WorldWideScience

Sample records for inibidores da inha

  1. BIOENSAIO PARA DETERMINAÇÃO DA RESISTÊNCIA DE PLANTAS DANINHAS AOS HERBICIDAS INIBIDORES DA ENZIMA ALS

    Directory of Open Access Journals (Sweden)

    CHRISTOFFOLETI PEDRO JACOB

    2001-01-01

    Full Text Available Com o uso intensivo de herbicidas inibidores da acetolactato sintase (ALS em áreas cultivadas com soja, no município de São Gabriel d'Oeste (MS, Brasil, selecionou-se um biótipo resistente da planta daninha Bidens pilosa. A confirmação bioquímica desta resistência, no entanto, é muito difícil de ser feita em campo. Assim, realizou-se um bioensaio com o objetivo de testar a sensibilidade da ALS desse biótipo aos herbicidas inibidores dessa enzima, por meio da aplicação simultânea de herbicidas inibidores da ALS e da KARI (cetoácido reductoisomerase. Para a inibição desta última enzima, utilizou-se o teste CPCA (ácido 1,1-ciclopropanodicarboxílico. Por ele, confirmou-se que a resistência do biótipo de Bidens pilosa é decorrente da insensibilidade da ALS aos herbicidas, que visam inibi-la; pois, quanto maior a quantidade de acetoína, maior é a atividade da enzima e mais intensa a coloração desenvolvida, proporcionando maiores valores nas leituras de absorbância.

  2. A regeneração hepática e os inibidores da enzima conversora da angiotensina

    Directory of Open Access Journals (Sweden)

    Fernando Silva Ramalho

    2000-01-01

    Full Text Available No presente estudo, o autor aborda conceitos fundamentais acerca do fenômeno regenerativo hepático, seguido de alguns aspectos importantes relacionados ao sistema calicreína-cininas. A associação entre os inibidores da enzima conversora da angiotensina, a bradicinina e a regeneração hepática é discutida à luz de estudos recentes, que revelam um papel estimulante das cininas sobre a proliferação hepatocelular. Os inibidores da enzima conversora da angiotensina, extremamente utilizados no tratamento clínico da hipertensão arterial sistêmica, da insuficiência cardíaca congestiva e da nefropatia diabética, também são capazes de favorecer a regeneração hepática.

  3. Manejo da Planta Daninha Brachiaria plantaginea Resistente aos herbicidas Inibidores da ACCase Management of the Weed Brachiaria plantaginea Resistant to ACCase Inhibitor Herbicides

    Directory of Open Access Journals (Sweden)

    P.J. Christoffoleti

    2001-04-01

    Full Text Available O objetivo deste trabalho foi estudar o manejo de uma população da planta daninha capim-marmelada (Brachiaria plantaginea resistente aos herbicidas inibidores da ACCase (ariloxifenoxipropionatos e ciclohexanodionas, utilizados na cultura da soja no sistema de plantio direto. Para isso, foram realizados dois experimentos: um utilizando herbicidas de manejo, com mecanismos de ação alternativos, comparando a eficácia destes com os inibidores da ACCase; e outro apenas com herbicidas inibidores da ACCase e aditivos misturados à calda. As sementes resistentes foram produzidas a partir de plantas comprovadamente resistentes; para comparação de resultados, foi utilizada uma população de capim-marmelada que nunca tinha sido pulverizada com inibidores da ACCase, portanto uma população suscetível. O experimento com os herbicidas de manejo foi realizado em condições de campo, porém as plantas ficaram em caixas com capacidade de 50 L, evitando-se a disseminação destas para áreas adjacentes. Concluiu-se que as plantas resistentes não apresentam resistência múltipla com herbicidas de manejo com mecanismos de ação alternativos, podendo os herbicidas glyphosate, paraquat, sulfosate, paraquat + diuron, MSMA e glufosinate ser utilizados no período entressafra das áreas com sistema de plantio direto, para manejo de populações resistentes de capim-marmelada aos herbicidas inibidores da ACCase. O experimento com aditivos foi realizado em casa de vegetação, com plantas em vasos individuais, utilizando sementes das populações suscetíveis e resistentes. Os herbicidas utilizados foram inibidores da ACCase, em cuja calda foram adicionados aditivos nitrogenados, do tipo uréia e sulfato de amônio, além de um tratamento sem aditivos. Concluiu-se que os aditivos não alteraram a eficácia dos herbicidas inibidores da ACCase nas plantas provenientes tanto da população suscetível quanto da resistente.The objective of this research was to

  4. Inibidores de proteases encontrados em sementes de Caesalpinia echinata (paubrasil: isolamento e caracterização do inibidor de tripsina

    Directory of Open Access Journals (Sweden)

    Lúcio Garcia de Oliveira

    Full Text Available Caesalpinia echinata, o pau-brasil, é uma árvore pertencente à família das Leguminosas, sub-família Caesalpinoidae. Como já foram encontrados inibidores de proteases em sementes de outras Leguminosas, o objetivo do trabalho é purificar e caracterizar o inibidor de tripsina extraído das sementes de C. echinata. Após extração salina e precipitação por acetona, os inibidores foram purificados por cromatografia de troca iônica e filtração em gel, apresentando massas moleculares de 19,5 e 10 kDa e constante de inibição da ordem de nM.

  5. Antiinflamatórios não-hormonais: inibidores da ciclooxigenase 2 Nonsteroidal anti-inflammatory drugs: cyclooxygenase 2 inhibitors

    Directory of Open Access Journals (Sweden)

    Maria Odete Esteves Hilário

    2006-11-01

    Full Text Available OBJETIVO: Analisar os antiinflamatórios não-hormonais (AINH inibidores seletivos da Cox 2 quanto ao mecanismo de ação, principais indicações, posologia e efeitos adversos mais comuns. FONTES DOS DADOS: MEDLINE e LILACS, sites da Food and Drug Administration (FDA e da Agência Nacional de Vigilância Sanitária (ANVISA. Foram selecionados os artigos mais importantes, com destaque para as publicações dos últimos 5 anos. SÍNTESE DOS DADOS: As principais indicações dos AINH são o controle da dor e da inflamação aguda e crônica. Não existem evidências que demonstrem maior efetividade de um AINH sobre outro. Até a presente data, nenhum inibidor da Cox2 foi liberado para uso na faixa etária pediátrica. Apenas o meloxicam e o etoricoxibe podem ser prescritos para adolescentes (13 e 16 anos, respectivamente. Os inibidores seletivos da Cox 2 são indicados em pacientes com efeitos adversos comprovadamente relacionados aos AINH não seletivos. Em alguns casos de alergia à aspirina, os Cox 2 seletivos podem ser prescritos, mas seu uso deve ser cuidadoso. Os principais efeitos adversos incluem os cardiovasculares e os fenômenos trombóticos. CONCLUSÕES: Os inibidores seletivos da Cox 2 são medicamentos que vêm sendo utilizados em algumas situações clínicas bem determinadas e podem oferecer algumas vantagens com relação aos AINH não seletivos. No entanto, devido ao custo mais elevado e aos potenciais efeitos adversos cardiovasculares, seu emprego deve ser criterioso.OBJECTIVE: To analyze selective COX 2 inhibitor nonsteroidal anti-inflammatory drugs (NSAID in terms of their mechanism of action, principal indications, posology and most common adverse effects. SOURCES: MEDLINE and LILACS databases and Food and Drug Administration (FDA and National Agency for Sanitary Vigilance (ANVISA - Agência Nacional de Vigilância Sanitária websites. The most important articles were selected and preference was given to articles published

  6. Estudo e determinação teórica de propriedades físico-químicas de fármacos anti-hipertensivos inibidores da Enzima Conversora de Angiotensina

    Directory of Open Access Journals (Sweden)

    LUíZA REIS CRUZ

    2010-12-01

    Full Text Available O pacote de softwares SpartanTM vs 04 foi utilizado para calcular algumas propriedades físico-químicas de uma série de inibidores da Enzima Conversora de Angiotensinogênio ECA. Simultaneamente, o pacote MarvinSketch 5.0.0 foi empregado para calcular o Coeficiente de Partição P dos inibidores. Através da análise dos resultados, conclui-se que: a o arranjo termodinâmico mais estável desses inibidores mimetiza aquele dos resíduos pré-terminais da angiotensina II, b há grande similaridade entre as cargas dos átomos que se ligam à macromolécula e c os cálculos mostram diferenças significativas entre os valores de P para os inibidores. Portanto, as diferenças farmacológicas existentes entre os inibidores estão mais intimamente relacionadas ao coeficiente de partição do que à capacidade destes de inibir o sítio ativo da ECA. Palavras-chave: ECA. Ab initio. Equilíbrio conformacional. Lipofilicidade. ABSTRACT Theoretical study and determination of physicochemical properties of antihypertensive angiotensin-converting enzyme inhibitors The software package SpartanTM 4.0 was employed to calculate some physicochemical properties of a series of available ACE inhibitors. Simultaneously, the program MarvinSketch 5.0.0 was employed to calculate the partition coefficients (P of the same compounds. After analyzing the results, we conclude that: a from a thermodynamic point of view, the most stable conformer of each inhibitor resembles, as expected, the most stable spatial arrangement of the preterminal residues of angiotensin II; b there is great similarity among the charge profiles of the potential binding sites of all the inhibitors; c there are large differences in P among these compounds. Summing up, the pharmacological differences reported between the inhibitors are more closely linked to their lipophilic properties than to their capacity to block the ACE active center. Keywords: ACE. Ab initio. Conformational

  7. Efeito do treinamento físico aeróbio nas respostas cardiovasculares de ratos hipertensos tratados com betabloqueador ou inibidor direto da renina

    OpenAIRE

    Karla Fabiana Goessler

    2012-01-01

    A hipertensão arterial é considerada como um fator de risco para o desenvolvimento de doenças cardiovasculares. Os betabloqueadores e o inibidor direto da renina (IDR) são uma alternativa de tratamento, por reduzir os valores da pressão arterial (PA) de repouso, assim como a prática regular de exercício físico. Os objetivos do estudo foram: 1) Determinar um protocolo de hipertensão, com bloqueio do óxido nítrico, e um protocolo de treinamento; 2) Verificar o comportamento da pressão arterial ...

  8. ATIVIDADE DE INIBIDORES DE PROTEASES EM LINHAGENS DE SOJA GENETICAMENTE MELHORADAS*

    Directory of Open Access Journals (Sweden)

    L. R. CARDOSO

    2008-11-01

    Full Text Available

    Este estudo teve como objetivo ajustar um método de determinação de inibidores de quimotripsina, determinar a atividade inibitória de tripsina e quimotripsina e verificar o efeito da eliminação genética na atividade destes inibidores em genótipos de soja. Foram analisados quatro genótipos de soja, os quais diferiam entre si com relação à presença ou ausência de lipoxigenases (LOX e do inibidor de tripsina Kunitz (KTI. Os testes foram realizados com a soja in natura e processada em diferentes temperaturas. Os fatores de tripsina e quimotripsina encontrados foram de 0,0188 e 0,0127 respectivamente. A atividade inibitória de tripsina, em mg/g de proteína, para as linhagens in natura variaram entre de 92,87 e 122,92, sendo as farinhas isentas de KTI as que apresentaram menor atividade inibitória. O processamento térmico de 120ºC/9 minutos foi suficiente para a completa inativação dos inibidores nas variedades isentas de KTI.

  9. Estudos QSAR e Ancoragem Molecular de Inibidores da Atividade Biológica do Fator de Inibição da Migração dos Macrófagos (MIF

    Directory of Open Access Journals (Sweden)

    Alex Gutterres Taranto

    2012-08-01

    Full Text Available Cumarina e 4-Cromonas são promissores inibidores de fator inibição da migração de macrófagos (MIF, uma proteína envolvida em doenças inflamatórias, como artrite reumatóide e outras patologias. Estudos teóricos de QSAR e ancoragem molecular de um conjunto de compostos mostraram correlação com estudos experimentais. Os descritores doadores de ligação hidrogênio e momento dipolo total foram capazes de prever atividade inibitória de compostos contra o MIF (MIFi . Paralelamente, estudos de ancoragem molecular também foram capazes de identificar ligações hidrogênio e hidrofóbicas entre os ligantes e o MIF. Como resultado, ambas as metodologias mostraram as contribuições de ligação de hidrogênio e interações hidrofóbicas para explicar a atividade de compostos inibidores de MIF, descrevendo os grupos farmacofóricos destes compostos. Adicionalmente, um conjunto de cumarinas naturais e sintéticas foi submetido aos modelos QSAR e de ancoragem molecular a fim de que as suas atividades contra MIF fossem preditas. Ambas as metodologias de modelagem molecular puderam estimar as interações intermoleculares entre inibidores e a enzima, os quais foram muito similares a compostos descritos previamente. Estes resultados podem ser úteis para o desenho de novos compostos contra doenças inflamatórias como artrite reumatóide.

  10. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology.

    Science.gov (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A

    2016-12-06

    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  11. Screening of a Novel Fragment Library with Functional Complexity against Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C

    2018-04-06

    Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  12. A pesquisa com a fosfoetanolamina sintética como inibidor da progressão de tumores

    Directory of Open Access Journals (Sweden)

    Natália Aparecida Oliveira Caetano

    2017-11-01

    Full Text Available Introdução: A fosfoetanolamina sintética (FS, conhecida como pílula do câncer, foi apresentada como promissora do tratamento de tumores. Essa substância tem seu mecanismo de ação voltado para as membranas celulares pela transdução de sinais e metabolismo de lipídeos que resultam na indução da apoptose. Objetivo: O presente trabalho avaliou os artigos da literatura que relacionam o uso da substância fosfoetanolamina sintética (FS como inibidor da progressão e disseminação de células tumorais no Brasil. Buscou-se também descrever os possíveis mecanismos associados com a ação da molécula para tratamento de tumores. Método: O trabalho é uma revisão bibliográfica, narrativa, exploratória e integrativa, nas bases de dados Biblioteca Virtual de Saúde, Google acadêmico, Pubmed e Scientific Electronic Library Online (SciELO. Critérios de inclusão: artigos completos disponíveis na literatura nacional e internacional, com palavras FS e tumores. Resultados: A partir de resultados de busca com 65 artigos, foram selecionados 19 artigos. Após análises das fontes de informações acima, foram selecionados os artigos que descreveram os efeitos da fosfoetanolamina sintética e os possíveis mecanismos associados com a ação da FS para tratamento de tumores. Conclusão: A fosfoetanolamina é um composto lipídico em elevada concentração em tumores, associada com elevada taxa de apoptose. Pesquisas préclínicas buscam validar a utilização da FS para tratamento tumoral. Até o presente não há dados que comprovem a eficácia da FS em neoplasias. Estudos clínicos relacionados ao uso da FS em tumores são essenciais para validação do uso da FS. Em abril de 2017, A FS não mostrou eficácia clínica em ensaios preliminares e os testes clínicos foram suspensos pela ANVISA.

  13. Fatores promotores e inibidores do alinhamento estratégico da tecnologia da informação em uma situação de fusão: o caso de uma rede varejista

    OpenAIRE

    Pereira, Christiane Maria Leite; Dornelas, Jairo Simião

    2010-01-01

    Este estudo buscou identificar fatores promotores e inibidores do alinhamento estratégico entre a tecnologia da informação e a estratégia empresarial em uma situação de fusão de empresas em um ambiente varejista. O caso possibilitou identificar percepções do corpo gerencial acerca das características promotoras e inibidoras do alinhamento. O estudo destacou eventos nos momentos antes do processo de fusão e no seu desenrolar, tal que se pôde associar aos fatores clássicos identificados na lite...

  14. Resistência de Bidens subalternans aos herbicidas inibidores da enzima acetolactato sintase utilizados na cultura da soja Resistance of Bidens subalternans to the acetolactate synthase inhibitor herbicides used in soybean crop

    Directory of Open Access Journals (Sweden)

    G.A. Gelmini

    2002-08-01

    Full Text Available O uso contínuo e prolongado de produtos com o mesmo mecanismo de ação pode provocar a manifestação de biótipos resistentes. Para verificar possíveis novos casos de resistência, bem como alternativas para prevenção e manejo, foram coletadas sementes de Bidens subalternans na região de São Gabriel D' Oeste-MS, em plantas que sobreviveram a tratamentos em que inibidores da ALS foram sistematicamente utilizados. Em experimento conduzido em vasos em casa de vegetação, o biótipo com histórico de resistente foi comparado ao suscetível quando submetido aos diversos herbicidas com diferentes mecanismos de ação usados em pós-emergência, os quais foram aplicados nas doses de zero, uma, duas, quatro e oito vezes a recomendada. Decorridos 20 dias, foram avaliadas a porcentagem de controle e a produção da fitomassa verde, visando estabelecimento de curvas de dose-resposta e obtenção dos fatores de resistência. O biótipo oriundo de área com histórico de aplicações repetidas de inibidores da ALS apresentou elevado nível de resistência aos herbicidas chlorimuron-ethyl e imazethapyr, demonstrando ser portador de resistência cruzada aos inibidores da ALS dos grupos das sulfoniluréias e imidazolinonas. Entretanto, esse biótipo foi eficientemente controlado pelos herbicidas fomesafen, lactofen, bentazon, glufosinato de amônio e glyphosate.The continuous and prolonged use of products with the same mechanism of action can provoke the manifestation of resistant biotypes. In horder to verify possible new cases, as well as alternatives for prevention and control, seeds of Bidens subalternans were collected at São Gabriel D' Oeste (MS region at plants that survived continuous treatments which sistematically ALS inhibitors. Through an experiment performed in pots inside a greenhouse, a resistant biotype was compared to a susceptible one when submitted to herbicides with different mechanisms of action and applied at post emergence

  15. Criatividade no Ensino Fundamental: Fatores Inibidores e Facilitadores segundo Gestores Educacionais

    Directory of Open Access Journals (Sweden)

    Eunice M. L. Soriano de Alencar

    Full Text Available Este estudo investigou a percepção de gestores de instituições de ensino fundamental sobre fatores que dificultam o professor promover o desenvolvimento da criatividade discente e procedimentos que poderiam utilizar para apoiar o professor na promoção da criatividade em sala de aula. Participaram 118 gestores de escolas públicas e particulares, os quais responderam a uma checklist de barreiras à criatividade em sala de aula e quatro questões abertas. Fatores inibidores mais apontados foram: desconhecimento pelo professor de práticas pedagógicas que poderiam ser utilizadas para propiciar o desenvolvimento da criatividade dos alunos e falta de entusiasmo pela atividade docente. Orientação, apoio e incentivo ao docente foi o procedimento mais apontado pelos gestores para auxiliar o professor a desenvolver a criatividade de seus alunos.

  16. Seleção de genótipos de cana-de-açúcar para acúmulo de protoporfirina ix com uso de herbicidas inibidores da protox

    OpenAIRE

    Barberis,L.R.M.; Trindade,M.L.B.; Velini,E.D.

    2009-01-01

    O objetivo do presente trabalho foi selecionar genótipos de cana-de-açúcar por meio de inibidores da PROTOX e antioxidantes para indução do acúmulo de protoporfirina IX (PROTO IX) e/ou de seus precursores em plantas. Esses compostos podem ser utilizados como agentes sensibilizantes em terapia fotodinâmica (TFD), os quais possibilitam uma fonte de baixo custo para o tratamento de neoplasias e carcinomas. O experimento foi montado em câmara climatizada, com aplicação de nove tratamentos (1. oxy...

  17. HERBICIDAS INIBIDORES DO FOTOSSISTEMA II – PARTE II / PHOTOSYSTEM II INHIBITOR HERBICIDES - PART

    Directory of Open Access Journals (Sweden)

    ILCA P. DE F. E SILVA

    2013-11-01

    Full Text Available Os herbicidas inibidores do fotossistema II (PSII ligam-se ao sítio da QB localizado na proteína D1 o qual se localiza na membrana dos tilacóides dos cloroplastos, causando, o bloqueia do transporte de elétrons da QA para QB, tendo como consequência, a peroxidação dos lipídios. Os principais fatores que afetam a evolução da resistência de plantas daninhas aos herbicidas têm sido agrupados em: genéticos, bioecológicos e agronômicos. A resistência de plantas daninhas a herbicidas é definida como a habilidade de uma planta sobreviver e reproduzir, após exposição a uma dose de herbicida normalmente letal para um biótipo normal da planta. A seletividade de um herbicida está relacionada à capacidade de eliminar plantas daninhas sem interferir na qualidade da planta de interesse econômico.

  18. Inibidores de corrosão naturais - Proposta de obtenção de produtos ecologicos de baixo custo a partir de resíduos industriais

    OpenAIRE

    Rocha, Janaina Cardozo da; Gomes, José Antônio da Cunha Ponciano

    2018-01-01

    RESUMO Os inibidores naturais são obtidos a partir de extratos de plantas ou de material biodegradável e acarretam a redução da intensidade de dissolução dos metais, diminuindo a sua taxa de corrosão. Pesquisas realizadas nos últimos anos relatam que muitos vegetais apresentam, em sua constituição, compostos com ação antioxidante, principalmente polifenóis. Nesse trabalho, será apresentado o histórico do desenvolvimento de inibidores naturais a partir de extratos de frutas para aplicação em m...

  19. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability.

    Science.gov (United States)

    Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A

    2017-07-05

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

  20. Terapia com inibidor da ECA com dosagens relativamente altas e risco de agravamento renal na insuficiência cardíaca crônica ACE-inhibitor therapy at relatively high doses and risk of renal worsening in chronic heart failure

    Directory of Open Access Journals (Sweden)

    Renato De Vecchis

    2011-12-01

    Full Text Available FUNDAMENTO: O efeito renoprotetor dos inibidores da ECA vem sendo questionado no caso de diminuição do volume circulante efetivo, como na insuficiência cardíaca crônica direita ou biventricular. Objetivo: Detectar os preditores clínicos de agravamento renal na população de pacientes com ICC, caracterizado por dois tipos de regime de dosagem de inibidores da ECA. MÉTODOS: De acordo com um desenho de coorte retrospectiva, seguimos dois grupos de pacientes com ICC - tanto direita quanto biventricular -, todos na classe III da NYHA, tratados com inibidores da ECA (enalapril ou lisinopril, e com fração de ejeção do ventrículo esquerdo (FEVE 10 mg por dia de enalapril ou lisinopril. A disfunção renal agravada (ARD foi definida pelo aumento de Cr > 30% com relação ao segmento basal. O modelo de risco proporcional de Cox foi utilizado para identificar os preditores da ARD entre as seguintes variáveis: os inibidores da ECA com "alta" dosagem, idade, FEVE basal, histórico de repetidas terapias intensivas com diuréticos de alça por via intravenosa (diurético intravenoso, diabete, Cr basal, histórico de hipertensão, pressão arterial sistólica BACKGROUND: Renoprotective effect of ACE-inhibitors has been questioned in case of decreased effective circulating volume, like in right or biventricular chronic heart failure. OBJECTIVE: To detect clinical predictors of renal worsening in CHF patient population characterized by two types of ACE-inhibitor dosing regimens. METHODS: According to a retrospective cohort design, we followed 2 groups of patients with CHF - whether right or biventricular -, all in III NYHA class treated with ACE-inhibitors (enalapril or lisinopril, and with left ventricular ejection fraction (LVEF 10 mg per day of enalapril or lisinopril. Worsened renal failure (ARD was defined by Cr increase >30% from baseline. Cox proportional hazards model was used to identify the predictors of ARD among the following variables

  1. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent (CNRS-UMR); (Einstein); (TAM)

    2011-08-24

    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.

  2. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis.

    Science.gov (United States)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C; Jacobs, William R; Kremer, Laurent

    2010-12-01

    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA_T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development. © 2010 Blackwell Publishing Ltd.

  3. Detecção da tolerância de diferentes espécies de capim-colchão a herbicidas inibidores do fotossistema II utilizando a técnica da fluorescência

    Directory of Open Access Journals (Sweden)

    Leandro Tropaldi

    2015-05-01

    Full Text Available Este estudo teve como objetivo investigar a tolerância ou susceptibilidade das espécies de capim-colchão (Digitaria ciliaris, D. horizontalis e D. nuda a herbicidas inibidores do fotossistema II (FSII, por meio da técnica da fluorescência, utilizando a taxa de transferência de elétrons do FSII como indicador. Para isso, foi conduzido um experimento em esquema fatorial 3x6, com três espécies de capim-colchão e seis tratamentos (ametryn, hexazinone, diuron+hexazinone, amicarbazone, diuron, tebuthiuron e testemunha aplicados em pós-emergência. Foi monitorada a taxa de transporte de elétrons (ETR do FSII em intervalos de tempo crescente e aferida a massa seca das plantas aos 21 dias após a aplicação. A partir dos dados da ETR, calculou-se um valor numérico representativo da taxa de inativação da ETR. Os resultados demonstraram que todas as espécies de capim-colchão estudadas são susceptíveis aos herbicidas ametryn e hexazinone (valores da taxa de inativação da ETR superiores a 10.000. Os herbicidas diuron e tebuthiuron apresentaram menores taxas de inativação da ETR para a D. nuda (3.585 e 3.497, respectivamente e maiores para as espécies D. ciliaris e D. horizontalis (acima de 10.000, enquanto que o herbicida amicarbazone apresentou valor intermediário para D. nuda (7.967. O monitoramento da ETR foi eficiente para verificar a atuação dos herbicidas nas diferentes espécies estudadas

  4. Multiple receptor conformers based molecular docking study of fluorine enhanced ethionamide with mycobacterium enoyl ACP reductase (InhA).

    Science.gov (United States)

    Khan, Akib Mahmud; Shawon, Jakaria; Halim, Mohammad A

    2017-10-01

    A major limitation in current molecular docking method is that of failure to account for receptor flexibility. Herein we report multiple receptor conformers based molecular docking as a practical alternative to account for the receptor flexibility. Multiple (forty) conformers of Mycobacterium Enoyl ACP Reductase (InhA) are generated from Molecular Dynamics simulation and twenty crystallographic structures of InhA bound to different inhibitors are obtained from the Protein Data Bank. Fluorine directed modifications are performed to currently available anti-tuberculosis drug ethionamide. The modified drugs are optimized using B3LYP 6-31G (d,p) level of theory. Dipole moment, frontier orbital gap and thermodynamical properties such as electronic energy, enthalpy and Gibbs free energy of these optimized drugs are investigated. These drugs are subsequently docked against the conformers of InhA. Molecular docking against multiple InhA conformations show variation in ligand binding affinity and suggest that Ser94, Gly96, Lys165 and Ile194 amino acids play critical role on strong drug-InhA interaction. Modified drug N1 showed greater binding affinity compared to EN in most conformations. Structure of PDB ID: 2NSD and snapshot conformer at 5.5ns show most favorable binding with N1 compared to other conformers. Fluorine participates in forming fluorine bonds and contributes significantly in increasing binding affinity. Our study reveal that addition of trifluoromethyl group explicitly shows promise in improving thermodynamic properties and in enhancing hydrogen bonding and non-bonded interactions. Molecular dynamics (MD) simulation show that EN and N1 remained in the binding pocket similar to the docked pose of EN-InhA and E1-InhA complexes and also suggested that InhA binds to its inhibitor in inhibitor-induced folding manner. ADMET calculations predict modified drugs to have improved pharmacokinetic properties. Our study concludes that multiple receptor conformers based

  5. Herbicidas alternativos para o controle de Conyza sumatrensis (Retz. E. H. Walker resistentes aos inibidores da ALS e EPSPs

    Directory of Open Access Journals (Sweden)

    Fernando Machado dos Santos

    2015-12-01

    Full Text Available RESUMO A buva (Conyza sumatrensis, uma das principais plantas daninhas já identificadas no sul do Brasil, vem apresentando controle insatisfatório, em resposta à aplicação dos herbicidas chlorimuron-ethyl e glyphosate. Por esta razão, o objetivo deste estudo foi avaliar herbicidas alternativos, visando ao controle de biótipos de C. sumatrensis, com resistência de nível baixo ao herbicida chlorimuron-ethyl e resistentes ao herbicida glyphosate. O experimento foi realizado em casa de vegetação, entre abril e agosto de 2012, no município de Passo Fundo, RS. O delineamento experimental foi o inteiramente casualizado, com quatro repetições, sendo avaliados 15 tratamentos com herbicidas, além de uma testemunha sem aplicação. As variáveis consideradas foram controle percentual, aos 14, 21 e 28 dias após a aplicação dos tratamentos (DAT e a matéria seca da parte aérea, aos 28 DAT. Como resultados, observou-se que os biótipos foram 100% controlados, aos 28 DAT, pelos tratamentos alternativos de paraquat + diuron; ammonium glufosinate; glyphosate + 2,4-D; glyphosate + ammonium glufosinate; 2,4-D; tembotrione e tembotrione + atrazine. O biótipo 17 evidenciou menor sensibilidade aos herbicidas inibidores da ALS e os biótipos 05, 17 e 20 não foram controlados pelo herbicida glyphosate.

  6. Redistribuição da gordura corporal induzida pelos inibidores de protease em pacientes com Aids Redistribution of body fat induced by HIV protease inhibitors in patients with AIDS

    Directory of Open Access Journals (Sweden)

    Cristina Mansur

    2006-10-01

    Full Text Available Apresentam-se quatro pacientes com infecção pelo vírus da imunodeficiência humana em tratamento com inibidores de proteases há oito meses e três semanas em média. Ressaltam-se o acúmulo de gordura na região dorsocervical e fáscies de lua cheia, semelhante à que ocorre na síndrome de Cushing.Four patients with Human Immunodeficiency Virus Infection in treatment with protease inhibitors for an average of 8 months and 3 weeks are reported. Fat accumulation in the cervical-dorsal region (buffalo hump and moon face, similar to that of Cushing's Syndrome, are highlighted.

  7. Análise da variabilidade da freqüência cardíaca em pacientes hipertensos, antes e depois do tratamento com inibidores da enzima conversora da angiotensina II Analysis of heart rate variability in hypertensive patients before and after treatment with angiotensin II-converting enzyme inhibitors

    Directory of Open Access Journals (Sweden)

    Antônio da Silva Menezes Júnior

    2004-08-01

    Full Text Available OBJETIVO: Comparar a variabilidade de freqüência cardíaca em indivíduos normotensos e hipertensos e observar o comportamento do sistema nervoso autônomo após terapia com inibidores da enzima conversora de angiotensina II. MÉTODO: Estudados 286 pacientes com diagnóstico de hipertensão arterial, pela 1ª vez, e divididos em 4 grupos, conforme a pressão arterial diastólica (PAD: grupo A - PAD110 mmHg. Os pacientes do grupo A (normais e do grupo C (HA moderada, somando 110 e 79 pacientes, respectivamente, submeteram-se ao Holter-ECG 24h com análise de variabilidade de freqüência cardíaca no domínio do tempo (DT e no domínio da freqüência (DF. O grupo C foi tratado com inibidores da ECA durante 3 meses, e após esse período novamente avaliado com Holter-ECG 24h e variabilidade da freqüência cardíaca, e os valores comparados com os normotensos. RESULTADOS: Os parâmetros SDNN, PNN50 (DT e o espectro LF (DF foram significativamente diferentes para os dois grupos, com valores notadamente diminuídos em hipertensos (pOBJECTIVE: To compare heart rate variability in normotensive and hypertensive individuals and to observe the behavior of the autonomic nervous system after treatment with angiotensin II-converting enzyme inhibitors. METHOD: The study comprised 286 patients diagnosed with arterial hypertension (AH for the first time and divided into 4 groups according to diastolic blood pressure (DBP levels: group A - DBP110 mmHg. Group A (110 healthy individuals and group C (79 patients with moderate AH underwent 24-hour Holter-ECG with analysis of heart rate variability in time domain (TD and frequency domain (FD. The group C patients were treated with ACE inhibitors for 3 months, and, after this period, they underwent a new 24-hour Holter-ECG study for assessing heart rate variability, the values being compared with those of normotensive individuals. RESULTS: The SDNN and PNN50 parameters (TD, and the LF spectrum (FD were

  8. Resistência de Eleusine indica aos inibidores de ACCase Eleusine indica resistance to ACCase inhibitors

    Directory of Open Access Journals (Sweden)

    R.A. Vidal

    2006-01-01

    Full Text Available Dentre as causas da ineficácia no controle de plantas daninhas destaca-se a resistência delas aos herbicidas. Os objetivos deste trabalho foram avaliar a suspeita de resistência de Eleusine indica a inibidores de acetil-CoA carboxilase (ACCase e investigar a ocorrência de resistência cruzada entre os inibidores de ACCase. Biótipo de Eleusine indica originado do Mato Grosso com suspeita de resistência aos herbicidas inibidores de ACCase foi avaliado em casa de vegetação na sua suscetibilidade para diversos produtos do grupo dos ariloxifenoxipropionatos e cicloexanodionas. Estudos de resposta à dose confirmaram que o biótipo era 18 vezes mais insensível ao sethoxydim do que biótipo suscetível nunca aspergido com herbicidas. Também se constatou resistência cruzada ao fenoxaprop, cyhalofop, propaquizafop e butroxydim. Não se observou resistência cruzada aos produtos fluazifop, haloxyfop, quizalofop e clethodim.Among the causes for weed control inefficacy, the worst one is resistance to herbicides. The objectives of this work were to evaluate an Eleusine indica biotype suspected of resistance to ACCase inhibitors and to investigate the occurrence of cross- resistance to several ACCase inhibitors. One biotype of Eleusine indica originated from Mato Grosso with suspected resistance to ACCase inhibitors was evaluated in a greenhouse in relation to its susceptibility to several products of the ariloxyphenoxypropionate and cyclohexanedione groups. Studies on dose response confirmed that the suspected biotype was 18 times more insensitive to sethoxydim than the susceptible biotype that had never been treated with herbicides. Cross-resistance was confirmed for fenoxaprop, cyhalofop, propaquizafop and butroxydim. No cross-resistance was observed with fluazifop, haloxyfop, quizalofop, and clethodim.

  9. Bioensaio rápido de determinação da sensibilidade da acetolactato sintase (ALS a herbicidas inibidores Rapid bioassay to determine the sensitivity of acetolactate synthase (ALS to inhibitor herbicides

    Directory of Open Access Journals (Sweden)

    Patrícia Andrea Monqueiro

    2001-03-01

    Full Text Available Foi avaliada a atividade da acetolactato sintase (ALS, em plantas resistentes e suscetíveis de B. pilosa e A. quitensis após a aplicação de herbicidas inibidores da ALS. O método baseia-se na utilização do ácido ciclopropanodicarboxílico (CPCA para inibir a cetoácido reductoisomerase (KARI, enzima que catalisa a reação seguinte do acetolactato na cadeia de biossíntese dos aminoácidos valina, leucina e isoleucina, provocando assim, o acúmulo de acetolactato, que na presença de um ácido forte forma acetoína. A base para a distinção entre os biotipos resistentes e suscetíveis é a quantidade de acetoína formada, que será maior nos biotipos em que a enzima ALS não sofreu inibição, ou seja, nos biotipos resistentes. A quantificação da acetoína acumulada ocorreu através da formação de um complexo colorido vermelho, devido a reação entre acetoína, creatina e naftol, cuja densidade ótica a 530 nm é proporcional à concentração do acetolactato formado na reação. Sendo assim, foi desenvolvido um ensaio utilizando este método após a aplicação dos herbicidas chlorimuron-ethyl e imazethapyr nos biotipos R e S de Bidens pilosa, Amaranthus quitensis no estádio de dois pares de folhas. O bioensaio demonstrou que a enzima ALS dos biotipos resistentes é insensível aos herbicidas inibidores da ALS e que este tipo de bioensaio é uma forma rápida e eficaz de diferenciação entre biotipos resistentes e suscetíveis.In order to compare the acetolactate synthase (ALS activity of resistant and susceptible biotypes of Bidens pilosa and Amaranthus quitensis to ALS inhibitor herbicides, a method based on ciclopronocarboxilic acid (CPCA to inhibit the enzyme ketoacidredutoisomerase (KARI is used. This enzyme catalyzes the reaction after acetolactate in the biosynthesis reaction chain of the aminoacids valine, leucine and isoleucine. In the presence of a KARI inhibitor, carbon from pyruvate flows through the branched chain

  10. Professor facilitador e inibidor da criatividade segundo universitários The teacher who facilitates or inhibits creativity according to undergraduates

    Directory of Open Access Journals (Sweden)

    Tales Vilela Santeiro

    2004-04-01

    Full Text Available Diante do reduzido número de pesquisas relacionando criatividade ao contexto universitário brasileiro, objetiva-se caracterizar o professor facilitador e o inibidor da criatividade, segundo opinião de calouros de Biomedicina (N=117 de uma universidade particular do Nordeste Paulista. Utiliza-se como instrumento um questionário com duas perguntas abertas, focalizando características do professor que facilita e do que inibe a criatividade dos alunos. As respostas foram avaliadas por categorias e por correlação de julgamentos de dois juízes. Os dados foram tratados quantitativamente (cálculos descritivos e Qui-quadrado. As características facilitadoras da criatividade foram relacionadas ao preparo do professor e as inibidoras foram referentes ao modo como o professor se relaciona com os alunos.In view of the reduced amount of researches relating creativity and the Brazilian university context, this work aims to characterize the teachers who facilitate and the ones who inhibit creativity according to the opinion of freshmen in Biomedicine (N=117 from private universities in the northeastern area of São Paulo state. It uses, as instrument, a two-question questionnaire focusing on the teacher’s characteristics that facilitate or inhibit the students’ creativity. The answers were assessed by categories and by the co-relation of two judges’ analyses. The data were quantitatively approached (descriptive calculus and Chi-square test. The creativity facilitating characteristics were associated to the teachers’ professional skills and the inhibiting ones refer to the teachers’ relationship with students.

  11. AMPLIFIKASI DAN IDENTIFIKASI MUTASI REGIO PROMOTER inhA PADA ISOLAT Mycobacterium tuberculosis MULTIDRUG RESISTANCE DENGAN TEKNIK POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum

    2014-10-01

    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  12. Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor

    Directory of Open Access Journals (Sweden)

    María Martínez-Hoyos

    2016-06-01

    Full Text Available Despite being one of the first antitubercular agents identified, isoniazid (INH is still the most prescribed drug for prophylaxis and tuberculosis (TB treatment and, together with rifampicin, the pillars of current chemotherapy. A high percentage of isoniazid resistance is linked to mutations in the pro-drug activating enzyme KatG, so the discovery of direct inhibitors (DI of the enoyl-ACP reductase (InhA has been pursued by many groups leading to the identification of different enzyme inhibitors, active against Mycobacterium tuberculosis (Mtb, but with poor physicochemical properties to be considered as preclinical candidates. Here, we present a series of InhA DI active against multidrug (MDR and extensively (XDR drug-resistant clinical isolates as well as in TB murine models when orally dosed that can be a promising foundation for a future treatment.

  13. Mutants of common bean alpha-amylase inhibitor-2 as an approach to investigate binding specificity to alpha-amylases Mutantes do inibidor-2 de alfa-amilase do feijão-comum para investigação da especificidade de ligação a alfa-amilases

    Directory of Open Access Journals (Sweden)

    Maria Cristina Mattar da Silva

    2004-03-01

    Full Text Available Despite the presence of a family of defense proteins, Phaseolus vulgaris can be attacked by bruchid insects resulting in serious damage to stored grains. The two distinct active forms of a-amylase inhibitors, a-AI1 and a-AI2, in P. vulgaris show different specificity toward a-amylases. Zabrotes subfasciatus a-amylase is inhibited by a-AI2 but not by a-AI1. In contrast, porcine a-amylase is inhibited by a-AI1 but not by a-AI2. The objective of this work was to understand the molecular basis of the specificity of two inhibitors in P. vulgaris (a-AI1 and a-AI2 in relation to a-amylases. Mutants of a-AI2 were made and expressed in tobacco plants. The results showed that all the a-AI2 mutant inhibitors lost their activity against the insect a-amylases but none exhibited activity toward the mammalian a-amylase. The replacement of His33 of a-AI2 with the a-AI1-like sequence Ser-Tyr-Asn abolished inhibition of Z. subfasciatus a-amylase. From structural modeling, the conclusion is that the size and complexity of the amylase-inhibitor interface explain why mutation of the N-terminal loop and resultant abolition of Z. subfasciatus a-amylase inhibition are not accompanied by gain of inhibitory activity against porcine a-amylase.Apesar de possuir uma família de proteínas de defesa, o feijão-comum (Phaseolus vulgaris L. pode ser atacado por insetos bruquídeos causando sérios danos aos grãos armazenados. O P. vulgaris possui duas formas ativas de inibidores de a-amilases, denominadas a-AI1 e a-AI2, que apresentam diferentes especificidades em relação às a-amilases. A a-amilase de Zabrotes subfasciatus é inibida por a-AI2 mas não por a-AI1. Em contraste, a a-amilase pancreática de porco é inibida por a-AI1 mas não é por a-AI2. O objetivo deste trabalho foi entender as bases moleculares da especificidade desses inibidores em relação às a-amilases. Para tanto, foram construídos mutantes do a-AI2, os quais foram expressados em plantas de fumo

  14. Os inibidores de tirosino quinase de segunda geração The inhibitors of tyrosine kinase

    Directory of Open Access Journals (Sweden)

    Márcia T. Delamain

    2008-04-01

    Full Text Available O imatinibe tem sido confirmado como terapia de primeira linha para a Leucemia Mielóide Crônica (LMC por apresentar respostas duradouras na maior parte dos pacientes, principalmente nos que se encontram em fase precoce da doença. Entretanto, resistência ou intolerância ao imatinibe podem ocorrer. A resistência ao imatinibe ocorre com muito mais freqüência em fases mais avançadas da doença, sendo a causa mais comum o desenvolvimento de mutações no sítio BCR-ABL. Em face deste problema, novos inibidores de tirosino quinase têm sido desenvolvidos, com maior potência, diminuindo assim a chance de desenvolvimento de resistência ao tratamento. O nilotinibe e o dasatinibe são dois exemplos de inibidores de segunda geração de tirosino quinase recentemente aprovados. Ambos têm demonstrado excelentes resultados em pacientes que desenvolvem resistência ou são intolerantes ao imatinibe.Despite the success with imatinib as the first choice treatment of chronic myeloid leukemia (CML, there is still a subset of patients that do not respond optimally to or are intolerant of this drug or lose response. Imatinib resistance can occur at any phase, but it is more frequent in advanced phases, with mutations in the BCR-ABL kinase domain being the most common mechanism of resistance. More potent tyrosine kinase inhibitors have been developed that can overcome resistance to imatinib. Nilotinib and dasatinib are good examples of new tyrosine kinase inhibitors that are available. With these new agents, patients who develop imatinib resistance or those unable to tolerate imatinib treatment can achieve significant clinical responses.

  15. Estudos visando a sintese total da estavamicina, um inibidor do virus da herpes

    OpenAIRE

    Luciana Souza Alcantara Jardim

    2000-01-01

    Resumo: O vírus Epstein-Barr (EBV) é um vírus causador da herpes em seres humanos, infectando linfócitos e células epiteliais. Estima-se que este vírus infecta aproximadamente 90% da população mundial. Em 1995, Estavamicina, um novo produto natural da família dos pirrolocetoindanos foi isolado da cultura líquida de Streptomyces sp. Estavamicina mostrou atividade inibidora moderada contra a ligação do fator de transcrição EBV BZLF1 com o DNA com um valor de IC50 = 50 mM. Estavamicina possui um...

  16. Resistence of Euphorbia Heterophylla L. to ALS-inhibiting herbicides in soybean Resistência de Euphorbia Heterophylla L. aos herbicidas inibidores da ALS na cultura da soja

    Directory of Open Access Journals (Sweden)

    Gerson Augusto Gelmini

    2005-10-01

    prolongado de produtos com o mesmo mecanismo de ação pode provocar a manifestação de biótipos resistentes, como ocorreu com Euphorbia heterophylla L. aos inibidores da ALS nos Estados do Paraná, Rio Grande do Sul e São Paulo. Para verificar possíveis novos casos, bem como alternativas para prevenção e manejo, foram coletadas sementes dessa espécie daninha na região de Caarapó (MS, em plantas que sobreviveram a tratamentos onde esses herbicidas foram sistematicamente aplicados nos últimos anos. Em casa-de-vegetação, comparou-se o efeito dos principais herbicidas usados em pós-emergência na cultura da soja sobre o biótipo com histórico de resistência e sobre um suscetível sendo instalado, um experimento em blocos ao acaso para cada produto (n = 4. Os herbicidas foram aplicados quando as plantas apresentavam de duas a quatro folhas verdadeiras nas doses zero, uma, duas, quatro e oito vezes a recomendação do fabricante. Aos vinte dias após a aplicação, foram avaliados parâmetros relativos ao controle e produção de fitomassa epígea com base nos valores de DC50 e GR50. Foi determinado também o fator de resistência (FR, que representa o número de vezes em que a dose necessária para proporcionar 50% de controle ou de redução na produção de fitomassa epígea do biótipo suscetível deve ser aumentada, para que possa ocorrer o mesmo efeito sobre o resistente. O biótipo resistente apresentou diferentes níveis de resistência aos herbicidas chlorimuron-ethyl e imazethapyr, demonstrando ser portador de resistência cruzada aos inibidores da ALS dos grupos das sulfoniluréias e imidazolinonas. O fator de resistência para chlorimuron-ethyl foi superior a 16,5 para a porcentagem de controle e a 16,9 para a produção de fitomassa epígea, enquanto que para imazethapyr, o fator de resistência foi superior a 25,0 e a 23,5, respectivamente. O biótipo resistente foi eficientemente controlado nos tratamentos com os herbicidas fomesafen (250 g ha-1

  17. Competitiveness of ALS inhibitors resistant and susceptible biotypes of Greater Beggarticks (Bidens subalternans Competitividade de biótipos de Picão-Preto (Bidens subalternans Resistente e euscetível aos inibidores da ALS

    Directory of Open Access Journals (Sweden)

    F.P. Lamego

    2011-06-01

    Full Text Available The continuous use of ALS-inhibiting herbicides has led to the evolution of herbicide-resistant weeds worldwide. Greater beggarticks is one of the most troublesome weeds found in the soybean production system in Brazil. Recently, a greater beggarticks biotype that is resistant (R to ALS inhibitors due to Trp574Leu mutation in the ALS gene was identified. Also, the adaptive traits between susceptible (S and R to ALS inhibitors biotypes of greater beggarticks were compared. Specifically, we aimed to: (1 evaluate and compare the relative growth rates (RGR between the biotypes; (2 analyze the seed germination characteristics of R and S biotypes under different temperature conditions; and (3 evaluate their competitive ability in a replacement series study. The experiments were conducted at the University of Arkansas, USA, in 2007 and at Universidade Federal do Rio Grande do Sul (Federal University of Rio Grande do Sul, Brazil, in 2008. Plant proportions for replacement series studies were respectively 100:0, 75:25, 50:50, 25:75 and 0:100, with a total population of 150 plants m-2. There was no difference in RGR between R and S biotypes. The R-biotype germination rate was lower than that of the S biotype. However, at low temperature conditions (15 ºC, the reverse was observed. In general, there is no difference in the competitive ability between R and S greater beggarticks biotypes.O uso contínuo de herbicidas inibidores da ALS tem levado à evolução de plantas daninhas resistentes mundialmente. Picão-preto é uma das mais importantes plantas daninhas no sistema de produção de soja no Brasil. Recentemente, foi identificado um biótipo de picao-preto resistente (R aos inibidores da ALS devido à mutação Trp574Leu no gene ALS. Também, foram comparadas características adaptativas entre biótipos de picao-preto suscetível (S e R aos inibidores da ALS. Especificamente, os objetivos deste trabalho foram: (1 avaliar e comparar o crescimento

  18. Depressão vascular no idoso: resposta ao tratamento antidepressivo associado a inibidor das colinesterases Vascular depression in elderly: response to treatment with antidepressant associated to cholinesterase inhibitor

    Directory of Open Access Journals (Sweden)

    Ricardo Barcelos

    2007-01-01

    Full Text Available CONTEXTO: Entre os transtornos neuropsiquiátricos ocasionados por eventos cerebrovasculares, a depressão vascular é pouco diagnosticada por médicos não especialistas, causando aumento da morbimortalidade de pacientes idosos. CASO CLÍNICO: Trata-se de um paciente com 67 anos que apresentou resposta parcial a tratamento com inibidores da recaptura de serotonina e efeitos adversos autonômicos graves com outros antidepressivos. A adição de rivastigmina ao citalopram promoveu sucesso terapêutico, com redução de 23 para 7 pontos, na escala de Hamilton para depressão. DISCUSSÃO: O resultado obtido traz novas perspectivas para o tratamento da depressão vascular, sendo necessários ensaios clínicos controlados que evidenciem o benefício da adição dos inibidores das colinesterases aos antidepressivos no tratamento destes pacientes.CONTEXT: Among neuropsychiatric disorders caused by cerebrovascular factors, vascular depression is diagnosed in a small degree by general practitioners, causing morbid-mortality increase in elderly. CASE REPORT: That is a case of a 67 year-old-man with partial response after treatment with a Selective Serotonin Receptors Inhibitor, and severe autonomic adverse effects with other antidepressants. The addition of rivastigmine to citalopram resulted in a therapeutic success, with a reduction of 23 to 7 points on the Hamilton Depressive Scale (HAM-D. DISCUSSION: The result obtained brings new perspectives to the treatment of vascular depression, providing that randomized controlled trials with larger sample sizes confirm the positive effect of the addition of a cholinesterase inhibitor to antidepressants in the treatment of these patients.

  19. Repercussão cardiovascular, com e sem álcool, do carbonato de lodenafila, um novo inibidor da PDE5

    OpenAIRE

    Silva, Adauto Carvalho; Toffoletto, Odaly; Lucio, Luiz Antonio Galvão; Santos, Paula Ferreira dos; Afiune, Jorge Barros; Massud Filho, João; Tufik, Sergio

    2010-01-01

    FUNDAMENTO: A disfunção erétil afeta um grande número de homens no mundo e os inibidores de PDE 5 (iPDE5) estão entre os principais métodos de tratamento desses pacientes. O consumo social de álcool e o ato sexual apresentam uma relação considerável. Portanto, a associação entre álcool e iPDE5 pode ocorrer. O carbonato de lodenafila é um novo iPDE5 desenvolvido por uma empresa brasileira. OBJETIVO: Avaliar a repercussão cardiovascular do carbonato de lodenafila, associado ou não ao álcool, as...

  20. Encoded library technology as a source of hits for the discovery and lead optimization of a potent and selective class of bactericidal direct inhibitors of Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas

    2014-02-27

    Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.

  1. Uso combinado da laserterapia de baixa potência e da inibição da ciclooxigenase-2 na reepitelização de ferida incisional em pele de camundongos: um estudo pré-clínico

    OpenAIRE

    Santuzzi,Cíntia Helena; Buss,Hygor Franca; Pedrosa,Diego França; Freire,Martha Oliveira Vieira Moniz; Nogueira,Breno Valentim; Gonçalves,Washington Luiz Silva

    2011-01-01

    FUNDAMENTOS: A laserterapia de baixa potência e os inibidores seletivos da ciclooxigenase-2 (ICOX2) vem sendo muito utilizados para modular a resposta inflamatória, entretanto, os seus efeitos na reepitelização de feridas não são bem compreendidos. OBJETIVO: Avaliar os efeitos isolados e combinados da laserterapia de baixa potência e da ICOX2 na reepitelização de ferida incisional na pele de camundongos. MÉTODO: Foi induzida uma ferida de 1 cm no dorso de cada camundongo, que foram divididos ...

  2. HERBICIDAS INIBIDORES DO FOTOSSISTEMA II – PARTE I /\tPHOTOSYSTEM II INHIBITOR HERBICIDES - PART I

    Directory of Open Access Journals (Sweden)

    ILCA P. DE F. E SILVA

    2013-11-01

    Full Text Available O controle químico tem sido o mais utilizado em grandes áreas de plantio, principalmente por ser um método rápido e eficiente. Os herbicidas inibidores do fotossistema II (PSII são fundamentais para o manejo integrado de plantas daninhas e práticas conservacionista de solo. A aplicação é realizada em pré-emergência ou pós-emergência inicial das plantas daninhas. A absorção é pelas raízes, tendo como barreira as estrias de Caspari, sendo a translocação realizada pelo xilema. O processo de absorção e translocação também são dependentes das próprias características do produto, como as propriedades lipofílicas e hidrofílicas, as quais podem ser medidas através do coeficiente de partição octanol-água (Kow. A inibição da fotossíntese acontece pela ligação dos herbicidas deste grupo ao sítio de ligação da QB, na proteína D1 do fotossistema II, o qual se localiza na membrana dos tilacóides dos cloroplastos, causando, o bloqueia do transporte de elétrons da QA para QB, interrompendo a fixação do CO2 e a produção de ATP e NAPH2.

  3. Purificação parcial de inibidores de tripsina de sementes de Caesalpinia ferrea e Swartzia polyphylla e o efeito dos extratos protéicos sobre fungos fitopatogênicos

    Directory of Open Access Journals (Sweden)

    Adriana Bariani

    2012-06-01

    Full Text Available Sementes de leguminosas apresentam alta concentração de inibidores de tripsina; estas proteínas estão envolvidas no metabolismo celular e também em mecanismos de defesa vegetal. A fim de confirmar ou não, a possível ação fungicida destas proteínas a partir de extratos de sementes de leguminosas arbóreas, o objetivo deste estudo foi detectar inibidores de tripsina em sementes de Caesalpinia ferrea (CfTI e Swartzia polyphylla (SpTI e testar os extratos contra os fungos fitopatogênicos Colletotrichum guaranicola, Corynespora cassiicola, Fusarium oxysporum e Sclerotium rolfsii, avaliando o crescimento micelial e a esporulação. Para tanto, amostras do material biológico vegetal, sementes finamente pulverizadas, foram submetidas à extração em NaCl 150 mM. Os extratos protéicos foram parcialmente purificados em coluna Sephadex G-100, submetidos à detecção dos inibidores e SDS-PAGE (12,5% e, utilizados nos bioensaios contra os fungos. O perfil eletroforético revelou uma única banda em CfTI e oito bandas em SpTI. Os extratos de C. ferrea e S. polyphylla exibiram efeito na diminuição da esporulação dos fungos testados, mas S. rolfsii foi inibido apenas por C. ferrea. Quanto ao crescimento micelial, os dois extratos tiveram efeito sobre F. oxysporum e S. rolfsii, ao passo que C. guaranicola foi inibido apenas por S. polyphylla, e C. cassiicola por C. ferrea. Concluiu-se que sementes de C. ferrea e S. polyphylla apresentam inibidores de tripsina. Além disso, os resultados sugerem que estas espécies de leguminosas arbóreas são promissoras no que concerne à prospecção de fungicidas naturais, uma vez que os extratos diminuíram o crescimento micelial e a esporulação de C. guaranicola, C. cassiicola, F. oxysporum e S. rolfsii.

  4. Estado da Arte dos Doentes com Cancro do Pulmão de Não Pequenas Células: Doença Avançada e Mutação EGFR Positiva

    Directory of Open Access Journals (Sweden)

    Bárbara Parente

    2018-02-01

    Full Text Available O aparecimento de terapêuticas dirigidas, trouxe na última década uma enorme esperança para os doentes com cancro do pulmão. Os inibidores dos recetores do fator de crescimento epidérmico (EGFR, erlotinib e gefitinib (inibidores de tirosina quinase TKI, estiveram na vanguarda das mudanças da prática de tratamento para doença avançada do cancro do pulmão de não pequenas células (CPNPC, nos últimos 10 anos, com a descoberta de mutações EGFR que conferem sensibilidade a inibidores da tirosina quinase no CPNPC. O ano de 2004, marcou o início da era da medicina de precisão para o cancro do pulmão. Os estudos randomizados de fase III investigaram o papel de dois inibidores de EGFR-TKI, gefitinib e erlotinib, como tratamento de primeira linha em comparação com a quimioterapia à base de platina, em doentes com CPNPC doença avançada com mutações de ativação do EGFR. Um TKI de segunda geração (afatinib encontra-se já aprovado pela EMA com a mesma indicação após resultados dos clínicos do Lux Lung 3 e 6. No entanto, os doentes com mutação EGFR positiva, regra geral, progridem após 10-12 meses de tratamento, necessitando de novas opções terapêuticas. Inibidores de 3ª geração entretanto desenvolvidos (dirigidos à mutação de resistência do T790M, e outras, após rebiópsia, demostraram uma notável eficácia, em doentes já tratados e com um perfil de toxicidade ainda menor que os TKI de 1ª e 2ª geração. Recebido: 30/05/2016 - Aceite: 03/06/2016

  5. Vida de vaso de inflorescências de Epidendrum ibaguense Kunth tratadas com inibidores de etileno

    Directory of Open Access Journals (Sweden)

    MARCELO AMARAL DE MOURA

    2010-12-01

    Full Text Available O objetivo deste trabalho foi avaliar a influência de inibidores da síntese e ação do etileno, incluindo ácido aminooxiacético (AOA, ácido aminoetoxivinilglicina (AVG, ácido acetilsalicílico (AAS e tiossulfato de prata (STS, aplicados na forma de pulverização ou solução de condicionamento sobre a qualidade de flores cortadas de Epidendrum ibaguense. As hastes foram colhidas e imediatamente submetidas aos seguintes tratamentos: (1 pulverização com 1,0 mM de AOA; (2 pulverização com 1,0 mM de AVG; (3 pulverização com 1,0 mM de AAS; (4 pulsing com 2,0 mM de STS, por 30 minutos; (5 pulverização com 1,0 mM de AOA + pulsing com 2,0 mM de STS, por 30 minutos; (6 pulverização com 1,0 mM de AVG + pulsing com 2,0 mM de STS; (7 pulverização com 1,0 mM de AAS + pulsing com 2,0 mM de STS; (8 pulverização + pulsing com água desionizada (controle. Após os tratamentos, as hastes foram mantidas em vasos com água desionizada, renovada a cada dois dias, para evitar o desenvolvimento de microrganismos. Ao final da longevidade, o qual variou de acordo com o tratamento, as inflorescências submetidas ao AVG e AVG + STS mostraram a maior porcentagem de abertura floral, visto que promoveram aumento de 49 e 88% em relação ao controle. A taxa de abscisão também foi influenciada pelos tratamentos, pois ao oitavo dia, as inflorescências controle apresentaram cerca de 51% de queda das flores, cujo início ocorreu, principalmente, a partir do quinto dia. As inflorescências tratadas ao AAS, AOA, STS, AVG, STS + AAS, STS + AOA e STS + AVG mostraram redução de 11, 39, 47, 71, 38, 61 e 86%, respectivamente. Além disso, houve atraso de 1, 2, 3, 4, 3, 3 e 8 dias para o início da abscisão, respectivamente. A longevidade de E. ibaguense foi afetada pelos inibidores do etileno, mas com exceção de AAS e AOA, os demais tratamentos foram significativamente maiores que o controle. O STS, AVG, AAS + STS, AOA + STS e AVG + STS tiveram longevidade

  6. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  7. Agronomic performance of rice to the use of urease inhibitor in two cropping systems Desempenho agronômico do arroz irrigado ao uso de inibidor de urease em dois sistemas de cultivo

    Directory of Open Access Journals (Sweden)

    Enio Marchesan

    2013-09-01

    Full Text Available The use of urea coated with urease inhibitor may become a useful tool for increasing the efficiency of nitrogen top-dressing in rice crop, thereby reducing nutrient losses through volatilization of NH3 (ammonia. Thus, the aim of this study was to evaluate the volatilization of NH3 and the response of rice to the use of urea coated with urease inhibitor in two cropping systems, no-tillage and conventional. For this purpose, field experiments were developed in the agricultural years 2007/2008 and 2008/2009, in UFSM in Santa Maria-RS. The design was randomized blocks in bifactorial scheme (2x5 with two sources, urea and urea + NBPT and five intervals of water intake (0; 3; 6; 9; 12 days after application of nitrogen sources. The results of two seasons show that the urease inhibitor present in urea slows and decrease the conversion of N to NH3, reducing the losses by volatilization, compared to urea without inhibitor. Among the systems, the losses are magnified in the no-tillage cropping system. The behavior of the response variable in relation to productivity is variable in two cropping systems used in this study and the stress caused to the rice plant by the late start of the irrigation is more damaging than the losses caused by the volatilization of NH3.A utilização de uréia recoberta com inibidor de urease pode tornar-se uma ferramenta útil para aumentar a eficiência da adubação nitrogenada em cobertura na cultura do arroz irrigado, diminuindo assim perdas do nutriente por volatilização de NH3 (amônia. Com isso, o objetivo desse trabalho foi avaliar a volatilização de NH3 e a resposta do arroz irrigado ao uso de uréia recoberta com inibidor de urease em dois sistemas de cultivo, direto e convencional. Para tanto, conduziram-se experimentos em campo, nos anos agrícolas 2007/2008 e 2008/2009, na UFSM em Santa Maria-RS. O delineamento utilizado foi o delineamento experimental blocos completos casualizados em esquema bifatorial (2x5

  8. Resposta do arroz irrigado ao uso de inibidor de urease em plantio direto e convencional Response of rice to the use of urease inhibitor in no-tillage and conventional

    Directory of Open Access Journals (Sweden)

    Mara Grohs

    2011-04-01

    Full Text Available O objetivo do presente trabalho foi avaliar a volatilização de N-NH3 e a resposta do arroz irrigado ao uso de ureia com inibidor de urease em dois sistemas de cultivo, direto e convencional. Para tanto, desenvolveu-se um experimento em campo, no ano agrícola 2008/09, na UFSM em Santa Maria/RS. O delineamento utilizado foi de blocos ao acaso em esquema bifatorial (2x5, sendo o fator A constituído por ureia e ureia revestida com B e Cu (inibidor de urease e o fator B composto por diferentes intervalos de entrada de água (0, 3, 6, 9, 12 dias após a aplicação das fontes de nitrogênio (N. Os resultados demonstram que o inibidor de urease retarda e diminui a conversão de N para NH3, reduzindo as perdas por volatilização, comparativamente à ureia sem inibidor. Entre os sistemas, as perdas são potencializadas no sistema plantio direto. O inibidor de urease não traz benefícios à produtividade em qualquer um dos sistemas de cultivo utilizados e o estresse causado na planta de arroz pelo atraso no início da irrigação é mais prejudicial do que as perdas causadas pela volatilização de N-NH3.The objective of this work was to measure the N-NH3 volatilization and the response of irrigated rice to the use of urea with urease inhibitor in two cropping systems, no-tillage and conventional. For this, an experiment in field was performed in the crop year 2008/09, at the UFSM in Santa Maria/RS. A random block in factorial scheme (2x5, with the factor A consisting of two nitrogen (N sources, urea and urea coated with B and Cu (urease inhibitor and the factor B consisting of different intervals of water intake (0, 3, 6, 9, 12 days after the application of N sources. The results demonstrated that the urease inhibitor slows and decreases the conversion of N to NH3, reducing the losses by volatilization, comparatively to urea without inhibitor. Between the systems, the losses were increased in the no-tillage system. The urease inhibitor does not add

  9. APLICAÇÃO FARMACÊUTICA DE INIBIDORES DE PROTEASES: UMA PROSPECÇÃO TECNOLÓGICA

    Directory of Open Access Journals (Sweden)

    Kátia da Conceição Machado

    2014-09-01

    Full Text Available As proteases são enzimas proteolíticas que degradam proteínas por quebra de ligações peptídicas específicas. Muitas proteases estão associadas com doenças como o câncer, a osteoporose, doenças inflamatórias e neurodegenerativas, bem como doenças parasitárias, virais ou bacterianas. Essas proteases estão envolvidas na patogênese de várias doenças e podem ser bons alvos terapêuticos, juntamente com os seus inibidores específicos. Essa prospecção teve como objetivo analisar as patentes que envolvem inibidores de proteases com aplicações farmacêuticas. A prospecção foi realizada tendo como base os pedidos de patente depositados em 4 bancos de dados analisados, sendo eles, Instituto Nacional de Propriedade Industrial (INPI, no European Patent Office (EPO, United States Patent and Trademark Office (USPTO e World Intellectual Property Organization (WIPO. Após a pesquisa foi constatado apenas 13 patentes, demostrando que em 2007 ocorreu o pico de depósito e que os Estados Unidos e a França são os maiores depositários. Quanto a classificação internacional de patentes, a maioria corresponde a A61K, que trata de preparações para finalidades médicas, odontológicas ou higiênicas. Contudo, foi observado que ainda existe um pequeno número de patentes, sendo necessário um interesse maior na aplicação farmacêutica para os inibidores de proteases

  10. Determinação da Cinética Ruminal da Proteína de Vários Alimentos Utilizando o Método de Inibidores In Vitro Determination of Ruminal Protein Kinetics of Feedstuffs Using an Inhibitor in vitro Method

    Directory of Open Access Journals (Sweden)

    Fernando Iván Londoño Hernández

    2002-02-01

    Full Text Available O objetivo do presente trabalho foi estimar os parâmetros cinéticos da degradação dos compostos nitrogenados de 24 alimentos concentrados e 14 volumosos, por intermédio do método de inibidores in vitro, utilizando-se o sistema Kjeldahl. Foi utilizado líquido ruminal oriundo de bovino recebendo dieta com 60% de volumoso e 40% de concentrado. Na preparação de 1000 mL do meio fermentador, utilizaram-se 800 mL do inóculo, 2 g de NaHCO3 em 50 mL de H2O destilada, 3,2 g de pectina em 100 mL de solução McDougall, 0,234 mL de mercaptoethanol, 0,195 g de sulfato de hidrazina em 25 mL de solução McDougall e 0,045 g de cloranfenicol em 25 mL de solução McDougall. Ao meio fermentador adicionaram-se 3,2 g de amido, 3,2 g de xilose e 0,16 mL de antiespumante (Antifoam 204, Sigma Chemical Co. A-6426. Foi determinado o desaparecimento dos compostos nitrogenados dos alimentos nos tempos 0 e 2 horas, incubados na quantidade de, aproximadamente, 1,875 mg de N para cada tubo de ensaio. As estimativas referentes às taxas de degradação mostraram que os alimentos farelo de glúten de milho, caseína, grão de amendoim moído, cama de frango contendo casca de café como material absorvente e raspa de mandioca possuem proteínas de rápida degradação, observando-se as mais lentas taxas de degradação para o fubá de milho, a farinha de carne e ossos, a cama de frango contendo capim-elefante como material absorvente, a levedura de cana-de-açúcar e a farinha de penas. De maneira geral, os parâmetros da degradação apresentaram resultados semelhantes aos reportados in situ. O método dos inibidores in vitro permitiu uma avaliação rápida e eficiente da cinética de degradação da proteína bruta dos alimentos concentrados. As taxas de degradação de alguns alimentos volumosos foram subestimadas.The objective of this work was to evaluate the kinetics parameters of nitrogen compounds degradation for 24 concentrate feedstuffs and 14 grasses, by

  11. Prospeção de inibidores de serinoproteinases em folhas de leguminosas arbóreas da floresta Amazônica Prospecting serine proteinase inhibitors in leaves from leguminous trees of the Amazon forest

    Directory of Open Access Journals (Sweden)

    Larissa Ramos Chevreuil

    2011-03-01

    Full Text Available Os inibidores de proteinases são proteínas extensivamente investigadas nos tecidos de estocagem, mas pouco prospectadas em outros tecidos vegetais. O objetivo deste estudo foi detectar a presença de inibidores de serinoproteinases em extratos foliares de quinze espécies de leguminosas arbóreas da Amazônia. As espécies estudadas foram: Caesalpinia echinata, C. ferrea, Cedrelinga cateniformis, Copaifera multijuga, Dinizia excelsa, Enterolobium contortisiliquum, E. maximum, E. schomburgkii, Leucaena leucocephala, Ormosia paraensis, Parkia multijuga, P. pendula, P. platycephala, Swartzia corrugata e S. polyphylla. Folhas foram coletadas, secas a 30ºC durante 48 h, trituradas e submetidas à extração com NaCl (0,15 M, 10% p/v resultando no extrato total. Ensaios foram executados para determinar a concentração de proteínas e detectar a atividade inibitória contra a tripsina e quimotripsina bovina. Os teores de proteínas bruta e solúvel nos extratos foliares variaram de 7,9 a 31,2% e 1,3 a 14,8%, respectivamente. A atividade inibitória sobre a tripsina e quimotripsina foi observada em todos os extratos foliares. Contudo, nos extratos de E. maximum, L. leucocephala, P. pendula, S. corrugata e S. polyphylla a inibição foi maior sobre a tripsina, enquanto o extrato de P. multijuga foi mais efetivo contra a quimotripsina. Nós concluímos que nos extratos foliares de leguminosas arbóreas têm inibidores de serinoproteinases e exibem potencial aplicações biotecnológicas.The proteinase inhibitors are proteins extensively investigated in tissue storage, but few prospected in other plant tissues. The aim of this study was to detect the presence of serine proteinase inhibitors in leaf extracts from fifteen species of leguminous trees of the Amazon forest. The species studied were Caesalpinia echinata, C. ferrea, Cedrelinga cateniformis, Copaifera multijuga, Dinizia excelsa, Enterolobium contortisiliquum, E. maximum, E. schomburgkii

  12. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability

    OpenAIRE

    Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.

    2017-01-01

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...

  13. Ammonia volatilization of urea in the out-of-season corn Volatilização de amônia da ureia na cultura do milho safrinha

    Directory of Open Access Journals (Sweden)

    Hamilton Seron Pereira

    2009-12-01

    Full Text Available The aim of this study was to evaluate the N losses due to volatilization at different rates of common urea, polymer coated urea and urease inhibitor-treated urea in the out-of-season corn, using semi-open static collectors. The treatments consisted of N levels on side-dressing fertilization with urea in different treatments: (a control (without N, (b urea 40 kg ha-1 N, (c urea 80 kg ha-1 N, (d polymer coated urea 40 kg ha-1 N, (e polymer coated urea 80 kg ha-1 N and (f urea with the urease inhibitor (UI N 80 kg ha-1 N. The results showed that the treatments with polymer coated urea and with urease inhibitor-treated urea reduced the volatilization of N around 50 % compared to common urea, either in the first and the second N side-dressing fertilizations. Thus, they demonstrate that the polymer coat and the urease inhibitors were effective in reducing the volatilization of urea N applied in coverage, which resulted in higher productivity. There was also increasing urease activity in the treatments with application of common urea.O objetivo deste estudo foi avaliar as perdas por volatilização doN em diferentes doses de ureia comum, revestida com polímeros e tratada com inibidores de urease na cultura do milho safrinha, utilizando coletores semiabertos estáticos. O N, na forma de ureia, foi aplicado em cobertura nas seguintes doses: milho safrinha solteiro (sem N; ureia - 40 kg ha-1 de N; ureia - 80 kg ha-1 de N; ureia revestida com polímeros - 40 kg ha-1 de N; ureia revestida com polímeros 80 kg ha-1 de N; e ureia com inibidor de urease (UI - 80 kg ha-1 de N. Os resultados mostraram que os tratamentos com ureia revestida e ureia com inibidor de urease reduziram a volatilização de N em torno de 50 % em relação à ureia comum, tanto na primeira quanto na segunda cobertura nitrogenada. Foi demonstrado que o revestimento da ureia e o inibidor da urease foram eficientes na redução da volatilização do N da ureia aplicados em cobertura, o

  14. Correlations of mutations in katG, oxyR-ahpC and inhA genes and in vitro susceptibility in Mycobacterium tuberculosis clinical strains segregated by spoligotype families from tuberculosis prevalent countries in South America

    Directory of Open Access Journals (Sweden)

    Suffys Philip N

    2009-02-01

    Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.

  15. Toxina botulínica para além da cosmética

    OpenAIRE

    Duarte, Maria José da Silva

    2015-01-01

    Dissertação de mestrado, Ciências Farmacêuticas, Faculdade de Ciências e Tecnologia, Universidade do Algarve, 2015 As neurotoxinas produzidas a partir da bactéria Clostridium botulinum são potentes inibidores dos neurotransmissores que se encontram entre os neurónios e o músculo, inibindo também a sinalização entre os neurónios. Dos sete serótipos pertencentes à neurotoxina botulínic...

  16. Antioxidantes da dieta como inibidores da nefrotoxicidade induzida pelo antitumoral cisplatina Dietary antioxidants as inhibitors of cisplatin-induced nephrotoxicity

    Directory of Open Access Journals (Sweden)

    Lusânia Maria Greggi Antunes

    2004-03-01

    Full Text Available A cisplatina é uma droga antineoplásica altamente efetiva contra vários tipos de cânceres humanos, tais como tumores do testículo e ovário, câncer da cabeça e pescoço e câncer do pulmão. Entretanto, a nefrotoxicidade é um dos principais efeitos colaterais da terapia com a cisplatina. A gravidade da nefrotoxicidade induzida pela cisplatina está relacionada com a concentração de platina nos rins. As evidências mostram que a nefrotoxicidade induzida pela cisplatina é atribuída ao dano oxidativo resultante da geração de radicais livres, e que a administração de antioxidantes é eficiente na inibição destes efeitos colaterais. Uma abordagem alternativa para proteger os roedores dos efeitos colaterais da cisplatina é o uso de conhecidos antioxidantes da dieta. Alguns estudos têm sido realizados para diminuir a peroxidação lipídica e os efeitos citotóxicos induzidos pela cisplatina, com o emprego de antioxidantes da dieta, tais como, selenito de sódio, vitaminas C e E, curcumina e o carotenóide bixina. Nós sugerimos que aqueles antioxidantes da dieta têm efeito nefroprotetor, e que os mecanismos antioxidantes destes compostos deveriam ser explorados durante a quimioterapia com a cisplatina.Cisplatin is a highly effective antineoplastic drug used against several types of human cancers, such as testicular and ovarian tumors; head and neck; and lung cancer. However, nephrotoxicity is one of the most important side-effects of cisplatin therapy. The severity of cisplatin nephrotoxicity is related to platinum concentration in the kidneys. There is a growing amount of evidence that cisplatin-induced nephrotoxicity is ascribed to oxidative damage resulting from free radical generation and that the administration of antioxidants is efficient in inhibiting these side effects. An alternative approach aiming to protect rodents against cisplatin side-effects is the introduction of known dietary antioxidants. Some studies have been

  17. Papel da ouabaína endógena sobre o sistema cardiovascular do modelo de hipertensão arterial DOCA-SAL.

    OpenAIRE

    Camilla Ferreira Wenceslau

    2012-01-01

    Tem sido demonstrado que na hipertensão arterial ocorre aumento de ouabaína plasmática, um inibidor da Na+K+-ATPase. Em 1998, Ferrari et al. desenvolveram uma molécula denominada de rostafuroxina, a qual é capaz de antagonizar os efeitos da ouabaína por deslocar a ligação desse glicosídeo com a Na+K+-ATPase. Dentro desse contexto, parece razoável sugerir que um anti-hipertensivo capaz de antagonizar os efeitos da ouabaína possa representar uma nova ferramenta farmacológica para o tratamento d...

  18. Competition effects with mixed stands of wheat and kochia (Kochia scoparia biotypes resistant and susceptible to acetolactase synthase inhibitor herbicides Efeitos competitivos da mistura de stands de trigo e biotipos de kochia (Kochia scoparia resistentes e susceptíveis aos herbicidas inibidores da acetolactase sintase

    Directory of Open Access Journals (Sweden)

    P.J. Christoffoleti

    1994-08-01

    Full Text Available Greenhouse experiments were conducted to compare the competitive ability of sulfonylurea resistant and susceptible kochia (Kochia scoparia L. Schard compared to wheat. The results of several replacement series experiments indicate that wheat was the dominant competitor, and an average of one wheat plant reduced resistant kochia yield per plant equal to the effect of 4.8 resistant kochia or 5.4 susceptible kochia plants. Intraspeciflc competition was more important than interspecific competition for wheat, whereas the reverse was true for the resistant and susceptible kochia. The results of the niche differentiation index (NDI indicate that wheat and either resistant or susceptible kochia are only partly limited by the same resources. The resistant and susceptible kochia, however, are limited by the same resources.Experimentos foram instalados em condições de casa-de-vegetação com o objetivo de comparar a capacidade competitiva de biotipos resistentes e suscetíveis aos herbicidas inibidores da enzima acetolactase synthase da planta daninha kochia (Kochia scoparia L. Schard comparada com trigo. Os resultados de diversos experimentos, utilizando a metodologia chamada de substitutiva, indicaram que o trigo foi o competidor dominante, e em média uma planta de trigo reduziu o crescimento da planta de kochia resistente igual ao efeito de 4,8 plantas de kochia resistente ou 5,4 plantas de kochia suscetível. A competição chamada de intraespecífíca foi mais importante que a competição interespecífica para o trigo, porém o inverso foi verdadeiro para os biotípos resistentes e susceptíveis de kochia. Os resultados do índice de diferenciação ecológica indicaram que trigo e qualquer um dos dois biotípos de kochia estudados foram limitados apenas parcialmente pelos mesmos recursos de crescimento. No entanto, o crescimento dos biotípos resistentes e susceptíveis de kochia foram limitados pelos mesmos fatores de crescimento.

  19. O papel dos inibidores do fator de necrose tumoral no tratamento da artrite idiopática juvenil The role of tumor necrosis factor inhibitors in the treatment of juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Patrícia Martin

    2006-04-01

    Full Text Available A artrite idiopática juvenil (AIJ é uma doença crônica que pode evoluir para uma incapacidade permanente, necessitando muitas vezes de tratamento agressivo. Enquanto alguns pacientes não respondem ao metotrexato ou imunossupressores, outros não os toleram. Nestes casos, o uso dos inibidores de fator de necrose tumoral (TNF ou anti-TNF é indicado. Conforme demonstrado por estudos multicêntricos e randomizados, o etanercepte apresenta eficácia no controle da doença, com efeito máximo nos primeiros três meses e até dois anos de tratamento contínuo. Não há publicação de estudos controlados com o infliximabe nem com o adalimumabe, mas seus efeitos parecem ser semelhantes aos do etanercepte. Estes agentes são relativamente seguros, podendo ser observadas complicações infecciosas, como a tuberculose e o herpes zoster. Raramente, podem ocorrer eventos auto-imunes, linfoproliferativos e sintomas gerais, como febre e cefaléia. No entanto, é importante salientar que apesar dos inibidores do TNF serem benéficos para muitas crianças com AIJ refratária, seus efeitos colaterais a longo prazo permanecem indefinidos, de forma que sua indicação deve ser criteriosa. Ademais, o alto custo destas drogas limita seu uso, especialmente em nosso país.Juvenile Idiopathic Arthritis (JIA is a chronic disease that may result in permanent disability, requiring sometimes aggressive treatment. While some patients may have an inadequate response to methotrexate and to other immunosuppressive drugs, others do not tolerate them. In these patients tumor necrosis factor inhibitors such as etanercept, infliximab and adalimumab are indicated. Multicentric and randomized studies have shown that etanercept is efficacious in disease control, reaching best effects within the first three months of therapy with sustained clinical improvement up to two years of continuous treatment. There are no published controlled studies involving children receiving

  20. Contribution of katG, ahpC and inhA mutations to the detection of isoniazid-resistant Mycobacterium tuberculosis isolates from Lebanon and Syria

    Directory of Open Access Journals (Sweden)

    F Dabboussi

    2015-01-01

    Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.

  1. Antiinflamatórios não esteróides inibidores da ciclooxigenase-2 (COX-2: aspectos atuais Antiinflamatorios no esteróides inhibidores de la ciclooxigenasa-2 (COX-2: aspectos actuales Cycloxygenase-2 inhibitors nonsteroid anti-inflammatory drugs: current issues

    Directory of Open Access Journals (Sweden)

    Carmen Luize Kummer

    2002-07-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Devido à alta incidência de efeitos colaterais relacionados aos antiinflamatórios não hormonais (AINES, a descoberta de duas isoformas da enzima ciclooxigenase, classificadas como: COX-1 ou constitutiva e COX-2 ou indutiva, formulou o paradigma que as propriedades antiinflamatórias dos AINES seriam mediadas através da inibição da enzima COX-2; já os efeitos colaterais, do bloqueio da COX-1. Entretanto, a isoforma COX-2 tem sido detectada constitutivamente em tecidos normais, levantando a dúvida sobre o quão realmente são seguros os inibidores específicos desta enzima. O objetivo desta revisão é relatar as mais recentes evidências clínicas e experimentais envolvendo a COX-2 e os compostos inibidores desta isoforma. CONTEÚDO: São exibidos os novos conceitos sobre as diferenças estruturais entre COX-1 e COX-2, a existência destas isoformas nos diversos tecidos, os resultados de experimentos em animais e humanos, além da observação clínica dos compostos inibidores específicos COX-2 (coxibs. Algumas prováveis novas indicações de antiinflamatórios não esteróides, principalmente coxibs, na demência de Alzheimer e em neoplasias são exemplificadas. CONCLUSÕES: Os coxibs representam importante avanço farmacológico no tratamento antiinflamatório, reduzindo a incidência de lesões gastrointestinais e apresentando possível indicação na prevenção de neoplasias e doenças neurológicas. No entanto, tais compostos apresentam efeitos colaterais indistinguíveis dos AINES convencionais e são drogas de alto custo. Como toda medicação de recente lançamento no arsenal médico, maiores avaliações são necessárias para o estabelecimento da real segurança destes compostos.JUSTIFICATIVA Y OBJETIVOS: Debido a la alta incidencia de efectos colaterales relacionados a los antiinflamatorios no hormonales (AINES, la descubierta de dos isoformas de la enzima ciclooxigenasa, clasificadas como: COX-1

  2. Active corrosion protection of AA2024 by sol-gel coatings with corrosion inhibitors =

    Science.gov (United States)

    Yasakau, Kiryl

    A industria aeronautica utiliza ligas de aluminio de alta resistencia para o fabrico dos elementos estruturais dos avioes. As ligas usadas possuem excelentes propriedades mecanicas mas apresentam simultaneamente uma grande tendencia para a corrosao. Por esta razao essas ligas necessitam de proteccao anticorrosiva eficaz para poderem ser utilizadas com seguranca. Ate a data, os sistemas anticorrosivos mais eficazes para ligas de aluminio contem cromio hexavalente na sua composicao, sejam pre-tratamentos, camadas de conversao ou pigmentos anticorrosivos. O reconhecimento dos efeitos carcinogenicos do cromio hexavalente levou ao aparecimento de legislacao banindo o uso desta forma de cromio pela industria. Esta decisao trouxe a necessidade de encontrar alternativas ambientalmente inocuas mas igualmente eficazes. O principal objectivo do presente trabalho e o desenvolvimento de pretratamentos anticorrosivos activos para a liga de aluminio 2024, baseados em revestimentos hibridos produzidos pelo metodo sol-gel. Estes revestimentos deverao possuir boa aderencia ao substrato metalico, boas propriedades barreira e capacidade anticorrosiva activa. A proteccao activa pode ser alcancada atraves da incorporacao de inibidores anticorrosivos no pretratamento. O objectivo foi atingido atraves de uma sucessao de etapas. Primeiro investigou-se em detalhe a corrosao localizada (por picada) da liga de aluminio 2024. Os resultados obtidos permitiram uma melhor compreensao da susceptibilidade desta liga a processos de corrosao localizada. Estudaram-se tambem varios possiveis inibidores de corrosao usando tecnicas electroquimicas e microestruturais. Numa segunda etapa desenvolveram-se revestimentos anticorrosivos hibridos organico-inorganico baseados no metodo sol-gel. Compostos derivados de titania e zirconia foram combinados com siloxanos organofuncionais a fim de obter-se boa aderencia entre o revestimento e o substrato metalico assim como boas propriedades barreira. Testes

  3. Efeitos do carbonato de lodenafila na consolidaÃÃo de fraturas da diÃfise femoral de Ratos tratados com haste intramedular

    OpenAIRE

    Gisele FaÃanha Diogenes Teixeira

    2010-01-01

    O objetivo do estudo foi verificar os efeitos do carbonato de lodenafil no processo de consolidaÃÃo Ãssea nos fÃmures de ratos reduzidos com fio de Kirshner. Os fatores vasculares sÃo extremamente importantes para a formaÃÃo do calo Ãsseo. O carbonato de lodenafil causa efeitos vasodilatadores, pertence ao grupo dos inibidores da fosfodiesterase seletiva para o tipo 5 (PDE5), enzima que hidrolisa monofosfato de guanosina cÃclico (GMPc). O GMPc induz o relaxamento da musculatura lisa, sendo ut...

  4. Resistência de biótipos de Euphorbia heterophylla l. Aos herbicidas inibidores da enzima ALS utilizados na cultura de soja Resistance of Euphorbia heterophylla l. Biotypes to ALS enzyme inhibitor herbicides used in soybean crop

    Directory of Open Access Journals (Sweden)

    GERSON AUGUSTO GELMINI

    2001-01-01

    Full Text Available Os herbicidas constituem-se na principal medida de controle de plantas daninhas na cultura de soja; no entanto, a pressão de seleção causada pelo uso contínuo de produtos com o mesmo mecanismo de ação pode provocar a seleção de biótipos resistentes, como ocorreu com Euphorbia heterophylla L., que se mostrou resistente aos herbicidas inibidores da enzima acetolactato sintase (ALS em áreas dos Estados do Paraná e Rio Grande do Sul. Para comprovar possíveis novos casos, bem como alternativas para prevenção e manejo, coletaram-se sementes de plantas de E. heterophylla L., na região de Assis (SP, que sobreviveram a tratamentos, em que esses herbicidas foram sistematicamente aplicados nos últimos anos. Desenvolveu-se o experimento em casa de vegetação, comparando-se o biótipo resistente ao suscetível, quando submetido aos diversos herbicidas aplicados em pós-emergência. Aplicaram-se quando as plantas encontravam-se no estádio de duas a quatro folhas verdadeiras, nas doses zero, uma, duas, quatro e oito vezes a recomendada. Aos 20 dias após a aplicação, avaliaram-se os parâmetros relativos ao controle e produção de fitomassa epígea visando ao estabelecimento de curvas de doses-resposta, à obtenção dos fatores de resistência com base nos valores da DL50 e GR50, e à verificação da ocorrência de resistência múltipla. O biótipo resistente apresentou diferentes níveis de resistência aos herbicidas chlorimuron-ethyl e imazethapyr, demonstrando resistência cruzada aos inibidores da ALS dos grupos das sulfoniluréias e imidazolinonas. No entanto, foi eficientemente controlado nos tratamentos com fomesafen (250 g.ha-1, lactofen (120 g.ha-1, flumiclorac-pentil (40 g.ha-1, glufosinato de amônio (150 g.ha-1 e glyphosate (360 g.ha-1.Herbicides are the main tool for weed control in soybean crop, but the selection pressure attributed to the repeated application of the same herbicides and the same mechanism of action can

  5. Análise do efeito imunomodulador da ouabaína na inflamação e nocicepção

    OpenAIRE

    Vasconcelos, Danielle Ingrid Bezerra de

    2011-01-01

    A Ouabaína é um glicosídeo cardiotônico, inibidor da Na+/K+-ATPase, utilizada na clínica para o tratamento de insuficiência cardíaca. Atualmente, sabe-se que essa substância é endógena, e capaz de interferir em várias funções fisiológicas, inclusive em diversos aspectos do sistema imunológico. Apesar disso, pouco se sabe sobre seu envolvimento em processos inflamatórios e nociceptivos. Neste trabalho, foi avaliada a atividade da Ouabaína na inflamação aguda desencadeada pela ad...

  6. Criatividade na educação superior: fatores inibidores Creativity in higher education: inhibiting factors

    Directory of Open Access Journals (Sweden)

    Eunice Maria Lima Soriano de Alencar

    2010-07-01

    Full Text Available O objetivo deste estudo foi investigar elementos percebidos por professores da educação superior como inibidores à promoção de condições adequadas ao desenvolvimento e expressão da criatividade de seus alunos. Trezentos e trinta e oito professores de instituições públicas e particulares de ensino superior responderam a uma checklist de barreiras à promoção de condições favoráveis à criatividade em sala de aula. Alunos com dificuldades de aprendizagem em sala de aula, desinteresse do aluno pelo conteúdo ministrado, poucas oportunidades para discutir e trocar ideias com colegas de trabalho sobre estratégias instrucionais e elevado número de alunos em sala de aula foram os itens com maior percentual de respostas. Alguns elementos cerceadores foram mais indicados por docentes de instituições públicas e outros por docentes de instituições particulares. Ademais, maior percentual de docentes do gênero feminino, comparativamente ao do gênero masculino, apontou cobrança de aulas expositivas pelos alunos e extensão do programa das disciplinas.The purpose of this study was to investigate the perception of higher education professors regarding inhibiting elements to the promotion of adequate conditions for the development and expression of students' creativity in the classroom. The participants were 338 professors from public and private higher education institutions, who completed a checklist of obstacles to the promotion of creativity in the classroom. Students with learning difficulties, students' lack of interest in the content taught, few opportunities to discuss and exchange ideas with colleagues about instructional strategies and large number of students in the classroom were the items with greater number of responses. Significant differences were observed among professors from public and private institutions of higher education in several items. Furthermore, a greater percentage of female, comparatively to male

  7. Isoflavonas em grãos de soja: importância da atividade de β-glicosidase na formação do sabor amargo e adstringente

    Directory of Open Access Journals (Sweden)

    J. M. A. Araújo

    1997-08-01

    Full Text Available As isoflavonas daidzeína e genisteína são responsáveis pelo sabor amargo e adstringente em derivados de soja, as quais aumentam durante a imersão dos grãos em água. A formação dessas substâncias podem ser inibidas pela glicono-δ-lactona, que atua como inibidor competitivo das β-glicosidases. Conclui-se, portanto, que as β-glicosidases são as responsáveis pela liberação de daidzeína e genisteína em grãos de soja imersos em água. A inibição da atividade das β-glicosidases, pela adição do inibidor (glicono-δ-lactona, reduziu o aparecimento das isoflavonas agliconas em 33% e 23% , respectivamente, nos cultivares Paraná e UFV-5.

  8. Tratamento da síndrome parkinsoniana pelo L-dopa

    Directory of Open Access Journals (Sweden)

    Roberto Melaragno

    1971-12-01

    Full Text Available O trabalho refere o tratamento com L-Dopa de 33 pacientes internados, sendo 19 homens e 14 mulheres. Os casos foram agrupados, segundo uma classificação esquemática, em leves, moderados, intensos e severos. As idades dos pacientes, previamente operados ou não, variaram de 42 a 78 anos. O esquema de medicação constou de administração de L-Dopa na dose inicial de 500 mg associado a um inibidor da MAO. A dose de L-Dopa era elevada de 500 mg cada 3 ou 4 dias, segundo a tolerância de cada paciente. Todos os sintomas dependentes, direta ou indiretamente, da rigidez tiveram melhoras mais nítidas em relação aos tremores. Durante a administração do medicamento os teores sangüíneos de ácido úrico e uréia, mostraram tendência para se elevar; a reserva alcalina, pelo contrário, tendeu para a diminuição; o hemograma revelou muitas vezes eosinofilia por vezes intensa. Os efeitos colaterais foram catalogados em dois tipos — efeitos adrenérgicos e efeitos dopaminérgicos — correspondentes a duas fases: uma primeira, de pequena duração, na qual foram usados concomitantemente o L-Dopa e um inibidor da MAO, surgindo cefaléia hipertensão arterial paroxística, rubor facial, sudorese, tenesmo vesical e angina pectoris; numa segunda fase surgiram os efeitos colaterais ditos dopaminérgicos, proporcionais à gravidade clínica do caso, cujas manifestações principais foram hipotensão arterial, sudorese fria, arritmia cardíaca e lipotimia. As complicações clínicas gerais eram representados habitualmente por anorexia, obstipação intestinal, náuseas, vômitos, discretas alterações do estado psíquico com depressão e euforia. Dentre as complicações neurológicas foram assinalados o estado parkinsonóide, discinesias e acatisia.

  9. Tratamento farmacológico da distimia: avaliação crítica da evidência científica Pharmacological treatment of dysthymia: a critical appraisal of the evidence

    Directory of Open Access Journals (Sweden)

    Maurício Silva de Lima

    1999-06-01

    Full Text Available Distimia é um transtorno depressivo de natureza crônica, mas de menor gravidade que a depressão maior, cujos sintomas persistem por mais ou menos dois anos. Este artigo aborda aspectos relativos à eficácia do tratamento farmacológico na distimia, a partir de resultados de revisões sistemáticas recentemente concluídas. Em termos de eficácia, os resultados foram similares para as diferentes classes de drogas, tais como tricíclicos (ADT, inibidores seletivos da recaptação da serotonina (ISRS, inibidores da mono-amino-oxidase (IMAO e outras drogas (sulpirida, amineptina, e ritanserina. Os pacientes tomando tricíclicos relataram um maior número de efeitos adversos, comparado com placebo. Em resumo, o tratamento farmacológico da distimia é eficaz, sem efeito diferencial entre os diversos antidepressivos. O uso de tricíclicos está associado à maior ocorrência de efeitos adversos e de desistências. Apesar de a distimia ser uma doença crônica, existe ainda informação limitada sobre a qualidade de vida dos pacientes e sobre o tratamento a médio e longo prazo.Dysthymia is a depressive disorder of chronic nature but of less severity than major depression, in which depressive symptoms are more or less continuous for at least two years. This paper discusses the role of pharmacological treatment for dysthymia. Similar results are found in terms of efficacy for different groups of drugs, such as tricyclic (TCA, selective serotonin reuptake inhibitors (SSRI, monoamine oxidase inhibitors (MAOI and other drugs (sulpiride, amineptine, and ritanserin. Patients treated on TCA are more likely to report adverse events, comparing with placebo. In conclusion, pharmacological treatment seems to be effective in the treatment of dysthymia with no differences between and within class of drugs. Although dysthymia is a chronic condition, there remains little information on quality of life and medium or long-term outcome.

  10. Tratamento medicamentoso da insuficiência cardíaca em hospital terciário de São Paulo

    Directory of Open Access Journals (Sweden)

    Barretto Antonio Carlos Pereira

    1997-01-01

    Full Text Available OBJETIVO: Verificar como são tratados pacientes com insuficiência cardíaca (IC em hospital terciário de São Paulo. MÉTODOS: Analisados 100 pacientes com IC, em tratamento ambulatorial, com idade média de 56,8 anos, sendo 76 homens. Todos realizaram estudo ecocardiográfico, que identificou diâmetros ventriculares entre 48 e 89mm (média 65,9 e fração de ejeção (FE entre 0,22 e 0,59 (média 0,43. A etiologia da disfunção ventricular (DV foi isquêmica em 42 casos, cardiomiopatia dilatada em 28, secundária à valvopatia em 12, doença de Chagas em 10 e cardiomiopatia hipertensiva em 8. Analisou-se a terapêutica prescrita, se continha inibidores da enzima conversora de angiotensina (IECA e qual a sua dosagem. Foi analisado, também, se a etiologia ou o grau de DV tinha influência na prescrição. RESULTADOS: Oitenta e sete pacientes receberam IECA, sendo que em 31 a dose foi inferior à preconizada nos grandes estudos. Digoxina foi prescrita em 69 casos, diuréticos em 85 e ácido acetilsalicílico em 33. Dividindo os pacientes em dois grupos, com FE maior e menor que 0,45, observamos que, no último, foi maior a prescrição de IECA (91,5% vs 80,4% e maior o uso de doses adequadas (61% vs 48,7%. CONCLUSÃO: A maioria dos pacientes foi tratada conforme recomendações atuais, apresentando boa tolerabilidade para IECA, contudo 1/3 deles não usou IECA em dose considerada adequada. Esquemas terapêuticos com betabloqueadores e inibidores da angiotensina II não fizeram parte da prática clínica rotineira.

  11. Avaliação da eficiência de um inibidor comercial livre e dissolvido em microemulsão na corrosão do aço API 5L A210

    OpenAIRE

    Pinheiro, Gleidson Lima

    2014-01-01

    Oleodutos sofrem corrosão do tipo química, devido a tensão, entre outros mecanismos, e eletroquímica devido a grande quantidade de salmoura (água e cloretos), presentes nos fluidos produzidos na formação. Este trabalho tem como objetivo estudar a eficiência de um inibidor de corrosão comercial, usado na indústria do petróleo, na inibição de corrosão agindo isoladamente e em mistura com microemulsão (ME) na proporção [1:1]. A ME foi obtida a partir dos seguintes constituintes: água de torneira...

  12. Retinite por citomegalovírus em pacientes pediátricos infectados pelo vírus da imunodeficiência humana em tratamento com "highly active antiretrovirus therapy" Cytomegalovirus retinitis in pediatric patients with AIDS receiving highly active antiretrovirus therapy

    Directory of Open Access Journals (Sweden)

    Maria Angélica Dimantas

    2004-09-01

    Full Text Available OBJETIVO: Descrever uma série de casos de retinite pelo citomegalovírus (CMV, na população pediátrica infectada pelo vírus da imunodeficiência humana (HIV, em tratamento com inibidores de protease e inibidores da transcriptase reversa (HAART, que apresentaram falência terapêutica e ausência de resposta aos antivirais utilizados no tratamento do CMV. MÉTODOS: Três pacientes pediátricos portadores da síndrome da imunodeficiência humana (AIDS, em tratamento com HAART, foram submetidos a exame oftalmológico em um centro universitário de referência - UNIFESP. RESULTADOS: Os três pacientes do sexo masculino apresentavam média de idade de seis anos (variando entre 10 meses e 13 anos e todos pertenciam à classificação C3 (CDC - Atlanta - EUA 1994. A média obtida entre a contagem de linfócitos CD4+ dos três casos foi de 67 cel/mm³ (variando entre 43 - 98 cel/mm³; e a média da carga viral foi de 190.000 cópias/ml (variando entre 53.600 - 460.000 cópias/ml. Os três pacientes desenvolveram resistência ao uso dos antiretrovirais análogos de nucleosídeos inibidores da transcriptase reversa e aos inibidores de protease (HAART, e em todos os casos foram utilizados antivirais específicos para o tratamento da retinite pelo CMV sem sucesso. CONCLUSÕES: Os benefícios obtidos desde a introdução da era HAART são, sem dúvida, sem precedentes dentro do quadro evolutivo da AIDS. O início da falência terapêutica observado com relação às drogas do HAART tem colaborado de maneira decisiva para o surgimento de casos de retinite pelo CMV tão agressivos quanto os observados na era pré-HAART. O exame de rotina para pacientes pediátricos torna-se fundamental, tanto pela escassez de estudos realizados neste grupo específico, quanto pela importância de seu prognóstico visual.BACKGROUND: To describe three cases of cytomegalovirus retinitis occurring in HIV-infected children taking protease inhibitors combined with transcriptase

  13. O uso de inibidores de apetite por mulheres: um olhar a partir da perspectiva de gênero The use of apetite inhibitors by women: an insight based on the gender perspective

    Directory of Open Access Journals (Sweden)

    Cristiane Magalhães de Melo

    2011-05-01

    Full Text Available O presente estudo teve como objetivo compreender os motivos que levam mulheres adultas a utilizar medicamentos inibidores do apetite e verificar, a partir da ótica de gênero, como se estabelece a relação dessas mulheres com seus próprios corpos. Orientado pelos princípios da pesquisa qualitativa, utilizou como técnicas de construção de dados a entrevista semiestruturada e a observação direta. Participaram como informantes do estudo seis mulheres usuárias de anorexígenos. Os resultados apontaram que as imagens, a publicidade e as redes sociais contribuem significativamente para a criação de padrões de aparência física e de "estilos de vida", cujo modelo preconiza a boa aparência (corpo magro e a felicidade conjugal. O corpo magro é representado como algo capaz de alterar condições, ou seja, pessoa gorda = pessoa infeliz; e pessoa magra = pessoa feliz. O estudo mostra que é no corpo como lócus que o papel socialmente destinado às mulheres será produzido e reproduzido.The scope of this study was to understand the motives that lead adult women to use appetite inhibitors and to establish, from a gender perspective, how these women relate to their own bodies. It was structured around the principles of qualitative research, and the methods of data collection were semi-structured interviews and direct observation. The informants were six women who used appetite inhibitors. The results indicated that images, publicity and social networks contribute significantly to the creation of new standards of physical appearance as well as lifestyles, which establish appearance (a slim body and a happy marriage as the desired model. The slim body is represented as something able to alter the temperament of the individual, in other words a fat person is an unhappy person and a slim person is a happy person. The study shows that it is in the body per se that the social role destined for women is produced and reproduced.

  14. Estudo clínico fase I de carbonato de lodenafila, um novo tipo de inibidor de fosfodiesterase 5 (PDE5), em voluntários saudáveis do sexo masculino = : A phase I clinical trial of lodenafil carbonate, a new phosphodiesterase type 5 (PDE5) inhibitor, in healthy male volunteers

    OpenAIRE

    Hilton Oliveira dos Santos Filho

    2013-01-01

    Resumo: Carbonato de Lodenafila é um novo tipo de inibidor de fosfodiesterase 5 (PDE5) utilizado no tratamento da disfunção erétil. O presente estudo foi realizado para avaliar a segurança, tolerabilidade e farmacocinética do carbonato de lodenafila após a administração de doses orais únicas ascendentes (de 1 a 100 mg) a voluntários saudáveis do sexo masculino (n = 33). O estudo foi um estudo clínico fase I, aberto, de escalonamento de dose, utilizando a administração de doses orais únicas de...

  15. Respostas de plantas de Eleusine indica sob diferentes condições hídricas a herbicidas inibidores da ACCase Responses of Eleusine indica plants under different water conditions to ACCase-inhibiting herbicides

    Directory of Open Access Journals (Sweden)

    M.R.R. Pereira

    2011-06-01

    Full Text Available Objetivou-se neste estudo avaliar a eficiência de controle de herbicidas inibidores da ACCase aplicados em pós-emergência em plantas de Eleusine indica submetidas a diferentes teores de água no solo. Os experimentos foram conduzidos em casa de vegetação, com a aplicação de três diferentes herbicidas (fluazifop-p-butil, haloxyfop-methyl e sethoxydim + óleo mineral Assist; o delineamento experimental utilizado para cada herbicida foi inteiramente casualizado, com quatro repetições, constituído de um fatorial 3 x 4, sendo a combinação de três manejos hídricos (-0,03, -0,07 e -1,5 MPa e quatro doses desses produtos (100, 50, 25 e 0% da dose recomendada. Os parâmetros fisiológicos avaliados foram: taxa fotossintética, condutância estomática, transpiração, temperatura da folha e matéria seca das plantas. As avaliações visuais de fitotoxicidade foram realizadas aos 14 dias após a aplicação. Os manejos hídricos aplicados não influenciaram o controle das plantas nos tratamentos testados, com exceção do herbicida sethoxydim, que teve sua eficiência hídrica prejudicada quando da deficiência hídrica nas aplicações das doses fracionadas. A taxa fotossintética, a transpiração e a condutância estomática foram maiores em plantas submetidas ao manejo hídrico de 13%, as quais apresentaram as menores temperaturas foliares em relação à temperatura ambiente.The objective of this study to evaluate the control efficiency of ACCase -inhibiting herbicides applied during post-emergence on plants of Eleusine indica under different soil water contents. The experiments were conducted in a greenhouse, with the application of three different herbicides (fluazifop-p-butyl, haloxyfop-methyl and sethoxydim + oil Assist Each herbicide experiment was arranged in a completely randomized design with four replications, consisting of a 3 x 4 factorial scheme, with the water management strategy combinations (-0.03, -0.07 and -1.5 MPa and

  16. Tratamento farmacológico da doença de Alzheimer Pharmacological treatment of Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Orestes V. Forlenza

    2005-06-01

    Full Text Available O presente artigo de revisão aborda as perspectivas atuais e futuras no tratamento farmacológico da doença de Alzheimer. Os benefícios e limitações da terapia de reposição colinérgica, representada fundamentalmente pelos inibidores das colinesterases, são apresentados com base em dados de pesquisas neurobiológicas, farmacológicas e clínicas, ilustrados pelos principais estudos controlados por placebo e por estudos recentes de metanálise. O papel da memantina nos casos de demência moderada a grave, bem como as perspectivas de seu emprego em associação com os inibidores das colinesterases, são discutidos adicionalmente com base em achados clínicos e neurobiológicos. Discute-se o papel da reposição estrogênica, dos antioxidantes, das estatinas e dos antiinflamatórios no tratamento e na prevenção da demência, levando em consideração os resultados negativos oriundos de estudos clínico-epidemiológicos recentes. Finalmente, são apresentadas algumas perspectivas futuras do tratamento da doença de Alzheimer: entre as estratégias farmacológicas, que têm como objetivo modificar mecanismos patogênicos, são abordadas as diferentes modalidades da terapêutica antiamilóide, com destaque na imunoterapia da doença de Alzheimer.The current article provides a comprehensive overview of the current strategies and the future directions of the pharmacological treatment of Alzheimer's disease. The benefits and shortcomings of cholinergic replacement therapy is discussed in the light of its neurobiological, pharmacological and clinical data, illustrated by the most relevant randomised controlled trials and recent meta-analytical studies. The role of memantine in moderate to severe dementia, and the perspectives of combination therapy are further discussed both at clinical and neuro-pharmacological levels. In addition, the role of oestrogen replacement, antioxidants, statins, and non-steroidal anti-inflammatory drugs, in the

  17. Eficiência da farinha desengordurada de gergelim como complemento protéico da farinha extrudada de caupi1

    Directory of Open Access Journals (Sweden)

    Geraldo Arraes Maia

    1999-07-01

    Full Text Available O objetivo deste trabalho foi promover uma avaliação nutricional da mistura protéica desengordurada, obtida do gergelim (Sesamum indicum L., com a farinha extrudada do caupi (Vigna unguiculata L. Walp, utilizando-se métodos físicos, bioquímicos, nutricionais e sensoriais. Usando-se semente integral do gergelim, com 54,08% de óleo e 21,83% de proteína, obteve-se a semente descascada com baixa concentração de oxalatos, que foi usada para a produção de farinha desengordurada de gergelim (FDG contendo 2,81% de óleo e 59,16% de proteína. A principal característica desta farinha foi sua alta concentração de aminoácidos sulfurados (30,88 mg/g proteína. Esta FDG foi usada como complemento da proteína da farinha do caupi obtida pelo processo de cozimento por extrusão (FEC, o que ocasionou a inativação de grande parte dos inibidores de tripsina. A proteína da farinha FEC mostrou uma concentração de 24,29%, um baixo conteúdo de aminoácidos sulfurados (17,22 mg/g proteína e alto teor de lisina (58,47 mg/g proteína. O alimento formulado foi considerado de boa qualidade nutricional.

  18. Efeitos do tratamento neonatal com inibidor seletivo de recaptura da 5-HT sobre o desenvolvimento anatômico crânio-encefálico Neonatal treatment effect with selective inibitor of 5-HT recapture over the cranium-encephalic anatomic development

    Directory of Open Access Journals (Sweden)

    Carolina Peixoto Magalhães

    2006-12-01

    Full Text Available Pesquisadas repercussões neonatais do tratamento crônico com inibidores seletivos de recaptura da serotonina (ISRS sobre crescimento somático, do encéfalo e crânio. Ratos machos foram divididos em grupos: controle (NaCl e Cit (10 µL/Kg citalopram 10 mg. Durante 21 dias pós-natais, foram aferidos peso corporal, eixo látero-lateral, ântero-posterior e circunferência do crânio. Aos 8, 15 e 22 dias pós-natais, os animais foram sacrificados para retirada do encéfalo para avaliar as medidas citadas acima. A utilização de ISRS provocou déficit de crescimento corporal, diminuição das medidas craniais e do encéfalo. O retardo é possivelmente decorrência de alteração na magnitude da ação trófica da serotonina sobre morfogênese crânio-facial, reforçando a participação do sistema serotoninérgico sobre o crescimento somático e ontogenético. O possível efeito hipofágico dos ISRS não é descartado.Neonatal repercussion researched of the serotonin selective recapture inibitor (SSRI chronic treatment about the somatic growth, of the encephalon and skull. Male rats were divided into groups: control (NaCl and Cit (10 µL/Kg citalopram 10 mg. In 21 post birth days were measured body weight, side axle , front and rear and skull circle. At 8, 15, 22 days after birth, animals were sacrified for the encephalon withdrawal to evaluate the measurements mentioned above. SSRI use caused body growth deficit, skull and encephalon reduction. The retard is possibly caused by the magnitude change of the trophic serotonin action over the skull-facial morphogenesis, reinforcing the serotoninergic system participation over the somatic and ontogenic growth. The SSRI possible hypophagic effects are not discarded.

  19. Docking molecular de derivados de 2-fenilindano-1,3-dionas inibidores da enzima HMG-CoA

    Directory of Open Access Journals (Sweden)

    R. Q. Pordeus

    2014-11-01

    Full Text Available As doenças cardiovasculares constituem uma das principais causas de mortes em todo o mundo. Estudos mostram que a enzima HMG-CoA é considerada uma precursora da via metabólica hipolipidêmica no soro sanguíneo. Na busca por uma nova classe de compostos aptos a inibir esta enzima e consequentemente reduzir os níveis de colesterol, as 2-fenilindano-1,3-dionas apresentam resultados promissores. Uma das maneiras de avaliar o poder farmacológico destes compostos e predizer análogos ainda mais potentes consiste na avaliação da interação entre fármaco (2-fenilindano-1,3-diona e enzima (HMG-CoA, em que se utiliza da técnica de modelagem molecular docking. Neste estudo, o procedimento computacional para obtenção dos resultados de docking foi feito através do software AutoDock 1.5.6. Para avaliar a interação no sítio ativo da HMG-CoA, utilizamos, dentre a série de congêneres, o composto 2-(2-clorofenilindano-1,3-diona. De acordo com os resultados obtidos, foi identificada uma interação hidrofílica importante, do tipo ligação de hidrogênio C=O∙∙∙H–N, a qual apresenta uma distância de 1.62 Å entre os grupos carbonila do anel diona e o aminoácido metionina da HMG-CoA. Outra ligação de hidrogênio p∙∙∙H–N com distância de 3.10 Å formada entre o anel aromático do grupo indano-1,3-diona e o aminoácido glicina também foi identificada.

  20. Eleusine indica resistance to Accase inhibitors

    OpenAIRE

    Vidal, Ribas Antonio; Portes, Emerson da Silva; Lamego, Fabiane Pinto; Trezzi, Michelangelo Muzell

    2006-01-01

    Dentre as causas da ineficácia no controle de plantas daninhas destaca-se a resistência delas aos herbicidas. Os objetivos deste trabalho foram avaliar a suspeita de resistência de Eleusine indica a inibidores de acetil-CoA carboxilase (ACCase) e investigar a ocorrência de resistência cruzada entre os inibidores de ACCase. Biótipo de Eleusine indica originado do Mato Grosso com suspeita de resistência aos herbicidas inibidores de ACCase foi avaliado em casa de vegetação na sua suscetibilidade...

  1. MAPEAMENTO TECNOLÓGICO DE TRATAMENTOS DA OBESIDADE USANDO COMPOSTOS NATURAIS DE FRUTAS/ TECHNOLOGICAL MAPPING OF OBESITY TREATMENTS USING NATURAL COMPOUNDS OF FRUITS

    Directory of Open Access Journals (Sweden)

    Josileide Gonçalves Borges

    2017-03-01

    Full Text Available A obesidade tem se tornado um problema global de saúde pública devido ao fato de haver uma clara evidência entre obesidade e diversas patologias. Novos enfoques para o tratamento da obesidade envolvem a inibição da absorção de triglicerídeos através da inibição da lipase pancreática. Os produtos naturais merecem destaque como inibidores da enzima lipase, principalmente aqueles encontrados em frutas comestíveis. O objetivo deste trabalho foi avaliar tratamentos contra a obesidade, com ênfase no uso de extratos de resíduos de frutas e seus metabólitos secundários para inibição de enzimas relacionadas à absorção de nutrientes pelo corpo. Foi utilizado o Espacenet, pois este banco de dados engloba patentes nacionais e internacionais depositadas e concedidas em mais de 90 países, incluindo o Brasil. No Espacenet foram realizadas buscas em relação a tratamentos da obesidade com ênfase nos inibidores enzimáticos utilizando resíduos de frutas. A pesquisa de patentes demostrou que de 1996 a 2013 houve um aumento considerável no depósito de patentes envolvendo tratamentos antiobesidade. As áreas de maior relevância para proteção patentária foram aplicações para fins medicinais, terapêuticos e farmacêuticos, somando 91 patentes, sendo A61K a classificação internacional de patente mais recorrente.  Os códigos CO7D e A23L também aparecem referindo-se a compostos químicos e constituintes de alimentos usados em tratamentos físicos. Sendo que estudos e pesquisas nesse tema têm tido muitos avanços e existe um grande potencial no Brasil para essas pesquisas devido à grande diversidade vegetal.

  2. Uso de medicações por via subaracnóidea no tratamento da dor crônica

    Directory of Open Access Journals (Sweden)

    Rocha Anita Perpétua Carvalho

    2002-01-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: A dor crônica é um desafio para a Medicina atual. Novos métodos e medicamentos têm sido propostos com o intuito de controlar os sintomas álgicos. A via de administração subaracnóidea tem se mostrado como uma alternativa viável e segura, embora necessite continuamente ser objeto de estudo de muitos pesquisadores. O objetivo deste trabalho é fazer uma revisão dos medicamentos disponíveis no arsenal terapêutico já consagrados pelo uso e os que se mostram promissores na atualidade para a prática clínica diária. CONTEÚDO: Nesta revisão são avaliados vários fármacos que apresentam ação analgésica quando utilizada via neuroeixo. Opióides, anestésicos locais, agonistas alfa2-adrenérgicos, antagonistas dos aminoácidos excitatórios e inibitórios, acetilcolina, inibidores da acetilcolinesterase, bloqueadores dos canais de cálcio, adenosina, serotonina, antidepressivos tricíclicos e inibidores da síntese de prostaglandinas são analisados no que concerne aos seus efeitos farmacológicos, incluindo os indesejáveis. CONCLUSÕES: Muitos avanços foram registrados no controle dos sintomas álgicos após a utilização das substâncias citadas por via raquidiana, onde certamente algumas serão aproveitadas e enriquecerão o arsenal terapêutico e outras relegadas temporária ou definitivamente. Entretanto, ainda serão necessários muitos estudos clínicos e experimentais para que estes conhecimentos possam ser incorporados e utilizados com segurança pelos profissionais que lidam com o tratamento da dor crônica.

  3. Uso de Intervenções Baseadas em Evidências na Síndrome Coronária Aguda – Subanálise do Registro ACCEPT

    Directory of Open Access Journals (Sweden)

    Ricardo Wang

    2014-04-01

    Full Text Available Fundamento: As diretrizes baseiam-se em evidências para pautar suas recomendações; apesar disso, há uma lacuna entre o recomendado e a prática clínica. Objetivo: Descrever a prática de prescrição de tratamentos com indicação baseada em diretrizes para pacientes com síndrome coronariana aguda no Brasil. Métodos: Foi realizada uma subanálise do registro ACCEPT, na qual foram avaliados os dados epidemiológicos e a taxa de prescrição de ácido acetilsalicílico, inibidores P2Y12, antitrombóticos, betabloqueadores, inibidores da enzima conversora de angiotensina/bloqueadores AT1 e estatinas. Além disso, avaliou-se a qualidade da reperfusão coronariana no infarto com supradesnivelamento do segmento ST. Resultados: Foram avaliados 2.453 pacientes. As taxas de prescrição de ácido acetilsalicílico, inibidores de P2Y12, antitrombóticos, betabloqueadores, inibidores da enzima conversora de angiotensina/bloqueadores AT1 e estatinas foram, respectivamente, de 97,6%, 89,5%, 89,1, 80,2%, 67,9%, 90,6%, em 24 horas, e, respectivamente, de 89,3%, 53,6, 0%, 74,4%, 57,6%, 85,4%, em 6 meses. Com relação ao infarto com supradesnivelamento do segmento ST, somente 35,9% e 25,3% dos pacientes foram submetidos a angioplastia primária e trombólise, respectivamente, nos tempos recomendados. Conclusão: Este registro mostrou altas taxas de prescrição inicial de antiplaquetários, antitrombóticos e estatina, bem como taxas mais baixas de betabloqueadores e de inibidores da enzima conversora de angiotensina/bloqueadores AT1. Independentemente da classe, todos apresentaram queda do uso aos 6 meses. A maioria dos pacientes com infarto com supradesnivelamento do segmento ST não foi submetida a reperfusão coronariana no tempo recomendado.

  4. Inibição da Na+/K+ATPase pelo derivado esteróide auabaína: Implicações sobre o ciclo de vesículas sinápticas em junção neuromuscular.

    OpenAIRE

    Ernani Aloysio Amaral

    2006-01-01

    Ouabaína é um derivado esteróide cardiotônico e inibidor específico da Na+K+-ATPase. Neste trabalho, os efeitos da ouabaína sobre o ciclo de vesículas sinápticas na junção neuromuscular de rã foram investigados de forma direta e dinâmica utilizando-se a sonda fluorescente FM1-43. Este marcador consiste em uma molécula anfipática com uma cauda hidrofóbica que promove a ligação da sonda à membrana do terminal axonal. Após um estímulo despolarizante, a membrana marcada com FM1-43 é internalizada...

  5. O tratamento farmacológico da fobia social Pharmacologic treatment of social phobia

    Directory of Open Access Journals (Sweden)

    Antonio Egidio Nardi

    1999-12-01

    Full Text Available A fobia social é o medo acentuado e persistente de comer, beber, tremer, enrubescer, falar, escrever, enfim, de agir de forma ridícula ou inadequada na presença de outras pessoas. A fobia social apresenta-se em dois tipos básicos: a circunscrita, restrita a apenas um tipo de situação social, e a generalizada, caracterizada pelo temor a todas ou quase todas situações sociais. As características clínicas da fobia social são a ansiedade antecipatória, os sintomas físicos, a esquiva e a baixa auto-estima. Conforme o rigor diagnóstico, estima-se que 5% a 13% da população geral apresentem sintomas fóbicos sociais que resultem em diferentes graus de incapacitação e limitações sociais e ocupacionais. O tratamento médico de escolha é o uso de medicamentos associados à psicoterapia cognitivo-comportamental. Beta-bloqueadores (atenolol, propranolol, antidepressivos inibidores da monoamino oxidase (IMAO (fenelzine, tanilcipromina, inibidores reversíveis da monoamino oxidase tipo-A (RIMA (moclobemida, brofaromina, benzodiazepínicos (clonazepam, bromazepam, alprazolam e antidepressivos inibidores seletivos de serotonina (ISRS (paroxetina, sertralina, fluoxetina e fluvoxamina e alguns outros (venlafaxina, nefazodone, gabapentina, clonidina têm demonstrado eficácia em inúmeros estudos com diferentes metodologias. Os antidepressivos tricíclicos (imipramina, clomipramina, o ácido valproico e a buspirona têm apresentado resultados negativos. A paroxetina é o medicamento mais estudado com metodologia duplo-cega, com melhores resultados e com boa tolerância. Atualmente, os indivíduos que têm sua vida prejudicada pela fobia social podem, com o tratamento eficaz, adquirir uma postura mais segura em situações sociais.Social phobia is a marked and persistent fear of eating, drinking, trembling, blushing, speaking, writing or doing almost everything in front of people due to concerns about embarrassment or being scrutinized by others

  6. Efeitos da rottlerin na esquizogonia eritrocitária de Plasmodium falciparum e implementação e avaliação de teste in vitro por fluorescência de atividade antiplasmodial

    OpenAIRE

    Cordeiro, Thuany de Moura

    2014-01-01

    A malária é uma doença infecciosa causada por protozoários Plasmodium spp. O P. falciparum é considerado o mais severo por ser o responsável pela maioria dos casos de morte causados pela doença. Devido ao rápido surgimento de cepas de P. falciparum resistentes às drogas antimalariais dá-se a importância de realizar um screening de compostos da biodiversidade, além de elucidar os mecanismos de ação de substâncias com comprovada ação antiplasmodial, como por exemplo, a rottlerin, um inibidor da...

  7. Estudo da atividade inibitória enzimática da quercetina sobre a resposta vasodepressora induzida pela bradicinina

    Directory of Open Access Journals (Sweden)

    Luciane Pereira Nascimento Häckl

    Full Text Available Em estudos recentes tem sido sugerido que os flavonóides, compostos de origem vegetal sendo encontrados em vários produtos alimentares, possuem uma ação inibitória de vários sistemas enzimáticos. A inibição da enzima conversora da angiotensina (ECA tem sido utilizada no tratamento da hipertensão. O mecanismo de ação dos inibidores da ECA implica na formação da Angiotensina II e na degradação da bradicinina. O propósito do presente estudo foi de analisar a ação da quercetina na atividade da ECA através da avaliação do efeito da angiotensina I (AI e da bradicinina (BK na pressão arterial de ratos anestesiados. Foram utilizados neste estudo ratos Wistar machos adultos. Estes animais foram anestesiados com uretana e foi introduzida na traquéia uma cânula de polietileno (PE 240 para facilitar a respiração. Também foi isolada e canulada (PE 50 a veia jugular para administração das substâncias em estudo. Para registro da pressão arterial foi introduzida na artéria carótida comum esquerda uma cânula de polietileno (PE 50 acoplada a um transdutor de pressão. A administração de BK (10 nmol/kg, i.v. induziu um efeito hipotensor, enquanto que a administração de AI (0,1 nmol/kg induziu uma resposta hipertensora. Pré-tratamento com captopril v.o. (100 nmol/kg 45 min antes e i.v. (10 nmol/kg 5 min antes aumentou significativamente a resposta à BK; embora captopril reduziu, também significativamente, o efeito da AI. O tratamento com quercetina via oral (30 mg/kg 45 min antes e via intravenosa (5 mg/kg 5 min antes aumentou significativamente o efeito da BK. O efeito da AI foi significativamente reduzido por ambos os tratamentos. Estes resultados sugerem que a quercetina potenciou o efeito hipotensor da bradicinina e reduziu o efeito hipertensor da angiotensina I através de ação inibitória sobre a enzima conversora da angiotensina, portanto apresentando um mecanismo de ação semelhante ao captopril.

  8. Atividade antitríptica de proteínas em polpas e sementes de frutas tropicais

    Directory of Open Access Journals (Sweden)

    Ágnes Denise de Lima Bezerra

    2014-06-01

    Full Text Available A alimentação saudável e diversificada é essencial para a manutenção da saúde física e mental, e apesar de o perfil alimentar atual valorizar a praticidade do comer, nota-se que a população está consumindo, de forma crescente, frutas, tanto na forma in natura como na forma de sucos. No entanto, o consumo de certas frutas in natura ocorre acompanhado da ingestão de suas sementes, cascas ou mesmo outras partes, podendo existir fatores antinutricionais, moléculas e/ou compostos que podem interferir na biodisponibilidade e/ou digestibilidade de nutrientes, tais como os inibidores de tripsina. Tais inibidores podem prejudicar o aproveitamento de proteínas presentes nos alimentos, porém estudos recentes vêm sendo divulgados, demonstrando também os efeitos benéficos dos mesmos. Este estudo teve como objetivo avaliar inibidores de tripsina nos extratos aquosos das frutas: goiaba (Psidium guajava L, das variedades Kumagai (branca e Paluma (vermelha; maracujá-amarelo (Passiflora edulis f. e melancia (Citrullus vulgaris Schrad. Para tal, foi realizada a detecção da presença da atividade antitríptica e a dosagem de proteínas solúveis. Em todos os extratos analisados, foi detectada atividade inibitória de tripsina, bem como de proteínas solúveis. Assim, a inibição pode ser explicada pela presença de inibidores proteicos, pois, nos extratos de sementes, em SDS-PAGE, foi possível visualizar um largo espectro de bandas proteicas. Vale ressaltar que, no estudo, as bandas proteicas que coincidem com as massas moleculares dos inibidores de tripsina não apareceram de forma majoritária, demonstrando que os extratos de sementes, provavelmente, possuem inibidor proteico, no entanto em pouca quantidade, justificando a baixa atividade antitríptica (1,36 a 15,15 UI / mg de peso seco, também apresentada pelos extratos de polpa. Portanto, tendo em vista o consumo recomendado das frutas, incluindo goiaba, maracujá e melancia

  9. Isolation of natural inhibitors of papain obtained from Carica papaya latex

    Directory of Open Access Journals (Sweden)

    Rubens Monti

    2004-09-01

    Full Text Available Studies were carried out to natural papain inhibitor from papaya latex. Fresh latex from green fruits of Carica papaya was collected and immediately transported in ice bath to the lab, from which three fractions with inhibitor effect of esterase papain activity were isolated by latex dialysis, Sephadex G-25 gel filtration and ionic exchange chromatography in SP-Sephadex C-25. The isolated fractions, identified as inhibitors I and II, showed a negative reaction with ninhydrin; however, the fraction identified as P-III showed positive reaction with ninhydrin. Kinetics data showed non-competitive inhibition (inhibitor I and uncompetitive (inhibitors II and P-III.Este trabalho apresenta novos dados sobre inibidores naturais de papaína. O látex fresco de frutos verdes de Carica papaya foi coletado pela manhã em plantações da região de Araraquara, SP, Brasil e imediatamente transportado ao laboratório em banho de gelo. Três frações com efeito inibitório da atividade esterásica da papaína foram isoladas a partir do látex fresco, através de diálise, filtração em Sephadex G-25 e cromatografia em SP-Sephadex C-25. As frações isoladas identificadas como inibidores I e II, mostraram reação negativa à ninidrina; entretanto, a fração identificada como P-III mostrou reação positiva. Dados cinéticos revelaram inibição não-competitiva (inibidor I e incompetitiva (inibidores II e P-III.

  10. Ethylene inhibitor aminoethoxyvinilglycine on glomerella leaf spot in apple cultivar 'Royal Gala' Inibidor de etileno aminoetoxivinilglicina sobre a mancha foliar de 'Glomerella' na cultivar de macieira 'Royal Gala'

    Directory of Open Access Journals (Sweden)

    Amauri Bogo

    2011-06-01

    Full Text Available Aqueous solution of Aminoethoxyvinylglycine (AVG has been commercialized in Brazil as ReTainTM C, 15% mainly as a potent inhibitor of ethylene biosynthesis by prevention of pre-harvest abscission and ripening of apple fruits. The effect of the product was evaluated during the 2007-08 and 2008-09 crop seasons in edafoclimatic conditions of Santa Catarina upland. Plants of 'Royal Gala' cultivar were sprayed with ReTainTM C, four weeks before the first commercial harvest at doses of 0; 62,5; 125, and 250mg a.i L-1. The incidence and severity were quantified weekly in 100 leaves distributed in four branches with 12 replications and assessed the area under the incidence -I and severity -S disease progress curve (AUIDPC and AUSDPC of Glomerella leaf spot (GLS. The AUIDPC and AUSDPC were significantly higher after AVG application and although there was no significant difference between 125 and 250mg a.i L-1 doses in both 2007-08 and 2008-09 crop seasons. In general, the symptoms of GLS (e.g. chlorosis, necrosis increased between the fourth and eighth week after application.Solução aquosa de Aminoetoxivinilglicina (AVG tem sido comercializada no Brasil como ReTainTM C, 15%, principalmente como um potente inibidor da biossíntese do etileno na prevenção da abscisão e maturação de frutos em macieira. O efeito do produto foi avaliado durante as safras 2007-08 e 2008-09 nas condições edafo-climáticas do planalto Catarinense. Plantas de maçãs 'Royal Gala' foram pulverizadas com o ReTainTM C, quatro semanas antes da primeira colheita comercial, nas concentrações de 0;62,5; 125 e 250mg i.a L-1. A incidência e a severidade foram quantificadas semanalmente em 100 folhas, distribuídas em quatro ramos por plantas, com 12 repetições e calculado a área abaixo da curva do progresso da incidência -I e severidade -S da doença (AACPID e AACPSD. A AACPID e AACPSD foram significativamente maiores após a aplicação do AVG e não houve diferen

  11. Efeito da temperatura de extrusão na absorção de água, solubilidade e dispersibilidade da farinha pré-cozida de milho-soja (70:30

    Directory of Open Access Journals (Sweden)

    Fernandes Marilene S.

    2003-01-01

    Full Text Available Com o objetivo de verificar a possibilidade do uso das farinhas pré-cozidas de milho-soja (70:30 por extrusão em produtos alimentícios, foram estudadas suas características tecnológicas. A mistura crua de milho e soja foi extrusada num extrusor Brabender de dupla-rosca com velocidade de alimentação constante de 20,8Kg/h, velocidade da rotação de parafuso de 100rpm e diâmetro de matriz de 5mm. Os perfis da temperatura de barril (TB foram: zona 1,60ºC (constante; zona 2,90ºC (constante; zona 3, 90, 110, 130 ou 150ºC e zona 4 (matriz, 110, 130 ou 150ºC. Os resultados mostraram que, o aumento da TB nas zonas 3 e 4 causou um aumento na absorção de água, nitrogênio solúvel em água, índice de solubilidade de nitrogênio, proteína dispersível em água e índice de dispersibilidade de proteína. Não foi verificada a atividade do inibidor de tripsina nas farinhas extrusadas estudadas. Sugere-se, portanto, o uso destas nos produtos cárneos e de panificação.

  12. Potenciais alternativas com extratos vegetais no controle da pinta preta do tomateiro

    Directory of Open Access Journals (Sweden)

    Edvan Nilson de Almeida

    2017-10-01

    Full Text Available Objetivou-se com o presente estudo avaliar o potencial antifúngico de três espécies de plantas medicinais: Zingiber officinale (gengibre, Allium sativum L. (alho e Caryophyllus aromaticus L. (cravo-da-índia in vitro e in vivo, para o controle do patógeno Alternaria solani, agente causal da pinta preta. Avaliou-se in vitro o crescimento micelial, germinação de esporos e o tamanho de tubos germinativos de A. solani nas concentrações de 1,0, 5,0, 10, 15 e 20%. Para a avaliação in vivo sementes de tomateiro cv. Santa Cruz Kada foram semeadas em bandejas de isopor de 200 células contendo substrato comercial. Após 30 dias as mudas foram transplantadas para vasos de 5 L contendo solo e mantidas em casa de vegetação. Os tratamentos para o ensaio em in vivo foram extrato aquoso de gengibre, alho e cravo-da-índia na concentração de 20%. As aplicações foram iniciadas após 47 dias do transplante das mudas para casa de vegetação, sendo realizada uma vez por semana até o momento da colheita. Foram realizadas avaliações da área abaixo da curva de progresso da doença (AACPD, número médio e peso de frutos. Os experimentos foram conduzidos em delineamento inteiramente casualizado, com cinco repetições. Os extratos de cravo-da-índia, alho e gengibre apresentaram efeito inibidor direto sobre o fungo e reduziram a AACPD em 55,8, 29,5 e 22,5% em relação à testemunha água, respectivamente. Esses resultados indicam potencial dos extratos vegetais avaliados no controle da pinta preta do tomateiro, com destaque para o extrato de cravo-da-índia.

  13. Efficacy of pharmacological treatment of dementia Eficácia do tratamento farmacológico da demência

    Directory of Open Access Journals (Sweden)

    Leon Flicker

    2002-04-01

    Full Text Available Over the last 25 years an increasing number of studies have been performed to evaluate therapeutic agents for people with dementia. Although numerous agents have been trialed at this stage there little evidence that therapeutic agents can prevent dementia or ameliorate the progression of dementia of any type. There is some evidence that specific medical management in high risk individuals can prevent strokes, and thus probably prevent vascular dementia, although this is extrapolating from the available evidence. There is considerable evidence that cholinesterase inhibitor are effective for cognitive symptoms in people with mild to moderate AD, and there is some evidence that they are also effective for other behavioural and functional symptoms. The currently available cholinesterase inhibitors seem to have approximately the same sized effect and thus the choice of agent may be largely determined by the incidence of side-effects. These agents have modest effects and a cautious therapeutic trial is indicated for those subjects with mild to moderate AD.Durante os últimos 25 anos, um número crescente de ensaios clínicos vem sendo conduzido com objetivo de avaliar a eficácia terapêutica de drogas para o tratamento de indivíduos com demência. Embora várias medicações tenham sido testadas, até o momento há pouca evidência de que essas drogas possam prevenir a síndrome demencial ou interferir em sua progressão, qualquer que seja a etiologia. Há alguma evidência de que intervenções específicas podem reduzir o risco de acidente vascular cerebral em indivíduos com alto risco e, assim, prevenir o desenvolvimento de demência vascular – embora isto seja uma extrapolação feita a partir dos dados disponíveis. Há evidência relativamente robusta de que os inibidores da colinesterase são eficazes para o tratamento dos sintomas cognitivos de pessoas com doença de Alzheimer (DA de gravidade leve à moderada, e há alguma evidência de

  14. Estudo do efeito da hidroxiuréia no mecanismo de gelatinização das suspensões de colágeno e de hemoglobina.

    OpenAIRE

    Alves, Ellen Denise Lopes

    2014-01-01

    Programa de Pós-Graduação em Engenharia de Materiais. Rede Temática em Engenharia de Materiais, Pró-Reitoria de Pesquisa e Pós-Graduação, Universidade Federal de Ouro Preto. A hidroxiuréia, antineoplásico potente usado no tratamento de vários tipos de câncer e na síndrome da imunodeficiência adquirida, é um inibidor eficiente na síntese de DNA de células humanas e bacterianas, e também é considerada a principal droga ministrada em pacientes com anemia falciforme. A anemia falciforme é cons...

  15. Síndrome serotoninérgica associada ao uso de paroxetina: relato de caso

    Directory of Open Access Journals (Sweden)

    CAVALLAZZI LUÍS OTÁVIO

    1999-01-01

    Full Text Available Relatamos um caso de síndrome serotoninérgica pelo uso de inibidor da recaptação da serotonina, a paroxetina. Tal síndrome por esta droga, sem combinações, ainda não tinha sido descrita na literatura.

  16. Expressão de metaloproteinases de matriz e de seus inibidores teciduais em carcinomas basocelulares Expression of matrix metalloproteinasis and their tissue inhibitors in basal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Rosy Iara Maciel de Azambuja Ribeiro

    2008-04-01

    Full Text Available INTRODUÇÃO: Aproximadamente 80% das neoplasias malignas de pele não-melanomas são carcinomas basocelulares (CBC. Apesar das raras metástases, esses tumores são localmente agressivos. As metaloproteinases de matriz (MMPs, especialmente as MMP-2 e 9, são importantes no processo de invasão. Em contrapartida, os inibidores teciduais das MMPs (TIMPs têm como principal função a inibição dessas enzimas. OBJETIVO: Investigar a associação de variáveis clinicopatológicas de pacientes portadores de CBC com a expressão de MMP-2, MMP-9, TIMP-1 e TIMP-2. MATERIAL E MÉTODOS: Foram selecionados 31 casos de CBC, sendo então obtidos, retrospectivamente, os dados referentes a idade, sexo e tamanho da lesão. Cortes histológicos das lesões foram submetidos a reação imuno-histoquímica pela técnica estreptavidina-biotina-peroxidase para detecção dos antígenos de interesse. Índices de imunomarcação foram construídos e comparados com os dados previamente obtidos. RESULTADOS: Observou-se correlação significativa entre idade e tamanho da lesão (R = 0,532; p = 0,008. Não foram observadas correlações significativas entre as outras variáveis e a expressão imuno-histoquímica dos antígenos de interesse. CONCLUSÃO: A expressão das metaloproteinases e de seus inibidores teciduais não parece ser influenciada pelos parâmetros investigados. Estudos adicionais são necessários para melhor compreensão de sua associação com o comportamento biológico do CBC.INTRODUCTION: Approximately 80% of non-melanoma skin neoplasias are basal cell carcinomas (BCC. Although metastasis is rare, BBC carcinomas are locally aggressive tumors. Matrix metalloproteinases (MMPs, mainly MMP-2 and MMP-9, play an important role on the invasion process. On the other hand, tissue inhibitors of MMPs (TIMPs have the main function of inhibiting these enzymes. OBJECTIVE: To investigate the association of clinical-pathological variables of BCC patients with the

  17. Impacto do polimorfismo genetico da enzima conversora da angiotensina no remodelamento cardiaco

    Directory of Open Access Journals (Sweden)

    Felipe Neves de Albuquerque

    2014-01-01

    Full Text Available Fundamento: O papel dos polimorfismos genéticos da enzima de conversão da angiotensina na insuficiência cardíaca, como preditor de desfechos ecocardiográficos, ainda não está estabelecido. é necessário identificar o perfil local para observar o impacto desses genótipos na população brasileira, sendo inédito o estudo da insuficiência cardíaca de etiologia exclusivamente não isquêmica em seguimento mais longo que 5 anos. Objetivo: Determinar a distribuição das variantes do polimorfismo genético da enzima de conversão da angiotensina e sua relação com a evolução ecocardiográfica de pacientes com insuficiência cardíaca de etiologia não isquêmica. Métodos: Análise secundária de prontuários de 111 pacientes e identificação das variantes do polimorfismo genético da enzima de conversão da angiotensina, classificadas como DD (Deleção/Deleção, DI (Deleção/Inserção ou II (Inserção/Inserção. Resultados: As médias da coorte foram: seguimento de 64,9 meses, idade de 59,5 anos, 60,4% eram homens, 51,4% eram brancos, 98,2% faziam uso de betabloqueadores e 89,2% de inibidores da enzima de conversão da angiotensina ou de bloqueador do receptor da angiotensina. A distribuição do polimorfismo genético da enzima de conversão da angiotensina foi: 51,4% de DD; 44,1% de DI; e 4,5% de II. Não se observou nenhuma diferença das características clínicas ou de tratamento entre os grupos. O diâmetro sistólico do ventrículo esquerdo final foi a única variável ecocardiográfica isolada significativamente diferente entre os polimorfismos genéticos da enzima de conversão da angiotensina: 59,2 ± 1,8 para DD versus 52,3 ± 1,9 para DI versus 59,2 ± 5,2 para II (p = 0,029. No seguimento ecocardiográfico, todas as variáveis (diferença entre a fração de ejeção do ventrículo esquerdo da última e da primeira consulta; diferença entre o diâmetro sistólico do ventrículo esquerdo da última e da primeira

  18. Reboxetina no tratamento da bulimia nervosa Reboxetine in the treatment of bulimia nervosa

    Directory of Open Access Journals (Sweden)

    Simone Mancini Castilho

    2003-06-01

    Full Text Available É vasta a literatura demonstrando a eficácia dos antidepressivos inibidores seletivos da recaptação de serotonina na Bulimia Nervosa, diminuindo a freqüência do comportamento alimentar compulsivo e dos vômitos. A boa resposta terapêutica aos agentes farmacológicos noradrenérgicos, como a desipramina e a reboxetina, embora menos encontrada na literatura, também já foi documentada. O presente relato de caso descreve o tratamento de uma paciente com Bulimia Nervosa utilizando-se reboxetina na dose de 4 a 8 mg ao dia. A resposta terapêutica vem confirmar os resultados favoráveis do uso desta droga no tratamento da Bulimia Nervosa.There is a substancial body of literature demonstrating the efficacy of selective serotonin reuptake inhibitors antidepressants (SSRI in reducing binge eating and vomiting frequency in Bulimia Nervosa. Good therapeutic response to noradrenergic agents, like desipramine and reboxetine, though not frequently reported in literature, has already been demonstrated. This case report describes the treatment of Bulimia Nervosa with reboxetine (4 to 8 mg/day and its favorable therapeutic results.

  19. Diretrizes da Associação Médica Brasileira para o tratamento do transtorno de ansiedade social Guidelines of the Brazilian Medical Association for the treatment of social anxiety disorder

    Directory of Open Access Journals (Sweden)

    Michelle N. Levitan

    2011-09-01

    Full Text Available INTRODUÇÃO: O transtorno de ansiedade social (TAS é o transtorno de ansiedade mais comum, freqüentemente sem remissões, sendo comumente associado com importante prejuízo funcional e psicossocial. A Associação Médica Brasileira (AMB, através do "Projeto Diretrizes", busca desenvolver consensos de diagnóstico e tratamento para as doenças mais comuns. O objetivo deste trabalho é apresentar os achados mais relevantes das diretrizes relativas ao tratamento do TAS, servindo de referência para o médico generalista e especialista. MÉTODO: O método utilizado foi o proposto pela AMB. A busca foi realizada nas bases de dados do MEDLINE (PubMed, Scopus, Web of Science e Lilacs, entre 1980 e 2010. A estratégia utilizada baseou-se em perguntas estruturadas na forma P.I.C.O (acrônimo das iniciais "paciente ou população"; "intervenção, indicador ou exposição"; "controle ou comparação" e; "outcome ou desfecho". RESULTADOS: Estudos evidenciam que o tratamento farmacológico de primeira linha para adultos e crianças são os inibidores seletivos de recaptação de serotonina e os inibidores de recaptação de serotonina e noradrenalina, enquanto que a terapia cognitivo-comportamental é apontada como melhor tratamento psicoterápico. Além disso, algumas comorbidades psiquiátricas foram associadas a uma pior evolução do TAS. CONCLUSÕES: Apesar da alta prevalência, o TAS acaba por não receber a devida atenção e tratamento. A melhor escolha para o tratamento de adultos é a associação psicoterapia cognitivo-comportamental com inibidores seletivos de recaptação de serotonina e os inibidores de recaptação de serotonina e noradrenalina. Outras opções como benzodiazepínicos ou inibidores da monoamino-oxidase devem ser usados como segunda e terceira opção respectivamente.INTRODUCTION: Social anxiety disorder (SAD is the most common anxiety disorder, usually with no remission, and is commonly associated with significant

  20. Farmacogenética de inibidores seletivos de recaptação de serotonina: uma revisão Pharmacogenetics of selective serotonine reuptake inhibitors: a review

    Directory of Open Access Journals (Sweden)

    Diana Klanovicz Silva

    2008-01-01

    Full Text Available A variabilidade da resposta aos medicamentos se deve em grande parte a fatores genéticos, e essa variabilidade afeta os efeitos terapêuticos e as reações adversas, de forma que a mesma dose de um medicamento pode ser benéfica para um paciente mas ineficaz para outro. Os fármacos conhecidos como inibidores seletivos de recaptação de serotonina (ISRSs pertencem a uma classe de medicamentos utilizados para o tratamento de uma série de patologias relacionadas com a serotonina, especialmente a depressão. O objetivo deste trabalho é reunir os dados presentes na literatura sobre a associação de genes candidatos com a resposta a ISRSs, fornecendo assim um panorama sobre o estado atual de conhecimento sobre o assunto. A resposta ao tratamento com ISRSs depende da variabilidade de genes codificantes de proteínas envolvidas com o papel da serotonina no cérebro. Com os avanços conquistados a partir do Projeto Genoma Humano, foi possível detectar essas variações, e várias delas mostraram ter importância farmacogenética. Portanto, alguns dos genes relacionados à farmacogenética dos ISRSs já são conhecidos, o que torna clara a necessidade de maiores investigações prospectivas para determinar a real utilidade desse conhecimento na prática clínica, com relação à possibilidade da determinação da dose adequada do fármaco correto para cada paciente, prática que vem sendo denominada de "medicina personalizada".A large proportion of the variability in drug response is due to genetic factors, and this variability affects therapeutic effects and adverse reactions, so that the same dosage of a drug can be beneficial to some patients, but ineffective to others. The drugs known as selective serotonin reuptake inhibitors (SSRI belong to a pharmacological class used in the management of a number of diseases related to serotonin, especially depression. The aim of this paper is to collect data from the literature about the association of

  1. Purification of a membrane-bound trypsin-like enzyme from the gut of the velvetbean caterpillar (Anticarsia gemmatalis Hübner =Purificação de uma enzima “tipo tripsina” não-solúvel do intestino da lagarta da soja (Anticarsia gemmatalis Hübner

    Directory of Open Access Journals (Sweden)

    Marcelo Matos Santoro

    2012-07-01

    Full Text Available Disruption of protein digestion in insects by specific endoprotease inhibitors is being regarded as an alternative to conventional insecticides for pest control. To optimize the effectiveness of this strategy, the understanding of the endoprotease diversity of the target insect is crucial. In this sense, a membrane-bound trypsin-like enzyme from the gut of Anticarsia gemmatalis fifth-instar larvae was purified. Non-soluble fraction of the gut extract was solubilized with 3-[(3-cholamidopropyldimethylammonio]-1-propanesulfonate (CHAPS and subjected to a p-aminobenzamidine affinity chromatography followed by anion-exchange chromatography. The yield of the purified enzyme was 11% with a purification factor of 143 and a final specific activity of 18.6 µM min.-1 mg-1 protein using N-α-benzoyl-L- Arg-p-nitroanilide (L-BApNA as substrate. The purified sample showed a single band with proteolytic activity active and apparent molecular mass of 25 kDa on SDS-PAGE. Molecular mass determined by MALDI-TOF mass spectrometry was 28,632 ± 26 Da. Although the low recovery and the difficulties in purifying large enzyme amounts limited its further characterization, the results contribute for the understanding of the proteases present on A. gemmatalis gut, which are potential targets for natural or specifically designed protease inhibitors.Comprometer a digestão de proteínas dos insetos pelo uso de inibidores específicos de endoproteases tem sido amplamente estudado como um método de controle de pragas alternativo ao uso dos inseticidas convencionais. No processo de otimização desta estratégia, o conhecimento da diversidade das endoproteases do inseto alvo torna-se crucial. Neste sentido, uma enzima “tipo-tripsina” ligada à membrana obtida do intestino de larvas do 5° instar de A. gemmatalis foi purificada. A fração insolúvel do extrato do intestino foi solubilizada com 3-[(3-cholamidopropyldimethylammonio]-1-propanesulfonate (CHAPS e submetida

  2. Experimental study of the action of COX-2 selective nonsteroidal anti-inflammatory drugs and traditional anti-inflammatory drugs in bone regeneration Estudo experimental da ação dos anti-inflamatórios não hormonais inibidores seletivos da ciclooxigenase 2 (COX-2 e anti-inflamatórios tradicionais na regeneração óssea

    Directory of Open Access Journals (Sweden)

    Bruno C. Tiseo

    2006-06-01

    Full Text Available OBJECTIVE: The aim of this study is to compare the effects of traditional nonsteroidal anti-inflammatory drugs with nonsteroidal anti-inflammatory drugs that are selective cyclooxygenase-2 (COX-2 inhibitors in the process of bone regeneration in a rat model. MATERIALS AND METHODS: Forty-four Wistar strain rats were subjected to osteotomy of the right femur and randomly divided into 3 groups according to the drug to be given (diclofenac, rofecoxib, or placebo. Each group was divided into 2 subgroups according to the time to euthanasia after the surgery. The animals of Subgroup 1 were submitted to euthanasia 2 weeks after surgery, and those of Subgroup 2, underwent euthanasia 4 weeks after surgery. Radiographic examinations and bone callus histomorphometry were analyzed. RESULTS: No intergroup statistical difference was found in the bone callus area or in bone formation area 2 and 4 weeks after surgery. Intra-group analysis concerning the bone neoformation area inside the callus showed a significant difference within the diclofenac group, which presented less tissue. CONCLUSIONS: Fracture consolidation in Wistar rats occurs within less than 2 weeks, and the use of nonsteroidal anti-inflammatory drugs does not significantly influence this process.OBJETIVO: Comparar os efeitos do uso de antiinflamatórios não-esteróides tradicionais (AINES e AINES que são inibidores seletivos da ciclooxigenase-2 (COX-2, no processo de regeneração óssea em ratos. MATERIAL E MÉTODO: Quarenta e quatro ratos da linhagem Wistar submetidos a osteotomia do femur direito e divididos em três grupos, conforme o medicamento que receberam (diclofenaco, rofecoxib e placebo. Cada grupo foi dividido em dois subgrupos, conforme o tempo até o sacrifício, após a cirurgia. Os animais do subgrupo 1 foram sacrificados duas semanas após a cirurgia e os do subgrupo 2, quatro semanas após a cirurgia. Foram analisados exames radiográficos e a histomorfometria do calo

  3. Acesso aos medicamentos para tratamento da doença de Alzheimer fornecidos pelo Sistema Único de Saúde em Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Celline Cardoso Almeida-Brasil

    Full Text Available Resumo: Avaliou-se as barreiras de acesso ao tratamento da doença de Alzheimer com base nos processos administrativos de medicamentos inibidores da colinesterase (IChE, enviados à Secretaria de Estado de Saúde de Minas Gerais, Brasil, entre 2012 e 2013. Utilizando-se informações de 165 processos selecionados aleatoriamente, abordaram-se as dimensões de acesso: acessibilidade geográfica, acomodação, aceitabilidade, disponibilidade e capacidade aquisitiva. O trâmite administrativo para o fornecimento dos IChE levou em média 39 dias e foi influenciado por características do trajeto percorrido pelo usuário. A maioria dos prescritores cumpriu menos de 80% dos critérios exigidos pelo Protocolo Clínico e Diretrizes Terapêuticas (PCDT da doença de Alzheimer. Como resultado, 38% dos processos não foram deferidos. A capacidade aquisitiva para o tratamento privado mensal com IChE foi de cerca de 21 dias de salário mínimo. Conclui-se que a burocracia do trâmite administrativo e a dificuldade de seguimento do PCDT pelos prescritores prejudicam o acesso ao tratamento da doença de Alzheimer e constituem uma grande carga para o orçamento dos pacientes.

  4. Terapia anti-hipertensiva utilizada por pacientes idosos de Porto Alegre/RS, Brasil = Antihypertensive therapy used by elderly patients from Porto Alegre/RS, Brazil

    Directory of Open Access Journals (Sweden)

    Schroeter, Guilherme

    2006-01-01

    Conclusões: Os diuréticos, inibidores da ECA e betabloqueadores foram os anti-hipertensivos mais utilizados. Muitas vezes o usuário comete erros na medicação, o que pode ser resolvido com uma assistência correta a esse paciente. Diante da prevalência da hipertensão entre os idosos, observa-se a necessidade de uma maior atenção dos profissionais de saúde a esses pacientes

  5. Resposta de calâncoe a reguladores de crescimento

    Directory of Open Access Journals (Sweden)

    MARCELLE MICHELOTTI BETTONI

    2009-06-01

    Full Text Available Kalanchoe (Kalanchoe blossfeldiana é uma planta ornamental envasada de destaque na floricultura nacional. O mercado demanda que ela apresente um crescimento vigoroso, porte pequeno (máximo 21 cm de altura com, no mínimo, dez flores abertas por vaso. Para produzirem plantas de primeira qualidade, os produtores de kalanchoe utilizam reguladores vegetais inibidores da síntese de giberelina. O CCC (Cloreto de Chlormequat é um inibidor da síntese de giberelina pouco usado em kalanchoe, porém, em outras ornamentais, tem sido relacionado com a obtenção de plantas mais atrativas para o mercado consumidor, por serem mais compactas, com hastes mais fortes e folhas mais verdes. Entre os reguladores vegetais, a aplicação de citocinina tem sido relacionada com aumento do número de hastes e de botões florais. Visando a reduzir o porte e aumentar o número de flores por planta, esta pesquisa avaliou o efeito da aplicação em kalanchoe do inibidor de giberelina Tuval® (contendo 100g L-1 de CCC e do extrato da alga Ascophyllum. Nodosum (composto contendo citocinina natural, em três épocas diferentes. Os resultados obtidos demonstraram que o Tuval®, nas concentrações de 1000 e 2000 mg L-1, reduziu o porte de kalanchoe; entretanto, a redução não foi suficiente para que as plantas pudessem ser consideradas como de primeira qualidade, e o efeito do extrato de A. nodosum na concentração de2000 mg L-1 associado ao CCC não ficou caracterizado.

  6. Eficácia de herbicidas inibidores da ACCase no controle de gramíneas em lavouras de soja Efficacy of ACCase-inhibiting herbicides in controlling grass weeds in soybean crops

    Directory of Open Access Journals (Sweden)

    A.L.L. Barroso

    2010-01-01

    Full Text Available Objetivou-se com este trabalho avaliar a eficácia de herbicidas inibidores da ACCase, aplicados isoladamente ou em associações, no controle das espécies de plantas daninhas pertencentes à família das gramíneas Brachiaria decumbens, Digitaria ciliaris, Eleusine indica, Brachiaria plantaginea e Cenchrus echinatus, na cultura da soja. O experimento foi conduzido em campo, em delineamento de blocos ao acaso com quatro repetições. Os tratamentos avaliados foram: clethodim (84 g ha-1, clethodim + quizalofop-p-ethyl (48 + 40 g ha-1, [clethodim + fenoxaprop-p-ethyl] (50 + 50 g ha-1, sethoxydim (230 g ha-1, tepraloxydim (100 g ha-1, fluazifop-p-butyl (125 g ha-1, haloxyfop-methyl (60 g ha-1 e testemunha sem herbicida. A convivência das plantas de soja com as gramíneas infestantes resultou em perda significativa na produtividade de grãos. Os melhores níveis de controle de B. decumbens foram verificados com a utilização de haloxyfop-methyl. Tepraloxydim pode ser considerado seletivo a B. decumbens. Nenhum tratamento proporcionou controle final de D. ciliaris superior a 90%, porém menor eficiência foi verificada quando se aplicaram sethoxydim e fluazifop-p-butyl. Apenas os tratamentos sethoxydim e [clethodim + fenoxaprop-p-ethyl] não mostraram controle satisfatório de E. indica. B. plantaginea foi a espécie mais facilmente controlada pelos herbicidas avaliados; no entanto, haloxyfop-methyl, tepraloxydim, clethodim e [clethodim + fenoxaprop-p-ethyl] se destacaram no controle dessa invasora. A adição de quizalofop-p-ethyl ao clethodim proporcionou incremento significativo no controle de C. echinatus. Também os herbicidas haloxyfop-methyl e tepraloxydim apresentaram controle satisfatório dessa espécie daninha.The objective of this work was to evaluate the efficacy of ACCase-inhibitors (ariloxyfenoxypropionates and cyclohexanodiones, applied alone or in combination, in controlling the grass weed species Brachiaria decumbens, Digitaria

  7. Analgésicos inibidores específicos da ciclooxigenase-2: avanços terapêuticos Analgésicos inhibidores específicos de la ciclooxigenase-2: avanzos terapéuticos Specific cyclooxygenase-2 inhibitor analgesics: therapeutic advances

    Directory of Open Access Journals (Sweden)

    Wilson Andrade Carvalho

    2004-06-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Os antiinflamatórios não-esteroidais (AINE estão entre as drogas mais prescritas e usadas no mundo, incluindo a utilização em Anestesiologia. O propósito desta revisão é discutir alguns aspectos atuais da bioquímica da ciclooxigenase, que vem servindo de base para o desenvolvimento dos novos AINE. CONTEÚDO: Estas drogas exercem suas ações principalmente através da inibição da ciclooxigenase (COX, a enzima chave que catalisa a conversão de ácido araquidônico em prostaglandinas e tromboxanos. Pelo menos duas isoformas da COX já foram identificadas, a COX-1, que é constitutivamente expressa na maioria dos tecidos, e a COX-2, que é uma forma induzível da enzima localizada principalmente nas células e tecidos envolvidos em processos inflamatórios. Com a descoberta da COX-2 e a determinação de sua estrutura, foi possível desenvolver drogas mais seletivas que reduzem a inflamação sem afetar a COX-1, protetora do estômago e rins, dando origem a uma nova geração de compostos antiinflamatórios denominados de inibidores específicos da COX-2. CONCLUSÕES: Embora estes compostos de última geração apresentem menor toxicidade para o trato gastrintestinal, outros efeitos adversos graves têm sido observados, incluindo insuficiência renal e efeitos cardiovasculares, como o infarto agudo do miocárdio e a trombose. A despeito destes efeitos colaterais, estes novos fármacos estão sendo testados em outras condições clínicas, principalmente no tratamento preventivo do câncer e da doença de Alzheimer.JUSTIFICATIVA Y OBJETIVOS: Los antiinflamatorios no-esteroidales (AINE están entre las drogas más prescritas y usadas en el mundo, incluyendo la utilización en Anestesiología. El propósito de esta revisión es discutir algunos aspectos actuales de la bioquímica de la ciclooxigenasis, que viene sirviendo de base para el desenvolvimiento de los nuevos AINE. CONTENIDO: Estas drogas ejercen su acci

  8. Qualidade tecnológica em diferentes porções do colmo e produtividade da cana-de-açúcar sob efeito de maturadores

    Directory of Open Access Journals (Sweden)

    Glauber Henrique Pereira Leite

    2010-12-01

    Full Text Available O objetivo deste trabalho foi avaliar a qualidade tecnológica da cana-de-açúcar, variedade RB855453, nas diversas porções do colmo, decorrente da aplicação de maturadores com diferentes mecanismos de ação e a influência na produtividade e na margem de contribuição agrícola. O delineamento experimental foi em blocos casualizados, com seis repetições. Os tratamentos constituíram-se da aplicação de três maturadores, sendo dois da classe dos inibidores do crescimento - glifosato, sulfometuron metil, e um da classe dos retardantes do crescimento - KNO3, com a adição de 1% de óleo vegetal, e a maturação natural como testemunha. Os tratamentos com KNO3 e sulfometuron metil, assim como a testemunha, não promoveram prejuízos ao desenvolvimento dos colmos. Os tratamentos com glifosato e sulfometuron metil propiciaram melhoria na qualidade tecnológica da matéria-prima, determinada até os 35 dias após aplicação, contribuindo para o processo de maturação e possibilitando antecipar o corte em relação à maturação natural (testemunha e ao tratamento com KNO3, propiciando maior retorno econômico. O tratamento com glifosato reduziu a produtividade de colmos, mas elevou a pol da cana na porção superior dos colmos, possibilitando maior altura de desponte.

  9. Rational Modulation of the Induced-Fit Conformational Change for Slow-Onset Inhibition in Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Lai, Cheng-Tsung; Li, Huei-Jiun; Yu, Weixuan; Shah, Sonam; Bommineni, Gopal R; Perrone, Victoria; Garcia-Diaz, Miguel; Tonge, Peter J; Simmerling, Carlos

    2015-08-04

    Slow-onset enzyme inhibitors are the subject of considerable interest as an approach to increasing the potency of pharmaceutical compounds by extending the residence time of the inhibitor on the target (the lifetime of the drug-receptor complex). However, rational modulation of residence time presents significant challenges because it requires additional mechanistic insight, such as the nature of the transition state for postbinding isomerization. Our previous work, based on X-ray crystallography, enzyme kinetics, and molecular dynamics simulation, suggested that the slow step in inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA involves a change in the conformation of the substrate binding loop from an open state in the initial enzyme-inhibitor complex to a closed state in the final enzyme-inhibitor complex. Here, we use multidimensional free energy landscapes for loop isomerization to obtain a computational model for the transition state. The results suggest that slow-onset inhibitors crowd key side chains on helices that slide past each other during isomerization, resulting in a steric clash. The landscapes become significantly flatter when residues involved in the steric clash are replaced with alanine. Importantly, this lower barrier can be increased by rational inhibitor redesign to restore the steric clash. Crystallographic studies and enzyme kinetics confirm the predicted effects on loop structure and flexibility, as well as inhibitor residence time. These loss and regain of function studies validate our mechanistic hypothesis for interactions controlling substrate binding loop isomerization, providing a platform for the future design of inhibitors with longer residence times and better in vivo potency. Similar opportunities for slow-onset inhibition via the same mechanism are identified in other pathogens.

  10. Análise de crescimento de biótipos de leiteira (Euphorbia heterophylla resistentes e suscetível aos herbicidas inibidores da ALS Growth analysis of resistant and susceptible wild poinsettia (Euphorbia heterophylla biotypes to ALS-inhibiting herbicides

    Directory of Open Access Journals (Sweden)

    R.A. Vidal

    2000-01-01

    Full Text Available Foram conduzidos dois experimentos em condições de casa de vegetação, com o objetivo de analisar comparativamente o crescimento de três biótipos de leiteira (Euphorbia heterophylla - EPHHL resistentes (R (Passo Fundo, Não-Me-Toque e Rio Pardo e um suscetível (S (Porto Alegre aos herbicidas inibidores da ALS, por meio do cálculo da taxa de crescimento relativo (TCR e dos índices que a compõem. Utilizou-se o delineamento experimental completamente casualizado, com três repetições e tratamentos organizados em fatorial 2 x 4 x 4, em que o fator A correspondeu às duas estações de crescimento (outono e primavera, o fator B aos quatro biótipos de EPHHL e o fator C às quatro épocas de determinação dos índices de crescimento das plantas de leiteira - no primeiro experimento, aos 15, 25, 35 e 45, e, no segundo, aos 23, 33, 43 e 53 dias após a emergência (DAE. No experimento realizado no outono não houve interação entre época de avaliação e biótipo nem efeito simples de biótipo. No experimento realizado na primavera, a razão de peso foliar (RPF do biótipo de Não-Me-Toque foi superior em média à dos demais biótipos; a razão de área foliar (RAF foi superior no biótipo de Não-Me-Toque aos 23 e 53 DAE; e não houve diferenças da TAL e TCR entre os biótipos. Esses resultados sugerem produtividade semelhante entre os biótipos R e S e, portanto, sua equivalência competitiva.Two trials were carried out under greenhouse conditions to compare the development of three ALS inhibitor herbicides resistant (R wild poinsettia (Euphorbia heterophylla biotypes (Passo Fundo, Não-Me-Toque and Rio Pardo - RS - Brazil and one susceptible (S (Porto Alegre - RS - Brazil using relative growth rate (RGR and related indices. The experiment was arranged as a completely randomized design, with three replications, in a 2 x 4 x 4 factorial, where factor A was two growth seasons (fall and spring; factor B, four biotypes of wild poinsettia

  11. Anticorpos fixadores de complemento para o vírus respiratório sincicial e adenovírus e inibidores da hemaglutinação para os vírus parainfluenza 1, 2 e 3 numa população infantil brasileira

    Directory of Open Access Journals (Sweden)

    José Alberto Neves Candeias

    1968-06-01

    Full Text Available Apresentaram-se os resultados obtidos na pesquisa de anticorpos fixadores de complemento para o vírus respiratório sincicial e adenovírus, assim como de anticorpos inibidores da hemaglutinação para os vírus parainfluenza dos tipos 1, 2 e 3, num grupo de 972 crianças de idade compreendida entre 3 meses e 14 anos. A técnica de colheita de sangue foi a de embebição em papel de filtro. Do total de crianças examinadas, considerando o conjunto de todas as idades, 34,6% apresentavam anticorpos para o vírus respiratório sincicial; as porcentagens com anticorpos para adenovírus, parainfluenza 1, parainfluenza 2 e parainfluenza 3, foram respectivamente 47,7%, 46,8%, 54,1% e 66,6%. Foram estudadas as distribuições dos anticorpos em função da idade, do sexo e da localização do domicílio. Em relação aos dois últimos atributos obtiveram-se os seguintes resultados: dos indivíduos do sexo masculino, 32,3% apresentavam anticorpos contra o vírus respiratório sincicial, 49,2% contra adenovírus, 60,1%, 65,1% e 78,3%, respectivamente, contra os vírus parainfluenza 1, 2 e 3; nas crianças do sexo feminino as porcentagens de positividade encontradas foram, respectivamente, 37,4%, 45,9%, 31,1%, 41,2% e 52,9%; em relação à localização do domicílio, 44,8% do total de crianças da zona rural mostraram possuir anticorpos contra o vírus respiratório sincicial, 70,1% contra adenovírus, 43,8% contra vírus parainfluenza 1 e 46,8% e 65,4% contra os vírus parainfluenza dos tipos 2 e 3; as porcentagens de positividade na zona urbana foram, respectivamente, 30,5%, 38,7%, 47,9%, 57,1% e 67,1%.The author presents the results of a survey for respiratory syncytial virus and adenovirus complement fixing antibodies and parainfluenza viruses 1, 2, 3 haemagglutination inhibition antibodies in a group of 972 chidren between 3 months and 14 years of age. The filter paper method of collecting whole blood was used. Altogether, the percentage of children

  12. An Effective Approach for Clustering InhA Molecular Dynamics Trajectory Using Substrate-Binding Cavity Features.

    Directory of Open Access Journals (Sweden)

    Renata De Paris

    Full Text Available Protein receptor conformations, obtained from molecular dynamics (MD simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to

  13. Overview of P-glycoprotein inhibitors: a rational outlook

    Directory of Open Access Journals (Sweden)

    Kale Mohana Raghava Srivalli

    2012-09-01

    Full Text Available P-glycoprotein (P-gp, a transmembrane permeability glycoprotein, is a member of ATP binding cassette (ABC super family that functions specifically as a carrier mediated primary active efflux transporter. It is widely distributed throughout the body and has a diverse range of substrates. Several vital therapeutic agents are substrates to P-gp and their bioavailability is lowered or a resistance is induced because of the protein efflux. Hence P-gp inhibitors were explored for overcoming multidrug resistance and poor bioavailability problems of the therapeutic P-gp substrates. The sensitivity of drug moieties to P-gp and vice versa can be established by various experimental models in silico, in vitro and in vivo. Ever since the discovery of P-gp, the research plethora identified several chemical structures as P-gp inhibitors. The aim of this review was to emphasize on the discovery and development of newer, inert, non-toxic, and more efficient, specifically targeting P-gp inhibitors, like those among the natural herb extracts, pharmaceutical excipients and formulations, and other rational drug moieties. The applications of cellular and molecular biology knowledge, in silico designed structural databases, molecular modeling studies and quantitative structure-activity relationship (QSAR analyses in the development of novel rational P-gp inhibitors have also been mentioned.Glicoproteína-p (P-gp, uma glicoproteína de transmembrana permeável, é um membro da superfamília (ABC de cassete de gene de ligação de ATP que funciona especificamente como um carreador mediado pelo transportador de efluxo ativo primário. É amplamente distribuído por todo o corpo e apresenta uma gama diversificada de substratos. Diversos agentes terapêuticos vitais são substratos para P-gp e sua biodisponibilidade é reduzida ou a resistência é induzida devido ao efluxo de proteínas. Portanto, os inibidores da P-gp foram explorados para a superação da resistência a

  14. HEMOFILIAS: FISIOPATOLOGIA, DIAGNÓSTICO E TRATAMENTO

    Directory of Open Access Journals (Sweden)

    Roberta Truzzi COLOMBO, Gerson ZANUSSO JÚNIOR

    2013-12-01

    Full Text Available A hemofilia é um grave distúrbio hereditário da coagulação sanguínea, causada pela deficiência da atividade coagulante do fator VIII (hemofilia A ou IX (hemofilia B. A doença é decorrente de alterações nos genes codificantes destes fatores localizados no braço longo do cromossomo sexual X. Assim sua ocorrência no sexo masculino é quase que exclusiva, devido o homem apresentar somente um cromossomo X. A gravidade da doença pode variar em severa, moderadamente severa e leve, após dosagem dos fatores VIII e IX da coagulação. Uma das complicações mais temíveis dos pacientes com esta doença refere-se ao desenvolvimento de inibidores, que são anticorpos direcionados contra os fatores infundidos. O diagnóstico da doença é realizado através de exames laboratoriais, principalmente pelo coagulograma completo e dosagem de fatores específicos, baseando-se nas manifestações clínicas apresentadas pelo paciente. A hemofilia não tem cura e a base do seu tratamento é a infusão do concentrado do fator deficiente. No entanto, pacientes podem desenvolver inibidores específicos para os fatores infundidos e, nestes casos as alternativas de tratamento são o uso da biotecnologia para novos medicamentos e o uso da terapia gênica

  15. As bases moleculares da hemofilia A

    Directory of Open Access Journals (Sweden)

    Simone Ferreira Pio

    2009-01-01

    Full Text Available As hemofilias são doenças hemorrágicas resultantes da deficiência de fator VIII (hemofilia A ou de fator IX (hemofilia B da coagulação, decorrentes de mutações nos genes que codificam os fatores VIII ou IX, respectivamente. A hemofilia A é mais frequente que a hemofilia B e acomete aproximadamente 1:10.000 nascimentos masculinos. A gravidade e frequência dos episódios hemorrágicos está relacionado ao nível residual de atividade de fator VIII presente no plasma e este relaciona-se ao tipo de mutação associada à doença. A clonagem do gene do fator VIII tornou possível o conhecimento das bases moleculares da hemofilia A, sendo hoje conhecidas mais de 1.000 mutações associadas à doença. O conhecimento das bases moleculares da hemofilia A permite uma melhor compreensão da relação genótipo-fenótipo da doença, tomada de condutas clínicas diferenciadas em casos de mutações associadas a um maior risco de desenvolvimento de inibidor, determinação da condição de portadora de hemofilia em mulheres relacionadas aos pacientes, implementação de programa de aconselhamento genético/orientação familiar e melhor compreensão das relações estruturais-funcionais do gene-proteína. Este artigo propõe revisar as bases moleculares da hemofilia A, os métodos laboratoriais utilizados para a caracterização das mutações e as implicações clínicas envolvidas no diagnóstico molecular da hemofilia A.Hemophilias are bleeding disorders due to deficiency of the blood coagulation factor VIII (hemophilia A or factor IX (hemophilia B, resulting from mutation on the gene coding for factor VIII or factor IX. Hemophilia A is more frequent than hemophilia B and affects 1:10,000 male newborns. The severity and frequency of hemorrhagic episodes is related to residual activity of factor VIII present in the plasma and relates to the type of mutation associated with the disorder. Cloning of the factor VIII gene has enabled researchers to

  16. Análise exploratória da utilização do programa de qualidade GESPÚBLICA nas instituições federais de ensino superior Exploratory analysis on the use of GESPÚBLICA quality program in public institutions of higher education

    Directory of Open Access Journals (Sweden)

    Eliane D'Martin Fowler

    2011-01-01

    Full Text Available atualmente tem-se dado importância à qualidade dos serviços públicos prestados ao cidadão. Propostas de gestão têm surgido para as organizações privadas, públicas, inclusive para Instituições de Ensino, como um diferencial para a melhoria dos serviços oferecidos. Programas da Qualidade, como o GESPÚBLICA, tornam-se uma opção para Instituições interessadas na melhoria da qualidade. O objetivo desse trabalho é averiguar quais Instituições Federais de Educação Superior possuem um programa da qualidade como o GESPÚBLICA implementado e, a partir de tal informação, conhecer as motivações e as restrições (inibidores, por parte dos gestores, para adesão ao programa. Dentre os fatores motivadores destacam-se melhoria do atendimento e a conquista do cidadão; melhoria contínua na gestão dos processos institucionais; redução da cultura burocrática; gestão baseada em fatos e maior valorização, capacitação dos servidores; gerenciamento eficaz da informação. Dentre os inibidores, citam-se a estrutura/recursos insuficientes para implantação do programa; custos envolvidos no programa; baixa capacitação, quadro reduzido e idade média avançada dos servidores; inexperiência institucional com programas da qualidade; excesso de burocracia e escassez de exemplos consolidados da implementação do programa nas Instituições de Ensino.Currently, great importance has been given to the quality of the public services offered to citizens. Proposals of management have emerged in private and public organizations, including educational institutions, as a differential for the improvement of services offered. Quality programs such as GESPÚBLICA have become an option for institutions interested in improving quality. The aim of this study is to determine which public Institutions of higher education have a quality program such as GESPÚBLICA implemented. The motivations and constraints (inhibitors to join the program were also

  17. Repercussão cardiovascular, com e sem álcool, do carbonato de lodenafila, um novo inibidor da PDE5 Repercusión cardiovascular, con y sin alcohol, del carbonato de lodenafila, un nuevo inhibidor de la PDE5 Cardiovascular repercussion of lodenafil carbonate, a new PDE5 inhibitor, with and without alcohol consumption

    OpenAIRE

    Adauto Carvalho Silva; Odaly Toffoletto; Luiz Antonio Galvão Lucio; Paula Ferreira dos Santos; Jorge Barros Afiune; João Massud Filho; Sergio Tufik

    2010-01-01

    FUNDAMENTO: A disfunção erétil afeta um grande número de homens no mundo e os inibidores de PDE 5 (iPDE5) estão entre os principais métodos de tratamento desses pacientes. O consumo social de álcool e o ato sexual apresentam uma relação considerável. Portanto, a associação entre álcool e iPDE5 pode ocorrer. O carbonato de lodenafila é um novo iPDE5 desenvolvido por uma empresa brasileira. OBJETIVO: Avaliar a repercussão cardiovascular do carbonato de lodenafila, associado ou não ao álcool, as...

  18. Resistance to ACCase inhibitors in Eleusine indica from Brazil involves a target site mutation Resistência aos inibidores de ACCase em Eleusine indica do Brasil envolve uma mutação na enzima alvo

    Directory of Open Access Journals (Sweden)

    M.D. Osuna

    2012-09-01

    Full Text Available Eleusine indica (goosegrass is a diploid grass weed which has developed resistance to ACCase inhibitors during the last ten years due to the intensive and frequent use of sethoxydim to control grass weeds in soybean crops in Brazil. Plant dose-response assays confirmed the resistant behaviour of one biotype obtaining high resistance factor values: 143 (fenoxaprop, 126 (haloxyfop, 84 (sethoxydim to 58 (fluazifop. ACCase in vitro assays indicated a target site resistance as the main cause of reduced susceptibility to ACCase inhibitors. PCR-generated fragments of the ACCase CT domain of the resistant and sensitive reference biotype were sequenced and compared. A point mutation was detected within the triplet of aspartate at the amino acid position 2078 (referred to EMBL accession no. AJ310767 and resulted in the triplet of glycine. These results constitute the first report on a target site mutation for a Brazilian herbicide resistant grass weed.Eleusine indica (ELEIN é uma espécie monocotiledônea, diploide. No Brasil, ela desenvolveu resistência aos inibidores da ACCase durante os últimos dez anos, devido ao uso intensivo e frequente desses graminicidas para controlar plantas daninhas em lavouras de soja. Experimentos de dose-resposta realizados com a planta confirmaram a resistência de um biótipo. Houve elevada tolerância aos herbicidas, com fatores de resistência da ordem de 143 (fenoxaprop, 126 (haloxyfop, 84 (sethoxydim e 58 (fluazifop. Ensaios com a enzima ACCase in vitro indicaram a insensibilidade desta como a principal causa de suscetibilidade reduzida a esses herbicidas. Fragmentos de PCR gerados do domínio CT da enzima ACCase dos biótipos resistente e sensível de referência foram sequenciados e comparados. Foi detectada uma mutação dentro do tripleto de asparagina na posição do aminoácido 2078 (referente ao acesso número AJ310767 no EMBL, que resultou no tripleto de glicina. Esses resultados constituem o primeiro caso

  19. MONITORAMENTO DA CORROSÃO INTERNA EM PLATAFORMAS OFFSHORE

    Directory of Open Access Journals (Sweden)

    Fernando Benedicto Mainier

    2008-08-01

    Full Text Available A corrosão é uma das principais causas de falhas em equipamentos e tubulações de plataformas de produção de petróleo. Essas falhas prejudicam o processo, atrasam o cronograma operacional de produção, geram altos custos de manutenção, além de gerar riscos à saúde e ao meio-ambiente. Devido ao fato de que a maioria dos equipamentos, tubulações e dutos das plataformas de produção são constituídos de aço (em geral, aço carbono, a indústria de exploração de petróleo estará sempre convivendo com os processos corrosivos. A utilização de um plano de monitoração da corrosão para diagnosticar, controlar e gerenciar a evolução dos processos corrosivos nas plataformas é a estratégia de ação proposta nesse trabalho. O Plano de Monitoração da Corrosão Interna (PMCI se baseia na análise laboratorial da corrosividade de fluídos e resíduos coletados periodicamente nos sistemas das plataformas de operação; na taxa de corrosão determinada pela utilização periódica de cupons instalados nas tubulações dos sistemas das plataformas, como cupons de perda de massa e sondas de resistência elétrica; e finalmente, na coleta periódica de dados operacionais obtidos durante a operação dos sistemas das plataformas. O PMCI irá direcionar e gerenciar as ações a serem tomadas no caso de um agravamento de um processo corrosivo, identificando dos mecanismos corrosivos e sua localização nos diversos sistemas das plataformas. A otimização do uso de inibidores de corrosão e outros produtos químicos é uma das principais vantagens do PMCI.

  20. MONITORAMENTO DA CORROSÃO INTERNA EM PLATAFORMAS OFFSHORE

    Directory of Open Access Journals (Sweden)

    Rafael Terzi

    2008-06-01

    Full Text Available A corrosão é uma das principais causas de falhas em equipamentos e tubulações de plataformas de produção de petróleo. Essasfalhas prejudicam o processo, atrasam o cronograma operacional de produção, geram altos custos de manutenção, além de gerarriscos à saúde e ao meio-ambiente. Devido ao fato de que a maioria dos equipamentos, tubulações e dutos das plataformas deprodução são constituídos de aço (em geral, aço carbono, a indústria de exploração de petróleo estará sempre convivendo com osprocessos corrosivos. A utilização de um plano de monitoração da corrosão para diagnosticar, controlar e gerenciar a evolução dosprocessos corrosivos nas plataformas é a estratégia de ação proposta nesse trabalho. O Plano de Monitoração da Corrosão Interna(PMCI se baseia na análise laboratorial da corrosividade de fluídos e resíduos coletados periodicamente nos sistemas dasplataformas de operação; na taxa de corrosão determinada pela utilização periódica de cupons instalados nas tubulações dossistemas das plataformas, como cupons de perda de massa e sondas de resistência elétrica; e finalmente, na coleta periódica dedados operacionais obtidos durante a operação dos sistemas das plataformas. O PMCI irá direcionar e gerenciar as ações a seremtomadas no caso de um agravamento de um processo corrosivo, identificando dos mecanismos corrosivos e sua localização nosdiversos sistemas das plataformas. A otimização do uso de inibidores de corrosão e outros produtos químicos é uma das principaisvantagens do PMCI.

  1. Inibição da tripsina de bicho-mineiro do cafeeiro por um fator não-protéico presente em extratos de folhas de mamona Coffee leaf miner trypsin inhibition with castor bean leaf extracts mediated by a non-protein agent

    Directory of Open Access Journals (Sweden)

    Guilherme Duarte Rossi

    2010-04-01

    Full Text Available Inibidores de tripsina representam uma estratégia de controle de insetos e, por isso, a identificação e caracterização desses inibidores são etapas muito importantes para que novas formas de controle de pragas sejam desenvolvidas. Os inibidores de tripsina atuam na digestão primária de proteínas e comprometem o processo digestivo por completo, reduzindo a disponibilidade de aminoácidos ao inseto. A incorporação de inibidores de tripsina na dieta de insetos-praga é uma forma de controle cuja eficácia foi verificada por diferentes autores. Este projeto foi conduzido a fim de se observar a eficiência de extratos de folhas de mamona na inibição "in vitro" de proteinases do tipo tripsina do bicho-mineiro do cafeeiro. Após testes realizados com os extratos de folhas de mamona não-fervidos e fervidos com e sem a adição de β-mercaptoetanol 0,2% (v/v e mediante precipitações com acetona, verificou-se que o inibidor é uma molécula termoresistente e não-protéica. Desta forma, iniciou-se um processo de purificação da molécula inibidora por meio de cromatografia de adsorção com posterior análise em espectrômetro de massas. Os resultados dos testes de inibição indicaram a presença de um inibidor de tripsina eficaz contra o bicho-mineiro do cafeeiro nos extratos de folhas de mamona capaz de inibir 2,48 + 0,15 UTI, o que representa aproximadamente 40% de inibição. Em testes realizados com tripsina bovina observou-se que o extrato de folhas de mamona não apresenta poder de inibição sobre essa enzima.Trypsin inhibitors stand for a strategy of insect control and, therefore, the identification and characterization of these inhibitors are very important steps for new forms of pest control to be developed. Trypsin inhibitors act in the primary digestion of proteins and endanger the digestive process wholly, reducing the availability of aminoacids to the insect. The incorporation of trypsin inhibitors in the diet of pest

  2. APROVEITAMENTO, COMPOSIÇÃO NUTRICIONAL E ANTINUTRICIONAL DA FARINHA DE QUINOA (CHENOPODIUM QUINOA

    Directory of Open Access Journals (Sweden)

    Cristiane de Oliveira LOPES

    2010-06-01

    Full Text Available

    A quinoa é um pseudocereal originário dos Andes, cultivado há milênios e amplamente distribuído ao mundo. No Brasil, foi introduzido na década de 90 e, através de modifi cações genéticas, desenvolveu-se a variedade BRS Piabiru, adaptada para cultivos em solos brasileiros. Nutricionalmente, destaca-se em relação a muitos cereais, como o trigo, o milho e a cevada, por apresentar qualidade protéica comparável à caseína do leite e pela ausência de proteínas formadoras de glúten. Além disso, possui elevado teor de lisina, vitaminas (como tiamina, ribofl avina, niacina e piridoxina e minerais (como magnésio, zinco, cobre, ferro manganês e potássio. É essencial a realização de estudos dos nutrientes e antinutrientes da quinoa, de utilizá-la no preparo e desenvolvimento de receitas isentas de glúten. Diante disso, o presente estudo objetivou elaborar uma farinha de quinoa (FQ, caracterizar a sua composição nutricional e antinutricional, além de aproveitá-la na formulação de bolinhos fritos e avaliar sua aceitabilidade. Para a obtenção da farinha, os grãos de quinoa foram secos em estufa com circulação de ar forçada a 60-65oC, triturados e peneirados. A FQ foi submetida às avaliações da composição centesimal, de alguns minerais (potássio, cálcio, ferro e zinco e antinutricional (nitrato, ácido oxálico e inibidor de tripsina, sendo ainda formuladas e avaliadas a aceitabilidade de três preparações de bolinhos fritos com diferentes adições de FQ em escala hedônica de 5 pontos. Observou-se que a FQ destacou-se em proteínas, fi bras, cinzas, potássio, ferro, cálcio e zinco. Os valores (mg/100g dos antinutrientes encontrados na FQ foram de 63,26 para o nitrato, 380 para o ácido oxálico e 2,11UTI/mg para inibidor de tripsina, sendo considerados teores menores aos de outros alimentos vegetais comumente utilizados na alimentação humana. O bolinho de formulação com 12,61% de FQ

  3. Avaliação da doença vascular do enxerto no transplante cardíaco: experiência de um centro brasileiro

    Directory of Open Access Journals (Sweden)

    Elide Sbardellotto Mariano da Costa

    2012-10-01

    Full Text Available FUNDAMENTO: O transplante cardíaco continua sendo o tratamento de escolha para a insuficiência cardíaca refratária ao tratamento otimizado. Dois métodos diagnósticos apresentam elevada sensibilidade no diagnóstico de episódios de rejeição ao enxerto e Doença Vascular do Enxerto (DVE, causas importantes de mortalidade no pós-transplante. OBJETIVO: Avaliar a relação entre os resultados do ultrassom intracoronariano (USIV e os laudos das biópsias endomiocárdicas (BX no seguimento de pacientes submetidos a transplante cardíaco em um serviço de referência brasileiro. MÉTODOS: Foi realizado um ensaio epidemiológico retrospectivo observacional, com pacientes submetidos a transplante cardíaco ortotópico, no período de 2000 a 2009. Foram analisados os prontuários desses pacientes e os resultados dos USIV e BX realizados rotineiramente no seguimento clínico pós-transplante e terapêutica em uso. RESULTADOS: Dos 77 pacientes analisados, 63,63% são do sexo masculino, nas faixas etárias de 22 a 69 anos. Quanto aos resultados dos USIV, 33,96% foram classificados em Stanford classe I, e 32,08%, como Stanford IV. Dos 143 laudos das biópsias, 51,08% tiveram resultado 1R, 3R em 0,69% dos laudos, e 14,48% apresentaram a descrição de efeito Quilty. Todos usaram antiproliferativos, 80,51% usaram inibidores da calcineurina e 19,48% usaram inibidores do sinal de proliferação (ISP. CONCLUSÃO: A avaliação dos pacientes pós-transplante cardíaco por meio do USIV incorpora informações detalhadas para o diagnóstico precoce e sensível da DVE, que são complementadas pelas informações histológicas fornecidas pelas BX, estabelecendo uma possível relação causal entre a DVE e os episódios de rejeição humoral.

  4. Seletividade de herbicidas aplicados nas gramas Santo Agostinho e Esmeralda Selectivity of herbicides applied on St. Augustinegrass and Emerald turfs

    Directory of Open Access Journals (Sweden)

    N.V. Costa

    2010-01-01

    Full Text Available Objetivou-se neste trabalho avaliar a seletividade de herbicidas aplicados nas gramas Santo Agostinho (Stenotaphrum secundatum e Esmeralda (Zoysia japonica em condições de campo. O delineamento experimental utilizado foi o de blocos casualizados, com quatro repetições. As gramas foram cortadas a 3 cm de altura e, em seguida, foram feitas as aplicações dos herbicidas. Os tratamentos utilizados foram: testemunha sem aplicação, fluazifop-p-butil (125 g ha-1, sethoxydim+óleo mineral (276 g ha-1 + 0,5% v v-1 de Assist, bispyribac-sodium (25 g ha-1, chlorimuron-ethyl (15 g ha-1, ethoxysulfuron (150 g ha-1, halosulfuron (112,5 g ha-1, iodosulfuron-methyl (10 g ha-1, metsulfuron-methyl (2,4 g ha-1, nicosulfuron (125 g ha-1, pyrithiobac-sodium (140 g ha-1, trifloxysulfuron-sodium (22,5 g ha-1, 2,4-D (720 g ha-1, quinclorac (375 g ha-1, atrazina (1.250 g ha-1, bentazon (600 g ha-1, linuron (1.350 g ha-1, fomesafen (187,5 g ha-1, lactofen (120 g ha-1, oxadiazon (600 g ha-1 e oxyfluorfen (720 g ha-1. Os herbicidas que apresentaram potencial de seletividade para o gramado de S. secundatum foram: os inibidores da ALS chlorimuron-ethyl, ethoxysulfuron, halosulfuron, iodosulfuron-methyl e metsulfuron-methyl, o mimetizador de auxina 2,4-D, os inibidores do fotossistema II atrazina e bentazon, bem como os inibidores da Protox fomesafen, lactofen e o oxadiazon. Para o gramado de Z. japonica, os herbicidas que apresentaram potencial de seletividade foram: os inibidores da ALS chlorimuron-ethyl, ethoxysulfuron, halosulfuron, metsulfuron-methyl e nicosulfuron, os mimetizadores de auxina 2,4-D e quinclorac, os inibidores do fotossistema II atrazina e bentazon, além dos inibidores da Protox fomesafen, lactofen e o oxadiazon.The objective of this study was to evaluate the selectivity of herbicides applied on turfgrasses St. Augustinegrass (Stenotaphrum secundatum and Emerald (Zoysia japonica under field conditions. The experimental design was randomized blocks

  5. Determinação da atividade in vitro de inibidores de tripsina em feijão (Phaseolus vulgaris L. preto, albumina e globulina
    Determination of the trypsin inhibitor activity in vitro of the black bean (Phaseolus vulgaris L. albumin and globulin

    Directory of Open Access Journals (Sweden)

    M. S. L. DUARTE

    2010-12-01

    Full Text Available

    Evidências científicas vêm demonstrando, nas últimas décadas, que o feijão possui uma baixa digestibilidade devido a diversos fatores, tais como estrutura compacta de suas proteínas e fatores antinutricionais. Este trabalho teve como objetivo determinar a atividade de inibidor de tripsina em feijão preto e nas suas frações proteicas, albumina e globulina. O resultado mostrou que a albumina apresentou alta taxa de inibição de atividade enzimática (99,81% em comparação, a globulina (31,98% e que o grão integral apresentou a menor taxa de inibição enzimática (14,33.

  6. Inhibition of cyclooxygenase-2 in experimental severe acute pancreatitis Inibição da Ciclo-Oxigenase-2 na pancreatite aguda grave experimental

    Directory of Open Access Journals (Sweden)

    José Luiz Jesus de Almeida

    2006-08-01

    Full Text Available BACKGROUND: The standard treatment for acute pancreatitis (AP is still based on supportive care. The search for a new drug that could change the natural history of the disease is a continuing challenge for many researchers. The aim of this study is to evaluate the effect of a cyclooxygenase-2 (COX-2 inhibitor on experimental AP in rats. METHODS: The animals were divided into 2 groups: Group 1 (n = 30-animals with taurocholate-induced AP treated with parecoxib (40 mg/kg. Group 2 (n = 30-animals with taurocholate-induced AP that received saline. The COX-2 inhibitor (parecoxib was injected immediately after AP induction, through the penis dorsal vein. The parameters evaluated were histology, serum levels of amylase, IL-6 and IL-10, and mortality rate. RESULTS: The serum levels of IL-6 and IL-10 in the parecoxib-treated group were lower than the control group. The amylase serum levels and the mortality rate remained unchanged in the treated animals. Histologic morphology also was unaltered, except for fat necrosis, which was higher in parecoxib-treated rats. CONCLUSION: Inhibition of Cox-2 decreases the systemic release of inflammatory cytokines, but has a poor effect on the direct pancreas injury caused by taurocholate.INTRODUÇÃO: O tratamento padrão para a pancreatite aguda permanece baseado em medidas de suporte. A busca por uma droga que altere a história natural da doença ainda é um desafio para muitos pesquisadores. O objetivo deste estudo é avaliar o efeito de um inibidor da COX-2 na pancreatite aguda grave experimental (PA em ratos. MÉTODO: Os animais foram divididos em dois Grupos: Grupo 1 (n=30 - animais com PA induzida por taurocolato e tratados com parecoxib (40mg/Kg. Grupo 2 (n=30 - animais com PA induzida por taurocolato que receberam solução salina. O inibidor de COX-2 (parecoxib foi injetado imediatamente após a indução, através da veia dorsal do pênis. Os parâmetros avaliados foram histologia, níveis séricos de

  7. Estudos preliminares de uma lectina de sementes de Parkia platycephala Benth

    Directory of Open Access Journals (Sweden)

    T.B Grangeiro

    1990-01-01

    Full Text Available Sementes de Parkia platycephala Benth.possuem uma lectina que é melhor extraída a pH 4,0 e pode ser isolada por cromatografia de afinidade em coluna de Sephadex G-50. A lectina aglutina eritrócitos de coelho mas não aglutina hemácias humanas (A, B e O, de boi, de carneiro ou de galinha. D-glicose, D-manose, D-frutose e derivados mostraram ser açúcares inibidores da atividade hemaglutinante, sendo que alfa-metil-glicosídeo e alfa-metil-manosídeo foram os mais potentes inibidores entre os açúcares testados.Seeds of Parkia platycephala Benth. have a lectin which is best extracted at pH 4,0 and partially purified using a Sephadex G-50 column as an affinity adsorbent. The lectin .agglutinates rabbit erythrocytes but not those of cow, sheep, chicken or human D-glucose, D-mannose, D-fructose and derivatives act as inhibitors of the lectin with o-methyl-glucopyranoside and O-methyl-mannopyranoside being the most potent ones.

  8. Cicatrização de feridas: estudo comparativo em ratos hipertensos não tratados e tratados com inibidor da enzima conversora da angiotensina

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes Pessole Biondo-Simões

    Full Text Available OBJETIVO: Reconhecer a interferência do captopril na cicatrização de feridas cutâneas de ratos hipertensos. MÉTODOS: Distribuíram-se 111 ratos em quatro grupos: controle normotenso (N=30; controle hipertenso (N=30, os quais receberam 1 ml/dia de solução de cloreto de sódio a 0.9% por via oral; grupo experimento (N=31, hipertensos que receberam 7,5mg/kg/dia de captopril e um grupo aferição (N=20, 10 hipertensos e 10 normotensos, nos quais aferiu-se a pressão na aorta abdominal, no último dia de experimento. Após 15 dias de medicação, fez-se uma incisão da pele e da tela subcutânea, na região médio-dorsal dos grupos I, II e III, seguida de síntese. Ressecaram-se as cicatrizes de 10 animais de cada grupo, no 4.º, 7.º e 14.º dias após a operação, que divididas em duas partes foram enviadas para a tensiometria e para análise histológica. RESULTADOS: A pressão arterial média de 83,18 ± 7,51 mmHg nos normotensos e 151,36 ± 10,51 mmHg nos hipertensos. As cicatrizes dos hipertensos tratados e não tratados eram menos resistentes que as dos normotensos, nos tempos iniciais (p<0,05 e que ao 14.º dia as resistências se igualaram. Não houve diferença entre o grupo tratado e o não tratado. A densidade de colágeno total foi maior nos normotensos em todos os tempos (p<0,05 e não houve diferença entre hipertensos tratados e não tratados. A epitelização, a reação inflamatória e a formação do tecido de granulação foi semelhante nos três grupos. CONCLUSÕES: O captopril, em ratos, não modifica a cicatrização, ficando as diferenças relacionadas à hipertensão.

  9. Tratamento da doença de Alzheimer: avaliação crítica sobre o uso de anticolinesterásicos Update on anticholinesterase treatment of Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    OSVALDO P. ALMEIDA

    1998-09-01

    Full Text Available A demência do tipo Alzheimer (DA é uma doença degenerativa que há até pouco tempo não tinha nenhum tratamento eficaz. Pesquisas realizadas a partir da década de 70 revelaram que os sistemas cerebrais que utilizam acetilcolina encontram-se gravemente comprometidos nesses pacientes, o que serviu de base para a introdução da terapêutica de base colinérgica da doença. Os inibidores da acetilcolinesterase foram os primeiros medicamentos que demonstraram ser úteis para o tratamento da DA em ensaios clínicos controlados contra placebo. Este artigo revê os principais estudos desenhados para investigar a eficácia e efeitos adversos da tacrina, donepezil, rivastigmina, e metrifonato em pacientes com DA. Discutem-se, ainda, os fatores que podem interferir na resposta do paciente ao tratamento com anticolinesterásicos, bem como as limitações inerentes a esse tipo de abordagem terapêutica.Alzheimer's disease (AD is a neurogenerative disorder that had no effective treatment until a few years ago. Many studies published during the past 20 years showed that the disease is associated with the disruption of brain systems that use acetilcholine. These findings shaped the development of the cholinergic treatment strategies for AD. The cholinesterase inhibitors were the first class of drugs to show positive results in double-blind placebo controlled studies for the treatment of AD. This paper reviews efficacy and safety studies of tacrine, donepezil, rivastigmine, and metrifonate in patients with AD. Factors that may interfere with patients' response to treatment are also discussed, as well as the limitations associated with the use of this class of drugs.

  10. TOMATO LEAFMINER Scrabipalpuloides absoluta (MEYRICK CONTROL WITH A NEW PLANT DERIVED ECDISE INHIBITOR ENSAIO DE CONTROLE À TRAÇA DO TOMATEIRO Scrobipalpuloides absoluta (Meyrick COM NOVO INIBIDOR DE ECDISE DE ORIGEM VEGETAL

    Directory of Open Access Journals (Sweden)

    Antônio Lopes da Silva

    2007-09-01

    Full Text Available

    A tomato leafminer Scrobipalpuloides absoluta control trial with a new insect growth regulator was carried out in Goiânia, Goiás State, Brazil. The azaradictin (Azatin 3% at 36, 42, and 48 g a.i./ha was compared to abamectin at 14.4 g a.i./ha, Cartap at 480 g a.i./ha, and a witness with no insecticide control. Data showed that Azatin 3% at the levels tested did not efficiently control the tomato S. absoluta.

    KEY-WORDS: Scrobipalpuloides absoluta; tomato leafminer; control.

    Foi realizado, em Goiânia - GO, 1994, um ensaio de campo visando ao controle da traça do tomateiro Scrobipalpuloides absoluta (Meyrick, utilizando um novo inibidor de ecdise de origem vegetal. O azaradictin (Azatin 3% nas dosagens de 36, 42 e 48g de ingrediente ativo/ha, foi comparado com abamectin na dosagem de 14,4g de ingrediente ativo/ha, Cartap na dosagem de 480 g de ingrediente ativo/ha e uma testemunha sem inseticida. Pelos resultados obtidos concluiu-se que o Azatin 3%, nas dosagens utilizadas, não controlou eficientemente a praga S. absoluta sobre tomateiro.

    PALAVRAS-CHAVE: Traça do tomateiro; Scrobipalpuloides absoluta; controle.

  11. Importância da avaliação da hemoglobina fetal na clínica da anemia falciforme The importance of the evaluation of fetal hemoglobin in the clinical assessment of sickle cell disease

    Directory of Open Access Journals (Sweden)

    Rita de Cassia Mousinho-Ribeiro

    2008-04-01

    Full Text Available A anemia falciforme está entre as doenças genéticas mais comuns e mais estudadas em todo o mundo. Ela é causada por mutação no gene β, produzindo alteração estrutural na molécula da hemoglobina. As moléculas de HbS, decorrentes da mutação, sofrem processo de polimerização fisiologicamente provocado pela baixa tensão de oxigênio, acidose e desidratação. Com isso, os eritrócitos passam a apresentar a forma de foice, causando vaso-oclusão e outras conseqüências. O objetivo desse estudo foi revisar a importância da hemoglobina fetal na clínica de pacientes portadores de anemia falciforme. O significado clínico da associação da elevação da hemoglobina fetal na anemia falciforme mostra-se favorável em termos hematológicos, pois, nessa interação, as células-F têm baixas concentrações de HbS e, com isso, inibem a polimerização da HbS e a alteração da morfologia dos eritrócitos. O tratamento com hidroxiuréia, em função do aumento na expressão da hemoglobina fetal que este fármaco proporciona, traz aos pacientes falcêmicos uma melhora significativa em sua clínica. Portanto, a hemoglobina fetal consiste no maior inibidor da polimerização da desoxi-HbS e, com isso, evita a falcização do eritrócito, a anemia hemolítica crônica, as crises dolorosas vaso-oclusivas, o infarto e a necrose em diversos órgãos, melhorando a clínica e a expectativa de vida dos pacientes.Sickle cell disease is one of the commonest and most studied genetic diseases in the world. Caused by a mutation of the β gene, it changes the molecular structure of hemoglobin. Abnormal Hb S molecules suffer polymerization physiologically provoked by a low oxygen tension, acidosis and dehydration. As a result, red blood cells take on a sickle cell form, which causes microvascular occlusion with varying consequences. The objective of this study was to review the importance of fetal hemoglobin in the clinical assessment of sickle cell

  12. Hiponatremia associada a antidepressivos: uma revisão

    Directory of Open Access Journals (Sweden)

    Margarete Costa

    Full Text Available RESUMO Objetivo Rever a literatura mais recente sobre a associação entre a hiponatremia e o uso de antidepressivos. Métodos Pesquisa bibliográfica nas bases de dados PubMed e SciELO, com os descritores “antidepressive agents” e “hyponatremia”, incluindo artigos de janeiro de 2006 a maio de 2016. Resultados Foram incluídos 45 artigos. A idade, o sexo feminino e a polimedicação são os fatores de risco mais relevantes, e os sintomas dependem da gravidade da hiponatremia. A hiponatremia pode ter várias causas, sendo a mais comum a síndrome da secreção inapropriada do hormônio antidiurético. Entre os inibidores seletivos da recaptação de serotonina, o citalopram e o escitalopram apresentam risco superior, à semelhança da venlafaxina. O risco de hiponatremia parece ser inferior com as classes restantes, à exceção dos inibidores da monoaminoxidase. Recomenda-se um ionograma prévio ao tratamento em doentes com mais de 60 anos e, sempre, um ionograma um mês após o seu início. O primeiro passo do tratamento é a suspensão do fármaco, revertendo a maioria dos casos leves. No entanto, o tratamento deve ser individualizado, considerando os riscos da hiponatremia e da correção. Conclusões A hiponatremia é um efeito colateral a considerar nos doentes que tomam antidepressivos. Quando a manutenção do tratamento é necessária, deve ser evitado o mesmo antidepressivo ou outro da mesma classe, sendo opções a trazodona, abupropiona, a agomelatina, a mirtazapina e a reboxetina, porque existem poucos relatos de hiponatremia com esses fármacos.

  13. Methylene blue for vasoplegic syndrome treatment in heart surgery: fifteen years of questions, answers, doubts and certainties Azul de metileno no tratamento da síndrome vasoplégica em cirurgia cardíaca: quinze anos de perguntas, respostas, dúvidas e certezas

    Directory of Open Access Journals (Sweden)

    Paulo Roberto Barbosa Evora

    2009-09-01

    Full Text Available OBJECTIVE: There is strong evidence that methylene blue (MB, an inhibitor of guanylate cyclase, is an excellent therapeutic option for vasoplegic syndrome (VS treatment in heart surgery. The aim of this article is to review the MB's therapeutic function in the vasoplegic syndrome treatment. METHODS: Fifteen years of literature review. RESULTS: 1 Heparin and ACE inhibitors are risk factors; 2 In the recommended doses it is safe (the lethal dose is 40 mg/kg; 3 The use of MB does not cause endothelial dysfunction; 4 The MB effect appears in cases of nitric oxide (NO up-regulation; 5 MB is not a vasoconstrictor, by blocking of the GMPc system it releases the AMPc system, facilitating the norepinephrine vasoconstrictor effect; 6 The most used dosage is 2 mg/kg as IV bolus followed by the same continuous infusion because plasmatic concentrations strongly decays in the first 40 minutes; 7 There is a possible "window of opportunity" for the MB's effectiveness. CONCLUSIONS: Although there are no definitive multicentric studies, the MB used to treat heart surgery VS, at the present time, is the best, safest and cheapest option, being a Brazilian contribution for the heart surgeryOBJETIVO: Existem fortes evidências de que o azul de metileno (AM, um inibidor da guanilato ciclase, é uma excelente opção terapêutica para o tratamento da síndrome vasoplégica (SV em cirurgia cardíaca. O objetivo deste artigo é rever o papel terapêutico do AM no tratamento da SV. MÉTODOS: Revisão da literatura em período de 15 anos. RESULTADOS: 1 A heparina e inibidores da ECA são fatores de risco; 2 Nas doses preconizadas é droga segura (a dose letal é de 40 mg/kg; 3 O AM não causa disfunção endotelial; 4 O efeito do AM só aparece em caso de supra-regulação de óxido nítrico (NO; 5 O AM não é um vasoconstritor, pelo bloqueio do sistema GMPc ele "libera" o sistema AMPc, facilitando o efeito vasoconstritor da noradrenalina; 6 A dosagem mais utilizada é 2

  14. Estudo da interferência de diferentes dietas nutricionais sobre as ações antiinflamatória e analgésica do Etoricoxib (Arcóxia®)

    OpenAIRE

    Bianchetti, érica Silva

    2006-01-01

    O etoricoxib (Arcóxia®) um medicamento novo posicionado para liderar a próxima geração de inibidores seletivos de COX-2 é um coxib de segunda geração potente e de ação rápida sendo motivo atualmente de muitos ensaios clínicos É o mais seletivo de COX-2 de todos os coxibs O objetivo deste estudo foi estudar em modelos in vivo a interferência sobre a atividade antiinflamatória e analgésica do etoricoxib antiinflamatório inibidor seletivo de COX-2 associado a diferentes tipos de dietas nutricion...

  15. A Concise Total Synthesis of (R)-Fluoxetine, a Potent and Selective Serotonin Reuptake Inhibitor

    OpenAIRE

    de Fátima, Ângelo; Lapis, Alexandre Augusto M.; Pilli, Ronaldo A.

    2005-01-01

    (R)-Fluoxetine, potent and selective serotonin reuptake inhibitor, has been synthesized in six steps, 50% overall yield and 99% ee from benzaldehyde via catalytic asymmetric allylation with Maruoka's catalyst. (R)-Fluoxetina, um inibidor potente e seletivo da recaptação da serotonina, foi sintetizada em seis etapas, 50% de rendimento total e 99% de excesso enantiomérico a partir do benzaldeído via alilação catalítica assimétrica empregando-se o sistema catalítico desenvolvido por Maruoka e...

  16. Factors affecting Helicobacter pylori eradication using a seven-day triple therapy with a proton pump inhibitor, tinidazole and clarithromycin, in brazilian patients with peptic ulcer Fatores que afetam a erradicação do Helicobacter pylori usando um tratamento triplo de sete dias com um inibidor de bomba de prótons associado ao tinidazol e a claritromicina, em pacientes brasileiros com úlcera péptica

    Directory of Open Access Journals (Sweden)

    Fernando Marcuz Silva

    2001-01-01

    Full Text Available Triple therapy is accepted as the treatment of choice for H. pylori eradication. In industrialized countries, a proton pump inhibitor plus clarithromycin and amoxicillin or nitroimidazole have shown the best results. Our aims were: 1. To study the eradication rate of the association of a proton pump inhibitor plus tinidazole and clarithromycin on H. pylori infection in our population. 2. To determine if previous treatments, gender, age, tobacco, alcohol use, and non-steroidal anti-inflammatory drugs (NSAIDs change the response to therapy. METHODS: Two hundred patients with peptic ulcer (upper endoscopy and H. pylori infection (histology and rapid urease test - RUT were included. A proton pump inhibitor (lansoprazole 30 mg or omeprazole 20 mg, tinidazole 500 mg, and clarithromycin 250 mg were dispensed twice a day for a seven-day period. Eradication was assessed after 10 to 12 weeks of treatment through histology and RUT. RESULTS: The eradication rate of H. pylori per protocol was 65% (128/196 patients. This rate was 53% for previously treated patients, rising to 76% for not previously treated patients, with a statistical difference pO esquema tríplice tem sido demonstrado como sendo o melhor tratamento para a erradicação do Helicobacter pylori. Nos países industrializados o uso de um inibidor de bomba de prótons associado a claritromicina e a amoxicilina ou a um nitroimidazólico, tem proporcionado os melhores resultados. Objetivamos estudar na nossa população a taxa de erradicação do H. pylori para a associação de um inibidor de bomba de prótons com o tinidazol e a claritromicina e determinar se a resposta ao tratamento é influenciada pelo tratamento prévio, sexo, tabagismo, alcoolismo, idade e uso de anti-inflamatórios não esteroidais (AINEs. PACIENTES E PROCEDIMENTOS: Duzentos pacientes com diagnóstico endoscópico de úlcera péptica e com infecção pelo H. pylori, confirmada pelo exame histológico e pelo teste rápido da

  17. Subvertendo o desejo no teatro das organizações: problematizações contemporâneas sobre o desejo e a expansão da vida nas relações de trabalho

    Directory of Open Access Journals (Sweden)

    Eloisio Moulin de Souza

    Full Text Available Este artigo pretende problematizar a concepção de desejo contida nas abordagens estruturalistas e pós-estruturalistas, colocando o desejo como objeto fundamental da análise contemporânea das relações de poder no local de trabalho, enfatizando a incapacidade do conceito estruturalista de desejo no processo de construção e catalisação de espaços laborais que promovam a expansão da vida. . Para tanto se realizou uma pesquisa qualitativa fundamentada na análise bibliográfica sobre o desejo, focando-se em Freud e no estruturalismo de Lacan, bem como no pós-estruturalismo de Deleuze, Rolnik e Foucault, salientando-se que este artigo adota uma concepção pós-estruturalista de desejo. Conclui-se que as teorias psicanalíticas modernas (Freud, estruturalistas (Lacan, bem como os trabalhos organizacionais de Chanlat e Dejours que utilizam a psicanálise em suas análises, ao definirem o que é desejo acabam criando fatores inibidores e despotencializadores do processo ético-político-estético de expansão da vida no local de trabalho. Diferentemente, o pós-estruturalismo, ao definir o desejo como social, capaz de construir e desconstruir realidades, consegue potencializar e problematizar a complexidade que envolve a expansão da vida no trabalho e na sociedade contemporânea.

  18. Modelagem molecular da interação entre a proteína de fusão do vírus sincicial respiratório humano e inibidores da ação viral. -

    OpenAIRE

    Cravo, Haroldo de Lima Pimentel [UNESP

    2012-01-01

    O Vírus Sincicial Respiratório Humano (hRSV) foi identificado em 1957 e mesmo após vários anos de investigação, nenhuma vacina foi desenvolvida. Acredita-se que a chave de inibição da ação viral são suas glicoproteínas de membrana, em especial a proteína de fusão (F), que com auxílio da proteína de ligação (G), é responsável pela instalação do hRSV na célula hospedeira. Há evidências experimentais de que compostos como flavonóides e glicosaminoglicanos podem diminuir a infecção viral, sendo e...

  19. Efeito renoprotetor da estatina: modelo animal de isquemia-reperfusão Renoprotective effect of statin: a ischemia-reperfusion animal model

    Directory of Open Access Journals (Sweden)

    Claudia Akemi Shibuya Teshima

    2010-09-01

    Full Text Available OBJETIVO: A lesão renal aguda isquêmica, de causa multifatorial, apresenta morbidade e mortalidade alarmantes. A estatina, inibidor de HMG-CoA redutase, tem demonstrado papel renoprotetor, com componente antioxidante, antiinflamatório e vascular. A atividade de heme oxigenase-1 pode ser mediadora desses efeitos pleitrópicos da estatina sobre o rim, ou seja, independente da ação de redução de lipídio. Esse estudo visou avaliar se o efeito renoprotetor da estatina pode ter mecanismo heme de proteção em ratos. MÉTODOS: O modelo isquêmico foi obtido por meio do clampeamento dos pedículos renais bilaterais por 30 minutos, seguido de reperfusão. Foram utilizados ratos Wistar, machos, pesando entre 250-300g, distribuídos nos seguintes grupos: SHAM (controle, sem clampeamento renal; Isquemia; Iquemia+Estatina (sinvastatina 0,5 mg/kg, via oral por 3 dias; Isquemia+Hemin (indutor de HO-1, 1 mg/100g, intraperitoneal 24h antes da cirurgia; Isquemia+SnPP (inibidor de HO-1, 2μmol/kg intraperitoneal 24h antes da cirurgia; Isquemia+Estatina+Hemin e Isquemia+Estatina+SnPP. Foram avaliados a função renal (clearance de creatinina, Jaffé, osmolalidade urinária, peróxidos urinários e a imunohistoquímica para ED-1. RESULTADOS: Os resultados mostraram que a estatina melhorou a função renal, a osmolalidade urinária, reduziu a excreção de peróxidos urinários e a infiltração de macrófagos em rins de animais submetidos à isquemia renal. O indutor da heme oxigenase-1 e a sua associação com sinvastatina reproduziram o padrão de melhora determinado pela sinvastatina. CONCLUSÃO: O estudo confirmou o efeito renoprotetor da estatina, com ação antioxidante e antiinflamatória, e sugere que esse efeito tenha interface com o sistema heme de proteção renal.OBJECTIVE: Ischemic acute kidney injury (iLRA, with multifatorial cause, presents alarming morbidity and mortality. Statin, HMG-CoA inhibition reductase has shown a renoprotective effect

  20. Estudo da influência da dieta e do inibidor da fosfodiesterase 5 tadalafil nas concentrações de citocinas inflamatórias, óxido nítrico e produtos finais de glicação avançada no tecido adiposo de ratos

    OpenAIRE

    Colombo, Giovani

    2014-01-01

    Tese (doutorado) - Universidade Federal de Santa Catarina, Centro de Ciências da Saúde, Programa de Pós-Graduação em Ciências Médicas, Florianópolis, 2014. Abstract : Introdução: Nas últimas décadas, descobriu-se que o adipócito era capaz de secretar adipocinas e citocinas com funções autócrinas, parácrinas e sistêmicas, que influenciavam de maneira importante, todo o metabolismo dos organismos vivos. Dentre os fatores associados aos distúrbios da biologia do adipócito, podemos destacar o ...

  1. Estudo da reatividade vascular em portadores de HIV com e sem uso de inibidor de protease Estudio de la reactividad vascular en portadores de VIH con y sin uso de inhibidor de proteasa Study of vascular reactivity in HIV patients whether or not receiving protease inhibitor

    Directory of Open Access Journals (Sweden)

    Hamilton Nenrod Pereira Teixeira

    2009-10-01

    Full Text Available FUNDAMENTO: Considerando o alto número de pacientes infectados por HIV em uso de antirretrovirais, evoluindo com alteração da função endotelial e aterotrombose, levando ao alto custo médico social, é importante identificar mecanismos fisiopatológicos envolvidos com a função endotelial em portadores de HIV, para que, precocemente, possamos intervir e evitar a progressão da doença. OBJETIVO: Avaliar a função endotelial pela vasodilatação endotélio dependente e independente em pacientes HIV positivo e em grupo controle. MÉTODOS: O estudo avaliou 27 pacientes HIV positivo e 16 do grupo controle. A avaliação da função endotelial foi realizada por meio da vasodilatação da artéria braquial endotélio dependente (hiperemia reativa e independente (nitroglicerina SL. RESULTADOS: Pacientes HIV positivo em uso de inibidor de protease (IP apresentaram vasodilatação endotélio independente significativamente menor que os subgrupos HIV negativo (p = 0,020 e HIV positivo sem uso de IP (p = 0,034. A variação do diâmetro da artéria braquial durante hiperemia reativa não apresentou significância estatística em qualquer subgrupo. A análise de regressão linear múltipla mostrou que apenas o IP estava associado ao delta relativo da reatividade braquial pelo vasodilatador, nos pacientes HIV positivo, aos 60 e 90 segundos. CONCLUSÃO: Os pacientes HIV positivo em uso de IP apresentam disfunção endotélio independente quando comparados a pacientes HIV positivo que não fazem uso de IP e a um grupo controle.FUNDAMENTO: Considerando el alto número de pacientes infectados por VIH en uso de antirretrovirales, evolucionando con la alteración de la función endotelial y aterotrombosis, llevando al alto coste médico social, es importante identificar mecanismos fisiopatológicos implicados en la función endotelial en portadores de VIH, para que, precozmente, podamos intervenir y evitar la progresión de la enfermedad. OBJETIVO: Evaluar

  2. Paroxetine and bupropion have no in vitro effects on lynphocyte proliferation and viability Paroxetina e bupropiona não apresentam efeito na viabilidade nem na proliferação de linfócitos in vitro

    Directory of Open Access Journals (Sweden)

    Ramiro Ronchetti

    2007-01-01

    Full Text Available OBJECTIVE: Initial studies with tricyclic antidepressants demonstrated that they jeopardize the immune system activity. Recent studies suggested that selective serotonin reuptake inhibitors would have stimulating immunological effects. Here, we explored the in vitro immunological effects of two antidepressants used in clinical practice, paroxetine (selective serotonin reuptake inhibitor and bupropion (norepinephrine and dopamine reuptake inhibitor. METHOD: Peripheral blood samples were obtained from 16 healthy volunteers and the peripheral blood mononuclear cells were isolated and cultured in vitro. We evaluated the effects of bupropion and paroxetine on cell viability as well as the ability to suppress phytohemagglutinin-induced lymphocyte proliferation. RESULTS: Both antidepressants produced neither significant effect on cell viability nor on T-cell proliferation. CONCLUSIONS: This could be of valuable information for the clinical practice when these drugs are administered. These results indicate a more favorable effect of such psychopharmacological drugs when compared to reported immunological effects associated with tryciclic antidepressants.OBJETIVO: Os estudos iniciais com antidepressivos tricíclicos demonstraram que estes prejudicam a atividade do sistema imune. Estudos mais recentes sugerem que os inibidores seletivos da recaptação de serotonina poderiam apresentar efeitos imunológicos estimulantes. No presente estudo, exploramos os efeitos imunológicos in vitro de dois antidepressivos usados na prática clínica, paroxetina (inibidor seletivo da recaptação de serotonina e bupropiona (inibidor da recaptação da noradrenalina e dopamina. MÉTODO: Obtiveram-se amostras de sangue periférico de 16 voluntários saudáveis e as células mononucleares do sangue periférico foram isoladas e cultivadas in vitro. Avaliamos os efeitos de bupropiona e da paroxetina em termos de viabilidade das células, como também a habilidade para

  3. Resistência insulínica pode prejudicar a redução da espessura mediointimal em adolescentes obesos

    Directory of Open Access Journals (Sweden)

    Priscila de Lima Sanches

    2012-10-01

    Full Text Available FUNDAMENTO: O processo aterosclerótico no nível endotelial começa em idade precoce e parece estar associado com a obesidade e suas comorbidades como a resistência insulínica. OBJETIVO: O objetivo deste estudo foi verificar a influência da resistência insulínica em marcadores inflamatórios e subclínicos de aterosclerose em adolescentes obesos. MÉTODOS: Sessenta e seis adolescentes obesos pós-púberes foram divididos em dois grupos de acordo com o índice de resistência insulínica estimado pelo Modelo de Avaliação da Homeostase (HOMA-RI: com resistência insulínica (RI n = 39 e sem resistência insulínica (NRI n = 27, e foram submetidos a uma intervenção interdisciplinar ao longo de um ano. A espessura mediointimal da artéria carótida comum (EMIC, e o tecido adiposo visceral e subcutâneo foram determinados por ultrassonografia. A composição corporal, pressão arterial, índice HOMA-RI, perfil lipídico e as concentrações de adipocinas [leptina, adiponectina, e inibidor do ativador do plasminogênio-1 (PAI-1] foram analisados antes e após a terapia. RESULTADOS: Ambos os grupos apresentaram melhoras significativas na composição corporal, estado inflamatório (redução da concentração de leptina e PAI 1; aumento de adiponectina plasmática e redução da EMIC. Apenas o grupo NRI mostrou correlação positiva entre as alterações na gordura visceral (∆Visceral e mudanças na EMIC (∆ EMIC (r = 0,42, p < 0,05. A análise por regressão linear simples revelou o ∆Visceral ser um preditor independente para a redução da EMIC nesse grupo (R2 ajustado = 0,14, p = 0,04. Os valores finais da EIMC permaneceram significativamente maiores no grupo RI, quando comparado com grupo NRI. CONCLUSÃO: A presença de resistência insulínica pode prejudicar mudanças na EMIC levando ao desenvolvimento precoce da aterosclerose em adolescentes obesos submetidos a uma intervenção interdisciplinar.

  4. AVALIAÇÃO IN VITRO DA AÇÃO DA QUITOSANA E DE SEU DERIVADO QUATERNIZADO NA INIBIÇÃO DO CRESCIMENTO DO FUNGO PENICILLIUM EXPANSUM / IN VITRO EVALUATION OF CHITOSAN AND ITS QUATERNIZED DERIVATIVE ON THE INHIBITION OF PENICILLIUM EXPANSUM GROWTH

    Directory of Open Access Journals (Sweden)

    L. D. Mendes

    2016-03-01

    Full Text Available Quitosana comercial de média massa molar (400.000 gmol-1e seu derivado quaternizado hidrossolúvel N,N,N-trimetilquitosana foram avaliados em condições laboratoriais, em análises in vitro, como agentes inibidores do crescimento de Penicillium expansum. Formulações nas concentrações de 0,1; 1,0; 5,0 e 10,0 gL-1 de cada polímero foram preparadas e adicionados em meio de cultura BDA sólido e aquoso. O fungo foi isolado de frutas contaminadas, cultivado e inoculado nos meios contendo os polímeros. Análises conduzidas por medida do crescimento de colônias em meio sólido e por contagem de esporos germinados em meio liquido (em câmara de Neubauer indicaram eficiência na redução da infestação por ambos os polímeros, porém em condições distintas. A quitosana apresentou elevada eficiência em meio líquido enquanto seu derivado foi eficaz na redução do crescimento em meio de cultura sólido, ambos em baixas concentrações (0,1 e 1,0 gL-1. Os resultados são discutidos com base nos mecanismos aceitos de ação antimicrobiana da quitosana, objetivando potenciais aplicações tópicas em frutos na condição pós-colheita.

  5. Action mechanism of inhibin α-subunit on the development of Sertoli cells and first wave of spermatogenesis in mice.

    Directory of Open Access Journals (Sweden)

    Kailai Cai

    Full Text Available Inhibin is an important marker of Sertoli cell (SC activity in animals with impaired spermatogenesis. However, the precise relationship between inhibin and SC activity is unknown. To investigate this relationship, we partially silenced both the transcription and translation of the gene for the α-subunit of inhibin, Inha, using recombinant pshRNA vectors developed with RNAi-Ready pSIREN-RetroQ-ZsGreen Vector (Clontech Laboratories, Mountain View, Calif. We found that Inha silencing suppresses the cell-cycle regulators Cyclin D1 and Cyclin E and up-regulates the cell-cycle inhibitor P21 (as detected by Western blot analysis, thereby increasing the number of SCs in the G1 phase of the cell cycle and decreasing the amount in the S-phase of the cell cycle (as detected by flow cytometry. Inha silencing also suppressed Pdgfa, Igf1, and Kitl mRNA levels and up-regulated Tgfbrs, Inhba, Inhbb, Cyp11a1, Dhh, and Tjp1 mRNA levels (as indicated by real-time polymerase chain reaction [PCR] analysis. These findings indicate that Inha has the potential to influence the availability of the ligand inhibin and its antagonist activin in the SC in an autocrine manner and inhibit the progression of SC from G1 to S. It may also participate in the development of the blood-testis barrier, Leydig cells, and spermatogenesis through its effect on Dhh, Tjp1, Kitl, and Pdgfa. Real-time PCR and Western blot analyses of Inha, Inhba, and Inhbb mRNA and Inha levels over time show that Inha plays an important role in the formation of round spermatid during the first wave of spermatogenesis in mice.

  6. Refractory gastroesophageal reflux disease Doença do refluxo gastroesofágico refratária

    Directory of Open Access Journals (Sweden)

    Joaquim Prado P. Moraes-Filho

    2012-12-01

    ão respondem satisfatoriamente ao tratamento com os inibidores da bomba protônica, o que ocorre em 20%-42% dos casos. Aqueles, portanto, que não apresentam resposta terapêutica a um ciclo de 4 a 8 semanas de tratamento com os inibidores da bomba protônica (omeprazol, pantoprazol, rabeprazol, lansoprazol, esomeprazol, pantoprazol-Mg podem constituir a denominada "DRGE refratária". RESULTADOS: É importante comentar que em alguns casos os pacientes não são realmente refratários ao tratamento, mas podem efetivamente não ter o diagnóstico de DRGE ou até mesmo não terem sido corretamente tratados. Quanto ao estabelecimento diagnóstico, o Consenso Brasileiro da DRGE baseado em evidências sugere a realização da endoscopia digestiva alta como primeiro passo, com o propósito de excluir a presença de úlcera péptica e câncer, além de identificar erosões na mucosa esofágica quando presentes. CONCLUSÕES: As principais causas de DRGE refratária são: (1 pirose funcional; (2 baixos níveis de aderência ao tratamento com os inibidores da bomba protônica; (3 dosagem inadequada dos inibidores da bomba protônica; (4 erro diagnóstico; (5 presença de comorbidades e esofagite induzida por comprimidos; (6 diferenças genotípicas; (7 refluxo gastroesofágico não-ácido; (8 doenças autoimunes de pele; (9 esofagite eosinofílica.

  7. Associação de carbonato de londenafil (Helleva) e treinamento fisico na ereção peniana de ratos

    OpenAIRE

    Clesio Borges Pena

    2009-01-01

    Resumo: A ereção peniana envolve a interação da estimulação neural do músculo liso do corpo cavernoso bem como liberação neuro-humoral de fatores contráteis e relaxantes do endotélio. A cascata de sinalização óxido nítrico (NO)/(GMPc) é o evento mais importante e efetivo no mecanismo de ereção peniana. Nesta última década, diversos inibidores de fosfodiesterase tipo 5 (PDE5) foram desenvolvidos e aprovados para o tratamento da disfunção erétil. Estes fármacos atuam inibindo a ação da PDE5 sob...

  8. Atividade antioxidante de três espécies de Eugenia (Myrtaceae)

    OpenAIRE

    Magina, Michele A.; Gilioli, Andressa; Moresco, Henrique H.; Colla, Guilherme; Pizzolatti, Moacir Geraldo; Brighente, Inês Maria Costa

    2010-01-01

    A atividade antioxidante dos extratos vegetais de Eugenia brasiliensis, E. beaurepaireana e E. umbelliflora foi avaliada usando diferentes métodos: Determinação da ação sequestrante de radicais livres usando DPPH, determinação do potencial redutor e determinação do potencial inibidor da peroxidação lipídica. Foi correlacionado também a o conteúdo de fenólicos totais e de flavonóides contidos nestes extratos e frações com a atividade antioxidante. As espécies E. brasiliensis e E. beaurepairean...

  9. Desenvolvimento e validação de metodologia analítica, ensaio de dissolução e estudo de estabilidade do carbonato de lodenafila

    OpenAIRE

    Cristiane Franco Codevilla

    2012-01-01

    O carbonato de lodenafila é um inibidor da fosfodiesterase tipo 5, desenvolvido no Brasil, o qual é um dímero formado por duas moléculas de lodenafila ligadas por uma ponte carbonato. Encontra-se disponível sob a forma de comprimidos. Não existe monografia disponível para este fármaco em nenhum código oficial. Assim, o objetivo do presente estudo foi desenvolver métodos analíticos para análise qualitativa e quantitativa do carbonato de lodenafila em comprimidos, avaliação da estabilidade fren...

  10. Tratamento da disforia pré-menstrual com antidepressivos: revisão dos ensaios clínicos controlados Treatment of premenstrual dysphoria with antidepressants: review of controlled clinical trials

    Directory of Open Access Journals (Sweden)

    Elie Cheniaux

    2006-01-01

    Full Text Available INTRODUÇÃO: A disforia pré-menstrual (DPM, que acomete entre 3% e 8% das mulheres em idade fértil, representa uma forma mais grave de síndrome pré-menstrual, na qual predominam as alterações do humor e do comportamento. Acredita-se que haja algum tipo de ligação entre a DPM e os transtornos do humor. OBJETIVO: Estudar a eficácia dos antidepressivos na DPM. MÉTODOS: Foi realizada uma revisão dos ensaios clínicos controlados com antidepressivos no tratamento da DPM, utilizando-se as seguintes bases de dados: Medline, Literatura Latino-Americana e do Caribe em Ciências da Saúde (LILACS, psycINFO e Biblioteca Cochrane. RESULTADOS: A clomipramina, a fluoxetina, a sertralina, a paroxetina e a venlafaxina se mostraram superiores ao placebo em diversos estudos. DISCUSSÃO: As mulheres que sofrem de DPM possivelmente apresentam uma disfunção serotoninérgica. CONCLUSÃO: Alguns antidepressivos, especialmente os inibidores seletivos da recaptação da serotonina (ISRS, parecem ser eficazes no tratamento da DPM.INTODUCTION: Premenstrual dysphoria (PMD, which affects between 3% and 8% of women during reproductive years, represents a more severe type of premenstrual syndrome. Mood and behavior changes are predominant in PMD. It is believed that there is some kind of link between PMS and mood disorders. OBJECTIVE: Studying the efficacy of antidepressants in PMD. METHODS: We elaborated a review of controlled clinical trials with antidepressants in the treatment of PMD, using the following databases: Medline, LILACS, psycINFO and Cochrane Library. RESULTS: Clomipramine, fluoxetine, sertraline, paroxetine and venlafaxine were superior to placebo in various studies. DISCUSSION: Women with PMD possibly present a serotonergic dysfunction. CONCLUSION: Some antidepressants, specialy SSRIs, seem to be effective in the treatment of PMD.

  11. Métodos para abandono do tabagismo e tratamento da dependência da nicotina Methods for smoking cessation and treatment of nicotine dependence

    Directory of Open Access Journals (Sweden)

    Aracy Pereira Silveira Balbani

    2005-12-01

    Full Text Available O tabagismo está relacionado a 30% das mortes por câncer. É fator de risco para desenvolver carcinomas do aparelho respiratório, esôfago, estômago, pâncreas, cérvix uterina, rim e bexiga. A nicotina induz tolerância e dependência pela ação nas vias dopaminérgicas centrais, levando às sensações de prazer e recompensa mediadas pelo sistema límbico. É estimulante do sistema nervoso central (SNC, aumenta o estado de alerta e reduz o apetite. A diminuição de 50% no consumo da nicotina pode desencadear sintomas de abstinência nos indivíduos dependentes: ansiedade, irritabilidade, distúrbios do sono, aumento do apetite, alterações cognitivas e fissura pelo cigarro. O aconselhamento médico é fundamental para o sucesso no abandono do fumo. A farmacoterapia da dependência de nicotina divide-se em: primeira linha (bupropiona e terapia de reposição da nicotina, e segunda linha (clonidina e nortriptilina. A bupropiona é um antidepressivo não-tricíclico que age inibindo a recaptação de dopamina, cujas contra-indicações são: epilepsia, distúrbios alimentares, hipertensão arterial não-controlada, abstinência recente do álcool e uso de inibidores da monoaminoxidase (MAO. A terapia de reposição de nicotina pode ser feita com adesivos e gomas de mascar. Os efeitos da acupuntura no abandono do fumo ainda não estão completamente esclarecidos. As estratégias de interrupção abrupta ou redução gradual do fumo têm a mesma probabilidade de sucesso.Smoking is related to 30% of cancer deaths. It is a risk factor for respiratory tract, esophagus, stomach, pancreas, uterine cervix, kidney and bladder carcinomas. Nicotine induces tolerance and addiction by acting on the central dopaminergic pathways, thus leading to pleasure and reward sensations within the limbic system. It stimulates the central nervous system (CNS, enhances alertness and reduces the appetite. A 50% reduction of nicotine consumption may trigger withdrawal

  12. Tratamento da síndrome parkinsoniana pelo L-dopa Parkinsonism's treatment by L-Dopa

    Directory of Open Access Journals (Sweden)

    Roberto Melaragno

    1971-12-01

    Full Text Available O trabalho refere o tratamento com L-Dopa de 33 pacientes internados, sendo 19 homens e 14 mulheres. Os casos foram agrupados, segundo uma classificação esquemática, em leves, moderados, intensos e severos. As idades dos pacientes, previamente operados ou não, variaram de 42 a 78 anos. O esquema de medicação constou de administração de L-Dopa na dose inicial de 500 mg associado a um inibidor da MAO. A dose de L-Dopa era elevada de 500 mg cada 3 ou 4 dias, segundo a tolerância de cada paciente. Todos os sintomas dependentes, direta ou indiretamente, da rigidez tiveram melhoras mais nítidas em relação aos tremores. Durante a administração do medicamento os teores sangüíneos de ácido úrico e uréia, mostraram tendência para se elevar; a reserva alcalina, pelo contrário, tendeu para a diminuição; o hemograma revelou muitas vezes eosinofilia por vezes intensa. Os efeitos colaterais foram catalogados em dois tipos — efeitos adrenérgicos e efeitos dopaminérgicos — correspondentes a duas fases: uma primeira, de pequena duração, na qual foram usados concomitantemente o L-Dopa e um inibidor da MAO, surgindo cefaléia hipertensão arterial paroxística, rubor facial, sudorese, tenesmo vesical e angina pectoris; numa segunda fase surgiram os efeitos colaterais ditos dopaminérgicos, proporcionais à gravidade clínica do caso, cujas manifestações principais foram hipotensão arterial, sudorese fria, arritmia cardíaca e lipotimia. As complicações clínicas gerais eram representados habitualmente por anorexia, obstipação intestinal, náuseas, vômitos, discretas alterações do estado psíquico com depressão e euforia. Dentre as complicações neurológicas foram assinalados o estado parkinsonóide, discinesias e acatisia.The results of the treatment with L-Dopa of 33 patients (19 males and 14 females are reported. The cases were separated, acording to their symptoms and signs, in slight, moderate, intense and severe ones

  13. Ativação da enzima conversora de angiotensina no coração após infarto do miocárdio e suas repercussões no remodelamento ventricular

    Directory of Open Access Journals (Sweden)

    Mill José Geraldo

    1997-01-01

    Full Text Available OBJETIVO: Determinar as alterações de atividade da enzima conversora de angiotensina (ECA no coração com infarto do miocárdio (IM e comparar os efeitos do captopril e losartan em parâmetros morfológicos e funcionais de ratos com IM. MÉTODOS: O IM foi produzido em ratos Wistar por ligadura de ramos da artéria coronária esquerda. Os controles (Con foram submetidos a uma cirurgia fictícia. Animais com IM e Con foram tratados com captopril (30mg/kg/dia ou losartan (15mg/kg/dia e estudados 30 dias após, determinando-se a atividade da ECA nos ventrículos direito (VD e esquerdo (VE, as alterações hemodinâmicas e as concentrações de hidroxiprolina (OH-Pro e proteína total no VD e VE. RESULTADOS: A atividade da ECA aumentou no VD (+25% e VE (+70% após IM. A maior atividade foi observada na cicatriz fibrótica, onde atingiu cerca de 4,5 vezes a do músculo do VE que sobreviveu ao IM (420±68 vs 94±8nmoles/g/min; P<0,01. O IM determinou aumento da pressão diastólica final e hipertrofia do VD e VE. Captopril e losartan foram igualmente eficazes em atenuar a hipertrofia e o aumento da pré-carga. O captopril também atenuou o aumento de OH-Pro no VD e VE após IM. O IM reduziu a concentração de proteína principalmente no músculo de VE, efeito esse acentuado pelo captopril. CONCLUSÃO: A grande atividade da ECA na cicatriz deve produzir altas concentrações de angiotensina II (AII no sangue que drena da cicatriz. Os efeitos dos inibidores da ECA seriam decorrentes, principalmente, da redução de geração local de AII, e não de aumento de cininas, uma vez que captopril e losartan exerceram efeitos similares no remodelamento pós-infarto.

  14. Antiretroviral treatment for HIV infection/AIDS and the risk of developing hyperglycemia and hyperlipidemia Tratamento antiretroviral para a infecção pelo HIV/AIDS e o risco de desenvolver hiperglicemia e dislipidemia

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Ramos de Araújo

    2007-04-01

    Full Text Available A cross-sectional study with internal comparison groups was conducted to describe sociodemographic characteristics, as well as verify the association between the type of antiretroviral treatment used and hyperglycemia and hyperlipidemia, with special attention to the use of HIV protease inhibitors. The data was obtained through an interview questionnaire, as well as blood and urine samples that were collected for the laboratory exams. A total of 418 patients were interviewed. 46 of these, however, met the exclusion criteria. The sample was therefore composed by 372 HIV positive patients, attended at the laboratory of the Correia Picanço State Hospital for the collection of blood, to estimate the HIV viral load and/or TCD4 cell counts from August to November 2000. The association between the variables was tested using the chi-square test and the p-value. A multiple logistic regression analysis was carried out to adjust for potential confounding factors. A greater frequency of patients with high glucose levels was observed among those making use of antiretroviral therapy without protease inhibitors, but the number of patients limited the comparisons. An association was verified between the total serum cholesterol level and the use of HIV protease inhibitors (p = 0.047 even after controlling for age. An association was also observed between the triglyceride levels and the use of HIV protease inhibitors, which remained after adjustment for age, sex and creatinine levels (p Um estudo epidemiológico transversal, com caráter analítico, foi realizado para descrever características sócio-demográficas bem como verificar a associação entre o tipo de tratamento antiretroviral empregado e hiperglicemia e hiperlipidemia, com especial atenção aos pacientes em uso de inibidores da protease do HIV. As informações foram obtidas a partir de um questionário e da coleta de sangue e urina para a execução dos exames laboratoriais. Foram entrevistados

  15. Tratamento da recidiva da leucemia mielóide crônica após transplante de medula óssea alogênico utilizando mesilato de imatinibe: relato de três casos Treatment of chronic myelogenous leukemia relapse after allogeneic bone marrow transplantation with imatinib mesylate: report of three cases

    Directory of Open Access Journals (Sweden)

    Ronald Pallotta

    2006-06-01

    Full Text Available O mesilato de imatinibe (MI, inibidor seletivo da tirosinoquinase envolvido na patogênese da leucemia mielóide crônica (LMC, tem se constituído como terapia farmacológica de primeira linha para o tratamento desta doença. A infusão de linfócitos do doador (DLI tem sido considerada como tratamento padrão para recidiva da LMC após transplante de medula óssea (TMO alogênico, apesar de estar freqüentemente associado à ocorrência de doença do enxerto contra hospedeiro e mielossupressão. Por apresentar resultados satisfatórios e boa tolerabilidade no tratamento da LMC, os autores empregaram o mesilato de imatinib como terapêutica alternativa à DLI em pacientes que sofreram recidiva após o TMO. Obtiveram sucesso em dois casos, sendo que em um houve retorno comprovado do quimerismo do doador. No terceiro caso houve progressão da doença e o paciente foi encaminhado para segundo TMO. Desta forma, devido ao caráter recente do tema, este estudo descritivo sugere que esta opção terapêutica possa ser estudada como alternativa na recaída pós-TMO.Imatinib mesylate (MI, a selective tyrosine kinase inhibitor involved in the pathogenesis of chronic myelogenous leukemia (CML, has become the first-line treatment for this disease. Donor lymphocyte infusion (DLI has been considered as the standard treatment for relapse after allogeneic bone marrow transplantation (BMT, even though it is frequently associated with graft versus host disease and myelosuppression. Because of the satisfactory results and tolerance of the treatment of CML, the authors used MI as an alternative therapy for DLI in patients that relapsed after BMT. They obtained cytogenetic remission in two cases, with, in one case, proven conversion to the donor chimera. The third case evolved with progression of the disease and a second BMT was required. Since this is a new alternative, this descriptive study suggests it should be considered as an alternative therapy for relapse

  16. Perfil do tratamento da insuficiência cardíaca na era dos betabloqueadores Heart failure treatment profile at the beta blockers era

    Directory of Open Access Journals (Sweden)

    Christiano Pereira Silva

    2007-04-01

    Full Text Available OBJETIVOS: A inibição dos sistemas renina-angiotensina-aldosterona (SRAA e sistema nervoso autônomo simpático aumentou a perspectiva de sobrevida desses pacientes, além de permitir substancial melhora na qualidade de vida. O objetivo deste trabalho foi avaliar a realidade do tratamento aplicado e seu impacto sobre a doença em pacientes acompanhados em um ambulatório especializado em insuficiência cardíaca(IC. MÉTODOS: Foram estudados 96 pacientes acompanhados no ambulatório de Insuficiência Cardíaca e Transplante do Instituto do Coração, do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (HC-FMUSP. Os dados foram coletados durante a consulta ambulatorial a partir de prontuário médico e exame clínico. A escolha dos pacientes foi aleatória. RESULTADOS: A maior parte dos pacientes encontrava-se em classe funcional II (42,3% e em estágio C de evolução (94,9%. A prescrição médica para os pacientes foi bastante próxima do preconizado pelas diretrizes. Aproximadamente 95% recebem inibidores do SRAA (inibidor de ECA - enalapril e captopril - ou antagonista dos receptores de angiotensina-losartan, enquanto 85% dos pacientes recebem, além desses, agentes betabloqueadores (carvedilol. A dose média prescrita também se aproxima das utilizadas nos grandes estudos, e atinge mais de 60% da dose máxima de cada medicação. Os dados hemodinâmicos encontrados mostram pacientes estáveis, apesar da intensidade da disfunção e do remodelamento ventricular destes. CONCLUSÃO: Pacientes portadores de IC acompanhados por equipe médica especializada têm prescrição médica mais próxima do preconizado. Esses pacientes, embora com características marcadas de gravidade da doença, conseguem estabilidade hemodinâmica e clínica com a otimização terapêutica adequada.OBJECTIVES: The inhibition of the rennin-angiotensin-aldosterone system (RAAS and sympathetic autonomous nervous system has increased the

  17. Diretrizes brasileiras para o tratamento da narcolepsia Brazilian guidelines for the treatment of narcolepsy

    Directory of Open Access Journals (Sweden)

    Flávio Alóe

    2010-09-01

    Full Text Available Este artigo relata as conclusões da reunião de consenso da Associação Brasileira de Sono com médicos especialistas brasileiros sobre o tratamento da narcolepsia, baseado na revisão dos artigos sobre narcolepsia publicados entre 1980 e 2010. Os objetivos do consenso são valorizar o uso de agentes avaliados em estudos randomizados placebo-controlados, emitir recomendações de consenso para o uso de outras medicações e informar pontos importantes a respeito da segurança e efeitos adversos das medicações. O tratamento da narcolepsia é baseado em diversas classes de agentes, estimulantes para sonolência excessiva, agentes antidepressivos para cataplexia e hipnóticos para sono noturno fragmentado. Medidas comportamentais são igualmente importantes e recomendadas universalmente. Todos os ensaios clínicos terapêuticos foram classificados de acordo com o nível de qualidade da evidência. Recomendações terapêuticas individualizadas para cada tipo de sintoma e recomendações gerais foram formuladas pelos autores. Modafinila é indicada como a primeira escolha para o tratamento da sonolência diurna. Agentes de segunda escolha para o tratamento da sonolência excessiva são metilfenidato de liberação lenta seguido pelo mazindol. Reboxetina, clomipramina, venlafaxina, desvenlafaxina e os inibidores seletivos de recaptação de serotonina em doses altas são a primeira escolha para o tratamento da cataplexia. Hipnóticos são utilizados para o tratamento do sono noturno fragmentado. Antidepressivos e hipnóticos são igualmente utilizados para o tratamento das alucinações hipnagógicas e paralisia do sono.This manuscript contains the conclusion of the consensus meeting of the Brazilian Sleep Association with Brazilian sleep specialists on the treatment of narcolepsy based on the review of medical literature from 1980 to 2010. The manuscript objectives were to reinforce the use of agents evaluated in randomized placebo

  18. Iontoforese associada ao princípio ativo ácido ascórbico: avaliação eletroquímica e de difusão vertical

    OpenAIRE

    Sinigaglia, Giovana

    2014-01-01

    A iontoforese é um método de incremento de permeação de substâncias pela pele com a utilização de corrente contínua. Neste estudo, será abordado o princípio ativo ácido ascórbico, que possui efeitos fisiológicos na pele, tais como a sua atividade antioxidante; é também um importante cofator da produção de colágeno pelos fibroblastos e ainda atua como inibidor da melanogênese, proporcionando um clareamento de manchas. Foram realizadas aplicações de iontoforese in vitro em gel com hidroxietilce...

  19. Anticorpos para os vírus da rubéola, do sarampo e da caxumba em crianças de São Paulo, Brasil Rubella, measles and mumps serum antibodies in children of S. Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Renato Piza de Souza Carvalho

    1976-12-01

    Full Text Available Foram dosados anticorpos inibidores da hemaglutinação para o vírus da rubéola, do sarampo e da caxumba, em amostras de soro de 166 crianças de elevado nível sócio-econômico, com idade de 6 a 12 anos, que freqüentavam, em 1969, uma escola primária na cidade de São Paulo, Brasil. A per-centagem de soros positivos foi de 49,3% para a rubéola, 88,2% para o sarampo e 79,4% para a caxumba. Através de interrogatório junto aos pais, observou-se significativa correspondência entre antecedentes clínicos positivos para sarampo e caxumba e presença de anticorpos circulantes (95,3% e 91,7%, respectivamente. Houve grande discordância quando os antecedentes clínicos ou vacinais para sarampo e caxumba eram negativos: 51,8% e 61,4% destas crianças possuíam anticorpos circulantes. Quanto à rubéola, não foi possível fazer-se tal correlação, pois a maioria das mães não sabia dar informações sobre esta doença, no passado.One hundred and sixty high socio-economic level, 6-12 year old children, attending a primary school, were tested in 1969 for rubella, measles and mumps HI antibodies. A 49.3% positivity for rubella antibodies, 88.2% for measles and 79.4% for mumps were found. A good correlation was observed between a positive history of clinical disease in the past and detectable serum antibodies for measles and mumps (95.3% and 91.7%, respectively. Quite on the contrary was observed when the history of measles and mumps disease or immunization in the past were negative, as 51.8% and 61.4% of these children, respectively, presented antibodies. As regards rubella, no correlation was obtained as the great majority of the parents was unable to give information on this disease in the past.

  20. Inhibition of cell proliferation by a selective inhibitor of the Ca{sup 2+}-activated Cl{sup -} channel, Ano1

    Energy Technology Data Exchange (ETDEWEB)

    Mazzone, Amelia; Eisenman, Seth T.; Strege, Peter R. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Yao, Zhen [Laboratory of Molecular Genetics, UCSF, San Francisco, CA (United States); Ordog, Tamas; Gibbons, Simon J. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Farrugia, Gianrico, E-mail: farrugia.gianrico@mayo.edu [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States)

    2012-10-19

    Highlights: Black-Right-Pointing-Pointer T16A{sub inh}-A01 blocked Ano1 currents in HEK cells expressing Ano1. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation in ICC primary cultures and CFPAC-1 cell line. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation of ICC in intact smooth muscle strips. -- Abstract: Background: Ion channels play important roles in regulation of cellular proliferation. Ano1 (TMEM16A) is a Ca{sup 2+}-activated Cl{sup -} channel expressed in several tumors and cell types. In the muscle layers of the gastrointestinal tract Ano1 is selectively expressed in interstitial cells of Cajal (ICC) and appears to be required for normal gastrointestinal slow wave electrical activity. However, Ano1 is expressed in all classes of ICC, including those that do not generate slow waves suggesting that Ano1 may have other functions. Indeed, a role for Ano1 in regulating proliferation of tumors and ICC has been recently suggested. Recently, a high-throughput screen identified a small molecule, T16A{sub inh}-A01 as a specific inhibitor of Ano1. Aim: To investigate the effect of the T16A{sub inh}-A01 inhibitor on proliferation in ICC and in the Ano1-expressing human pancreatic cancer cell line CFPAC-1. Methods: Inhibition of Ano1 was demonstrated by whole cell voltage clamp recordings of currents in cells transfected with full-length human Ano1. The effect of T16A{sub inh}-A01 on ICC proliferation was examined in situ in organotypic cultures of intact mouse small intestinal smooth muscle strips and in primary cell cultures prepared from these tissues. ICC were identified by Kit immunoreactivity. Proliferating ICC and CFPAC-1 cells were identified by immunoreactivity for the nuclear antigen Ki67 or EdU incorporation, respectively. Results: T16A{sub inh}-A01 inhibited Ca{sup 2+}-activated Cl{sup -} currents by 60% at 10 {mu}M in a voltage-independent fashion. Proliferation of ICC was significantly reduced in primary cultures

  1. Action of plant proteinase inhibitors on enzymes of physiopathological importance

    Directory of Open Access Journals (Sweden)

    Maria Luiza V. Oliva

    2009-09-01

    Full Text Available Obtained from leguminous seeds, various plant proteins inhibit animal proteinases, including human, and can be considered for the development of compounds with biological activity. Inhibitors from the Bowman-Birk and plant Kunitz-type family have been characterized by proteinase specificity, primary structure and reactive site. Our group mostly studies the genus Bauhinia, mainly the species bauhinioides, rufa, ungulata and variegata. In some species, more than one inhibitor was characterized, exhibiting different properties. Although proteins from this group share high structural similarity, they present differences in proteinase inhibition, explored in studies using diverse biological models.Obtidas de sementes leguminosas, várias proteínas inibem proteinases de origem animal, incluindo humanas, e podem ser consideradas para o desenvolvimento de compostos com atividade biológica. Inibidores da família Bowman-Birk e da família Kunitz vegetal tem sido caracterizados em relação a especificidade para proteinase, estrutura primária e sitio reativo. O nosso grupo majoritariamente vem estudando o gênero Bauhinia, principalmente as espécies bauhinioides, rufa, ungulatae variegata. Em algumas espécies, mais de um inibidor com propriedades diferentes foi caracterizado. Embora tais proteínas apresentem alta similaridade estrutural, diferem quanto à inibição de proteinases, e foram exploradas em estudos utilizando diversos modelos biológicos.

  2. Seleção de genótipos de cana-de-açúcar para acúmulo de protoporfirina ix com uso de herbicidas inibidores da protox Selection of Sugarcane Genotypes for Protoporphyrin IX Accumulation using Protox-Inhibiting Herbicides

    Directory of Open Access Journals (Sweden)

    L.R.M. Barberis

    2009-01-01

    Full Text Available O objetivo do presente trabalho foi selecionar genótipos de cana-de-açúcar por meio de inibidores da PROTOX e antioxidantes para indução do acúmulo de protoporfirina IX (PROTO IX e/ou de seus precursores em plantas. Esses compostos podem ser utilizados como agentes sensibilizantes em terapia fotodinâmica (TFD, os quais possibilitam uma fonte de baixo custo para o tratamento de neoplasias e carcinomas. O experimento foi montado em câmara climatizada, com aplicação de nove tratamentos (1. oxyfluorfen + glutamato monossódico + vitaminas C e E; 2. oxyfluorfen + glutamato monossódico + vitaminas C e E + ácido levulênico; 3. oxyfluorfen; 4. carfentrazone + glutamato monossódico + vitaminas C e E; 5. carfentrazone + glutamato monossódico + vitaminas C e E + ácido levulênico; 6. carfentrazone; 7. testemunha + vitaminas C e E; 8. testemunha + vitaminas C e E + ácido levulênico; e 9. testemunha em oito genótipos de cana-de-açúcar (PO933499, RB806043, RB470355, PO830698, SP701143, PO901387, PO894414 e SP903414, dispostos em esquema fatorial 9 x 8, com quatro repetições. As repetições constituíram-se de folhas (20 cm destacadas de cada genótipo, sendo estas pulverizadas com os tratamentos mencionados, em simulador estacionário. Foram realizadas avaliações visuais de controle aos 2 DAA (dias após aplicação e, no fim do estudo, determinações analíticas via extração da biomassa fresca, verificando os teores de protoporfirina IX por cromatografia líquida de alta eficiência. Os resultados mostraram que em curto prazo foram detectados aumentos significativos nas concentrações de PROTO IX para os genótipos RB470355 e SP903414 submetidos ao tratamento 2 e para o genótipo SP701143 submetido ao tratamento 8, indicando que eles podem ser utilizados como fontes acumuladoras de protoporfirina IX.The objective of this study was to select sugarcane genotypes through PROTOX inhibitors and antioxidants to induce the accumulation

  3. Efeitos da angiotensina-I e isquemia na recuperação funcional em corações isolados

    Directory of Open Access Journals (Sweden)

    Ubirajara Oliveira de Oliveira

    2011-11-01

    Full Text Available FUNDAMENTO: A ressuscitação de parada cardíaca pode apresentar disfunção miocárdica determinada pelo tempo da isquemia, e a inibição da enzima conversora de angiotensina (ECA pode reduzir a disfunção cardíaca durante a reperfusão. OBJETIVO: Investigar os efeitos da angiotensina-I e diferentes períodos de isquemia na recuperação funcional em corações de ratos isolados. MÉTODOS: Os corações isolados de ratos Wistar (n = 45; 250-300 g foram submetidos a diferentes períodos de isquemia global (20, 25 ou 30 min e reperfundidos (30 min com o tampão Krebs-Henseleit, ou com a adição de 400 nmol/L de angiotensina-I, ou com 400 nmol/L de angiotensina-I + 100 µmol/L de captopril durante o período de reperfusão. RESULTADOS: A derivada positiva máxima de pressão (+dP/dt max e o produto frequência-pressão foram reduzidos nos corações expostos à isquemia de 25 min (~ 73% e à isquemia de 30 min (~ 80% vs. isquemia de 20 min. A pressão diastólica final do ventrículo esquerdo (PDFVE e a pressão de perfusão (PP foram aumentadas nos corações expostos à isquemia de 25 min (5,5 e 1,08 vezes, respectivamente e à isquemia de 30 min (6 e 1,10 vezes, respectivamente vs. isquemia de 20 min. A angiotensina-I ocasionou uma diminuição no +dP/dt max e no produto frequência-pressão (~ 85-94% em todos os períodos de isquemia e um aumento na PDFVE e na PP (6,9 e 1,25 vezes, respectivamente apenas na isquemia de 20 min. O captopril foi capaz de reverter parcial ou completamente os efeitos da angiotensina-I na recuperação funcional nas isquemias de 20 e 25 min CONCLUSÃO: Os dados sugerem que a angiotensina-II participa direta ou indiretamente no dano pós-isquêmico e que a capacidade de um inibidor da ECA atenuar esse dano depende do tempo de isquemia.

  4. Antidepressants in social anxiety disorder Antidepressivos no transtorno de ansiedade social

    Directory of Open Access Journals (Sweden)

    Antonio E. Nardi

    2001-09-01

    Full Text Available Social anxiety disorder (SAD is a marked and persistent fear of doing almost everything in front of people due to concerns about being judge by others. An up-to-date review is needed in order to reach a practical judgement of all psychopharmacological data. Case reports, open and double-blind trials with SAD were described and commented upon from a clinical point of view. The MEDLINE system was searched from 1975 to 2001. The references from the selected papers were also used as a source. MAOIs (fenelzine, tranylcypromine, reversible monoamino oxidase-A inhibitors (moclobemide, brofaromine, SSRIs (paroxetine, sertraline, fluoxetine, fluvoxamine and some other antidepressants (venlafaxine, nefazodone have proven effective in several studies with various methodologies. The MAOIs have more serious adverse effects and the SSRIs have the best tolerance. SSRIs are efficacious and the first choice of treatment.A fobia social é o medo acentuado e persistente patológico de comer, beber, tremer, enrubescer, falar, escrever, enfim, de agir de forma ridícula ou inadequada na presença de outras pessoas. Muitos estudos clínicos têm sido conduzidos com o objetivo de se obter um tratamento eficaz. É necessária uma revisão atualizada para alcançar um julgamento clínico de todos os dados com antidepressivos. O sistema MEDLINE foi pesquisado no período de 1975 a 2001. As referências dos artigos consultados também foram utilizadas com fonte. Antidepressivos inibidores da monoamino oxidase (IMAO (fenelzine, tanilcipromina, inibidores reversíveis da monoamino oxidase tipo--A (RIMA (moclobemida, brofaromina, antidepressivos inibidores seletivos de serotonina (ISRS (paroxetina, sertralina, fluoxetina, fluvoxamina e alguns outros (venlafaxina, nefazodone têm demonstrado eficácia em inúmeros estudos com diferentes metodologias. Os ISRS são o grupo mais estudado com metodologia duplo-cega, com melhores resultados e com boa tolerância, sendo a primeira

  5. Considerações sobre a clínica e o tratamento de uma manifestação incomum do transtorno dismórfico corporal: a síndrome de referência olfatória

    Directory of Open Access Journals (Sweden)

    Cristiane Maluhy Gebara

    2011-01-01

    Full Text Available Neste relato, descreve-se o caso de um rapaz de 23 anos que apresentava a crença de exalar um odor desagradável proveniente da transpiração e acreditava que incomodava as outras pessoas. O paciente foi medicado com amissulprida associada a técnicas de terapia cognitivo-comportamental (TCC, tendo havido acentuada melhora do quadro clínico. Foram abordados aspectos relativos à nosologia e às manifestações clínicas da síndrome de referência olfatória (SRO, e o seu tratamento foi discutido. Observou-se que experimentos comportamentais envolvendo exposição com desafio às crenças delirantes podem ser úteis no tratamento desse transtorno e que os antipsicóticos, particularmente a amissulprida, podem ser uma boa alternativa aos inibidores de recaptação da serotonina (IRSs no tratamento da SRO.

  6. CONTROLE QUÍMICO DA Scrobipalpuloides absoluta Meyrick, 1971 SOBRE TOMATEIRO INDUSTRIAL COM INSETICIDA FISIOLÓGICO INIBIDOR DA ECDISE CHEMICAL CONTROL OF THE TOMATO LEAF MINER Scrobipalpuloides absoluta (MEYRICK USING A NEW INSETICIDE INHIBITOR OF ECDYSIS

    Directory of Open Access Journals (Sweden)

    Danilo Couto

    2007-09-01

    Full Text Available

    Foi realizado, no município de Goiânia (GO, no período de maio a outubro de 1994, um experimento visando ao controle químico da traça (S. absoluta no tomateiro, cultura rasteira. O delineamento experimental foi de blocos ao acaso com sete tratamentos em quatro repetições. Cada unidade experimental foi constituída de quatro linhas com cinco metros de comprimento, um metro entre linhas da cultivar Roma VF. Os produtos utilizados foram: Atabron 50 CE (Clorfluazuron nas doses de 0,5; 0,75; 1,0 e 1,5 litro por hectare do produto comercial; Vertimec 18 CE (Abamectin: 1,0 litro por hectare, acrescido de 0,25% de óleo mineral; Cartap 500 BR (Cartap na dose de 0,96 kg/hectare; e uma testemunha. Foram realizadas quatro aplicações consecutivas, semanalmente, a partir do aparecimento dos primeiros adultos da praga na cultura, gastando-se 1.000 litros de calda/hectare. Pelos resultados obtidos, pode-se concluir que o Atabron 50 CE controlou eficientemente a S. absoluta nas dosagens a partir de 0,75 litro (37,5 g i.a. por hectare, igualando-se ao Vertimec, até 21 dias após a última aplicação, e sendo superior ao Cartap. O Atabron apresentou um controle que variou entre 86,4 a 93,8% de eficiência.

    PALAVRAS-CHAVE: Tomateiro; controle químico; traça; Scrobipalpuloides absoluta.

    The tomato leafminer (Scrobipalpuloides absoluta, a common pest of tomato plant, is distributed in many regions in Brazil. In order to determine the efficiency of Chlorfluazuron to control the tomato leafminer, a field experiment was carried out in Goiânia, Goiás state, Brazil. The treatment and dosage in grams of active

  7. Composição química e antinutrientes presentes nas amêndoas cruas e torradas de chicha (Sterculia striata A. St. Hill & Naudin Chemical composition and antinutrients of raw and roasted chicha almonds (Sterculia striata A. St. Hill & Naudin

    Directory of Open Access Journals (Sweden)

    Aline Gomes de Moura e Silva

    2011-04-01

    Full Text Available OBJETIVO: Analisar os componentes químicos e antinutrientes antes e após torrefação da amêndoa de chichá da espécie Sterculia striata A. St. Hill & Naudin, oriunda de Corrente, Piauí. MÉTODOS: Foram realizadas análises: centesimal, perfil de ácidos graxos, antinutrientes (taninos, inibidor de tripsina, inibidor de amilase, lectina, fitatos, compostos fenólicos e atividade de peroxidase e polifenoloxidase. RESULTADOS: Os resultados da análise centesimal da amêndoa crua e torrada foram: lipídeos de 25,1% e 26,2%, carboidratos de 44,4% e 45,6%, proteína de 20,8% e 22,1%, cinzas de 3,7% e 4,0%, fibra alimentar total de 12,3% e 10,4%, respectivamente. Nas amêndoas cruas e torradas não foram encontradas lectinas, taninos, inibidores de tripsina e alfa-amilase. Verificou-se a ausência de peroxidase e polifenoloxidase e conteúdo de compostos fenólicos de 107,7mg/100g e 108,9mg/100g para amêndoas cruas e torradas, respectivamente. CONCLUSÃO: A torrefação realizada a 205°C por 11 minutos diminuiu o teor de fitatos de 10,6mg/g para 5,5mg/g. Por fim, as amêndoas de chichá, cruas e torradas, apresentam alto teor de proteínas, fibras, ácidos graxos monoinsaturados e saturados.OBJECTIVE: This study analyzed the chemical components and antinutrients present in raw and roasted chichá almonds from the species Sterculia striata A. St. Hill & Naudin harvested in Corrente, Piauí. METHODS: The following were determined: percent composition, fatty acid profile, antinutrients (tannins, trypsin inhibitor, amylase inhibitor, lectin, phytates, phenolic compounds and peroxidase and polyphenol oxidase activities. RESULTS: The percentage composition of the raw and lipid almonds were respectively: 25.1% and 26.2% fats, 44.4% and 45.6% carbohydrates, 20.8% and 22.1% protein, 3.7% and 4.0% ashes, and 12.3% and 10.4% total fiber. Neither raw nor roasted almonds contained lectins, tannins, trypsin inhibitors, alpha-amylase, peroxidase and

  8. Estudo de inibidores de corrosão em concreto armado

    OpenAIRE

    Vieira,Daniel Venâncio; Pelisser,Fernando; Paula,Marcos Marques da Silva; Mohamad,Gihad; Nóbrega,Ana Cecília Vieira da

    2010-01-01

    A corrosão é um fenômeno que afeta toda a sociedade, atribuindo-se uma grande importância sócio-econômica aos seus efeitos. Na área da engenharia, existem diversas conseqüências do processo corrosivo, como ocorre no aço de reforço das estruturas de concreto. Na intenção de oferecer segurança e durabilidade às estruturas, empresas do ramo químico e de produtos para construção civil disponibilizam no mercado diferentes formas de proteção à corrosão. Este trabalho apresenta análises de medidas d...

  9. Expressão gênica do transportador de serotonina e concentração de serotonina no hipotálamo de ratos jovens manipulados com fluoxetina durante a lactação.

    OpenAIRE

    Pinheiro, Isabeli Lins

    2013-01-01

    A serotonina atua na regulação de eventos biológicos envolvidos no desenvolvimento precoce do sistema nervoso. Neste período crítico o aumento dos níveis encefálicos deste neurotransmissor pode alterar componentes do sistema serotoninérgico, como o transportador de serotonina. Os inibidores seletivos da recaptação de serotonina bloqueiam o transportador e aumentam a quantidade de serotonina extracelular. O aumento farmacologicamente induzido neste período é capaz de gerar alterações funcionai...

  10. Reacções cutâneas adversas aos inibidores do receptor do factor de crescimento epidérmico: estudo de 14 doentes Adverse cutaneous reactions to epidermal growth factor receptor inhibitors: a study of 14 patients

    Directory of Open Access Journals (Sweden)

    Felicidade Santiago

    2011-06-01

    Full Text Available FUNDAMENTOS: O cetuximab e o erlotinib, inibidores do receptor do factor de crescimento epidérmico, provocam frequentemente reacções cutâneas adversas peculiares. OBJETIVOS: Caracterizar do ponto de vista clínico-evolutivo as reacções cutâneas adversas e avaliar a sua abordagem terapêutica. METODOLOGIA: Entre março/2005 e setembro/2009 foram seguidos 14 doentes com idade média de 59,6 anos, em tratamento com cetuximab (7 ou erlotinib (7, por neoplasia pulmonar (10 ou colorrectal (4. Retrospectivamente foi avaliado o padrão clínico evolutivo de reacção cutânea, o intervalo entre a introdução do fármaco e o início dos sintomas e a resposta ao tratamento. RESULTADOS: Doze doentes apresentaram erupção papulopustulosa predominantemente na face, decote e dorso, em média 13,5 dias após o início do fármaco. Efectuaram tratamento oral com minociclina ou doxiciclina e tópico com metronidazol, peróxido de benzoílo e/ou corticoide. Ocorreu melhoria das lesões em todos os doentes. Cinco doentes, em média oito semanas após o início da terapia, apresentaram granulomas piogénicos periungueais, em quatro casos associados a paroníquia, melhorados com tratamento tópico (antibióticos, corticoides e antissépticos. Observou-se xerose em alguns doentes e, de forma isolada, outros efeitos adversos, como telangiectasias e angiomas, alterações dos cabelos e cílios e nevos melanocíticos eruptivos. Na maioria dos doentes, a terapêutica com o inibidor do receptor do factor de crescimento epidérmico foi mantida. CONCLUSÃO: Com o crescente uso destas terapêuticas-alvo, torna-se obrigatório reconhecer e tratar os seus efeitos cutâneos adversos, assegurando uma intervenção atempada de forma a permitir a manutenção desta terapêuticaBACKGROUND: Cetuximab and erlotinib, epidermal growth factor receptor inhibitors, often cause peculiar adverse cutaneous reactions. OBJECTIVES: Our aim was to evaluate adverse cutaneous reactions

  11. Rice seedling and plant development as affected by increasing rates of penoxsulam under controlled environments Desenvolvimento de plântulas e plantas adultas de arroz em função de doses crescentes de penoxsulam em ambiente controlado

    Directory of Open Access Journals (Sweden)

    G. Concenço

    2006-01-01

    Full Text Available Rice is a major staple in many countries. Weed control is one of the factors limiting higher rice yield. ALS (acetolactate synthase-inhibiting herbicides are desirable weed control herbicides because of their high efficacy, low toxicity to mammalians, and low rates used. An important herbicide characteristic is high selectivity to the crop, since it facilitates fast crop establishment and greater crop advantage over the weeds. The objectives of this work were to study the effects of increasing rates of the ALS-inhibiting herbicide penoxsulam on seed integrity and germination, and seedling and plant development of rice cv. BRS Pelota under controlled laboratory and greenhouse conditions. The results showed that penoxsulam affected rice germination and seedling and plant growth at rates above 54 g a.i. ha-1, and that penoxsulam is safe for rice seedling development at the currently recommended rates.O arroz é componente importante da dieta humana em vários países. Entre os fatores que limitam o aumento na sua produtividade está o controle de plantas daninhas. Os herbicidas inibidores da ALS (acetolactato sintase são preferidos em razão da alta eficiência no controle de plantas daninhas, da baixa toxicidade aos mamíferos e das baixas doses utilizadas. Uma característica importante que um herbicida deve possuir é a alta seletividade à cultura, pois ela implica estabelecimento mais rápido, com vantagem competitiva sobre as plantas daninhas. O objetivo deste trabalho foi estudar os efeitos do herbicida inibidor da ALS penoxsulam em doses crescentes sobre a integridade e germinação das sementes, bem como sobre o desenvolvimento inicial das plântulas e da planta adulta do cultivar BRS Pelota, sob condições de ambiente controlado (laboratório e casa de vegetação. Os resultados mostraram que o penoxsulam afetou a germinação e o crescimento de plântulas e plantas adultas nas doses acima de 54 g i.a. ha-1 e que ele é seguro para o

  12. Tratamento de insuficiência cardíaca com benazepril em cães com cardiomiopatia dilatada e endocardiose Treatment of congestive heart failure with benazepril in dogs with dilated cardiomyopathy and endocardiosis

    Directory of Open Access Journals (Sweden)

    P.M. Pereira

    2005-09-01

    Full Text Available Foram avaliados os efeitos clínicos do benazepril, um inibidor da enzima de conversão da angiotensina de ação prolongada, em cães com insuficiência cardíaca congestiva (ICC secundária à endocardiose de mitral ou cardiomiopatia dilatada. O medicamento foi administrado na dose de 0,25 a 0,5mg/kg/dia. Diuréticos, digitálicos e f��rmacos antiarrítmicos foram usados de acordo com a necessidade de cada paciente. Exames físico, radiográfico e eletrocardiográfico foram realizados nos dias 0, 7, 28 e 56. A gasometria arterial e a bioquímica sérica foram avaliadas nos dias 0 e 56. Os sinais de dispnéia e o estado geral dos pacientes melhoraram em todos os cães após o início do tratamento. Houve diminuição na freqüência da tosse e não houve alterações no eletrocardiograma, exceto pela diminuição na amplitude e na duração da onda P. Nenhum efeito colateral foi observado. Conclui-se que o benazepril é um inibidor da enzima de conversão da angiotensina, eficaz e bem tolerado no tratamento da ICC no cão.Clinical effects of benazepril, a long acting angiotensin-converting enzyme (ACEi, in dogs with naturally-occurring congestive heart failure (CHF caused by mitral endocardiosis or dilated cardiomyopathy were studied. The drug was given orally at a dose of 0.25 to 0.5mg/kg/day. Diuretics, digitalics, and antiarrhtyhmic drugs were given as needed. Physical, radiographic, and eletrocardiographic examination were performed at days 0, 7, 28, and 56. Serum biochemistry and arterial blood gases were obtained at days 0 and 56. Signs of dyspnea and general condition improved in all dogs. Cough decreased in frequency. The electrocardiogram did not change with benazepril use except for a decrease in P wave amplitude and duration. No adverse effects related to the use of benazepril were observed. Benazepril is an effective and well tolerated ACEi for the treatment of CHF in dogs.

  13. Síndrome de Gilles de la Tourette associada ao transtorno de déficit de atenção com hiperatividade: resposta clínica satisfatória a inibidor seletivo da recaptura de serotonina e metilfenidato Tourette syndrome associated with attention-deficit hyperactivity disorder: satisfactory clinical response to selective serotonin reuptake inhibitor and methylphenidate

    Directory of Open Access Journals (Sweden)

    Roberta Benitez Freitas Passos

    2010-01-01

    Full Text Available A Síndrome de Gilles de la Tourette (SGT, caracterizada pela presença de tiques motores e vocais, apresenta elevada associação com transtorno obsessivo-compulsivo (TOC e transtorno de déficit de atenção com hiperatividade (TDAH. Essas condições frequentemente causam mais prejuízo aos pacientes do que os tiques, propriamente. Relata-se o caso clínico de um paciente com SGT e comorbidade com TDAH e TOC. O tratamento com inibidor seletivo de recaptura de serotonina (ISRS e metilfenidato promoveu melhora significativa dos sintomas de TDAH, sintomas compulsivos e tiques.Tourette Syndrome (TS, characterized by motor and vocal tics, is often associated with obsessive compulsive disorder (OCD and attention-deficit hyperactivity disorder (ADHD. These associated conditions frequently cause more impairment in patients than tics themselves. We report the case of TS with comorbid ADHD and OCD. Treatment with selective serotonin reuptake inhibitor and methylphenidate, led to significantly improvement of ADHD symptoms, compulsive symptoms and tics.

  14. Thermostabilisation of human serum butyrylcholinesterase for detection of its inhibitors in water and biological fluids

    Directory of Open Access Journals (Sweden)

    Lakshmanan Jaganathan

    1999-01-01

    Full Text Available The ability of gelatine-trehalose to convert the normally fragile, dry human serum BChE into a thermostable enzyme and its use in the detection of cholinesterase inhibitors in water and biological fluids is described. Gelatine or trehalose alone is unable to protect the dry enzyme against exposure to high temperature, while a combination of gelatine and trehalose were able to protect the enzyme activity against prolonged exposure to temperature as high as +50°C. A method for rapid, simple and inexpensive means of screening for cholinesterase inhibitors such as carbamates and organophosphates in water, vegetables and human blood has been developed.A capacidade da gelatina-trehalose em converter a frágil BChE do soro humano em uma enzima termoestável e seu uso na descoberta de inibidores de colinesterase em água e fluidos biológicos é apresentado. A Gelatina ou trehalose são incapazes de proteger a enzima seca BchE do soro humano contra exposição a elevadas temperaturas, enquanto que uma combinação de gelatina e trehalose são capazes de proteger a atividade de enzima contra exposição prolongada a temperaturas elevadas e da ordem de 50° C. Um método barato, simples e rápido de screening para inibidores de colinesterase tal como carbamatos e organofosfatos em água, verduras e sangue humano foi desenvolvido.

  15. Fabricação de lã de rocha a partir da escória da produção de ligas FeSiMn Manufacture of mineral wool from slag of ferroalloy production FeSiMn

    Directory of Open Access Journals (Sweden)

    G. F. Rodrigues

    2012-12-01

    Full Text Available Este trabalho visou o estudo da produção de lã de rocha utilizando escória da produção de ligas de ferro silício manganês. O resíduo em questão possui características químicas que indicam a possibilidade de adição deste resíduo em formulações de lãs minerais. Procedeu-se a fusão da escória em um forno elétrico a arco, em escala de laboratório. A escória foi fundida e vazada na temperatura de 1450 ºC em um recipiente com água, visando um resfriamento brusco e com isso uma aproximação do método de produção das lãs de rocha. Amostras da lã de rocha produzida foram caracterizadas por técnicas de análise química, difração de raios X, microscopia eletrônica de varredura e análise térmica diferencial sendo que, os resultados obtidos foram comparados aos valores encontrados na literatura. Os resultados encontrados mostram que a reciclagem dos resíduos para a produção de lãs de rocha é promissora, pois o reaproveitamento da escória de ferro silício manganês permite a transformação destes resíduos em subprodutos através da incorporação dos resíduos na produção de lã de rocha, que possui amplo mercado como isolante térmico, acústico e inibidor de propagação de chamas.This study aimed to investigate the production of rock wool using slag from the production of ferrosilicon manganese alloys. The waste in question has chemical characteristics that indicate the possibility of adding this in formulations of mineral wool. There has been melting the slag in an electric arc furnace in laboratory scale. The slag was melted and poured at a temperature of 1450 ºC in a container with water, aiming at a rapid cooling and thus an approximation of the method of production of rock wool. Samples of rock wool produced were characterized by techniques of chemical analysis, X-ray diffraction, scanning electron microscopy and differential thermal analysis is that the results were compared to those found in the

  16. Ambiente escolar: o currículo oculto maltratado

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Pereira Silva

    2007-06-01

    Full Text Available Este trabalho reflete sobre o ambiente escolar, uma das dimensões que compõe o currículo oculto, através de um estudo de caso realizado na “Escola Municipal de 1° Grau da Urbis VI”, localizada no município de Vitória da Conquista no estado da Bahia. A pesquisa realizada no ano 2001, período caracterizado pelo significativo crescimento das matrículas no ensino fundamental devido à implementação do Fundo de Manutenção e Desenvolvimento do Ensino Fundamental e Valorização do Magistério — FUNDEF, buscou identificar os fatores inibidores da gestação de um saudável ambiente escolar que estão traduzidos na compressão dos espaços, na carência de recursos pedagógicos e no rígido controle do tempo.

  17. Long-term health benefits of appetite suppressants remain unproven Beneficios de los inhibidores de apetito en la salud a largo plazo permanecen sin comprobación Benefícios dos inibidores de apetite à saúde a longo prazo permanecem sem comprovação

    Directory of Open Access Journals (Sweden)

    Francisco José Roma Paumgartten

    2011-12-01

    da prevalência da obesidade tornou a prevenção e tratamento do sobrepeso importante desafio para a Saúde Pública. Além da dieta e exercício, os medicamentos são necessários para pacientes que não conseguem perder peso com as mudanças comportamentais. O objetivo do artigo foi sumarizar as preocupações atuais com a segurança e efetividade de medicamentos inibidores do apetite. Vários anorexígenos foram banidos por razões de segurança. Em 2010, a sibutramina foi retirada do mercado porque um estudo de longa duração mostrou que ela aumentava o risco de eventos cardiovasculares. Até agora nenhum estudo com número expressivo de pacientes demonstrou que anorexígenos reduzem a morbi-mortalidade associada ao sobrepeso. A retirada da sibutramina do mercado mostra que diretrizes para avaliação de medicamentos anorexígenos devem ser mais rigorosas, e que estudos de longa duração sobre os benefícios para a saúde devem ser realizados antes da comercialização.

  18. Alteração precoce da matriz extracelular e parâmetros diastólicos na síndrome metabólica

    Directory of Open Access Journals (Sweden)

    Angela B. S. Santos

    2013-10-01

    Full Text Available FUNDAMENTOS: Síndrome Metabólica (SM está associada com maior risco cardiovascular, porém não está claro se as alterações miocárdicas presentes nessa condição, como a disfunção diastólica, são consequência de mecanismos sistêmicos ou de efeitos diretos no miocárdio. OBJETIVOS: Comparar função diastólica, biomarcadores de atividade da Matriz Extracelular (MEC, inflamação e estresse hemodinâmico, em pacientes com SM e controles saudáveis. MÉTODOS: Pacientes com SM (n = 76 e controles saudáveis (n = 30 foram avaliados clinicamente e submetidos a exame ecocardiográfico e mensuração dos níveis plasmáticos de metaloproteinase-9 (MMP9, inibidor tecidual da metaloproteinase-1 (TIMP1, proteína C reativa ultrassensível (PCR-us, resistência insulínica (HOMA-RI e NT-proBNP. RESULTADOS: O grupo SM apresentou menor onda E' (10,1 ± 3,0 cm/s vs. 11,9 ± 2,6 cm/s, p = 0,005, maiores valores para onda A (63,4 ± 14,1 vs. 53,1 ± 8,9 cm/s, p < 0,001, razão E/E'(8,0 ± 2,2 vs. 6,3 ± 1,2; p < 0,001, MMP9 (502,9 ± 237,1 vs. 330,4 ± 162,7 ng/mL, p < 0,001, PCR-us (p = 0,001 e HOMA-RI (p < 0,001, sem diferença nos níveis de TIMP1 e NT-proBNP. Na análise multivariada, apenas MMP9 foi independentemente associada a SM. CONCLUSÃO: Pacientes com SM apresentaram diferenças em medidas ecocardiográficas de função diastólica, na atividade da MEC, PCR-us e HOMA-RI em relação aos controles. Porém, somente MMP9 foi independentemente associada com SM. Esses achados sugerem que os efeitos precoces da SM sobre a atividade da MEC podem não ser detectados nas medidas ecocardiográficas de função diastólica usuais.

  19. POSSIBILIDADES DO DESENVOLVIMENTO DO TURISMO ÉTNICO NAS COMUNIDADES QUILOMBOLAS DE DIAMANTINA/MG: OPORTUNIDADES E DESAFIOS

    Directory of Open Access Journals (Sweden)

    Elcione Luciana da Silva

    2016-04-01

    Full Text Available O conceito do turismo étnico vem se desenvolvendo nas últimas décadas e envolve a valorização cultural e possibilidade de promover diversas experiências e inter-relações entre visitantes e comunidades quilombolas. Este artigo versa sobre as comunidades quilombolas (Mata dos Crioulos, Vargem do Inhaí e Quartel de Indaiá – Diamantina/MG, que vêm sofrendo conflitos e pressões de ordem territorial, o que dificulta ainda mais a manutenção da cultura local. O objetivo desta pesquisa é sugerir o desenvolvimento do turismo étnico nas mesmas como forma de desenvolvimento local e valorização do patrimônio cultural material e imaterial. Para alcançar o resultado da pesquisa foram utilizadas referências bibliográficas e documentais. Palavra-chaves: Turismo étnico; comunidades quilombolas; conflitos ambientais e territoriais.

  20. Towards the design of new and improved drilling fluid additives using molecular dynamics simulations

    Directory of Open Access Journals (Sweden)

    Richard L. Anderson

    2010-03-01

    projeto de moléculas commelhores propriedades. Devido à natureza desordenada da dimensão nanoscópica dos nano poros dos minerais argilosos, simulações computacionais têm se tornado uma ferramenta poderosa para estudar as interações entre o inchamento da argila e o inibidor. Neste trabalho revisamos brevemente o histórico do desenvolvimento de fluidos técnicos de perfuração, o impacto ambiental dos fluidos de perfuração e o uso de simulações computacionais para estudar as interações entre os fluidos de perfuração e os inibidores do inchamento. Nós reportamos resultados para alguns estudos baseados em simulações de dinâmica molecular em larga escala em uma solução aquosa de baixo peso molecular com solutos compostos por macromoléculas inibidoras. A estrutura e as interações entre inibidores compostos por polipropileno óxido, polietileno óxido e moléculas e a argila montmorilonita são estudadas.

  1. Nefrite Intersticial Aguda Após Exposição a Losartan

    Directory of Open Access Journals (Sweden)

    Letícia Schwerz Weinert

    2007-07-01

    Full Text Available Nefrite intersticial aguda é uma causa comum de perda aguda de função renal. Exposição a drogas é o fator desencadeante mais freqüentemente relatado, porém auto-imunidade e infecções também estão associadas. Os inibidores da enzima de conversão da angiotensina têm sido relatados como possíveis agentes, porém não há relato na literatura de nefrite intersticial com uso de losartan. Descrevemos então, o caso de perda aguda de função renal após exposição a losartan, em paciente com dano renal prévio por nefropatia diabética, cuja biópsia renal diagnosticou nefrite intersticial aguda.

  2. Cysteine proteinases and cystatins

    Directory of Open Access Journals (Sweden)

    Adeliana S. Oliveira

    2003-01-01

    Full Text Available This review describeds the definition, localization, functions and examples of cysteine proteinases and their protein inhibitors in vertebrate, non-vertebrate animals and plants. These inhibitors are related with defense mechanisms of plant against pests. It also describes the factors involved in the specific cysteine proteinase-cystatin interaction and high degree of affinity and large specificity in this interaction which are not only represented by the compatibility between amino acid residues of the active site involved in catalysis, but also of all amino acid residues that participante in the enzyme-inhibitor interaction.Nesta revisão foram descritas definições, localizações, funções e exemplos de proteinases cisteínicas e suas proteinas inibidoras em animais vertebrados e invertebrados e plantas. Tratamos principalmente com aqueles inibidores que são relatados com o mecanismo de defesa da planta contra pestes. Em adição, comentamos sobre recentes trabalhos que contribuíram para uma melhor compreenção dos fatores envolvidos na interação específica proteinase cisteínica-cistatina. Por outro lado, chamamos atenção para o alto grau de afinidade e grande especificidade na interação que não são apenas representadas pela compatibilidade entre os residuos de aminoácidos do sítio ativo envolvidos na catalise, mas também de todos os resíduos de aminoácidos que participam da interação enzima-inibidor.

  3. O uso de inibidores da enzima conversora de angiotensina e sua relação com eventos no pós-operatório de cirurgia de revascularização miocárdica The use of inhibitors of angiotensin-converting enzyme and its relation to events in the postoperative period of CABG

    Directory of Open Access Journals (Sweden)

    Graciane Radaelli

    2011-09-01

    Full Text Available FUNDAMENTO: Os inibidores da enzima conversora de angiotensina (IECA reduzem o risco de óbito, infarto agudo do miocárdio (IAM e acidente vascular encefálico (AVE em portadores de doença coronariana. No entanto, não há consenso quanto à sua indicação em pacientes que serão submetidos à cirurgia de revascularização miocárdica (CRM. OBJETIVO: Avaliar a relação entre uso pré-operatório de IECA e eventos clínicos após realização da CRM. MÉTODOS: Estudo de coorte retrospectivo. Foram incluídos dados de 3.139 pacientes consecutivos submetidos à CRM isolada em hospital terciário brasileiro, entre janeiro de 1996 e dezembro de 2009. O seguimento dos pacientes foi realizado até a alta hospitalar ou óbito. Desfechos clínicos no pós-operatório foram analisados entre os usuários e os não-usuários de IECA no pré-operatório. RESULTADOS: Cinquenta e dois por cento (1.635 dos pacientes receberam IECA no pré-operatório. O uso de IECA foi preditor independente da necessidade de suporte inotrópico (RC 1,24, IC 1,01-1,47; P=0,01, de insuficiência renal aguda (IRA, RC 1,23, IC 1,01-1,73; P=0,04 e de evolução para fibrilação atrial (FA, RC 1,32, IC 1,02-1,7; P=0,03 no pós-operatório. A mortalidade entre os pacientes que receberam ou não IECA no pré-operatório foi semelhante (10,3 vs. 9,4%, P=0,436, bem como a incidência de IAM e AVE (15,6 vs. 15,0%, P=0,694 e 3,4 vs. 3,5%, P=0,963, respectivamente. CONCLUSÃO: O uso pré-operatório de IECA foi associado a maior necessidade de suporte inotrópico e maior incidência de IRA e FA no pós-operatório, não estando associado ao aumento das taxas de IAM, AVE ou óbitoBACKGROUND: Angiotensin-converting enzyme (ACE inhibitors reduce the chance of death, myocardial infarction (MI and cerebrovascular accident (CVA in patients with coronary disease. However there is no consensus as to its indication in patients undergoing coronary artery bypass grafting (CABG. OBJECTIVE: To

  4. Polimorfismo genético, terapia farmacológica e função cardíaca seqüencial em pacientes com insuficiência cardíaca Genetic polymorphism, medical therapy and sequential cardiac function in patients with heart failure

    Directory of Open Access Journals (Sweden)

    Marco Antonio Romeo Cuoco

    2008-04-01

    Full Text Available FUNDAMENTO: Variantes funcionais do gene da enzima conversora da angiotensina (ECA podem estar associados com a resposta à terapia em portadores de insuficiência cardíaca (IC. OBJETIVO: Testar a hipótese de diferenças na avaliação ecocardiográfica seqüencial da fração de ejeção do ventrículo esquerdo de pacientes com IC em tratamento farmacológico, inclusive com inibidores da ECA, em relação ao polimorfismo de inserção (I e deleção (D do gene da ECA. MÉTODOS: Estudamos 168 pacientes (média de idade 43,3±10,1 anos, 128 (76,2% dos quais homens, com IC e ecocardiogramas seqüenciais. O polimorfismo I/D foi determinado por reação em cadeia da polimerase. A fração de ejeção do ventrículo esquerdo (FEVE foi analisada comparativamente aos genótipos. Mais de 90% dos pacientes estavam tomando inibidores da ECA. RESULTADOS: Houve um aumento significantemente maior na FEVE média em pacientes com o alelo D, em comparação com pacientes com genótipo II (p = 0,01 após um seguimento médio de 38,9 meses. O alelo D foi associado com aumento de 8,8% na FEVE média no mesmo período. Além disso, observou-se uma tendência para um efeito do "número de cópias" do alelo D sobre o aumento da FEVE média com o tempo: uma diferença de 3,5% na variação da FEVE entre os pacientes com genótipos II e ID (p = 0,03 e de 5% entre os pacientes com genótipos II e DD (p = 0,02. CONCLUSÃO: O polimorfismo de deleção do gene da ECA pode estar associado com a resposta ao tratamento farmacológico com inibidores da ECA em portadores de IC. Outros estudos controlados poderão contribuir para uma melhor compreensão das influências genéticas sobre a resposta à terapia.BACKGROUND: Functional variants of angiotensin-converting enzyme (ACE gene may be associated with response to therapy in patients with heart failure (HF. OBJECTIVE: To test the hypothesis of differences in sequential echocardiographic evaluations of left ventricular

  5. Pesquisa de resíduos de antibióticos em leite pasteurizado tipo C, comercializado na cidade de Salvador.

    OpenAIRE

    G. M. S. Barros; N. M. de Jesus; M. H. Silva

    2005-01-01

    RESUMO: O leite é um alimento de alto valor nutritivo, amplamente consumido pelo homem, sendo considerado como um dos principais alimentos da dieta das crianças. Por ser considerado um alimento completo em nutrientes facilmente assimiláveis, torna-se um excelente meio de cultura para a maioria dos microrganismos encontrados na natureza. No leite nunca se deve tolerar inibidores ou substâncias para aumentar sua capacidade de conservação. A incorporação de antibióticos no leite pode oc...

  6. Estudo histologico dos efeitos de drogas antiinflamatorias (Betametasona, Papaina e Prioxicam) sobre a evolução do tecido de granulação em ratos

    OpenAIRE

    Maria Esperança Rabello Junqueira

    1983-01-01

    Resumo: A final idade do presente trabalho foi o acompanhamento da síntese do colágeno no tecido de, granulação induzidoartificialmente em ratos desde uma fase precoce até sua maturaçao. Objetivou-se também o estudo dos diversos efeitos de drogas anti inflamatórias com princípios ativos diferentes na evolução deste mesmo tecido tomparando-a com aquIa observada em animais sob condições normais. Os resultados obtidos demonstraram que a betametasona na dose de 0)0428 mg/kg é uma potente inibidor...

  7. Fibrodysplasia ossificans progressiva: case report Fibrodisplasia ossificante progressiva: relato de caso

    Directory of Open Access Journals (Sweden)

    Andre Leite Gonçalves

    2005-12-01

    Full Text Available Fibrodysplasia ossificans progressiva (FOP is a rare autosomal dominant disorder characterized by postnatal progressive heterotopic ossification of the connective tissue and congenital malformation of the big toes. We report on a nine-year-old girl with clinical and radiological features of FOP. She was born with bilateral hallux valgus and at the age of nine presented an indurate mass in the left cervical region that was painful. A significant decreased range of motion in all levels of the spine and shoulder girdle was found. The radiographs showed heterotopic ossification in the thoracic region. The patient had two outbreaks of the disease ("flare-ups" that were treated with prednisone 2 mg/kg/day for four days. After the "flare-ups", she had a continuous therapy with a Cox-2 inhibitor (25 mg/day and a leukotriene inhibitor, montelukast (10 mg/day.A fibrodisplasia ossificante progressiva (FOP é doença rara, autossômica dominante, caracterizada por ossificação heterotópica progressiva pós-natal do tecido conjuntivo e malformação congênita dos háluces. Relatamos o caso de menina de nove anos com o quadro clínico-radiológico típico de FOP, nascida com hálux valgo bilateral e que aos 9 anos de idade apresentou massa dolorosa, de consistência endurecida, sem sinais inflamatórios, situada na região cervical. Adicionalmente, era possível observar diminuição importante da movimentação em todos os níveis da coluna vertebral e da cintura escapular. A avaliação radiológica revelou a presença de ossificações heterotópicas na região torácica e malformação bilateral dos háluces. A paciente teve outros dois surtos da doença, que foram tratados com corticosteróide oral por quatro dias, (2 mg/kg/dia seguido por tratamento prolongado com inibidores da Cox-2 (25 mg/dia e com inibidor de leucotrienos (10 mg/dia.

  8. Estudo da mutação do recetor do fator de crescimento epidérmico, durante 5 anos, numa população de doentes com cancro do pulmão de não pequenas células

    Directory of Open Access Journals (Sweden)

    A.S. Castro

    2013-01-01

    Full Text Available Resumo: Introdução: Em 2006, a Unidade de Pneumologia Oncológica do Serviço de Pneumologia do Centro Hospitalar de Vila Nova de Gaia/Espinho iniciou a sequenciação da mutação do recetor do fator de crescimento epidérmico (EGFR em doentes com CPNPC selecionados e desde 2010 realiza a sequenciação sistematicamente em todos os doentes, independentemente da histologia, hábitos tabágicos, idade ou sexo. O objetivo deste trabalho foi caracterizar o grupo de doentes que efetuou a sequenciação entre 2006-2010, determinar a frequência da mutação EGFR, avaliar as sobrevidas globais e após uso de inibidores da tirosina quinase (ITK, nos doentes que efetuaram esta terapêutica em 2.a e 3.a linha com conhecimento do estado da mutação do EGFR. Métodos: Análise estatística descritiva dos doentes que efetuaram sequenciação EGFR em 2006-2010 e sobrevida mediana global nos doentes que efetuaefetuaram ITK em 2.a e 3.a linha. Registo do material disponível para análise e demora média de resultado do exame, de acordo com o material enviado. Resultados: A sequenciação foi efetuada em 374 doentes, 71,1% sexo masculino, 67,1% não/ex-fumadores, 32,9% fumadores; 57,8% adenocarcinoma e 23,5% carcinoma epidermoide (CE. A mutação foi detetada em 49 doentes (13,1%. No total dos doentes estudados, a taxa de mutação foi de 9% no sexo masculino e 23% no sexo feminino. A sobrevida mediana global após o uso de erlotinib foi de 14 meses para os doentes com mutação positiva do EGFR versus 6 meses nos doentes não mutados (p = 0,003. Conclusão: O nosso grupo teve uma taxa de mutação global de 13,1%, com predomínio no sexo feminino, não fumadores, histologia adenocarcinoma. Em doentes selecionados (2006/2009, a taxa de mutação foi de 16%; nos doentes não selecionados (2010 foi de 10,4%. Este estudo tem vindo a permitir um melhor conhecimento da taxa de mutação do EGFR na população portuguesa, bem como avaliar os resultados das

  9. Bovine S protein (vitronectin increases phagocytosis of Streptococcus dysgalactiae Aumento na fagocitose de Streptococcus dysgalactiae pela ação da proteína S bovina (vitronectina

    Directory of Open Access Journals (Sweden)

    Laerte Francisco Filippsen

    1999-01-01

    Full Text Available The effects of bovine S protein (vitronectin on phagocytosis of Streptococcus dysgalactiae strains isolated from cattle with mastitis were investigated. Phagocytized streptococci were determined by a fluorometric microassay using glass adherent polymorphonuclear neutrophils (PMN. Preincubation of S. dysgalactiae with bovine S protein significantly increased their phagocytosis by PMN. Bovine S protein had no effect on phagocytic killing of non-S protein binding S. pyogenes cultures. Enzymatic digestion of the bovine S protein binding sites on S. dysgalactiae with pronase resulted in a significative reduction of the effects of S protein on phagocytosis. It could thus be concluded that in addition to its role as a promoter of cellular adhesion and complement inhibitor, bovine S protein may also influence the phagocytosis of S. dysgalactiae during inflammatory processes.Foram investigados os efeitos da proteína S bovina (vitronectina na fagocitose de amostras de Streptococcus dysgalactiae isoladas de bovinos com mastite. A determinação do número de estreptococos fagocitados foi realizada pelo método fluorométrico utilizando neutrófilos polimorfonucleares (NPM aderidos em lâminas de vidro. A pré-incubação do S. dysgalactiae com a proteína S bovina aumentou significativamente a sua fagocitose por NPM. A proteína S bovina não causou efeito na fagocitose de culturas de S. pyogenes, já que não apresentam sítios de ligação para esta proteína. A digestão enzimática com pronase dos sítios de ligação S. dysgalactiae para a proteína S bovina resultou numa significativa redução do efeito da proteína S na fagocitose. Pode-se concluir que além do papel como promotor da adesão celular e inibidor do complemento, a proteína S bovina pode também influir na fagocitose do S. dysgalactiae durante os processos inflamatórios.

  10. GESTÃO DE COMUNIDADES DE PRÁTICA: FATORES CRÍTICOS DE SUCESSO AS SUAS MANUTENÇÕES

    Directory of Open Access Journals (Sweden)

    Sabrina Rebelo Schmitt

    2015-09-01

    Full Text Available As Comunidades de Prática – CoPs assumem um papel importante na criação e no compartilhamento do conhecimento organizacional, e suas formações dependem de uma gama de fatores que agem como propulsores ou inibidores ao seu bom desenvolvimento. Com essa compreensão, o objetivo deste estudo é identificar os fatores críticos de sucesso – FCS à manutenção das Comunidades. Para alcançar tal objetivo, realizou-se uma pesquisa exploratória de cunho bibliográfica, por meio da busca sistemática da literatura em base científica de dados. Como resultado para a investigação, chegou-se a um quadro-síntese em que 28 fatores são apresentados como críticos ao sucesso das CoPs.

  11. Filosofia da análise da estabilidade da liquidez

    Directory of Open Access Journals (Sweden)

    Rodrigo Antônio Chaves da Silva

    2005-07-01

    Full Text Available A informação foi considerada finalidade de nosso conhecimento, até o período em os pensadores e pesquisadores da contabilidade passaram a raciocinar sobre o conteúdo e o significado dos informes. Nesta busca da razão sobre os estados patrimoniais, surgiu a análise contábil que procura por meio de relações e identidades, o significado da dinâmica expressa da estaticamente na informação. O primeiro aspecto que surgiu no objeto de análise foi o estudo da liquidez, que é um dos principais exercícios do patrimônio. A estabilidade também é outro exercício básico e imprescindível, pois este é que promove o equilíbrio do organismo administrativo. A ciência contábil após a sua dignidade científica passou a trilhar caminhos esplendorosos, amparados em doutrina que permite alcançar os píncaros filosóficos. Os estudos concernentes aos aspectos de interação da estabilidade na liquidez são, complexos e somente com os recursos filosóficos da contabilidade se pode estudá-los com o panorama holístico e sublime. A filosofia da contabilidade não é alheia às suas práticas tecnológicas, podendo buscar pontos sublimes de panoramas abrangentes, para o estudo analítico da liquidez e estabilidade, observando todas as dimensionalidades e essencialidades de acontecimentos, na comprovação e orientação dos estados de ineficácia e eficácia patrimonial.

  12. Análise da transferência de calor de fluidos térmicos aditivado com etilenoglicol e polímeros

    OpenAIRE

    Santana, Rony Oliveira de

    2016-01-01

    Um sistema de arrefecimento é usado para manter a temperatura ideal de funcionamento e evitar sobreaquecimento, através de um fluido térmico também chamado fluido de arrefecimento e um trocador de calor. Os fluidos de arrefecimento são normalmente compostos por uma solução de água e um aditivo, além de aditivos inibidores de corrosão e corantes. O etilenoglicol é um tipo de álcool amplamente utilizado como aditivo por ser totalmente solúvel, com baixa ou nenhuma atividade corrosiva e quimicam...

  13. Ruminal fermentation modification of protein and carbohydrate by means of roasted and estimation of microbial protein synthesis Modificação da fermentação ruminal de proteína e carboidrato por meio da tostagem e estimativa de síntese de proteína microbiana

    Directory of Open Access Journals (Sweden)

    Héctor Andrade-Montemayor

    2009-07-01

    Full Text Available The animal meal prohibition as a protein source with low ruminal degradability in ruminant nutrition, creates the need to seek alternatives, as legume seeds, however, its protein, have a high degradability, which could generate losses of nitrogen in the rumen. Other problem in the legume seeds is the content of antinutritional factors such as protease inhibitors, tannins, phenolic compounds, lectins and some others, could affect the digestibility. One alternative to decrease the degradability of the protein and/or decrease the activity of some antinutritional factors is the use of different technological treatments such as roasting. Microbial protein synthesis is dependent on the availability of nitrogen or amino acids and of the degradable carbohydrate content, or of content of Organic Matter digestible and rumen degraded (OMDRD, and the synchronization in rumen degradation between protein and carbohydrates. If there are high amounts of degradable nitrogen or if the content and rate of carbohydrates degradation in the rumen is reduced or not synchronized with the degradation of protein, could be losses of nitrogen and/or energy in the rumen. In this paper, we analyze the characteristics of proteins and carbohydrates from various seeds and grains, the effect of dry-roasted application on degradability behavior of seeds.A proibição das farinhas de origem animal como fonte de proteína com baixa degradabilidade na nutrição de ruminantes, criou a necessidade de buscar alternativas, como sementes de leguminosas, porém, sua proteínas têm alta degradabilidade, podendo gerar perdas de nitrogênio no rúmen. Outro problema em sementes de leguminosas é o conteúdo de fatores antinutricionais, como os inibidores de proteases, taninos, compostos fenólicos, lectinas e alguns outros, podendo afetar a digestibilidade. Uma alternativa para diminuir a degradabilidade da proteína e/ou diminuir a atividade de alguns fatores antinutricionais é o uso de

  14. Conjecturas da Epistemológia Jurídica e Aspectos da Teoria da Linguagem

    OpenAIRE

    Oliveira, Rita de Cássia Cartelli de; Cesumar; Motta, Ivan Dias; Cesumar

    2008-01-01

    Apresentar-se-ão reflexões em torno da epistemologia jurídica e alguns aspectos da teoria da linguagem; a necessidade de acompanhamento e aprimoramento da linguagem jurídica, para que o direito não se distancie da realidade, mantendo-se apenas como um sistema do status quo; uma breve análise de algumas teorias da ciência do direito e da linguagem; as especificidades dos termos lingüísticos para a análise da ciência do direito, pautada na contemporaneidade sob a perspectiva humanista, buscando...

  15. Estrutura arbórea da Floresta Ombrófila Densa Altomontana de serras do Sul do Brasil Tree component structure of tropical upper montane rain forests in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Maurício Bergamini Scheer

    2011-12-01

    tree individuals (perimeter at breast height - PBH > 10 cm were sampled, which included 28 families, 43 genera and 78 species. The cloud forest sampled in Serra Gigante showed the highest richness (41 species, followed by Serra da Prata (37, Serra da Igreja (34 and Serra do Ibitiraquire (26. The mean tree height was 4.8 m, the PBH was 22.9 cm, the tree abundance was 4779 in/ha, the basal area was 33.5 m²/ha and the Shannon diversity index was 2.68 nats/ind. Combining our data with the published data on the Serra do Mar region, resulting in a total of 11 surveys and 204 plots (10200 m², a matrix with 75 identified species was obtained. In this matrix, the five most important species in the structure of the forest were Ilex microdonta, Siphoneugena reitzii, Drimys angustifolia, Ocotea porosa and Ilex chamaedrifolia. The cloud forests sampled in Serra do Mar showed lower richness and diversity indexes than the cloud forests in Serra da Mantiqueira (Southeast and higher richness and diversity than cloud forests in Aparados da Serra Geral (South. These differences are possibly related to the anthropic influences, geographic distances, different centers of endemism, the tropical and subtropical surroundings, and geomorphology, among other factors.

  16. Uso combinado da laserterapia de baixa potência e da inibição da ciclooxigenase-2 na reepitelização de ferida incisional em pele de camundongos: um estudo pré-clínico Combined use of low level laser therapy and cyclooxygenase-2 selective inhibition on skin incisional wound reepithelialization in mice: a preclinical study

    Directory of Open Access Journals (Sweden)

    Cíntia Helena Santuzzi

    2011-04-01

    Full Text Available FUNDAMENTOS: A laserterapia de baixa potência e os inibidores seletivos da ciclooxigenase-2 (ICOX2 vem sendo muito utilizados para modular a resposta inflamatória, entretanto, os seus efeitos na reepitelização de feridas não são bem compreendidos. OBJETIVO: Avaliar os efeitos isolados e combinados da laserterapia de baixa potência e da ICOX2 na reepitelização de ferida incisional na pele de camundongos. MÉTODO: Foi induzida uma ferida de 1 cm no dorso de cada camundongo, que foram divididos em quatro grupos (N=20: Controle, Laserterapia, Tratados com celecoxib e Terapia conjugada. Os animais dos grupos celecoxib e Terapia conjugada foram tratados com celecoxib por 10 dias antes da incisão cutânea. As feridas experimentais foram irradiadas com laserterapia de baixa potência He-Ne (632nm, dose: 4J/cm2 em varredura, por 12 segundos durante três dias consecutivos nos grupos Laserterapia e Terapia conjugada. Os animais foram sacrificados no 3º dia de pós-operatório. Amostras das feridas foram coletadas e coradas (Tricromio de Masson para análise histomorfométrica. RESULTADOS: Tanto o grupo Laserterapia, quanto o grupo celecoxib, mostrou aumento da reepitelização cutânea em relação ao grupo Controle, entretanto, o grupo Terapia conjugada não apresentou diferenças. Quanto à queratinização o grupo Laserterapia e Terapia conjugada apresentaram redução dos queratinócitos, comparados com o grupo Controle. CONCLUSÕES: Os resultados mostram que o uso da laserterapia de baixa potência e da ICOX2 isoladamente aumentam as células epiteliais, mas somente a laserterapia de baixa potência reduziu os queratinócitos cutâneos. O tratamento conjugado restabelece a reepitelização inata e dimunui a queratinização, embora ocorra uma acelerada contração da ferida com melhora na organização da ferida na pele de camundongos.BACKGROUND: Low level laser therapy and cyclooxygenase-2 (ICOX2 selective inhibitors have been widely used

  17. Efeito inibidor de um estímulo precedente visual em uma tarefa de tempo de reação simples.

    OpenAIRE

    Sara Agueda Fuenzalida Squella

    2007-01-01

    Estudos sobre a orientação da atenção que utilizam o procedimento de Posner têm demonstrado dois efeitos: uma facilitação inicial no processamento do estímulo que aparece no lugar para onde dirigiu-se a atenção e subsequentemente um prejuízo no processamento deste estímulo, neste local. Em um trabalho anterior não evidenciamos o efeito facilitador da orientação da atenção em uma tarefa de tempo de reação simples. Levantamos algumas hipóteses para explicar este efeito oposto. Para testarmos ta...

  18. Anti-Müllerian Hormone and Inhibin-A, but not Inhibin-B or Insulin-Like Peptide-3, may be Used as Surrogates in the Diagnosis of Polycystic Ovary Syndrome in Adolescents: Preliminary Results.

    Science.gov (United States)

    Yetim, Aylin; Yetim, Çağcıl; Baş, Firdevs; Erol, Oğuz Bülent; Çığ, Gülnaz; Uçar, Ahmet; Darendeliler, Feyza

    2016-09-01

    Polycystic ovary syndrome (PCOS) is a common endocrine problem in adolescents with an increasing prevalence of 30%. Pursuing new biomarkers with high specificity and sensitivity in the diagnosis of PCOS in adolescents is currently an active area of research. We aimed to investigate the diagnostic value of anti-Müllerian hormone (AMH), insulin-like peptide-3 (INSL3), inhibin-A (INH-A), and inhibin-B (INH-B) in adolescents with PCOS and also to determine the association, if any, between these hormones and clinical/laboratory findings related with hyperandrogenism. The study group comprised 53 adolescent girls aged between 14.5 and 20 years who were admitted to our outpatient clinic with symptoms of hirsutism and/or irregular menses and diagnosed as having PCOS in accordance with the Rotterdam criteria. Twenty-six healthy peers, eumenorrheic for at least two years and body mass index-matched, constituted the controls. Fasting blood samples for hormones [luteinizing hormone (LH), follicle-stimulating hormone (FSH), dehydroepiandrosterone-sulfate (DHEAS), androstenedione (D4-A), total/free testosterone (T/fT), sex hormone binding globulin (SHBG), AMH, INSL3, INH-A, INH-B] were drawn after an overnight fast. In the PCOS group, 83% of the subjects were oligomenorrheic/amenorrheic and 87% had hirsutism. The LH, LH/FSH ratio, total T, fT, free androgen-index (FAI), DHEAS levels were significantly higher (p=0.005, p=0.042, p=0.047, pPCOS patients as compared to the controls. Although the INSL-3 and INH-B levels showed no difference between the groups (p>0.05), AMH and INH-A levels were found to be significantly higher in the PCOS group compared to the controls (pPCOS. When AMH and INH-A were used in combination, the sensitivity (96.2%) increased. INSL3 and INH-B were not found to have diagnostic value in adolescents with PCOS. On the other hand, it was shown that INH-A could be used as a new diagnostic biomarker in addition to AMH.

  19. HIV-1 anti-retroviral drug effect on the C. albicans hyphal growth rate by a Bio-Cell Tracer system Efeito da droga anti-retroviral HIV-1 no crescimento de hifas de C. albicans monitoradas pelo sistema "Bio-Cell Tracer"

    Directory of Open Access Journals (Sweden)

    Nadja Rodrigues de Melo

    2006-09-01

    Full Text Available Declining incidence of oropharyngeal candidosis and opportunistic infections over recent years can be attributed to the use of highly active anti-retroviral therapy (HAART. Infection with C. albicans generally involves adherence and colonization of superficial tissues. During this process, budding yeasts are able to transform to hyphae and penetrate into the deep tissue. Using the biocell tracer system, C. albicans hyphal growth was dynamically observed at the cellular level. Ritonavir was effective in the inhibition of hyphal growth with growth rate of 0.8 mum/min. This study showed the in vitro effect of HIV anti-retroviral drug on the growth rate of the C. albicans hyphae.O declínio na incidência de candidose orofaríngea e infecções oportunistas associadas a infecção pelo HIV tem sido atribuído a introdução da terapia antiretroviral combinada (HAART. Infecção por C. albicans envolve aderência e colonização da mucosa superficial. Durante este processo leveduras são capazes de transformar-se na forma de hifas e penetrar nos tecidos mais profundos. Usando o sistema "Bio-Cell Tracer", o crescimento de hifas de C. albicans foi observado dinamicamente a nível celular. Ritonavir, inibidor de protease do HIV, foi efetivo na inibição do crescimento de hifas com media de 0.8 mim/min.O presente estudo demonstrou o efeito in vitro de um agente anti-retroviral HIV sobre o crescimento de hifas de C. albicans.

  20. Proteomic Analysis of Bacillus thuringiensis Strain 4.0718 at Different Growth Phases

    Directory of Open Access Journals (Sweden)

    Xiaohui Li

    2012-01-01

    Full Text Available The growth process of Bacillus thuringiensis Bt4.0718 strain was studied using proteomic technologies. The proteins of Bt whole cells at three phases—middle vegetative, early sporulation, and late sporulation—were extracted with lysis buffer, followed with separation by 2-DE and identified by MALDI-TOF/TOF MS. Bioactive factors such as insecticidal crystal proteins (ICPs including Cry1Ac(3, Cry2Aa, and BTRX28, immune inhibitor (InhA, and InhA precursor were identified. InhA started to express at the middle vegetative phase, suggesting its contribution to the survival of Bt in the host body. At the early sporulation phase, ICPs started their expression. CotJC, OppA, ORF1, and SpoIVA related to the formation of crystals and spores were identified, the expression characteristics of which ensured the stable formation of crystals and spores. This study provides an important foundation for further exploration of the stable expression of ICPs, the smooth formation of crystals, and the construction of recombinant strains.

  1. ALIENAÇÃO PARENTAL E SUAS CONSEQUÊNCIAS JURÍDICAS

    Directory of Open Access Journals (Sweden)

    Suellen Fernanda Portela

    2017-02-01

    Full Text Available O objetivo deste trabalho é analisar as consequências jurídicas advindas com a prática da Alienação Parental. A lei 12.318/2010 foi criada com o fim de garantir à criança e ao adolescente um desenvolvimento saudável em uma família devidamente estruturada, prevendo “punições” àquele que abusar do seu poder familiar ou influência sobre a criança, implantando falsas memórias sobre qualquer dos genitores, vindo a praticar com isso, o cada dia mais conhecido ato de Alienação Parental. O texto conduz a uma análise das consequências trazidas nos incisos do artigo 6º dessa lei como forma de conscientização da gravidade desse ato e como a lei se incumbe de apresentar meios inibidores para o mesmo.

  2. Efeito de agentes anti-hipertensivos sobre as células estreladas durante a regeneração hepática em ratos

    Directory of Open Access Journals (Sweden)

    Ramalho Fernando S.

    2000-01-01

    Full Text Available O efeito de um inibidor da enzima conversora da angiotensina (lisinopril, de um antagonista do receptor da angiotensina II (losartan e da bradicinina na população de células estreladas (CE durante o fenômeno regenerativo hepático foi estudado. Ratos machos Wistar receberam lisinopril, losartan, bradicinina ou solução salina em volumes proporcionais, intraperitonealmente, antes e após hepatectomia parcial a 70% (HP. Cinco animais de cada grupo experimental e controle foram sacrificados sob anestesia com éter em 36 horas após a HP. A população de CE marcadas para alfa-actina de músculo liso foi estimada nas zonas periportal e pericentral das amostras hepáticas. A população de CE foi menor no grupo tratado com losartan, e maior nos grupos tratados com bradicinina e lisinopril que no grupo controle. Estes resultados sugerem que o losartan pode inibir, e a bradicinina e o lisinopril podem estimular a população de CE durante a regeneração hepática em ratos.

  3. Criatividade no trabalho docente segundo professores de história: limites e possibilidades

    Directory of Open Access Journals (Sweden)

    Maria de Fátima Magalhães Mariani

    Full Text Available Foi objetivo do presente estudo investigar componentes da organização do trabalho pedagógico e elementos de caráter pessoal/individual que agem como inibidores e facilitadores da expressão da criatividade do professor de História. Participaram do estudo 16 professores de História de 5ª a 8ª séries do Ensino Fundamental de cinco escolas públicas e cinco escolas particulares de Brasília, Distrito Federal. Utilizou-se a entrevista semiestruturada na coleta dos dados. Realizou-se análise de conteúdo, elaborando-se categorias que abrangeram o conteúdo das respostas obtidas. Vários aspectos foram identificados como estímulos e limites à criatividade no trabalho docente. Liberdade e a paixão pelo trabalho foram os facilitadores mais enfatizados. Problemas no relacionamento professor-aluno foi um dos limites mais destacado. Este estudo contribui para desvelar aspectos que impedem a expressão criativa do professor e outros relativos a um ambiente pedagógico favorável à criatividade docente.

  4. Mutaciones asociadas con resistencia a rifampicina o isoniazida en aislamientos clínicos de M. tuberculosis de Sonora, México DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico

    Directory of Open Access Journals (Sweden)

    Enrique Bolado-Martínez

    2012-04-01

    Full Text Available OBJETIVO: Realizar el análisis de regiones específicas de genes asociados con resistencia a isoniazida o rifampicina. MATERIAL Y MÉTODOS: Se estudiaron 22 cepas de M. tuberculosis, aisladas en Sonora, México. Se utilizaron iniciadores para regiones específicas de los genes rpoB, katG e inhA y la región ahpC-oxyR. Los productos de PCR se secuenciaron y analizaron. RESULTADOS: Se identificaron mutaciones en la región promotora del gen inhA, región ahpC-oxyR, codón 315 del gen katG y codones 451 ó 456 del gen rpoB. CONCLUSIONES: La identificación de mutaciones no descritas previamente obliga a continuar el análisis genotípico de cepas aisladas en Sonora.OBJECTIVE: To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. MATERIALS AND METHODS: Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. RESULTS: Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. CONCLUSIONS: Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

  5. Angiogênese e doenças da retina Angiogenesis and retinal diseases

    Directory of Open Access Journals (Sweden)

    Francisco Max Damico

    2007-06-01

    Full Text Available Angiogênese é o processo de formação de vasos sangüíneos a partir de vasos preexistentes, que ocorre em condições fisiológicas e patológicas. É fenômeno complexo no qual participam inúmeras moléculas que estimulam e inibem a formação dos neovasos. O aumento da permeabilidade vascular e a neovascularização sub-retiniana são as causas da perda visual nas doenças proliferativas da retina, como a degeneração macular relacionada à idade e a retinopatia diabética, e o fator de crescimento do endotélio vascular ("vascular endothelial growth factor", VEGF desempenha um papel muito importante nesse processo. Existem quatro isoformas da molécula de VEGF biologicamente ativas em seres humanos, das quais o VEGF165 é a isoforma predominante no olho humano, e existem evidências de que seja a isoforma responsável pela neovascularização patogênica no olho. Além de ser potente mitógeno de células endoteliais, o VEGF aumenta a permeabilidade vascular, inibe a apoptose das células endoteliais e promove migração de precursores de células endoteliais. O VEGF não é a única molécula cuja expressão está aumentada na angiogênese patológica. O fator de crescimento de fibroblasto ("basic fibroblast growth factor", bFGF, as angiopoetinas, o fator derivado do epitélio pigmentado ("pigment epithelium-derived factor", PEDF e os fatores de adesão relacionados à matriz extracelular também exercem papel importante no balanço entre fatores pró- e antiangiogênicos. Todo o conhecimento adquirido sobre o mecanismo da angiogênese ocular patológica tem possibilitado o desenvolvimento de vários inibidores desse processo. Atualmente existem dois anticorpos anti-VEGF para uso intravítreo e outras abordagens terapêuticas do bloqueio da angiogênese ocular estão em fase de desenvolvimento. As novas drogas deverão ser armas poderosas no tratamento das principais causas de cegueira legal irreversível em indivíduos com mais de 65

  6. Doença de Crohn gastroduodenal ¾ relato de quatro casos e revisão da literatura

    Directory of Open Access Journals (Sweden)

    ABRAHÃO Jr Luiz João

    2001-01-01

    Full Text Available Racional -- A doença de Crohn pode acometer todo o tubo digestivo, porém o envolvimento gastroduodenal é classicamente descrito como raro (0,5% a 13%. Objetivos - Descrever os achados clínicos, radiológicos, endoscópicos e o tratamento de quatro pacientes com doença de de Crohn gastroduodenal e rever a literatura. Pacientes e Métodos - Quatro pacientes (um homem de 24 anos e três mulheres de 37, 66 e 74 anos com epigastralgia, emagrecimento e febre baixa foram acompanhados nos hospitais das Universidades Federais do Rio de Janeiro e Fluminense. Diarréia intermitente e artralgia/artrite estavam presentes em dois e uma paciente foi operada de urgência por síndrome de obstrução pilórica. Exames laboratoriais revelaram anemia em uma das pacientes, sendo normais nos demais. Os estudos baritados revelaram ulcerações aftóides no estômago e duodeno, assim como ulcerações em íleo terminal e deformidades em ambos. Os achados endoscópicos compreenderam úlceras aftóides e serpiginosas e lesões polipóides no antro gástrico e úlceras geográficas em duodeno. Colonoscopia foi realizada em dois pacientes, revelando ileíte ulcerada em um e pancolite ulcerada em outro. O exame histopatológico revelou processo inflamatório crônico inespecífico sem granulomas, sendo excluídas outras causas de doença granulomatosa gástrica. Instituído tratamento com prednisona e inibidores de bomba de prótons, com remissão da doença em dois pacientes e evolução para síndrome de estenose pilórica em um (submetido a gastroenteroanastomose. Conclusão - A doença de Crohn gastroduodenal possui características clínicas, terapêuticas e prognósticas distintas. O avanço da endoscopia digestiva e a adoção de novos critérios para o diagnóstico histopatológico tem demonstrado incidência maior (17 a 75% que a previamente relatada.

  7. A utilização da teoria da aprendizagem significativa no ensino da Enfermagem

    OpenAIRE

    Alana Tamar Oliveira de Sousa; Nilton Soares Formiga; Simone Helena dos Santos Oliveira; Marta Miriam Lopes Costa; Maria Júlia Guimarães Oliveira Soares

    2015-01-01

    RESUMO Objetivo: sintetizar a produção científica acerca da Teoria da Aprendizagem Significativa no processo de ensino-aprendizagem em Enfermagem. Método: revisão integrativa realizada nas bases de dados MEDLINE, LILACS, SciELO, BDENF e CINAHL, com artigos que abordaram a temática ou aspectos da teoria da aprendizagem significativa de David Ausubel. Fizeram parte da amostra dez artigos, sendo seis escritos no idioma português e quatro no inglês, publicados de 1998 a 2013. Resultados: cinco...

  8. Publicidade e ética: um estudo da construção da imagem da mulher

    Directory of Open Access Journals (Sweden)

    Elizabeth Moraes Gonçalves

    2010-02-01

    Full Text Available O texto propõe uma reflexão sobre a ética da responsabilidade na publicidade veiculada nas revistas Claudia e Nova. Trata-se de uma pesquisa descritiva, resultante da leitura dos anúncios selecionados, subsidiada por teóricos da Análise do Discurso da linha francesa, que busca averiguar como a mulher é representada. Constatou-se que no contexto da sociedade contemporânea o retrato da mulher como sedutora ainda está presente, mesmo que em vários momentos ela apareça como protagonista de sua própria vida.

  9. Aspectos toxicológicos do bissulfito e outros agentes tóxicos sobre a síntese de glicerol-3-fosfato desidrogenase citoplasmática de levedura de panificação

    Directory of Open Access Journals (Sweden)

    E. A.L. GATTáS

    2009-01-01

    Full Text Available

    A síntese de glicerol-3-fosfato desidrogenase intracelular (EC 1.1.1.8 foi investigada a partir de fermento de panificação em cultivos submersos, contendo glicose ou glicerol como únicas fontes de carbono. Agentes inibitórios da via glicolítica, do ciclo de Krebs e da Cadeia Respiratória inibiram a síntese da enzima quando adicionados em baixas concentrações até 7,5 x 10-4 mol/L. A repressão exercida pela glicose sobre a síntese da glicerol-3-fosfato desidrogenase em meio YP-glicose foi reduzida, com a adição de produtos de fermentação e de bissulfito de sódio. Observou-se aumentos de 22-110% na síntese da enzima. Entretanto, em meio YP-glicerol, a adição de bissulfito de sódio 0,06 % (p/v reduziu a síntese da enzima em 29%, enquanto, o acetaldeído 0,012 % (v/v estimulou a síntese de glicerol-3-fosfato desidrogenase em 12%. Palavras-chave: fermento de panificação; glicerol-3-fosfato desidrogenase; inibidores.

  10. Psicofarmacologia de antidepressivos

    Directory of Open Access Journals (Sweden)

    Ricardo Alberto Moreno

    1999-05-01

    Full Text Available O advento de medicamentos antidepressivos tornou a depressão um problema médico, passível de tratamento. Nas últimas cinco décadas, a psicofarmacologia da depressão evoluiu muito e rapidamente. Os primeiros antidepressivos - os antidepressivos tricíclicos (ADTs e os inibidores da monaminooxidase (IMAOs - foram descobertos através da observação clínica. Os ADTs apresentavam boa eficácia devido à sua ação, aumentando a disponibilidade de norepinefrina e serotonina. Seu uso foi limitado em função do bloqueio de receptores de histamina, colinérgicos e alfa-adrenérgicos que acarretavam efeitos colaterais levando à baixa tolerabilidade e risco de toxicidade. Da mesma forma, o uso dos IMAOs ficava comprometido em função do risco da interação com tiramina e o risco de crises hipertensivas potencialmente fatais. A nova geração de antidepressivos é constituída por medicamentos que agem em um único neurotransmissor (como os inibidores seletivos de recaptação de serotonina ou de noradrenalina ou em múltiplos neurotransmissores/receptores, como venlafaxina, bupropion, trazodona, nefazodona e mirtazapina, sem ter como alvo outros sítios receptores cerebrais não relacionados com a depressão (tais como histamina e acetilcolina. Este artigo revisa a farmacologia dos antidepressivos, particularmente quanto ao mecanismo de ação, farmacocinética, efeitos colaterais e interações farmacológicas.Antidepressant drugs turned depression into a treatable medical problem. In the last five decades, the psychopharmacology of depression has evolved rapidly. Early antidepressants - tricyclic antidepressants (TCAs and monoamine oxidase inhibitors (MAOIs - were discovered through clinical observation. The TCAs exhibited good antidepressant efficacy due to the enhancement in serotonin and norepinephrine availability. Its use was limited because of unwanted side effects and toxicity risk related to the blockade of histaminergic, cholinergic

  11. Arquitetura da paisagem da cidade e a importância da sistematização da análise do problema projetual

    Directory of Open Access Journals (Sweden)

    Rodrigo Gonçalves dos Santos

    2007-12-01

    Full Text Available Com este artigo pretende-se levantar os conceitos próprios da atividade da Arquitetura Paisagística encarando-a como disciplina projetual e associando-a ao Design Ambiental, necessitando, assim, de linhas metodológicas específicas para apresentação de soluções coerentes aos problemas paisagísticos. Sob esta ótica, reflexões sobre o uso da vegetação no projeto dos espaços exteriores são apresentadas apontando-se uma etapa de sistematização da análise do problema de projeto, dentro da abordagem da concepção de uma metodologia projetual em arquitetura paisagística. Também foram analisadas oito vias de circulação da área central de Florianópolis, Santa Catarina, Brasil, exemplificando uma etapa de sistematização da análise do problema de projeto.

  12. O papel das proteínas da matriz extracelular e das metaloproteinases em carcinomas de cabeça e pescoço: uma atualização bibliográfica The role of matrix extracellular proteins and metalloproteinases in head and neck carcinomas: an updated review

    Directory of Open Access Journals (Sweden)

    Antonio L.A. Pereira

    2005-02-01

    Full Text Available Interações entre células neoplásicas e constituintes da matriz extracelular (MEC interferem fortemente no desenvolvimento tumoral, incluindo os localizados em cabeça e pescoço, pois influenciam a proliferação e sobrevivência celular, bem como a sua capacidade de migrar do sítio primário para outros tecidos e formar metástases. Essa migração celular é facilitada pela destruição parcial da MEC, a qual é realizada pelas metaloproteinases (MMPs, que representam uma família de mais de vinte endopeptidases, com atividade controlada pela expressão de inibidores específicos (TIMPs. Diversos estudos utilizando-se de marcadores para constituintes da MEC bem como pelas MMPs têm fornecido informações adicionais sobre o diagnóstico e prognóstico em carcinomas de cabeça e pescoço. Nesta revisão consideraremos o papel da MEC e das MMPs na progressão desses tumores, enfatizando que não somente a degradação proteolítica está envolvida neste processo, como também interações entre vários constituintes da MEC fornecem substrato para regulação e crescimento destes tumores.Interactions involving tumor cells and the extracellular matrix (ECM strongly influence tumor development, including head and neck tumors, affecting cell proliferation and survival as well as the ability to migrate beyond the original location into other tissues to form metastases. These cell migration is often facilitated by partial destruction of the surrounding ECM, which is catalyzed by matrix metalloproteinases (MMPs, a family of more than 20 endopeptidases that is controlled by regulated expression of specific inhibitors (TIMPs. Several studies of ECM and MMPs markers have provided additional diagnostic and prognostic information in head and neck carcinomas. In this review, we are considering the role of ECM and MMPs in tumor progression, emphasizing its proteolytic contributors to this process, and interactions between several members of ECM providing

  13. Hipotensão arterial em cirurgia de revascularização do miocárdio: influência dos inibidores da enzima conversora de angiotensina Hipotensión arterial en cirugía de revascularización del miocardio: influencia de los inhibidores de la enzima conversora de angiotensina Arterial hypotension in myocardial revascularization surgery: influence of angiotensin-converting enzyme inhibitors

    Directory of Open Access Journals (Sweden)

    Míriam Gomes Jordão

    2002-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Os inibidores da enzima conversora da angiotensina (IECA são drogas muito utilizadas em estados hipertensivos e insuficiência cardíaca. Seu uso prolongado pode acarretar instabilidade hemodinâmica com episódios hipotensivos durante a indução anestésica. O objetivo deste estudo é comparar a incidência de hipotensão arterial em pacientes cronicamente tratados com IECA com pacientes não tratados com IECA, quando submetidos à anestesia para cirurgia de revascularização do miocárdio. MÉTODO: Participaram do estudo 50 pacientes, estado físico ASA II, III e IV, divididos em dois grupos: Grupo 1 - pacientes tratados com IECA por mais de dois meses e Grupo 2 - pacientes que não fazem uso de IECA. Os parâmetros avaliados foram pressão arterial média (PAM, freqüência cardíaca (FC, sendo anotados os menores valores da PAM e FC verificados em diferentes períodos da anestesia, e análise do segmento ST em D II e V5. Durante a CEC, foi determinada a resistência vascular sistêmica. RESULTADOS: A incidência de hipotensão arterial em pacientes anestesiados em uso de IECA foi maior do que no grupo controle em vários períodos da anestesia, mas principalmente na indução anestésica. Neste grupo foi necessário o uso de dopamina por tempo mais prolongado. Dos 26 pacientes tratados previamente com IECA, 23% necessitaram de drogas para correção da hipotensão desde a indução até a CEC e 19,1% em outros períodos da anestesia, perfazendo um total de 42,3%. No grupo controle nenhum paciente necessitou infusão contínua de drogas para aumentar a pressão arterial sistêmica, da indução até a CEC. Porém, 21% dos pacientes deste grupo necessitaram dopamina ou araminol em um ou mais períodos da anestesia. CONCLUSÕES: Neste estudo, os pacientes tratados com IECA, por tempo prolongado, apresentam maior incidência de hipotensão arterial na indução anestésica, necessitando, com maior freqüência, de

  14. Characterization of mutations causing rifampicin and isoniazid resistance of Mycobacterium tuberculosis in Syria.

    Science.gov (United States)

    Madania, Ammar; Habous, Maya; Zarzour, Hana; Ghoury, Ifad; Hebbo, Barea

    2012-01-01

    In order to characterize mutations causing rifampicin and isoniazid resistance of M. tuberculosis in Syria, 69 rifampicin resistant (Rif(r)) and 72 isoniazid resistant (Inh(r)) isolates were screened for point mutations in hot spots of the rpoB, katG and inhA genes by DNA sequencing and real time PCR. Of 69 Rif(r) isolates, 62 (90%) had mutations in the rifampin resistance determining region (RRDR) of the rpoB gene, with codons 531 (61%), 526 (13%), and 516 (8.7%) being the most commonly mutated. We found two new mutations (Asp516Thr and Ser531Gly) described for the first time in the rpoB-RRDR in association with rifampicin resistance. Only one mutation (Ile572Phe) was found outside the rpoB-RRDR. Of 72 Inh(r) strains, 30 (41.6%) had a mutation in katGcodon315 (with Ser315Thr being the predominant alteration), and 23 (32%) harbored the inhA(-15C-->T) mutation. While the general pattern of rpoB-RRDR and katG mutations reflected those found worldwide, the prevalence of the inhA(-15C-->T mutation was above the value found in most other countries, emphasizing the great importance of testing the inhA(-15C-->T) mutation for prediction of isoniazid resistance in Syria. Sensitivity of a rapid test using real time PCR and 3'-Minor groove binder (MGB) probes in detecting Rif(r) and Inh(r) isolates was 90% and 69.4%, respectively. This demonstrates that a small set of MGB-probes can be used in real time PCR in order to detect most mutations causing resistance to rifampicin and isoniazid.

  15. [DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico].

    Science.gov (United States)

    Bolado-Martínez, Enrique; Pérez-Mendoza, Ansix; Alegría-Morquecho, Francisco Monserrat; Candia-Plata, María del Carmen; Aguayo-Verdugo, María del Rosario; Alvarez-Hernández, Gerardo

    2012-01-01

    To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

  16. AVALIAÇÃO DO TRATAMENTO REALIZADO COM O ANTIVIRAL FOSFATO DE OSELTAMIVIR (TAMIFLU® E OS EXAMES LABORATORIAIS DE PACIENTES DIAGNOSTICADOS COM GRIPE A SUBTIPO H1N1 EM UM HOSPITAL DA CIDADE DE TOLEDO – PARANÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    Kiara Regina Canzi

    2015-12-01

    Full Text Available O fosfato de oseltamivir, uma pró-droga do carboxilato de oseltamivir, é um inibidor potente e seletivo das enzimas neuraminidase. A atividade da enzima viral, neuraminidase, é importante tanto para a entrada do vírus em células não infectadas quanto para a liberação de partículas virais. O carboxilato de oseltamivir inibe a neuraminidase do vírus da gripe de ambos os tipos: Influenza A e B, impedindo a replicação do mesmo. 46 pacientes com idades entre 1 e 76 anos de idade, de ambos os sexos, internados em um Hospital na cidade de Toledo durante o período de Junho de 2009 a Janeiro de 2010, com casos confirmados ou suspeitos de gripe A subtipo H1N1. Durante o período de internamento, foi avaliado o uso do Fosfato de Oseltamivir, bem como reações adversas e tempo de uso do medicamento e os exames empregados para auxiliar o diagnóstico (Hemograma completo e a gasometria arterial. O tempo de uso do medicamento não excedeu o preconizado, o qual foi de 5 (cinco dias ininterruptos, e entre as reações adversas ou efeitos colaterais estão náusea (43,47%, cefaléia (8,69% e vômitos (17,39%. As alterações laboratoriais evidenciam leucócitos normais (média de 9.145 mL, plaquetas de 246.166 mm³, pH sanguíneo (gasometria arterial levemente ácido e PO2 (mmHg e SO2 abaixo dos valores de referência. A abordagem da infecção pelo vírus Influenza A H1N1 2009 representa desafio epidemiológico-clinico-laboratorial-terapêutico em todo o mundo. Logo, requer esforço coletivo para impedir o seu avanço e os riscos de letalidade e mortalidade incluídos em sua disseminação.

  17. A utilização da teoria da aprendizagem significativa no ensino da Enfermagem

    Directory of Open Access Journals (Sweden)

    Alana Tamar Oliveira de Sousa

    2015-08-01

    Full Text Available RESUMOObjetivo:sintetizar a produção científica acerca da Teoria da Aprendizagem Significativa no processo de ensino-aprendizagem em Enfermagem.Método:revisão integrativa realizada nas bases de dados MEDLINE, LILACS, SciELO, BDENF e CINAHL, com artigos que abordaram a temática ou aspectos da teoria da aprendizagem significativa de David Ausubel. Fizeram parte da amostra dez artigos, sendo seis escritos no idioma português e quatro no inglês, publicados de 1998 a 2013.Resultados:cinco artigos fizeram alusão à Teoria da Aprendizagem Significativa, quatro citaram Ausubel como autor dessa teoria e apenas dois seguiram a estrutura para a aplicação da teoria completamente. Há escassez de estudos sobre o tema e os que o abordam não o correlacionam com a teoria de Ausubel.Conclusão:faz-se necessário romper com a dicotomia entre teoria e prática e promover a articulação dos conteúdos com a ação, introduzindo o aluno como autor de seu próprio conhecimento.

  18. Gestões do desenvolvimento e desenvolvimentos da gestão: da unilateralidade reificada à dialogicidade da simbiose homem/natureza

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Justen

    Full Text Available Este artigo, ao situar culturalmente os fenômenos da gestão e do desenvolvimento, em sua concepção tradicional, no projeto da modernidade e ao identificar o predomínio da unilateralidade reificada na interface entre gestão e desenvolvimento - a primeira vista como instrumento técnico submisso à via clássica do segundo - almeja evidenciar as potencialidades da compreensão e da construção de alternativas, tanto para a gestão como para o desenvolvimento, a partir da ressignificação dessa interface. Para tanto, o esforço foi direcionado ao resgate do que é comum aos fenômenos da gestão e do desenvolvimento - os substratos antropológico e ecológico -, nucleados nos princípios da reciprocidade dialógica, concretizadora da condição antropológica, e da finitude, caracterizadora da condição ecológica. Ao final, são apresentadas oito potenciais contribuições advindas da exploração renovada da interface entre a gestão e o desenvolvimento. Propôs-se, ainda, a substituição da lógica instrumental da eficiência financeira, comum à concepção tradicional dos fenômenos estudados, pela lógica da simbiose dialógica homem/natureza, uma vez que, como fenômenos sociais, desenvolvimento e gestão, mediados pelo meio, também são ecológicos em sua essência.

  19. O sentido da espiritualidade na transitoriedade da vida

    Directory of Open Access Journals (Sweden)

    Isabel Cristina de Oliveira Arrieira

    Full Text Available Resumo Objetivo: Compreender o sentido da espiritualidade para a pessoa em cuidados paliativos. Métodos: Abordagem qualitativa, fundamentada na fenomenologia existencialista e referencial de Viktor Frankl. Os participantes foram nove pessoas em cuidados paliativos atendidas no domicílio. Informações coletadas por meio da observação e de entrevista realizadas no período de junho a outubro de 2014, gravadas, transcritas e transformadas em texto interpretado com a abordagem fenomenológica hermenêutica. Resultados: Surgiram as seguintes categorias: sentido de continuidade da vida; sentido de alívio do sofrimento; sentido de naturalidade da morte e sentido de valorização do viver. Conclusão: Para a integralidade da atenção faz-se necessário a inclusão da espiritualidade na prática do cuidado em saúde. A espiritualidade proporciona o encontro existencial entre a pessoa em cuidados paliativos e os profissionais que a cuidam em sua integralidade.

  20. Volatilização de amônia oriunda de ureia pastilhada com micronutrientes em ambiente controlado

    Directory of Open Access Journals (Sweden)

    Juliano Bahiense Stafanato

    2013-06-01

    Full Text Available Novas tecnologias com o intuito de minimizar as perdas de N-NH3 por volatilização devem ser desenvolvidas para aumentar a eficiência de uso do N-ureia. A incorporação de boro e cobre na ureia pode reduzir esses efeitos por meio da inibição da atividade da urease. O experimento foi conduzido em casa de vegetação, onde foram aplicados diferentes fertilizantes nitrogenados (ureia pastilhada com e sem boro e cobre, sulfato de amônio, ureia com inibidor da urease NBPT, ureia granulada e ureia revestida com boro e cobre na superfície de um Planossolo Háplico contido em bandejas (0,1 m² de área e 10 cm de profundidade, em dose equivalente a 200 kg ha-1 de N. Foram avaliadas as perdas de N-NH3 por volatilização durante 18 dias, com o auxílio de um coletor semiaberto. A adição de cobre e boro no processo de pastilhamento da ureia reduziu as perdas de amônia por volatilização em até 54 %, quando comparado com a ureia granulada comercial, comprovando ser eficiente contra as perdas de N-NH3 por volatilização.

  1. Processos da construção da Política Nacional de Promoção da Saúde

    Directory of Open Access Journals (Sweden)

    João Leite Ferreira Neto

    2013-10-01

    Full Text Available Investigou-se os processos de construção da Política Nacional de Promoção da Saúde (PNPS, pela análise de três documentos produzidos pelo Ministério da Saúde entre 2002 e 2005 e do texto final da PNPS. Foram entrevistados cinco sujeitos que participaram da construção da PNPS, dos quais três eram gestores do Ministério da Saúde e dois pesquisadores. Os documentos foram explorados com a Análise do Discurso. O artigo contribui para aprofundar os debates sobre o processo de construção da PNPS. A promoção da saúde revelou seus antagonismos, o que motivou a demora de sua aprovação final. A indução internacional via financiamento demonstrou ser o elemento crucial para a definição da forma final da PNPS, trazendo de volta a criticada ênfase na mudança de estilos de vida em suas "Ações". Destaca-se o processo de produção negociada de consenso, que culminou com a criação do Comitê Gestor da PNPS, com a participação de diversos subsetores, estrutura inovadora no Ministério da Saúde.

  2. Depressão e diabetes mellitus Depression and diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Renério Fráguas

    2009-01-01

    Full Text Available O diabetes mellitus possui elevada prevalência, acometendo cerca de 7% da população brasileira. Em torno de 20% a 30% dos pacientes com diabetes apresentam depressão. A depressão pode atuar como um fator de risco para o desenvolvimento do diabetes, piorar seus sintomas e interferir com o autocuidado dos pacientes. Quando não tratada adequadamente, a depressão nesses pacientes tende a evoluir com elevada taxa de recorrência. Entre os tratamentos disponíveis, encontramos na literatura um benefício da psicoterapia, cognitiva ou cognitivo-comportamental, para melhora dos sintomas depressivos, mas sem evidência de um benefício no controle glicêmico. Os antidepressivos tricíclicos, em especial os com maior ação noradrenérgica, e os inibidores da monoaminoxidase (IMAOs tendem a aumentar os níveis glicêmicos. A bupropiona não interfere na glicemia e há evidências de que os inibidores seletivos de recaptura de serotonina (ISRS melhoram os níveis glicêmicos e podem reduzir a taxa de recaídas, mostrando-se boas opções de tratamento farmacológico. A eletroconvulsoterapia também é uma estratégia interessante para esses pacientes, recomendando-se, no entanto, monitorização da glicemia. Não foram encontrados estudos significativos sobre os demais antidepressivos disponíveis para comercialização.Diabetes mellitus has an estimated prevalence of 7% among Brazilian population. Around 20% to 30% of these patients have a depressive disorder. Depression can work as risk factor to the development of diabetes, can worse its symptoms and interfere with self-care. When not adequately treated, depressive disorder in these patients tends to have high rates of recurrence. Among the available treatments literature shows a benefit of psychotherapy, mainly cognitive or cognitive-behavioral, in ameliorating depressive symptoms, but without impact on glycaemic control. Tryciclic antidepressants, especially those with more noradrenergic

  3. Superação de dormência em sementes de beterraba por meio de imersão em água corrente Overcoming beetroot seeds dormancy through immersion in running water

    Directory of Open Access Journals (Sweden)

    Josué B. da Silva

    2005-12-01

    Full Text Available A presença de inibidores de germinação no fruto da beterraba pode comprometer o estande da cultura. O presente trabalho objetivou avaliar a interferência do período de imersão em água corrente no desempenho fisiológico das sementes de beterraba. Para tanto, sementes da cultivar Top Tall Early Wonder foram submetidas à ação de água corrente durante 0 (testemunha, 1; 1,5; 2; 3; 4; 5 e 6 horas, secadas e avaliadas pelo teste de germinação. A lavagem por duas horas foi suficiente para aumentar a germinação das sementes.The presence of germination inhibitors in the fruit of beetroot can reduce the stand of crop. The present work aimed to evaluate the interference of immersion period in running water in the physiological performance of the beetroot seeds. Seeds from cultivar Top Tall Early Wonder were submitted to the action of running water during 0 (control, 1; 1,5; 2; 3; 4; 5 and 6 hours, dried and physiologically evaluated using germination test. Washing the seeds during two hours was enough to increase the germination.

  4. Teoria da adequação econômica da conduta: significado econômico da conduta em face da tutela penal antitruste

    OpenAIRE

    Luiz da Silva, Ivan

    2009-01-01

    Essa tese tem por objetivo o desenvolvimento da teoria da adequação econômica da conduta no direito penal econômico. Vale-se de uma abordagem interdisciplinar abrangendo a Economia, o direito econômico e o direito penal. Para alcançar o desiderato a investigação analisou a intervenção do direito penal em face da atividade econômica e, em especial, os fundamentos da tutela penal antitruste, para fins de estabelecer os contornos teóricos necessários à aplicação das premissas fund...

  5. Ocorrência da ferrugem da videira em Minas Gerais

    Directory of Open Access Journals (Sweden)

    Adelica Aparecida Xavier

    2012-03-01

    Full Text Available A ferrugem da videira causada por Phakopsora euvitis Ono constitui-se numa ameaça às regiões produtoras de uva em função do potencial destrutivo da planta. A doença foi detectada no Brasil, pela primeira vez, em 2001. Atualmente, ela ocorre no Paraná, Mato Grosso do Sul, São Paulo, Rio Grande do Sul, Mato Grosso, Roraima, Espírito Santo e Santa Catarina. Em abril de 2010, observaram-se na estação experimental da Unimontes, Janaúba, Minas Gerais, plantas da cv. Niágara rosada com sintomas típicos da doença. A análise dos sintomas e a caracterização dos urediniósporos sésseis, levemente equinulados, com formato oval, ou elipsoide formado em urédias subepidérmicas na origem, inrompentes e com paráfises circundantes dorsalmente, levaram à diagnose de Phakopsora euvitis como o agente causal da doença. Este é o primeiro relato da doença no Estado de Minas Gerais.

  6. A CPMI da Violência Contra a Mulher e a Implementação da Lei Maria Da Penha

    Directory of Open Access Journals (Sweden)

    Carmen Hein de Campos

    2015-05-01

    Full Text Available Este artigo analisa as conclusões da Comissão Parlamentar Mista de Inquérito da Violência contra a Mulher, criada pelo Congresso Nacional Brasileiro em 2012, no que tange à aplicação da Lei Maria da Penha. Após um ano e meio de trabalho, o relatório da CPMI apontou a fragilidade das políticas públicas de enfrentamento à violência contra mulheres e os obstáculos na implementação da Lei Maria da Penha, dentre os quais, destacam-se: a precariedade da rede de serviços e o reduzido número de juizados especializados em atendimento às mulheres em situação de violência doméstica e familiar; o descumprimento da decisão do Supremo Tribunal Federal que proíbe a aplicação da suspensão condicional do processo; a resistência de operadores/as do direito em entender a proposta da nova lei e romper com a lógica familista e o insuficiente orçamento para o desenvolvimento e a manutenção das políticas públicas de enfrentamento a essas situações de violência. A análise do relatório da CPMI permite concluir que os estados brasileiros investem muito pouco em políticas públicas específicas e que a implementação integral da Lei Maria da Penha depende de uma nova compreensão jurídica, da articulação entre os poderes públicos e de uma política orçamentária de gênero.

  7. A PROBLEMÁTICA DA BIOPIRATARIA: REFLEXÕES A PARTIR DA GEOPOLÍTICA E DOS DIREITOS DA SOCIOBIODIVERSIDADE

    OpenAIRE

    Nunes, Denise Silva; UFSM; Tybusch, Jerônimo Siqueira; UFSM

    2013-01-01

    O bioimperialismo configura-se como uma característica da geopolítica da atualidade, com alicerces nas estruturas da globalização e do capitalismo. Nesse contexto, a problemática da pesquisa consiste na violação dos direitos dos povos locais e a exploração do meio ambiente, em que o atual sistema internacional de propriedade intelectual contribui para a biopirataria dos recursos naturais, por meio da infiltração, em áreas ricas em diversidade biológica, das grandes corporações, multinacionais...

  8. A dignidade da pessoa humana na doutrina social da igreja

    Directory of Open Access Journals (Sweden)

    Manzone, Gianni

    2010-01-01

    Full Text Available O texto faz uma análise panorâmica sobre a compreensão da dignidade humana nos diversos textos da Doutrina Social da Igreja, mostrando o entendimento da mesma nos diversos documentos dos Papas, notadamente Leão XII, Pio XI, Pio XII e João Paulo II, além de apontar aspectos históricos e culturais que influenciaram cada pronunciamento, o que foi determinante para a evolução do pensamento do Magistério na questão social. O ponto de partida é a visão antropológica da Doutrina Social da Igreja, resumida em termos de “homem criado por Deus a sua imagem e resgatado pelo sangue de Jesus Cristo” (Sollicitudo Rei Socialis 29. A partir daí, há a defesa do primado do ser humano sobre o social e reivindicações totalitaristas que perpassaram a história recente da humanidade, embora a pessoa seja sempre um ser-em-relação e situado em uma sociedade determinada

  9. Sustitución de lardo por grasa vegetal en salchichas: incorporación de pasta de aguacate. Efecto de la inhibición del oscurecimiento enzimático sobre el color Substituição do toucinho por gordura vegetal em salsichas: adição da pasta de abacate. Efeito da inibição do escurecimiento enzimatico na cor

    Directory of Open Access Journals (Sweden)

    Ubaldo Rueda-Lugo

    2006-06-01

    Full Text Available La sustitución de grasa animal es importante para mejorar la calidad nutricional de los alimentos de origen animal. Tradicionalmente, los embutidos contienen cantidades relativamente altas de grasas insaturadas, por lo que se ha buscado la sustitución parcial o total de estas con grasas o aceites de origen vegetal. El aprovechamiento del aguacate como fuente de grasa vegetal es una alternativa para este tipo de productos. La oxidación de este fruto es uno de los principales problemas durante la industrialización. En este trabajo se han añadido dos inhibidores del oscurecimiento enzimático, ácido ascórbico y eritorbato de sodio, para determinar el efecto de éstos sobre el color de salchichas de cerdo. Se han encontrado diferencias en la luminosidad de las muestras con respecto al tratamiento control, además de que este mismo parámetro se ha reducido con el tiempo de almacenamiento. No ha habido efecto significativo de los antioxidantes sobre las otras componentes del color. El uso de eritorbato de sodio en la elaboración de pasta de aguacate ha reducido el oscurecimiento de la pasta durante su congelación, sin afectar mayormente otros parámetros de color del producto terminado. La aceptación del producto por un grupo de consumidores ha sido aceptable.A substituição da gordura animal ou toucinho é importante para melhorar a qualidade nutricional dos alimentos de origem animal. Tradicionalmente, os embutidos contêm quantidades relativamente elevadas de gorduras insaturadas, e a substituição parcial ou total com gordura vegetal ou óleo é desejável. O abacate é fonte de gordura vegetal como uma alternativa para este tipo de produto. A oxidação desta fruta é um dos problemas principais durante a industrialização. Neste trabalho foram adicionados dois inibidores de escurecimento enzimatico, ácido ascórbico e eritorbato do sódio, para determinar o efeito destes na cor das salsichas. As diferenças na luminosidade das

  10. As causas imediatas do crescimento da renda, da redução da desigualdade e da queda da extrema pobreza na Bahia, no Nordeste e no Brasil entre 2003 e 2011

    OpenAIRE

    de Souza, Pedro H. G. F.

    2013-01-01

    O objetivo deste trabalho é explicar as causas imediatas do crescimento da renda domiciliar per capita, da redução da desigualdade e da queda da extrema pobreza para cinco recortes geográficos – Brasil, Nordeste, Bahia, Região Metropolitana (RM) de Salvador e Bahia não metropolitana – durante o período recente de crescimento pró-pobre (2003-2011). Com base em decomposições dinâmicas dos três aspectos, este texto procura verificar se as mudanças dos últimos anos seguem ou não um mesmo padrão g...

  11. Evapotranspiração da cultura da cebola

    Directory of Open Access Journals (Sweden)

    G. M. Oliveira

    2015-10-01

    Full Text Available A determinação da quantidade de água necessária para as culturas é um dos principais fatores para o correto planejamento, dimensionamento e manejo de qualquer sistema de irrigação. O presente trabalho teve como objetivo, comparar medida da evapotranspiração da cultura (ETc da cebola com estimativa obtida a partir da evapotranspiração de referência (ETo determinada por diferentes métodos e Kc proposto na literatura. O experimento foi conduzido no campo experimental do Departamento de Tecnologia e Ciências Sociais da Universidade do Estado da Bahia - UNEB, em Juazeiro, no período de junho a setembro de 2011. As medidas da ETc foram obtidas em evapotranspirômetros e as estimativas, a partir de ETo determinada pelos métodos: Penman-Monteith (padrão FAO, Penman-Monteith modificado por Villa Nova et al. (2004, Hargreaves & Samani, Makkink e Jensen & Haise e Kc proposto por Marouelli et al. (2005, para a cultura da cebola. É fundamental a avaliação de métodos de estimativa da evapotranspiração de referência antes de sua aplicação, pois erros consideráveis podem ser cometidos na determinação da quantidade de água a ser aplicada a uma cultura, o que repercutirá certamente, na produtividade.Evapotranspiration crop onionAbstract: The determination of the amount of water needed for crops is a major factor for the correct planning, sizing and management of any irrigation system. This study aimed to compare measure of crop evapotranspiration (ETc onion with estimates obtained from the reference evapotranspiration (ETo determined by different methods and Kc proposed in the literature. The experiment was conducted in the experimental field of the Department of Technology and Social Sciences, University of the State of Bahia, in Juazeiro, from June to September 2011. The ETc measurements were obtained in evapotranspirometers and estimates, from ETo determined by the methods: Penman-Monteith (FAO standard, Penman-Monteith modified

  12. 76 FR 27861 - Airworthiness Directives; Diamond Aircraft Industries GmbH Models DA 42, DA 42 NG, and DA 42 M-NG...

    Science.gov (United States)

    2011-05-13

    ... Airworthiness Directives; Diamond Aircraft Industries GmbH Models DA 42, DA 42 NG, and DA 42 M-NG Airplanes... on Diamond aeroplanes, the majority of which were DA 40. In additional, at least 18 doors have been... conditions) while the aeroplane was parked. All DA 40 and DA 42 aeroplanes have a system installed that...

  13. Sarcoma da Artéria Pulmonar — dificuldades diagnósticas e terapêuticas

    Directory of Open Access Journals (Sweden)

    Sofia Neves

    2003-01-01

    Full Text Available RESUMO: O Sarcoma da Artéria Pulmonar é um tumor raro, apresentando-se com sinais e sintomas inespecíficos, simulando por vezes o Tromboembolismo Pulmonar (TEP, o que torna o seu diagnóstico difícil e tardio.A este propósito os autores apresentam um caso de um homem de 59 anos, ex-fumador, internado por dispneia de esforço, toracalgia e sintomas gerais.Portador de uma radiografia e TAC torácicas, ambas evidenciando imagens sugestivas de Trombose da Artéria Pulmonar Direita.Analiticamente e antes de qualquer terapêutica: Inibidor Lúpico ↑ e anticardiolipina IgM +.Presumido diagnóstico inicial de TEP crónico em doente com provável Síndroma de Hipercoaguabilidade, iniciou terapêutica hipocoagulante, com melhoria.Reinternado 2 meses após alta por agravamento clínico e radiológico. Proposto e aceite para Tromboendarterectomia Pulmonar, sob circulação extracorporal e paragem cardiocirculatória em hipotermia profunda (18 ºC. Durante a cirurgia constatou-se a presença de «mega-artérias pulmonares» preenchidas por massa trombosada que se estendia às ramificações arteriais segmentares. Após a exérese dessa massa houve necessidade de realizar Pneumectomia direita por hemorragia progressiva incontrolável.Veio a falecer ao 7.º dia de pós-operatório, por ARDS em pulmão único.Resultado Anatomopatológico: Sarcoma da Artéria Pulmonar com Metastização Pulmonar e Pleural.REV PORT PNEUMOL IX (1: 41-51 ABSTRACT: Primary Pulmonary Artery Sarcoma is a rare entity, which shares some clinical features with Thromboembolic Pulmonary Disease (TEPD, complicating differential diagnosis.The authors report a Clinical Case of a Primary Pulmonary Artery Sarcoma in a 59 years old man, admitted with a history of dyspnoea on exertion, chest pain and general symptoms. Chest X-ray, Computed Tomography Scan, Angiographies and Magnetic Resonance Imaging

  14. SOBRE OS FUNDAMENTOS DA ARQUITETURA DA INFORMAÇÃO

    Directory of Open Access Journals (Sweden)

    Alfram Roberto Rodrigues de Albuquerque

    2011-10-01

    Full Text Available Expõe-se o estado atual da disciplina Arquitetura da Informação quanto a problemática terminológica da definição do campo de estudo, apresentando-se argumentos para uma definição de Arquitetura da Informação de uma forma ampla na qual os usos correntes dessa expressão sejam vistos como especializações. Defende-se uma definição com a utilização de um conjunto de propriedades mínimas cujas interações levam a uma terminologia formal e cuja abstração leva a uma definição formal do conceito que emprega a linguagem de morfismos da Teoria das Categorias. Trata-se de um recorte de alguns dos resultados obtidos na tese de doutoramento de um dos autores, defendida em setembro de 2010. O contexto da pesquisa é exposto e alguns dos resultados obtidos são delineados.

  15. 76 FR 12627 - Airworthiness Directives; Diamond Aircraft Industries GmbH Models DA 42, DA 42 NG, and DA 42 M-NG...

    Science.gov (United States)

    2011-03-08

    ... Industries GmbH Models DA 42, DA 42 NG, and DA 42 M-NG Airplanes AGENCY: Federal Aviation Administration (FAA... on Diamond aeroplanes, the majority of which were DA 40. In additional, at least 18 doors have been... conditions) while the aeroplane was parked. All DA 40 and DA 42 aeroplanes have a system installed that...

  16. Adaptação de um sistema de ensaio biológico para detecção de fatores relaxantes endoteliais derivados do endocárdio atrial canino Adaptation of bioassay to detect endothelium-derived relaxing factors from the canine atrial endocardium

    Directory of Open Access Journals (Sweden)

    Yeow Leng Chua

    2009-06-01

    Full Text Available OBJETIVO: Estudar a liberação de fatores relaxantes derivados do endotélio (EDRF pelo endocárdio de aurículas de corações caninos. MÉTODOS: Aurículas atriais caninas foram suturadas em forma de tubos e o efluente desses tubos foram submetidos a ensaios biológicos (sistema de perfusão isolada em câmaras de órgãos utilizando artéria coronária canina, para a detecção de EDRFs. RESULTADOS: O efluente da aurícula direita promoveu relaxamento de 58,4 + 10,1% e da aurícula esquerda 74,9 + 8,5% da contração inicial obtida pela ação da prostagladina F2α em artéria coronária. Não houve diferença estatística no relaxamento da artéria coronária induzido pelos efluentes das aurículas direita e esquerda. O relaxamento induzido pelos efluentes das aurículas direita e esquerda foi abolido pelo tratamento das mesmas com Triton X-100. O tratamento das aurículas com L-NMMA, um inibidor competitivo da síntese de óxido nítrico, e com indometacina, um inibidor da via da ciclooxigenase, promoveu redução no relaxamento da artéria coronária induzido pelo efluente auricular, indicando que o endotélio endocárdico libera óxido nítrico e prostanóides. CONCLUSÕES: Esse estudo demonstra, pela primeira vez, a liberação luminal in vitro de EDRF e prostaciclina pelo átrio de coração canino. A habilidade do endotélio endocárdico em produzir esses fatores pode ter um papel importante na prevenção da formação de trombos nas câmaras cardíacas.OBJECTIVE: The aim of this study was to assess the release of endothelium-derived relaxing factors from the endocardium of canine atrial appendage. METHODS: To study the release of endothelium-derived relaxing factor (EDRF from intact atrial endocardial endothelium, tube-shaped sutures of canine atrial appendages were performed and effluents from these tubes were bioassayed (isolated perfused organ chamber system for detection of EDRF in canine coronary artery. RESULTS: Effluent from

  17. A inclusão da subjetividade no ensino da Psicopatologia

    Directory of Open Access Journals (Sweden)

    Octavio Domont de Serpa Junior

    2007-08-01

    Full Text Available O estudo da Psicopatologia tem sido freqüentemente apresentado em sua dimensão descritiva. Apesar da relevância para o ensino - auxiliar o aluno a reconhecer a dimensão sintomatológica dos quadros psicopatológicos -, exclui a dimensão subjetiva da experiência do adoecimento e seus aspectos relacionais. Partindo da tradição antropológico-existencial, apresentamos uma experiência de ensino de Psicopatologia que considera tais dimensões relevantes para a compreensão do sofrimento mental. Trabalhando com estudo de caso descritivo, são apresentadas duas novas modalidades de práticas na disciplina Psicopatologia Especial I, oferecida para alunos do curso de Psicologia da UFRJ. A proposta é ampliar o ensino prático, tradicionalmente centrado no modelo da extensa entrevista clínica, realizada diante de um grande grupo de alunos que a tudo assistem passivamente. Pretendemos aproximar o ensino e a prática da Psicopatologia dos ideais da Reforma Psiquiátrica Brasileira, que concebe o adoecimento mental como fenômeno complexo, envolvendo a relação do sujeito com o mundo.

  18. Autocorrelation descriptor improvements for QSAR: 2DA_Sign and 3DA_Sign

    Science.gov (United States)

    Sliwoski, Gregory; Mendenhall, Jeffrey; Meiler, Jens

    2016-03-01

    Quantitative structure-activity relationship (QSAR) is a branch of computer aided drug discovery that relates chemical structures to biological activity. Two well established and related QSAR descriptors are two- and three-dimensional autocorrelation (2DA and 3DA). These descriptors encode the relative position of atoms or atom properties by calculating the separation between atom pairs in terms of number of bonds (2DA) or Euclidean distance (3DA). The sums of all values computed for a given small molecule are collected in a histogram. Atom properties can be added with a coefficient that is the product of atom properties for each pair. This procedure can lead to information loss when signed atom properties are considered such as partial charge. For example, the product of two positive charges is indistinguishable from the product of two equivalent negative charges. In this paper, we present variations of 2DA and 3DA called 2DA_Sign and 3DA_Sign that avoid information loss by splitting unique sign pairs into individual histograms. We evaluate these variations with models trained on nine datasets spanning a range of drug target classes. Both 2DA_Sign and 3DA_Sign significantly increase model performance across all datasets when compared with traditional 2DA and 3DA. Lastly, we find that limiting 3DA_Sign to maximum atom pair distances of 6 Å instead of 12 Å further increases model performance, suggesting that conformational flexibility may hinder performance with longer 3DA descriptors. Consistent with this finding, limiting the number of bonds in 2DA_Sign from 11 to 5 fails to improve performance.

  19. Parâmetros erosividade da chuva, da enxurrada e da chuva-enxurrada correlacionados com as perdas de solo de um luvissolo

    Directory of Open Access Journals (Sweden)

    A. W. Albuquerque

    2002-09-01

    Full Text Available Foram estudadas as correlações lineares simples, múltiplas e não-lineares entre os parâmetros erosividade da chuva, da enxurrada e da chuva-enxurrada e as perdas de solo provocadas por chuvas erosivas num Luvissolo. Os dados correspondentes ao período de 1986-1990 foram obtidos na estação experimental de Sumé (PB, pertencente à Universidade Federal da Paraíba - UFPB. Para determinar os parâmetros erosividade da chuva, da enxurrada e da chuva-enxurrada, foram analisadas chuvas individuais registradas em 136 pluviogramas. O volume de enxurrada isolado ou em combinação com características da chuva contribuiu, de forma significativa, para melhorar a estimativa das perdas de solo de chuvas individuais. Os parâmetros erosividade da chuva-enxurrada a(Vu α I30b; a(Vu α I5b; a(EIAb e da enxurrada a(Vub foram os melhores estimadores das perdas de solo para chuvas individuais. Dentre os parâmetros da erosividade da chuva, os que melhor se correlacionaram com as perdas de solo foram aqueles que incluíram o produto do volume da chuva pela intensidade máxima em trinta minutos a(VrI30.

  20. CONTRIBUIÇÃO PARA O CONHECIMENTO DA GEOMORFOLOGIA DA CADEIA DA ARRÁBIDA (PORTUGAL: CARTOGRAFIA GEOMORFOLÓGICA E GEOMORFOMETRIA

    Directory of Open Access Journals (Sweden)

    André Filipe Fonseca

    2015-03-01

    Full Text Available A cadeia da Arrábida resulta da interação de processos tectónicos e erosivos ao longo de um período de tempo alargado, situado entre o Miocénico médio e a atualidade. O desmantelamento da cadeia processou-se em função da componente de movimentação tectónica, da posição da linha de costa e dos processos erosivos a ela associados, desempenhando a rede hidrográfica um papel fundamental no restabelecimento do equilíbrio dinâmico entre processos endógenos e exógenos. Esta relação está expressa no escalonamento altitudinal de formas erosivas aplanadas e suspensas sobre a rede de drenagem atual, evidenciando uma evolução policíclica do relevo controlada pelo levantamento da Serra da Arrábida, pela subsidência do Sinclinal de Albufeira e pelas oscilações do nível do mar no decorrer do período plio-quaternário. Sobrepõe-se a este processo o rejogo vertical de falhas de orientação NNE-SSW a NE-SW evidenciando um aumento progressivo da deformação de oeste para leste. O presente trabalho pretende contribuir para o conhecimento da geomorfologia da cadeia da Arrábida recorrendo a técnicas de geomorfometria para a extração semiautomática e análise de formas de relevo. Dado o contexto morfotectónico, é dada particular atenção à interferência da tectónica na evolução do relevo.

  1. O uso da aromaterapia na melhora da autoestima

    Directory of Open Access Journals (Sweden)

    Juliana Rizzo Gnatta

    2011-10-01

    Full Text Available Os objetivos deste estudo foram verificar se a inalação dos óleos essenciais de rosa e de ylang-ylang alteram a percepção da autoestima e comparar a eficácia dos mesmos. O projeto foi aprovado pelo Comitê de Ética em Pesquisa do Hospital da Universidade de São Paulo. Participaram 43 funcionários dos setores de Higienização e da Central de Materiais e Esterilização durante os meses de maio a julho de 2009. Os sujeitos foram randomizados em três grupos: dois que receberem os óleos essenciais e outro que recebeu placebo (essência de rosa. A avaliação da autoestima foi feita através de uma escala já validada no Brasil, sendo aplicada antes do uso dos aromas, depois de 30 dias de uso e ao completar 60 dias. Dentre os resultados, verificou-se que a amostra era constituída por 88,6% de indivíduos com média e alta autoestima e que os óleos essenciais em questão não alteraram de forma significativa a percepção da autoestima.

  2. Da onda da gestão da qualidade a uma filosofia da qualidade da gestão: Balanced Scorecard promovendo mudanças

    Directory of Open Access Journals (Sweden)

    Andréa Cavalcanti Correia Lima

    2004-06-01

    Full Text Available No final da década de 80 a Gestão da Qualidade Total (GQT era apresentada como capaz de resolver todos os problemas e atender a todas as necessidades da gestão das organizações. Buscando solucionar problemas de gestão não equacionados pela GQT, muitas organizações começam a adotar o Balanced Scorecard (BSC. Uma questão ainda não discutida com profundidade no mundo acadêmico é a viabilidade de integração desses dois modelos. O presente artigo discute a possibilidade de integração dessas duas ferramentas, verificando as melhorias que podem alcançar, principalmente no gerenciamento da estratégia da organização. Assim sendo, realizou-se estudo de caso no Caesar Park Hotel Fortaleza (CPHF, empresa que vêm adotando com sucesso os dois modelos. A pesquisa revela que é possível integrar os princípios da GQT com os do BSC, à medida que os fundamentos de ambos se complementam, sendo assim a utilização conjunta das ferramentas propicia melhor gerenciamento da estratégia da organização.In recent years, many organizations have been managed according to the principles of Total Quality Management (TQM, which became known around the globe in the 1980's, when looking for explanations for the so-called "Japanese miracle". TQM was presented as being capable of solving all problems and attending to all company management needs, a stage that seems outdated now. In the search for a model that would allow them to analyze and follow up the implementation of organizational strategies, without remaining limited to Quality indicators, many companies started to adopt the Balanced Scorecard (BSC. Companies using TQM question whether it is viable together with the BSC. In order to contribute to a solution to this question, this article discusses the possibility of aligning these two tools. Therefore, a case study was carried out at the Caesar Park Hotel Fortaleza, a company that implanted TQM in 1997 and started to adopt the BSC in 2000. The

  3. Proteção funcional da enzima heme-oxigenase-1 na lesão renal aguda isquêmica e tóxica Protección funcional de la enzima heme-oxigenasa-1 en la lesión renal aguda isquémica y tóxica Functional protection of heme-oxygenase-1 enzyme in ischemic and toxic acute kidney injury

    Directory of Open Access Journals (Sweden)

    Cassiane Dezoti

    2009-01-01

    Full Text Available OBJETIVOS: Verificar a proteção funcional da heme-oxigenase (HO-1, por meio do uso do seu indutor (Hemin e seu inibidor químico (protoporfirina de zinco-ZnPP na lesão renal aguda isquêmica e tóxica pela Polimixina B (PmxB em ratos. MATERIAL: Foram utilizados ratos Wistar, adultos e machos divididos em 8 grupos: SHAM (controle, Isquemia (Isq, Isq+Hemin (indutor de HO-1, Isq+ZnPP (inibidor de HO-1, SALINA (controle, Polimixina B (PmxB, PmxB+Hemin, PmxB+ZnPP. MÉTODOS: Jaffé (clearance de creatinina, Clcr e FOX-2 (peróxidos urinários. RESULTADOS: A isquemia (30´ dos pedículos reais e a administração de PmxB reduziu o Clcr com manutenção do fluxo urinário. Os peróxidos urinários se elevaram em ambas as lesões. A administração do Indutor de HO-1 determinou melhora da função renal e redução dos níveis de peróxidos urinários. CONCLUSÃO: Os resultados deste estudo demonstraram que a isquemia e a PmxB induzem LRA oxidativa. O indutor de HO-1 atenuou a lesão em ambos os modelos por atenuação do mecanismo redox.OBJETIVOS: Verificar la protección funcional de la heme-oxigenasa (HO-1, por medio del uso de su inductor (Hemin y su inhibidor químico (protoporfirina de zinc-ZnPP en la lesión renal aguda isquémica y tóxica producida por la Polimixina B (PmxB en ratas. MATERIAL: Fueron utilizadas ratas Wistar, adultas y machos divididos en 8 grupos: SHAM (control, Isquemia (Isq, Isq+Hemin (indutor de HO-1, Isq+ZnPP (inibidor de HO-1, SALINA (control, Polimixina B (PmxB, PmxB+Hemin, PmxB+ZnPP. MÉTODOS: Jaffé (clearance de creatinina, Clcr y FOX-2 (peróxidos urinarios. RESULTADOS: La isquemia (30´ de los pedículos reales y la administración de PmxB redujo el Clcr con manutención del flujo urinario. Los peróxidos urinarios se elevaron en ambas lesiones. La administración del Inductor de HO-1 determinó mejora de la función renal y reducción de los niveles de peróxidos urinarios. CONCLUSIÓN: Los resultados de este

  4. A Lei Maria da Penha sob a perspectiva da ética da vingança / Maria da Penha law unde the ethics of revenge approach

    OpenAIRE

    Nunes, Thaísa Silva de Oliveira; Faculdade de Direito de Vitória

    2011-01-01

    RESUMO: Analisa-se a lei 11.340/2006, conhecida como Lei Maria da Penha, sob a perspectiva da ética da vingança, considerando-se a situação de seu uso de forma equivocada. Nesse sentido, argui-se que o judiciário deve tomar um cuidado maior ao julgar casos de violência doméstica. Aborda-se também a possibilidade de uma mulher abandonada ou ultrajada pelo seu companheiro reagir de forma a resgatar a confiança em si, ao invés de se utilizar da prática da vingança permitida pelos mecanismos jurí...

  5. A RELAÇÃO DA TELEVISÃO E DA INTERNET COM O CONSUMO: ANÁLISES DA IDEOLOGIA E DA CULTURA NAS PROPAGANDAS

    Directory of Open Access Journals (Sweden)

    Fábio Carlos Rodrigues Alves

    2016-10-01

    Full Text Available Mais que um meio de comunicação, as tecnologias da comunicação, em especial a TV, transmitem valores, ideias e atitudes, ou seja, todo um conteúdo atitudinal e procedimental. O presente texto discute o papel da mídia televisiva e da internet na transmissão de valores culturais, atendo-se principalmente na questão do consumo. Analisamos propagandas oriundas do ambiente televisivo e também a veiculada pela internet a partir da qual objetivamos, à luz do conceito de Cultura e Ideologia investigar e assinalar o condicionamento dos consumidores ao ato de consumo.

  6. Revisão sobre alterações hemostáticas na doença hipertensiva específica da gravidez (DHEG Hemostatic changes revision in preeclampsia

    Directory of Open Access Journals (Sweden)

    Luci Maria Sant'Ana Dusse

    2001-01-01

    Full Text Available A doença hipertensiva específica da gravidez (DHEG, na sua forma pura, caracteriza-se pelo aparecimento, em grávida normotensa, após a vigésima semana de gestação, da tríade sintomática: hipertensão, proteinúria e edema. Nessa doença, não ocorrem as alterações hemodinâmicas observadas na gravidez normal, que incluem ajustes na fisiologia renal e cardiovascular. A manifestação mais característica da DHEG é uma vasoconstrição arteriolar acentuada, que acarreta um aumento da resistência vascular periférica e tem como conseqüência imediata o aparecimento da hipertensão. Evidências de aumento do consumo plaquetário e de disfunção das células endoteliais têm sido observadas na DHEG. Conclusões conflitantes com relação ao sistema fibrinolítico foram obtidas, onde um aumento, diminuição ou inalteração da função desse sistema em gestantes com DHEG, comparando-se à gestantes normais, foram relatados. Considerando-se que o diagnóstico da DHEG é essencialmente clínico e, muitas vezes, difícil de ser estabelecido, inúmeros têm sido os esforços para se determinar parâmetros hemostáticos que tenham um valor preditivo no diagnóstico e prognóstico da doença. Nesse sentido, a contagem de plaquetas, a determinação da trombomodulina, do complexo trombina-antitrombina III e do inibidor do ativador do plasminogênio tipo 2 foram propostas como parâmetros auxiliares para o diagnóstico da doença. No entanto há ainda muita controvérsia quanto à utilidade desses possíveis marcadores laboratoriais, e nenhum deles é plenamente aceito. Recentemente, foi sugerida uma associação entre a ocorrência de complicações da gravidez, incluindo-se a DHEG, e a presença de mutações genéticas que favorecem a manifestação de eventos tromboembólicos. Dessa forma, foi proposta a avaliação hemostática das gestantes que manifestaram a DHEG, mesmo sem história de episódio tromboembólico anterior, através da

  7. O PAPEL DA ÁFRICA NA NOVA ROTA DA SEDA MARÍTIMA

    Directory of Open Access Journals (Sweden)

    Diego Pautasso

    2017-01-01

    Full Text Available O objetivo do presente artigo é analisar o lugar da África na construção da Nova Rota da Seda Marítima. Este é justamente um dos vetores do ambicioso projeto chinês de integração da Ásia, Europa e África, lançada em 2013 sob título de Iniciativa OBOR (One Belt, One Road. Na medida que os desafios da reconstrução nacional são superados, a China torna-se mais assertiva e dá forma à sua estratégia de inserção mundial. Nesse sentido, a Nova Rota da Seda agrega os objetivos centrais da diplomacia da China para o século XXI, reservando à África a condição de trampolim para que o projeto se torne global.

  8. ANÁLISE PRELIMINAR DA CONTROLADORIA DA CIDADE DE SALVADOR

    Directory of Open Access Journals (Sweden)

    João Marcelo Pitiá Barreto

    2012-06-01

    Full Text Available A Controladoria tem sido alvo de estudos e destaque de análises e reflexões dos estudiosos das ciências que têm como foco o campo gerencial das organizações como a da Administração e Contabilidade. É importante observar a contribuição da Controladoria à governança pública, fundamento de uma gestão democrática e participativa. Nesse contexto, insere-se o objetivo deste estudo, refletir sobre atuação da controladoria pública da cidade de Salvador, observando a contribuição efetiva na governança nesse município. Os estudos foram desenvolvidos na Secretaria da Fazenda (SEFAZ do município a quem Controladoria vincula-se. Com caráter exploratório, essa investigação descritiva envolveu pesquisa de campo, análise de documentos e relatórios emitidos pela SEFAZ e pelo Tribunal de Contas do Município (TCM. Verificou-se o organograma da SEFAZ, seu orçamento e os pareceres do TCM. Os resultados expressam a importância da Controladoria e denotam a impressão de que, na instituição estudada, essa área não esteja cumprindo bem seu papel. 

  9. SÍNTESES E PROPRIEDADES DE FÁRMACOS INIBIDORES DA TIROSINA QUINASE BCR-ABL, UTILIZADOS NO TRATAMENTO DA LEUCEMIA MIELOIDE CRÔNICA

    Directory of Open Access Journals (Sweden)

    Liviane D. de Azevedo

    Full Text Available The chronic myeloid leukemia (CML is characterized by presence of the Philadelphia chromosome (Ph, originated from the translocation between chromosomes 9 and 22. This chromosome generates an abnormal protein tyrosine kinase which is responsible for tumor cell proliferation. The emergence of tyrosine kinase inhibitors (TKIs has transformed the treatment of CML and imatinib being the first representative of this class. Although treatment with imatinib has reached surprising results, approximately 30% of patients exhibited resistance, especially in later stages of the disease. This fact stimulated the development of novel BCR-ABL enzyme inhibitors drugs classified as tyrosine kinase inhibitors (TKIs of second and third generations. The TKIs have different chemical functions in their structure, and the knowledge of synthetic methods for preparation of these compounds can be a powerful tool for the development of new derivatives. The five approved BCR-ABL Tyrosine Kinase inhibitors (TKI used in Chronic Myeloid Leukemia (CML are reviewed aiming the main synthetic routes, highlighting the advantages and disadvantages associated with them.

  10. UM ESTUDO DA INFLUÊNCIA DA GESTÃO DE PESSOAS NO DESEMPENHO DO TRABALHADOR E NA MELHORIA DA QUALIDADE

    Directory of Open Access Journals (Sweden)

    Crislaine Carvalho

    2017-01-01

    Full Text Available A qualidade é uma das principais preocupações presentes dentro das organizações, e estas estão sempre à procura de ferramentas que possam auxiliar nesse processo. A influência da gestão de pessoas no desempenho do trabalhador pode ser um diferencial para as empresas no mercado competitivo. Este trabalho tem a finalidade de apresentar o relacionamento entre a gestão de pessoas e a gestão da qualidade e seus reflexos no processo de melhoria contínua. Nesse contexto, foi feita uma revisão bibliográfica da evolução histórica da qualidade e os reflexos da gestão de pessoas nesse processo. Foi estudado também uma evolução do termo Gestão de Pessoas e suas diversas nomenclaturas adotadas ao longo do tempo, e as influências dessas nomenclaturas no relacionamento com os funcionários. Essa pesquisa trouxe resultados positivos a respeito da influência da gestão de pessoas na melhoria da qualidade, mostrando que os interesses da empresa e dos funcionários podem sim caminhar juntos, desde que ambos os lados estejam satisfeitos, o que confirmou a hipótese inicial desse trabalho.

  11. "Geografia da Fome": da lógica regional à universalidade

    Directory of Open Access Journals (Sweden)

    Arruda Bertoldo Kruse Grande de

    1997-01-01

    Full Text Available Geografia da Fome revela a associação harmoniosa da capacidade de argumentar com a segurança científica, um novo modo de pensar e de agir frente à realidade alimentar e nutricional e também uma abordagem pioneira no dimensionamento da fome coletiva como um fenômeno geograficamente universal. Admitiu, com base nas especificidades regionais, que as contribuições parciais poderiam compor um mapeamento caracterizador da universalidade do problema, permitindo construir uma imagem diferente do Brasil e do mundo, possibilitando a estruturação de um plano universal de combate à fome, abrindo novos caminhos para aqueles que buscam a correção de desequilíbrios regionais e a eliminação do subdesenvolvimento. Nesse livro-manifesto, Josué de Castro reinterpretou o papel da geografia clássica, incorporando uma das dimensões explicativas mais importantes, que é a da análise política, para desvendar a significação e conseqüências do desenvolvimento espacial desigual. A releitura de Geografia da Fome mostra que seus delineamentos conceituais e propositivos continuam vivos e constituem instrumentos indispensáveis para repensar criticamente a realidade brasileira e, em particular, a nordestina. Geografia da Fome, no seu cinqüentenário, torna-se um livro atual pela sua mensagem estimuladora e perturbadora.

  12. "Geografia da Fome": da lógica regional à universalidade

    Directory of Open Access Journals (Sweden)

    Bertoldo Kruse Grande de Arruda

    1997-09-01

    Full Text Available Geografia da Fome revela a associação harmoniosa da capacidade de argumentar com a segurança científica, um novo modo de pensar e de agir frente à realidade alimentar e nutricional e também uma abordagem pioneira no dimensionamento da fome coletiva como um fenômeno geograficamente universal. Admitiu, com base nas especificidades regionais, que as contribuições parciais poderiam compor um mapeamento caracterizador da universalidade do problema, permitindo construir uma imagem diferente do Brasil e do mundo, possibilitando a estruturação de um plano universal de combate à fome, abrindo novos caminhos para aqueles que buscam a correção de desequilíbrios regionais e a eliminação do subdesenvolvimento. Nesse livro-manifesto, Josué de Castro reinterpretou o papel da geografia clássica, incorporando uma das dimensões explicativas mais importantes, que é a da análise política, para desvendar a significação e conseqüências do desenvolvimento espacial desigual. A releitura de Geografia da Fome mostra que seus delineamentos conceituais e propositivos continuam vivos e constituem instrumentos indispensáveis para repensar criticamente a realidade brasileira e, em particular, a nordestina. Geografia da Fome, no seu cinqüentenário, torna-se um livro atual pela sua mensagem estimuladora e perturbadora.

  13. Alterações funcionais da junção neuromuscular provocadas em ratos pela administração diária e prolongada de um agente curarizante Functional changes of the neuromuscular junction induced in rats by a daily and prolonged ministration of a curare agent

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Zanini

    1967-06-01

    Full Text Available A ratos adultos, machos, foi administrado durante 8 semanas, uma vez ao dia, o iodeto do dimetiléter da d-tubocurarina (DMT, pela via intraperitoneal. Os animais foram distribuídos em 3 lotes: os do 1.°, receberam 5,5 gama de DMT/kg/dia; os do 2.°, 16,6 gama/kg/dia; os do 3.° (controle, 1 ml da solução isotônica de cloreto de sódio. A força muscular dos animais foi avaliada uma vez por semana, de acordo com o método descrito no texto, antes e após a injeção intraperitoneal da referida substância. Com o decorrer da experimentação, observou-se que: a houve diminuição significativa da força muscular dos animais, avaliada após esvaecimento da atividade curarizante do DMT; b a determinação da força muscular, feita logo após a injeção, mostrou que a dose de 5,5 gama/kg/dia provoca um aumento da suscetibilidade dos animais à ação curarizante do DMT; c o efeito inibidor provocado pela dose de 16,6 gama/kg/dia de DMT aumentou no início mas diminuiu significantemente após a 5ª semana, muito embora houvesse uma progressiva diminuição da força muscular, sugerindo independência entre os dois efeitos. Com base nesses resultados, são discutidos alguns fenômenos que podem ocorrer na instalação e tratamento da miastenia grave.Dimethylether of d-tubocurarine iodide (DMT was administered daily, by intraperitoneal route, to adult male rats during 8 weeks. The animals were divided in three groups: the animals of the first group were given 5.5 gama/kg/day of DMT; those of the second group were given 16.6 gama/ kg/day; the rats of the 3rd (the control group, received 1 cm³ of isotonic saline solution. The animals muscular force was evaluated once a week right before and after intraperitoneal injection of the drug. During the course of the trial, it was noted: aa significant reduction of the animals muscular force, evaluated after disappearance of the DMT curarizing effect; bmeasurements of muscular force, performed straight

  14. Influência da nutrição mineral foliar sobre doenças da parte aérea da cultura do trigo

    Directory of Open Access Journals (Sweden)

    Rafael Gustavo Ferreira Morales

    2012-02-01

    Full Text Available A utilização de fungicida para o controle de doenças foliares na cultura do trigo é prática comum entre os triticultores. Contudo, devido ao impacto ambiental provocado pelo seu uso generalizado, buscam-se alternativas para controle dos fitopatógenos. Sendo assim, este trabalho teve como objetivo avaliar o efeito da nutrição mineral foliar sobre as doenças foliares do trigo, bem como seu efeito sobre o desenvolvimento da planta. O delineamento experimental foi em blocos casualizados com quatro repetições e quatro tratamentos: 1- testemunha; 2- adubação foliar aos 30 dias após a emergência (DAE e aos 75 DAE; 3- fungicida aos 30 e 75 DAE; e 4- adubação foliar aos 30 DAE e adubação foliar mais fungicida aos 75 DAE. Foram realizadas nove avaliações da incidência e da severidade do oídio, cujos dados foram utilizados para o cálculo das áreas abaixo das curvas de progresso da doença; três avaliações da severidade da ferrugem e da mancha da gluma; e duas avaliações da mancha amarela. Foram determinadas a massa de matéria fresca e seca da parte aérea e do sistema radicular e a produtividade da cultura. Foi observada redução da incidência e da severidade de oídio em função da adubação foliar, apenas na primeira avaliação de incidência e nas segunda e quinta avaliações de severidade da doença. O efeito complementar dos nutrientes com o fungicida para redução das doenças foi observado apenas para a mancha amarela, com redução de aproximadamente 11,16 % da severidade. Os maiores valores de produtividade foram observados para os tratamentos apenas com fungicida e, com fungicida mais nutrientes. A adubação foliar proporcionou aumento da massa fresca de raízes e massa seca de raízes. Apesar disso, não houve aumento da massa fresca da parte aérea em função da adubação foliar.

  15. A aplicação dos recursos da seguridade social, a partir da perspectiva da teoria dos sistemas, da teoria comunicacional e do caos

    OpenAIRE

    Júnior, Dávio Antonio Prado Zarzana

    2011-01-01

    Este trabalho, focalizando o custeio da Seguridade Social, pretende realizar três verificações: a primeira, a existência ou não de desvios na aplicação dos recursos arrecadados para este financiamento, inclusive a partir da formulação de um conceito de desvio. A segunda, examinar os desequilíbrios que esses possíveis desvios produziriam, sob a ótica da Teoria dos Sistemas, utilizando-se, em adição, terminologia própria da Teoria Comunicacional. E a terceira, perscrutar a pos...

  16. Origin of the DA and non-DA white dwarf stars

    Science.gov (United States)

    Shipman, Harry L.

    1989-01-01

    Various proposals for the bifurcation of the white dwarf cooling sequence are reviewed. 'Primordial' theories, in which the basic bifurcation of the white dwarf sequence is rooted in events predating the white dwarf stage of stellar evolution, are discussed, along with the competing 'mixing' theories in which processes occurring during the white dwarf stage are responsible for the existence of DA or non-DA stars. A new proposal is suggested, representing a two-channel scenario. In the DA channel, some process reduces the hydrogen layer mass to the value of less than 10 to the -7th. The non-DA channel is similar to that in the primordial scenario. These considerations suggest that some mechanism operates in both channels to reduce the thickness of the outermost layer of the white dwarf. It is also noted that accretion from the interstellar medium has little to do with whether a particular white dwarf becomes a DA or a non-DA star.

  17. Várias Marias: efeitos da Lei Maria da Penha nas delegacias

    Directory of Open Access Journals (Sweden)

    Roberta Carvalho Romagnoli

    2015-08-01

    Full Text Available Este artigo discute os dados qualitativos da pesquisa “Violência Doméstica perpetrada contra a mulher no município de Montes Claros: um recorte possível”, financiada pelo CNPq e pela FAPEMIG. O objetivo do estudo foi investigar quantitativamente e qualitativamente os atos violentos contra as mulheres na cidade de Montes Claros, Minas Gerais. A vertente qualitativa pretendia conhecer o sentido da violência para as mulheres envolvidas e seus reflexos na família, através de entrevistas semiestruturadas que não se efetivaram. A partir da Análise Institucional de René Lourau analisamos essa inviabilidade como dado qualitativo, examinando o cotidiano da delegacia após a lei Maria da Penha. Concluímos que a intervenção judicial não é suficiente para a inibição da violência contra a mulher, pois em certos casos afasta da delegacia mulheres com outras demandas acerca da violência, que sofrem e que não podem contar com a ajuda policial para a resolução dos seus conflitos.

  18. Implicações da visibilidade da enfermagem no exercício profissional

    Directory of Open Access Journals (Sweden)

    Liziani Iturriet Avila

    Full Text Available A construção da imagem da Enfermagem é permeada por aspectos históricos, socioeconômicos e culturais. Ao explorar esta temática, objetivou-se conhecer a percepção dos enfermeiros acerca da visibilidade do cotidiano de trabalho da equipe de enfermagem. Pesquisa qualitativa do tipo exploratória, com 30 enfermeiros de um hospital universitário do sul do país. Os dados foram coletados, de julho a outubro de 2012, através de entrevista semi-estruturada e submetidos à análise textual discursiva. Os resultados apontam que a visibilidade da Enfermagem está relacionada à trajetória histórica da profissão, à falta de reconhecimento da cientificidade da Enfermagem, à veiculação errônea na mídia, aos comportamentos inadequados perante a equipe e, ainda, à sobrecarga de trabalho. Assim, a desmistificação da imagem da profissão inclui uma busca de maior visibilidade midiática, realização de marketing pessoal, comportamento adequado perante a equipe de saúde e demonstração de autonomia profissional, desafios estes que deverão ser superados pela Enfermagem.

  19. Angioedema recorrente – caso clínico

    Directory of Open Access Journals (Sweden)

    Sandrina Martins

    2016-02-01

    Full Text Available Introdução: O Angioedema hereditário (AEH é uma causa rara de angioedema recorrente, resultante de um defeito a nível do gene que codifica o inibidor do C1 esterase (C1 -INH. O edema envolve predominantemente os tecidos da face, membros, trato gastrointestinal e área genital. O envolvimento da laringe, apesar de menos frequente, constitui a expressão clínica mais grave, sendo potencialmente fatal. Caso clínico: Descreve -se o caso clínico de uma criança do sexo feminino de oito anos de idade referenciada à consulta de pediatria por episódios recorrentes de angioedema. O estudo efetuado revelou tratar -se de um caso de AEH. Discussão: O diagnóstico, estabelecido com base no quadro clínico, estudo do complemento e história familiar, é de importância fundamental considerando que o AEH é potencialmente fatal e exige uma terapêutica específica.

  20. High susceptibility of activated lymphocytes to oxidative stress-induced cell death

    Directory of Open Access Journals (Sweden)

    Giovanna R. Degasperi

    2008-03-01

    Full Text Available The present study provides evidence that activated spleen lymphocytes from Walker 256 tumor bearing rats are more susceptible than controls to tert-butyl hydroperoxide (t-BOOH-induced necrotic cell death in vitro. The iron chelator and antioxidant deferoxamine, the intracellular Ca2+ chelator BAPTA, the L-type Ca2+ channel antagonist nifedipine or the mitochondrial permeability transition inhibitor cyclosporin A, but not the calcineurin inhibitor FK-506, render control and activated lymphocytes equally resistant to the toxic effects of t-BOOH. Incubation of activated lymphocytes in the presence of t-BOOH resulted in a cyclosporin A-sensitive decrease in mitochondrial membrane potential. These results indicate that the higher cytosolic Ca2+ level in activated lymphocytes increases their susceptibility to oxidative stress-induced cell death in a mechanism involving the participation of mitochondrial permeability transition.O presente estudo demonstra que linfócitos ativados de baço de ratos portadores do tumor de Walker 256 são mais susceptíveis à morte celular necrótica induzida por tert-butil hidroperóxido (t-BOOH in vitro quando comparados aos controles. O quelante de ferro e antioxidante deferoxamina, o quelante intracelular de Ca2+ BAPTA, o antagonista de canal de Ca2+ nifedipina ou o inibidor da transição de permeabilidade mitocondrial ciclosporina-A, mas não o inibidor de calcineurina FK-506, inibiram de maneira similar a morte celular induzida por t-BOOH em linfócitos ativados e controles. Os linfócitos ativados apresentaram redução do potencial de membrana mitocondrial induzida por t-BOOH num mecanismo sensível a ciclosporina-A. Nossos resultados indicam que o aumento da concentração de Ca2+ citosólico em linfócitos ativados aumenta a susceptibilidade dos mesmos à morte celular induzida por estresse oxidativo, num mecanismo envolvendo a participação do poro de transição de permeabilidade mitocondrial.

  1. Hanna Krall e os caminhos tortos da memória e da identidade

    OpenAIRE

    Piotr Kilanowski

    2013-01-01

    Neste artigo apresentamos a escritora polonesa de origem judaica Hanna Krall por meio da análise literária do seu romance Sublokatorka (A sublocatária).  O romance, com elementos autobiográficos, apresenta a personalidade cindida de uma menina sobrevivente do Holocausto e discute o tema da identidade polonesa, judaica e judaico-polonesa. Através da observação da memória e do processo de criação da memória, a autora mostra a construção da identidade falsa e a repressão da verdadeira, o comport...

  2. Direito à palavra: interrogações acerca da proposta da justiça restaurativa

    Directory of Open Access Journals (Sweden)

    Edson Luiz André de Sousa

    Full Text Available Partindo da constatação da necessidade de alternativas ao sistema de Justiça atual, o presente artigo objetiva dar voz a uma das propostas que vem ganhando força no cenário jurídico mundial: a Justiça Restaurativa. Para tanto, este artigo explora essa proposta, promovendo uma análise crítica amparada em autores da psicanálise (freudo-lacaniana e da Filosofia (com F. Ost e J. Derrida. Através da Justiça Restaurativa, é possível questionar a potência da circulação da palavra, característica que promove o tensionamento entre psicanálise e Direito. Além disso, a questão da Lei e das leis, da performatividade dos atos da fala, da posição do Juiz, da experiência do encontro restaurativo e da função das utopias são os principais vieses que compõem esta análise. Mais voltado para a possibilidade de anunciar questionamentos sobre essa proposta tão nova no contexto brasileiro do que de encontrar respostas satisfatórias, este artigo mantém em suspenso várias conclusões, embora assuma a constatação da importante função utópica da Justiça Restaurativa.

  3. Cruzeiros marítimos: realidade da oferta e da demanda no mercado brasileiro

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo de Almeida Ramoa

    2014-12-01

    Full Text Available O turismo marítimo apresenta uma demanda crescente e constante nos Estados Unidos e na Europa. No Brasil, esse mercado vinha se destacando com crescimento exponencial da demanda, no entanto, a partir da temporada 2011/2012 a taxa de crescimento tem apresentado queda. Este estudo de caráter exploratório e descritivo utiliza o método de procedimento matemático e tem como objetivo geral identificar a realidade da oferta e da demanda no mercado brasileiro de cruzeiros marítimos. Para atingi-lo foram identificados os históricos da oferta e da demanda, no período de 2004 a 2013, e da situação atual da infraestrutura portuária, através da utilização de técnicas de documentação indireta, procedimento documental e bibliográfico. Para se comparar a taxa de crescimento do mercado brasileiro com os principais mercados foi realizado cálculo da extrapolação matemática exponencial. Os resultados apresentados indicam que o Brasil é o único país entre os dez maiores mercados de cruzeiros marítimos, que possui taxa de crescimento negativo, indicando haver uma crise no segmento de cruzeiros marítimos, cujo motivo aponta para os problemas estruturais como sendo uma das causas da queda da oferta e da demanda no mercado brasileiro.

  4. ESTATUTO PARADOXAL DA PELE E CULTURA CONTEMPORÂNEA: da porosidade à pele-teflon

    Directory of Open Access Journals (Sweden)

    Maria Cristina Franco Ferraz

    2014-06-01

    Full Text Available A exploração do estatuto paradoxal da pele - interface dentro/fora - permite ultrapassar a dicotomia metafísica superfície/profundidade, problematizando a tendência atual, também expressa na teoria, a um elogio das superfícies e a um horror por oposições dicotômicas. Possibilta avaliar as implicações do fechamento da porosidade da pele em formas de sociabilidade estimuladas na cultura da imagem, da exibição, do espetáculo, bem expressas pelo material inorgânico teflon. Sendo Poros, na visão grega, pai de Eros, a investigação acerca do estatuto paradoxal da pele convida a uma retomada do tema do erotismo. Partindo de perspectivas oferecidas por Agamben acerca da pornografia, ligada ao valor de exibição nas sociedades de espetáculo e de consumo, e relacionando-as a diversas reflexões de José Gil acerca do corpo e da pele, discute-se e convoca-se a abertura da porosidade da pele.

  5. ANÁLISE DA PAISAGEM DA BACIA HIDROGRÁFICA DO RIO ALMADA (BA COM BASE NA FRAGMENTAÇÃO DA VEGETAÇÃO

    Directory of Open Access Journals (Sweden)

    Maria Eugênia Bruck de Moraes

    2012-04-01

    Full Text Available O estudo da fragmentação da paisagem em uma bacia é de extrema importância por avaliar o status de conservação da vegetação, um recurso essencial para a manutenção da qualidade da água. O presente trabalho apresenta uma análise da fragmentação da paisagem na Bacia Hidrográfica do Rio Almada, localizada no sul da Bahia, abrangendo 9 municípios parcialmente abastecidos pela água desta bacia. Foi realizado o mapeamento dos fragmentos florestais que apresentaram área mínima de 3ha, com base na interpretação da Carta de Uso e Cobertura do Solo elaborada através da classificação supervisionada de imagens Landsat. Para a análise dos fragmentos foram adotadas 5 métricas da paisagem: tamanho, formato, efeito de borda, isolamento e conectividade. Os resultados obtidos demonstram que a BHRA ainda abriga fragmentos bastante representativos, visto que dos 58 fragmentos identificados, 8 têm área acima de 300ha, 20 entre 100 e 300ha, 21 entre 30 e 100ha e 9 entre 3 e 30ha. Com relação ao formato dos fragmentos, constatou-se que apenas 10% dos mesmos apresentam forma circular, indicando que os 90% restantes encontram-se susceptíveis ao efeito de borda, sendo que os mais alongados estão localizados no interior da bacia, provavelmente em função do avanço da pecuária extensiva nessa direção. E quanto ao isolamento dos fragmentos, a análise da conectividade com borda expandida, através de simulações, permitiu identificar que a partir da distância de 200m, 31 dos fragmentos poderiam ser conectados. Assim, pôde-se concluir que o somatório destes fragmentos, caso fossem devidamente conectados, representaria uma área de significativo valor para a conservação de espécies típicas da mata atlântica e, consequentemente, para a manutenção da qualidade da água desta bacia.

  6. Alterações vasculares em ratos obesos por dieta rica em gordura: papel da Via L-arginina/NO Endotelial

    Directory of Open Access Journals (Sweden)

    Thiago Bruder Nascimento

    2011-07-01

    Full Text Available FUNDAMENTO: Mecanismos subjacentes a anormalidades vasculares na obesidade ainda não estão completamente esclarecidos. OBJETIVO: Foi avaliada a via do óxido nítrico/L-arginina na resposta vascular de ratos obesos por dieta rica em gordura, enfocando as células endoteliais e do músculo liso. MÉTODOS: Ratos com 30 dias de vida foram divididos em 2 grupos: controle (C e obeso (OB, ratos sob dieta rica em gordura por 30 semanas. Após 30 semanas, foram registrados o peso corporal, índice de adiposidade, pressão arterial e perfis metabólicos e endócrinos dos animais. Foram obtidas curvas para noradrelanina na ausência e presença de inibidor de óxido nítrico sintase (L-NAME, 3x10-4M em aorta torácica intacta e com desnudamento em ratos C e OB. RESULTADOS: As medidas de peso corporal, índice de adiposidade, leptina e insulina aumentaram nos ratos OB, enquanto a pressão arterial permaneceu inalterada. A obesidade também produziu tolerância à glicose e resistência à insulina. A reatividade à noradrenalina da aorta intacta foi similar em ratos C e OB. A presença de L-NAME produziu um aumento similar nas respostas máximas, mas um desvio maior à esquerda das respostas nas aortas intactas dos ratos C em relação aos ratos OB [EC50 (x10-7M: C = 1,84 (0,83-4,07, O = 2,49 (1,41-4,38; presença de L-NAME C = 0,02 (0,01-0,04*, O = 0,21 (0,11-0,40*†,*p < 0,05 vs controle respectivo,†p < 0,05 vs controle mais L-NAME, n = 6-7]. Nenhum dos protocolos alterou a reatividade à noradrenalina de aortas com desnudamento. CONCLUSÃO: A obesidade induzida por dieta rica em gordura promove alterações metabólicas e vasculares. A alteração vascular envolveu uma melhora da via endotelial L-arginina/NO provavelmente relacionada à hiperinsulinemia e hiperleptinemia induzidas por dieta. A maior resistência aos efeitos do L-NAME na aorta de ratos obesos diz respeito a menor vulnerabilidade de indivíduos obesos na presença de patologias

  7. ANÁLISE OPERACIONAL DA COLHEITA FLORESTAL NO SUL DA BAHIA

    OpenAIRE

    CARMO, F. C. A.

    2013-01-01

    CARMO, Flávio Cipriano de Assis. Análise operacional da colheita florestal no sul da Bahia. 2013. Dissertação (Mestrado em Ciências Florestais) Universidade Federal do Espírito Santo, Jerônimo Monteiro-ES. Orientador: Prof. Dr. Nilton César Fiedler. Coorientador: Profª. Drª. Elizabeth Neire da Silva Oliveira de Paula. Objetivou-se com esta pesquisa realizar uma análise operacional das atividades de colheita florestal em plantios de eucalipto no sul da Bahia. No estudo foram avaliados os ...

  8. Espiritualidade na formação do administrador sob a ótica dos professores: um estudo de caso na Faculdade Gamma

    Directory of Open Access Journals (Sweden)

    Rogério Passos dos Santos

    2013-12-01

    Full Text Available Nos últimos 25 anos, as teorias administrativas têm sido alvo de uma série de críticas, sobretudo quanto ao seu caráter instrumental. Como possível resposta a esse problema, na década de 1990 intensificaram-se as discussões sobre a temática da espiritualidade nas organizações. Todavia, apesar do crescente interesse internacional por esse assunto, a revisão de literatura acadêmica revela que, no Brasil, são quase inexistentes os estudos sobre esse tema. Ainda são mais raras as pesquisas que relacionam a formação do administrador com a temática da espiritualidade. Assim, o propósito neste estudo foi entender como tem sido a formação do administrador, no que tange aos princípios da espiritualidade. Para cumprir o objetivo da investigação, inicialmente se procurou realizar uma discussão teórica dos conceitos essenciais a este trabalho: críticas à formação tradicional do administrador, espiritualidade e espiritualidade na formação do administrador. A metodologia escolhida foi a qualitativa do tipo exploratório-descritiva, optando-se pelo estudo de caso como estratégia metodológica. Os resultados obtidos sinalizam, na faculdade pesquisada, um contexto marcado por inibidores de uma formação do administrador que contemple, de forma significativa, a questão da espiritualidade.

  9. ESTIMAÇÃO DA IDADE DA REGENERAÇÃO DA VEGETAÇÃO DE CERRADO A PARTIR DE IMAGENS LANDSAT

    Directory of Open Access Journals (Sweden)

    Philippe Maillard, Priscilla S. Costa-Pereira

    2011-07-01

    Full Text Available Nas regiões em que a rede de monitoramento hidrossedimentológico é precária ou inexistente, a utilização de modelos hidrológicos, de base física que proporcionem estimativas da geração de escoamento superficial e a perda de solo, se torna muito útil para fins de planejamento das bacias hidrográficas. O presente trabalho trata da aplicação do modelo hidrossedimentológico “Soil And Water Assessment Tool” nas Sub-Bacias 2 e 1 da Bacia Experimental de São João do Cariri. O modelo com a interface ArcSWAT, que se une ao SIG, necessita da entrada de “Modelo Digital de Elevação” (MDE da bacia e as simulações foram realizadas utilizando dois MDEs para fins de análise comparativa: um originado a partir da interpolação de dados de campo e outro obtido através de sensoriamento remoto. Com isto foi possível verificar a confiabilidade do uso de MDE obtido por sensoriamento remoto. Em nível das sub-bacias experimentais, foi realizada a parametrização, na Sub-Bacia 2, e a validação, na Sub-Bacia 1. O desempenho do modelo, para a geração da lâmina escoada, foi avaliado pelo coeficiente de determinação (R² e do fator da eficiência de Nash-Sutcliffe. Os resultados mostram desempenho satisfatório para ambos os MDEs, mostrando a pouca sensibilidade da topografia da geração de lâmina simulada em pequenas bacias. Por outro lado, a produção de sedimentos apresentou resultados insatisfatórios, além do que foi significativa a discrepância da distribuição da erosão do solo na superfície da bacia pelos dois MDEs utilizados.

  10. COMPORTAMENTO DA ARRECADAÇÃO PRÓPRIA E DA CARGA TRIBUTÁRIA NOS MUNICÍPIOS DA ZONA DA MATA MINEIRA

    Directory of Open Access Journals (Sweden)

    Anderson de Oliveira Reis

    2016-06-01

    Full Text Available O processo de descentralização consolidado pela constituição de 1988 mudou a dinâmica do federalismo brasileiro aumentando as receitas disponíveis e também as responsabilidades do fornecimento de serviços para os municípios, que em termos financeiros são muito dependentes das transferências governamentais. Diante da importância dos municípios na Administração Pública como entes federativos, este estudo tem como objetivo identificar, a partir da classificação em grupos, a mudança no perfil da arrecadação tributária própria dos municípios da Zona da Mata Mineira tendo por base os períodos de 2005 e 2010. Trata-se de pesquisa descritiva e quantitativa em que se utilizou as metodologias de Análise de Cluster e Teste t para amostras emparelhadas. Os resultados apontam para formação de 4 grupos de acordo com o esforço fiscal (baixo, médio e alto. Em média observa-se uma evolução positiva na arrecadação própria dos municípios que foi confirmada pelo Teste t. Conclui-se que apesar da dependência dos recursos de transferências, os municípios têm realizados esforços para aumentar a arrecadação própria e consequentemente suas receitas disponíveis.

  11. IMPLICAÇÕES DA ANÁLISE V-A-T DA TEORIA DAS RESTRIÇÕES NA GESTÃO DA CADEIA DE SUPRIMENTOS

    Directory of Open Access Journals (Sweden)

    Diego Augusto de Jesus Pacheco

    2016-03-01

    Full Text Available O objetivo dessa pesquisa é identificar o impacto da análise V-A-T da Teoria das Restrições na gestão estratégica de materiais à luz da Matriz de Posicionamento Estratégico dos Materiais (MPEM. A partir de dois estudos de caso, buscou-se verificar: i em qual classificação cada empresa se enquadrava dentro da lógica V-A-T, e ii se a gestão estratégica de materiais a partir da abordagem da MPEM pode ser considerada semelhante ou não nos casos investigados. Os resultados da pesquisa apontaram que a classificação V-A-T no caso da empresa S é do tipo A e no caso da empresa K é do tipo V. Já a análise da gestão estratégica de materiais a partir da MPEM, evidenciou que no caso S pertence ao quadrante não crítico e no caso K pertence ao quadrante estratégico. Identificou-se que a classificação V-A-T tende a impactar na gestão de materiais e no controle de estoques.

  12. Influência da idade da planta e da maturação dos frutos no momento da colheita na qualidade do café

    OpenAIRE

    Borges,Fernanda Barbosa; Jorge,José Tadeu; Noronha,Regina

    2002-01-01

    São de grande importância os cuidados no preparo do café desde a colheita até o consumo e o estudo de parâmetros que possam influenciar na classificação comercial do grão e na qualidade da bebida. Teve-se como objetivos analisar a influência da idade das plantas, pertencentes à mesma variedade, e dos estágios de maturação dos grãos (secos, cerejas e verdes) no resultado da classificação comercial e na qualidade da bebida. Realizou-se a colheita, por derriça no pano, de uma área com café arábi...

  13. A decomposição do Estado e o protagonismo da sociedade civil no enfrentamento da questão social no Brasil: os dilemas da cidadania e da democracia na contemporaneidade

    Directory of Open Access Journals (Sweden)

    Freire, Silene de Moraes

    2006-01-01

    Full Text Available O presente artigo foi elaborado a partir de preocupações profissionais voltadas para desvelar a presença e o enfrentamento, por parte do Estado e da sociedade civil, da questão social no cenário histórico-cultural da sociedade brasileira, evidenciado a partir da década de noventa, sobretudo, quando observamos a guinada do Estado brasileiro para a “mentalidade privatizante” que as reformas estruturais de cunho neoliberal promoveram. No caso brasileiro, tal projeto reafirma uma das particularidades de nossa cultura política: o moderno se constitui por meio do “arcaico”, recriando nossa herança histórica ao atualizar aspectos persistentes e, ao mesmo tempo, transformando-os no contexto da globalização. Pretendemos, assim, discutir de que modo a permanência histórica da desigualdade social, dos limites da cidadania e da democracia serviram como elemento facilitador para a implementação da agenda neoliberal no Brasil

  14. Aspectos macroepidemiológicos da esquistossomose mansônica: análise da relação da irrigação no perfil espacial da endemia no Estado da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Martins Jr. Davi Félix

    2003-01-01

    Full Text Available Estudos na África, de forma enfática, têm mostrado a associação entre a implantação de perímetros de irrigação e o aumento ou expansão da ocorrência esquistossomose mansônica ou hematóbica. O objetivo deste estudo foi verificar a associação entre a prática de irrigação no território do Estado da Bahia e a ocorrência e a difusão da infecção pelo Schistosoma mansoni. O desenvolvimento da irrigação no Estado da Bahia assume duas formas: a primeira é intensiva em capital e mecanizada, voltada para produção agrícola de exportação e necessitando de pouca mão-de-obra. Na segunda forma, caracteriza-se pelo baixo grau de mecanização e utilização intensiva de mão-de-obra. O estudo mostrou que os municípios com as maiores áreas irrigadas não são aqueles que registram as mais altas taxas de prevalência da infecção. Na maior parte desses municípios a irrigação é intensiva em termos de capital e tecnologia. Os achados concluem que diferentemente do observado na África, no Estado da Bahia, a irrigação tem tido pequena influência na definição do perfil espacial da endemia.

  15. Injeção de corticosteróide em patologias vocais inflamatórias crônicas, revisão da literatura Steroid injection in chronic inflammatory vocal fold disorders, literature review

    Directory of Open Access Journals (Sweden)

    Andrea Maria Campagnolo

    2008-12-01

    Full Text Available Os corticosteróides são potentes inibidores da inflamação e da cicatrização. Administração local de esteróides diretamente na laringe tem sido relatada em diversas patologias laríngeas. OBJETIVO: O objetivo desse estudo é realizar uma revisão da literatura sobre o uso de infiltração de corticosteróide em pregas vocais, em pacientes com patologias vocais benignas, inflamatórias e crônicas de laringe. METODOLOGIA: Realizou-se uma busca eletrônica na base de dados Medline, selecionando-se estudos clínicos que utilizavam corticosteróides em patologias benignas da laringe. RESULTADOS: Os corticosteróides são indicados nas seguintes situações: 1 doenças inflamatórias agudas, principalmente naquelas relacionadas a edema que comprometa a via aérea; 2 doenças auto-imunes com alterações laríngeas; 3 estenose laríngea; 4 em lesões benignas inflamatórias das pregas vocais, como nódulos, pólipos e edema de Reinke, para diminuir o processo inflamatório pré-cirúrgico ou na tentativa de se evitar uma intervenção cirúrgica; 5 em fonocirurgia, com o objetivo de reduzir a formação de cicatriz. Seu uso pode ser profilático, visando à prevenção da formação de cicatriz ou terapêutico em uma cicatriz já formada. CONCLUSÃO: Os corticosteróides podem ser considerados uma opção terapêutica importante no manejo de várias patologias, principalmente aquelas de origem inflamatória que causam alterações vocais.Steroids are potent inhibitors of inflammation and wound repair. Local administration of steroids directly into the larynx has been reported in many laryngeal diseases. AIM: The purpose of this study is to review related literature about the use of steroid injection in patients with benign, inflammatory and chronic vocal disease. METHODOLOGY: We performed an electronic survey in Medline database and selected clinical trials regarding steroid use in benign laryngeal diseases. RESULTS: Steroids are indicated in

  16. Da possibilidade de uma Teoria Pura da Ciência da Informação: reflexões iniciais entre a Ciência da Informação e a Ciência do Direito

    Directory of Open Access Journals (Sweden)

    Max Cirino de Mattos

    Full Text Available O artigo discute a fragilidade epistemológica da Ciência da Informação, a partir da adoção de um termo polissêmico, como objeto científico, e a similaridade dessa situação com o contexto da criação da Teoria Pura do Direito de Hans Kelsen. Após a apresentação de algumas definições sobre o objeto da Ciência da Informação, discutem-se alguns reflexos relacionados à identidade científica e à fundamentação teórica derivadas de um objeto polissêmico. Apresenta-se uma breve introdução à Teoria Pura do Direito e algumas reflexões sobre a possibilidade de uma Teoria Pura da Ciência da Informação.

  17. A LEITURA DA GRAMÁTICA DA FORMA DO CONJUNTO HABITACIONAL CAMPINAS-F DA CDHU EM CAMPINAS

    Directory of Open Access Journals (Sweden)

    Marcelo de Morais

    2014-12-01

    Full Text Available A gramática da forma constitui uma importante ferramenta que pode dar suporte para futuros estudos e melhor qualidade em conjuntos habitacionais. A utilização de sistemas generativos de projeto pode aperfeiçoar uma série de rotinas de projeto, potencializando seu uso com outras ferramentas de informática. Este trabalho apresenta os resultados de estudo exploratório com um sistema generativo de projeto em processo de simulação e imersão, por meio do qual se pode avaliar o desenvolvimento e as alterações do projeto de implantação de conjunto habitacional social, ocasionadas pela variação das regras nos algoritmos criados. Inicialmente, se realizou a leitura Analítica da Gramática da Forma de um Conjunto Habitacional específico e, posteriormente, simulou-se em ferramenta computacional a Gramática da Forma Paramétrica, para futuros estudos de melhorias em conjuntos habitacionais similares. Tal ferramenta visa desenvolver soluções inovadoras em tecnologia da informação e comunicação aplicadas à construção e arquitetura. Os resultados demonstram a potencialidade do uso da Gramática da Forma, permitindo a inserção de novos parâmetros a cada momento, criando a perspectiva de flexibilidade na concepção e gerando diversas possibilidades que podem ser analisadas e comparadas durante o processo de tomada de decisão do projeto.

  18. A Sintaxe da Janela

    Directory of Open Access Journals (Sweden)

    Luís Antônio Jorge

    1993-12-01

    Full Text Available A preocupação fundamenta! do trabalho é de caráter ontológico: esboçar o problema das significações apriorísticas e autônomas dos elementos que compõem a sintaxe arquitetônica. O trabalho elege um desses elementos: a janela. Este artigo parte da aproximação histórica entre a janela e a secção da pirâmide visual, construção imaginária da teoria da perspectiva renascentista. A consideração da janela na linguagem arquitetônica implica reconhecer uma ambigüidade essencial: a janela deve inserir-se ordenadamente no plano da parede - raciocínio típico da modenatura - mas também relacionar-se com a imagem vista através dela, que extrapola o plano, ressaltando a tridimensionalidade - herança da perspectiva renascentista, fundamentada no espaço euclidiano. Ver janela ou ver através da janela são alternativas que se colocam tanto ao observador interno ao edifício, quanto ao externo. Texto de duplaface, a sintaxe da janela versa sobre o relacionamento desses dois lados

  19. ANÁLISE EXPERIMENTAL DA INFLUÊNCIA DA TECNOLOGIA HOMEPLUG NA QUALIDADE DA ENERGIA ELÉTRICA

    Directory of Open Access Journals (Sweden)

    Antonio Luiz Pereira de Siqueira Campos

    2008-03-01

    Full Text Available Trabalhos recentes têm estudado características do meio elétrico para a transmissão de dados, ruídos e técnicas empregadas na comunicação pela rede elétrica. A maioria dos trabalhos limita-se a fazer testes de desempenho do protocolo. Diversos pesquisadores têm se preocupado com a influência das transmissões de dados na rede elétrica sobre as comunicações sem fio, mas ninguém tem se preocupado com a influência dessas transmissões na qualidade da energia elétrica. Este trabalho apresenta resultados preliminares sobre o efeito produzido por redes de computadores que utilizam a tecnologia Homeplug 1.0 na qualidade da energia elétrica. Para isso, foram escolhidos parâmetros apropriados para análise da qualidade da energia elétrica, bem como, foram definidas as formas de se obter esses parâmetros. Foi montada uma rede de computadores, com modem’s PLC, no CEFET-RN e realizados testes iniciais para medição da qualidade de energia elétrica. Resultados numéricos são apresentados.

  20. O panorama das Drogas no México: da margem da sociedade ao centro da cultura

    Directory of Open Access Journals (Sweden)

    Diana Palaversich

    2013-12-01

    Full Text Available O artigo destaca o percurso das manifestações culturais ligadas ao tráfico de drogas no México, de um lugar marginal, de subcultura, na sociedade mexicana das décadas de 1970 e 1980, expressas principalmente através dos narcocorridos e do narcocine, para um lugar no mainstream cultural mexicano, desde o início do século 21, com destaque especial para a narcoliteratura. O aumento da violência, provocado pela guerra ao narcotráfico, produz uma proliferação da temática nos meios de comunicação e se reflete em áreas da cultura como as artes plásticas e a literatura, produzindo um novo tipo de expressão artística ou narrativa, que tanto pode ser oportunista e contribuir para a banalização da violência do narcotráfico como ser crítica e narrar o impacto individual e coletivo do tráfico de drogas, narrar a desenfreada e violenta realidade mexicana sem cair no estilo da imprensa marrom, do folclore ou dos lugares comuns dos romances de ação.

  1. Depressão e ansiedade em profissionais da educação das regiões da Amerios e da AMEOSC

    Directory of Open Access Journals (Sweden)

    Roque Strieder

    2010-07-01

    Full Text Available Estudos anteriores evidenciaram a existência de baixa autoestima em profissionais da educação. Esta, aliada ao sentimento de pessimismo, sensação de fracasso, culpa e autodepreciação, torna temeroso o sucesso de ações educacionais. São sentimentos que conduzem a atitudes de indecisão e irritabilidade; podem prejudicar o processo educacional e aprendente. Com o uso de escalas oficiais, da psicologia, propõe-se dimensionar a propensão a sintomas de depressão e ansiedade em professores das regiões da Amerios e da AMEOSC, como forma de contribuir com a tomada de decisões tanto em relação à qualificação quanto de ajuda a ser prestada aos professores. Foram envolvidos na pesquisa, aproximadamente, 20% dos professores da rede estadual e municipal das duas regiões. Eles responderam às questões dos formulários: Inventário de Depressão de Beck (depressão e Escala de Avaliação de Hamilton (ansiedade. Os resultados mostram que os professores pesquisados da rede estadual apresentam tendências a estados depressivos e de ansiedade superiores aos da rede municipal. Conclui-se que, para além da necessária qualificação profissional, os professores necessitam de outras formas de ajuda, como melhor compreensão do ambiente de trabalho, das formas inter-relacionais da atualidade, das formas de fortalecimento da autoestima e confiança, do reconhecimento humano, social e econômico; também, é importante elaborar estratégias de ação que impeçam a perda da autoestima; por último, reconhece-se que os professores precisam de atenção, ajuda e valorização.

  2. Controle da calogênese do pau-brasil in vitro In vitro calogenesis control of pau-brasil

    Directory of Open Access Journals (Sweden)

    Elias Terra Werner

    2009-12-01

    Full Text Available A indução da calogênese é a primeira etapa para obtenção de embriões e sementes. Para o controle da calogênese de Caesalpinia echinata, foram usados discos de foliólolos do pau-brasil em diferentes fases de desenvolvimento combinados com os fitorreguladores 2,4-D (0, 5, 10, 20, 50, 100 mg/L e 6-BAP (2,0 mg/L, cultivados em meio de cultura de Murashige e Skoog (1962 acrescido de sacarose (30 g/L, mioinositol (100 mg/L e ágar (7,5 g/L. Foi testado, também, o efeito de 6-BAP (0, 0,5, 1,0, 2,0, 5,0 e 10 mg/L no crescimento de ápices meristemáticos. Foliólolos juvenis cultivados com baixa concentração de 2,4-D (5 e 20 mg/L e foliólolos jovens tratados com altas concentrações de 2,4-D (50 e 100 mg/L geraram calos sem diferenças significativas entre luz e escuro. Quanto ao controle da oxidação, melhores resultados foram proporcionados pelo carvão ativado, porém inibidores da calogênese. A transferência dos calos do meio de cultura MS com altas concentrações de 2,4-D (5,0; 10,0; e 20,0 mg/L para meio sem fitorreguladores estimulou a formação de massas pró-embrionárias (MPEs. Os meios livres de fitorreguladores, 2,0 mg/L de 2,4-D e 0,5 mg/L de 2,4-D elevaram o número de calos embriogênicos e de massas pré-embrionárias. Somente em 0,5 mg/L 2,4-D se verificaram algumas estruturas semelhantes a embriões somáticos nas fases globular e codiforme.The present work dealt with the in vitro control of callogenesis of brazilwood. The induction of callogenesis is the first step to obtain embryos and seeds. In order to control the callogenesis of Caesalpinia echinata, leaf discs of brazilwood in different developmental stages were used combined with the growth regulators 2,4-D (0, 5, 10, 20, 50, 100 mg/L and 6-BAP (2,0 mg/L, cultivated in the Murashige and Skoog (1962 medium supplemented with sucrose (30 g/L, myo-inositol (100 mg/L and agar (7,5 g/L. The effect of 6-BAP (0, 0,5, 1,0, 2,0, 5,0 and 10 mg/L on the growth of

  3. Uso de medicamentos, glicemia capilar e índice de massa corpórea em pacientes com diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Márcio Flávio Moura de Araújo

    2013-10-01

    Full Text Available Objetivou-se relacionar o uso de medicamentos com a glicemia capilar e o índice de massa corpórea em pacientes com diabetes mellitus tipo 2. Estudo transversal realizado entre janeiro e julho de 2009, nos domicílios de 437 pacientes de doze centros de saúde de Fortaleza-CE. Utilizou-se um formulário para o registro das variáveis sociodemográficas e clinicas, glicemia capilar, índice de massa corpórea e uso de medicamentos. Dos pacientes com glicemia capilar normal, 93% não utilizavam antidepressivos / ansiolíticos (p = 0,02. Aproximadamente 99% dos que apresentavam a glicemia capilar elevada não utilizavam cálcio diariamente (p = 0,04. Entre aqueles com índice de massa corpórea normal, 45,5% tomavam diariamente anti-hipertensivos da classe inibidor da ECA (p = 0,03. O uso diário de drogas inibidoras da ECA, antidepressivos / ansiolíticos e cálcio apresentou associação com a glicemia capilar e o índice de massa corpórea, respectivamente. É importante que o enfermeiro avalie o peso corporal e a glicemia capilar dos pacientes com diabetes, em particular daqueles que fazem uso contínuo de medicamentos.

  4. Fresnel: O formulador matemático da teoria ondulatória da luz

    OpenAIRE

    Bassalo, José Maria Filardo

    1988-01-01

    Neste artigo, apresentamos alguns aspectos da vida de Fresnel, engenheiro e físico francês que se notabilizou pela formulação matemática da teoria ondulatória da luz, e cujo bicentenário de nascimento transcorre neste ano de 1988. Realçamos, neste trabalho, suas principais pesquisas relacionadas com o estudo da difração, dupla-refração e reflexão da luz, nas quais utilizou a idéia revolucionária de transversalidade da onda luminosa para deduzir equações, as quais explicaram alg...

  5. A TRANSFORMAÇÃO DA MEMÓRIA EM MERCADORIA: FIM DA PRODUÇÃO FABRIL E A CONTINUIDADE DA “MARCA”

    Directory of Open Access Journals (Sweden)

    Sílvia Aparecida Guarnieri Ortigoza

    2008-04-01

    Full Text Available O resgate da história da Fábrica de Chapéus Sarkis foi retratado neste estudo. Buscou-se analisar as influências da referida fábrica no município de Itapira, principalmente na organização e produção do centro urbano e no cotidiano dos citadinos. Seu fechamento foi entendido a partir das mudanças da moda mundial e de seus reflexos no lugar Itapira – SP, Brasil. Este estudo contempla uma análise regressiva do período (décadas de 1920 a 1960 em que o chapéu era um acessório indispensável na vida cotidiana das pessoas. Reencontrando o presente, procurou-se entender o conteúdo da forma espacial que hoje se encontra em vestígios. O estudo é singular por identificar no espaço geográfico itapirense atual a peculiaridade da transformação da tradição da fábrica em mercadoria.

  6. Didáctica da física e didáctica da química : experimentação no ensino da física e da química

    OpenAIRE

    Pereira, Alda

    1991-01-01

    Formação - Professores A componente experimental no ensino da Física e da Química. Experimentação na sala de aula e alguns exemplos. Disciplina “Didáctica da Física e da Química”, do Curso de Profissionalização em Exercício.

  7. The major histocompatibility complex genes impact pain response in DA and DA.1U rats.

    Science.gov (United States)

    Guo, Yuan; Yao, Fan-Rong; Cao, Dong-Yuan; Li, Li; Wang, Hui-Sheng; Xie, Wen; Zhao, Yan

    2015-08-01

    Our recent studies have shown that the difference in basal pain sensitivity to mechanical and thermal stimulation between Dark-Agouti (DA) rats and a novel congenic DA.1U rats is major histocompatibility complex (MHC) genes dependent. In the present study, we further used DA and DA.1U rats to investigate the role of MHC genes in formalin-induced pain model by behavioral, electrophysiological and immunohistochemical methods. Behavioral results showed biphasic nociceptive behaviors increased significantly following the intraplantar injection of formalin in the hindpaw of DA and DA.1U rats. The main nociceptive behaviors were lifting and licking, especially in DA rats (PDA rats were significantly higher than those in DA.1U rats in both phases of the formalin test (PDA rats was significantly higher than that of DA.1U rats (PDA was greater than that in DA.1U rats (PDA rats was significantly higher than that in DA.1U rats in the respective experimental group (PDA and DA.1U rats exhibited nociceptive responses in formalin-induced pain model and DA rats were more sensitive to noxious chemical stimulus than DA.1U rats, indicating that MHC genes might contribute to the difference in pain sensitivity. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. DIvERTICULE DE ZENKER

    African Journals Online (AJOL)

    origine de complications respiratoires aigues (détresse respiratoire aigue, pneumopathie d'inha- lation) ou chronique (bronchite chronique, asthme) qui surviennent dans 20 % des cas [8]. L'examen clinique est souvent normal. Cependant une.

  9. BIOTECNOLOGIA, DESENVOLVIMENTO E INOVAÇÃO: REFLEXÕES ACERCA DA PROPRIEDADE INTELECTUAL, LEI DE CULTIVARES E DA LICENÇA COMPULSÓRIA NO ÂMBITO DA BIOTECNOLOGIA

    Directory of Open Access Journals (Sweden)

    Fabiane Oliveira

    2014-12-01

    Full Text Available Considera-se o contexto dos processos de inovação e desenvolvimento no mundo moderno, a preocupação socioambiental e a tecnologia desenvolvida em função da agroindústria. Destaca-se a crescente importância conferida à biotecnologia na sociedade contemporânea. Reflete-se criticamente o estudo da propriedade intelectual no âmbito da biotecnologia em face do Estado e da inovação e do desenvolvimento. Busca-se, primeiramente, apresentar definição, origem e aspecto relevante da biotecnologia, a fim de tornar a sapiência desta ciência mais pragmática. Posto isso, elucida-se sobre a área de abrangência da proteção da propriedade intelectual nesse ramo da ciência. Nesse viés, ocupa-se também de demonstrar a Lei de Propriedade Intelectual mediante a problemática das patentes no setor biotecnológico. Observa-se, a seguir, o estudo da Lei de Cultivares em função da utilização do mecanismo de prospecção de patentes. Demonstra-se os aspectos importantes e o impacto da Lei de Cultivares no âmbito da propriedade intelectual. Exemplifica-se as cultivares protegidas. Apresenta-se a problemática da licença compulsória no âmbito da propriedade intelectual no ramo da biotecnologia. Objetiva-se demonstrar a situação desse ramo da ciência sob o prisma da propriedade intelectual, do fortalecimento e da padronização desses direitos. Expõe-se, por último, a importância da proteção dessa ciência para o desenvolvimento e para a inovação no país. Para isso, recorta-se a analise atual da Biotecnologia e da Propriedade Intelectual no Brasil sob o enfoque da legislação especifica e da hipótese da licença compulsória. Utiliza-se de pesquisa bibliográfica na área de biotecnologia, economia e direito, sob o enfoque da propriedade intelectual, inovação e do desenvolvimento.

  10. Angiotensina-(1-7 durante o processo inicial na cascata da ovulação em bovinos Angiotensin-(1-7 during the initial process of ovulatory cascade in cattle

    Directory of Open Access Journals (Sweden)

    Joabel Tonellotto dos Santos

    2012-10-01

    Full Text Available O presente estudo teve como objetivo avaliar o efeito da Ang-(1-7 e de seu receptor (MAS na regulação da ovulação. No experimento I, utilizando um modelo in vitro de cultivo de células foliculares, foi avaliado o efeito do tratamento com Ang-(1-7 ou do bloqueio do receptor MAS através do inibidor d-Ala7-Ang-(1-7 (A-779 na expressão de RNAm para epirregulina (Ereg; um marcador inicial do processo de ovulação em células da granulosa. No experimento II, foi utilizado um modelo in vivo de injeção intrafolicular no qual vinte vacas tiveram o ciclo estral sincronizado e, quando os folículos atingiram um diâmetro mínimo de 12mm, foi realizada a injeção intrafolicular de A-779 ou solução salina 0,9%. No momento da injeção intrafolicular, foi realizada uma aplicação IM de análogo de GnRH. A suplementação com Ang-(1-7 ou o bloqueio de seu receptor MAS em sistema de cultivo de células da granulosa não alteraram o padrão de expressão de RNAm para Ereg. A aplicação intrafolicular de A-779 (10-5M não bloqueou a ovulação quando realizada antes do início do pico esperado de LH (100% das vacas ovularam nos grupos A-779 e controle, sugerindo que a Ang-(1-7 não possui papel relevante no início da cascata ovulatória em bovinos.This study aimed to evaluate the effect of Ang-(1-7 and its receptor (MAS in the regulation of the ovulatory cascade. In the experiment I, the effect of Ang-(1-7 or d-Ala7-Ang-(1-7 (A-779; Ang-(1-7 antagonist on the epirregulin (Ereg; initial marker of ovulation process mRNA expression in granulosa cells was assessed using an in vitro model of follicular cell culture. In experiment II, it was used an in vivo intrafollicular injection model, in which twenty cows had their follicular waves synchronized and the ovarian follicular size was daily monitored by ultrasound. Follicles that reached a minimum diameter of 12mm were injected with A-779 or saline 0.9%. At the time of the intrafollicular injection

  11. O CAMINHAR DA CIÊNCIA DA INFORMAÇÃO E O XV ENCONTRO NACIONAL DE PESQUISA EM CIÊNCIA DA INFORMAÇÃO

    Directory of Open Access Journals (Sweden)

    Renata Maria Abrantes Baracho

    2014-10-01

    Full Text Available Este artigo descreve algumas características da Ciência da Informação como área do conhecimento e apresenta o Encontro Nacional de Pesquisa em Ciência da Informação (ENANCIB como o evento seminal da área. Busca-se criar a memória do ENANCIB, promovido pela Associação Nacional de Pesquisa e Pós-Graduação em Ciência da Informação (ANCIB, desde a sua criação em 1994, ao longo de suas quinze edições. O ENANCIB congrega pesquisadores e programas de pós-graduação nacionais, além de propiciar um fórum para discussão dos temas de pesquisa da área. Em 2014, o XV ENANCIB tem lugar em Belo Horizonte – Minas Gerais e é organizado pelo Programa de Pós-Graduação em Ciência da Informação (PPGCI da Escola de Ciência da Informação (ECI da Universidade Federal de Minas Gerais de Minas Gerais (UFMG. No âmbito do PPGCI, nasceu a percepção de que o evento deveria propor a discussão sobre como as mais recentes tecnologias da informação e da comunicação têm alterado a sociedade e a forma de interagir das pessoas, bem como o papel relevante da Ciência da Informação nesse contexto. Os dispositivos móveis, nuvens, big data, linked data, dentre outras formas de interagir com a informação têm causado transformações em vários âmbitos e exigido novas abordagens para os estudos em CI. O tema do XV ENANCIB “Além das `nuvens´: expandindo as fronteiras da Ciência da Informação”, proporciona a oportunidade para refletir sobre essas mudanças que impactam na interação humana com a informação, bem como sobre suas implicações para o futuro da CI.

  12. ESTUDO DA ALTERAÇÃO DA COR E DEGRADAÇÃO DA CLOROFILA DURANTE ARMAZENAGEM DE ERVA-MATE TIPO CHIMARRÃO

    OpenAIRE

    Gisela Cabral Malheiros

    2007-01-01

    A Ilex paraguariensis A. St.-Hill., conhecida popularmente como erva-mate, é uma espécie nativa da região subtropical da América do Sul, a qual é matéria-prima para o produto ervamate, utilizado principalmente no preparo da bebida chimarrão. Dentre os atributos sensoriais da erva-mate tipo chimarrão, a cor constitui o primeiro critério utilizado pelo consumidor para sua aceitabilidade. A cor verde da erva-mate deve-se à presença de clorofila. Ocorrem perdas expressivas de clorofila no proc...

  13. Efeito de drogas utilizadas no tratamento de hipertensão arterial sistêmica sobre a pressão intra-ocular: estudo experimental no cão

    Directory of Open Access Journals (Sweden)

    Hashimoto Mitsuo

    2002-01-01

    Full Text Available Objetivo: Estudar os efeitos de duas drogas utilizadas no tratamento de hipertensão arterial sistêmica (captopril e propranolol sobre a pressão intra-ocular (PIO e pressão de perfusão (PP em cães anestesiados. Métodos: Foram estudados 24 cães, divididos em 3 grupos de 8. No primeiro grupo (GI, foi administrado captopril (um inibidor da enzima conversora de angiotensina na dose de 1,5 mg/kg por via endovenosa. No segundo grupo (GII, foi administrado propranolol (um beta-bloqueador na dose de 1,5 mg/kg por via endovenosa. O terceiro grupo (GIII foi o grupo controle. A PIO e a pressão arterial média (PAm foram medidas por manometria. A pressão de perfusão (PP foi calculada pela diferença entre a PAm e a PIO. A freqüência cardíaca (FC foi monitorada com oxímetro de pulso. Os parâmetros foram estudados em 6 momentos (0, 10, 30, 60, 90 e 120 minutos. Resultados: Houve redução estatisticamente significativa da PIO (p<0,05 nos grupos em que foram administrados captopril e propranolol, sem diferença entre as drogas. Com captopril, houve redução da PAm e da PP aos 10 e 30 minutos. Com propranolol, não houve redução da PAm ou da PP. Conclusão: Houve redução da PIO com uso do captopril e também do propranolol. Entretanto, a redução acentuada da PAm e da PP causadas pelo captopril, podem ser indesejáveis para a irrigação do nervo óptico.

  14. Effect of arachidonic acid supplementation and cyclooxygenase/lipoxygenase inhibition on the development of early bovine embryos Influência do ácido araquidónico e da inibição da ciclo-oxigenase ou lipo-oxigenase no desenvolvimento inicial de embriões bovinos

    Directory of Open Access Journals (Sweden)

    Rosa Maria Pereira

    2006-04-01

    Full Text Available The effect of arachidonic acid (AA cascade on bovine embryo development in a granulosa cell co-culture system was studied. Arachidonic acid (100 µM was supplemented from 1-cell to 8-16 cell block stage (first three days of co-culture and from 1-cell to hatching. Specific cyclooxygenase (indomethacin, 28 µM and lipoxygenase (nordihydroguaiaretic acid - NDGA, 28 µM inhibitors were used from 1-cell to 8-16 cell block stage with AA. Embryo development was assessed by cleavage, day 7-day 8 and hatched embryo rates and by measuring growth rates through development stages found in days 7-10 of culture (day 0 = insemination day. Embryo quality was scored at day 8. A 6.5-10.4% increase on cleavage rate after AA supplementation was found. This AA supplementation from 1-cell to hatching delayed embryo growth rate beyond day 7 and a reduction on hatching rate was detected. When AA supplementation was restricted to the first three days of co-culture those negative effects were overcome. Also, indomethacin and NDGA prevented the positive effect of AA and induced a significant reduction on cleavage, respectively. NDGA further decreased day 7 embryo rate and quality. Results suggest that AA has a two-phase action on bovine embryos, promoting early development and impairing embryo growth from day 7 onwards and hatching rates. Both cyclooxygenase and lipoxygenase were found to be important pathways to promote cleavage.Estudou-se a influência da cascata do ácido araquidónico (AA no desenvolvimento de embriões bovinos produzidos in vitro em co-cultura com células da granulosa. Os embriões foram suplementados com AA (100 µM desde o estádio de 1 célula até 8-16 células (primeiros três dias de co-cultura ou até a eclosão. Introduziram-se inibidores específicos da ciclo-oxigenase (indometacina, 28 µM e da lipo-oxigenase (ácido nordihidroguaiarético - NDGA, 28 µM, juntamente com o ácido araquidónico, desde o estádio de 1 célula até 8-16 c

  15. Outcomes of cancer surgery after inhalational and intravenous anesthesia

    DEFF Research Database (Denmark)

    Soltanizadeh, Sinor; Degett, Thea H; Gögenur, Ismail

    2017-01-01

    Perioperative factors are probably essential for different oncological outcomes. This systematic review investigates the literature concerning overall mortality and postoperative complications after cancer surgery with inhalational (INHA) and intravenous anesthesia (TIVA). A search was conducted...

  16. ARTIMANHAS DA HEGEMONIA: OBSTÁCULOS À RADICALIZAÇÃO DA DEMOCRACIA NO BRASIL

    Directory of Open Access Journals (Sweden)

    Frederico Alves Costa

    Full Text Available Resumo Este artigo apresenta como foco o debate sobre dificuldades na construção da luta política na contemporaneidade brasileira, mais especificamente nos últimos anos do governo do Presidente da República Luiz Inácio Lula da Silva. Objetiva-se, a partir do diálogo entre a Teoria Democrática Radical e Plural - desenvolvida por Ernesto Laclau e Chantal Mouffe - e posicionamentos de representantes de diferentes grupos de movimentos sociais brasileiros, discutir dois modos de resistência da hegemonia a alternativas de democratização da sociedade. Esses modos, concebidos como artimanhas da hegemonia, são denominados expansão hegemônica e expurgo à diferença. O debate contribui para a análise sobre estratégias políticas no campo da psicologia social.

  17. Responsabilidade Social das empresas: a contraface da sociedade civil e da cidadania

    Directory of Open Access Journals (Sweden)

    Simionatto, Ivete

    2006-01-01

    Full Text Available O artigo tem como objeto o estudo das mudanças que vêm ocorrendo nas relações entre Estado e sociedade civil e sua manifestação específica nas propostas articuladas em torno da responsabilidade social das empresas. Parte-se da hipótese de que estas práticas vêm contribuindo para a formação de consensos que fortalecem a hegemonia do capital na atualidade, mediante a redução do papel do Estado e o fortalecimento da esfera privada como setor de regulação social. Este cenário indica mudanças nas relações entre Estado e sociedade civil, uma vez que a responsabilidade social das empresas manifesta-se como uma nova proposta de sociabilidade e de resposta às expressões da questão social. Por fim, identifica-se que os serviços sociais oferecidos através da responsabilidade social fortalecem o campo do voluntariado, da solidariedade e das instituições do terceiro setor, precarizam o trabalho do Assistente Social com rebatimentos na esfera da cidadania e dos demais valores e princípios que sustentam o projeto ético-político da profissão

  18. Avaliação da doença vascular do enxerto no transplante cardíaco: experiência de um centro brasileiro Assessment of cardiac allograft vasculopathy in cardiac transplantation: experience of a Brazilian center

    Directory of Open Access Journals (Sweden)

    Elide Sbardellotto Mariano da Costa

    2012-10-01

    Full Text Available FUNDAMENTO: O transplante cardíaco continua sendo o tratamento de escolha para a insuficiência cardíaca refratária ao tratamento otimizado. Dois métodos diagnósticos apresentam elevada sensibilidade no diagnóstico de episódios de rejeição ao enxerto e Doença Vascular do Enxerto (DVE, causas importantes de mortalidade no pós-transplante. OBJETIVO: Avaliar a relação entre os resultados do ultrassom intracoronariano (USIV e os laudos das biópsias endomiocárdicas (BX no seguimento de pacientes submetidos a transplante cardíaco em um serviço de referência brasileiro. MÉTODOS: Foi realizado um ensaio epidemiológico retrospectivo observacional, com pacientes submetidos a transplante cardíaco ortotópico, no período de 2000 a 2009. Foram analisados os prontuários desses pacientes e os resultados dos USIV e BX realizados rotineiramente no seguimento clínico pós-transplante e terapêutica em uso. RESULTADOS: Dos 77 pacientes analisados, 63,63% são do sexo masculino, nas faixas etárias de 22 a 69 anos. Quanto aos resultados dos USIV, 33,96% foram classificados em Stanford classe I, e 32,08%, como Stanford IV. Dos 143 laudos das biópsias, 51,08% tiveram resultado 1R, 3R em 0,69% dos laudos, e 14,48% apresentaram a descrição de efeito Quilty. Todos usaram antiproliferativos, 80,51% usaram inibidores da calcineurina e 19,48% usaram inibidores do sinal de proliferação (ISP. CONCLUSÃO: A avaliação dos pacientes pós-transplante cardíaco por meio do USIV incorpora informações detalhadas para o diagnóstico precoce e sensível da DVE, que são complementadas pelas informações histológicas fornecidas pelas BX, estabelecendo uma possível relação causal entre a DVE e os episódios de rejeição humoral.BACKGROUND: Cardiac transplantation continues to be the treatment of choice for heart failure refractory to optimized treatment. Two methods have high sensitivity for diagnosing allograft rejection episodes and cardiac

  19. An extension of PPLS-DA for classification and comparison to ordinary PLS-DA.

    Directory of Open Access Journals (Sweden)

    Anna Telaar

    Full Text Available Classification studies are widely applied, e.g. in biomedical research to classify objects/patients into predefined groups. The goal is to find a classification function/rule which assigns each object/patient to a unique group with the greatest possible accuracy (classification error. Especially in gene expression experiments often a lot of variables (genes are measured for only few objects/patients. A suitable approach is the well-known method PLS-DA, which searches for a transformation to a lower dimensional space. Resulting new components are linear combinations of the original variables. An advancement of PLS-DA leads to PPLS-DA, introducing a so called 'power parameter', which is maximized towards the correlation between the components and the group-membership. We introduce an extension of PPLS-DA for optimizing this power parameter towards the final aim, namely towards a minimal classification error. We compare this new extension with the original PPLS-DA and also with the ordinary PLS-DA using simulated and experimental datasets. For the investigated data sets with weak linear dependency between features/variables, no improvement is shown for PPLS-DA and for the extensions compared to PLS-DA. A very weak linear dependency, a low proportion of differentially expressed genes for simulated data, does not lead to an improvement of PPLS-DA over PLS-DA, but our extension shows a lower prediction error. On the contrary, for the data set with strong between-feature collinearity and a low proportion of differentially expressed genes and a large total number of genes, the prediction error of PPLS-DA and the extensions is clearly lower than for PLS-DA. Moreover we compare these prediction results with results of support vector machines with linear kernel and linear discriminant analysis.

  20. O clássico e o emergente: desafios da produção, da divulgação e da utilização do conhecimento da Enfermagem

    Directory of Open Access Journals (Sweden)

    Márcia de Assunção Ferreira

    2013-09-01

    Full Text Available Reflexão sobre os paradigmas da ciência e os desafios contemporâneos da produção, divulgação e utilização do conhecimento. Abordam-se os desafios relativos à pesquisa do cuidado de enfermagem, os recursos e as estratégias políticas da área para superá-los. Os argumentos se amparam na Enfermagem como disciplina prática e na tríade ensinar-cuidar-pesquisar voltada às demandas dos usuários, com vistas à promoção da saúde e bem-estar, dentro de um paradigma de cuidado. Articular os modelos de ciência, ampliar os recursos humanos, materiais e financeiros, investir nos mestrados profissionais, na ampliação dos programas de pós-graduação acadêmicos e na formação de redes de cooperação são alguns dos desafios e estratégias apontados para que a área enfrente as lutas do campo hegemônico da saúde, da ciência e da tecnologia para se manter no sistema.

  1. Dimensão da maturidade à luz da logoterapia

    Directory of Open Access Journals (Sweden)

    Libardi, Tadeu Antonio

    2008-01-01

    Full Text Available O artigo aborda o tema da maturidade humana à luz da logoterapia, fundada por Viktor Emil Frankl. Nos dias de hoje, existe a frustração existencial, não mais a sexual, como analisada por Freud. Cada ser humano, como pessoa livre e responsável e tendo como meta a busca da maturidade, vai percorrendo seu próprio caminho, que o leva à ceitação de si, de seus limites e potencialidades e ao relacionamento social e religioso, capacitando-o ao confronto com o sofrimento humano

  2. A metodologia de projecto na aprendizagem da biodiversidade e geodiversidade na praia da concha

    OpenAIRE

    Rosa, Marina Maria Filipe

    2012-01-01

    Dissertação de mestrado em Biologia e de Geologia, apresentada ao Departamento de Ciências da Terra e ao Departamento de Ciências da Vida Este trabalho consistiu na implementação e avaliação da metodologia de projeto no estudo da Biodiversidade e Geodiversidade na Praia da Concha, Portugal Central, dando ênfase ao trabalho prático, através de uma aula de campo e de aulas laboratoriais. O trabalho foi realizado numa escola da Marinha Grande, com 11 alunos do 10º ano de escolaridade. Sendo a...

  3. Influência da idade da planta e da maturação dos frutos no momento da colheita na qualidade do café

    Directory of Open Access Journals (Sweden)

    Borges Fernanda Barbosa

    2002-01-01

    Full Text Available São de grande importância os cuidados no preparo do café desde a colheita até o consumo e o estudo de parâmetros que possam influenciar na classificação comercial do grão e na qualidade da bebida. Teve-se como objetivos analisar a influência da idade das plantas, pertencentes à mesma variedade, e dos estágios de maturação dos grãos (secos, cerejas e verdes no resultado da classificação comercial e na qualidade da bebida. Realizou-se a colheita, por derriça no pano, de uma área com café arábica variedade Catuaí de 12 anos e de outra de 3 anos. Constituiu-se, para cada idade das plantas, os seguintes lotes: 100% cereja, 60% cereja e 40% verde, 80% cereja e 20% verde, 60% cereja e 40% seco, 80% cereja e 20% seco, e composição obtida na colheita. Na classificação comercial, obedeceu-se as normas estabelecidas pela Tabela Oficial Brasileira de Classificação (tipo, peneira, aspecto, cor e seca. Na classificação da bebida, optou-se por utilizar consumidores como provadores, com o objetivo de analisar a aceitabilidade da bebida pelo mercado consumidor. Como resultados, obteve-se, na classificação por tamanho e determinação de peneira média que os lotes de 12 anos apresentaram-se, com peneira média 15, resultado inferior aos lotes de 3 anos, com peneira média 16. Na classificação comercial e na da bebida, os resultados foram melhores, em geral, para os lotes de 3 anos em diferentes misturas, sem influência dos diferentes estágios de maturação.

  4. Estudos organizacionais, (descolonialidade e estudos da dependência: as contribuições da Cepal

    Directory of Open Access Journals (Sweden)

    Sergio Wanderley

    Full Text Available O objetivo deste artigo é (revisitar o conceito de dependência como categoria de investigação da (e a partir da América Latina, por meio de uma perspectiva histórica crítica descolonial, a fim de ampliar o espaço de debates em estudos organizacionais e promover alternativas à ordem neoliberal. Este ensaio terá como foco os estudos da dependência realizados pela Comissão Econômica para a América Latina e o Caribe (Cepal durante a década de 1950 e o início dos anos 1960. A perspectiva descolonial é um constructo teórico de autores latino-americanos que se consideram herdeiros da longa tradição do pensamento social crítico da região, na qual a teoria da dependência está inserida. As propostas dos autores da dependência confrontaram as principais teorias ortodoxas do Norte produzidas à época. A partir do conceito de centro-periferia, da denúncia de assimetrias nas relações entre essas regiões, do reconhecimento da interdependência entre desenvolvimento e subdesenvolvimento, o conceito de dependência foi sendo (reelaborado nas décadas de 1950 e 1960 por diversos autores latino-americanos como uma categoria de investigação da realidade da (e a partir da região. Essas investigações tinham por objetivo não somente elaborar constructos teóricos, mas, também, transformar a realidade por meio da criação de diversas organizações e instituições que deveriam servir ao propósito de superar o subdesenvolvimento. A denúncia da historicidade da situação de subdesenvolvimento desnudou o caráter de neutralidade do economicismo das teorias produzidas no Norte e promoveu um encontro teórico entre economia e política que muito tem a contribuir com a área dos estudos organizacionais.

  5. Evaluation of HIV-Leishmania co-infection in patients from the northwestern Paraná State, Brazil = Avaliação da co-infecção HIV-Leishmania em pacientes da região noroeste do Estado do Paraná, Brasil

    Directory of Open Access Journals (Sweden)

    Élide Aparecida Oliveira

    2011-01-01

    pelo HIV também apresentavam o DNA de Leishmania (Viannia, detectável no sangue por PCR. A sorologia, pesquisa direta de Leishmania, cultura e PCR de lesões de pele foram negativas. A positividade da PCR não estava associada à contagem de linfócitos T CD4+, doença oportunista, tratamento, uso de inibidores de protease, tatuagem, uso de drogas injetáveis, ambiente da residência ou história prévia de LTA. Os resultados mostraram que indivíduos portadores do vírus HIV que residem em área endêmica podem apresentar o DNA de Leishmania sem manifestar sintomas de LTA. Estes resultados podem ser atribuídos a ação dos medicamentos anti retrovirais que controlam a replicação viral mantendo a integridade do sistema imunológico ou a uma possível atividade anti-Leishmania destas drogas.

  6. Estatuto da cidade e juridificação da reforma urbana no Brasil

    OpenAIRE

    Ana Paula Soares Carvalho

    2012-01-01

    O início da década passada foi marcado por um importante evento relacionado ao tratamento das questões urbanas no Brasil. Em dez de julho de 2001, foi promulgada a Lei Federal n 10.257, conhecida como Estatuto da Cidade, que regulamenta o capítulo da política urbana da Constituição de 1988. O Estatuto da Cidade provê suporte legal consistente para aquelas municipalidades comprometidas com o enfrentamento dos problemas sociais e urbanos que afetam diariamente as condições de vida dos habitante...

  7. A identidade à flor da pele: etnografia da prática da tatuagem na contemporaneidade

    Directory of Open Access Journals (Sweden)

    Andrea Lissett Pérez

    2006-04-01

    Full Text Available No presente artigo, realiza-se uma descrição etnográfica da prática da tatuagem na contemporaneidade, a partir de uma perspectiva que prioriza as noções da prática, das interações e das experiências vividas durante o processo de ser tatuado. A reflexão tenta reconstruir uma visão total da prática da tatuagem que abrange o mundo subjetivo e as dinâmicas sociais como partes constitutivas desse ato. Entre as idéias conclusivas estão, de um lado, o surgimento de uma nova normalidade estética e vivencial no seio da sociedade ocidental e, de outro, a configuração de uma nova subjetividade, a dos "tatuados", como um processo interativo, inovador, emotivo e reflexivo, em que o corpo se converte em uma forma de expressão e construção do sujeito.This article provides a descriptive account of contemporary tattooing, based on a perspective that prioritizes the notion of practice, as well as the interactions and experiences involved in the process of being tattooed. The analysis attempts to rebuild a holistic view of tattooing, combining subjective processes and social dynamics as equally constitutive parts of this activity. Among the conclusions reached are: (a the emergence of tattooing as a new aesthetic norm and a lived experience at the heart of the western society; and (b the configuration of a new subjectivity, the ‘tattooed,’ as an interactive, innovative, emotional and reflexive process in which the body is converted into a form of expressing and constructing the subject.

  8. CONDICIONANTES DA COMPETITIVIDADE EMPRESARIAL

    Directory of Open Access Journals (Sweden)

    José Luiz Contador

    2010-03-01

    Full Text Available Este trabalho examina teoricamente os fatores determinantes da competitividade do produto e do negócio, imprescindíveis à elaboração de estratégias competitivas que visam à obtenção e sustentação de vantagens competitivas. Esse tema é objeto tanto da área de marketing estratégico quanto da de estratégia empresarial. Nas duas áreas, há um ponto de consenso que afirma que a empresa deve diferenciar sua oferta para conquistar e manter vantagem competitiva. Mas, os estudos conduzidos por meio do modelo de Campos e Armas da Competição revelaram que a empresa pode diferenciar seu produto e/ou serviço de modo mais amplo, levando em consideração, na formulação da sua estratégia competitiva, também o campo da competição, quer do produto, quer dela própria. Assim, o objetivo deste artigo é evidenciar que, para a empresa ser competitiva, além de diferenciar seu produto e/ou seu serviço no sentido tradicional, ela precisa: 1 diferenciar seu produto incluindo a definição em quais campos vai competir em cada segmento; e 2 escolher as armas da competição que irá utilizar e definir a intensidade de cada arma. Para atingir tal objetivo, foram necessários vários conceitos do modelo de Campos e Armas da Competição: campo da competição, arma da competição, tese do modelo, configuração dos campos da competição, campo coadjuvante, produto coadjuvante e par produto-mercado. Como uma proposta inovadora sempre desperta dúvida, é mostrado o processo de validação do modelo de Campos e Armas da Competição e são discutidas sua universalidade, consistência e completude.

  9. Estudo da Concentração de Mercado ao Longo da Cadeia Produtiva da Soja no Brasil

    Directory of Open Access Journals (Sweden)

    Nilson Luiz Costa

    2014-12-01

    Full Text Available O objetivo da presente pesquisa foi mensurar a concentração de mercado ao longo da cadeia produtiva da soja. A partir dessas informações tornou-se possível avaliar se as estratégias para manter e ampliar o poder de mercado e a governança ao longo da cadeia produtiva da soja resultam em sucesso, captação do excedente do produtor rural de soja e competitividade da agroindústria processadora do grão. Neste contexto, foram calculados o Market Share, a Relação de Concentração e do Índice de Herfindahl-Hirschmann. Confirmou-se a hipótese de que o mercado que fornece insumos para os produtores rurais de soja está altamente concentrado. A hipótese de elevada concentração no segmento de aquisição e processamento da soja também foi confirmada.  Concluiu-se que o produtor rural de soja encontra-se em situação de fragilidade econômica, pois: a adquire insumos em mercado oligopolizado e vende a produção em mercado oligopsonizado; b as empresas dominantes estão protegidas por barreiras à entrada. Diante deste cenário e das análises realizadas, cabe ao Estado brasileiro definir a forma de inserção dos agentes nacionais, em especial do produtor rural: se será caracterizado como um instrumento de acumulação do capital internacional ou se participará dos ganhos e se constituirá como agente de desenvolvimento regional. 

  10. Gramsci e o debate em torno da filosofia da prÃxis

    OpenAIRE

    Jecson GirÃo Lopes

    2013-01-01

    A presente dissertaÃÃo margeia em torno da discussÃo sobre a maneira pela qual Gramsci debate com os autores de seu tempo, principalmente com Nicolai BukhÃrin, defensor, segundo Gramsci, de um marxismo vulgar, devido sua compreensÃo mecanicista (economicista), fatalista, pelo uso do positivismo na filosofia da prÃxis, marxismo, (materialismo vulgar) e Benedetto Croce, a partir de sua ideia revisionista da filosofia da prÃxis (neo-idealismo: historicismo idealista, conforme Gramsci), como send...

  11. Estado da arte da S.C.I.E. desde 1951 a 2008 e a sua aplicação como especialidade da engenharia

    OpenAIRE

    Borges, Carlos Avelino Ferreira

    2013-01-01

    No âmbito da dissertação apresentada à Universidade da Madeira para cumprimento dos requisitos necessários à obtenção do grau de Mestre em Engenharia Civil, foi desenvolvida uma pesquisa na área da Segurança Contra Incêndio em Edifícios, abreviadamente designada por SCIE, desde 1951 a 2008 e a sua aplicação como especialidade da Engenharia, designadamente ao nível da fenomenologia da combustão, no que concerne à evolução histórica dos organismos, legislação, normas técnicas e factos his...

  12. MANEJO DA IRRIGAÇÃO DA CULTURA DA ALFACE (Lactuca sativa L. ATRAVÉS DO TANQUE CLASSE A

    Directory of Open Access Journals (Sweden)

    ANDRADE JÚNIOR A.S. de

    1997-01-01

    Full Text Available Com o objetivo de avaliar o efeito de diferentes níveis de irrigação, baseados em frações da evaporação do Tanque Classe A (ECA (0,25; 0,50; 0,75 e 1,00 sobre o comportamento produtivo da cultura da alface, variedade "Mesa 659" (tipo americana, cultivada em uma estufa plástica e irrigada por gotejamento, foi conduzido um experimento durante o período de julho a setembro de 1993. O comportamento produtivo foi avaliado através da determinação da matéria fresca (MFP, produtividade (PROD e eficiência do uso de água (EUA. Os resultados de MFP e PROD mostraram resposta quadrática, indicando acréscimo em ambos à medida que aumentaram as lâminas de irrigação aplicadas até o nível 0,75 da ECA, apresentando valores máximos de 818,72 g e 90,97 t.ha-1, respectivamente. Os dados relativos à EUA revelaram resposta linear decrescente, significando que à medida que os níveis de irrigação aumentam ocorre uma diminuição na EUA.

  13. Da ordem. Da cidade. Da literatura: personagens à beira do "ruim do mundo"

    Directory of Open Access Journals (Sweden)

    Eliana Kuster

    2007-12-01

    Full Text Available As grandes cidades estão doentes. Seus sintomas: a quebra da sociabilidade e a irrupção rotineira da violência. Diante disso, ecoa na sociedade um clamor por ordem. No mesmo momento em que a polícia põe a tropa na rua, os literatos criam personagens que dão voz à sensação crescente de que a cidade está deixando de ser uma referência à constituição das identidades urbanas. É a partir da literatura, em especial da obra do escritor Rubem Fonseca, que iremos perscrutar as possibilidades apresentadas pela cidade para o convívio humano.The great cities are sick. Its indications: the sociability in addition and the routine irruption of the violence. Ahead of this, a outcry for order echoes in the society. At the same moment where the policy goes to the street, the writers create personages who give voice to the increasing sensation of that the city is leaving of being a reference to the constitution of the urban identities. It is from literature, in special of the writer Rubem Fonseca, that we will go to investigate the possibilities presented for the city for the human conviviality.

  14. Instrumento mensurador de adesao para hipertensos: contribuicao da Teoria da Resposta ao Item

    Directory of Open Access Journals (Sweden)

    Malvina Thais Pacheco Rodrigues

    2013-06-01

    Full Text Available OBJETIVO: Analisar instrumento de medição da adesão ao tratamento da hipertensão por meio da "Teoria da Resposta ao Item". MÉTODOS: Estudo analítico com 406 hipertensos com complicações associadas, atendidos na atenção básica em Fortaleza, CE, 2011, pela "Teoria da Resposta ao Item". As etapas de execução foram: teste de dimensionalidade, calibração dos itens; tratamento dos dados e construção da escala, analisadas com base no modelo de resposta gradual. Estudo da dimensionalidade do instrumento foi feito pela análise da matriz de correlação policórica e análise fatorial de informação completa. Utilizou-se o software Multilog para calibração dos itens e estimação dos escores. RESULTADOS: Os itens referentes ao tratamento medicamentoso foram os mais diretamente relacionados à adesão, enquanto aqueles referentes ao tratamento não medicamentoso precisam ser reformulados, pois possuíram menor quantidade de informação psicométrica e baixa discriminação. A independência dos itens, o reduzido número de níveis da escala e as baixas variâncias explicadas no ajuste dos modelos mostraram as principais fragilidades do instrumento analisado. A "Teoria da Resposta ao Item" mostrou-se relevante para análise, pois avaliou o respondente quanto à adesão ao tratamento da hipertensão, ao nível de dificuldade dos itens e à sua capacidade de discriminação entre indivíduos com diferentes níveis de adesão, o que gerou maior quantidade de informação. CONCLUSÕES: O instrumento analisado é limitado para medir a adesão ao tratamento da hipertensão, mediante análise pela "Teoria da Resposta ao Item", e necessita de ajustes. A adequada formulação dos itens é importante para medir precisamente o traço latente desejado.

  15. Impacto da abertura comercial sobre a produtividade da indústria brasileira

    OpenAIRE

    Silva, Danielle Barbosa Lopes da

    2004-01-01

    Dentro do atual contexto econômico brasileiro, não existem dúvidas da importância de se discutir o tema produtividade industrial. Dentre os vários benefícios que um aumento da produtividade industrial pode gerar, há de se destacar a manutenção de preços baixos, a redução das taxas de juros e aumento do investimento e consumo. Além disso, o aumento da produtividade industrial ao reduzir o custo da produção e aumentar a sua escala, torna os produtos nacionais com preços mais competitivos no com...

  16. A circulação da experiência da dor em narrativas no Facebook

    Directory of Open Access Journals (Sweden)

    Marlon Santa Maria Dias

    2017-07-01

    Full Text Available Este trabalho reflete alguns aspectos da problemática da circulação na ambiência da midiatização. A partir de material coletado em um grupo de discussão no Facebook sobre a mobilização “Eu não mereço ser estuprada”, analisamos as estratégias discursivas que compõem os processos de enunciação da mobilização dos atores sociais. Apontamos a reconfiguração narrativa na circulação da experiência da dor e a criação de redes interativas de apoio e aconselhamento.

  17. Diagnóstico e tratamento da tuberculose latente em pacientes com doenças inflamatórias crônicas e uso de imunobiológicos inibidores do TNF-α Diagnosis and treatment of latent tuberculosis in patients with chronic inflammatory diseases: use of TNF-alpha-targeting biological products

    Directory of Open Access Journals (Sweden)

    Diana Maria de Almeida Lopes

    2011-06-01

    Full Text Available OBJETIVO: Traçar o perfil clínico-epidemiológico de pacientes candidatos ao uso de fármacos anti-TNF-α diagnosticados como portadores de tuberculose latente (TBL e avaliar os desfechos do tratamento profilático com isoniazida. MÉTODOS: Análise descritiva prospectiva seguida de um estudo analítico observacional transversal dos desfechos do tratamento profilático em um grupo de 45 candidatos ao uso de fármacos anti-TNF-α. A avaliação dos pacientes constou de anamnese, exame clínico, radiografia de tórax e teste tuberculínico (TT por Mantoux. RESULTADOS: A idade média dos pacientes foi 45 anos, e 56,0% dos pacientes eram mulheres. Doenças reumatológicas crônicas, doenças dermatológicas crônicas e doença de Crohn estavam presentes em 46,7%, 40,0% e 13,3% dos pacientes, respectivamente. A média de enduração do TT foi 14,6 mm (variação: 5-30 mm. A maioria dos pacientes (n = 30; 66,7% apresentou enduração > 10 mm. Dos 16 pacientes com cicatriz vacinal BCG, a média de enduração foi de 15,7 mm, sendo que 14 tiveram enduração > 10 mm. Os resultados de radiografia de tórax foram considerados normais e com alterações mínimas em 64,4% e em 35,6%, respectivamente. Apenas 1 paciente (2,2% abandonou o tratamento com isoniazida, 41 (91,2% completaram o tratamento, 2 (4,4% tiveram de interromper o tratamento por hepatite medicamentosa, e 1 (2,2% foi transferido para outro hospital. Dos que completaram o tratamento, 5 apresentaram efeitos colaterais leves. CONCLUSÕES: A determinação do perfil dos candidatos ao uso de inibidores do TNF-α é importante para o manejo do tratamento da TBL, bem como para estabelecer protocolos clínicos de uso e acompanhamento do uso desses fármacosOBJECTIVE: To determine the clinical and epidemiological profile of patients who are candidates for TNF-α inhibitor use and are classified as having latent tuberculosis (LTB, as well as to evaluate the outcomes of prophylactic treatment with

  18. Da Dor no Corpo à Dor na Alma: O Conceito de Violências Psicológicas da Lei Maria Da Penha

    Directory of Open Access Journals (Sweden)

    Isadora Vier Machado

    2015-05-01

    Full Text Available Este artigo expõe os resultados de pesquisa de campo, realizada entre dezembro de 2010 e julho de 2011 em uma cidade do Sul do Brasil, a respeito da instrumentalização do conceito de violências psicológicas, trazido pela Lei Maria da Penha (Lei 11.340/06, a fim de construir uma leitura da lei a partir deste conceito. Os dados são referentes às/aos agentes que compõem o corpus da polícia, na Delegacia da Mulher e do Ministério Público do município, prioritariamente. Nesses locais, buscou-se compreender como o conceito de violências psicológicas é trabalhado pelas/os agentes e qual o significado teórico-prático que o subjaz. Enfim, coloca-se este dispositivo da lei em posição de questionar a sua própria implementação, de pensar as mudanças que se operam na condição de mulheres em situação de violências e de problematizar as relações entre local e global no campo estudado. A metodologia utilizada foi composta por pesquisa de inspiração etnográfica e levantamento bibliográfico nos campos do Direito, da Psicologia e da Antropologia.

  19. O “Estado da Arte” da produção acadêmica sobre o fenômeno da judicialização da saúde no Brasil

    OpenAIRE

    Bittencourt, Guaraci Bragança

    2016-01-01

    A saúde é um tema muito estudado no Brasil, haja vista a grande quantidade de estudos nos campos da saúde pública, saúde coletiva, epidemiologia, bioética, dentre tantos outros. No entanto, o tema da saúde, como um direito, pode ser considerado uma temática recente. Este trabalho realizou uma análise da produção acadêmica, entre os anos de 2010 e 2014 sobre judicialização da saúde, por meio de revisão de literatura, realizada em dois bancos de dados. A produção acadêmica no Brasil tem se dedi...

  20. Efeito da monensina e extrato de própolis sobre a produção de amônia e degradabilidade in vitro da proteína bruta de diferentes fontes de nitrogênio Effect of monensin and propolis extract on ammonia production and in vitro degradability of crude protein of different nitrogen sources

    Directory of Open Access Journals (Sweden)

    Juliana Silva Oliveira

    2004-04-01

    Full Text Available Este experimento foi conduzido com o objetivo de avaliar a fermentação da proteína de três fontes de nitrogênio (tripticase, farelo de soja e farinha de peixe, com ou sem monensina ou extrato de própolis. Foram feitas incubações utilizando 7,2 mL de tampão de McDougall, 2,0 mL de inóculo, 0,2 mL de solução etanólica contendo ou não monensina ou própolis e 84,4, 150 ou 112,5 mg/10 mL de tripticase, farelo de soja e farinha de peixe, respectivamente, em arranjo fatorial 3x3. Os frascos foram incubados anaerobicamente a 39ºC em banho-maria durante 120 horas, coletando-se amostras do meio ao longo do tempo de incubação para determinação de amônia, proteína microbiana, proteína solúvel e degradabilidade da proteína. A farinha de peixe causou menor produção de amônia que a tripticase e o farelo de soja no tratamento controle, devido à sua menor degradabilidade. Tanto a monensina como a própolis reduziram a produção de amônia nos tratamentos contendo tripticase e farelo de soja, induzindo ao acúmulo de proteína solúvel no meio de incubação. A síntese de proteína microbiana foi similar para os três alimentos, com presença ou não dos inibidores, exceto no caso da própolis que a estimulou no tratamento contendo farinha de peixe. Observou-se maior degradabilidade da proteína bruta nos tratamentos controle para o farelo de soja (73%, em relação à farinha de peixe (42%. A monensina reduziu a degradação da tripticase e do farelo de soja, pela inibição da produção de amônia, e a própolis aumentou a degradação da farinha de peixe, pelo aumento da concentração de proteína solúvel no meio. Devido ao efeito in vitro da própolis sobre a atividade de fermentação, há necessidade de realização de pesquisas para verificar o efeito da mesma sobre a fermentação ruminal e sobre o desempenho dos animais.This experiment had as objective to evaluate protein fermentation of three nitrogen sources

  1. USO DA SISTEMATIZAÇÃO DA ASSISTÊNCIA DE ENFERMAGEM (SAE: UMA FERRAMENTA PARA REALIZAÇÃO DA AUDITORIA DE QUALIDADE

    Directory of Open Access Journals (Sweden)

    Maria Izelta da Silva Santos

    2013-04-01

    Full Text Available Realizar uma revisao bibliografica acerca da Sistematização da Assistencia de Enfermagem (SAE como instrumento para auditoria de qualidade. Metodos: Foram revisados 12 artigos cientificos sobre auditoria e 10 artigos sobre SAE, bem como dois livros sobre os assuntos abordados. Esta revisao e de carater descritivo. Resultados: Por meio da pesquisa, tornou-se evidente a correlação da SAE com a auditoria. A SAE bem implementada pode contribuir para uma auditoria de qualidade.

  2. Aproximações entre Nietzsche e Adorno acerca da massificação da cultura e da vida administrada

    Directory of Open Access Journals (Sweden)

    Francisco Fianco

    Full Text Available Resumo: Pretendemos pensar as relações entre arte e sociedade, tendo sempre em mente a tensão irredutível entre a autonomia e a heteronomia de uma em relação a outra. Para tanto, traçaremos uma análise dos argumentos principais a respeito dessa relação dialética, em dois momentos distintos da reflexão filosófica sobre o tema. Em um primeiro momento, traremos a defesa de uma certa autonomia da arte com referência não apenas à sociedade que a produz, como também aos valores morais que são ensinados através dela, com as reflexões e, sobretudo, com as críticas de Nietzsche sobre suas interpretações da tragédia clássica, a partir principalmente de O Nascimento da Tragédia, para, em um segundo momento, poder traçar um paralelo dessa argumentação com a constatação de Adorno a respeito da instrumentalização e da comercialização da arte, no contexto contemporâneo, expondo algumas das críticas de Nietzsche realizadas no séc. XIX sobre as produções culturais gregas do séc. IV a. C. e contextualizando-as em relação aos fenômenos estéticos contemporâneos.

  3. Aspectos moleculares da anemia falciforme

    Directory of Open Access Journals (Sweden)

    Galiza Neto Gentil Claudino de

    2003-01-01

    Full Text Available No presente artigo abordaram-se vários aspectos relacionados à natureza molecular da anemia falciforme, desordem hematológica de caráter hereditário que acomete expressivo número de indivíduos em várias regiões do mundo. As pesquisas realizadas em torno desta patologia da hemácia, ao longo de quase um século, a partir de 1910, cooperaram para a criação de um novo e importante segmento da ciência, denominado biologia molecular. A descoberta dos polimorfismos da mutação (GAT->GTG no gene que codifica a cadeia beta da hemoglobina, originando diferentes haplótipos da doença, permitiu um melhor e mais amplo conhecimento em torno da heterogeneidade clínica nos pacientes falcêmicos. Analisando a hemoglobina na sua estrutura normal e mutante, sua produção e evolução, pode-se ter um entendimento mais completo da fisiopatologia desta doença e da sua complexidade clínica.

  4. Problemas na padronização da reação em cadeia da polimerase para diagnóstico da tuberculose pulmonar

    Directory of Open Access Journals (Sweden)

    Bollela Valdes R.

    1999-01-01

    Full Text Available OBJETIVO: Padronizar reação em cadeia da polimerase para diagnóstico de tuberculose pulmonar, comparando os resultados obtidos com as técnicas microbiológicas clássicas, e analisar seu uso numa região de alta prevalência da tuberculose. MÉTODOS: Foram descontaminadas, após a baciloscopia, 42 amostras de escarro de pacientes. Em seguida, procedeu-se ao cultivo em Lowenstein-Jensen e à reação em cadeia da polimerase com "primers" que amplificam um fragmento de 123 pares de base do genoma do Mycobacterium tuberculosis. RESULTADOS: Das 42 amostras de escarro, 10 apresentaram cultura positiva para M. tuberculosis. Dez foram positivas à baciloscopia e 16 mostraram-se positivas na reação em cadeia da polimerase. A sensibilidade e especificidade do teste em relação à cultura foi de 90% e 81%, respectivamente. CONCLUSÕES: A reação em cadeia da polimerase tem sensibilidade comparável à da cultura e pode ser realizada em apenas um dia, resultando em tratamento precoce e melhor controle da doença. A padronização e avaliação de técnicas de biologia molecular no diagnóstico da tuberculose no Brasil é imprescindível na discussão da implantação deste exame na rotina diagnóstica em centros de referência.

  5. Vulnerabilidades sociais e juvenil nos mananciais da zona sul da cidade de São Paulo

    OpenAIRE

    Borelli,Elizabeth

    2012-01-01

    http://dx.doi.org/10.1590/S1414-49802012000100006 Este artigo é um produto parcial da pesquisa “Reflexos da Vulnerabilidade Socioambiental nas Manifestações Musicais dos Jovens Paulistanos da Periferia”, identificando como recorte geográfico a periferia da Zona Sul da cidade de São Paulo. Trata-se de uma região que começou a se formar devido à ocupação populacional desordenada em áreas de manancial, onde a vulnerabilidade social é agravada por situações de risco e degradação ambiental, da...

  6. Da delegacia da mulher à Lei Maria da Penha: Absorção/tradução de demandas feministas pelo Estado

    Directory of Open Access Journals (Sweden)

    Cecília MacDowell Santos

    2012-10-01

    Full Text Available Este artigo examina as respostas do Estado às demandas feministas para o combate à violência doméstica contra mulheres no Brasil desde meados dos anos 1980. São identificados três momentos de mudanças institucionais que direta ou indiretamente moldam e refletem os contextos da atuação estatal: o momento da criação da primeira delegacia da mulher, em 1985; o do surgimento dos Juizados Especiais Criminais, em 1995; e o da promulgação da Lei 11.340, em 2006, conhecida como Lei Maria da Penha. Estes momentos refletem a interação entre múltiplas forças sociopolíticas, sinalizando fluxos e refluxos de políticas públicas e lutas feministas. A análise destes momentos, que pretende contribuir para as teorias feministas do Estado no contexto latino‑americano, revela diferentes formas de atuação estatal e variados graus de absorção/tradução/traição/silenciamento das demandas feministas.

  7. Antimoulting Activity of Eremanthus erythropappus (DC. MacLeisch

    Directory of Open Access Journals (Sweden)

    Danielle Barbosa

    2012-06-01

    Resumo. Os extratos e metabólitos secundários de plantas podem agir como agentes tóxicos e inibidores do da alimentação e do desenvolvimento em insetos. Neste estudo foi utilizado Oncopeltus fasciatus (Dallas (Hemiptera como modelo experimental a fim de avaliar as atividades do extrato etanólico bruto e frações obtidos das flores ou caules de Eremanthus erythropappus (DC. MacLeisch (Asteraceae, na mortalidade e sobre o desenvolvimento do inseto. A fração butanólica obtida do extrato etanólico mostrou toxidade sobre as ninfas de O. fasciatus, bem como atividade de inibição do crescimento. Os resultados sugerem que a fração butanólica de E. erythropappus possui substâncias ativas sobre a fisiologia, crescimento e desenvolvimento de insetos.

  8. Controle da pérola-da-terra, Eurhizococcus brasiliensis (Hempel) (Homoptera:Margarodidae), através da insetigação

    OpenAIRE

    Hickel, Eduardo R.; Peruzzo, Edegar L.; Schuck, Enio

    2001-01-01

    A pérola-da-terra, Eurhizococcus brasiliensis (Hempel) (Homoptera: Margarodidae), é a principal praga da videira no Sul do Brasil. As estratégias normais de controle desta praga não afetam a população do inseto porque os indivíduos estão no subsolo e desenvolvem um corpo globoso resistente a intempéries. Assim sendo, um ensaio foi conduzido em laboratório para verificar a possibilidade de aplicar a insetigação no controle da pérola-da-terra. Tubos de 50 mm de altura de cano PVC (150 mm fi) fo...

  9. Oocyte activation and preimplantation development of bovine embryos obtained by specific inhibition of cyclin-dependent kinases Ativação oocitária e desenvolvimento pré-implantação de embriões bovinos obtidos com o uso de inibidores específicos das quinases dependentes de ciclina

    Directory of Open Access Journals (Sweden)

    F. Perecin

    2007-04-01

    MIV foram expostos à ionomicina seguido ou não pelo tratamento com inibidores específicos das quinases dependentes de ciclina (CDKI, e avaliados quanto à configuração nuclear, taxa de ativação e desenvolvimento até blastocisto. Os tratamentos combinados (ionomicina+CDKI apresentaram melhor taxa de ativação (77,3% e desenvolvimento embrionário inicial (35,2% do que a ionomicina sozinha (69,4% e 21,9%, respectivamente, e também promoveram ativação mais uniforme (aproximadamente 90% de formação de um pronúcleo. Estes resultados demonstram que os CDKIs potencializam o efeito da ionomicina na ativação e desenvolvimento embrionário inicial e podem auxiliar na obtenção de protocolos de ativação mais eficientes, aumentando a capacidade de desenvolvimento de embriões produzidos por meio de biotécnicas reprodutivas.

  10. In vitro and in vivo antifungal activity of natural inhibitors against Penicillium expansum Inibidores naturais no controle in vitro e in vivo de Penicillium expansum

    Directory of Open Access Journals (Sweden)

    Claudia Fieira

    2013-02-01

    Full Text Available Penicillium expansum is the causative agent of apple blue mold. The inhibitory effects of the capsaicin derived from Capsicum spp. fruits and yeast Hansenula wingei against P. expansum were evaluated in an in vitro and in in vivo assay using Fuji apples. The minimum inhibitory concentration of capsaicin determined using the broth micro-dilution method was 122.16 µg mL-1. Capsaicin did not reduce blue mold incidence in apples. However, it was able to delay fungal growth in the first 14 days of the in vivo assay. The in vivo effect of the yeast Hansenula wingei AM2(-2, alone and combined with thiabendazole at low dosage (40 µg mL-1, on the incidence of apple diseases caused by P. expansum was also described. H. wingei AM2(-2 combined with a low fungicide dosage (10% of the dosage recommended by the manufacturer showed the best efficacy (100% up to 7 days of storage at 21 ºC, later showing a non-statistically different decrease (p > 0.05 after 14 (80.45% and 21 days (72.13%, respectively. These results contribute providing new options for using antifungal agents against Penicillium expansum.Penicillium expansum é o agente causador da doença em maçã conhecida como mofo azul. O efeito inibitório da capsaicina derivada dos frutos Capsicum spp. e da levedura Hansenula wingei foi avaliado através de ensaios in vitro e in vivo em maçã. A concentração inibitória mínima da capsaicina de 122,16 µg mL-1 foi determinada usando microdiluição. A capsaicina não mostrou capacidade em reduzir a incidência do mofo azul na maçã. Entretanto, um retardo no crescimento do fungo foi observado nos 14 primeiros dias dos ensaios in vivo. Também descrevemos o efeito da levedura Hansenula wingei AM2(-2 isolada e em combinação com tiabendazol em baixa dosagem (40 µg mL-1 no controle da doença de maçãs por P. expansum.Hansenula wingei AM2(-2, em combinação com baixa dosagem de tiabendazol (10% da recomendada pelo fabricante, apresentou 100% de

  11. O problema da desigualdade social na teoria da sociedade de Niklas Luhmann

    Directory of Open Access Journals (Sweden)

    Roberto Dutra Torres Junior

    Full Text Available A teoria da sociedade de Niklas Luhmann é frequentemente acusada de conservadorismo, visto que negligencia a relevância das estruturas de desigualdade na sociedade moderna. Este artigo propõe uma leitura alternativa dessa teoria, a qual implica uma reconsideração do papel das estruturas de desigualdade para a reprodução dos sistemas sociais. O argumento principal é que as estruturas de desigualdade orientam o modo pelo qual os sistemas sociais selecionam os indivíduos para suas operações. Ao mesmo tempo, é feita uma defesa da tese luhmanniana sobre o primado da diferenciação funcional, pois, enquanto as estruturas de desigualdade podem variar, assumindo formas contingentes, cuja transformação não representa a transformação da sociedade, a diferenciação funcional, ao contrário, representa a própria identidade da sociedade, permanecendo como uma dimensão invariável e necessária nos horizontes de sentido da modernidade.

  12. Isenção da ciência, neutralidade da análise

    Directory of Open Access Journals (Sweden)

    Daniel Menezes Coelho

    2012-01-01

    Full Text Available O artigo discute as relações entre a psicanálise e a ciência, especialmente no que tange aos seus métodos de investigação e trabalho. Para isso, tomamos como objeto a noção de neutralidade, tal como podemos apreendê-la na clínica da psicanálise, para confrontá-la com o que chamamos de isenção no campo da ciência, que não quer dizer outra coisa que a neutralidade proposta lá. Veremos que, apesar da clara filiação da noção psicanalítica para com a noção vinda da ciência, a neutralidade clínica da psicanálise toma outro rumo, que se pode mesmo opor ao sentido do termo na ciência. Enquanto em ciência o termo quer significar um processo de purificação e de seleção, em psicanálise ele surge como a exigência de nada selecionar.

  13. MACIEZ DA CARNE BOVINA

    Directory of Open Access Journals (Sweden)

    Antonio Bento Mancio

    2006-10-01

    Full Text Available Dentre as características de qualidade da carne bovina, a maciez assume posição de destaque, sendo considerada a característica organoléptica de maior influência na aceitação da carne por parte dos consumidores. A dureza da carne pode ser dividida em dureza residual, causada pelo tecido conjuntivo e outras proteínas do estroma, e dureza de actomiosina, causada pelas proteínas miofibrilares. Dentre os fatores que influenciam a maciez da carne, podem ser destacados a genética, a raça, a idade ao abate, o sexo, a alimentação, o uso de agentes hormonais (?-adrenérgicos e os tratamentos post-mortem. A qualidade final da carne é resultante de tudo o que aconteceu com o animal durante toda a cadeia produtiva. Devem-se assegurar procedimentos adequados de transporte, armazenamento, manipulação, exposição e preparo da carne, a fim de se obter um produto de melhor qualidade. PALAVRAS-CHAVE: Calpaínas, calpastatina, qualidade da carne, rigor mortis, tecido muscular.

  14. APLICABILIDADE DA SISTEMATIZAÇÃO DA ASSISTÊNCIA DE ENFERMAGEM NA ESTRATÉGIA DE SAÚDE DA FAMÍLIA: UMA REVISÃO BIBLIOGRÁFICA

    Directory of Open Access Journals (Sweden)

    Anna Paula Mendonça Barros

    2016-01-01

    Full Text Available Trata-se de uma revisão da literatura realizada no período de 2002 a 2012 cujo objetivo foi revisar e analisar as publicações relacionadas à aplicabilidade da Sistematização da Assistência de Enfermagem na Estratégia de Saúde da Família. Os trabalhos selecionados foram agrupados por similaridade em três categorias temáticas: Funções assistenciais do enfermeiro na ESF; Aplicabilidade da SAE na prática do enfermeiro da ESF; Implementação da ESF e da SAE. Foi demonstrado aumento das publicações nos últimos anos e maior preocupação por parte dos enfermeiros a cerca da temática e que a utilização da SAE na ESF proporciona o estabelecimento de vínculo entre enfermeiro-usuário-família com fortalecimento do elo com a comunidade, de modo que o enfermeiro poderá interligar as informações disponíveis, guiando a assistência prestada a nível individual e familiar. Aplicar a SAE na ESF requer ao enfermeiro dedicação, ousadia e determinação frente às dificuldades em assimilar gerência e assistência, duas funções importantes que o enfermeiro realiza diariamente.

  15. Modelo para sistemas da qualidade como base da estrategia competitiva

    OpenAIRE

    Marco Antonio Silveira

    1999-01-01

    Resumo: Vários autores propõem a empresa como um sistema em transformação, sendo que esse enfoque sistêmico parece oferecer um meio efetivo de prover as capacidades estratégicas que são valorizadas pelos mercados atuais. Por outro lado, vem crescendo a consciência para o enfoque da qualidade como base da estratégia competitiva, onde esta é associada à lucratividade e incluída no processo de planejamento estratégico, tornando-se um instrumento eficaz de concorrência que, para fazer frente à di...

  16. Tópicos da teoria da relatividade

    OpenAIRE

    Fragata, Paulo Renato Ferreira

    2013-01-01

    Dissertação de Mestrado, Matemática para Professores, 25 de Outubro 2013, Universidade dos Açores. Qualquer descrição física da natureza tem por base a especificação da posição e do instante em que decorre determinado acontecimento. Para tal, é necessário recorrer a um sistema de coordenadas, escolhido por cada observador, do modo que ele achar mais pertinente. Dada a generalidade na escolha do sistema de coordenadas, é útil conhecer as regras que nos permitem comparar cálculos feitos em d...

  17. Um levantamento sobre do uso de ferramentas da Web 2.0 entre os estudantes da Ciência da Informação da Universidade Federal de Santa Catarina

    Directory of Open Access Journals (Sweden)

    Eduarda Bodaneze de Oliveira

    2014-04-01

    Full Text Available http://dx.doi.org/10.5007/1518-2924.2014v19n39p153   Nas últimas décadas, puderam-se verificar enormes mudanças nas relações sociais e grandes transformações nos sistemas de comunicação que tornaram mais rápidos os fluxos de informação por meio dos recursos da Internet. A ideia de uma Web 2.0 (a Web colaborativa agrega ideais de colaboração, interação e participação que proporcionam, através de uma organização em rede, uma intensa produção de informação. Este trabalho analisa o uso de ferramentas da Web 2.0 pelos alunos do Departamento de Ciência da Informação da Universidade Federal de Santa Catarina através da caracterização do perfil dos estudantes como usuários destas ferramentas, da identificação das áreas de interesse, das ferramentas mais utilizadas e das principais finalidades de uso das redes sociais Facebook, Twitter e LinkedIn. O estudo concluiu que há um grande potencial, dentro do segmento avaliado, para a troca de informações e difusão de conhecimentos através das ferramentas da Web 2.0. Além disso, estas ferramentas são vistas pelo público-alvo da pesquisa como sendo de grande utilidade, tanto para funções pessoais e de relacionamento quanto para interesses acadêmicos e profissionais.

  18. Cointegrating MiDaS Regressions and a MiDaS Test

    OpenAIRE

    J. Isaac Miller

    2011-01-01

    This paper introduces cointegrating mixed data sampling (CoMiDaS) regressions, generalizing nonlinear MiDaS regressions in the extant literature. Under a linear mixed-frequency data-generating process, MiDaS regressions provide a parsimoniously parameterized nonlinear alternative when the linear forecasting model is over-parameterized and may be infeasible. In spite of potential correlation of the error term both serially and with the regressors, I find that nonlinear least squares consistent...

  19. Resistência genotípica e monitoramento da favorabilidade para ocorrência da ferrugem alaranjada da cana-de-açúcar

    Directory of Open Access Journals (Sweden)

    Kelly Lana Araújo

    2013-12-01

    Full Text Available A ferrugem alaranjada é atualmente uma das principais doenças da cana-de-açúcar. Redução na produtividade de genótipos suscetíveis e intermediários superiores a 40% foram registradas em muitos países, inclusive no Brasil. Este trabalho foi desenvolvido com o objetivo de monitorar os principais genótipos de cana-de-açúcar plantados no Brasil, sob alta pressão de inóculo, quanto à ocorrência e ao desenvolvimento da ferrugem alaranjada. O experimento foi conduzido em área experimental da Usina Univalem, do Grupo Raízen S.A., localizada em Valparaíso (SP. O delineamento experimental utilizado foi em blocos casualizados, com 38 tratamentos (genótipos e quatro repetições. Cada parcela foi constituída por três linhas de cinco metros, espaçadas de 1,4m. Entre cada parcela foi incluída uma linha do genótipo CV14, suscetível à ferrugem alaranjada. A partir da emergência das plantas, todas as parcelas foram monitoradas mensalmente para determinar o início do aparecimento dos sintomas da doença. Depois de constatados os primeiros sintomas, a severidade da ferrugem alaranjada foi quantificada mensalmente na folha +3 em três plantas por parcela. Os meses mais favoráveis para ocorrência da doença foram Fevereiro, Março, Abril e Maio. Foram observados sintomas da ferrugem alaranjada nos genótipos CTC 9, CV 14, RB93-5641, SP842025, RB72-454, SP89-1115, SP81-3250, RB85-5156, CTC 15, RB92-579, SP83-2847 e RB92-5211. Os genótipos SP84-2025 e CV 14 foram os mais suscetíveis à doença. Este trabalho contribui para aperfeiçoar o manejo integrado da ferrugem alaranjada no Brasil, além de auxiliar os programas de melhoramento visando à obtenção de novas variedades resistentes à doença.

  20. Estudo e otimização da produção da dextranasacarase e caracterização da dextrana produzida por Leuconostoc mesenteroides FT045B

    OpenAIRE

    Vettori, Mary Helen Palmuti Braga [UNESP

    2011-01-01

    Um estudo comparativo de onze métodos para determinação da atividade da dextranasacarase e de enzimas relacionadas foi realizado. Atualmente existem dois métodos usualmente empregados na determinação da atividade da dextranasacarase. Um método relativamente difundido para a reação da enzima com a sacarose consiste na medição dos valores redutores da D-frutose pelo reagente 3,5-dinitrosalicilato (DNS). Outro método é a reação da enzima com 14Csacarose, pela adição de uma alíquota da reação em ...

  1. ASPECTOS RELEVANTES DO INSTITUTO DA INVERSÃO DO ÔNUS DA PROVA

    OpenAIRE

    João Alberto Mendes Bezerra Júnior

    2017-01-01

    O presente trabalho pretende contribuir, ainda que minimamente, com o mundo jurídico, no que diz respeito ao instituto da inversão do ônus da prova, previsto no art. 6º, VIII do Código Brasileiro de Defesa do Consumidor, sob o enfoque do Direito Constitucional. Além de abordar o alcance dos requisitos impostos por esse dispositivo legal, o estudo trata do momento em que a inversão do ônus da prova deve ocorrer no processo civil, trazendo novas luzes a respeito, mormente como reforço à tese da...

  2. O uso da teoria da visão baseada em recursos em propriedades rurais: uma revisão sistemática da literatura

    Directory of Open Access Journals (Sweden)

    Daniela Moreira de Carvalho

    2014-09-01

    Full Text Available A teoria da Visão Baseada em Recursos (VBR tem se destacado como uma das mais importantes correntes teóricas da estratégia. O uso da teoria dos recursos mostra-se promissor para a análise das propriedades rurais, permitindo avançar no conhecimento do potencial a ser explorado em torno dos recursos internos. No presente estudo, contribui-se com um levantamento da literatura sobre os principais recursos e/ou fatores-chave determinantes para o desempenho de propriedades rurais por meio da análise de trabalhos que utilizaram a teoria da VBR como base teórica. Com esse levantamento, pretende-se verificar quais recursos foram considerados estratégicos pela literatura da área. A metodologia utilizada foi de revisão sistemática. Os resultados indicaram que o uso da teoria em estudos de empreendimentos agropecuários ainda é incipiente. Foram levantados 14 artigos em fazendas em geral e, dentre esses, três estudos em fazendas produtoras de leite que mostram resultados consistentes quanto ao impacto dos recursos sobre o desempenho. Recursos humanos e organizacionais foram os mais citados como estratégicos e fundamentais para o desempenho. Os recursos físicos foram citados mais vezes em artigos que analisaram o meio rural se comparado à literatura geral do uso da VBR, talvez pela maior dependência de aspectos naturais no desempenho das fazendas em relação aos outros setores da economia. Contudo, devido ao pequeno número de trabalhos encontrados e à diversidade de abordagens em torno da teoria, não é possível realizar inferências, somente concluir que existe um gap de conhecimento nessa área que deve ser suprido por meio de novas e amplas pesquisas.

  3. Disruption of the 37-kDa/67-kDa laminin receptor gene in bovine ...

    African Journals Online (AJOL)

    ... gene encoding for the prion binding site in bovine fetal fibroblasts. The heterozygous BFF are ready to be used in producing homozygous cattle, which will be applied to study the interaction between prion and the 37-kDa/67-kDa LRP/LR. Key words: Prion, PrPC, PrPSc, 37-kDa/67-kDa laminin receptor, gene targeting.

  4. INTEGRAÇÃO AFRICANA: DA ORGANIZAÇÃO DA UNIDADE AFRICANA À UNIÃO AFRICANA

    OpenAIRE

    Diallo, Alfa Oumar

    2015-01-01

    Desde Kwamé N´Krumah a unidade da África era um grande desejo. A Organização da Unidade Africana (OUA) servia aos olhares de alguns na pobreza moral e material do continente. Destaca-se, que dentro da OUA, alguns fundadores militavam em favor da instituição dos Estados Unidos da África enquanto que outros pregavam, ao contrário, pela fragmentação dos Estados-Nações sob uma forma organizacional. Os Estados Unidos da África certamente seriam limitados à exploração contínua deste continente, mas...

  5. GESTÃO DA INOVAÇÃO EM EMPRESAS DE TECNOLOGIA DA INFORMAÇÃO E COMUNICAÇÃO NO ESTADO DA BAHIA

    Directory of Open Access Journals (Sweden)

    Luan Carlos Santos Silva

    2014-12-01

    Full Text Available O presente artigo traz para a discussão, reflexões acerca do entendimento da gestão da inovação em empresas de tecnologia da informação e comunicação (TICs que em muitas abordagens não levam em consideração a especificidade região e do mercado onde elas atuam, bem como o relacionamento direto com os processos da inovação. A pesquisa foi qualitativa e do ponto de vista por sua natureza, constitui-se como aplicada. Sendo caracterizada como uma pesquisa descritiva. O objetivo geral do artigo foi analisar o processo de gestão da inovação nas empresas de Tecnologia da Informação e Comunicação (TICs do Pólo de Informática de Ilhéus no Estado da Bahia. E finaliza-se destacando que para enfrentar os desafios no mercado, as empresas do Pólo de Informática devem inovar seus processos continuamente, e adquirindo novos conhecimentos organizacionais para terem uma postura empreendedora e inovadora junto ao mercado, a execução, manutenção e ampliação dessas ações tornam-se fundamentais para um maior fortalecimento das empresas de (TICs no Estado da Bahia.

  6. Aquiles e Mêmnon face à morte: um estudo da cena da Psicostasia na pintura da cerâmica ática

    Directory of Open Access Journals (Sweden)

    José Geraldo Costa Grillo

    2014-11-01

    Full Text Available O autor estuda as pinturas da cerâmica ática, com a representação da Psicostasia de Aquiles e Mêmnon, respon­dendo à questão do contexto, no interior do qual ela adquire sentido. Defende a ideia de que ela está imersa na esfera reli­giosa e ligada ao tema da morte, especificamente ao ideal he­roico da bela morte, o qual vem ser o meio de o guerreiro es­capar do fim que a morte representa, uma vez que esta morte heroica lhe permite permanecer vivo na memória de seu povo.

  7. Endocardite acuta da Staphylococcus haemolyticus meticillino sensibile, con recidiva dopo trattamento da ceppo meticillino resistente

    Directory of Open Access Journals (Sweden)

    Giacomo Magnani

    2005-03-01

    Full Text Available Le endocarditi su valvole native (NVE da Stafilococchi coagulasi negativi (CoNS presentano un andamento aggressivo simile a quello da Staphylococcus aureus e sono difficili da trattare per l’alta incidenza da parte dei CoNS di resistenza a oxacillina.Viene riportato un caso di NVE da Staphylococcus haemolyticus meticillino sensibile, con risposta iniziale favorevole al trattamento con oxacillina, ma con successiva recidiva a distanza di tre mesi legata comparsa di ceppo oxacillino-resistente. L’ipotesi è che l’infezione sia stata sostenuta da una popolazione batterica con fenotipo eteroresistente, che in seguito al trattamento antibiotico ha sviluppato resistenza omogenea a oxacillina. Nell’impostare un trattamento per infezioni gravi da Stafilococchi sensibili in vitro ad oxacillina è necessario considerare sempre la presenza di un eteroresistenza.

  8. Estudo comparativo da qualidade da água da chuva coletada em telhado com telhas de concreto e em telhado verde para usos não potáveis

    Directory of Open Access Journals (Sweden)

    Celimar Azambuja Teixeira

    Full Text Available Resumo Este artigo apresenta uma comparação da qualidade da água da chuva coletada em telhado inclinado com telhas de concreto (residência 1 e cobertura plana e vegetada (residência 2, indicada como telhado verde. Os objetivos desta investigação foram: (1 analisar a qualidade da água da chuva captada nas duas coberturas, com base nos parâmetros da NBR 15527 (ABNT, 2007 e (2 fazer acompanhamento da qualidade da água armazenada para verificar eficiência e comportamento dos dois telhados. Este estudo foi desenvolvido em Curitiba, PR, onde é obrigatório o aproveitamento da água da chuva em novas construções desde o ano de 2007. A água da chuva captada no telhado com telhas de concreto apresentou menores valores para turbidez e demanda química de oxigênio na maioria dos resultados (oito e sete amostras, respectivamente. O telhado verde contribuiu para a diminuição da acidez natural da água da chuva. Não foram atendidos os parâmetros microbiológicos estabelecidos na NBR 15527 (ABNT, 2007 em nenhuma das amostras coletadas. Apesar de a qualidade da água da chuva não atender todos os parâmetros indicados na NBR 15527 (ABNT, 2007, essa água vem sendo aproveitada nas residências para limpeza de calçadas, irrigação de jardim e descarga em bacias sanitárias, sem indicação de inconvenientes pelos moradores.

  9. Determinantes sociais da saude e o Programa Saude da Familia no municipio de Sao Paulo

    Directory of Open Access Journals (Sweden)

    Tatiana Pluciennik Dowbor

    2013-08-01

    Full Text Available OBJETIVO Analisar a situação do trabalho com determinantes sociais da saúde no âmbito do Programa Saúde da Família. MÉTODOS Estudo de caso com métodos mistos de pesquisa, ancorados em estratégia sequencial explanatória, com 171 gerentes das unidades do Programa Saúde da Família em São Paulo, SP, em 2005/2006. Questionários autopreenchíveis foram aplicados. Entrevistas semiestruturadas e grupos focais foram realizados com amostra intencional de profissionais envolvidos no trabalho com determinantes sociais da saúde. Os dados quantitativos foram analisados por análise descritiva, análise de correspondência múltipla, análise de agrupamento e testes de correlação entre variáveis. Os dados qualitativos foram apurados por análise de conteúdo e a criação de categorias temáticas. RESULTADOS Apesar da concentração de atividades direcionadas ao cuidado com a doença, o Programa Saúde da Família realizou atividades relacionadas à determinação social da saúde, contemplando todas as formas de abordagem da promoção da saúde (biológico, comportamental, psicológico, social e estrutural e os principais determinantes sociais da saúde descritos na literatura. Houve diferença significativa quanto à abrangência dos determinantes trabalhados nas unidades em relação às diferentes regiões do município. Constatou-se fragilidade das iniciativas e a sua desconexão com a estrutura programática do Programa Saúde da Família. CONCLUSÕES A quantidade e variedade de atividades com determinantes sociais da saúde realizadas no Programa Saúde da Família mostram potencial para trabalhar a determinação social da saúde. Mas a fluidez de objetivo e o caráter extraordinário das atividades descritas questionam sua sustentabilidade como parte integral da atual estrutura organizacional do programa.

  10. A ARQUIVÍSTICA COMO DISCIPLINA APLICADA NO CAMPO DA CIÊNCIA DA INFORMAÇÃO

    Directory of Open Access Journals (Sweden)

    Fernanda Ribeiro

    2011-06-01

    Full Text Available Apesar de os arquivos terem origens muito remotas, que se podem confundir com as origens da própria escrita, a Arquivística como disciplina só no século XIX e no quadro do historicismo e do positivismo, se começou a afirmar, numa perspectiva de “ciência auxiliar” da História. Esta perspectiva historicista e custodial adquiriu novos contornos por alturas da viragem do século, graças à afirmação da vertente tecnicista, que se desenvolveu ao longo de todo o século XX, por efeito das condições sociais, económicas e culturais derivadas da revolução tecnológica em curso. Neste texto põe-se em confronto o tradicional paradigma historicista, custodial e tecnicista da Arquivística com um novo paradigma emergente, apelidado de pós-custodial, informacional e científico que entende esta disciplina como um saber aplicado do campo da Ciência da Informação, sendo apresentados os fundamentos epistemológicos, teóricos e metodológicos da abordagem proposta.

  11. A EVOLUÇÃO DA TECNOLOGIA DA INFORMAÇÂO (TI DENTRO DA ADMINISTRAÇÃO

    Directory of Open Access Journals (Sweden)

    Joe Yukinori Katsurayama

    2017-03-01

    Full Text Available Buscamos relacionar a tecnologia e os paradigmas contemporâneos que hoje são de fundamental importância na rede empresarial e como neste contexto cotidiano essa questão é primordial para o desenvolvimento. O fenômeno da globalização mostra o quanto está modernizado a crescente expansão das mídias nas empresas atuais. Diante disto, o objetivo do estudo visa realizar um levantamento bibliográfico sobre a eficácia da Tecnologia da Informação na Administração. Para isto foram levantados estudos sobre a evolução desta tecnologia na base de dados Scielo, Google Acadêmico. Observou- se com o presente estudo que aos poucos as empresas foram se sensibilizando para a importância da informação na gestão de negócios. O conceito de TI engloba software, telecomunicações, automação, recursos multimídia, recursos de organização de dados, entre outros.

  12. Apontamentos sobre a disciplina História da Educação na Universidade da Região da Campanha – Urcamp (1959-2001

    Directory of Open Access Journals (Sweden)

    Regina Quintanilha Azevedo, Clarisse Ismério

    2011-03-01

    Full Text Available Resumo A proposta deste trabalho é fazer um levantamento de dados sobre a disciplina de História da Educação, entre 1959 e 2001, no Curso de Pedagogia, na Universidade da Região da Campanha – URCAMP. Estes apontamentos servirão como contribuição para um futuro mapeamento sobre a disciplina da História da Educação no ensino superior no Brasil. O texto está dividido em três partes: primeiro o perfil da Universidade da Região da Campanha, na segunda parte focalizamos a disciplina de História da Educação no Curso de Pedagogia, nessa Instituição, entre 1959 e 2001, e no terceiro momento o trabalho das professoras da disciplina de História da Educação, atualmente, na URCAMP. Foi realizada uma investigação no arquivo morto da Diretoria de Ingressos e Registros (DIR da URCAMP, nas pastas dos Registros Acadêmicos, no mesmo setor e no setor de Recursos Humanos da Instituição - nas pastas de professores, arquivo digital e no arquivo morto e na Biblioteca. Com um novo olhar na História da Educação foi realizada uma análise das diversas fontes entrecruzadas, tendo a preocupação de que esta apreciação sirva de aporte para novos trabalhos. Palavras-chave: curso de Pedagogia; disciplina História da Educação; formação de professores.   Abstract The proposal of this work is to make a data collecting on disciplines of History of the Education, between 1959 and 2001, in the Course of Pedagogy, in URCAMP (Universidade da Região da Campanha. These notes will serve as contribution for a future mapping on disciplines of History of the Education in superior education in Brazil. The text is divided in three parts: first the profile of the URCAMP, in the second part we focus on disciplines of History of the Education in the Course of Pedagogy, in this Institution, between 1959 - 2001 and at the third moment, the work of the teachers of disciplines of History of the Education, currently, in this University. It was made an inquiry

  13. Max Weber e Martin Heidegger: a centralidade da razão e a perda da liberdade

    Directory of Open Access Journals (Sweden)

    Edilene Maria de Carvalho Leal

    2015-10-01

    Full Text Available A intenção desse artigo é analisar algumas ambivalências da modernidade, com destaque para a que consideramos a principal delas: a centralidade da razão como categoria analítica e como modelo das práticas sociais. Essa proposta é, evidentemente, uma proposta de análise teórica que se dará no âmbito específico da teoria social e da filosofia, principalmente desde interpretações produzidas por Max Weber e Martin Heidegger. Trata-se, em uma primeira instância, da tentativa de discutir criticamente as “autodescrições” que esses pensadores fizeram da modernidade. De um lado, a defesa weberiana da centralidade da razão; de outro, a crítica pós-metafísica heideggeriana dessa centralidade. Desse flagrante desencontro, podemos destacar um possível encontro analítico entre eles, ou seja, a crítica à perda da liberdade no contexto moderno.

  14. Max Weber e Martin Heidegger: a centralidade da razão e a perda da liberdade

    Directory of Open Access Journals (Sweden)

    Edilene Maria de Carvalho Leal

    2015-09-01

    Full Text Available A intenção desse artigo é analisar algumas ambivalências da modernidade, com destaque para a que consideramos a principal delas: a centralidade da razão como categoria analítica e como modelo das práticas sociais. Essa proposta é, evidentemente, uma proposta de análise teórica que se dará no âmbito específico da teoria social e da filosofia, principalmente desde interpretações produzidas por Max Weber e Martin Heidegger. Trata-se, em uma primeira instância, da tentativa de discutir criticamente as “autodescrições” que esses pensadores fizeram da modernidade. De um lado, a defesa weberiana da centralidade da razão; de outro, a crítica pós-metafísica heideggeriana dessa centralidade. Desse flagrante desencontro, podemos destacar um possível encontro analítico entre eles, ou seja, a crítica à perda da liberdade no contexto moderno.

  15. Repercussoes do pet-saude na formacao de estudantes da area da saude

    Directory of Open Access Journals (Sweden)

    Paula Hubner Freitas

    2013-09-01

    Full Text Available OBJETIVO: O estudo teve como objetivo conhecer as repercussões do Programa de Educação pelo Trabalho para a Saúde/PET-Saúde na formação de estudantes da área da saúde. METODOS: Configura-se como exploratório-descritivo, com abordagem qualitativa.Fizeram parte do estudo, vinte estudantes participantes do PET-Saúde. A técnica de coleta de dados foi a entrevista semi-estruturada e o método de análise dos dados empregado, a análise de conteúdo temática. RESULTADOS: Os dados sinalizam que o PET-Saúde configura-se como um programa facilitador para a busca da integralidade e que proporciona articulação teórica-prática entre estudantes, serviço de saúde e comunidade, o que é imprescindível para a reorientação da formação em saúde. CONCLUSÃO: Conclui-se que o desafio centra-se na formação crítico-reflexiva de profissionais da área da saúde, apontando para novos comportamentos e atitudes.

  16. Manutenção da infectividade de Tymovírus em extratos de plantas Maintenance of infectivity of Tymovirus in plant extracts

    Directory of Open Access Journals (Sweden)

    Maria Mércia Barradas

    1992-12-01

    Full Text Available Quatro isolados do vírus do mosaico da berinjela (EMV - "eggplant mosaic virus" - grupo tymovírus foram armazenados a partir de extratos foliares de hospedeiras com sintomas sistêmicos. Os virus EMV-Al (isolado de Abelia, EMV-Sc (isolado da Escócia, -ts (estirpe-padrão e VNBT (vírus da necrose branca do tomateiro, que induzem sintomas em Chenopodium amaranticolor, C. murale, C. quinoa (Família Chenopodiaceae Datura stramonium, Lycopersicon esculentum e Nicotiana glutinosa (Solanaceae, foram conservados em extratos destas plantas, à temperatura ambiente, em geladeira e em congelador. A infectividade dos vírus, em diferentes períodos de armazenamento, foi testada em plantas de datura e glutinosa, para se determinar a longevidade in vitro. Constatou-se que, quando guardados em baixas temperaturas,os extratos preservam por mais tempo a infectividade dos vírus. No caso de datura e glutinosa, por exemplo, resultados positivos foram obtidos até 413 e 282 dias de armazenamento, respectivamente, em congelador. Entretanto, com relação às espécies de Chenopodium testadas, mesmo alguns extratos recém-preparados conduziram a resultados negativos, confirmando a presença de inibidores de infecção viral nestas plantas. Das três espécies, é sugerida a utilização apenas de C.quinoa para o preparo de extratos visando preservar estes vírus e, assim mesmo, por um período relativamente curto (entre 53 e 80 dias. A avaliação geral dos resultados mostra que, para os tymovírus estudados neste trabalho, é possível conservar a infectividade através da técnica de armazenamento de extratos foliares de plantas sistemicamente infectadas.Four isolates of EMV (eggplant mosaic virus - tymovirus group were preserved in crude extracts from systemically-infected plants. EMV-Al (Abelia strain, EMV-Sc (Scottish strain, EMV-ts (type-strain and TWNV (tomato white necrosis virus which induce symptoms in Chenopodium amaranticolor, C. murale, C. quinoa

  17. Papel da vitamina B12 na patogenia da mielose funicular

    Directory of Open Access Journals (Sweden)

    Horacio M. Canelas

    1965-12-01

    Full Text Available Foi estudada a absorção da vitamina B12 radioativa em 29 casos de mielose funicular. O diagnóstico baseou-se na clássica sintomatologia neu- rológica e na presença de acloridria gástrica e eventuais alterações hemato-lógicas. As manifestações neurológicas foram avaliadas de modo semiquan-titativo e correlacionadas com os resultados do teste de excreção urinária da vitamina B12. Não foi verificada correlação significante da absorção da vitamina B12, quer com a sintomatologia nuerológica total, quer com as síndromes periférica e funicular dorsal. Contudo, foi encontrada significante correlação negativa entre a síndrome piramidal e a absorção da vitamina B12. Os resultados são confrontados com o papel desempenhado pela vitamina B12 na síntese das bainhas de mielina e do ácido ribonuclêico, sendo salientada a importância dêste último para a vida das células nervosas e dos longos axônios.

  18. A INFLUÊNCIA DA TECNOLOGIA E DA INTERNET NO MARKETING

    Directory of Open Access Journals (Sweden)

    Lúcia Cristina Vargas Machado

    2014-09-01

    Full Text Available O dinamismo do mundo globalizado vem exigindo grandes mudanças das organizações, sejam para aquelas que produzem bens tangíveis, sejam para as prestadoras de serviços. E dentro da observância das mudanças, pode-se considerar as revoluções vividas pela humanidade, considerando aquela que mais mudou o cenário mercadológico pela primeira vez que foi 1ª revolução industrial e, a outra, a revolução da informação. Neste contexto, o objetivo deste trabalho é demonstrar através da revisão de literatura, a significativa e importante transformação da informação para a área de marketing das organizações. A revolução da informação, tendo como suas precursoras e legítimas aliadas a tecnologia e a internet, respectivamente, fez com que surgisse um novo tipo de marketing: o marketing digital. Com este novo tipo de marketing, as organizações que estiverem mais presentes na internet, poderão obter uma maior vantagem competitiva e como consequência uma maior lucratividade

  19. Pessoal ocupado e jornada de trabalho: uma releitura da evolução da produtividade no Brasil

    Directory of Open Access Journals (Sweden)

    Fernando de Holanda Barbosa Filho

    2014-06-01

    Full Text Available Esse artigo recalcula a evolução da produtividade do trabalho e da produtividade total dos Fatores (PTF no Brasil entre os anos de 1982 e 2012 usando uma série de horas trabalhadas em vez da série de pessoal ocupado. Para tanto, utilizamos dados da PNAD e da PME para construir uma série mensal de horas trabalhadas que compatibilizasse as mudanças metodológicas da PNAD e da PME. A comparação da série de horas trabalhadas com a de pessoal ocupado revela a redução da jornada de trabalho no Brasil, fenômeno consistente em todo o período de análise e que impacta a produtividade. Com isso, a utilização de uma série de horas trabalhadas possibilita uma releitura da evolução da produtividade nas últimas três décadas no Brasil. Em particular, mostramos que a perda da produtividade do trabalho (-0,6% a.a ocorrida entre os anos de 1982 e 1992 é explicada pela redução da jornada de trabalho média (-0,7% da economia brasileira. Os resultados indicam que, no período 1982-2012, tanto a produtividade do trabalho (35,8% quanto a PTF (16,3% apresentaram uma elevação superior à sugerida por boa parte da literatura sobre o tema baseada em séries de pessoal ocupado.

  20. GERONTOLOGIA: ESTADO DA ARTE

    Directory of Open Access Journals (Sweden)

    Vera M.A.Tordino Brandão

    2010-02-01

    Full Text Available O Programa de Gerontologia da PUC desenvolve pesquisas focando o ser na perspectiva do envelhecimento. As atividades são interdisciplinares e reúnem docentes, alunos e ex-alunos. Nesta mesa redonda apresentamos um panorama sobre estes estudos. Na área da educação e comunicação o foco está centrado na longevidade e na preparação e representação social da velhice. São ressaltadas como temáticas: a formação continuada de profissionais e pesquisadores; o significado da religiosidade/espiritualidade ao longo da trajetória, e sua repercussão na qualidade de vida do idoso; os programas sócio-educacionais para idosos e concepções sobre educação; o monitoramento da mídia na cobertura da crescente longevidade e seus impactos. Em identidade e modos de morar reflete-se sobre soluções planejadas e sua adequação para a inclusão do envelhecimento populacional como questão fundamental, que implica a elaboração de novas políticas, investigações e, especialmente, apresenta-se como questão a ser analisada, refletida e vivenciada pela sociedade em geral. Quanto à saúde, o Programa desenvolve várias pesquisas numa abordagem interdisciplinar tendo como objetos de estudo: a terapia assistida com animais direcionada a idosos com diagnóstico de Alzheimer; o acompanhamento terapêutico e o atendimento psicoterapêutico em grupo, a aplicação da técnica de Calatonia em idosos moradores de ILPI, além da investigação sobre impasses clínicos no idoso frágil. Palavras-chave: gerontologia, longevidade, envelhecimento

  1. Profilaxia da peste

    Directory of Open Access Journals (Sweden)

    Renato dos Santos Araújo

    1967-12-01

    Full Text Available O autor parte da premissa de que a profilaxia da doença infecciosa decorre do encadeamento epidemiológico: fonte de infecção-veículo transmissor - receptivel, para explicar a da peste, baseada no mesmo princípio. Depois de citar os 4 principais complexos epidemiológicos da peste e afirmar que tôda a profilaxia da doença consiste em atingir os dois primeiros elos dessas cadeias e proteger o último, passa a classificar os vários métodos profiláticos empregados em 2 grandes grupos: o das medidas destrutivas ou provisórias e o das medidas supressivas ou definitivas. Entre as primeiras arrola a desratização e a despulização, às quais acrescenta o tratamento e isolamento do doente e do portaãor, e entre as segundas inclui a anti-ratização e a imunização. A seguir, passa a explicar em que consistem essas várias medidas profiláticas e quais os agentes de que se tem lançado mão para executá-las, expendendo ao curso dessa exposição o conceito que formula a respeito de cada uma delas, à guisa de apreciação do seu valor relativo. Enaltece sobretudo as medidas supressivas ou definitivas, às quais empresta a maior significação na luta antipestosa, chamando a atenção, em especial, para a necessidade de estudos imunológicos para aperfeiçoamento do poder imunitário das vacinas de germes vivos avirulentos, que considera um grande recurso para a profilaxia da doença, sobretudo para a proteção do rurícola, cujo labor e modo de vida o expõem inevitavelmente a se infectar, por ocasião da ocorrência de epizootias de origem silvestre. Concluída essa primeira parte, passa a fazer o histórico de como se desenvolveu a campanha contra a peste, no Brasil, desde a época da sua invasão em 1899 pelo pôrto de Santos até os nossos dias. Nesse histórico, detem-se um pouco para expôr a atuação do extinto Serviço Nacional de Peste, o qual, criado em 1941, após a reorganização do Departamento Nacional de Saúde, passou

  2. O direito da guerra em Francisco Suárez: o projeto civilizador da Escolástica Espanhola

    Directory of Open Access Journals (Sweden)

    Paulo Emílio Borges de Macedo

    2013-03-01

    Full Text Available O presente texto analisa o direito da guerra em Francisco Suárez. Menos uma explanação sobre um ramo do direito internacional, neste trabalho, busca investigar-se a origem deste direito, sob uma ótica bastante particular. Trata-se de reconstruir o intento de um dos maiores expositores da Escolástica Espanhola para salvar uma tradição cristã muito antiga da sua destruição. A doutrina da guerra justa, embora de origem cristã, corresponde a um dos maiores esforços da humanidade como um todo para limitar a violência da guerra, mesmo antes da existência de um direito internacional. Para manter a validade das proposições da teoria da guerra justa – e minimizar os efeitos da guerra –, Suárez precisou alterar-lhe o fundamento: de doutrina religiosa, ela se tornou jurídica.

  3. Adiposidade corporal, mas não resistência insulínica, associa-se ao polimorfismo -675 4G/5G no gene PAI-1 em uma amostra de crianças mexicanas

    Directory of Open Access Journals (Sweden)

    Ulises de la Cruz-Mosso

    2013-10-01

    Full Text Available OBJETIVO: Elaboramos este estudo para avaliar se o polimorfismo -675 4G/5G no gene inibidor 1 do ativador do plasminogênio se associa à obesidade e à resistência insulínica em crianças mexicanas. MÉTODOS: Foi realizado um estudo transversal em 174 crianças, 89 delas com peso normal e 85 obesas, variando sua idade de 6 a 13 anos. Todas as crianças eram do estado de Guerrero e foram recrutadas de três escolas primárias na cidade de Chilpancingo, México. Os níveis de insulina foram determinados por prova imunoenzimática. Foi usado o modelo de avaliação da homeostase para determinar resistência insulínica. O polimorfismo -675 4G/5G no gene PAI-1 foi analisado pelo método reação de polimerase em cadeia-polimorfismo no comprimento dos fragmentos de restrição. RESULTADOS: A prevalência de resistência insulínica no grupo obeso foi mais alta (49,41% do que no grupo com peso normal (16,85%. O polimorfismo 4G/5G do PAI-1 foi encontrado em equilíbrio de Hardy Weinberg. O genótipo 4G/5G contribuiu para um aumento significativo da relação cintura-quadril (β = 0,02, p = 0,006, da circunferência da cintura (β = 4,42, p = 0,009 e da espessura da prega subescapular (β = 1,79, p = 0,04, mas não se relacionou com a resistência insulínica. CONCLUSÃO: O genótipo -675 4G/5G do gene PAI-1 se associou a aumento da adiposidade corporal em crianças mexicanas.

  4. Efeito da urina de vaca no estado nutricional da alface

    Directory of Open Access Journals (Sweden)

    Nelson Licínio C. de Oliveira

    2010-08-01

    Full Text Available Existem diversos relatos da utilização da urina de vaca em hortaliças, todavia sua eficácia carece de comprovação. Objetivou-se avaliar o efeito da urina de vaca no estado nutricional da alface. O experimento foi constituído de 12 tratamentos, esquema de parcelas subdivididas, em blocos ao acaso, com quatro repetições. Nas parcelas foram alocadas as vias de aplicação (solo ou foliar e nas subparcelas as concentrações das soluções (0,00; 0,25; 0,50; 0,75; 1,00 e 1,25% v/v. Aplicou-se 60 mL de solução/planta, divididos em cinco aplicações de 5; 5; 10; 20 e 20 mL/planta, aos 7, 14, 21, 28 e 35 após o transplante, respectivamente. Durante o ciclo avaliou-se o índice SPAD e na colheita a massa da matéria seca de cabeça (MSCA e os teores de N, P, K, Ca, Mg, S, Na, Zn, Fe, Mn, Cu e B na matéria seca das folhas (MSF, caule (MSC e raízes (MSR. Em ambas as vias de aplicação o índice SPAD apresentou incremento linear às concentrações e resposta quadrática ao longo do tempo. A MSCA teve comportamento linear às concentrações, com aumento de 25,9 e 35,4% nas aplicações via foliar e solo, respectivamente. Não houve efeito de concentrações sobre teores de nutrientes na MSF e MSC. Na MSR, via solo, os teores de P e K apresentaram pontos de máximo enquanto Fe e Mn de mínimo; o Na apresentou incremento linear às concentrações via foliar. Os efeitos da urina sobre o crescimento da alface provavelmente são devidos a fatores outros que não somente a quantidade de nutrientes veiculados nas soluções.

  5. O desenvolvimento da Competência Informacional nas crianças a partir da literatura infantil

    OpenAIRE

    Djuli Machado De Lucca; Clarice Fortkamp Caldin; João Primo Ramirez Righi

    2015-01-01

    Objetiva realizar uma reflexão acerca da prática de leitura de literatura infantil para o desenvolvimento da Competência Informacional nas crianças. A Competência Informacional é caracterizada por um movimento que estimula o uso crítico e reflexivo da informação. Trata da primeira fase de desenvolvimento da Competência Informacional, entendida, nesse artigo, como letramento informacional, que se constitui em um processo. É nessa fase que o indivíduo desenvolve habilidades básicas relacionadas...

  6. A ruptura articulatória dos seres: a propósito da exposição da vida à dispersão da sua ontologia

    OpenAIRE

    Rosa, Jorge Leandro

    2014-01-01

    Este artigo trata da possibilidade de renovar o entendimento da eugenia no mundo contemporâneo. A biologia e a genética são fontes científicas da eugenia, mas não fazem parte de seu núcleo filosófico. Essa é a razão pela qual vemos a ontologia subjacente à eugenia como nossa principal preocupação. O estatuto da eugenia como uma prática está mudando rapidamente e a vida é tanto o objeto como a dimensão oculta dessa mudança. Entendida por meio da história dos seres, a dispersão da ontologia per...

  7. Acompanhamento de familias de criancas com doenca cronica: percepcao da equipe de Saude da Familia

    Directory of Open Access Journals (Sweden)

    Etelvaldo Francisco Rego Sousa

    2013-12-01

    Full Text Available Este estudo objetivou caracterizar como a equipe da Estratégia Saúde da Família percebe sua dinâmica de acompanhamento de famílias que convivem com a doença crônica da criança. Trata-se de uma pesquisa qualitativa que teve como referencial teórico o Interacionismo Simbólico e como método a Análise de Conteúdo, técnica de análise categorial temática. Para a coleta de dados utilizou-se o grupo focal, que foi desenvolvido com três equipes de Saúde da Família, totalizando 32 sujeitos. Os resultados foram organizados em três categorias temáticas: Peculiaridades das famílias que convivem com a doença crônica da criança; Equipe, família e Estratégia Saúde da Família e Limitações para cuidar. A percepção da equipe é que o desenho da Estratégia Saúde da Família favorece o acesso à experiência familiar, permitindo o reconhecimento de suas especificidades. Os dados revelam ainda as limitações da equipe em sua capacidade de resolução e a necessidade de investimentos na articulação entre os distintos serviços, setores e equipamentos sociais.

  8. PROCESSO DE FORMAÇÃO DA OPINIÃO DO AUDITOR: UMA ABORDAGEM A PARTIR DA SUFICIÊNCIA E PROPRIEDADE DA PROVA

    Directory of Open Access Journals (Sweden)

    ERIVAN FERREIRA BORGES, MSC

    2008-08-01

    Full Text Available O trabalho apresenta um ensaio sobre o processo de formação da opinião do auditor, sob uma perspectiva da prova como elemento principal na formação deste processo. Caracteriza a opinião como um ato de poder capaz de influenciar a tomada de decisão por parte de usuários internos e externos. Apresenta os característicos de propriedade e suficiência como qualificadores da prova numa perspectiva construcionista, como elementos fundamentais à formação do juízo a respeito de um dado, fato ou fenômeno passível de investigação. Abordando a teoria de Mautz (1980, propõe um desenho gráfico do processo de auditoria, enfocando os caracteres da prova como fundamento da opinião do auditor. A proposta não se traduz numa tentativa de estabelecer um novo modelo de processo de formação da opinião do autor, mas numa oportunidade de entender este processo no contexto geral dos trabalhos de auditoria realizados dentro das organizações na conjuntura econômica atual.

  9. O impacto da tecnologia da informação na estratégia de marketing da indústria de cartões de crédito

    OpenAIRE

    Ferreira, Eduardo Carlos

    2010-01-01

    Esse trabalho se propõe a explorar as mudanças ocorridas na estratégia de marketing da indústria como uma resultante da revolução da informação, da evolução tecnológica das ferramentas de marketing e na evolução no composto de marketing

  10. À margem da segunda escravidão? A dinâmica da escravidão no vale amazônico nos quadros da economia-mundo capitalista

    Directory of Open Access Journals (Sweden)

    Daniel Souza Barroso

    Full Text Available Resumo: Não é incomum, na historiografia brasileira, a percepção da formação econômica e social da Amazônia como espaço no qual uma economia escravista de base agrícola não chegou a se estabelecer. Embora tal noção venha sendo desconstruída por diversos estudos produzidos ao longo das últimas décadas, que evidenciaram a efetividade econômica e demográfica da escravidão negra no vale amazônico, ainda não foi levado a efeito um esforço de reflexão sobre essa questão nos quadros da economia-mundo capitalista, como se apresenta neste artigo. Para tanto, a economia escravista da região é cotejada com a chamada segunda escravidão, faceta mais conhecida da história global da escravidão no século XIX.

  11. DETERMINANTES DA DIVULGAÇÃO DOS INDICADORES DE DESEMPENHO DA GRI NAS EMPRESAS DO BRASIL E DA ESPANHA

    Directory of Open Access Journals (Sweden)

    Alan Diógenes Góis

    2015-01-01

    Full Text Available O estudo tem por objetivo investigar os fatores determinantes da divulgação dos indicadores de desempenho de sustentabilidade da GRI nas empresas listadas nas bolsas do Brasil e da Espanha. Para tanto, foram analisados os dados de 94 empresas de capital aberto dos dois países que publicaram relatórios anuais e/ou de sustentabilidade, referentes a 2011, no padrão GRI-G3. A pesquisa é descritiva, com abordagem quantitativa dos dados, utilizando-se a Regressão Linear Múltipla para quatro modelos de disclosure (econômico, ambiental, social e de sustentabilidade. Os resultados mostram que as empresas da Espanha apresentam um nível de disclosure de sustentabilidade mais elevado, e que o nível de evidenciação geral, considerando o conjunto das dimensões da sustentabilidade (econômica, social e ambiental, corresponde a 72,7%. Quanto ao resultado dos modelos de regressão, observa-se que as variáveis independentes (Tamanho, Rentabilidade, Endividamento, Auditoria, Setor de Impacto Ambiental e Idade não explicam o disclosure econômico; porém, quanto aos disclosures ambiental, social e de sustentabilidade, as variáveis Tamanho e Idade são fatores determinantes.

  12. Os azulejos da Misericórdia: a imagem documento na história da cultura religiosa luso-brasileira

    Directory of Open Access Journals (Sweden)

    Maria Eurydice de Barros Ribeiro

    2015-06-01

    Full Text Available Os azulejos portugueses em Portugal e no Brasil são considerados quase sempre como objetos da História da Arte. A proposta deste estudo consiste em abordar os azulejos não como objetos de arte, mas como documentos da história da cultura luso-brasileira. O conceito de imagem documento será desenvolvido por meio da análise de um dos ritos mais importantes da história da cultura religiosa ocidental: a procissão. A atenção do estudo recairá, em especial, sobre a Procissão dos Ossos, que se encontra representada nos painéis de azulejos (séc. XVIII da Igreja da Misericórdia em Salvador. A Procissão dos Ossos, instituída por D. Manoel em 1498, tinha como objetivo a retirada dos ossos dos justiçados, dando-lhes sepultura. Para a missão, o rei designou a Ordem da Misericórdia. O ato régio se estendeu ao Brasil, quando a primeira Casa da Misericórdia foi fundada na cidade do Salvador, em 1549. O painel, datado do século XVIII, representando a cerimônia, divide o espaço da igreja da Misericórdia com outras duas representações: a procissão do Senhor Morto, introduzida no Brasil (também pelos portugueses, e a Procissão do Fogaréu, introduzida pelos espanhóis. Entre a data da realização da primeira Procissão dos Ossos e o assentamento do painel de azulejos existe um espaço de tempo que permite avaliar a heterogeneidade dos tempos da arte, onde os ritmos diferenciados não coincidem, necessariamente, com os tempos da história.

  13. 75 FR 52292 - Airworthiness Directives; Diamond Aircraft Industries GmbH Models DA 40 and DA 40F Airplanes

    Science.gov (United States)

    2010-08-25

    ... Industries GmbH Models DA 40 and DA 40F Airplanes AGENCY: Federal Aviation Administration (FAA), Department... new airworthiness directive (AD) for all Diamond Aircraft Industries GmbH Models DA 40 and DA 40F... received information from Diamond Aircraft Industries GmbH that the Models DA 40 and DA 40F airplanes have...

  14. O guardião da Constituição: o Supremo Tribunal Federal como poder autônomo no julgamento da Lei da Ficha Limpa

    OpenAIRE

    Rossi, Luís Antônio

    2016-01-01

    A presente tese, subsumindo a decisão diante do debate entre os juristas Hans Kelsen e Carl Schmitt sobre o controle de constitucionalidade pátrio, tem o escopo de analisar o comportamento do Supremo Tribunal Federal no julgamento da constitucionalidade da Lei da Ficha Limpa. A tese, ao analisar e refletir sobre quem deve ser o guardião da Constituição , pretende demonstrar que o sistema constitucional brasileiro adotou o positivismo de Hans Kelsen, mas a amplitude da Constituição de 1988, o...

  15. Remoção de polifenóis da farinha de folhas de mandioca Removal of polyphenols of the flour cassava leaves

    Directory of Open Access Journals (Sweden)

    Angelita Duarte Corrêa

    2004-06-01

    Full Text Available A farinha de folhas de mandioca apresenta baixa digestibilidade, mesmo possuindo um teor relativamente elevado em proteínas, principalmente, devido à presença de substâncias como os polifenóis. Visando melhorar o aproveitamento protéico desta farinha, empregaram-se três solventes (água, etanol 50mL/100mL e hidróxido de amônio 1mol/L para remover os polifenóis. Folhas maduras de mandioca foram coletadas na fase vegetativa, em três repetições, colocadas em bandejas de papel e secas à sombra sobre bancadas de madeira, em recinto fechado e arejado, em temperatura ambiente. Após secagem, retiraram-se os pecíolos e as folhas foram moídas e passadas em peneira de 40mesh. A farinha foi submetida, antes e após a remoção dos polifenóis, às análises de umidade, fibra detergente neutra (FDN, fibra detergente ácida (FDA, açúcares totais, proteína bruta, vitamina C total, beta-caroteno, cianeto, inibidor de tripsina, polifenóis e digestibilidade protéica in vitro. Após remoção dos polifenóis, houve diminuição dos teores de açúcares totais, vitamina C total, inibidor de tripsina e polifenóis e aumento de FDN, FDA, proteína bruta, beta-caroteno e digestibilidade protéica in vitro. Dos solventes empregados para remover polifenóis, o hidróxido de amônio foi o mais eficaz, com índice de remoção de 94%, seguido pelo etanol (83% e água (65%. A digestibilidade da proteína in vitro aumentou em 74%, quando o solvente empregado na remoção dos polifenóis foi o hidróxido de amônio.Even featuring a relatively high level in proteins, the flour of cassavaleaves presents low digestibility, mainly, due to the presence of such substances as polyphenols. Seeking to improve the protein availability of such flour, three solvents (water, ethanol 50mL/100mL and ammonium hydroxide 1mol/L were used for the removal of the polyphenols. Mature leaves of cassava were picked in phase of vegetative development, in three repetitions, they

  16. Um modelo da maturidade da gestão da demanda: Um estudo multicaso na cadeia de suprimento de produtos de mercearia básica

    Directory of Open Access Journals (Sweden)

    Daniela de Castro Melo

    2015-03-01

    Full Text Available A gestão da demanda deve equilibrar as necessidades dos clientes com as capacidades da empresa, reduzindo incertezas, resultando em fluxos mais eficientes na cadeia de suprimentos. O objetivo deste estudo foi propor um modelo para analisar a maturidade do processo de gestão da demanda na cadeia de suprimentos de produtos de mercearia básica. Espera-se que o modelo resultante possa subsidiar as empresas a se estruturarem e desenvolverem competências para atingir maturidade no processo de gestão da demanda. Para tal, realizou-se um estudo multicaso que envolveu 22 empresas, dentre as quais: indústrias fornecedoras de produtos de mercearia básica, atacadistas distribuidores e supermercados. Foram realizadas observações diretas e 33 entrevistas nestas empresas. A pesquisa possibilitou estruturar um modelo de maturidade em gestão da demanda composto de quatro estágios divididos em nove dimensões: compartilhamento de informações; planejamento de ações conjuntas; execuções de ações conjuntas; interações inter e intraempresas; indicadores de desempenho; envolvimento da alta gerência; segmentação de clientes; segmentação de fornecedores; tecnologia da informação. Este modelo pode permitir às empresas identificar em qual estágio se encontram e em qual dimensão precisam focar seus esforços. Cada uma das dimensões representa um meio para que as empresas possam se estruturar e otimizar a rentabilidade por meio da melhoria da eficiência e da eficácia na cadeia de suprimentos.

  17. Política da imagem na era da convocação

    Directory of Open Access Journals (Sweden)

    Jose Luiz Aidar Prado

    2012-06-01

    Full Text Available Criticar os dispositivos biopolíticos convocadores das sociedades de controle não significa cair num determinismo apocalíptico. A partir de Didi-Huberman e Rancière, pensaremos, na trilha benjaminiana, o conceito de imagem dialética, a fim de evitar o caminho da denúncia da imagem como idolatria ou do espectador como passivo. Trata-se de pensar uma política crítica da imagem.

  18. Avaliação de furanocumarinas como inibidores da fotossíntese através de ensaios de fluorescência da clorofila a

    Directory of Open Access Journals (Sweden)

    Olívia Moreira Sampaio

    2012-01-01

    Full Text Available The evaluations of Chorophyll a fluorescence emitted by superior plants carry structural information and photosynthetic apparatus function. Quantitative analysis apparatus of fluorescence kinetic were measured by energy flows (ABS, (TR, (ET and (DI, known as phenomenological phenomena of OJIP test. Four furocoumarins were isolated from Ruta graveolens (Rutaceae, and chorophyll a (Chl a fluorescence assays were performed with these compounds to evaluate the photosynthesis inhibition potential. This test was realized in spinach`s leaf discs and in Lolium perenne leaves. The results indicated the herbicide potential mainly for bergapten and chalepin.

  19. EFEITOS DA LARGURA DA FAIXA DE CAPINA NA CULTURA DA MAMONA

    Directory of Open Access Journals (Sweden)

    EDISON MARTINS PAULO

    1997-01-01

    Full Text Available Estudou-se a influência de diferentes larguras de faixas de controle de plantas daninhas sobre a altura, o número de racemos e a produção de grãos da mamoneira (Ricinus communis L. var. IAC-80, objetivando-se determinar a área vegetada entre as linhas de plantio. Os experimentos foram desenvolvidos em Adamantina, na Estação Experimental de Agronomia da Alta Paulista do Instituto Agronômico (IAC, nos anos agrícolas 1989/90, 1990/91 e 1991/92. O delineamento estatístico adotado foi o de blocos ao acaso com quatro repetições e oito tratamentos. Os tratamentos consistiram em faixas com 0,0; 0,5; 1,0; 1,5; 2,0; 2,5 e 3,0 m de largura capinadas ao longo da linha de plantio e mantidas sempre livres de plantas daninhas; além dessas, mateve-se uma faixa de 1,0 m de largura e mesmo procedimento, na qual a comunidade infestante das entrelinhas era roçada manual- mente sempre que a altura média de 0,3 m era atingida. Concluiu-se que faixas de capina menores do que 1,0 m aplicadas sobre a linha de plantio da cultura diminuíram a produção de grãos, o número de racemos e a altura da mamoneira.Three experiments were carried out in Adamantina at the Experimental Station of Agronomy of Alta Paulista, Instituto Agronômico (IAC, State of São Paulo, Brazil, on a Dark Red Latosol during 1989-1992, in order to study the effects of different row widths covered by weeds on the yield, height and number of racemes of IAC-80 castor bean cultivar. Hoed rows of 0.0, 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0 m wide were studied. An extra treatment had the entire plot covered with weeds mantained at 0.3 m height. The row space used was 3.0 x 1.0 m and the plots were 9.0 x 5.0 m. The experiment was set in a randomized complete block design with four replications. Hoeing row width of 1.0 m or less reduced raceme emission, plant height and seed yields.

  20. MATRIZ DE NOSSA SENHORA DA CONCEIÇÃO DA SERRA-ES: IGREJA E RELIGIOSIDADE NO CONTEXTO DA ROMANIZAÇÃO CATÓLICA (1880 - 1916)

    OpenAIRE

    PIMENTEL, R. R.

    2012-01-01

    RESUMO A presente dissertação tem como objetivo analisar as manifestações da religiosidade relacionadas à matriz de Nossa Senhora da Conceição da cidade da Serra, no Espírito Santo, durante a atuação dos bispos D. Pedro Maria de Lacerda, D. João Batista Corrêa Nery e D. Fernando Monteiro, agentes do projeto de romanização da Igreja Católica no Espírito Santo entre os anos de 1880 e 1916. Este período abarca uma grande transformação na vida política e religiosa do Brasil, que passa de ...

  1. Nos trilhos da Rua da Linha: a motivação semântica da Toponímia Urbana da cidade de Santo Antônio de Jesus

    Directory of Open Access Journals (Sweden)

    Lana Cristina Santana de Almeida

    2012-01-01

    Full Text Available Este artigo é resultado de um estudo monográfico realizado em 2009, no curso de Especialização em Estudos Linguísticos, pela Universidade de Feira de Santana- BA (UEFS e da continuação dos estudos onomásticos realizados no curso de Pós-graduação stricto sensu, na Universidade Federal do Estado da Bahia (UFBA-BA. O objetivo da pesquisa centrou-se na análise das motivações toponímicas da área urbana da cidade de Santo Antônio de Jesus- BA, com enfoque sobre os principais logradouros dos bairros que correspondem às vias de acesso mais antigas da cidade, a saber, Centro, Nossa Senhora das Graças, São Benedito e Andaiá. Também, nesta pesquisa, verificou-se a coexistência entre as nomeações oficiais de alguns logradouros desses bairros e suas nomeações iniciais, as quais remetem ao processo de urbanização desta cidade. Para o desenvolvimento deste artigo, utilizou-se como base teórico-metodológica os princípios de pesquisa onomástica proposto por Dick (1990, 1996, 2001, 2003, 2007 e a teoria estruturalista de Saussure (1969 e Guiraud (1972, no que diz respeito aos aspectos referenciais do signo toponímico.

  2. Uma teoria da decisão judicial da Previdência Social: contributo para superação da prática utilitarista

    OpenAIRE

    José Antonio Savaris

    2010-01-01

    O presente trabalho tem como objetivo propor determinados critérios para a realização judicial do Direito em matéria previdenciária. Aponta que recentes decisões previdenciárias da Suprema Corte adotam a ética utilitarista da maximização da satisfação dos interesses do maior número. Estuda os contornos fundamentais do utilitarismo, conjugando as críticas que lhe são dirigidas a partir da filosofia política. Aborda o modo como o utilitarismo adentra ao universo jurídico, destacando sua influên...

  3. A dimensão da pobreza, da desnutrição e da fome no Brasil

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Monteiro

    2003-08-01

    Full Text Available Este trabalho pretende contribuir para um melhor entendimento da dimensão e possíveis soluções para a fome e a desnutrição no Brasil. Inicialmente, procuramos esclarecer a natureza distinta de cada um desses problemas e o que os distingue conceitualmente da pobreza. A seguir, examinamos as alternativas disponíveis para operacionalizar os conceitos de pobreza, desnutrição e fome em estudos empíricos que buscam aferir a freqüência desses problemas na população. Finalmente, apresentamos e comparamos resultados relativos à freqüência, distribuição geográfica e tendência secular da pobreza, da desnutrição e da fome no Brasil e destacamos suas principais implicações para o delineamento de políticas públicas que busquem o controle desses problemas em nosso meio.This paper intends to contribute to a better understanding of the dimension and possible solutions for hunger and malnutrition in Brazil. We start by clarifying conceptual distinctions between hunger and malnutrition and what distinguishes these two problems from poverty. Then we examine available alternatives to implement the concepts of poverty, malnutrition and hunger in field studies aiming to assess the magnitude of these problems in the population. Finally, we present and compare results on the frequency, distribution and secular trends of poverty, malnutrition and hunger in Brazil and we also discuss its main implications to the design of public policies aiming the control of these problems.

  4. O tempo da fronteira retorno à controvérsia sobre o tempo histórico da frente de expansão e da frente pioneira

    Directory of Open Access Journals (Sweden)

    JOSÉ DE SOUZA MARTINS

    1996-06-01

    Full Text Available O tema da fronteira é um tema recorrente na literatura brasileira de Ciências Sociais. Apesar das tentativas de alguns antropólogos de importar as idéias que F. Turner desenvolveu para explicar o deslocamento da fronteira nos Estados Unidos, e que tratam da influência da fronteira na formação do caráter nacional americano, essas idéias, a rigor, não se aplicam no caso brasileiro. Geógrafos e antropólogos, entre os anos 30 e 50, realizaram pesquisas de campo que se tornaram essenciais para uma concepção sociológica da fronteira enraizada no que há de historicamente singular e sociologicamente relevante no caso brasileiro. É a partir dessas referências que o autor formula a sua tese de que a fronteira é, simultaneamente, lugar da alteridade e expressão da contemporaneidade dos tempos históricos. A unidade do diverso, pressuposto metodológico da dialética, encontra aí o lugar mais adequado e mais rico para a investigação científica.

  5. Inibidor da ECA e concentrações do peptídeo natriurético do tipo B, em idosos com insuficiência cardíaca Inhibidor de la enzima conversora de la angiotensina y concentraciones del péptido natriurético de tipo B, en personas adultas mayores con insuficiencia cardiaca ACE inhibitors and plasma B-type natriuretic peptide levels in elderly patients with heart failure

    Directory of Open Access Journals (Sweden)

    Felicio Savioli Neto

    2009-05-01

    Full Text Available FUNDAMENTO: Ensaios clínicos demonstraram os benefícios dos inibidores da ECA (IECA na atividade neuro-hormonal e na capacidade funcional de pacientes com insuficiência cardíaca (IC, com a magnitude desses efeitos sendo proporcional à dose desses agentes. Entretanto, a sistemática exclusão dos idosos, observada na maioria desses estudos, tem questionado a validação e incorporação de tais resultados na população geriátrica. OBJETIVO: Avaliar os efeitos de diferentes doses de quinapril, um IECA com meia vida biológica >24 horas, nas concentrações plasmáticas do PNB, nas distâncias percorridas no teste da caminhada de 6 minutos (TC-6 min e na incidência de reações adversas, em idosos com IC sistólica. MÉTODOS: Foram avaliados 30 pacientes (76,1 ± 5,3 anos; 15 mulheres, IC II-III (NYHA, FE ventricular esquerda FUNDAMENTO: Ensayos clínicos revelaron los beneficios de los inhibidores de la enzima conversora de la angiotensina (IECA en la actividad neurohormonal y en la capacidad funcional de pacientes con insuficiencia cardiaca (IC. La magnitud de esos efectos fue proporcional a la dosificación de esos agentes. Sin embargo, la sistemática exclusión de las personas adultas mayores, observada en la mayoría de esos estudios, ha conllevado al cuestionamiento de la validación e incorporación de dichos resultados en la población geriátrica. OBJETIVO: Evaluar los efectos de diferentes dosis de quinapril, un IECA con vida media biológica >24 horas, en las concentraciones plasmáticas del péptido natriurético de tipo B (PNB, en las distancias recorridas en el test de marcha de 6 minutos (TM6m y en la incidencia de reacciones adversas, en personas adultas mayores con IC sistólica. MÉTODOS: Se evaluaron a 30 pacientes (76,1 ± 5,3 años; 15 mujeres, IC II-III (NYHA, fracción de eyección (FE ventricular izquierda BACKGROUND: Clinical trials have demonstrated the benefits of ACE inhibitors (ACEI in the neurohormonal

  6. Significados Ocultos da Enfermagem

    Directory of Open Access Journals (Sweden)

    Wiliam César alves Machado

    2011-04-01

    Full Text Available Sabe-se que as ações de cuidar em enfermagem foram sendo moldadas através da história da humanidade e deram-se, majoritariamente, na esfera do subjetivo que permeia as interações existenciais do ser humano que cuida e daquele que recebe cuidados. Campo fecundo para intercâmbios eletromagnéticos. Suas origens remontam ao cuidado prestado por mães, pais, avós, irmãos e demais familiares incumbidos da responsabilidade de ajudar entes recém-natos, crianças, doentes e idosos em suas necessidades de cuidados para preservação da vida.

  7. Avaliação da Qualidade da Tradução: resultados da primeira fase de um estudo longitudinal sobre a aquisição da competência tradutória

    Directory of Open Access Journals (Sweden)

    Tania LIPARINI CAMPOS

    Full Text Available RESUMO Este artigo apresenta um recorte do projeto Competência Tradutória e Formação de Tradutores: o desenvolvimento das subcompetências específicas do tradutor (CNPq 485158/2013-2, cujo objetivo é investigar o desenvolvimento da competência tradutória em um grupo de tradutores em formação a partir de um estudo longitudinal. São apresentados a metodologia - adaptada dos trabalhos de Colina (2008, PACTE (2011b e Braga (2012 - e os resultados da análise da qualidade do produto final da primeira fase do projeto. Estes apontam que os sujeitos têm competência tradutória ainda pouco desenvolvida e que a produção de traduções adequadas está relacionada ao nível de dificuldade da tradução.

  8. Os Avanços e os Limites da Queda Recente da Desigualdade no Brasil.

    Directory of Open Access Journals (Sweden)

    Patrícia Andrade de Oliveira e Silva

    2014-08-01

    Full Text Available O presente artigo tem como objetivo analisar os avanços e os limites na análise da queda recente verificada na desigualdade no Brasil. É sabido que durante os anos 2000, a alteração verificada no Índice de Gini teve como efeitos a redução expressiva da pobreza extrema, com um crescimento de quase 20% na renda desses indivíduos. No entanto, apesar da melhora nos rendimentos - derivado da conjugação entre o aquecimento da economia nacional (com expansão do consumo, melhora dos preços relativos e maior atuação das políticas sociais e internacional - alguns trabalhos argumentam que a desigualdade deve ser vista por um prisma multidimensional. Nesse sentido, pretende-se sintetizar e analisar a literatura acerca do tema, demonstrando as suas limitações e propondo novos enfoques para o estudo da realidade brasileira.

  9. Percalços da Educação Infantil como direito da criança: análise da história e da legislação das décadas de 1980 e 1990

    OpenAIRE

    Lucas, Maria Angélica Olivo Francisco; Universidade Estadual de Maringá; Machado, Maria Cristina Gomes; Universidade Estadual de Maringá

    2012-01-01

    Nesse artigo, discutimos a respeito da função da educação infantil entre o fim da ditadura militar até a aprovação da atual Lei de Diretrizes e Bases (LDB). Esse período se constitui em etapa importante para a história desse nível de ensino devido à produção de documentos fundamentais que reconhecem os direitos da criança, tais como a Constituição Federal (1988), o Estatuto da Criança e do Adolescente – ECA (1990) e a Política Nacional de Educação Infantil – PNEI (1994) – fontes deste estudo....

  10. Recortando e colando as imagens da vida cotidiana do trabalho e da cultura lúdica das meninas-mulheres e das mulheres-meninas da Zona da Mata Canavieira Pernambucana

    Directory of Open Access Journals (Sweden)

    MAURÍCIO ROBERTO DA SILVA

    Full Text Available Este texto trata de diversos aspectos macro e microssociais da vida cotidiana das meninas-mulheres e das mulheres-meninas da Zona na Mata Canavieira Pernambucana. Procura mostrar, por um lado, a alienação e o conformismo que se expressam na dura e perversa vida de trabalho precoce, dupla jornada de trabalho e trabalho doméstico dessas meninas e mulheres. Por outro lado, valoriza outros aspectos relacionados à transgressão e resistência da cultura lúdica construídas em surdina na vida cotidiana, para além da alienação e do conformismo, a saber: o lazer/lúdico construído à revelia do sistema patriarcal e do projeto de estranhamento do trabalho capitalista no mundo rural.

  11. Recortando e colando as imagens da vida cotidiana do trabalho e da cultura lúdica das meninas-mulheres e das mulheres-meninas da Zona da Mata Canavieira Pernambucana

    Directory of Open Access Journals (Sweden)

    SILVA MAURÍCIO ROBERTO DA

    2002-01-01

    Full Text Available Este texto trata de diversos aspectos macro e microssociais da vida cotidiana das meninas-mulheres e das mulheres-meninas da Zona na Mata Canavieira Pernambucana. Procura mostrar, por um lado, a alienação e o conformismo que se expressam na dura e perversa vida de trabalho precoce, dupla jornada de trabalho e trabalho doméstico dessas meninas e mulheres. Por outro lado, valoriza outros aspectos relacionados à transgressão e resistência da cultura lúdica construídas em surdina na vida cotidiana, para além da alienação e do conformismo, a saber: o lazer/lúdico construído à revelia do sistema patriarcal e do projeto de estranhamento do trabalho capitalista no mundo rural.

  12. Terapia cognitivo-comportamental da fobia social

    OpenAIRE

    Ito,Lígia M; Roso,Miréia C; Tiwari,Shilpee; Kendall,Philip C; Asbahr,Fernando R

    2008-01-01

    OBJETIVO: Este artigo revisa aspectos relevantes da fobia social e os estágios de tratamento através da terapia cognitivo-comportamental em crianças, adolescentes e adultos. MÉTODO: A partir do banco de dados Medline, realizou-se revisão da literatura publicada a respeito do tratamento da fobia social por meio da terapia cognitivo-comportamental. RESULTADOS: Revisão da literatura sugere que a fobia social é uma condição prevalente e crônica, caracterizada por inibição social e timidez excessi...

  13. USO DA DORAMECTINA NO TRATAMENTO DA DEMODICOSE CANINA: RELATO DE CASO

    Directory of Open Access Journals (Sweden)

    Lívia Silva JACOMINE

    2017-12-01

    Full Text Available A demodicose ou sarna demodécica é uma dermatoparasitose não contagiosa e ocasionada por uma reação cutânea inflamatória relacionada à multiplicação excessiva do ácaro Demodex canis. As causas da doença não estão totalmente definidas, entretanto, a baixa imunidade é um fator que predispõe a doença. A classificação da demodicose baseia-se na localização corpórea do animal, sendo localizada ou generalizada. O prognóstico é variável. Os sinais clínicos são alopecia, eritema, descamação, hiperpigmentação, liquenificação, febre e linfoadenopatia. O diagnóstico é realizado através de raspado cutâneo, impressão em fita de acetato, tricograma ou biópsia de pele. O tratamento há décadas foi realizado através do uso do amitraz, porém, além da toxicidade, o uso inadequado desse fármaco ocasionou em desenvolvimento de resistência. Atualmente, as lactonas macrocíclicas, tais como ivermectina, doramectina, milbemicina oxima e moxidectina vêm sendo empregadas com sucesso em cães. Entretanto, cães das raças dolicocéfalas, tais como Collie e Pastor Alemão, dentre outras, manifestam reações tóxicas graves com o uso da ivermectina. Assim, o objetivo desse trabalho foi relatar um caso do uso da doramectina na dose de 0,6 mg/kg, via oral a cada 72 horas, durante 60 dias no tratamento da demodicose generalizada em um cão da raça Pastor Alemão. Os resultados obtidos demostraram a melhora clínica do animal e nenhum efeito adverso foi clinicamente observado. Concluindo, não obstante a demodicose ser uma doença clínica desafiadora, o uso da doramectina demostrou vantagens pelo maior intervalo de administração, redução na duração do tratamento e a ausência de reações adversas, comuns as avermectinas quando usadas em animais dolicocéfalos.

  14. Projeto Caminhão da Ciência: Popularização da Ciência no Oeste da Bahia

    Directory of Open Access Journals (Sweden)

    E. C. V. de Magalhães

    2014-11-01

    Full Text Available O Projeto Caminhão da Ciência tem por objetivo promover a divulgação científica em Escolas e espaços públicos da Região Oeste da Bahia. O projeto teve início no ano de 2009, com apoio do CNPq, ocorrendo a sua primeira apresentação no ano de 2010, na feira libre de Barreiras. Várias áreas do conhecimento são contempladas entre eles: Biologia, Física, Química, Matemática, Geologia e Engenharias. O projeto se fundamenta por apresentações de temáticas desenvolvidas por alunos de graduação, sob a orientação de professores da Universidade Federal do Oeste da Bahia-UFOB, envolvidos no projeto. Diversas temáticas são desenvolvidas na forma trabalhos interdisciplinares entre eles: elaboração de maquetes, experimentos com uso de materiais alternativos, vídeos, jogos e ainda informativos em websites e webblogs. Para as apresentações do projeto, são realizadas visitas nas escolas ou outros espaçoes e os materiais trasportados no Caminhão são montados no espaço físico disponibilizado, criando um cenário similar ao de uma feira de ciências. Neste trabalho são apresentados relatos de apresentações realizadas em Escolas, enfatizando os resultados obtidos que demonstram a socialização do conhecimento científico entre os monitores e a comunidade assistida, além da interação entre a Universidade e a sociedade.

  15. As dobras da imagem

    Directory of Open Access Journals (Sweden)

    Profª. Drª. Fátima Antunes da Silva (Yaska Antunes

    2009-05-01

    Full Text Available O presente trabalho tem por objetivo tentar compreender a produção da imagem visual no teatro. Para isso se vale da apropriação livre do conceito de “dobra? de Gilles Deleuze para se referir à multiplicidade de imagens criadas pelas diversas modalidades artísticas. Como no teatro há o entrelaçamento de imagens verbais – palavras enunciadas pelo texto dramático ou teatral – com imagens visuais – a visualidade advinda da composição cênica concreta que organiza no espaço ator e objeto –, a ênfase só podia recair sobre estas duas formas imagéticas. No caso do teatro, surge ainda a percepção de que para além da materialidade da cena, outras imagens emergem do confronto entre palco e platéia. Nesse sentido, imagem teatral seria então aquilo que surge da interação entre ator e espectador. A contribuição desse trabalho pode estar no fato de atualizar certos conceitos sobre a criação da imagem poética na poesia e no cinema para aplicá-los ao teatro. Ao recuperar o pensa-mento de Otávio Paz, Alfredo Bosi, Sergei Eisenstein, entre outros, bus-ca-se promover uma reflexão mais aprofundada sobre a construção visual no teatro.

  16. Determinação dos valores da pressão da artéria pulmonar, da oximetria, da hemogasometria e dos teores plasmáticos de lactato em bezerros nos primeiros 30 dias de vida

    OpenAIRE

    Melina Marie Yasuoka

    2012-01-01

    A presente pesquisa avaliou a determinação dos valores da pressão da artéria pulmonar, da oximetria, da hemogasometria e dos teores plasmáticos de lactato em bezerros neonatos, com a finalidade de contribuir nos estudos de clonagem e no desenvolvimento de neonatologia veterinária. A monitorização logo após o parto e o nascimento se tornou necessária para a manutenção da vida destes animais, aprimorando-se os protocolos e procedimento tomados, a avaliação clínica do sistema cardiovascular e re...

  17. Severe hyponatremia and the syndrome of inappropriate secretion of antidiuretic hormone (SIADH associated with fluoxetine: case report Hiponatremia grave e síndrome da secreção inapropriada de hormônio antidiurético (SSIHAD associada com fluoxetina: relato de caso

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Twardowschy

    2006-03-01

    Full Text Available Hyponatremia is a significant complication of treatment with serotonin selective reuptake inhibitors (SSRI. We describe a case of a 53-year-old woman that was started on fluoxetine 20 mg/day for depression. Nine days later, the patient started with weakness, nausea, progressing to confusion, inapetence and vomit. Three hours later she became unresponsive and had a generalized seizure. She was brought to our emergency service. On admission, the patient was normovolemic, without focal motor deficits, but had mild generalized muscle rigidity and Babinski's sign bilaterally. Serum sodium was 105 mmol/L, serum osmolality, 220 mmol/L, and urinary osmolality, 400 mmol/L. The other laboratory exams, chest X-ray, cerebrospinal fluid and cranium tomography were normal. She was found to have fluoxetine-induced SIADH and it was descontinued. We started the hyponatremia correction and, in 5 days, the mental status of the patient gradually returned to a normal baseline, paralleling the resolution of her hyponatremia, without recurrence. Hyponatremia and SIADH should be considered if a patient experiences deterioration in his or her clinical condition while taking SSRI. The use of SSRI antidepressants should be remembered in the differential diagnosis of drug-induced hyponatremia.A hiponatremia é complicação significativa do tratamento com inibidores seletivos da recaptação da serotonina (ISRS. Descrevemos o caso de uma paciente de 53 anos de idade que iniciou uso de fluoxetina 20 mg/dia para depressão. Nove dias depois, a paciente apresentou fraqueza, náusea, progredindo para confusão, inapetência e vômitos. Três horas depois ela tornou-se irresponsiva e teve uma crise convulsiva generalizada. Foi então trazida ao nosso serviço de emergência. Na admissão, a paciente estava normovolêmica, sem déficits motores focais, mas apresentava leve rigidez muscular generalizada e sinal de Babinski bilateralmente. O sódio sérico era 105 mmol

  18. QUALIDADE SANITÁRIA DA ÁGUA DISTRIBUÍDA PARA CONSUMO HUMANO PELO SISTEMA DE ABASTECIMENTO PÚBLICO DA CIDADE DE ARARAQUARA-SP

    Directory of Open Access Journals (Sweden)

    JULIANA ALVARES DUARTE BONINI CAMPOS

    2009-07-01

    Full Text Available

    Considerando-se a importância da qualidade da água para a saúde da população, amostras foram coletadas em locais representativos da rede de abastecimento público de Araraquara e analisadas quanto à qualidade físico-química e microbiológica. A cidade foi dividida em dez setores de acordo com a localização dos reservatórios de distribuição. As amostras foram coletadas nas residências selecionadas, em torneiras provenientes da rede de abastecimento. Para verificar a influência da rede de distribuição na qualidade da água, as amostras foram coletadas levando-se em consideração a distância dos reservatórios de distribuição, selecionando-se residências próximas, intermediárias e localizadas na ponta da rede. Foram determinados os teores de flúor, ferro, cloro e cálcio, bem como a cor, a turbidez e o pH, além da contagem de coliformes totais e fecais. Os dados obtidos foram analisados estatisticamente e os resultados comparados com os padrões de potabilidade propostos pela legislação brasileira. Os resultados mostraram que apenas o flúor apresentou algumas variações em sua concentração, estando fora do padrão de potabilidade, o que sugere a necessidade de um maior rigor no controle da fluoretação da água de Araraquara. Os resultados permitem afirmar que o controle físico-químico e microbiológico da água tratada pelo Departamento Autónomo de Água e Esgotos de Araraquara (DAAE revelou-se adequado e que a rede não interferiu na qualidade da água distribuída.

  19. Historicidade da filosofia em Hegel e Heidegger

    OpenAIRE

    Christian Iber

    2017-01-01

    Gostaria de discutir, em forma de teses, a temática da historicidade da filosofia em contraste e na sua divergência em Hegel e Heidegger. Diferente do historicismo, que não soluciona o problema da historicidade da filosofia, porque ele dissolve tendencialmente a filosofia na história da filosofia e não coloca em especial a questão da verdade, Hegel e Heidegger desenvolvem uma teoria genuinamente filosófica da história da filosofia do interesse filosófico pela verdade. Esse interesse genuiname...

  20. Entre prisões da imagem, imagens da prisão

    Directory of Open Access Journals (Sweden)

    Fernanda Spanier Amador

    2014-04-01

    Full Text Available O artigo discute a temática das prisões, da imagem e da subjetividade. Pensando na direção das análises foucaultianas de que as prisões estão estabelecidas nos mais ínfimos espaços da vida cotidiana pelas práticas disciplinares e por jogos de visibilidade e enunciabilidade, pergunta-se: como a experimentação de produção de imagens digitais a respeito do trabalho na prisão, por parte de trabalhadores penitenciários, pode criar um plano perturbador das tecnologias prisionais já estabelecidas, introduzindo dissonâncias nas enunciabilidades e nas visibilidades que atravessam a prisão?

  1. Carcinoma diferenciado da tireóide: a validade da complementação da tireoidectomia

    Directory of Open Access Journals (Sweden)

    José Luís Braga de Aquino

    Full Text Available OBJETIVO: Analisar a invasão tumoral do lobo contralateral da glândula tireóide no carcinoma diferenciado, correlacionando o risco/benefício com as complicações decorrentes de uma segunda intervenção. MÉTODO: De outubro/93 a dezembro/96 foram operados 20 pacientes com carcinomas diferenciados da glândula tireóide. Os parâmetros analisados foram sexo, idade, tipo de operação, tipo de complicações, histopatológico da peça cirúrgica e invasão do lobo contralateral. Eram dois pacientes do sexo masculino (10% e 18 do feminino (90%; as idades variaram de 17 a 89 anos; o tipo histológico mais freqüente foi o carcinoma papilífero (13 casos, seguido do folicular (seis casos e carcinoma de células de Hürthle (um caso. Como primeiro procedimento cirúrgico houve 11 lobectomias + istmectomias, quatro lobectomias subtotais e uma istmectomia. Cinco pacientes não realizaram a totalização (um por fibrose, três por perda de seguimento e um por ser microcarcinoma. RESULTADOS: Na análise do lobo contralateral realizada em 15 pacientes, 11 resultaram negativas e outras quatro positivas (26,6%. As complicações apresentadas foram rouquidão (dois casos revertidos com tratamento fonoterápico, hipoparatireoidismo (dois casos, um transitório e um permanente. CONCLUSÃO: A totalização da tireoidectomia é um procedimento importante no tratamento do tumor maligno da tireóide pela alta porcentagem de metástase contralateral (26,6%. Além disso, é um procedimento com mortalidade nula e pequena incidência de complicações.

  2. REFLETINDO SOBRE AS ESPECIFICIDADES DA GEOGRAFIA NA CRISE DA MODERNIDADE

    Directory of Open Access Journals (Sweden)

    Patrício A. S. Carneiro Carneiro

    2010-08-01

    Full Text Available O presente artigo discute a evolução da ciência moderna, bem como a crise desse paradigma dominante e seus efeitos sobre a geografia. Destaca ainda a necessidade da construção de um novo pensamento científico para além das fronteiras disciplinares e do método absoluto.

  3. Controle Externo da governança de Tecnologia da Informação

    Directory of Open Access Journals (Sweden)

    Raimir Holanda Filho

    2012-06-01

    Full Text Available O crescente processo de informatização da Administração Pública brasileira contribui para uma maior agilidade e qualidade nos serviços públicos prestados para a sociedade e um consequente aumento na transparência das ações governamentais. Por outro lado, os gastos nos investimentos e na manutenção dos recursos de Tecnologia da Informação (TI vêm aumentando consideravelmente, bem como tem-se verificado uma forte dependência das instituições com relação aos sistemas informatizados e à segurança das suas bases de dados. Com o aumento da importância estratégica da área de TI, houve uma busca pela aplicação de modelos de governança, com o objetivo de tornar a área controlável, com resultados mensuráveis e orientada aos objetivos do negócio da instituição. A auditoria de TI tem como função principal avaliar o processo de gestão, no que se refere aos seus diversos aspectos, tais como a governança corporativa, gestão de riscos de TI e procedimentos de aderência às normas regulatórias, apontando eventuais desvios e vulnerabilidades, como também oferecendo alternativas de soluções para esses diversos problemas. No âmbito do controle externo, os Tribunais de Contas começam a reconhecer a necessidade de implantar áreas especializadas na realização de Auditoria de TI. Neste contexto, o presente trabalho pretende apresentar quais as abordagens utilizadas nesta área de fiscalização, destacando a importância da Governança de TI como importante instrumento na atuação do controle externo na fiscalização da gestão e do uso da Tecnologia da Informação na Administração Pública.

  4. Muito além da cigarra e da formiga = Far beyond the ant and the grasshopper

    Directory of Open Access Journals (Sweden)

    Motta, Ana Raquel

    2014-01-01

    Full Text Available As práticas discursivas intersemióticas presentes nos cantos de trabalho são aqui abordadas através de triangulação teórica entre a análise enunciativa do discurso, a ergologia e a etnomusicologia. O objetivo principal é analisar o modo pelo qual muitas experiências humanas, em diversas culturas, desmentem o discurso da “Cigarra e da Formiga”, que caracterizo como o discurso que vincula a música (indexando toda a arte à ociosidade, que desvincula a música da vida cotidiana e que considera o trabalho apenas um peso, uma atividade meio, em que o prazer não se faz presente. Um vídeo sobre o trabalho em uma Casa de Farinha da Comunidade de Barreiras no município de Barrocas, no Estado da Bahia (Brasil é descrito e analisado, possibilitando a conclusão de que, em mutirões em que se trabalha cantando, o corpo-si (cf. SCHWARTZ integra aspectos da identidade, do cumprimento da tarefa e da memória coletiva do grupo

  5. RELIGIÃO E NEGAÇÃO DA MODERNIDADE: A LEITURA FUNDAMENTALISTA DA BÍBLIA NAS REVISTAS DE ESCOLA BÍBLICA DOMINICAL DA ASSEMBLÉIA DE DEUS

    OpenAIRE

    Bertone de Oliveira Sousa

    2010-01-01

    Este artigo investiga as peculiaridades da leitura da Bíblia realizada pelos redatores das revistas de Escola Bíblica Dominical da Assembléia de Deus no Brasil, tendo como ponto de partida a ortodoxia doutrinária professada pela igreja e o fundamentalismo religioso presente em suas representações. Para isso, faz uma breve historicização da igreja, bem como uma problematização do conceito de fundamentalismo, para depois analisar-se as revistas de faixa etária de jovens e adultos da editora CPA...

  6. E qual o lugar da Geografia Regional no contexto atual da Geografia?

    OpenAIRE

    Serpa, Angelo

    2001-01-01

    Este artigo é uma revisão bibliográfica comentada sobre o papel da Geografia Regional no contexto da ciência geográfico contemporânea, resultado das reflexões e experiência como professor, desde 1997, das disciplinas Geografia Regional I e II (do curso de graduação em Geografia) e Evolução e Organização do Espaço Regional (do curso de Mestrado em Geografia), na Universidade Federal da Bahia.

  7. Modelagem da qualidade da água do rio Poti em Teresina (PI

    Directory of Open Access Journals (Sweden)

    Antônio Alves de Oliveira Filho

    2017-07-01

    Full Text Available RESUMO O crescimento desordenado da capital piauiense - marcado, sobretudo, pela ocupação habitacional às margens do rio Poti e pela existência de ligações clandestinas de esgoto bruto nas tubulações de drenagem pluvial - tem contribuído significativamente para a poluição das águas da bacia hidrográfica do rio Parnaíba (região semiárida do Brasil. A presente pesquisa tem como objetivo realizar a modelagem matemática da qualidade da água em um trecho de 36,8 km de extensão do rio Poti, com base na plataforma QUAL-UFMG. A pesquisa apresenta-se como o primeiro estudo envolvendo modelagem da qualidade da água no referido rio. Os componentes modelados foram: oxigênio dissolvido (OD, demanda bioquímica de oxigênio (DBO e coliformes termotolerantes (CT. Os resultados das medições de campo indicaram desconformidades do parâmetro CT com relação à Resolução CONAMA nº 357/2005. A calibração dos coeficientes de decaimento para cada parâmetro resultou em desvios médios entre dados medidos e modelados de até 20% e coeficientes de eficiência de Nash-Sutcliffe superiores a 0,75, o que indica que o QUAL-UFMG pode ser utilizado como base para predição da qualidade da água em rios localizados em regiões semiáridas. O modelo calibrado também foi comparado aos dados de campo obtidos na literatura. Finalmente, foram realizadas simulações do modelo para diferentes cenários de vazão (mínimas e máximas, apresentando resultados coerentes e que podem ser utilizados para a gestão dos recursos hídricos do estado do Piauí.

  8. Uma proposta de analise da capacidade de inovação da firma a partir de estudos de caso em empresas do setor agroindustrial da Região

    OpenAIRE

    Benedet, Daniele Mello

    2013-01-01

    Sendo inovação um tema complexo, que merece destaque, busca-se compreender o processo inovativo da firma que é um agente dinâmico, formado por um conjunto de recursos produtivos que se adaptam ao ambiente competitivo ao qual pertence, por meio da identificação da sua capacidade de inovação. O objetivo da presente dissertação é compreender as características da capacidade inovativa de firmas que incorporam inovações tecnológicas, por meio de quatro capacidades entendidas como formadoras da cap...

  9. Avaliação da reprodutibilidade das medidas da camada de fibras nervosas retiniana e da cabeça do nervo óptico pela tomografia de coerência óptica

    Directory of Open Access Journals (Sweden)

    Ricardo Rau

    2012-10-01

    Full Text Available OBJETIVO: Determinar a reprodutibilidade da espessura da camada de fibras nervosas da retina peripapilar e dos parâmetros da cabeça do nervo óptico em olhos normais, utilizando a tomografia de coerência óptica de domínio espectral (SD-OCT. MÉTODOS: Trinta e quatro olhos de 34 indivíduos saudáveis foram incluídos no estudo. O protocolo do cubo do disco óptico 200x200 do OCT Cirrus foi utilizado para gerar 3 imagens de cada olho para avaliar a reprodutibilidade. O coeficiente de correlação intraclasse (ICC foi calculado para as medidas da espessura da camada de fibras nervosas da retina e da cabeça do nervo óptico. RESULTADOS: A correlação foi excelente para todas as medidas da espessura da camada de fibras nervosas da retina (ICC entre 0,87 e 0,98. O mesmo ocorreu com os parâmetros da cabeça do nervo óptico que, com exceção da razão E/D vertical (ICC 0,56, apresentou ICC entre 0,83 e 0,99. CONCLUSÃO: As medidas de espessura da camada de fibras nervosas da retina peripapilar e os parâmetros da cabeça no nervo óptico demonstraram uma excelente reprodutibilidade com o OCT Cirrus, indicando que este aparelho poderá ser uma ferramenta útil no estudo do glaucoma. Este estudo apresenta algumas limitações, como o pequeno número de casos avaliados, sendo necessários maiores estudos para corroborar nossos achados.

  10. Apatia multimodal iatrogênica Multimodal apathy: a unique effect of antidepressant therapy at the neurological-psychiatric interface

    Directory of Open Access Journals (Sweden)

    Ricardo de Oliveira-Souza

    1996-06-01

    Full Text Available O presente trabalho documenta um efeito peculiar dos antidepressivos em 5 pacientes - a apatia -, definida pela incapacidade de experimentar emoções. O reconhecimento da apatia no curso de tratamento antidepressivo deve levantar a possibilidade de iatrogenia e suspensão do antidepressivo em uso. Frizamos que a apatia deve ser diferenciada da abulia e da avolição, com as quais é comumente contundida. Documentamos que a indiferença emocional pode se confinar a um domínio sensorial ("apatia unimodal" ou, como em nossos casos, a mais de uma modalidade ("apatia multimodal". Circuitos anterobasais, centrados na amígdala e no pólo temporal, são fortes candidatos para integrar a experiência emocional às imagens mentais e percepções multimodais do ambiente, uma vez que para eles convergem os principais sistemas de projeção do prosencéfalo, ao mesmo tempo em que se situam em pontos estratégicos para modular o córtex pré-frontal e parieto-têmporo-occipital. O fato de que a apatia foi produzida por classes quimicamente distintas, como ISRSs (inibidores seletivos de recaptação da serotonina, IMAOs (inibidores reversíveis da monoamino oxidase e tricíclicos, indica que a fisiopatologia em jogo se deve a alguma ação compartilhada por essas drogas no plano subneuronal. A intervenção em circuitos serotoninérgicos cerebrais parece o mecanismo mais adequado para explicar tal efeito.The present paper reports on five patients who developed apathy as a peculiar side effect of antidepressants. Their behavioral and psychopathological changes were primarily due to the near-absence of emotional experience, a key characteristic that distinguishes apathy from avolition and abulia. The emergence of apathy in the course of an antidepressant treatment should raise the suspicion of an adverse effect of the drug and lead to its prompt withdrawal. A sample of the relevant clinical evidence favoring the distinction of apathy confined to a single

  11. História da genética no Brasil: um olhar a partir do Museu da Genética da Universidade Federal do Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Vanderlei Sebastiao de Souza

    2013-06-01

    Full Text Available Aborda o contexto de criação do Museu da Genética, em 2011 no Departamento de Genética na Universidade Federal do Rio Grande do Sul, em Porto Alegre, e apresenta sua estrutura e conteúdo. Argumenta-se que os materiais disponibilizados no Museu da Genética constituem uma rica fonte para pesquisas sobre a história da genética no Brasil (e da genética de populações humanas em particular a partir da segunda metade do século XX, tema ainda pouco investigado, apesar da proeminência dessa área do conhecimento no Brasil.

  12. Recognizing Multi-user Activities using Wearable Sensors in a Smart Home

    DEFF Research Database (Denmark)

    Wang, Liang; Gu, Tao; Tao, Xianping

    2010-01-01

    The advances of wearable sensors and wireless networks oer many opportunities to recognize human activities from sensor readings in pervasive computing. Existing work so far focuses mainly on recognizing activities of a single user in a home environment. However, there are typically multiple inha...

  13. [2- (2, 4-dimethylphenylthio) phenyl] aniline and it

    Indian Academy of Sciences (India)

    Sambhaji

    MgSO4, 0.5 g aspargine and 2 ml glycerol in distilled water (100 ml) followed by pH ..... aniline and its derivatives with the crystal structure of. Page 13. 13. Mycobacterium tuberculosis enoyl-acyl carrier protein reductase (InhA) (PDB ID: 4TZK).

  14. ASPECTOS RELEVANTES DO INSTITUTO DA INVERSÃO DO ÔNUS DA PROVA

    Directory of Open Access Journals (Sweden)

    João Alberto Mendes Bezerra Júnior

    2017-04-01

    Full Text Available O presente trabalho pretende contribuir, ainda que minimamente, com o mundo jurídico, no que diz respeito ao instituto da inversão do ônus da prova, previsto no art. 6º, VIII do Código Brasileiro de Defesa do Consumidor, sob o enfoque do Direito Constitucional. Além de abordar o alcance dos requisitos impostos por esse dispositivo legal, o estudo trata do momento em que a inversão do ônus da prova deve ocorrer no processo civil, trazendo novas luzes a respeito, mormente como reforço à tese da regra de julgamento, que, ao invés de corresponder a uma violação do princípio constitucional do devido processo legal, fortalece-o dentro de nosso ordenamento jurídico.

  15. Consenso 2012 da Sociedade Brasileira de Reumatologia sobre o manejo de comorbidades em pacientes com artrite reumatoide 2012 Brazilian Society of Rheumatology Consensus on the management of comorbidities in patients with rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Ivânio Alves Pereira

    2012-08-01

    Full Text Available OBJETIVO: Elaborar recomendações da Comissão de Artrite Reumatoide da Sociedade Brasileira de Reumatologia (SBR para o manuseio das comorbidades em artrite reumatoide (AR. MÉTODOS: Revisão da literatura e opinião de especialistas da Comissão de AR da SBR. RESULTADOS E CONCLUSÕES: Recomendações: 1 Diagnosticar e tratar precoce e adequadamente as comorbidades; 2 O tratamento específico da AR deve ser adaptado às comorbidades; 3 Inibidores da enzima conversora da angiotensina (IECA ou bloqueadores dos receptores de angiotensina II (BRA são preferidos no tratamento da hipertensão arterial sistêmica; 4 Em pacientes com AR e diabetes mellitus, deve-se evitar o uso contínuo de dose cumulativa alta de corticoides; 5 Sugere-se o uso de estatinas para manter níveis de LDL menor que 100 mg/dL e índice aterosclerótico menor que 3,5 em pacientes com AR e comorbidades; 6 A síndrome metabólica deve ser tratada; 7 Recomenda-se a realização de exames para a investigação de aterosclerose subclínica; 8 Maior vigilância para um diagnóstico precoce de neoplasia oculta; 9 Medidas de prevenção para trombose venosa são sugeridas; 10 Recomenda-se a realização de densitometria óssea em pacientes com AR acima de 50 anos, e naqueles com idade menor com corticoide maior que 7,5 mg por mais de três meses; 11 Pacientes com AR e osteoporose devem evitar quedas, e devem ser aconselhados a aumentarem a ingestão de cálcio, aumentarem a exposição solar e fazerem atividade física; 12 Suplementação de cálcio e vitamina D é sugerida.Autilização de bisfosfonatos é sugerida para pacientes com escore T menor que -2,5 na densidade mineral óssea; 13 Recomenda-se equipe multidisciplinar, com participação ativa do médico reumatologista no tratamento das comorbidades.OBJECTIVE: To elaborate recommendations of the Rheumatoid Arthritis Committee of the Brazilian Society of Rheumatology (SBR to manage comorbidities in rheumatoid arthritis (RA

  16. DA NECESSIDADE DE EFETUAÇÃO DA REPRESENTAÇÃO DA VÍTIMA NOS CRIMES DE VIOLÊNCIA DOMÉSTICA CONTRA A MULHER, À LUZ DA AÇÃO DIRETA DE INCONSTITUCIONALIDADE 4.424/DF.

    Directory of Open Access Journals (Sweden)

    Ozana Rodrigues Boritza

    2018-03-01

    Full Text Available Este trabalho possui a finalidade de discutir acerca da necessidade de efetuação da representação criminal da vítima, em casos de violência doméstica e familiar contra a mulher, sob o enfoque da decisão proferida pelo Supremo Tribunal Federal no julgamento da Ação Direta de Inconstitucionalidade 4.424/DF. Procurar-se-á demonstrar quão antiga é a condição de submissão da mulher, através de um estudo das sociedades ao longo da história, abordando suas características, a fim de identificar a herança deixada por estas para a sociedade atual. Será apreciada a Lei 11.340/06 (Maria da Penha, destacando as razões de sua criação, seus objetivos, fins sociais e as modificações que efetuou no ordenamento jurídico nacional ao entrar em vigor. Buscar-se-á entender no que consiste a violência doméstica e familiar contra a mulher, suas formas de expressão, as peculiaridades presentes em tal situação, vislumbrando elencar também os motivos que impedem muitas vítimas de denunciar seus agressores.

  17. O Papel da Economia Ecológica nas Políticas Públicas da América Latina : Consenso Latino-Americano da Reunião da ISEE em Washington

    OpenAIRE

    Weiss, Joseph Samson

    2017-01-01

    Depois de dois anos de conversas, as sociedades regionais indicadas, autores institucionais, chegaram a este consenso sobre o papel da economia ecológica na política pública da América Latina, abrangendo os dez temas seguintes: Indicadores de bem-estar apropriados à sustentabilidade socioambiental; Desvinculação do crescimento econômico do uso intensivo de energia e de materiais, assim como da degradação ambiental (decoupling em inglês); Inovação tecnológica com redução de impactos ambientais...

  18. EFEITOS DA SUPLEMENTAÇÃO DE ß-HIDROXI ß-METILBUTIRATO (HMB SOBRE O GANHO DE MASSA MUSCULAR: UMA REVISÃO DOS ASPECTOS ATUAIS

    Directory of Open Access Journals (Sweden)

    RENATA REBELLO MENDES

    2009-07-01

    Full Text Available

    O ganho de massa muscular tem sido tema bastante discutido nas últimas décadas, gerando reflexões sobre métodos eficientes de Se alcançar tal fenômeno. Dentre os métodos mais elucidados, encontram-se o exercício de resistência, os agentes farmacológicos e os suplementos nutricionais. Nesta última classificação, destaca-se atualmente o HMB, um metabólito da leucina. O HMB, associado a treinamentos de resistência, tem sido mencionado como importante inibidor do catabolismo muscular. Acredita-se que a interação entre a suplementação de HMB e o metabolismo protéico seja mediado por uma maior disponibilidade de colesterol, que, por sua vez, é destinado à síntese e regeneração de membranas celulares. Estudos envolvendo suplementação de HMB e indivíduos sedentários em início de treinamento têm demonstrado resultados bastante satisfatórios, em relação ao ganho de massa magra e de força. Porém, em se tratando de indivíduos treinados, os resultados observados têm sido pouco relevantes. Portanto, considera-se necessária a realização de novos estudos comparativos entre altletas e sedentários, objetivando a obtenção de dados mais consistentes.

  19. Imaginários da ordem e da desordem: os 25 anos do Movimento Sem Terra na perspectiva da Revista Veja

    Directory of Open Access Journals (Sweden)

    Marcos Paulo Campos

    2010-04-01

    Full Text Available O presente trabalho tem por objetivo analisar a produção de um imaginário sociodiscursivo a respeito dos 25 anos de atuação do Movimento Sem Terra (MST por parte da revista Veja. Para tanto, a análise põe em foco a reportagem alusiva ao aniversário do Movimento publicada na edição 2097 do periódico. A interpretação aqui trabalhada inscreve-se numa articulação de referenciais analíticos advindos da teoria de análise do discurso e da produção sociológica que trata dos movimentos sociais, especialmente, a relação desses com a grande mídia. Os trabalhos de Maria da Glória Gohn, Porto-Gonçalves e Eduardo Souza são leituras constitutivas da perspectiva sobre os movimentos sociais assumida no texto, bem como, a elaboração de Patrick Charaudeau sobre os imaginários sociais construídos pela prática discursiva contida em sua obra intitulada “Discurso Político” (2006. A análise feita neste trabalho aponta para a mobilização de estratégias discursivas, por parte da revista Veja, que localiza o MST como elemento central do imaginário da desordem no mundo rural.

  20. Aspectos genético-quantitativos da qualidade da carne em frangos

    Directory of Open Access Journals (Sweden)

    Gaya Leila de Genova

    2006-01-01

    Full Text Available O estudo dos parâmetros genéticos das características de qualidade de carne de aves permite à industria avícola se adequar às exigências da indústria processadora, aumentando sua eficiência, e melhorando a aceitação da carne de frango pelo mercado consumidor. Além disso, por meio do estudo destes parâmetros, valiosas informações sobre a caracterização do fenômeno denominado PSE, que representa a carne pálida, flácida e exsudativa, podem ser obtidas, uma vez que são escassos os estudos a esse respeito em frangos. O conhecimento do comportamento genético e da relação entre os atributos da carne e outras características de interesse em frangos de corte pode favorecer o estabelecimento mais preciso e adequado das estratégias utilizadas nos programas de seleção.

  1. OS TUPI GUARANI DA ALDEIA RENASCER (SP: UMA REFLEXÃO SOBRE OS ENUNCIADOS DA MISTURA E OS AGENCIAMENTOS DA "CULTURA"

    Directory of Open Access Journals (Sweden)

    Amanda Cristina Danaga

    2012-12-01

    Full Text Available Esse artigo visa discutir a interlocução da aldeia Renascer com os outros (índios e não índios dentro do contexto de produção da “cultura”. A aldeia em questão fica no município de Ubatuba e formou-se a partir da ocupação de uma aldeia cenográfica, utilizada nas filmagens do longa-metragem “Hans Staden”. Na aldeia residem índios Tupi Guarani e Guarani Mbya, e, assim como as demais aldeias da região, Renascer está inserida no “universo dos projetos” na busca por maior visibilidade no cenário político nacional e nos investimentos, para tornar aparentes as singularidades de sua “cultura”. Na Aldeia Renascer os Tupi Guarani e Guarani Mbya (apesar das diferenças que destacam entre si se organizam e se complementam em torno dos aspectos políticos e religiosos de suas comunidades, agenciando o discurso da “cultura”, principalmente, na interação com o mundo dos não índios, ao requererem seus direitos territoriais e reconhecimento em vários aspectos.

  2. Como os conceitos da gestão da qualidade total podem ser aplicados na prevenção da poluição

    OpenAIRE

    Jose Jeronimo Teixeira

    2006-01-01

    Resumo: O desempenho ambiental de uma organização vem tendo importância cada vez maior para as partes interessadas (consumidor, acionista, colaboradores e sociedade). Atingir um desempenho ambiental adequado requer o comprometimento da organização, uma abordagem sistemática e uma busca contínua da melhoria da qualidade do meio ambiente. O propósito desta dissertação é demonstrar como os conceitos de prevenção da poluição, podem ser implementados em uma organização utilizando-se um ou todos os...

  3. O desenvolvimento da autonomia do estudante de guitarra através da experimentação lúdica nas primeiras fases da aprendizagem

    OpenAIRE

    Soares, Eduardo Daniel Martins Baltar

    2013-01-01

    Relatório de estágio de mestrado em Ensino da Música Ao longo da nossa experiência contexto do ensino básico da música em regime articulado em Portugal, observamos a vigência de um conjunto de práticas educativas musicais baseadas na procura da máxima produtividade, uma tendência que actualmente goza de grande aceitação social. Na nossa opinião, estas práticas podem promover hábitos negativos que não proporcionam uma formação musical e humana completa, nem facilita a progressiv...

  4. Estudo de egressos da Faculdade de Ciências Médicas e da Saúde da PUC-SP de 2004 a 2013

    Directory of Open Access Journals (Sweden)

    Carolina de Campos Carvalho do Amaral Gurgel

    2015-10-01

    Full Text Available Introdução: Desde o início de suas atividades, a Faculdade de Ciências Médicas e da Saúde o curriculum, de 1951 até 2005 seguia o método tradicional de ensino – flexneriano. A partir de então houve mudança para o método ABP. O modelo tradicional permitiu reorganizar o funcionamento das escolas médicas, mas desencadeou um processo de extirpação das propostas de atenção em saúde. No modelo do ABP, o processo educativo está centrado no estudante, estimula-se a capacidade de auto formação, fomentada pela busca ativa de informações. Objetivos: Traçar o perfil do egresso da Faculdade de Ciências Médicas e da Saúde (FCMS; Analisar a percepção dos egressos do curso de Medicina da Faculdade de Ciências Médicas e da Saúde (FCMS quanto à formação e prática profissional; Verificar a inserção destes médicos no mercado de trabalho e nível de satisfação pessoal. Justificativas: Um estudo sobre a compreensão da formação, satisfação profissional dos egressos da Faculdade de Ciências Médicas e da Saúde do curso de Medicina, nunca foi realizada antes pelos pesquisadores da instituição.  Além disso, a modificação do modelo de ensino fomentou a necessidade de avaliar a visão que os ex-alunos tiveram sobre sua formação e se o método de ensino foi decisivo para isso. Metodologia: A fim de obtermos os dados para o estudo, um questionário autoaplicável foi enviado via e-mail e redes sociais para os alunos formados entre 2004 a 2013.  Os dados obtidos foram filtrados a partir dos nossos objetivos traçados inicialmente. Separamos dois grupos: dos egressos de 2004 e 2005, formados pelo método tradicional, e dos e egressos de 2012 e 2013, formados pelo método PBL. Iniciando a análise comparativa de dados. Análise dos dados/Resultado da análise: Apesar dos egressos que cursaram o novo currículo focado no ABP tenham quase a mesma percepção dos que cursaram o antigo, quanto a necessidade de aperfei

  5. Vigilância do desenvolvimento da linguagem da criança: conhecimentos e práticas de profissionais da atenção básica à saúde

    Directory of Open Access Journals (Sweden)

    Raquel Aparecida Pizolato

    Full Text Available RESUMO Objetivo: analisar os conhecimentos e as práticas dos enfermeiros, médicos e cirurgiões-dentistas que atuam na Atenção Básica em relação ao desenvolvimento da linguagem da criança nos primeiros anos de vida. Métodos: tratou-se de uma pesquisa qualitativa com 30 profissionais de uma rede de Atenção Básica dentre eles, médicos, enfermeiros e cirurgiões-dentistas. Uma consulta individual foi realizada mediante um questionário semiestruturado. Empregou-se a técnica de análise temática de discurso, utilizando-se três figuras metodológicas: a Ideia Central, as Expressões-Chaves e o Discurso do Sujeito Coletivo. Resultados: os conhecimentos que os profissionais têm sobre o desenvolvimento da linguagem da criança estavam ancorados às ideias centrais de conhecer alguns marcos do desenvolvimento, a linguagem da criança depende do estímulo do meio, da família e da audição normal, saber muito pouco ou não saber nada sobre o assunto. Os profissionais relataram que gostariam de obter mais informações sobre o assunto em relação aos marcos do desenvolvimento da linguagem da criança, desvios da normalidade e orientações para pais de forma a aprimorar o atendimento da saúde infantil. Conclusão: o conhecimento dos profissionais sobre o assunto apresentou-se limitado, havendo necessidade de ampliar práticas de educação em saúde pela Fonoaudiologia, em parceria com as Instituições de Ensino e os profissionais dos Núcleos de Apoio Saúde da Família, junto aos profissionais da Equipe de Estratégia Saúde da Família, destacando-se o trabalho sobre os marcos do desenvolvimento da linguagem da criança.

  6. Modelagem da biomassa total e da lenha por unidade de área para bracatingais nativos

    Directory of Open Access Journals (Sweden)

    Ronan Felipe de Souza

    2014-02-01

    Full Text Available A bracatinga (Mimosa scabrella Benth. é uma espécie pioneira nativa da Floresta Ombrófila Mista de rápido crescimento e cultivada, predominantemente, na forma de povoamentos puros ou consorciada com culturas agrícolas pelos pequenos e médios produtores da região metropolitana de Curitiba. O objetivo deste estudo foi selecionar equações estimativas da biomassa total e da lenha de bracatingais por unidade de área nas diferentes idades, disponibilizando, assim, uma ferramenta simples e de fácil aplicação durante o processo de comercialização dos povoamentos. Os dados são provenientes de 272 parcelas temporárias com idades variando de 3 a 18 anos. Foram testados 21 modelos tradicionais: 10 aritméticos e semilogarítmicos e 11 logarítmicos. Foram também desenvolvidas equações pelo processo Stepwise a partir de uma matriz de correlação. As equações ajustadas foram comparadas pelo Coeficiente de determinação ajustado (R²aj, Erro-padrão da estimativa percentual (Syx%, teste F e Distribuição gráfica de resíduos. Duas equações para cada caso foram selecionadas, sendo uma tradicional e a outra desenvolvida por Stepwise. Para a biomassa total, foram selecionadas a equação de Clutter e a equação aritmética desenvolvida por Stepwise; e para a biomassa da lenha, a equação da variável combinada, proposta por Spurr, e a equação aritmética de Stepwise. Por fim, realizou-se teste Qui-quadrado (x² a partir de uma amostra de 17 parcelas extraídas da base de dados, em que as quatro equações selecionadas foram consideradas válidas para a estimativa da biomassa total e da lenha dos bracatingais da região metropolitana de Curitiba.

  7. EFEITO DA DESIDRATAÇÃO FOAM MAT NA RETENÇÃO DA VITAMINA C DA POLPA DE CAJAMANGA

    Directory of Open Access Journals (Sweden)

    Caroline Alves BREDA

    2013-04-01

    Full Text Available O objetivo do trabalho foi avaliar o efeito da desidratação foam mat na retenção da vitamina C em polpa de cajamanga. A polpa de cajamanga foi elaborada a partir de quatro formulações utilizando três agentes espumantes combinados em diferentes concentrações: 1 pectina cítrica, 2 produto à base de monoglicerídeos destilados, monoestearato de sorbitana e polissorbato 60 (Emustab e 3 produto à base de sacarose, carboximetilcelulose e goma guar (Super Liga Neutra. A composição proximal e o conteúdo de vitamina C foram determinados na polpa fresca e nas polpas desidratadas obtidas a partir das formulações. Os resultados mostraram que a adição de agentes espumantes favoreceu ao incremento de açúcares e fibras na polpa desidratada. Os agentes formadores de espuma influenciaram na retenção da vitamina C. A polpa desidratada contendo 1,5% de Emustab e 1,0% de pectina obteve maior retenção da vitamina (28,55%.

  8. Aquisição da linguagem: considerações da perspectiva da interação social Language acquisition: explanations of the social interaction perspective

    Directory of Open Access Journals (Sweden)

    Lucivanda Cavalcante Borges

    2003-01-01

    Full Text Available Os estudos sobre a influência dos fatores sociais na aquisição da linguagem tiveram grande impulso com as críticas às considerações de Chomsky de que havia uma "pobreza dos estímulos" e, portanto, a criança não poderia adquirir a linguagem a partir do meio social. Autores da perspectiva da Interação Social no estudo da linguagem desafiam a posição chomskiana, e evidenciam a importância da interação social para a aquisição da linguagem, especialmente as relações da criança com a mãe. Essas relações representam um sistema dinâmico, segundo o qual ambos contribuem com suas experiências e conhecimentos para o curso da interação. A linguagem é entendida, nesta perspectiva, enquanto comunicação, e portanto é anterior ao surgimento das palavras. Neste trabalho, pretende-se apresentar as explicações desta perspectiva teórica sobre o processo de aquisição da linguagem infantil. Serão discutidos os efeitos da fala materna (motherese e sua influência na aquisição da linguagem por parte da criança, assim como os diferentes estilos de input lingüístico, considerando também a importância das características da criança na interação.The studies on the influence of social factors on language acquisition were largely influenced by the criticism made to Chomsky's ideas. Researchers following the social interaction perspective disagree with Chomsky and stress the influence of input on language acquisition. This perspective recognises the role of social interaction between adult and child, especially the mother, in the development of infant language. The relationship is characterised by a bidirectional model in which both parts contribute to the course of interaction. In this perspective, language is considered communication, and so initiate before the emission of words. The aim of this paper is to present the explanations of Social Interaction perspective regarding children's language acquisition. Maternal speech

  9. A CONTABILIDADE DA DESAPROPRIAÇÃO: UM EXAME PRELIMINAR SOBRE O CIRCUITO INFERIOR DA EXPANSÃO URBANA DA METRÓPOLE DE SÃO PAULO

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Rizzi

    2017-03-01

    Full Text Available No final da década de 2000, com a iminência da construção de mais um trecho do Rodoanel Mário Covas, seu trecho Norte, viabilizado por recursos provenientes do Programa de Aceleração do Crescimento – PAC para o transporte, a questão dos fundos de consumo, isto é, dos espaços periurbanos da metrópole paulista, ganhou importância para os agentes do capital atuantes no espaço urbano. Em 2007, foram realizadas entrevistas com a Defesa Civil da sub-prefeitura Brasilândia-Freguesia do Ó e com o sub-prefeito de Jacanã- Tremembé. Também foram realizados trabalhos de campo, nesse mesmo ano, em áreas dessas referidas sub-prefeituras e também na região da “Cratera” e “Colônia”, na zona sul de São Paulo, região conhecida como Parelheiros. Esses campos e entrevistas foram realizados com o objetivo de se observar a questão da urbanização periurbana da Metrópole de São Paulo e sua relação com áreas legalmente protegidas. O texto a seguir é composto de informações extraídas dessas fontes secundárias reforçadas por dados oficiais e estruturado a partir de determinados referenciais teóricos da geografia crítica contemporânea.

  10. Teorias da linguística cognitiva para pensar a categorização no âmbito da Ciência da Informação

    Directory of Open Access Journals (Sweden)

    Luciana Monteiro KREBS

    Full Text Available Resumo Discorre-se sobre fenômenos descritos pela Linguística Cognitiva, estabelecendo relações com a Ciência da Informação, tendo a categorização como fio condutor temático da discussão. A categorização é abordada pela perspectiva da Linguística Cognitiva e cotejada com as demais abordagens linguísticas, com o objetivo de contribuir para a pesquisa na área de organização do conhecimento. Abordam-se os conceitos de análise componencial sêmica, conhecimento dicionarístico e enciclopédico, para depois se trabalharem teorias da Linguística Cognitiva, como semelhanças familiares, Semântica de Frames, categorias radiais, teoria dos protótipos e, por fim, barreiras categoriais fluidas. Conclui-se que a categorização se dá através de complexos processos que refletem aspectos experimentais, imaginativos e ecológicos da mente, colocando em suspenso a ideia de que as categorias possuam limites claros e rígidos. A interpretação de conceitos e, consequentemente, a categorização dependem do contexto de aplicação e, portanto, não são universais. Este artigo contribui para a discussão vigente a respeito da problemática da interoperabilidade de Simple Knowledge Organization System a partir da reflexão sobre essas questões.

  11. Efeito da eutonia no tratamento da fibromialgia

    OpenAIRE

    Maeda,Cecília; Martinez,José Eduardo; Neder,Matilde

    2006-01-01

    OBJETIVO: avaliar a eutonia como método terapêutico auxiliar no tratamento da fibromialgia (FM). MÉTODOS: estudou-se um grupo de 20 mulheres, segundo os critérios do American College of Rheumatology (ACR), com duração mínima de seis meses, sem alterações no tratamento medicamentoso ou prescrição de exercícios nesse período. As pacientes foram avaliadas através do questionário de dados sociodemográficos; Escala Visual Analógica (EVA) para dor e questionário genérico de avaliação da qualidade d...

  12. Aplicação de índices para avaliação da qualidade da água da Bacia Costeira do Sapucaia em Sergipe

    Directory of Open Access Journals (Sweden)

    Rosa Cecília Lima Santos

    2017-08-01

    Full Text Available RESUMO A redução da disponibilidade qualiquantitativa da água no mundo está diretamente relacionada às formas de uso e ocupação do solo, aos processos produtivos da agricultura e da pecuária, ao processo de urbanização e à geração de efluentes domésticos e industriais. Por isso, é importante a realização de diagnósticos de bacias hidrográficas, sobre o uso e a ocupação de seu solo e sobre a qualidade da água como ferramenta para a gestão hídrica. Este estudo teve como objetivo caracterizar e monitorar a qualidade da água da Bacia Costeira do Sapucaia, Sergipe. As coletas foram realizadas em oito pontos, com periodicidade trimestral, de agosto de 2014 a setembro de 2015. Na avaliação da qualidade da água foram utilizados: o Índice de Qualidade da Água (IQA e o Índice de Estado Trófico (IET. As análises das amostras foram realizadas de acordo com os procedimentos estabelecidos no Standard Methods, sendo analisados os seguintes parâmetros: coliformes totais e termotolerantes, turbidez, pH, oxigênio dissolvido, sólidos totais, fósforo total, nitrogênio total, temperatura, condutividade, demanda bioquímica de oxigênio e clorofila. Os resultados do IQA classificam os corpos d’água em aceitável (2,5%, bom (92,5% e ótimo (5,0%. Os resultados do IET classificaram as amostras como: ultraoligotrófico (67,5%, oligotrófico (20,0%, mesotrófico (2,5%, eutrófico (7,5% e supereutrófico (2,5%. Os resultados obtidos permitem afirmar que os rios Aningas, Sapucaia e a Lagoa Redonda apresentam baixo grau de degradação, com menor conservação do ponto amostral localizado no Rio Sapucaia, dentro da Reserva Santa Isabel, por ser uma área bastante visitada nos finais de semana e feriados.

  13. Comportamento da área foliar da videira “Isabel” submetida a diferentes tipos e doses de biofertilizantes

    Directory of Open Access Journals (Sweden)

    Olivânia dos Santos Nascimento

    2014-06-01

    Full Text Available Objetivou-se verificar o efeito da aplicação de diferentes tipos e doses de biofertilizante, na área foliar da videira ‘Isabel’ em cultivo orgânico nas condições edafoclimáticas de Catolé do Rocha-PB. Estudou-se os efeitos de 5 tipos de biofertilizante biofertilizante e 8 doses na área foliar da videira ‘Isabel’ após a primeira poda de produção. O experimento foi conduzido sob condições de campo, em área pertencente à Universidade Estadual da Paraíba, Campus IV. O delineamento adotado foi o de blocos casualizados, com 40 tratamentos, no esquema fatorial 5 x 8, com 4  repetições, totalizando 160 parcelas experimentais, os tratamentos consistiram em aplicações crescentes de diferentes biofertilizante, aplicados de forma independente. O valor da área foliar unitária da videira Isabel aumentou com o incremento da dose do biofertilizante B1 até um limite ótimo de 0,93 L/planta/aplicação; o valor da área foliar unitária diminuiu com o aumento da dose do biofertilizante B1 acima do limite ótimo de 0,93 L/planta/aplicação; a utilização de biofertilizante enriquecido com farinha de rocha e leguminosa (B3 proporcionou maior área foliar unitária e área foliar da planta da videira Isabel.

  14. EFEITOS DA BUROCRACIA NA AVALIAÇÃO DA EDUCAÇÃO SUPERIOR

    Directory of Open Access Journals (Sweden)

    Glades Tereza Félix

    2014-01-01

    Full Text Available Este artigo situa-se na fronteira do debate geral das políticas de educação superior. Tais políticas estão vinculadas às estratégias de inserção da economia nas grandes transformações em âmbito mundial. Nesse contexto, são instaurados processos de avaliação da educação superior que contribuem para a redefinição da relação entre o Estado e o sistema de ensino superior. É nessa perspectiva que se situa o objeto deste estudo – identificar o modelo de gestão pública que conduziu a incorporação formal e definitiva da avaliação como ato regulatório e compulsório no primeiro Governo FHC (1995-2002. De caráter descritivo, com uma abordagem qualitativa, na revisão de literatura destacamos as características do Estado Burocrático e do Estado Gerencial. Igualmente, estudamos o conceito e o significado de eficiência no plano administrativo de ambos os Estados. Os resultados mostraram que o modelo de gestão pública estava em transição, quando a política pública denominada avaliação da educação superior tornou-se regulatória, definitiva e compulsória no país, pois mesmo tendo a base no modelo Gerencial, tal concretização só foi possível por meio de ações burocráticas ancoradas no excesso de legislações. Conclui-se que a emergência da avaliação da educação superior na década de 90 ampliou a burocracia.

  15. Avaliação da composição molecular da cápsula anterior da lente de cães idosos com catarata de alto risco

    Directory of Open Access Journals (Sweden)

    Ana Paula Hvenegaard

    Full Text Available Resumo: Atualmente, a cápsula anterior e o epitélio da lente tem sido cada vez mais estudados, com o intuito de reduzir as possíveis complicações do pós-operatório da remoção da catarata, tal como a opacidade da cápsula posterior, alteração ocasionada principalmente pela diferenciação e migração das células do epitélio lenticular para a cápsula posterior da lente. O objetivo deste estudo foi analisar a composição molecular da cápsula anterior da lente pela técnica histoquímica de PAS (avaliação de proteoglicanos e picrosirius red (avaliação de colágeno IV, em cães idosos com catarata diabética e não diabética do tipo hipermadura, submetidos ao uso ou não de azul de tripano a 0,1 % durante a facoemulsificação. Vinte e sete cães foram estudados, incluindo 21 fêmeas e 6 machos, de 8 a 12 anos de idade (média = 9,6 anos, de diversas raças e divididos em 2 grupos: GC (catarata hipermadura e GCD (catarata diabética. Os resultados das análises realizadas mostraram que ambas as amostras, tanto as provenientes das cataratas hipermaduras, quanto das diabéticas, apresentam semelhante composição molecular de proteoglicanos e colágeno IV e isto independente da utilização de azul de tripano a 0,1 %. Conclui-se, portanto, que se os resultados obtidos forem decorrentes de alterações provocadas pelo rápido metabolismo da catarata diabética e pela cronicidade da catarata hipermadura sugere-se que o comprometimento da estrutura capsular seja de intensidade equivalente e, por consequência, que isto também possa prejudicar o metabolismo das células do epitélio anterior da lente, diminuindo assim a incidência da opacidade da cápsula posterior de cães com catarata diabética e hipermadura submetidos à facoemulsificação.

  16. Competitividade da cadeia produtiva do Arapaima gigas, o pirarucu da Amazônia brasileira

    OpenAIRE

    Gleriani Torres Carbone Ferreira

    2016-01-01

    Com um quinto da água doce do planeta, o sistema fluvial da Amazônia apresenta um enorme potencial para piscicultura. De acordo com a FAO, em função das suas condições geográficas, o Brasil é um dos poucos países que tem condições de atender à crescente demanda mundial, podendo tornar-se um dos maiores produtores de peixes do mundo. A observação desse potencial amazônico motivou o desenvolvimento desta pesquisa que se debruça sobre a questão da competitividade da cadeia produtiva de Arapaima ...

  17. EFEITO DA SALINIDADE NA GERMINAÇÃO E DESENVOLVIMENTO INICIAL DA LEUCENA

    Directory of Open Access Journals (Sweden)

    Gorgônio Maurício da Nóbrega Neto

    1999-08-01

    Full Text Available RESUMO Este trabalho teve por objetivo avaliar o efeito de diferentes níveis de NaCl na germinação e desenvolvimento inicial da leucena (Leucaena leucocephala (Lam. de Wit.. O experimento foi conduzido em casa-de-vegetação, tendo-se utilizado NaCl para salinização artificial do solo, de modo a se obter as concentrações de 0,15; 0,30; 0,45 e 0,60% (CEesiguais a 6, 12, 18 e 24 dS m-1. Analisaram-se as seguintes variáveis: percentagem de germinação, índice de velocidade de germinação (IVG, área foliar, altura de plantas e matéria seca. A análise dos dados demonstrou que o potencial de germinação da leucena foi afetado com o aumento da concentração de NaCl e que o desenvolvimento inicial da leucena sofreu efeito mais significativo a partir da concentração de 0,45%, mas as variáveis área foliar e matéria seca foram afetadas a partir de 0,15 e 0,30%, respectivamente.

  18. Democracia digital? Os usos da Internet pelos sindicatos da saúde

    OpenAIRE

    Marques Alves, P.

    2015-01-01

    Os movimentos sindicais dos países capitalistas desenvolvidos vêm enfrentando uma crise profunda desde os anos 70. As suas causas são múltiplas, nelas se mesclando fatores que lhes são exógenos com outros endógenos, remetendo para a sua burocratização. Visando revitalizar-se, eles têm vindo a implementar ações diversificadas, onde se conta a adoção das TIC e da Internet. Este artigo apresenta os resultados de um estudo sobre a adoção e os usos da Internet pelos sindicatos da saúde. Visou-se c...

  19. Ação antagônica de rizobactérias contra Phytophthora parasitica e p. citrophthora e seu efeito no desenvolvimento de plântulas de citros

    Directory of Open Access Journals (Sweden)

    AMORIM EDNA PEIXOTO DA ROCHA

    2002-01-01

    Full Text Available O antagonismo de Pseudomonas putida biovar A (C1-1B, P. putida biovar B (Santa Bárbara, P. fluorescens (C2-8C e RA2, Bacillus subtilis (OG e RC2 e Flavobacterium sp. (CIS/NA contra Phytophthora parasitica e P. citrophthora , agentes da podridão radicular dos citros, foi avaliado através da inibição do crescimento micelial (cultura pareada e redução na percentagem de infecção da doença em mudas de citros (tratamento de sementes com rizobactérias. Na seleção preliminar, 33 isolados bacterianos foram testados. Sementes de citros pré-germinadas foram tratadas por imersão nas suspensões das bactérias (10(9 ufc/ml, e plantadas em tubetes contendo solo natural infestado com o fitopatógeno (50 ml de suspensão/ kg de solo. A avaliação da percentagem de infecção foi efetuada após 15 dias. In vitro, os isolados bacterianos RC2, OG, CIS/NA e C1-1B foram os mais ativos inibidores do crescimento micelial de Phytophthora. Em condições de casa de vegetação, todos os isolados proporcionaram redução na percentagem de infecção da doença em todos os ensaios realizados. Promoção de crescimento de plantas foi verificada pela inoculação de plântulas com as linhagens OG, RC2, CiS/Na e C1-1B.

  20. Da Vinci-assisted abdominal cerclage.

    Science.gov (United States)

    Barmat, Larry; Glaser, Gretchen; Davis, George; Craparo, Frank

    2007-11-01

    To report the first placement of an abdominal cervicoisthmic cerclage using the da Vinci robot. Case report. Tertiary-care hospital. A 39-year-old female with a history of cervical insufficiency who required a cerclage and was not a candidate for transvaginal cerclage placement. Abdominal cervicoisthmic cerclage placement using the da Vinci robot. Ability to safely and successfully place an abdominal cerclage using the da Vinci robot. Abdominal cerclage was successfully placed using the da Vinci robot. The patient had minimal blood loss and was discharged to home on the same day as surgery. Da Vinci robot-assisted abdominal cerclage placement is an innovative application of robotic surgery and may alter the standard of care for women who require this surgery.

  1. Zoneamento agroclimático da palma forrageira (Opuntia sp. para o estado da Paraíba

    Directory of Open Access Journals (Sweden)

    Bergson G. Bezerra

    2014-07-01

    Full Text Available A palma forrageira tornou-se, ao longo dos anos, uma importante alternativa forrageira no semiárido brasileiro (SAB principalmente em longos períodos de estiagens. Apesar de sua magnitude para a agropecuária, seu cultivo tem dispensando tratos culturais básicos e embasamento técnico-científico quanto às suas exigências climáticas. Assim, o principal objetivo deste estudo foi elaborar o zoneamento agroclimático da cultura da palma forrageira (Opuntia sp. para o estado da Paraíba. O zoneamento agroclimático da palma forrageira foi elaborado com base nos indicadores climáticos delineados na literatura e nos dados climatológicos de precipitação e temperatura (média, máxima e mínima de 97 localidades do estado da Paraíba. De acordo com os resultados obtidos, a mesorregião da Borborema é a que apresenta as condições climáticas mais favoráveis para o cultivo da palma forrageira. As mesorregiões do Agreste, Sertão e a parte do Litoral, são aptas porém com restrições. No entanto, recomenda-se o cultivo da palma forrageira em todo o território do estado da Paraíba, exceto para a parte costeira da mesorregião do Litoral e região em torno de Areia. Em ambos os casos a inaptidão ocorre em função do excesso de precipitação.

  2. BIOECOLOGIA E MANEJO DA BROCA-DA-ERVA-MATE, Hedypathes betulinus (KLUG, 1825 (COLEOPTERA: CERAMBYCIDAE

    Directory of Open Access Journals (Sweden)

    Jerson V. Carús Guedes

    2006-07-01

    Full Text Available A cultura da erva-mate (Ilex paraguariensis A.St.-Hil. apresenta grande importância social, cultural e econômica no sul do Brasil. Com a formação de povoamentos puros e o aumento da área de plantio, observou-se um aumento populacional de muitas espécies de insetos. Dentre os insetos-praga, a broca-da-erva-mate, Hedypathes betulinus (Klug, 1825 (Coleoptera: Cerambycidae, é a de maior importância econômica, em razão dos danos que causa e seu difícil controle. A fase larval ocorre no interior dos galhos e troncos das plantas, dificultando sua detecção e manejo. O manejo cultural e o mecânico são os mais indicados, como a coleta de adultos, poda e queima de partes atacadas da planta, nutrição equilibrada, densidade adequada de plantas e manutenção de áreas com vegetação nativa ou ainda a introdução do policultivo. Com essas técnicas, espera-se um maior equilibrio do agroecossistema e, com isso, a diminuição dos insetos-praga a um nível aceitável. Portanto, o objetivo deste trabalho é reunir e discutir as informações da bioecologia e manejo da broca-da-erva-mate.

  3. A questão da universidade e da formação em ciências sociais

    Directory of Open Access Journals (Sweden)

    Sylvia Gemignani Garcia

    2000-05-01

    Full Text Available A análise histórica dos processos sociais e intelectuais que caracterizam a formação cultural e científica na modernidade contemporânea permite a reconstrução de questões culturais e educacionais que se fazem constantemente presentes hoje no dia-a-dia da vida universitária na forma de problemas acadêmicos e administrativos. Situada na intersecção das áreas de história intelectual, sociologia da ciência e das instituições científicas e sociologia da educação e da cultura, essa perspectiva de investigação aborda, primeiro, os amplos processos institucionais nas esferas da política, da economia e da cultura que situam a questão contemporânea da universidade e da formação em ciências sociais; em seguida, expõe alguns aspectos centrais do debate sociológico acerca da natureza da disciplina e do perfil da formação em ciência social; e, finalmente, discute certos pressupostos e categorias básicas das atuais propostas de reforma universitária.The historical analysis of the social and intellectual processes that characterise the cultural and scientific education in contemporary modernity allows for the reconstruction of cultural and educational questions, which are perceived as academic and administrative problems in our daily lives at the university. The approach adopted in this paper is situated at the intersection between intellectual history, the sociology of science and scientific institutions and the sociology of education and culture. It discusses, firstly, the wide institutional processes in the political, economic and cultural spheres that circumscribe the contemporary questions of the university and the education in social sciences; secondly, it analyses some of the central aspects of the sociological debate on the nature of the discipline and the profile of the education in social sciences; finally it looks at a few premises and basic categories of the present proposals for the reform of the university.

  4. Trauma da Veia Porta

    Directory of Open Access Journals (Sweden)

    Gustavo Pereira Fraga

    Full Text Available OBJETIVO: O trauma da veia porta é raro e freqüentemente fatal por causa de exsanguinação e alta incidência de lesões de estruturas adjacentes. Devido às pecualiaridades desta lesão e diferentes condutas propostas na literatura, o objetivo dos autores é relatar a experiência neste tipo de lesão. MÉTODO: Estudo retrospectivo, de janeiro de 1994 e dezembro de 2001, de 1370 pacientes submetidos à laparotomia devido trauma abdominal. Entre esses, 15 pacientes apresentavam lesão da veia porta. As lesões foram classificadas conforme a sua extensão e localização. RESULTADOS: O mecanismo de trauma predominante foi o penetrante. O diagnóstico da lesão foi realizado no intraoperatório. Os procedimentos executados foram: sutura, anastomose término-terminal e ligadura da veia porta. A mortalidade foi de 53,3%. CONCLUSÃO: A lesão da veia porta possui alta taxa de mortalidade e o atendimento adequado está diretamente relacionado à sobrevida.

  5. da Zehirlenmeleri

    Directory of Open Access Journals (Sweden)

    Necati Akbulut

    2015-02-01

    Full Text Available Gıda Teknolojisinin gelişmesi ile, gıda maddesinin tüketici için daha alımlı olmasını sağlamak, kısa zamanda bozulmasını engellemek ve pazara yeni çeşitler sunmak için bazı kimyasal maddeler kullanılmaya başlanılmıştır. Bunun yanında tarımda kullanılan kimyasal maddeler artmış, ambalaj sanayi gelişmiş, bu dada maddelerine bulaşan maddelerin türlerini arttırmıştır. Ayrıca gıda maddelerine belirli amacı olmadan katılan maddelerde vardır. Diğer taraftan tüketiciyi aldatmak, hile yapmak, çok kar sağlamak veya kötü kaliteyi gizlemek amacı ile de kullanılan maddeler bulunmaktadır. İster teknik zorunluk, ister hile amacıyla olsun bu tür yabancı maddeler öncelikle insan sağlığını ilgilendirmektedir. Bazı maddelerin vücuda alınması sakıncasız olduğu halde, bazıları sakıncalıdır. Sakıncasız olanlarında belirli bir sınırın üzerinde uzun süre alınmaları zararlı olabilmektedir. Bu toplum sağlığı sorunu birçok ülkeyi gıda sanayiinde kullanılan kimyasal maddelerin hoşgörü sınırlarının hesaplanması noktasına götürmüştür.

  6. ARAUTOS DO IMPROVÁVEL, PIONEIROS DA RADIOFONIA E DA CINEMATOGRAFIA EDUCACIONAL NO BRASIL (1920-1930

    Directory of Open Access Journals (Sweden)

    Patrícia Coelho da Costa

    2015-06-01

    Full Text Available Este artigo tem como tema os processos de introdução da radiofonia e da cinematografia no Brasil, ocorridos nas décadas de 1920 e 1930, vistos como resultado de uma fermentação intelectual que enxergava nestes veículos de comunicação a possibilidade de libertar nosso povo, disperso pela imensidão do território nacional, das explicações lendárias e da ignorância. Nesse sentido, o texto apresenta uma análise sobre o papel pioneiro desempenhado por estes intelectuais, a discussão por eles protagonizada em torno da finalidade do rádio e do cinema, bem como as estratégias empregadas para que estes veículos tivessem emprego exclusivamente educacional. Especialmente, este artigo discute as principais frentes de legitimação para a crescente interferência do Estado nos setores da radiodifusão, do cinema e da educação.

  7. Efeito da estratégia de diversificação no valor da empresa: uma revisão sistemática da literatura

    OpenAIRE

    Conceição, Elimar Veloso; Santos, David Ferreira Lopes; Terence, Ana Claudia Fernandes

    2018-01-01

    Não há um consenso teórico e prático quanto à importância da estratégia de diversificação no modelo de criação de valor da empresa. O objetivo deste estudo é analisar os resultados das principais pesquisas acadêmicas neste tema, avalia-se o efeito da diversificação evidenciada na literatura na expectativa de oferecer um framework capaz de aumentar a compreensão da controversa relação entre diversificação e criação de valor. A amostra abrange 38 artigos publicados nos últimos 21 anos (1996 e 2...

  8. RELIGIÃO E NEGAÇÃO DA MODERNIDADE: A LEITURA FUNDAMENTALISTA DA BÍBLIA NAS REVISTAS DE ESCOLA BÍBLICA DOMINICAL DA ASSEMBLÉIA DE DEUS

    Directory of Open Access Journals (Sweden)

    Bertone de Oliveira Sousa

    2010-05-01

    Full Text Available Este artigo investiga as peculiaridades da leitura da Bíblia realizada pelos redatores das revistas de Escola Bíblica Dominical da Assembléia de Deus no Brasil, tendo como ponto de partida a ortodoxia doutrinária professada pela igreja e o fundamentalismo religioso presente em suas representações. Para isso, faz uma breve historicização da igreja, bem como uma problematização do conceito de fundamentalismo, para depois analisar-se as revistas de faixa etária de jovens e adultos da editora CPAD, privilegiando-se as que abordam temas relacionados a questões sociais como secularismo, humanismo, aborto, eutanásia, divórcio, evolucionismo, ateísmo, homossexualismo, entre outros. Investiga-se também como essa leitura se contrapõe a uma concepção histórico-crítica da Bíblia e a aspectos da modernidade que a instituição sente ameaçarem sua integridade doutrinária. Este texto situa-se no marco teórico da História Cultural a fim de apreender as características das representações sociais produzidas pelo grupo religioso aqui estudado.

  9. Effects of ascorbic acid supplementation in ileum myenteric neurons of streptozotocin-induced diabetic rats Efeitos da suplementação do ácido ascórbico nos neurônios mientéricos do íleo de ratos diabéticos induzidos por estreptozootocina

    Directory of Open Access Journals (Sweden)

    Sonia M. Silverio

    2009-04-01

    Full Text Available The exacerbation of the oxidative stress and of the polyol pathway which impair damage myenteric plexus are metabolic characteristics of diabetes. The ascorbic acid (AA is an antioxidant and an aldose reductase inhibitor, which may act as neuroprotector. The effects of AA supplementation on the density and cellular body profile area (CP of myenteric neurons in STZ-induced diabetes in rats were assessed. Four groups with five animals each were formed: normoglycemic (C; diabetic (D; AA-treated diabetic (DS and AA-treated normoglycemic (CS. Dosagen of 50mg of AA were given, three times a week, for each animal (group DS and CS. Ninety days later and after euthanasia, the ileum was collected and processed for the NADPH-diaphorase technique. There were no differences (P>0.05 in the neuronal density among the groups. The CP area was lower (PA exacerbação do estresse oxidativo e da via do poliol que comprometem o plexo mioentérico são alterações metabólicas características do diabetes. O ácido ascórbico (AA é antioxidante e inibidor da aldose redutase, podendo atuar como neuroprotetor. Verificaram-se os efeitos da suplementação com AA sobre o número e a área do perfil do corpo celular (PC de neurônios mioentéricos em ratos diabéticos induzidos por estreptozootocina. Formaram-se quatro grupos com cinco animais cada: normoglicêmico (C; diabético (D; diabético tratado com AA (DS; e normoglicêmico tratado com AA (CS. Três vezes por semana administrou-se 50mg de AA para cada animal (grupos DS e CS. Após 90 dias e eutanásia com tiopental, o íleo foi coletado e processado para a técnica da NADPH-diaforase. Não se observaram diferenças (P>0,05 na densidade neuronal entre os grupos. A área do PC foi menor (P<0,05 para os grupos DS e CS, com incidência maior de neurônios com área do PC superior a 200µm² para os grupos C e D. Concluiu-se que o AA não influenciou a densidade neuronal do íleo, mas foi neuroprotetor prevenindo o

  10. Normatividade, tecnicidade e/ou cientificidade da Biblioteconomia

    OpenAIRE

    Carvalho Silva, Jonathas Luiz

    2013-01-01

    Este trabalho apresenta como problema uma questão que pode ser discutida a partir da seguinte pergunta: como ocorre o processo de construção da normatividade, da tecnicidade e/ou da cientificidade da Biblioteconomia? Discute também a construção de uma normatividade, tecnicidade e/ou cientificidade da Biblioteconomia, contemplando perspectivas em relação à organização e ao tratamento da informação, fontes, recursos e serviços de informação, práticas profissionais e estudos centrados nos usuári...

  11. Capacidade funcional para atividades da vida diária de idosos da Estratégia de Saúde da Família da zona rural

    Directory of Open Access Journals (Sweden)

    Andressa Hoffmann Pinto

    Full Text Available Resumo O artigo objetivou descrever o perfil dos idosos da zona rural de Pelotas, considerando a prevalência de capacidade funcional para as atividades básicas e instrumentais da vida diária segundo idade, sexo, renda, escolaridade e doenças crônicas não transmissíveis. Estudo quantitativo, transversal e analítico, realizado com 820 idosos, de julho a outubro de 2014. Utilizou-se o teste de qui-quadrado de heterogeneidade de Pearson para as exposições nominais e o teste de tendência para aquelas ordinais. Na amostra predominaram as mulheres, entre 60-69 anos, que se autodenominaram brancas e viviam com seus companheiros. A prevalência de capacidade para as atividades básicas da vida diária (ABVD foi de 81,8% e para as instrumentais da vida diária (AIVD 54,6%. As variáveis sexo (masculino, idade (60-69 e não ter problemas cardíacos foram associadas de forma significativa com as ABVD. Já, as AIVD apresentaram associação com idade (60-69 anos, anos de escolaridade (5-8, renda (1-2 salários e osteoporose. O estudo conclui que os idosos, na maioria, eram funcionalmente capazes para a realização das atividades da vida diária, tanto básicas quanto instrumentais. Espera-se que os resultados e a iniciativa em estudar os idosos residentes na zona rural sirvam de estimulo a futuras pesquisas.

  12. Repercussões da Lei Maria da Penha no enfrentamento da violência de gênero Repercussions of the Maria da Penha law in tackling gender violence

    Directory of Open Access Journals (Sweden)

    Maíra Meneghel de Quadros

    2013-03-01

    Full Text Available Este texto apresenta os discursos acerca da Lei Maria da Penha enunciados por uma amostra de mulheres vítimas e outra de operadores que atendem situações de violência de gênero na cidade de Porto Alegre. Os dados fazem parte de uma pesquisa que investigou a rota crítica percorrida pelas mulheres ao decidir denunciar a violência. Os depoimentos foram selecionados de 45 entrevistas semiestruturadas respondidas por 21 mulheres e 25 operadores do setor policial, jurídico, ação social, saúde e organizações não governamentais. Os dados foram analisados com auxílio do software NVivo e um dos temas selecionados foi a Lei Maria da Penha. A maioria dos entrevistados mencionou os aspectos positivos e inovadores da lei, embora tenham apontado também os seus limites. Os operadores percebem o dispositivo legal como recurso importante no enfrentamento às violências, alinhado às convenções internacionais, trazendo inovações e aumentando o acesso das mulheres ao judiciário. Como fragilidades, mulheres e operadores apontaram a ineficiência na aplicação das medidas protetivas, a falta de recursos materiais e de pessoas, a fragmentação da rede de atenção e o movimento de setores conservadores da sociedade para deslegitimar a Lei.This paper presents the declarations about the Maria da Penha law made by a sample of women victims and care workers who handle situations of gender violence in the city of Porto Alegre. The data are part of a study that investigated the critical path followed by women who decide to denounce violence. The statements were selected from 45 semi-structured interviews answered by 21 women and 25 professionals from the police, legal, social and health services and nongovernmental institutions. Data were analyzed using NVivo software and one of the categories selected was the Maria da Penha law. Most respondents mentioned the positive and innovatory aspects of the law, though they also pointed out its limitations

  13. Falando de morte e da finitude no ambiente escolar: um estudo à luz do sentido da vida

    Directory of Open Access Journals (Sweden)

    Thiago Antonio Avellar de Aquino

    Full Text Available O presente estudo teve como objetivo identificar as concepções da morte e suas repercussões para o sentido da vida entre os adolescentes. Para tanto, foi efetuada uma pesquisa-ação para abordar o tema da finitude partindo da concepção de Viktor Frankl sobre o sentido da vida e da morte. Contou-se com a participação de 17 estudantes do terceiro ano do ensino médio, a maioria do sexo feminino (52,9%, com idade média de 17 anos e amplitude de 15 a 24 anos. Os resultados foram obtidos por meio de cinco intervenções em sala de aula. Cada intervenção teve a duração média de 45 minutos, constituindo-se de questionamentos acerca da morte, do morrer e do sentido da vida. Em seguida, as respostas dos participantes foram submetidas a uma análise de conteúdo. No que se refere às representações da morte, emergiram três categorias: pensamentos, sentimentos e crenças. Sobre a compreensão do sentido da vida, os adolescentes responderam em duas direções: os sentidos subjetivos e sentidos objetivos. Quando refletiram sobre a própria morte, as suas respostas foram classificadas em termos de três categorias valorativas: vivenciais, atitudinais e criativos. No que se refere à pergunta “Como seria a vida se ninguém morresse?”, foram observados os seguintes tipos de argumentos: valorização da vida, corrigir erros do passado, resposta tautológica, resposta religiosa e dialética vida-morte. Os resultados mostraram a importância de tratar sobre o tema da finitude no âmbito escolar.

  14. Tecnologias da não-violência e modernização da justiça no Brasil: o caso da justiça restaurativa

    Directory of Open Access Journals (Sweden)

    Schuch, Patrice

    2008-01-01

    Full Text Available Este artigo investiga, sob o ponto de vista antropológico, alguns aspectos da implementação da justiça restaurativa no Brasil. Através da pesquisa etnográfica, pode-se salientar que a justiça restaurativa articula um conjunto de atores diversos e conjuga ideários de autogestão e transformação individual com modernização da justiça e promoção de uma cultura de paz. Este texto objetiva entender como se dá a emergência dessa nova tecnologia de gerenciamento da vida, assim como discutir certas tensões próprias ao processo de sua disseminação.

  15. O ANTIESCRAVISMO DA ILUSTRAÇÃO EM ADAM SMITH E JOSÉ DA SILVA LISBOA

    Directory of Open Access Journals (Sweden)

    Rafaela Domingos Lago

    2016-08-01

    Full Text Available Até meados do século XVIII escravidão e servidão faziam parte da natureza das sociedades no Ocidente. Na segunda metade do Setecentos, contudo, iniciou-se a condenação da escravidão pelos escritores da Ilustração principalmente na Inglaterra e França. Tal ideário foi trazido para o Brasil nas primeiras décadas do Oitocentos por estudantes brasileiros que frequentaram universidades europeias. Este artigo pretende examinar como as ideias antiescravistas de Adam Smith foram assimiladas nos escritos de José da Silva Lisboa, o Visconde de Cairu, no início do Oitocentos.

  16. Experimentação política da amizade em comunidades da internet a partir da teoria dos afetos de Espinosa

    Directory of Open Access Journals (Sweden)

    Lívia Godinho Nery Gomes Azevedo

    2015-08-01

    Full Text Available A compreensão da amizade em sua qualidade política designa um vínculo privilegiado de abertura à alteridade que permite ao corpo experimentações de afetar outros corpos e por eles ser afetado, cujos efeitos podem suscitar transformações na potência de agir. A concepção do corpo em Espinosa, sustentada pela unidade corpo-alma e capacidade de afeto, constitui um elemento precioso para a compreensão da presença e das intensidades afetivas em jogo nas relações de amizades na internet, as quais excluem contato físico. O presente projeto buscou investigar e analisar a maneira com que as comunidades na internet estão sendo utilizadas favorecendo a experimentação política da amizade. As narrativas revelaram que as comunidades da internet se constituem um espaço propício de trocas de ideias e experiências que aumentam a capacidade de reflexão dos sujeitos. As relações mediadas pela internet também favorecem novos modos de organização política e de exercício da cidadania.

  17. Construção da taxonomia brasileira para descritores da personalidade

    Directory of Open Access Journals (Sweden)

    Guzzo Raquel Souza Lobo

    2002-01-01

    Full Text Available Esta é uma pesquisa que utiliza a abordagem psicoléxica para servir de apoio aos estudos sobre avaliação da personalidade. Trata-se de um projeto, seguindo a metodologia alemã como parte de um programa transcultural. A importância deste estudo refere-se, principalmente, ao estabelecimento de uma base científica para a construção ou adaptação de instrumentos para avaliação psicológica. O projeto inclui quatro fases: 1 identificação e extração de adjetivos existentes no léxico da língua portuguesa; 2 exclusão de adjetivos de acordo com critérios estabelecidos pela proposta alemã, em uma análise de dois juízes; 3 classificação dos adjetivos quanto à freqüência de uso, à clare