficial effects and specific advantages of inorganic nitrate/nitrite. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Annual reports in inorganic and general syntheses 1973

    CERN Document Server

    Niedenzu, Kurt

    1974-01-01

    Annual Reports in Inorganic and General Syntheses-1973 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book covers the synthetic aspects and structural or mechanistic features of elements, including the main group hydrides, alkali and alkaline earth elements, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, and lead, nitrogen, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens and pseudohalogens, and noble gases. The text also discusses the synthetic aspects and structural or mechanistic features of

  6. Casting fine grained, fully dense, strong inorganic materials

    Science.gov (United States)

    Brown, Sam W.; Spencer, Larry S.; Phillips, Michael R.

    2015-11-24

    Methods and apparatuses for casting inorganic materials are provided. The inorganic materials include metals, metal alloys, metal hydrides and other materials. Thermal control zones may be established to control the propagation of a freeze front through the casting. Agitation from a mechanical blade or ultrasonic energy may be used to reduce porosity and shrinkage in the casting. After solidification of the casting, the casting apparatus may be used to anneal the cast part.

  7. Biomarkers of Exposure: A Case Study with Inorganic Arsenic

    OpenAIRE

    Hughes, Michael F.

    2006-01-01

    The environmental contaminant inorganic arsenic (iAs) is a human toxicant and carcinogen. Most mammals metabolize iAs by reducing it to trivalency, followed by oxidative methylation to pentavalency. iAs and its methylated metabolites are primarily excreted in urine within 4–5 days by most species and have a relatively low rate of bioaccumulation. Intra- and interindividual differences in the methylation of iAs may affect the adverse health effects of arsenic. Both inorganic and organic trival...

  8. Controlled Interactions between Two Dimensional Layered Inorganic Nanosheets and Polymers

    Science.gov (United States)

    2016-06-15

    AFRL-AFOSR-JP-TR-2016-0071 Controlled Interactions between Two Dimensional Layered Inorganic Nanosheets and Polymers Cheolmin Park YONSEI UNIVERSITY...Interactions between Two Dimensional Layered Inorganic Nanosheets and Polymers 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA2386-14-1-4054 5c.  PROGRAM ELEMENT...prospects for a variety of emerging applications in a broad range of fields, such as electronics, energy conversion and storage, catalysis and polymer

  9. Annual reports in inorganic and general syntheses 1972

    CERN Document Server

    Niedenzu, Kurt

    1973-01-01

    Annual Reports in Inorganic and General Syntheses-1972 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses alkali and alkaline earth elements, alloys, silver, gold, zinc, cadmium, mercury, boron, aluminum, gallium, indium, thallium, yttrium, scandium, lanthanides, actinides, titanium, zirconium, hafnium, Group V and VI transition elements, manganese, technetium, rhenium, iron, cobalt, nickel, ruthenium, osmium, rhodium, and iridium. The text also describes the chemistry of palladium, platinum, silicon, germanium, tin,

  10. Durability of an inorganic polymer concrete coating

    Science.gov (United States)

    Wasserman, Kenneth

    The objective of the research program reported in this thesis is to evaluate the durability of an inorganic polymer composite coating exposed to freeze/thaw cycling and wet-dry cycling. Freeze/thaw cycling is performed following ASTM D6944-09 Standard Practice for Resistance of Cured Coatings to Thermal Cycling and wet/dry cycling is performed following guidelines set forth in a thesis written by Ronald Garon at Rutgers University. For both sets of experiments, four coating mixture proportions were evaluated. The variables were: silica/alumina ratio, mixing protocol using high shear and normal shear mixing, curing temperatures of 70 and 120 degrees Fahrenheit and use of nano size constituent materials. The mix with highest silica/alumina ratio was designated as Mix 1 and mixes with lower ratios were designated as Mix 2 and Mix 3. Mix 4 had nano silica particles. Four prisms were used for each variable including control that had no coating. The performance of the coating was evaluated using adhesion strength measured using: ASTM D7234 Test Method for Pull-Off Strength of Coatings on Concrete Using Portable Adhesion Testers. Tests were performed after every five consecutive cycles of thermal conditioning and six consecutive cycles of wet-dry exposure. Results from the thermal cycling and wet-dry testing demonstrate that all coating formulations are durable. The minimum adhesion strength was 300 psi even though a relatively weak base concrete surface was chosen for the study. The weak surface was chosen to simulate aged concrete surfaces present in actual field conditions. Due to the inherent nature of the test procedure the variation in test results is high. However, based on the test results, high shear mixer and high temperature curing are not recommended. As expected nano size constituent materials provide better performance.

  11. Synthesis of polymer/inorganic nanocomposite films using highly porous inorganic scaffolds.

    Science.gov (United States)

    Zhang, Huanjun; Popp, Matthias; Hartwig, Andreas; Mädler, Lutz

    2012-04-07

    Polymeric/inorganic nanocomposite films have been fabricated through a combination of flame-spray-pyrolysis (FSP) made inorganic scaffold and surface initiated polymerization of cyanoacrylate. The highly porous structure of pristine SnO(2) films allows the uptake of cyanoacrylate and the polymerization is surface initiated by the water adsorbed onto the SnO(2) surface. Scanning electron microscopy study reveals a nonlinear increase in the composite particle size and the film thickness with polymerization time. The structural change is rather homogeneous throughout the whole layer. The composite is formed mainly by an increase of the particle size and not by just filling the existing pores. High-resolution transmission electron microscopy imaging shows SnO(2) nanoparticles embedded in the polymeric matrix, constituting the nanocomposite material. Thermogravimetric analysis indicates that the porosity of the nanocomposite films decreases from 98% to 75%, resulting in a significant enhancement of the hardness of the films. DC conductivity measurements conducted in situ on the nanocomposite layer suggest a gradual increase in the layer resistance, pointing to a loss of connectivity between the SnO(2) primary particles as the polymerization proceeds. This journal is © The Royal Society of Chemistry 2012

  12. Holographic patterning of organic-inorganic photopolymerizable nanocomposites

    Science.gov (United States)

    Sakhno, Oksana V.; Goldenberg, Leonid M.; Smirnova, Tatiana N.; Stumpe, J.

    2009-09-01

    We present here novel easily processible organic-inorganic nanocomposites suitable for holographic fabrication of diffraction optical elements (DOE). The nanocomposites are based on photocurable acrylate monomers and inorganic nanoparticles (NP). The compatibility of inorganic NP with monomers was achieved by capping the NP surface with proper organic shells. Surface modification allows to introduce up to 50wt.% of inorganic NP in organic media. Depending on the NP nature (metal oxides, phosphates, semiconductors, noble metals) and their properties, the materials for both efficient DOE and multifunctional elements can be designed. Organic-inorganic composites prepared have been successfully used for the effective inscription of periodic volume refractive index structures using the holographic photopolymerization method. The nanocomposite preparation procedure, their properties and optical performance of holographic gratings are reported. The use of functional NP makes it possible to obtain effective holographic gratings having additional physical properties such as light-emission or NLO. Some examples of such functional polymer-NP structures and their possible application fields are presented. The combination of easy photo-patterning of soft organic compounds with physical properties of inorganic materials in new nanocomposites and the flexibility of the holographic patterning method allow the fabrication of mono- and multifunctional one- and multi-dimensional passive or active optical and photonic elements.

  13. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  14. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  15. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  16. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  17. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  18. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  19. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  20. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  1. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  2. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  3. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  4. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  5. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  7. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  8. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  9. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  10. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  11. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  12. Computer-Assisted Inverse Design of Inorganic Electrides

    Directory of Open Access Journals (Sweden)

    Yunwei Zhang

    2017-02-01

    Full Text Available Electrides are intrinsic electron-rich materials enabling applications as excellent electron emitters, superior catalysts, and strong reducing agents. There are a number of organic electrides; however, their instability at room temperature and sensitivity to moisture are bottlenecks for their practical uses. Known inorganic electrides are rare, but they appear to have greater thermal stability at ambient conditions and are thus better characterized for application. Here, we develop a computer-assisted inverse-design method for searching for a large variety of inorganic electrides unbiased by any known electride structures. It uses the intrinsic property of interstitial electron localization of electrides as the global variable function for swarm intelligence structure searches. We construct two rules of thumb on the design of inorganic electrides pointing to electron-rich ionic systems and low electronegativity of the cationic elements involved. By screening 99 such binary compounds through large-scale computer simulations, we identify 24 stable and 65 metastable new inorganic electrides that show distinct three-, two-, and zero-dimensional conductive properties, among which 18 are existing compounds that have not been pointed to as electrides. Our work reveals the rich abundance of inorganic electrides by providing 33 hitherto unexpected structure prototypes of electrides, of which 19 are not in the known structure databases.

  13. Evaluation of inorganic sorbent treatment for LWR coolant process streams

    International Nuclear Information System (INIS)

    Roddy, J.W.

    1984-03-01

    This report presents results of a survey of the literature and of experience at selected nuclear installations to provide information on the feasibility of replacing organic ion exchangers with inorganic sorbents at light-water-cooled nuclear power plants. Radioactive contents of the various streams in boiling water reactors and pressurized water reactors were examined. In addition, the methods and performances of current methods used for controlling water quality at these plants were evaluated. The study also includes a brief review of the physical and chemical properties of selected inorganic sorbents. Some attributes of inorganic sorbents would be useful in processing light water reactor (LWR) streams. The inorganic resins are highly resistant to damage from ionizing radiation, and their exchange capacities are generally equivalent to those of organic ion exchangers. However, they are more limited in application, and there are problems with physical integrity, especially in acidic solutions. Research is also needed in the areas of selectivity and anion removal before inorganic sorbents can be considered as replacements for the synthetic organic resins presently used in LWRs. 11 figures, 14 tables

  14. The role of inorganic phosphate in intact human erythrocytes

    International Nuclear Information System (INIS)

    Nishiguchi, Eiko; Umeda, Masahiro.

    1988-01-01

    The role of inorganic phosphate in intact human erythrocytes was investigated by phosphorus-31 nuclear magnetic resonance ( 31 P NMR). When erythrocytes stored for 5 weeks were incubated at 37 deg C, pH 7.4, in medium containing 2 mM adenine and 10 mM inosine, with or without 5 mM glucose, a substance of around 4 ppm, as assessed by 31 P NMR chemical shift, was detected in the mixture. However, this substance disappeared by the addition of inorganic phosphate. When erythrocytes stored for 4 weeks in acid citrate dextrose (ACD) solution were incubated with 2 mM adenine, 10 mM inosine, 5 mM glucose, 50 mM inorganic phosphate and 10 mM pyruvate at 37 deg C, pH 7.4, the 2,3-DPG level increased gradually, whereas the ATP level initially increased and then decreased. Intracellular inorganic phosphate appeared to be used for the synthesis of ATP and 2,3-DPG during the first 30 min. of the reaction. These results suggests that the inorganic phosphate accelerates glycolysis by increasing the activity of glycolytic enzymes rather than its direct involvement in synthesizing organic phosphorus compounds in stored erythrocytes. The results also suggests that the reserve energy from ATP synthesis is not sufficient for the synthesis of 2,3-DPG. (author)

  15. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  16. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  17. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  18. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  19. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  20. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  1. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  2. Heterostructures based on inorganic and organic van der Waals systems

    International Nuclear Information System (INIS)

    Lee, Gwan-Hyoung; Lee, Chul-Ho; Zande, Arend M. van der; Han, Minyong; Cui, Xu; Arefe, Ghidewon; Hone, James; Nuckolls, Colin; Heinz, Tony F.; Kim, Philip

    2014-01-01

    The two-dimensional limit of layered materials has recently been realized through the use of van der Waals (vdW) heterostructures composed of weakly interacting layers. In this paper, we describe two different classes of vdW heterostructures: inorganic vdW heterostructures prepared by co-lamination and restacking; and organic-inorganic hetero-epitaxy created by physical vapor deposition of organic molecule crystals on an inorganic vdW substrate. Both types of heterostructures exhibit atomically clean vdW interfaces. Employing such vdW heterostructures, we have demonstrated various novel devices, including graphene/hexagonal boron nitride (hBN) and MoS 2 heterostructures for memory devices; graphene/MoS 2 /WSe 2 /graphene vertical p-n junctions for photovoltaic devices, and organic crystals on hBN with graphene electrodes for high-performance transistors

  3. Organic-Inorganic Perovskites: Structural Versatility for Functional Materials Design.

    Science.gov (United States)

    Saparov, Bayrammurad; Mitzi, David B

    2016-04-13

    Although known since the late 19th century, organic-inorganic perovskites have recently received extraordinary research community attention because of their unique physical properties, which make them promising candidates for application in photovoltaic (PV) and related optoelectronic devices. This review will explore beyond the current focus on three-dimensional (3-D) lead(II) halide perovskites, to highlight the great chemical flexibility and outstanding potential of the broader class of 3-D and lower dimensional organic-based perovskite family for electronic, optical, and energy-based applications as well as fundamental research. The concept of a multifunctional organic-inorganic hybrid, in which the organic and inorganic structural components provide intentional, unique, and hopefully synergistic features to the compound, represents an important contemporary target.

  4. Transparent bulk-size nanocomposites with high inorganic loading

    International Nuclear Information System (INIS)

    Chen, Shi; Gaume, Romain

    2015-01-01

    With relatively high nanoparticle loading in polymer matrices, hybrid nanocomposites made by colloidal dispersion routes suffer from severe inhomogeneous agglomeration, a phenomenon that deteriorates light transmission even when the refractive indices of the inorganic and organic phases are closely matched. The dispersion of particles in a matrix is of paramount importance to obtain composites of high optical quality. Here, we describe an innovative, yet straightforward method to fabricate monolithic transparent hybrid nanocomposites with very high particle loading and high refractive index mismatch tolerance between the inorganic and organic constituents. We demonstrate 77% transmission at 800 nm in a 2 mm-thick acrylate polymer nanocomposite containing 61 vol. % CaF 2 nanoparticles. Modeling shows that similar performance could easily be obtained with various inorganic phases relevant to a number of photonic applications

  5. Hydrogen Bonding and Stability of Hybrid Organic-Inorganic Perovskites

    KAUST Repository

    El-Mellouhi, Fedwa

    2016-09-08

    In the past few years, the efficiency of solar cells based on hybrid organic–inorganic perovskites has exceeded the level needed for commercialization. However, existing perovskites solar cells (PSCs) suffer from several intrinsic instabilities, which prevent them from reaching industrial maturity, and stabilizing PSCs has become a critically important problem. Here we propose to stabilize PSCs chemically by strengthening the interactions between the organic cation and inorganic anion of the perovskite framework. In particular, we show that replacing the methylammonium cation with alternative protonated cations allows an increase in the stability of the perovskite by forming strong hydrogen bonds with the halide anions. This interaction also provides opportunities for tuning the electronic states near the bandgap. These mechanisms should have a universal character in different hybrid organic–inorganic framework materials that are widely used.

  6. Organic-inorganic membranes for filtration of corn distillery

    Directory of Open Access Journals (Sweden)

    Myronchuk Valeriy G.

    2016-01-01

    Full Text Available Organic-inorganic membranes were obtained by modification of polymer microfiltration membrane with inorganic ion-exchangers, which form secondary porosity inside macroporous substrate (zirconium hydrophosphate or simultaneously in the macroporous substrate and active layer, depending of the particle size (from ≈50 nm up to several microns. Precipitation of the inorganic constituent is considered from the point of view of Ostwald-Freundlich equation. Such processes as pressing test in deionized water and filtration of corn distillery at 1-6 bar were investigated. Theoretical model allowing to establish fouling mechanism, was applied. It was found that the particles both in the substrate and active layer prevent fouling of the membrane with organics and provide rejection of colloidal particles.

  7. Total and inorganic arsenic in fish samples from Norwegian waters.

    Science.gov (United States)

    Julshamn, Kaare; Nilsen, Bente M; Frantzen, Sylvia; Valdersnes, Stig; Maage, Amund; Nedreaas, Kjell; Sloth, Jens J

    2012-01-01

    The contents of total arsenic and inorganic arsenic were determined in fillet samples of Northeast Artic cod, herring, mackerel, Greenland halibut, tusk, saithe and Atlantic halibut. In total, 923 individual fish samples were analysed. The fish were mostly caught in the open sea off the coast of Norway, from 40 positions. The determination of total arsenic was carried out by inductively coupled plasma mass spectrometry following microwave-assisted wet digestion. The determination of inorganic arsenic was carried out by high-performance liquid chromatography-ICP-MS following microwave-assisted dissolution of the samples. The concentrations found for total arsenic varied greatly between fish species, and ranged from 0.3 to 110 mg kg(-1) wet weight. For inorganic arsenic, the concentrations found were very low (fish used in the recent EFSA opinion on arsenic in food.

  8. Mechanical Designs for Inorganic Stretchable Circuits in Soft Electronics.

    Science.gov (United States)

    Wang, Shuodao; Huang, Yonggang; Rogers, John A

    2015-09-01

    Mechanical concepts and designs in inorganic circuits for different levels of stretchability are reviewed in this paper, through discussions of the underlying mechanics and material theories, fabrication procedures for the constituent microscale/nanoscale devices, and experimental characterization. All of the designs reported here adopt heterogeneous structures of rigid and brittle inorganic materials on soft and elastic elastomeric substrates, with mechanical design layouts that isolate large deformations to the elastomer, thereby avoiding potentially destructive plastic strains in the brittle materials. The overall stiffnesses of the electronics, their stretchability, and curvilinear shapes can be designed to match the mechanical properties of biological tissues. The result is a class of soft stretchable electronic systems that are compatible with traditional high-performance inorganic semiconductor technologies. These systems afford promising options for applications in portable biomedical and health-monitoring devices. Mechanics theories and modeling play a key role in understanding the underlining physics and optimization of these systems.

  9. Hydrogen Bonding and Stability of Hybrid Organic-Inorganic Perovskites

    KAUST Repository

    El-Mellouhi, Fedwa; Marzouk, Asma; Bentria, El Tayeb; Rashkeev, Sergey N.; Kais, Sabre; Alharbi, Fahhad H.

    2016-01-01

    In the past few years, the efficiency of solar cells based on hybrid organic–inorganic perovskites has exceeded the level needed for commercialization. However, existing perovskites solar cells (PSCs) suffer from several intrinsic instabilities, which prevent them from reaching industrial maturity, and stabilizing PSCs has become a critically important problem. Here we propose to stabilize PSCs chemically by strengthening the interactions between the organic cation and inorganic anion of the perovskite framework. In particular, we show that replacing the methylammonium cation with alternative protonated cations allows an increase in the stability of the perovskite by forming strong hydrogen bonds with the halide anions. This interaction also provides opportunities for tuning the electronic states near the bandgap. These mechanisms should have a universal character in different hybrid organic–inorganic framework materials that are widely used.

  10. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  11. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  12. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  13. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  14. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  15. Human Exposure and Health Effects of Inorganic and Elemental Mercury

    Science.gov (United States)

    Zheng, Wei

    2012-01-01

    Mercury is a toxic and non-essential metal in the human body. Mercury is ubiquitously distributed in the environment, present in natural products, and exists extensively in items encountered in daily life. There are three forms of mercury, i.e., elemental (or metallic) mercury, inorganic mercury compounds, and organic mercury compounds. This review examines the toxicity of elemental mercury and inorganic mercury compounds. Inorganic mercury compounds are water soluble with a bioavailability of 7% to 15% after ingestion; they are also irritants and cause gastrointestinal symptoms. Upon entering the body, inorganic mercury compounds are accumulated mainly in the kidneys and produce kidney damage. In contrast, human exposure to elemental mercury is mainly by inhalation, followed by rapid absorption and distribution in all major organs. Elemental mercury from ingestion is poorly absorbed with a bioavailability of less than 0.01%. The primary target organs of elemental mercury are the brain and kidney. Elemental mercury is lipid soluble and can cross the blood-brain barrier, while inorganic mercury compounds are not lipid soluble, rendering them unable to cross the blood-brain barrier. Elemental mercury may also enter the brain from the nasal cavity through the olfactory pathway. The blood mercury is a useful biomarker after short-term and high-level exposure, whereas the urine mercury is the ideal biomarker for long-term exposure to both elemental and inorganic mercury, and also as a good indicator of body burden. This review discusses the common sources of mercury exposure, skin lightening products containing mercury and mercury release from dental amalgam filling, two issues that happen in daily life, bear significant public health importance, and yet undergo extensive debate on their safety. PMID:23230464

  16. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  17. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  18. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  19. Hybrid Organic/Inorganic Nanocomposites for Photovoltaic Cells

    Science.gov (United States)

    Liu, Ruchuan

    2014-01-01

    Inorganic/organic hybrid solar cells have attracted a lot of interest due to their potential in combining the advantages of both components. To understand the key issues in association with photoinduced charge separation/transportation processes and to improve overall power conversion efficiency, various combinations with nanostructures of hybrid systems have been investigated. Here, we briefly review the structures of hybrid nanocomposites studied so far, and attempt to associate the power conversion efficiency with these nanostructures. Subsequently, we are then able to summarize the factors for optimizing the performance of inorganic/organic hybrid solar cells. PMID:28788591

  20. Inorganic electret with enhanced charge stability for energy harvesting

    DEFF Research Database (Denmark)

    Wang, Fei; Hansen, Ole

    2013-01-01

    We report a new surface treatment of inorganic electret materials which enhances the charge stability. Coating the surfaces with 1H, 1H, 2H, 2H - perfluorodecyltrichlorosilane (FDTS) makes the electret surface more hydrophobic which improves the surface charge stability under high humidity condit...... conditions. Thermal tests show that the thermal stability of charge in the inorganic electrets is also much better than that of polymer materials such as CYTOP. A demonstrator device with SiO2 electrets shows promising results for energy harvesting applications....

  1. Binary systems solubilities of inorganic and organic compounds

    CERN Document Server

    Stephen, H

    1963-01-01

    Solubilities of Inorganic and Organic Compounds, Volume 1: Binary Systems, Part 1 is part of an approximately 5,500-page manual containing a selection from the International Chemical Literature on the Solubilities of Elements, Inorganic Compounds, Metallo-organic and Organic Compounds in Binary, Ternary and Multi-component Systems. A careful survey of the literature in all languages by a panel of scientists specially appointed for the task by the U.S.S.R. Academy of Sciences, Moscow, has made the compilation of this work possible. The complete English edition in five separately bound volumes w

  2. Organic and inorganic osmolytes at lipid membrane interfaces

    DEFF Research Database (Denmark)

    Westh, P.; Peters, Günther H.j.

    2008-01-01

    This chapter discusses the interactions of organic osmolytes and membranous interfaces, and the effects of these interactions on the properties of the membrane. It also includes a treatment of inorganic ions at the membrane interface since osmolyte effects involve a balance between organic...... and inorganic components. Before turning to the physicochemical discussion of interfacial interactions, the chapter outlines some central parts of the biology and biotechnology of organic osmolytes. It reviews the central relationships in preferential interaction theory, which we use in subsequent paragraphs...

  3. Total and inorganic arsenic in fish samples from Norwegian waters

    DEFF Research Database (Denmark)

    Julshamn, K.; Nilsen, B. M.; Frantzen, S.

    2012-01-01

    The contents of total arsenic and inorganic arsenic were determined in fillet samples of Northeast Arctic cod, herring, mackerel, Greenland halibut, tusk, saithe and Atlantic halibut. In total, 923 individual fish samples were analysed. The fish were mostly caught in the open sea off the coast......-assisted dissolution of the samples. The concentrations found for total arsenic varied greatly between fish species, and ranged from 0.3 to 110 mg kg–1 wet weight. For inorganic arsenic, the concentrations found were very low (...

  4. Development of Inorganic Solar Cells by Nano-technology

    Institute of Scientific and Technical Information of China (English)

    Yafei Zhang; HueyLiang Hwang; Huijuan Geng; Zhihua Zhou; Jiang Wu; Zhiming Wang; Yaozhong Zhang; Zhongli Li; Liying Zhang; Zhi Yang

    2012-01-01

    Inorganic solar cells, as durable photovoltaic devices for harvesting electric energy from sun light, have received tremendous attention due to the fear of exhausting the earth’s energy resources and damaging the living environment due to greenhouse gases. Some recent developments in nanotechnology have opened up new avenues for more relevant inorganic solar cells produced by new photovoltaic conversion concepts and effective solar energy harvesting nanostructures. In this review, the multiple exciton generation effect solar cells, hot carrier solar cells, one dimensional material constructed asymmetrical schottky barrier arrays, noble nanoparticle induced plasmonic enhancement, and light trapping nanostructured semiconductor solar cells are highlighted.

  5. Effects of atmospheric inorganic nitrogen deposition on ocean biogeochemistry

    OpenAIRE

    Krishnamurthy, Aparna; Moore, J. Keith; Zender, Charles S; Luo, Chao

    2007-01-01

     We perform a sensitivity study with the Biogeochemical Elemental Cycling (BEC) ocean model to understand the impact of atmospheric inorganic nitrogen deposition on marine biogeochemistry and air-sea CO2 exchange. Simulations involved examining the response to three different atmospheric inorganic nitrogen deposition scenarios namely, Pre-industrial (22 Tg N/year), 1990s (39 Tg N/year), and an Intergovernmental Panel on Climate Change (IPCC) prediction for 2100, IPCC-A1FI (69 Tg N/year). Glob...

  6. Sol-gel additive for systems with inorganic binders

    International Nuclear Information System (INIS)

    Akstinat, M.; Antenen, D.; Suter, W.

    1996-01-01

    A sol-gel additive for inorganic binder systems and sol-gel process for producing air-placed concrete and mortar by using such sol-gel additives are disclosed. Sol-gel additives for gel-derived inorganic binder systems (for example plaster, cement, lime, special slags, etc.) marked improve the consistency of such binder systems during processing or allow their consistency to be regulated. In addition, these sol-gel additives regulate setting times and substantially improve durability (chemical resistance, reduced permeability) and the mechanical properties of the set binder system. (author)

  7. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  8. Electrochemical determination of inorganic mercury and arsenic--A review.

    Science.gov (United States)

    Zaib, Maria; Athar, Muhammad Makshoof; Saeed, Asma; Farooq, Umar

    2015-12-15

    Inorganic mercury and arsenic encompasses a term which includes As(III), As(V) and Hg(II) species. These metal ions have been extensively studied due to their toxicity related issues. Different analytical methods are used to monitor inorganic mercury and arsenic in a variety of samples at trace level. The present study reviews various analytical techniques available for detection of inorganic mercury and arsenic with particular emphasis on electrochemical methods especially stripping voltammetry. A detailed critical evaluation of methods, advantages of electrochemical methods over other analytical methods, and various electrode materials available for mercury and arsenic analysis is presented in this review study. Modified carbon paste electrode provides better determination due to better deposition with linear and improved response under studied set of conditions. Biological materials may be the potent and economical alternative as compared to macro-electrodes and chemically modified carbon paste electrodes in stripping analysis of inorganic mercury and arsenic. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Synchrotron radiation studies of inorganic-organic semiconductor interfaces

    International Nuclear Information System (INIS)

    Evans, D.A.; Steiner, H.J.; Vearey-Roberts, A.R.; Bushell, A.; Cabailh, G.; O'Brien, S.; Wells, J.W.; McGovern, I.T.; Dhanak, V.R.; Kampen, T.U.; Zahn, D.R.T.; Batchelor, D.

    2003-01-01

    Organic semiconductors (polymers and small molecules) are widely used in electronic and optoelectronic technologies. Many devices are based on multilayer structures where interfaces play a central role in device performance and where inorganic semiconductor models are inadequate. Synchrotron radiation techniques such as photoelectron spectroscopy (PES), near-edge X-ray absorption fine structure (NEXAFS) and X-ray standing wave spectroscopy (XSW) provide a powerful means of probing the structural, electronic and chemical properties of these interfaces. The surface-specificity of these techniques allows key properties to be monitored as the heterostructure is fabricated. This methodology has been directed at the growth of hybrid organic-inorganic semiconductor interfaces involving copper phthalocyanine as the model organic material and InSb and GaAs as the model inorganic semiconductor substrates. Core level PES has revealed that these interfaces are abrupt and chemically inert due to the weak bonding between the molecules and the inorganic semiconductor. NEXAFS studies have shown that there is a preferred orientation of the molecules within the organic semiconductor layers. The valence band offsets for the heterojunctions have been directly measured using valence level PES and were found to be very different for copper phthalocyanine on InSb and GaAs (0.7 and -0.3 eV respectively) although an interface dipole is present in both cases

  10. Extraordinary Interfacial Stitching between Single All-Inorganic Perovskite Nanocrystals

    NARCIS (Netherlands)

    Gomez, Leyre; Lin, Junhao; De Weerd, Chris; Poirier, Lucas; Boehme, Simon C.; Von Hauff, Elizabeth; Fujiwara, Yasufumi; Suenaga, Kazutomo; Gregorkiewicz, Tom

    2018-01-01

    All-inorganic cesium lead halide perovskite nanocrystals are extensively studied because of their outstanding optoelectronic properties. Being of a cubic shape and typically featuring a narrow size distribution, CsPbX3 (X = Cl, Br, and I) nanocrystals are the ideal starting material for the

  11. Tolerance of High Inorganic Mercury of Perna viridis : Laboratory ...

    African Journals Online (AJOL)

    Tolerance of High Inorganic Mercury of Perna viridis : Laboratory Studies of Its Accumulation, Depuration and Distribution. ... coefficient, indicating that it could act as one of the excretion routes for Hg and it can be proposed as a sensitive biomonitoring material for Hg. The fecal materials released by the mussel had elevated ...

  12. Heavy metals and inorganic constituents in medicinal plants of ...

    African Journals Online (AJOL)

    Heavy metals such as Cr, Fe, Zn, Mn, Ni, Pb, Cu and Cd, and inorganic ions like HCO3-, CO32-, Ca2+, Mg2+, Cl-, Na+, SO42-, NO3-, Fe2+ and F- were investigated in medicinally important plants: Taraxacam officinale, Cichorium intybus and Figonia critica, applying atomic absorption spectrophotometer techniques. In the ...

  13. Development of ultrafiltration and inorganic adsorbents: January--March 1977

    International Nuclear Information System (INIS)

    Koenst, J.W. Jr.

    1977-01-01

    Ultrafiltration media with and without the assistance of bone char filters were evaluated to determine their effectiveness in removing radionuclides from contaminated solutions. Precipitants, resin, adsorbents, and inorganic adsorbents were studied to determine their effectiveness in decontaminating solutions. A study of the effects of radiation on ultrafiltration media was initiated. An ultrafiltration media pilot plant was ordered and is being installed

  14. Comparative assessment of different poultry manures and inorganic ...

    African Journals Online (AJOL)

    Dr. M.B. Adewole

    20-10-10) applied at 0.4 t ha-1 and zero manure/inorganic fertilizer application served as ... poultry composts were air-dried, ground and analyzed for their chemical ..... research. 2nd Ed. John Wiley & Sons, Incorporation, New York, 680 p.

  15. Properties of extended inorganic solids predicted/rationalized by ...

    Indian Academy of Sciences (India)

    Administrator

    Due to the vastly complex nature of the problem, guidelines for the preparation of extended inorganic solids with specific electronic properties remain meagre. Here we present the use of First Principles LMTO band structure calculations for the rationalization of the properties of a number of interesting extended solids.

  16. Safe recycling of materials containing persistent inorganic and carbon nanoparticles

    NARCIS (Netherlands)

    Reijnders, L.; Njuguna, J.; Pielichowski, K.; Zhu, H.

    2014-01-01

    For persistent inorganic and carbon nanomaterials, considerable scope exists for a form of recycling called ‘resource cascading’. Resource cascading is aimed at the maximum exploitation of quality and service time of natural resources. Options for resource cascading include engineered nanomaterials

  17. Influence of lignin on properties of wood-inorganic sorbents

    International Nuclear Information System (INIS)

    Remez, V.P.; Charina, M.V.; Klass, S.M.; Shubin, A.S.; Tkachev, K.V.; Isaeva, O.F.

    1986-01-01

    Present article is devoted to influence of lignin on properties of wood-inorganic sorbents. The influence of component composition of matrix on sorption properties of sorbents and their stability in different mediums is studied. The dependence of sorption capacity of sorbent on component matrix composition and its porous structure is defined.

  18. Evaluation of Creatine Kinase Activity and Inorganic Phosphate ...

    African Journals Online (AJOL)

    subjects presenting with major VOC. Keywords: Serum creatine kinase activity, Serum inorganic phosphate concentration, Sickle cell disease,. Steady state, Vaso‑occlusive crisis. Original Article. Address for correspondence: Dr. John C Aneke,. Department of Hematology,. Nnamdi Azikiwe University Teaching. Hospital ...

  19. Modern applications of polarography and voltammetry to inorganic analysis

    International Nuclear Information System (INIS)

    Lee, A.F.

    1983-01-01

    This report summarized developments in polarography and voltametry up to 1982. Modern electronic equipment and scanning waveforms are explained briefly. Extensive tables of recent inorganic applications, mainly in the geochemical and metallurgical fields, are included, and show results based on the new approaches

  20. Determination of Carboxylic Acids and Water-soluble Inorganic Ions ...

    African Journals Online (AJOL)

    Atmospheric aerosol samples of PM2.5 and PM10 were collected in April–May 2011 from a rural site in Tanzania and analyzed for water-soluble inorganic ions and low molecular weight carboxylic acids using ion chromatography. PM2.5 and PM10 low-volume samplers with quartz fibre filters were deployed and aerosol ...

  1. Technical note: An inorganic water chemistry dataset (1972–2011 ...

    African Journals Online (AJOL)

    A national dataset of inorganic chemical data of surface waters (rivers, lakes, and dams) in South Africa is presented and made freely available. The dataset comprises more than 500 000 complete water analyses from 1972 up to 2011, collected from more than 2 000 sample monitoring stations in South Africa. The dataset ...

  2. Thermal hazard assessment of TMCH mixed with inorganic acids

    Directory of Open Access Journals (Sweden)

    Yeh Chi-Tang

    2018-01-01

    Full Text Available 1,1-Bis(tert-butylperoxy-3,3,5-trimethylcyclohexane (TMCH is a typical peroxide with two peroxy groups that may runaway and/or explode due to mixing with inorganic acids, such as HCl, HNO3, H2SO4, or H3PO4. In this study, reactivities of TMCH mixed with the above inorganic acids were assessed by differential scanning calorimetry (DSC. Furthermore, data obtained by DSC, such as exothermic onset temperature (T0, maximum temperature (Tmax, and heat of decomposition (ΔHd could be employed to acquire thermal safety parameters. Moreover, thermal activity monitor III (TAM III was employed to investigate the thermal hazards while storing or transporting TMCH and TMCH mixed with four types of commonly used inorganic acids, here as HCl, HNO3, H2SO4, or H3PO4 under isothermal conditions. Mixing TMCH with those inorganic acids resulted in higherΔHd except H3PO4, and mixing TMCH with HCl clearly decreased T0. Therefore, the phenomena of mixing those incompatible materials with TMCH can be concluded as the worst cases in terms of contamination hazards during storage and transportation of TMCH.

  3. Fundamentals of EUV resist-inorganic hardmask interactions

    Science.gov (United States)

    Goldfarb, Dario L.; Glodde, Martin; De Silva, Anuja; Sheshadri, Indira; Felix, Nelson M.; Lionti, Krystelle; Magbitang, Teddie

    2017-03-01

    High resolution Extreme Ultraviolet (EUV) patterning is currently limited by EUV resist thickness and pattern collapse, thus impacting the faithful image transfer into the underlying stack. Such limitation requires the investigation of improved hardmasks (HMs) as etch transfer layers for EUV patterning. Ultrathin (<5nm) inorganic HMs can provide higher etch selectivity, lower post-etch LWR, decreased defectivity and wet strippability compared to spin-on hybrid HMs (e.g., SiARC), however such novel layers can induce resist adhesion failure and resist residue. Therefore, a fundamental understanding of EUV resist-inorganic HM interactions is needed in order to optimize the EUV resist interfacial behavior. In this paper, novel materials and processing techniques are introduced to characterize and improve the EUV resist-inorganic HM interface. HM surface interactions with specific EUV resist components are evaluated for open-source experimental resist formulations dissected into its individual additives using EUV contrast curves as an effective characterization method to determine post-development residue formation. Separately, an alternative adhesion promoter platform specifically tailored for a selected ultrathin inorganic HM based on amorphous silicon (aSi) is presented and the mitigation of resist delamination is exemplified for the cases of positive-tone and negative-tone development (PTD, NTD). Additionally, original wafer priming hardware for the deposition of such novel adhesion promoters is unveiled. The lessons learned in this work can be directly applied to the engineering of EUV resist materials and processes specifically designed to work on such novel HMs.

  4. Identification of inorganic anions by gas chromatography/mass spectrometry.

    Science.gov (United States)

    Sakayanagi, Masataka; Yamada, Yaeko; Sakabe, Chikako; Watanabe, Kunio; Harigaya, Yoshihiro

    2006-03-10

    Inorganic anions were identified by using gas chromatography/mass spectrometry (GC/MS). Derivatization of the anions was achieved with pentafluorobenzyl p-toluenesulphonate (PFB-Tos) as the reaction reagent and a crown ether as a phase transfer catalyst. When PFB-Br was used as the reaction reagent, the retention time of it was close to those of the derivatized inorganic anions and interfered with the analysis. In contrast, the retention time of PFB-Tos differed greatly from the PFB derivatives of the inorganic anions and the compounds of interest could be detected without interference. Although the PFB derivatives of SO4, S2O3, CO3, ClO4, and ClO3 could not be detected, the derivatives of F, Cl, Br, I, CN, OCN, SCN, N3, NO3, and NO2 were detected using PFB-Tos as the derivatizing reagent. The inorganic anions were detectable within 30 ng approximately, which is of sufficient sensitivity for use in forensic chemistry. Accurate mass number was measured for each PFB derivative by high-resolution mass spectrometry (HRMS) within a measurement error of 2 millimass units (mmu), which allowed determination of the compositional formula from the mass number. In addition, actual analysis was performed successively by our method using trial samples of matrix.

  5. Effect of organic and inorganic fertilizers on nutrient concentrations ...

    African Journals Online (AJOL)

    Effect of organic and inorganic fertilizers on nutrient concentrations in plantain ( Musa spp.) ... Fruit parameters measured were fruit weight, edible proportion and pulp dry matter content; also, the concentrations of nitrogen (N), phosphorus (P), potassium (K), calcium (Ca), iron (Fe) and zinc (Zn) in fruits were determined.

  6. Evaluation of Serum Calcium and Inorganic Phosphate Levels in ...

    African Journals Online (AJOL)

    The importance of calcium and inorganic phosphate in pregnancy cannot be overemphasized. Their adequacy or otherwise amongst pregnant and lactating women in Enugu metropolis receiving their routine antenatal supplements was the focus of this study. Two hundred subjects (forty in each trimester; forty lactating and ...

  7. Isotope dilution mass spectrometry of inorganic and organic substances

    International Nuclear Information System (INIS)

    Heumann, K.G.

    1986-01-01

    The aim of this short review of IDMS is to provide an introduction into the principles of this analytical method and to show possible applications of this accurate technique, e.g. negative thermal ionization IDMS for inorganic anion analysis or the analysis of organic compounds in the field of clinical chemistry. (orig./RB)

  8. Evaluation of Pollutant Loads: Organic and Inorganic in River ...

    African Journals Online (AJOL)

    This study was carried out to determine the organic and inorganic pollutant loads in River Ukoghor of the Lower Benue Basin. Grab water samples were collected from the outlet of the River into River Benue, twice a month in three replications for a period of eight months (April November, 2002) using sterilized one-litre ...

  9. Effect of organic and inorganic fertilizer on yield and chlorophyll ...

    African Journals Online (AJOL)

    The effects of amending soil with organic (poultry manure) and inorganic fertilizer on yield and chlorophyll content of maize (Zea mays L.) and sorghum (Sorghum bicolour (L.) Moench) was carried out at the Teaching and Research (T&R) Farm of the Obafemi Awolowo University, (O.A.U.) Ile - Ife, Nigeria. The experiment ...

  10. Turning Sunlight into Electricity-Inorganic Solar Cells and Beyond

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Turning Sunlight into Electricity - Inorganic Solar Cells and Beyond. A K Shukla. Volume 16 Issue 12 December 2011 pp 1294-1302. Fulltext. Click here to view fulltext PDF. Permanent link:

  11. Modern Trends in Inorganic Chemistry (MTIC-XIII)

    Indian Academy of Sciences (India)

    MAC 10

    Institute of Science, Bangalore during December 7–10, 2009. The MTIC series of ... The topics covered in this issue span a wide range from ... chemistry that reflect the current trends of research in inorganic chemistry in India. We thank the ...

  12. Response of food organisms to inorganic nitrogen availability ...

    African Journals Online (AJOL)

    Influence of inorganic N2 forms on pond food organisms was investigated. Seven identified plankton taxa comprising four phytoplankton: Desmidiaceae (desmids), Bacillariophyceae (diatoms), Cyanophyceae (blue-green algae) and Chlorophyceae (green algae) and three zooplankton: Protozoa, Cladocera and Rotifera ...

  13. Generalized synthesis of periodic surfactant/inorganic composite materials

    NARCIS (Netherlands)

    Huo, Q.; Margolese, D.I.; Ciesla, U.; Feng, P.; Gier, T.E.; Sieger, P.; Leon, R.; Petroff, P.M.; Schüth, F.; Stucky, G.D.

    1994-01-01

    THE recent synthesis of silica-based mesoporous materials by the cooperative assembly of periodic inorganic and surfactant-based structures has attracted great interest because it extends the range of molecular-sieve materials into the very-large-pore regime. If the synthetic approach can be

  14. Evaluation of Creatine Kinase Activity and Inorganic Phosphate ...

    African Journals Online (AJOL)

    Background: Biochemical parameters vary in subjects with different hemoglobin phenotypes, compared with normal controls. Aim: The aim was to evaluate serum creatine kinase (CK) activity and inorganic phosphate concentrations in Nigerian adults with homozygous and heterozygous hemoglobin phenotypes. Subjects ...

  15. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  16. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  17. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  18. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  19. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  20. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  1. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  2. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  3. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  4. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  5. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  6. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  7. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  8. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  9. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  10. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  11. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  12. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  13. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  14. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  15. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  16. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  17. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  18. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  19. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  20. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...