WorldWideScience

Sample records for inhibits human epidermal

  1. Inhibition of iodine-125-labeled human follitropin binding to testicular receptor by epidermal growth factor and synthetic peptides

    International Nuclear Information System (INIS)

    Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.

    1986-01-01

    Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of 125 I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of 125 I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of 125 I-labeled human FSH to testis receptor

  2. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  3. INHIBITION OF PROTEIN TYROSINE PHOSPHATASE ACTIVITY MEDIATES EPIDERMAL GROWTH FACTOR RECEPTOR SIGNALING IN HUMAN AIRWAY EPITHELIAL CELLS

    Science.gov (United States)

    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  4. Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

    Science.gov (United States)

    Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

    2012-05-01

    Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

  5. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells.

    Science.gov (United States)

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon

    2017-02-04

    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  6. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  7. Inhibition of Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Phosphorylation on Tumor-Associated Endothelial Cells Leads to Treatment of Orthotopic Human Colon Cancer in Nude Mice

    Directory of Open Access Journals (Sweden)

    Takamitsu Sasaki

    2007-12-01

    Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.

  8. Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

    International Nuclear Information System (INIS)

    Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen

    2013-01-01

    Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

  9. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  10. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.

    2011-01-01

    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  11. Sulindac metabolites inhibit epidermal growth factor receptor activation and expression

    Directory of Open Access Journals (Sweden)

    Ahnen Dennis

    2005-01-01

    Full Text Available Abstract Background Regular use of nonsteroidal anti-inflammatory drugs (NSAIDs is associated with a decreased mortality from colorectal cancer (CRC. NSAIDs induce apoptotic cell death in colon cancer cells in vitro and inhibit growth of neoplastic colonic mucosa in vivo however, the biochemical mechanisms required for these growth inhibitory effects are not well defined. We previously reported that metabolites of the NSAID sulindac downregulate extracellular-signal regulated kinase 1/2 (ERK1/2 signaling and that this effect is both necessary and sufficient for the apoptotic effects of these drugs. The goal of this project was to specifically test the hypothesis that sulindac metabolites block activation and/or expression of the epidermal growth factor (EGF receptor (EGFR. Methods HT29 human colon cancer cells were treated with EGF, alone, or in the presence of sulindac sulfide or sulindac sulfone. Cells lysates were assayed by immunoblotting for phosphorylated EGFR (pEGFR, pY1068, total EGFR, phosphorylated ERK1/2 (pERK1/2, total ERK1/2, activated caspase-3, and α-tubulin. Results EGF treatment rapidly induced phosphorylation of both EGFR and ERK1/2 in HT29 colon cancer cells. Pretreatment with sulindac metabolites for 24 h blocked EGF-induced phosphorylation of both EGFR and ERK1/2 and decreased total EGFR protein expression. Under basal conditions, downregulation of pEGFR and total EGFR was detected as early as 12 h following sulindac sulfide treatment and persisted through at least 48 h. Sulindac sulfone induced downregulation of pEGFR and total EGFR was detected as early as 1 h and 24 h, respectively, following drug treatment, and persisted through at least 72 h. EGFR downregulation by sulindac metabolites was observed in three different CRC cell lines, occurred prior to the observed downregulation of pERK1/2 and induction of apoptosis by these drugs, and was not dependent of caspase activation. Conclusion These results suggest that

  12. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    Science.gov (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  13. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells.

    Science.gov (United States)

    Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han

    2011-11-09

    Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

  15. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  16. Inhibition of epidermal cell proliferation by borderline rays

    Energy Technology Data Exchange (ETDEWEB)

    Born, W [Freiburg Univ.; Daikeler, G

    1976-08-01

    Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

  17. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  18. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  19. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.

    2007-01-01

    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  20. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  1. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  2. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  3. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  4. Epidermal growth factor (EGF) inhibits stimulated thyroid hormone secretion in the mouse

    International Nuclear Information System (INIS)

    Ahren, B.

    1987-01-01

    It is known that epidermal growth factor (EGF) inhibits iodide uptake in the thyroid follicular cells and lowers plasma levels of thyroid hormones upon infusion into sheep and ewes. In this study, the effects of EGF on basal and stimulated thyroid hormone secretion were investigated in the mouse. Mice were pretreated with 125 I and thyroxine; the subsequent release of 125 I is an estimation of thyroid hormone secretion. It was found that basal radioiodine secretion was not altered by intravenous injection of EGF (5 micrograms/animal). However, the radioiodine secretion stimulated by both TSH (120 microU/animal) and vasoactive intestinal peptide (VIP; 5 micrograms/animal) were inhibited by EGF (5 micrograms/animal). At a lower dose level (0.5 microgram/animal), EGF had no influence on stimulated radioiodine secretion. In conclusion, EGF inhibits stimulated thyroid hormone secretion in the mouse

  5. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  6. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Directory of Open Access Journals (Sweden)

    Raj Victor

    2011-08-01

    Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.

  7. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Science.gov (United States)

    2011-01-01

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061

  8. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  9. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  10. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  11. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  12. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  13. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  14. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  15. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  16. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  17. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  18. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  19. Antitumor efficacy of triple monoclonal antibody inhibition of epidermal growth factor receptor (EGFR) with MM151 in EGFR-dependent and in cetuximab-resistant human colorectal cancer cells

    Science.gov (United States)

    Napolitano, Stefania; Martini, Giulia; Martinelli, Erika; Della Corte, Carminia Maria; Morgillo, Floriana; Belli, Valentina; Cardone, Claudia; Matrone, Nunzia; Ciardiello, Fortunato; Troiani, Teresa

    2017-01-01

    Purpose We investigated the effect of triple monoclonal antibody inhibition of EGFR to overcome acquired resistance to first generation of anti-EGFR inhibitors. Experimental design MM151 is a mixture of three different monoclonal IgG1 antibodies directed toward three different, non-overlapping, epitopes of the EGFR. We performed an in vivo study by using human CRC cell lines (SW48, LIM 1215 and CACO2) which are sensitive to EGFR inhibitors, in order to evaluate the activity of MM151 as compared to standard anti-EGFR mAbs, such as cetuximab, as single agent or in a sequential strategy of combination MM151 with irinotecan (induction therapy) followed by MM151 with a selective MEK1/2 inhibitor (MEKi) (maintenance therapy). Furthermore, the ability of MM151 to overcome acquired resistance to cetuximab has been also evaluated in cetuximab-refractory CRC models. Results MM151 shown stronger antitumor activity as compared to cetuximab. The maintenance treatment with MM151 plus MEKi resulted the most effective therapeutic modality. In fact, this combination caused an almost complete suppression of tumor growth in SW48, LIM 1215 and CACO2 xenografts model at 30 week. Moreover, in this treatment group, mice with no evidence of tumor were more than double as compared to single agent treated mice. Its superior activity has also been demonstrated, in cetuximab-refractory CRC models. Conclusions These results provide experimental evidence that more efficient and complete EGFR blockade may determine better antitumor activity and could contribute to prevent and/or overcome acquired resistance to EGFR inhibitors. PMID:29137301

  20. Emerging role of epidermal growth factor receptor inhibition in therapy for advanced malignancy: focus on NSCLC

    International Nuclear Information System (INIS)

    Langer, Corey J.

    2004-01-01

    Combination chemotherapy regimens have emerged as the standard approach in advanced non-small-cell lung cancer. Meta-analyses have demonstrated a 2-month increase in median survival after platinum-based therapy vs. best supportive care, and an absolute 10% improvement in the 1-year survival rate. Just as importantly, cytotoxic therapy has produced benefits in symptom control and quality of life. Newer agents, including the taxanes, vinorelbine, gemcitabine, and irinotecan, have expanded our therapeutic options in the treatment of advanced non-small-cell lung cancer. Despite their contributions, we have reached a therapeutic plateau, with response rates seldom exceeding 30-40% in cooperative group studies and 1-year survival rates stable between 30% and 40%. It is doubtful that substituting one agent for another in various combinations will lead to any further improvement in these rates. The thrust of current research has focused on targeted therapy, and epidermal growth factor receptor inhibition is one of the most promising clinical strategies. Epidermal growth factor receptor inhibitors currently under investigation include the small molecules gefitinib (Iressa, ZD1839) and erlotinib (Tarceva, OSI-774), as well as monoclonal antibodies such as cetuximab (IMC-225, Erbitux). Agents that have only begun to undergo clinical evaluation include CI-1033, an irreversible pan-erbB tyrosine kinase inhibitor, and PKI166 and GW572016, both examples of dual kinase inhibitors (inhibiting epidermal growth factor receptor and Her2). Preclinical models have demonstrated synergy for all these agents in combination with either chemotherapy or radiotherapy, leading to great enthusiasm regarding their ultimate contribution to lung cancer therapy. However, serious clinical challenges persist. These include the identification of the optimal dose(s); the proper integration of these agents into popular, established cytotoxic regimens; and the selection of the optimal setting(s) in which

  1. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  2. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  3. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  4. Effects of epidermal growth factor receptor kinase inhibition on radiation response in canine osteosarcoma cells.

    Science.gov (United States)

    Mantovani, Fernanda B; Morrison, Jodi A; Mutsaers, Anthony J

    2016-05-31

    Radiation therapy is a palliative treatment modality for canine osteosarcoma, with transient improvement in analgesia observed in many cases. However there is room for improvement in outcome for these patients. It is possible that the addition of sensitizing agents may increase tumor response to radiation therapy and prolong quality of life. Epidermal growth factor receptor (EGFR) expression has been documented in canine osteosarcoma and higher EGFR levels have been correlated to a worse prognosis. However, effects of EGFR inhibition on radiation responsiveness in canine osteosarcoma have not been previously characterized. This study examined the effects of the small molecule EGFR inhibitor erlotinib on canine osteosarcoma radiation responses, target and downstream protein expression in vitro. Additionally, to assess the potential impact of treatment on tumor angiogenesis, vascular endothelial growth factor (VEGF) levels in conditioned media were measured. Erlotinib as a single agent reduced clonogenic survival in two canine osteosarcoma cell lines and enhanced the impact of radiation in one out of three cell lines investigated. In cell viability assays, erlotinib enhanced radiation effects and demonstrated single agent effects. Erlotinib did not alter total levels of EGFR, nor inhibit downstream protein kinase B (PKB/Akt) activation. On the contrary, erlotinib treatment increased phosphorylated Akt in these osteosarcoma cell lines. VEGF levels in conditioned media increased after erlotinib treatment as a single agent and in combination with radiation in two out of three cell lines investigated. However, VEGF levels decreased with erlotinib treatment in the third cell line. Erlotinib treatment promoted modest enhancement of radiation effects in canine osteosarcoma cells, and possessed activity as a single agent in some cell lines, indicating a potential role for EGFR inhibition in the treatment of a subset of osteosarcoma patients. The relative radioresistance of

  5. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  6. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  7. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  8. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  9. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.

    1981-01-01

    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  10. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  11. Deletion of epidermal Rac1 inhibits HPV-8 induced skin papilloma formation and facilitates HPV-8- and UV-light induced skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo

    2016-09-06

    Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.

  12. Epidermal growth factor receptor inhibition by anti-CD147 therapy in cutaneous squamous cell carcinoma.

    Science.gov (United States)

    Frederick, John W; Sweeny, Larissa; Hartman, Yolanda; Zhou, Tong; Rosenthal, Eben L

    2016-02-01

    Advanced cutaneous squamous cell carcinoma (SCC) is an uncommon and aggressive malignancy. As a result, there is limited understanding of its biology and pathogenesis. CD147 and epidermal growth factor receptor (EGFR) have been identified as oncologically important targets, but their relationship remains undefined in cutaneous SCC. Multiple cutaneous SCC cell lines (Colo-16, SRB-1, and SRB-12), were treated in vitro with a range of chimeric anti-CD147 monoclonal antibody (mAb) (0, 50, 100, and 200 µg/mL) or transfected with a small interfering RNA against CD147 (SiCD147). Cell proliferation, migration (scratch wound healing assay), and protein expression was then assessed. In vivo, Colo-16 flank xenografts were treated anti-CD147 mAb (150 µg i.p. triweekly). After treatment with anti-CD147 (200 µg/mL), there was a significant decrease in proliferation for all cell lines relative to controls (p CD147 (200 µg/mL) resulted in decreased cell migration for all cell lines, with an average of 43% reduction in closure compared to controls (p CD147 antibody therapy and siRNA mediated reduction in CD147 expression were both found to decrease protein expression of EGFR, which correlated with a reduction in downstream total and phosphorylated protein kinase B (pAKT). Tumor growth in vivo was reduced for both the anti-CD147 treatment group and the SiCD147 group relative to controls. Inhibition and downregulation of CD147 in cutaneous SCC resulted in suppression of the malignant phenotype in vitro and in vivo, which may be mediated in part by an alteration in EGFR expression. As a result, CD147 may serve as a potential therapeutic target for advanced cutaneous SCC. © 2014 Wiley Periodicals, Inc.

  13. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

    Science.gov (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

    2003-12-01

    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  14. Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

    International Nuclear Information System (INIS)

    Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

    1997-01-01

    This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

  15. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  16. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  17. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  18. E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions

    DEFF Research Database (Denmark)

    Perrais, Michaël; Chen, Xiao; Perez-Moreno, Mirna

    2007-01-01

    growth inhibitory signals. To address this question, we have selectively formed E-cadherin homophilic bonds at the cell surface of isolated epithelial cells by using functionally active recombinant E-cadherin protein attached to microspheres. We find that E-cadherin ligation alone reduces the frequency...... of cells entering the S phase, demonstrating that E-cadherin ligation directly transduces growth inhibitory signals. E-cadherin binding to beta-catenin is required for cell growth inhibition, but beta-catenin/T-cell factor transcriptional activity is not involved in growth inhibition resulting from...... homophilic binding. Neither E-cadherin binding to p120-catenin nor beta-catenin binding to alpha-catenin, and thereby the actin cytoskeleton, is required for growth inhibition. E-cadherin ligation also inhibits epidermal growth factor (EGF) receptor-mediated growth signaling by a beta...

  19. Experimental radioimmunotherapy of a xenografted human glioma using [sup 131]I-labeled monoclonal antibody to epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D

    1993-09-01

    [sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).

  20. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-02-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  1. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    International Nuclear Information System (INIS)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

  2. Phenobarbital indirectly activates the constitutive active androstane receptor (CAR) by inhibition of epidermal growth factor receptor signaling.

    Science.gov (United States)

    Mutoh, Shingo; Sobhany, Mack; Moore, Rick; Perera, Lalith; Pedersen, Lee; Sueyoshi, Tatsuya; Negishi, Masahiko

    2013-05-07

    Phenobarbital is a central nervous system depressant that also indirectly activates nuclear receptor constitutive active androstane receptor (CAR), which promotes drug and energy metabolism, as well as cell growth (and death), in the liver. We found that phenobarbital activated CAR by inhibiting epidermal growth factor receptor (EGFR) signaling. Phenobarbital bound to EGFR and potently inhibited the binding of EGF, which prevented the activation of EGFR. This abrogation of EGFR signaling induced the dephosphorylation of receptor for activated C kinase 1 (RACK1) at Tyr(52), which then promoted the dephosphorylation of CAR at Thr(38) by the catalytic core subunit of protein phosphatase 2A. The findings demonstrated that the phenobarbital-induced mechanism of CAR dephosphorylation and activation is mediated through its direct interaction with and inhibition of EGFR.

  3. Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J.; Cruickshank, Sheena M.

    2014-01-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. PMID:25015889

  4. Expression of PML tumor suppressor in A 431 cells reduces cellular growth by inhibiting the epidermal growth factor receptor expression

    International Nuclear Information System (INIS)

    Vallian, S.; Chang, K.S.

    2004-01-01

    Our previous studies showed that the promyelocytic leukemia, PML, protein functions as a cellular and growth suppressor. Transient expression of PML was also found to repress the activity of the epidermal growth factor receptor gene promoter. In this study we have examined the effects of PML on A431 cells, which express a high level of + protein. The PML gene was introduced into the cells using the adenovirus-mediated gene transfer system. Western blot analysis on the extracts from the cells expressing PML showed a significant repression in the expression of the epidermal growth factor receptor protein. The cells were examined for growth and DNA synthesis. The data showed a marked reduction in both growth and DNA synthesis rate in the cells expressing PML compared with the control cells. Furthermore, in comparison with the controls, the cells expressing PML were found to be more in G1 phase, fewer in S and about the same number in the G2/M phase. This data clearly demonstrated that the repression of epidermal growth factor receptor expression in A 431 cells by PML was associated with inhibition of cell growth and alteration of the cell cycle distribution, suggesting a novel mechanism for the known growth inhibitory effects of PML

  5. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  6. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee

    2013-06-01

    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  8. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  9. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  10. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

  11. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  12. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  13. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  14. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin

    2015-12-01

    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  15. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Science.gov (United States)

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien

    2015-01-01

    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  16. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  17. Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

    International Nuclear Information System (INIS)

    Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

    1997-01-01

    Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

  18. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  19. Epidermal growth factor receptor-induced activato protein 1 activity controls density-dependent growht inhibition in normal rat kidney fibroblasts.

    NARCIS (Netherlands)

    Hornberg, J.J.; Dekker, H.; Peters, P.H.J.; Langerak, P.; Westerhoff, H.V.; Lankelma, J.; Zoelen, E.J.J.

    2006-01-01

    Density-dependent growth inhibition secures tissue homeostasis. Dysfunction of the mechanisms, which regulate this type of growth control is a major cause of neoplasia. In confluent normal rat kidney (NRK) fibroblasts, epidermal growth factor (EGF) receptor levels decline, ultimately rendering these

  20. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  1. Epidermal growth factor receptor inhibition reduces angiogenesis via hypoxia-inducible factor-1α and Notch1 in head neck squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Wei-Ming Wang

    Full Text Available Angiogenesis, a marker of cancer development, affects response to radiotherapy sensibility. This preclinical study aims to understand the receptor tyrosine kinase-mediated angiogenesis in head neck squamous cell carcinoma (HNSCC. The receptor tyrosine kinase activity in a transgenic mouse model of HNSCC was assessed. The anti-tumorigenetic and anti-angiogenetic effects of cetuximab-induced epidermal growth factor receptor (EGFR inhibition were investigated in xenograft and transgenic mouse models of HNSCC. The signaling transduction of Notch1 and hypoxia-inducible factor-1α (HIF-1α was also analyzed. EGFR was overexpressed and activated in the Tgfbr1/Pten deletion (2cKO mouse model of HNSCC. Cetuximab significantly delayed tumor onset by reducing tumor angiogenesis. This drug exerted similar effects on heterotopic xenograft tumors. In the human HNSCC tissue array, increased EGFR expression correlated with increased HIF-1α and micro vessel density. Cetuximab inhibited tumor-induced angiogenesis in vitro and in vivo by significantly downregulating HIF-1α and Notch1. EGFR is involved in the tumor angiogenesis of HNSCC via the HIF-1α and Notch1 pathways. Therefore, targeting EGFR by suppressing hypoxia- and Notch-induced angiogenesis may benefit HNSCC therapy.

  2. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  3. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...

  4. Impaired epidermal wound healing in vivo upon inhibition or deletion of Rac1

    DEFF Research Database (Denmark)

    Tscharntke, Michael; Pofahl, Ruth; Chrostek-Grashoff, Anna

    2007-01-01

    inhibited on collagen I and, to a lesser extent, on fibronectin. Stroboscopic analysis of cell dynamics (SACED) of N17Rac1 transgenic and control keratinocytes identified decreased lamella-protrusion persistence in connection with increased ruffle frequency as a probable mechanism for the observed...

  5. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  7. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

  8. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  9. Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells.

    Science.gov (United States)

    Yanagihara, K; Cheng, H; Cheng, P W

    2000-01-01

    Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

  10. Synergistic Induction of Cyclooxygenase-2 by Transforming Growth Factor-β1 and Epidermal Growth Factor Inhibits Apoptosis in Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Debabrata Saha

    1999-12-01

    Full Text Available Increased expression of cyclooxygenase-2 (COX-2 expression has been observed in several human tumor types and in selected animal and cell culture models of carcinogenesis, including lung cancer. Increased expression of COX-2 and production of prostaglandins appear to provide a survival advantage to transformed cells through the inhibition of apoptosis, increased attachment to extracellular matrix, increased invasiveness, the stimulation of angiogenesis. In the present studies, we found that transforming growth factor β1 (TGF-β1 and epidermal growth factor (EGF synergistically induced the expression of COX-2 and prostaglandin E2 (PGE2 production in mink lung epithelial (Mvi Lu cells. EGF, but not PDGF or IGF-1, was able to inhibit TGF-β1-induced apoptosis in Mvi Lu cells and this effect was blocked by NS-398, a selective inhibitor of COX-2 activity, suggesting a possible role for COX-2 in the anti-apoptosic effect of EGF receptor ligands. The combination of TGF-β1 and EGF also significantly induced COX-2 expression in rat intestinal epithelial (RIE-1 cells and completely prevented sodium butyrate (NaBu-induced apoptosis. The synergistic induction of COX-2 by TGF-β1 and EGF was not observed in R1B-L17 cells, a line derived from Mvi Lu cells that lacks the TGF-β type-I receptor. AG1478, a selective inhibitor of EGF receptor tyrosine kinase activity, completely suppressed the induction of COX-2 expression by either EGF or TGF-β1+EGF. Also, PD98059, a specific inhibitor of MEK/ERK pathway, SB203580, a specific inhibitor of p38 MAPK activity, significantly inhibited the induction of COX-2 in response to combined EGF and TGF-β1. These results suggest an important collaborative interaction of TGF-β1 and EGF signaling in the induction of COX-2 and prostaglandin production in Mv1Lu cells.

  11. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  12. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  13. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    International Nuclear Information System (INIS)

    Kang, Khong Bee; Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong

    2012-01-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)–Akt-DNA–dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H 2 AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H 2 AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G 2 /M arrest and increased γ-H 2 AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H 2 AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are resistant to irradiation

  14. Gefitinib radiosensitizes stem-like glioma cells: inhibition of epidermal growth factor receptor-Akt-DNA-PK signaling, accompanied by inhibition of DNA double-strand break repair.

    Science.gov (United States)

    Kang, Khong Bee; Zhu, Congju; Wong, Yin Ling; Gao, Qiuhan; Ty, Albert; Wong, Meng Cheong

    2012-05-01

    We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H(2)AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H(2)AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G(2)/M arrest and increased γ-H(2)AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H(2)AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Stem-like gliomaspheres are resistant to irradiation-induced cytotoxicity, G(2)/M arrest, and DNA DSBs, compared with nonstem

  15. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Khong Bee, E-mail: dmskkb@nccs.com.sg [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore); Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore)

    2012-05-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, {gamma}-H{sub 2}AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, {gamma}-H{sub 2}AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G{sub 2}/M arrest and increased {gamma}-H{sub 2}AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased {gamma}-H{sub 2}AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are

  16. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    International Nuclear Information System (INIS)

    Korc, M.; Magun, B.E.

    1985-01-01

    PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

  17. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  18. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  19. Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis.

    Science.gov (United States)

    McKnight, Braden; Seidel, Rachel; Moy, Ron

    2015-10-01

    Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

  20. Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy.

    Science.gov (United States)

    Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi

    2013-02-01

    We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

  1. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.

    2014-01-01

    Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  2. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  3. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

    Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  4. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  5. Amlexanox Blocks the Interaction between S100A4 and Epidermal Growth Factor and Inhibits Cell Proliferation.

    Directory of Open Access Journals (Sweden)

    Ching Chang Cho

    Full Text Available The human S100A4 protein binds calcium, resulting in a change in its conformation to promote the interaction with its target protein. Human epidermal growth factor (EGF is the target protein of S100A4 and a critical ligand of the receptor EGFR. The EGF/EGFR system promotes cell survival, differentiation, and growth by activating several signaling pathways. Amlexanox is an anti-inflammatory and anti-allergic drug that is used to treat recurrent aphthous ulcers. In the present study, we determined that amlexanox interacts with S100A4 using heteronuclear single quantum correlation titration. We elucidated the interactions of S100A4 with EGF and amlexanox using fluorescence and nuclear magnetic resonance spectroscopy. We generated two binary models (for the S100A4-EGF and S100A4-amlexanox complexes and observed that amlexanox and EGF share a similar binding region in mS100A4. We also used a WST-1 assay to investigate the bioactivity of S100A4, EGF, and amlexanox, and found that amlexanox blocks the binding between S100A4 and EGF, and is therefore useful for the development of new anti-proliferation drugs.

  6. Genistein inhibits proliferation of colon cancer cells by attenuating a negative effect of epidermal growth factor on tumor suppressor FOXO3 activity

    International Nuclear Information System (INIS)

    Qi, Wentao; Weber, Christopher R; Wasland, Kaarin; Savkovic, Suzana D

    2011-01-01

    Soy consumption is associated with a lower incidence of colon cancer which is believed to be mediated by one of its of components, genistein. Genistein may inhibit cancer progression by inducing apoptosis or inhibiting proliferation, but mechanisms are not well understood. Epidermal growth factor (EGF)-induced proliferation of colon cancer cells plays an important role in colon cancer progression and is mediated by loss of tumor suppressor FOXO3 activity. The aim of this study was to assess if genistein exerts anti-proliferative properties by attenuating the negative effect of EGF on FOXO3 activity. The effect of genistein on proliferation stimulated by EGF-mediated loss of FOXO3 was examined in human colonic cancer HT-29 cells. EGF-induced FOXO3 phosphorylation and translocation were assessed in the presence of genistein. EGF-mediated loss of FOXO3 interactions with p53 (co-immunoprecipitation) and promoter of p27kip1 (ChIP assay) were examined in presence of genistein in cells with mutated p53 (HT-29) and wild type p53 (HCT116). Silencing of p53 determined activity of FOXO3 when it is bound to p53. Genistein inhibited EGF-induced proliferation, while favoring dephosphorylation and nuclear retention of FOXO3 (active state) in colon cancer cells. Upstream of FOXO3, genistein acts via the PI3K/Akt pathway to inhibit EGF-stimulated FOXO3 phosphorylation (i.e. favors active state). Downstream, EGF-induced disassociation of FOXO3 from mutated tumor suppressor p53, but not wild type p53, is inhibited by genistein favoring FOXO3-p53(mut) interactions with the promoter of the cell cycle inhibitor p27kip1 in colon cancer cells. Thus, the FOXO3-p53(mut) complex leads to elevated p27kip1 expression and promotes cell cycle arrest. These novel anti-proliferative mechanisms of genistein suggest a possible role of combining genistein with other chemoreceptive agents for the treatment of colon cancer

  7. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  8. PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

    Science.gov (United States)

    Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

    2014-03-01

    To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

  9. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  10. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

    Science.gov (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

    2013-09-07

    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  11. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  12. Human milk glycoconjugates that inhibit pathogens.

    Science.gov (United States)

    Newburg, D S

    1999-02-01

    Breast-fed infants have lower incidence of diarrhea, respiratory disease, and otitis media. The protection by human milk has long been attributed to the presence of secretory IgA. However, human milk contains large numbers and amounts of complex carbohydrates, including glycoproteins, glycolipids, glycosaminoglycans, mucins, and especially oligosaccharides. The oligosaccharides comprise the third most abundant solid constituent of human milk, and contain a myriad of structures. Complex carbohydrate moieties of glycoconjugates and oligosaccharides are synthesized by the many glycosyltransferases in the mammary gland; those with homology to cell surface glycoconjugate pathogen receptors may inhibit pathogen binding, thereby protecting the nursing infant. Several examples are reviewed: A fucosyloligosaccharide inhibits the diarrheagenic effect of stable toxin of Escherichia coli. A different fucosyloligosaccharide inhibits infection by Campylobacter jejuni. Binding of Streptococcus pneumoniae and of enteropathogenic E. coli to their respective receptors is inhibited by human milk oligosaccharides. The 46-kD glycoprotein, lactadherin, inhibits rotavirus binding and infectivity. Low levels of lactadherin in human milk are associated with a higher incidence of symptomatic rotavirus in breast-fed infants. A mannosylated glycopeptide inhibits binding by enterohemorrhagic E. coli. A glycosaminoglycan inhibits binding of gp120 to CD4, the first step in HIV infection. Human milk mucin inhibits binding by S-fimbriated E. coli. The ganglioside, GM1, reduces diarrhea production by cholera toxin and labile toxin of E. coli. The neutral glycosphingolipid, Gb3, binds to Shigatoxin. Thus, many complex carbohydrates of human milk may be novel antipathogenic agents, and the milk glycoconjugates and oligosaccharides may be a major source of protection for breastfeeding infants.

  13. Epidermal growth factor receptor activation by diesel particles is mediated by tyrosine phosphatase inhibition

    International Nuclear Information System (INIS)

    Tal, Tamara L.; Bromberg, Philip A.; Kim, Yumee; Samet, James M.

    2008-01-01

    Exposure to particulate matter (PM) is associated with increased cardiopulmonary morbidity and mortality. Diesel exhaust particles (DEP) are a major component of ambient PM and may contribute to PM-induced pulmonary inflammation. Proinflammatory signaling is mediated by phosphorylation-dependent signaling pathways whose activation is opposed by the activity of protein tyrosine phosphatases (PTPases) which thereby function to maintain signaling quiescence. PTPases contain an invariant catalytic cysteine that is susceptible to electrophilic attack. DEP contain electrophilic oxy-organic compounds that may contribute to the oxidant effects of PM. Therefore, we hypothesized that exposure to DEP impairs PTPase activity allowing for unopposed basal kinase activity. Here we report that exposure to 30 μg/cm 2 DEP for 4 h induces differential activation of signaling in primary cultures of human airway epithelial cells (HAEC), a primary target cell in PM inhalation. In-gel kinase activity assay of HAEC exposed to DEPs of low (L-DEP), intermediate (I-DEP) or high (H-DEP) organic content showed differential activation of intracellular kinases. Exposure to these DEP also induced varying levels of phosphorylation of the receptor tyrosine kinase EGFR in a manner that requires EGFR kinase activity but does not involve receptor dimerization. We demonstrate that treatment with DEP results in an impairment of total and EGFR-directed PTPase activity in HAEC with a potency that is independent of the organic content of these particles. These data show that DEP-induced EGFR phosphorylation in HAEC is the result of a loss of PTPase activities which normally function to dephosphorylate EGFR in opposition to baseline EGFR kinase activity

  14. Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells.

    Science.gov (United States)

    Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo

    2017-10-01

    The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

  15. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

    Science.gov (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

    2016-06-21

    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  16. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)

    2017-09-15

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.

  18. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    International Nuclear Information System (INIS)

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana

    2008-01-01

    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

  19. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  20. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  1. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    International Nuclear Information System (INIS)

    Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo

    2017-01-01

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers

  2. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2016-03-15

    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  3. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2009-09-01

    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  4. In Vitro Responsiveness of Glioma Cell Lines to Multimodality Treatment With Radiotherapy, Temozolomide, and Epidermal Growth Factor Receptor Inhibition With Cetuximab

    International Nuclear Information System (INIS)

    Combs, Stephanie E.; Schulz-Ertner, Daniela; Roth, Wilfried; Herold-Mende, Christel; Debus, Juergen; Weber, Klaus-Josef

    2007-01-01

    Background: The majority of glioblastoma multiforme (GBM) cells express the epidermal growth factor receptor (EGFR). The present study evaluates the combination of temozolomide (TMZ), EGFR inhibition, and radiotherapy (RT) in GBM cell lines. Methods and Materials: Human GBM cell lines U87, LN229, LN18, NCH 82, and NCH 89 were treated with various combinations of TMZ, RT, and the monoclonal EGFR antibody cetuximab. Responsiveness of glioma cells to the combination treatment was measured by clonogenic survival. Results: Overall, double and triple combinations of RT, TMZ, and cetuximab lead to additive cytotoxic effects (independent toxicity). A notable exception was observed for U87 and LN 18 cell lines, where the combination of TMZ and cetuximab showed substantial antagonism. Interestingly, in these two cell lines, the combination of RT with cetuximab resulted in a substantial increase in cell killing over that expected for independent toxicity. The triple combination with RT, cetuximab, and TMZ was nearly able to overcome the antagonism for the TMZ/cetuximab combination in U87, however only marginally in LN18, GBM cell lines. Conclusion: It appears that EGFR expression is not correlated with cytotoxic effects exerted by cetuximab. Combination treatment with TMZ, cetuximab and radiation resulted in independent toxicity in three out of five cell lines evaluated, the antagonistic effect of the TMZ/cetuximab combination in two cell lines could indicate that TMZ preferentially kills cetuximab-resistant cells, suggesting for some cross-talk between toxicity mechanisms. Expression of EGFR was no surrogate marker for responsiveness to cetuximab, alone or in combination with RT and TMZ

  5. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

    2013-01-01

    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  6. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  7. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  8. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  9. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  10. Inhibition in the Human Auditory Cortex.

    Directory of Open Access Journals (Sweden)

    Koji Inui

    Full Text Available Despite their indispensable roles in sensory processing, little is known about inhibitory interneurons in humans. Inhibitory postsynaptic potentials cannot be recorded non-invasively, at least in a pure form, in humans. We herein sought to clarify whether prepulse inhibition (PPI in the auditory cortex reflected inhibition via interneurons using magnetoencephalography. An abrupt increase in sound pressure by 10 dB in a continuous sound was used to evoke the test response, and PPI was observed by inserting a weak (5 dB increase for 1 ms prepulse. The time course of the inhibition evaluated by prepulses presented at 10-800 ms before the test stimulus showed at least two temporally distinct inhibitions peaking at approximately 20-60 and 600 ms that presumably reflected IPSPs by fast spiking, parvalbumin-positive cells and somatostatin-positive, Martinotti cells, respectively. In another experiment, we confirmed that the degree of the inhibition depended on the strength of the prepulse, but not on the amplitude of the prepulse-evoked cortical response, indicating that the prepulse-evoked excitatory response and prepulse-evoked inhibition reflected activation in two different pathways. Although many diseases such as schizophrenia may involve deficits in the inhibitory system, we do not have appropriate methods to evaluate them; therefore, the easy and non-invasive method described herein may be clinically useful.

  11. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  12. Luteoloside Inhibits Proliferation of Human Chronic Myeloid ...

    African Journals Online (AJOL)

    Purpose: To investigate the effects of luteoloside on the proliferation of human chronic ..... Zhang N, Wang D, Zhu Y, Wang J, Lin H. Inhibition ... Han X. Protection of Luteolin-7-O-Glucoside Against ... Hwang YJ, Lee EJ, Kim HR, Hwang KA.

  13. Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

    International Nuclear Information System (INIS)

    Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN

    2014-01-01

    Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

  14. Radiolabeled pertuzumab for imaging of human epidermal growth factor receptor 2 expression in ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Dawei [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Im, Hyung-Jun [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Sun, Haiyan; Cho, Steve Y. [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Valdovinos, Hector F.; England, Christopher G.; Ehlerding, Emily B.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Lee, Dong Soo [Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Huang, Peng [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2017-08-15

    Human epidermal growth factor receptor 2 (HER2) is over-expressed in over 30% of ovarian cancer cases, playing an essential role in tumorigenesis and metastasis. Non-invasive imaging of HER2 is of great interest for physicians as a mean to better detect and monitor the progression of ovarian cancer. In this study, HER2 was assessed as a biomarker for ovarian cancer imaging using {sup 64}Cu-labeled pertuzumab for immunoPET imaging. HER2 expression and binding were examined in three ovarian cancer cell lines (SKOV3, OVCAR3, Caov3) using in vitro techniques, including western blot and saturation binding assays. PET imaging and biodistribution studies in subcutaneous models of ovarian cancer were performed for non-invasive in vivo evaluation of HER2 expression. Additionally, orthotopic models were employed to further validate the imaging capability of {sup 64}Cu-NOTA-pertuzumab. HER2 expression was highest in SKOV3 cells, while OVCAR3 and Caov3 displayed lower HER2 expression. {sup 64}Cu-NOTA-pertuzumab showed high specificity for HER2 (K{sub a} = 3.1 ± 0.6 nM) in SKOV3. In subcutaneous tumors, PET imaging revealed tumor uptake of 41.8 ± 3.8, 10.5 ± 3.9, and 12.1 ± 2.3%ID/g at 48 h post-injection for SKOV3, OVCAR3, and Caov3, respectively (n = 3). In orthotopic models, PET imaging with {sup 64}Cu-NOTA-pertuzumab allowed for rapid and clear delineation of both primary and small peritoneal metastases in HER2-expressing ovarian cancer. {sup 64}Cu-NOTA-pertuzumab is an effective PET tracer for the non-invasive imaging of HER2 expression in vivo, rendering it a potential tracer for treatment monitoring and improved patient stratification. (orig.)

  15. Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.

    Science.gov (United States)

    Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei

    2015-07-28

    To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.

  16. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  17. Neutralization of IL-8 prevents the induction of dermatologic adverse events associated with the inhibition of epidermal growth factor receptor

    DEFF Research Database (Denmark)

    Bangsgaard, Nannie; Houtkamp, Mischa; Schuurhuis, Danita H

    2012-01-01

    Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance to treatm......Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance......, characterized by acute follicular neutrophil-rich hair follicle inflammation, and thus mimicked adverse events induced by systemic administration of EGFR inhibitors. In this model, we tested the hypothesis that neutrophils, attracted by IL-8, play a central role in the observed rash. Indeed, concomitant local...

  18. Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields.

    Science.gov (United States)

    Collard, J-F; Hinsenkamp, M

    2015-05-01

    We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

  19. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

  20. Genistein-mediated inhibition of glycosaminoglycan synthesis, which corrects storage in cells of patients suffering from mucopolysaccharidoses, acts by influencing an epidermal growth factor-dependent pathway

    Directory of Open Access Journals (Sweden)

    Barańska Sylwia

    2009-03-01

    Full Text Available Abstract Background Mucopolysaccharidoses (MPS are inherited metabolic disorders caused by mutations leading to dysfunction of one of enzymes involved in degradation of glycosaminoglycans (GAGs. Due to their impaired degradation, GAGs accumulate in cells of patients, which results in dysfunction of tissues and organs. Substrate reduction therapy is one of potential treatment of these diseases. It was demonstrated previously that genistein (4', 5, 7-trihydroxyisoflavone inhibits synthesis and reduces levels of GAGs in cultures of fibroblasts of MPS patients. Recent pilot clinical study indicated that such a therapy may be effective in MPS III (Sanfilippo syndrome. Methods To learn on details of the molecular mechanism of genistein-mediated inhibition of GAG synthesis, efficiency of this process was studied by measuring of incorporation of labeled sulfate, storage of GAGs in lysosomes was estimated by using electron microscopic techniques, and efficiency of phosphorylation of epidermal growth factor (EGF receptor was determined by using an ELISA-based assay with fluorogenic substrates. Results Effects of genistein on inhibition of GAG synthesis and accumulation in fibroblasts from patients suffering from various MPS types were abolished in the presence of an excess of EGF, and were partially reversed by an increased concentration of genistein. No such effects were observed when an excess of 17β-estradiol was used instead of EGF. Moreover, EGF-mediated stimulation of phsophorylation of the EGF receptor was impaired in the presence of genistein in both wild-type and MPS fibroblasts. Conclusion The results presented in this report indicate that the mechanism of genistein-mediated inhibition of GAG synthesis operates through epidermal growth factor (EGF-dependent pathway.

  1. Peptide inhibition of human cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    Morris Cindy A

    2011-02-01

    Full Text Available Abstract Background Human cytomegalovirus (HCMV is the most prevalent congenital viral infection in the United States and Europe causing significant morbidity and mortality to both mother and child. HCMV is also an opportunistic pathogen in immunocompromised individuals, including human immunodeficiency virus (HIV- infected patients with AIDS, and solid organ and allogeneic stem cell transplantation recipients. Current treatments for HCMV-associated diseases are insufficient due to the emergence of drug-induced resistance and cytotoxicity, necessitating novel approaches to limit HCMV infection. The aim of this study was to develop therapeutic peptides targeting glycoprotein B (gB, a major glycoprotein of HCMV that is highly conserved across the Herpesviridae family, that specifically inhibit fusion of the viral envelope with the host cell membrane preventing HCMV entry and infection. Results Using the Wimley-White Interfacial Hydrophobicity Scale (WWIHS, several regions within gB were identified that display a high potential to interact with lipid bilayers of cell membranes and hydrophobic surfaces within proteins. The ability of synthetic peptides analogous to WWIHS-positive sequences of HCMV gB to inhibit viral infectivity was evaluated. Human foreskin fibroblasts (HFF were infected with the Towne-GFP strain of HCMV (0.5 MOI, preincubated with peptides at a range of concentrations (78 nm to 100 μM, and GFP-positive cells were visualized 48 hours post-infection by fluorescence microscopy and analyzed quantitatively by flow cytometry. Peptides that inhibited HCMV infection demonstrated different inhibitory concentration curves indicating that each peptide possesses distinct biophysical properties. Peptide 174-200 showed 80% inhibition of viral infection at a concentration of 100 μM, and 51% and 62% inhibition at concentrations of 5 μM and 2.5 μM, respectively. Peptide 233-263 inhibited infection by 97% and 92% at concentrations of 100

  2. Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Boér K

    2016-10-01

    Full Text Available Katalin Boér Department of Medical Oncology, Szent Margit Hospital, Budapest, Hungary Abstract: Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6 inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2-ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant

  3. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  4. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  5. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.

    Science.gov (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

    2017-01-01

    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  6. Combined inhibition of EMMPRIN and epidermal growth factor receptor prevents the growth and migration of head and neck squamous cell carcinoma cells.

    Science.gov (United States)

    Suzuki, Shinsuke; Ishikawa, Kazuo

    2014-03-01

    It has been reported that the epidermal growth factor receptor (EGFR) expression is associated with the extracellular matrix metalloproteinase inducer (EMMPRIN) in some solid tumors; however, the relationship of EMMPRIN with EGFR in head and neck cancers is not fully understood. To determine the relationship between EMMPRIN and EGFR in head and neck squamous cell carcinoma (HNSCC), HNSCC cells were stimulated with epidermal growth factor (EGF), a ligand of EGFR. EMMPRIN expression in HNSCC cells was upregulated by EGF. In addition, EGF stimulation induced HNSCC cell invasion and MMP-9 expression. This increase in invasion and MMP-9 expression was abrogated by downmodulation of EMMPRIN. Furthermore, to determine the effects of combined EMMPRIN and EGFR targeting in HNSCC, HNSCC cells were treated with an EMMPRIN function-blocking antibody and the EGFR inhibitor AG1478. This combined treatment resulted in greater inhibition of HNSCC cell proliferation and migration compared with the individual agents alone. These results suggest that EMMPRIN mediates EGFR-induced tumorigenicity and that combined targeting of EMMPRIN and EGFR may be an efficacious treatment approach.

  7. Inhibition of EGF processing in responsive and nonresponsive human fibroblasts

    International Nuclear Information System (INIS)

    Schaudies, R.P.; Wray, H.L.

    1988-01-01

    We have examined the proteolytic processing of radiolabeled epidermal growth factor (EGF) in EGF growth-responsive human foreskin fibroblasts (HFF) versus EGF nonresponsive human fetal lung fibroblasts (HFL). Previous studies have shown that both cell lines demonstrate similar binding affinities and numbers of binding sites, as well as similar rates of internalization and degradation of the bound, radiolabeled hormone. We have used nondenaturing electrophoresis to compare how these two cell lines process EGF at its carboxy terminus. EGF lacking either one [des-(53)-EGF] or six [des (48-53)-EGF] carboxy terminal amino acids could be distinguished by this method. Chloroquine or leupeptin were added to the incubation system in an attempt to accentuate potential differences in hormonal processing between the responsive and nonresponsive cell lines. In the absence of inhibitors, the responsive and nonresponsive cells generated similar distributions of processed forms of EGF after 30-minutes incubation. However, after 4-hours incubation in the constant presence of 125I-EGF, the electrophoretic profiles of extracted hormone were substantially different. The radiolabel within the responsive cells, as well as that released from them, migrated predominantly at the dye front, indicating complete degradation of EGF. In contrast, the majority of the radiolabel within the nonresponsive cells migrated as partially processed forms of hormone, while the released radiolabel migrated at the dye front. Addition of chloroquine to either cell line inhibited processing of EGF beyond removal of the carboxyl terminal arginine residue. Both intact 125I-EGF, and 125I-EGF lacking the carboxyl terminal arginine were released from chloroquine-treated cells in a ratio equal to that present in the intact cells

  8. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  9. UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

    International Nuclear Information System (INIS)

    Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

    1996-01-01

    UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

  10. A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

    International Nuclear Information System (INIS)

    Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong

    2016-01-01

    The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

  11. A cyclic peptide derived from alpha-fetoprotein inhibits the proliferative effects of the epidermal growth factor and estradiol in MCF7 cells.

    Science.gov (United States)

    Torres, Cristian; Antileo, Elmer; Epuñán, Maráa José; Pino, Ana María; Valladares, Luis Emilio; Sierralta, Walter Daniel

    2008-06-01

    A cyclic peptide derived from the active domain of alpha-fetoprotein (AFP) significantly inhibited the proliferation of MCF7 cells stimulated with the epidermal growth factor (EGF) or estradiol (E2). The action of these three agents on cell growth was independent of the presence of calf serum in the culture medium. Our results demonstrated that the cyclic peptide interfered markedly with the regulation of MAPK by activated c-erbB2. The cyclic peptide showed no effect on the E2-stimulated release of matrix metalloproteinases 2 and 9 nor on the shedding of heparin-binding EGF into the culture medium. We propose that the AFP-derived cyclic peptide represents a valuable novel antiproliferative agent for treating breast cancer.

  12. Combination treatment with ionising radiation and gefitinib ('Iressa', ZD1839), an epidermal growth factor receptor (EGFR) inhibitor, significantly inhibits bladder cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Colquhoun, AJ; Mchugh, LA; Tulchinsky, E.; Kriajevska, M.; Mellon, JK

    2007-01-01

    External beam radiotherapy (EBRT) is the principal bladder-preserving monotherapy for muscle-invasive bladder cancer. Seventy percent of muscle-invasive bladder cancers express epidermal growth factor receptor (EGFR), which is associated with poor prognosis. Ionising radiation (IR) stimulates EGFR causing activation of cytoprotective signalling cascades and thus may be an underlying cause of radioresistance in bladder tumours. We assessed the ability of IR to activate EGFR in bladder cancer cells and the effect of the anti-EGFR therapy, gefitinib on potential radiation-induced activation. Subsequently we assessed the effect of IR on signalling pathways downstream of EGFR. Finally we assessed the activity of gefitinib as a monotherapy, and in combination with IR, using clonogenic assay in vitro, and a murine model in vivo. IR activated EGFR and gefitinib partially inhibited this activation. Radiation-induced activation of EGFR activated the MAPK and Akt pathways. Gefitinib partially inhibited activation of the MAPK pathway but not the Akt pathway. Treatment with combined gefitinib and IR significantly inhibited bladder cancer cell colony formation more than treatment with gefitinib alone (p=0.001-0.03). J82 xenograft tumours treated with combined gefitinib and IR showed significantly greater growth inhibition than tumours treated with IR alone (p=0.04). Combining gefitinib and IR results in significantly greater inhibition of invasive bladder cancer cell colony formation in vitro and significantly greater tumour growth inhibition in vivo. Given the high frequency of EGFR expression by bladder tumours and the low toxicity of gefitinib there is justification to translate this work into a clinical trial. (author)

  13. Advanced glycosylation end product promotes forkhead box O1 and inhibits Wnt pathway to suppress capacities of epidermal stem cells.

    Science.gov (United States)

    Zhu, Jie; Wang, Peng; Yu, Zhimin; Lai, Wei; Cao, Yi; Huang, Pinbo; Xu, Qiaodong; Yu, Menglei; Xu, Junyao; Huang, Zitong; Zeng, Bing

    2016-01-01

    Diabetes mellitus is frequently accompanied by chronic complications like delayed wound healing, which is consider to be attributed to the accumulation of advanced glycosylation end product (AGE). However, the impacts of AGE on epidermal stem cells (ESCs) are largely unknown. This study aims to address the influence and mechanism of AGE on ESCs. ESCs isolated from rats were cultured in AGE-modified bovine serum albumin and transfected with small interfering RNA to knock down AGE-specific receptor (AGER). Expression of stem cell markers integrin β1 (ITGB1) and keratin 19 (KRT19), cell viability, apoptosis and reactive oxygen species (ROS) were examined. Wnt pathway-related factors Wnt family member 1 (WNT1), WNT3A, β-catenin, v-myc avian myelocytomatosis viral oncogene homolog (MYC), cyclin D1 (CCND1) and matrix metallopeptidase 7 (MMP7) were quantified. The interaction between forkhead box O1 (FOXO1) and β-catenin was assessed by co-immunoprecipitation. Results indicated that AGE down-regulated ITGB1 and KRT19 expression, suppressed ESC viability and promoted apoptosis, and ROS level ( P factor 1 to interact with β-catenin, which might help to elucidate the mechanism of AGE repressing ESCs. This study helps to understand the mechanism of accumulated AGE in affecting ESC capacities, and provides potential therapeutic targets to meliorate diabetic wound healing.

  14. A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jihene Elloumi-Mseddi

    2014-01-01

    Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

  15. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten

    2011-01-01

    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  16. Epidermal growth factor receptor antibody plus recombinant human endostatin in treatment of hepatic metastases after remnant gastric cancer resection

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.

  17. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

    2003-01-01

    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  18. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  19. Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine.

    Science.gov (United States)

    Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E

    2017-01-01

    Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

  20. Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance

    Science.gov (United States)

    Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou

    2018-05-01

    Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

  1. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  2. Molecular mechanisms involved in the inhibition of tumor cells proliferation exposed to elevated concentrations of the epidermal growth factor

    International Nuclear Information System (INIS)

    Guillen, Isabel A; Berlanga, Jorge; Camacho, Hanlet

    2013-01-01

    The EGF promotes inhibition of cell proliferation in vitro and in vivo models depending on its concentration, application schema and the type of tumor cells on which it acts. Our research hypothesis was based on the fact that the EGF varies the expression of genes involved in a negative regulation of tumor cell lines proliferation carrying high levels of its receptor (EGFR). Our objectives were, to obtain information about the effect of EGF on tumor cell proliferation in vitro and in vivo models and, know the gene expression patterns of a group of genes involved in cancer signaling pathways and EGFR. The results showed that EGF at nanomolar concentrations inhibits the tumor cells proliferation bearing high levels of EGFR and, promotes the survival of treated animals, establishing a direct relationship between the inhibition of cell proliferation, high concentrations of EGF and, high amount of EGFR in the cells. The differential gene expression profile showed a variation in a group of genes which exert a powerful control over the cell cycle progression, gene transcription and apoptosis. It was concluded that the inhibition of tumor cell proliferation by the action of EGF is due to activation of molecular mechanisms controlling cell cycle progression. This work won the Annual Award of the Cuban Academy of Sciences in 2012

  3. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

    NARCIS (Netherlands)

    Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.

    2007-01-01

    PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

  4. Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

    International Nuclear Information System (INIS)

    Zhou, Yan; Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing; Zhong, Hua

    2016-01-01

    Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

  5. Fisetin inhibits epidermal growth factor-induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression.

    Science.gov (United States)

    Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa

    2017-01-01

    Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.

  6. Fisetin inhibits epidermal growth factor–induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression

    Science.gov (United States)

    Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen

    2017-01-01

    Purpose Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)–induced cell migration and the underlying mechanisms remain unclear. Methods Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription–PCR (RT–PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Results Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Conclusions Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1–dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases. PMID:29296070

  7. Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yan [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China); Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing [Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Zhong, Hua, E-mail: eddiedong8@hotmail.com [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China)

    2016-11-01

    Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

  8. Spice phenolics inhibit human PMNL 5-lipoxygenase.

    Science.gov (United States)

    Prasad, N Satya; Raghavendra, R; Lokesh, B R; Naidu, K Akhilender

    2004-06-01

    A wide variety of phenolic compounds and flavonoids present in spices possess potent antioxidant, antimutagenic and anticarcinogenic activities. We examined whether 5-lipoxygenase (5-LO), the key enzyme involved in biosynthesis of leukotrienes is a possible target for the spices. Effect of aqueous extracts of turmeric, cloves, pepper, chili, cinnamon, onion and also their respective active principles viz., curcumin, eugenol, piperine, capsaicin, cinnamaldehyde, quercetin, and allyl sulfide were tested on human PMNL 5-LO activity by spectrophotomeric and HPLC methods. The formation of 5-LO product 5-HETE was significantly inhibited in a concentration-dependent manner with IC(50) values of 0.122-1.44 mg for aqueous extracts of spices and 25-83 microM for active principles, respectively. The order of inhibitory activity was of quercetin>eugenol>curcumin>cinnamaldehyde>piperine>capsaicin>allyl sulfide. Quercetin, eugenol and curcumin with one or more phenolic ring and methoxy groups in their structure showed high inhibitory effect, while the non-phenolic spice principle allyl sulfide showed least inhibitory effect on 5-LO. The inhibitory effect of quercetin, curcumin and eugenol was similar to that of synthetic 5-LO inhibitors-phenidone and NDGA. Moreover, the inhibitory potency of aqueous extracts of spice correlated with the active principles of their respective spices. The synergistic or antagonistic effect of mixtures of spice active principles and spice extracts were investigated and all the combinations of spice active principles/extracts exerted synergistic effect in inhibiting 5-LO activity. These findings clearly suggest that phenolic compounds present in spices might have physiological role in modulating 5-LO pathway.

  9. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  10. Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter

    2012-01-01

    by treatment with trastuzumab (20 nM). This resulted in inhibition of cardiomyocyte proliferation, but interestingly only in hypoxic cells. Co-treatment of HL-1 cells with HB-EGF (10 nM) but not with NRG-1 (5 ng/ml) rescued the cardiomyocytes from HER2 inhibition. HL-1 cardiomyocytes exposed to hypoxia...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

  11. Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

    2006-01-01

    Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

  12. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  13. Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor receptor 2-dependent and other solid tumors.

    Science.gov (United States)

    Gandhi, Leena; Bahleda, Rastislav; Tolaney, Sara M; Kwak, Eunice L; Cleary, James M; Pandya, Shuchi S; Hollebecque, Antoine; Abbas, Richat; Ananthakrishnan, Revathi; Berkenblit, Anna; Krygowski, Mizue; Liang, Yali; Turnbull, Kathleen W; Shapiro, Geoffrey I; Soria, Jean-Charles

    2014-01-10

    Human epidermal growth factor (HER) -mediated signaling is critical in many cancers, including subsets of breast and lung cancer. HER family members signal via the phosphatidylinositide 3-kinase (PI3K) -AKT/protein kinase B-mammalian target of rapamycin (mTOR) cascade; mTOR activation is critical for the expression of multiple contributors to tumor growth and invasion. On the basis of preclinical data suggesting synergy of HER2 inhibition and mTOR inhibition in breast and lung cancer models, we conducted a phase I combination study of neratinib, a small-molecule irreversible pan-HER tyrosine kinase inhibitor, and temsirolimus, an mTOR inhibitor, in patients with advanced solid tumors. This study enrolled patients to dosing combinations of neratinib and temsirolimus. The primary objective was to estimate the toxicity contour of the combination and establish recommended phase II doses. Sixty patients were treated on 12 of 16 possible dosing combinations. Diarrhea was the most common drug-related (93%) and dose-limiting toxicity (DLT), constituting four of 10 DLTs. Dose-limiting grade 3 metabolic abnormalities were also observed. Other frequent drug-related toxicities included nausea, stomatitis (both 53%), and anemia (48%). Two maximum-tolerated dose combinations were identified: 200 mg of neratinib/25 mg of temsirolimus and 160 mg of neratinib/50 mg of temsirolimus. Responses were noted in patients with HER2-amplified breast cancer resistant to trastuzumab, HER2-mutant non-small-cell lung cancer, and tumor types without identified mutations in the HER-PI3K-mTOR pathway. The combination of neratinib and temsirolimus was tolerable and demonstrated antitumor activity in multiple tumor types, warranting further evaluation.

  14. Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

    International Nuclear Information System (INIS)

    Bell, C.W.

    1987-01-01

    Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

  15. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  16. Assessment of Epidermal Growth Factor Receptor (EGFR expression in human meningioma

    Directory of Open Access Journals (Sweden)

    Perry Arie

    2010-05-01

    Full Text Available Abstract Purpose This study explores whether meningioma expresses epidermal growth factor receptor (EGFR and determines if there is a correlation between the WHO grade of this tumor and the degree of EGFR expression. Methods Following institutional review board approval, 113 meningioma specimens from 89 patients were chosen. Of these, 85 were used for final analysis. After a blinded review, immunohistochemical stains for EGFR were performed. Staining intensity (SI was scored on a scale 0-3 (from no staining to strong staining. Staining percentage of immunoreactive cells (SP was scored 1-5 (from the least to the maximum percent of the specimen staining. Immunohistochemical score (IHS was calculated as the product of SI and SP. Results Eighty-five samples of meningioma were classified in accordance with World Health Organization (WHO criteria: benign 57/85 (67%, atypical 23/85 (27%, and malignant 5/85 (6%. The majority of samples demonstrated a moderate SI for EGFR. IHS for EGFR demonstrated a significant association between SI and histopathologic subtype. Also, there was a correlation between the SP and histopathologic subtype (p = 0.029. A significant association was determined when the benign and the atypical samples were compared to the malignant with respect to the SP (p = 0.009. While there was a range of the IHS for the benign and the atypical histologic subtypes, malignant tumors exhibited the lowest score and were statistically different from the benign and the atypical specimens (p Conclusions To our knowledge, this represents the largest series of meningioma samples analyzed for EGFR expression reported in the literature. EGFR expression is greatest in benign meningiomas and may serve a potential target for therapeutic intervention with selective EGFR inhibitors.

  17. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  18. Nitric oxide from inflammatory origin impairs neural stem cell proliferation by inhibiting epidermal growth factor receptor signaling

    Directory of Open Access Journals (Sweden)

    Bruno Pereira Carreira

    2014-10-01

    Full Text Available Neuroinflammation is characterized by activation of microglial cells, followed by production of nitric oxide (NO, which may have different outcomes on neurogenesis, favoring or inhibiting this process. In the present study, we investigated how the inflammatory mediator NO can affect proliferation of neural stem cells (NSC, and explored possible mechanisms underlying this effect. We investigated which mechanisms are involved in the regulation of NSC proliferation following treatment with an inflammatory stimulus (LPS plus IFN-γ, using a culture system of subventricular zone (SVZ-derived NSC mixed with microglia cells obtained from wild-type mice (iNOS+/+ or from iNOS knockout mice (iNOS-/-. We found an impairment of NSC cell proliferation in iNOS+/+ mixed cultures, which was not observed in iNOS-/- mixed cultures. Furthermore, the increased release of NO by activated iNOS+/+ microglial cells decreased the activation of the ERK/MAPK signaling pathway, which was concomitant with an enhanced nitration of the EGF receptor. Preventing nitrogen reactive species formation with MnTBAP, a scavenger of peroxynitrite, or using the peroxynitrite degradation catalyst FeTMPyP, cell proliferation and ERK signaling were restored to basal levels in iNOS+/+ mixed cultures. Moreover, exposure to the NO donor NOC-18 (100 µM, for 48 h, inhibited SVZ-derived NSC proliferation. Regarding the antiproliferative effect of NO, we found that NOC-18 caused the impairment of signaling through the ERK/MAPK pathway, which may be related to increased nitration of the EGF receptor in NSC. Using MnTBAP nitration was prevented, maintaining ERK signaling, rescuing NSC proliferation. We show that NO from inflammatory origin leads to a decreased function of the EGF receptor, which compromised proliferation of NSC. We also demonstrated that NO-mediated nitration of the EGF receptor caused a decrease in its phosphorylation, thus preventing regular proliferation signaling through the

  19. The combi-targeting concept: synthesis of stable nitrosoureas designed to inhibit the epidermal growth factor receptor (EGFR).

    Science.gov (United States)

    Domarkas, Juozas; Dudouit, Fabienne; Williams, Christopher; Qiyu, Qiu; Banerjee, Ranjita; Brahimi, Fouad; Jean-Claude, Bertrand Jacques

    2006-06-15

    According to the "combi-targeting" concept, the EGFR tyrosine kinase (TK) inhibitory potency of compounds termed "combi-molecules" is critical for selective growth inhibition of tumor cells with disordered expression of EGFR or its closest family member erbB2. Here we report on the optimization of the EGFR TK inhibitory potency of the combi-molecules of the nitrosourea class by comparison with their aminoquinazoline and ureidoquinazoline precursors. This led to the discovery of a new structural parameter that influences their EGFR TK inhibitory potency, i.e., the torsion angle between the plane of the quinazoline ring and the ureido or the nitrosoureido moiety of the synthesized drugs. Compounds (3'-Cl and Br series) with small angles (0.5-3 degrees ) were generally stronger EGFR TK inhibitors than those with large angles (18-21 degrees ). This was further corroborated by ligand-receptor van der Waals interaction calculations that showed significant binding hindrance imposed by large torsion angles in the narrow ATP cleft of EGFR. Selective antiproliferative studies in a pair of mouse fibroblast NIH3T3 cells, one of which NIH3T3/neu being transfected with the erbB2 oncogene, showed that IC(50) values for inhibition of EGFR TK could be good predictors of their selective potency against the serum-stimulated growth of the erbB2-tranfected cell line (Pearson r = 0.8). On the basis of stability (t(1/2)), EGFR TK inhibitory potency (IC(50)), and selective erbB2 targeting, compound 23, a stable nitrosourea, was considered to have the structural requirements for further development.

  20. Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

    2017-12-01

    Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

  1. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  2. 125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    International Nuclear Information System (INIS)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

  3. The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

    International Nuclear Information System (INIS)

    Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung

    2012-01-01

    Highlights: ► HBP sequence identified from HB-EGF has cell penetration activity. ► HBP inhibits the NF-κB dependent inflammatory responses. ► HBP directly blocks phosphorylation and degradation of IκBα. ► HBP inhibits nuclear translocation of NF-κB p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

  4. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  5. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  6. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  7. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  8. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  9. Inhibition of human aromatase complex (CYP19) by antiepileptic drugs

    DEFF Research Database (Denmark)

    Jacobsen, Naja Wessel; Halling-Sørensen, Bent; Birkved, Franziska Maria A Kramer

    2008-01-01

    of 1.4-49.7 mM. Carbamazepine, gabapentin, primidone, topiramate and vigabatrin showed no inhibition. Additionally, binary drug combinations were tested to investigate if combination therapy could potentiate the aromatase inhibition. Additive inhibition was seen in combination experiments...... with valproate and phenobarbital. When adding carbamazepine to a range of valproate concentrations no additional inhibition was seen. The data for some of the AEDs show that side effects on steroid synthesis in humans due to inhibition of aromatase should be considered....

  10. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  11. EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR AND HUMAN PAPILLOMAVIRUS (HPV L1 CAPSID PROTEIN IN CERVICAL SQUAMOUS INTRAEPITHELIAL LESIONS

    Directory of Open Access Journals (Sweden)

    Balan Raluca

    2010-09-01

    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  12. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars.

    Science.gov (United States)

    Jackisch, Christian; Lammers, Philip; Jacobs, Ira

    2017-04-01

    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer. Copyright © 2017 Authors, Pfizer Inc. Published by Elsevier Ltd.. All rights reserved.

  13. Association of Polymorphisms in Connective Tissue Growth Factor and Epidermal Growth Factor Receptor Genes With Human Longevity.

    Science.gov (United States)

    Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J

    2017-08-01

    Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

    International Nuclear Information System (INIS)

    Stromberg, K.; Hudgins, W.R.

    1986-01-01

    Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

  15. Epidermal growth factor inhibits rat pancreatic cell proliferation, causes acinar cell hypertrophy, and prevents caerulein-induced desensitization of amylase release.

    Science.gov (United States)

    Morisset, J; Larose, L; Korc, M

    1989-06-01

    The in vivo effects of epidermal growth factor (EGF) on pancreatic growth and digestive enzyme concentrations were compared with the actions of the pancreatic secretagogue caerulein in the adult rat. EGF (10 micrograms/kg BW) did not alter pancreatic weight or protein content. However, this concentration of EGF inhibited [3H]thymidine incorporation into DNA by 44%, decreased DNA content by 20%, and increased the concentrations of amylase, chymotrypsinogen, and protein by 106%, 232%, and 42%, respectively. Pancreatic acini prepared from EGF-treated rats exhibited a characteristic secretory response to caerulein that was superimposable to that obtained in acini from saline-treated rats. In both groups of acini half-maximal and maximal stimulation of amylase release occurred at approximately 5 pM and 50 pM caerulein, respectively. In contrast to EGF, caerulein (1 microgram/kg BW) increased pancreatic weight by 29% and protein content by 59%, and enhanced [3H]thymidine incorporation into DNA by 70%. Although caerulein increased the concentrations of pancreatic amylase and chymotrypsinogen by 38% and 297%, respectively, pancreatic acini prepared from caerulein-treated rats were less sensitive to the actions of caerulein in vitro when compared with acini from control rats. Indeed, the EC50 was shift from 4.8 pM to 9.8 pM after 4 days of treatment. EGF potentiated the actions of caerulein on pancreatic weight, protein content, and chymotrypsinogen concentration, and prevented the caerulein-induced alteration in the secretory responsiveness of the acinar cell. Conversely, caerulein reversed the inhibitory effect of EGF on thymidine incorporation. These findings suggest that EGF may modulate the trophic effects of certain gastrointestinal hormones, and may participate in the regulation of pancreatic exocrine function in vivo.

  16. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Directory of Open Access Journals (Sweden)

    Delfina Costa

    2018-05-01

    Full Text Available Mesenchymal stromal cells (MSC present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF] can exert immunosuppressive effects on T and natural killer (NK lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16. In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR; thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy.

  17. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Science.gov (United States)

    Costa, Delfina; Venè, Roberta; Benelli, Roberto; Romairone, Emanuele; Scabini, Stefano; Catellani, Silvia; Rebesco, Barbara; Mastracci, Luca; Grillo, Federica; Minghelli, Simona; Loiacono, Fabrizio; Zocchi, Maria Raffaella; Poggi, Alessandro

    2018-01-01

    Mesenchymal stromal cells (MSC) present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF)] can exert immunosuppressive effects on T and natural killer (NK) lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC) and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16). In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR); thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF) of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy. PMID:29910806

  18. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  19. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh

    1984-01-01

    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  20. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

    Science.gov (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

    2016-05-01

    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  1. Materials and optimized designs for human-machine interfaces via epidermal electronics.

    Science.gov (United States)

    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A

    2013-12-17

    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Linking γ-aminobutyric acid A receptor to epidermal growth factor receptor pathways activation in human prostate cancer.

    Science.gov (United States)

    Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung

    2014-03-05

    Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier

  3. /sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

  4. Non-small-cell lung cancer cells combat epidermal growth factor receptor tyrosine kinase inhibition through immediate adhesion-related responses

    Directory of Open Access Journals (Sweden)

    Wang HY

    2016-05-01

    Full Text Available Hsian-Yu Wang,1,2 Min-Kung Hsu,3,4 Kai-Hsuan Wang,1 Ching-Ping Tseng,2,4 Feng-Chi Chen,3,4 John T-A Hsu1,4 1Institute of Biotechnology and Pharmaceutical Research, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 2Institute of Molecular Medicine and Bioengineering, National Chiao Tung University (NCTU, Hsinchu, 3Division of Biostatistics and Bioinformatics, Institute of Population Health Sciences, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 4Department of Biological Science and Technology, National Chiao Tung University (NCTU, Hsinchu, Taiwan, Republic of China Background: Epidermal growth factor receptor (EGFR tyrosine kinase inhibitors (TKIs, such as gefitinib, erlotinib, and afatinib, have greatly improved treatment efficacy in non-small cell lung cancer (NSCLC patients with drug-sensitive EGFR mutations. However, in some TKI responders, the benefits of such targeted therapies are limited by the rapid development of resistance, and strategies to overcome this resistance are urgently needed. Studies of drug resistance in cancer cells typically involve long term in vitro induction to obtain stably acquired drug-resistant cells followed by elucidation of resistance mechanisms, but the immediate responses of cancer cells upon drug treatment have been ignored. The aim of this study was to investigate the immediate responses of NSCLC cells upon treatment with EGFR TKIs.Results: Both NSCLC cells, ie, PC9 and H1975, showed immediate enhanced adhesion-related responses as an apoptosis-countering mechanism upon first-time TKI treatment. By gene expression and pathway analysis, adhesion-related pathways were enriched in gefitinib-treated PC9 cells. Pathway inhibition by small-hairpin RNAs or small-molecule drugs revealed that within hours of EGFR TKI treatment, NSCLC cells used adhesion-related responses to combat the drugs. Importantly, we show here that the Src family inhibitor, dasatinib, dramatically inhibits

  5. A role for the epidermal growth factor receptor signaling in development of intestinal serrated polyps in mice and humans.

    Science.gov (United States)

    Bongers, Gerold; Muniz, Luciana R; Pacer, Michelle E; Iuga, Alina C; Thirunarayanan, Nanthakumar; Slinger, Erik; Smit, Martine J; Reddy, E Premkumar; Mayer, Lloyd; Furtado, Glaucia C; Harpaz, Noam; Lira, Sergio A

    2012-09-01

    Epithelial cancers can be initiated by activating mutations in components of the mitogen-activated protein kinase signaling pathway such as v-raf murine sarcoma viral oncogene homolog B1 (BRAF), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), or epidermal growth factor receptor (EGFR). Human intestinal serrated polyps are a heterogeneous group of benign lesions, but some progress to colorectal cancer. Tumors that arise from these polyps frequently contain activating mutations in BRAF or KRAS, but little is known about the role of EGFR activation in their development. Polyp samples were obtained from adults during screening colonoscopies at Mount Sinai Hospital in New York. We measured levels of EGFR protein and phosphorylation in human serrated polyps by immunohistochemical and immunoblot analyses. We generated transgenic mice that express the ligand for EGFR, Heparin-binding EGF-like growth factor (HB-EGF), in the intestine. EGFR and the extracellular-regulated kinases (ERK)1/2 were phosphorylated in serrated areas of human hyperplastic polyps (HPPs), sessile serrated adenomas, and traditional serrated adenomas. EGFR and ERK1/2 were phosphorylated in the absence of KRAS or BRAF activating mutations in a subset of HPP. Transgenic expression of the EGFR ligand HB-EGF in the intestines of mice promoted development of small cecal serrated polyps. Mice that expressed a combination of HB-EGF and US28 (a constitutively active, G-protein-coupled receptor that increases processing of HB-EGF from the membrane) rapidly developed large cecal serrated polyps. These polyps were similar to HPPs and had increased phosphorylation of EGFR and ERK1/2 within the serrated epithelium. Administration of pharmacologic inhibitors of EGFR or MAPK to these transgenic mice significantly reduced polyp development. Activation of EGFR signaling in the intestine of mice promotes development of serrated polyps. EGFR signaling also is activated in human HPPs, sessile serrated adenomas

  6. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  7. Human epidermal growth factor receptor 2 status of gastric cancer patients in Asia: results from a large, multicountry study.

    Science.gov (United States)

    Pathmanathan, Nirmala; Geng, Jing-Shu; Li, Wencai; Nie, Xiu; Veloso, Januario; Wang, John; Hill, Julie; Mccloud, Philip; Bilous, Michael

    2017-06-01

    Current estimates of the human epidermal growth factor receptor 2 (HER2)-positivity rate in gastric cancer vary widely in the literature, and there are limited data from countries in Asia. The primary aim of this study was to conduct a clinical audit of laboratories across seven countries in Asia to determine the incidence of HER2-positive gastric cancer in this region. Pathologists were asked to collect data on patient gender, age, cancer site, specimen type, tumor spread, type and grade, HER2 test results, including protein and/or gene copy enumeration, and final HER2 status on consecutive gastric cancer cases tested for HER2 in their laboratory over a 2-year period. HER2 results from 5,301 gastric cancers were submitted by 50 laboratories. The overall HER2-positivity rate was 9.7% which, after the exclusion of China, increased to 18.1%. The rate between countries ranged from 0% to 23.1%, and from 0% to 50.0% between laboratories. An equivocal HER2 result was recorded in 19.5% of cases. Despite the lack of centralized testing to confirm the accuracy of HER2 diagnoses, the incidence of HER2-positive gastric cancer observed here was comparable to that reported in the literature. Nevertheless, rates were highly variable between countries and laboratories, which suggests a lack of HER2 testing expertise in gastric cancer. Given that the mortality rates for gastric cancer in Eastern Asia are the highest in the world, efforts should focus on improving HER2 testing expertise in the region so that patients receive the appropriate treatment early in their disease. © 2016 The Authors. Asia-Pacific Journal of Clinical Oncology Published by John Wiley & Sons Australia, Ltd.

  8. MECHANISM OF PROTEIN TYROSINE PHOSPHATASE INHIBITION IN HUMAN AIRWAY EPITHELIAL CELLS (HAEC) EXPOSED TO ZN2+

    Science.gov (United States)

    A number of studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to Zn2+ inhibits protein tyrosine phosphatase (PTP) activity and leads to activation of epidermal growth factor receptor (EGFR) signaling in ...

  9. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.

    1986-01-01

    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  10. Milk fat globule-epidermal growth factor-factor VIII-derived peptide MSP68 is a cytoskeletal immunomodulator of neutrophils that inhibits Rac1.

    Science.gov (United States)

    Hendricks, Louie; Aziz, Monowar; Yang, Weng-Lang; Nicastro, Jeffrey; Coppa, Gene F; Symons, Marc; Wang, Ping

    2017-02-01

    Prolonged neutrophil infiltration leads to exaggerated inflammation and tissue damage during sepsis. Neutrophil migration requires rearrangement of their cytoskeleton. Milk fat globule-epidermal growth factor-factor VIII-derived short peptide 68 (MSP68) has recently been shown to be beneficial in sepsis-induced tissue injury and mortality. We hypothesize that MSP68 inhibits neutrophil migration by modulating small GTPase Rac1-dependent cytoskeletal rearrangements. Bone marrow-derived neutrophils (BMDNs) or whole lung digest isolated neutrophils were isolated from 8 to 10 wk old C57BL/6 mice by Percoll density gradient centrifugation. The purity of BMDN was verified by flow cytometry with CD11b/Gr-1 staining. Neutrophils were stimulated with N-formylmethionine-leucine-phenylalanine (f-MLP) (10 nM) in the presence or absence of MSP68 at 10 nM or cecal ligation and puncture (CLP) was used to induce sepsis, and MSP68 was administered at 1 mg/kg intravenously. Cytoskeletal organization was assessed by phalloidin staining, followed by analysis using fluorescence microscopy. Activity of the Rac1 GTPase in f-MLP or CLP-activated BMDN in the presence or absence of MSP68 was assessed by GTPase enzyme-linked immunosorbent assay. Mitogen-activated protein (MAP) kinase activity was determined by western blot densitometry. BMDN treatment with f-MLP increased cytoskeletal remodeling as revealed by the localization of filamentous actin to the periphery of the neutrophil. By contrast, cells pretreated with MSP68 had considerably reduced filamentous actin polymerization. Cytoskeletal spreading is associated with the activation of the small GTPase Rac1. We found BMDN-treated with f-MLP or that were exposed to sepsis by CLP had increased Rac1 signaling, whereas the cells pretreated with MSP68 had significantly reduced Rac1 activation (P Rac1-MAP kinase-mediated neutrophil motility. Thus, MSP68 is a novel therapeutic candidate for regulating inflammation and tissue damage caused

  11. Screening of plant extracts for human tyrosinase inhibiting effects.

    Science.gov (United States)

    Kim, M; Park, J; Song, K; Kim, H G; Koh, J-S; Boo, Y C

    2012-04-01

    Screening for tyrosinase (TYR) inhibitors potentially useful for control of skin pigmentation has been hampered by the limited availability of human TYR. To overcome this hurdle, we have established human embryonic kidney (HEK293)-TYR cells that constitutively express human TYR. In the current study, we assayed human TYR inhibition activities of 50 plant extracts using the lysates of transformed HEK293-TYR cells. The strongest inhibition of human TYR was shown by the extract of Vaccinium bracteatum Thunberg, followed by the extract of Morus bombycis Koidzumi. The former extract did not inhibit mushroom TYR activity whereas significant inhibition was observed with the latter extract, demonstrating the importance of using human TYR in the screening for human TYR inhibitors. Upon liquid-liquid partitioning of the extract from V. bracteatum, the active constituents were enriched in the ethyl acetate fraction, and the subsequent preparatory thin-layer chromatography identified p-coumaric acid (PCA) as the main active constituent. The hypo-pigmentation of PCA was verified in the MelanoDerm™ Skin Model. This study demonstrates that transformed HEK293-TYR cells could expedite the discovery of human TYR-specific inhibitors from natural sources which might be useful in the control of skin pigmentation. © 2012 The Authors. ICS © 2012 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  12. Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

    NARCIS (Netherlands)

    Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

    2000-01-01

    Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

  13. Fluconazole inhibits human adrenocortical steroidogenesis in vitro

    NARCIS (Netherlands)

    R. van der Pas (Rob); L.J. Hofland (Leo); J. Hofland (Johannes); A.E. Taylor (A.); W. Arlt (Wiebke); J. Steenbergen (Jacobie); P.M. van Koetsveld (Peter); W.W. de Herder (Wouter); F.H. de Jong (Frank); R.A. Feelders (Richard)

    2012-01-01

    textabstractThe antifungal agent ketoconazole is often used to suppress cortisol production in patients with Cushing's syndrome (CS). However, ketoconazole has serious side effects and is hepatotoxic. Here, the in vitro effects of ketoconazole and fluconazole, which might be less toxic, on human

  14. Luteoloside Inhibits Proliferation of Human Chronic Myeloid ...

    African Journals Online (AJOL)

    Purpose: To investigate the effects of luteoloside on the proliferation of human chronic myeloid leukemia K562 cells and whether luteoloside induces cell cycle arrest and apoptosis in K562 cells. Methods: Luteoloside's cytotoxicity was assessed using a cell counting kit. Cell cycle distribution was analysed by flow cytometry ...

  15. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  16. Pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.

  17. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

  18. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T

    2013-06-01

    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  19. Targeted delivery of polyamidoamine-paclitaxel conjugate functionalized with anti-human epidermal growth factor receptor 2 trastuzumab

    Directory of Open Access Journals (Sweden)

    Ma P

    2015-03-01

    Full Text Available Pengkai Ma,1 Xuemei Zhang,1 Ling Ni,2 Jinming Li,2 Fengpu Zhang,1 Zheng Wang,1 Shengnan Lian,1 Kaoxiang Sun1 1School of Pharmacy, Yantai University, Yantai, Shandong Province, People’s Republic of China; 2State Key Laboratory of Long-acting and Targeting Drug Delivery System, Yantai, Shandong Province, People’s Republic of China Background: Antibody-dendrimer conjugates have the potential to improve the targeting and release of chemotherapeutic drugs at the tumor site while reducing adverse side effects caused by drug accumulation in healthy tissues. In this study, trastuzumab (TMAB, which binds to human epidermal growth factor receptor 2 (HER2, was used as a targeting agent in a TMAB-polyamidoamine (PAMAM conjugate carrying paclitaxel (PTX specifically to cells overexpressing HER2. Methods: TMAB was covalently linked to a PAMAM dendrimer via bifunctional polyethylene glycol (PEG. PTX was conjugated to PAMAM using succinic anhydride as a cross-linker, yielding TMAB-PEG-PAMAM-PTX. Dynamic light scattering and transmission electron microscopy were used to characterize the conjugates. The cellular uptake and in vivo biodistribution were studied by fluorescence microscopy, flow cytometry, and Carestream In Vivo FX, respectively. Results: Nuclear magnetic resonance spectroscopy demonstrated that PEG, PTX, fluorescein isothiocyanate, and cyanine7 were conjugated to PAMAM. Ultraviolet-visible spectroscopy and sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that TMAB was conjugated to PEG-PAMAM. Dynamic light scattering and transmission electron microscopy measurements revealed that the different conjugates ranged in size between 10 and 35 nm and had a spherical shape. In vitro cellular uptake demonstrated that the TMAB-conjugated PAMAM was taken up by HER2-overexpressing BT474 cells more efficiently than MCF-7 cells that expressed lower levels of HER2. Co-localization experiments indicated that TMAB-conjugated PAMAM was

  20. Effects of recombinant human epidermal growth factor on the proliferation and radiation survival of human fibroblast cell lines in vitro

    International Nuclear Information System (INIS)

    Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook

    2006-01-01

    To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing

  1. BDNF/TrkB signaling protects HT-29 human colon cancer cells from EGFR inhibition

    International Nuclear Information System (INIS)

    Brunetto de Farias, Caroline; Heinen, Tiago Elias; Pereira dos Santos, Rafael; Abujamra, Ana Lucia; Schwartsmann, Gilberto

    2012-01-01

    Highlights: ► BDNF protected HT-29 colorectal cancer cells from the antitumor effect of cetuximab. ► TrkB inhibition potentiated the antitumor effect of cetuximab. ► BDNF/TrkB signaling might be involved in resistance to anti-EGFR therapy. -- Abstract: The clinical success of targeted treatment of colorectal cancer (CRC) is often limited by resistance to anti-epidermal growth factor receptor (EGFR) therapy. The neurotrophin brain-derived neurotrophic factor (BDNF) and its receptor TrkB have recently emerged as anticancer targets, and we have previously shown increased BDNF levels in CRC tumor samples. Here we report the findings from in vitro experiments suggesting that BDNF/TrkB signaling can protect CRC cells from the antitumor effects of EGFR blockade. The anti-EGFR monoclonal antibody cetuximab reduced both cell proliferation and the mRNA expression of BDNF and TrkB in human HT-29 CRC cells. The inhibitory effect of cetuximab on cell proliferation and survival was counteracted by the addition of human recombinant BDNF. Finally, the Trk inhibitor K252a synergistically enhanced the effect of cetuximab on cell proliferation, and this effect was blocked by BDNF. These results provide the first evidence that increased BDNF/TrkB signaling might play a role in resistance to EGFR blockade. Moreover, it is possible that targeting TrkB could potentiate the anticancer effects of anti-EGFR therapy.

  2. BDNF/TrkB signaling protects HT-29 human colon cancer cells from EGFR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Brunetto de Farias, Caroline [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Children' s Cancer Institute, 90420-140 Porto Alegre, RS (Brazil); Laboratory of Neuropharmacology and Neural Tumor Biology, Department of Pharmacology, Institute for Basic Health Sciences, Federal University of Rio Grande do Sul, 90050-170 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Heinen, Tiago Elias; Pereira dos Santos, Rafael [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Laboratory of Neuropharmacology and Neural Tumor Biology, Department of Pharmacology, Institute for Basic Health Sciences, Federal University of Rio Grande do Sul, 90050-170 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Abujamra, Ana Lucia [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Children' s Cancer Institute, 90420-140 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Schwartsmann, Gilberto [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Department of Internal Medicine, School of Medicine, Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); and others

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer BDNF protected HT-29 colorectal cancer cells from the antitumor effect of cetuximab. Black-Right-Pointing-Pointer TrkB inhibition potentiated the antitumor effect of cetuximab. Black-Right-Pointing-Pointer BDNF/TrkB signaling might be involved in resistance to anti-EGFR therapy. -- Abstract: The clinical success of targeted treatment of colorectal cancer (CRC) is often limited by resistance to anti-epidermal growth factor receptor (EGFR) therapy. The neurotrophin brain-derived neurotrophic factor (BDNF) and its receptor TrkB have recently emerged as anticancer targets, and we have previously shown increased BDNF levels in CRC tumor samples. Here we report the findings from in vitro experiments suggesting that BDNF/TrkB signaling can protect CRC cells from the antitumor effects of EGFR blockade. The anti-EGFR monoclonal antibody cetuximab reduced both cell proliferation and the mRNA expression of BDNF and TrkB in human HT-29 CRC cells. The inhibitory effect of cetuximab on cell proliferation and survival was counteracted by the addition of human recombinant BDNF. Finally, the Trk inhibitor K252a synergistically enhanced the effect of cetuximab on cell proliferation, and this effect was blocked by BDNF. These results provide the first evidence that increased BDNF/TrkB signaling might play a role in resistance to EGFR blockade. Moreover, it is possible that targeting TrkB could potentiate the anticancer effects of anti-EGFR therapy.

  3. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

    Science.gov (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

    2004-09-01

    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

  4. Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

    International Nuclear Information System (INIS)

    Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

    2009-01-01

    Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

  5. Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

    Directory of Open Access Journals (Sweden)

    Santosh Kumar

    2015-01-01

    Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

  6. Human Sulfatase 2 inhibits in vivo tumor growth of MDA-MB-231 human breast cancer xenografts

    International Nuclear Information System (INIS)

    Peterson, Sarah M; Concino, Michael F; Liaw, Lucy; Martini, Paolo GV; Iskenderian, Andrea; Cook, Lynette; Romashko, Alla; Tobin, Kristen; Jones, Michael; Norton, Angela; Gómez-Yafal, Alicia; Heartlein, Michael W

    2010-01-01

    Extracellular human sulfatases modulate growth factor signaling by alteration of the heparin/heparan sulfate proteoglycan (HSPG) 6-O-sulfation state. HSPGs bind to numerous growth factor ligands including fibroblast growth factors (FGF), epidermal growth factors (EGF), and vascular endothelial growth factors (VEGF), and are critically important in the context of cancer cell growth, invasion, and metastasis. We hypothesized that sulfatase activity in the tumor microenvironment would regulate tumor growth in vivo. We established a model of stable expression of sulfatases in the human breast cancer cell line MDA-MB-231 and purified recombinant human Sulfatase 2 (rhSulf2) for exogenous administration. In vitro studies were performed to measure effects on breast cancer cell invasion and proliferation, and groups were statistically compared using Student's t-test. The effects of hSulf2 on tumor progression were tested using in vivo xenografts with two methods. First, MDA-MB-231 cells stably expressing hSulf1, hSulf2, or both hSulf1/hSulf2 were grown as xenografts and the resulting tumor growth and vascularization was compared to controls. Secondly, wild type MDA-MB-231 xenografts were treated by short-term intratumoral injection with rhSulf2 or vehicle during tumor growth. Ultrasound analysis was also used to complement caliper measurement to monitor tumor growth. In vivo studies were statistically analyzed using Student's t test. In vitro, stable expression of hSulf2 or administration of rhSulf2 in breast cancer cells decreased cell proliferation and invasion, corresponding to an inhibition of ERK activation. Stable expression of the sulfatases in xenografts significantly suppressed tumor growth, with complete regression of tumors expressing both hSulf1 and hSulf2 and significantly smaller tumor volumes in groups expressing hSulf1 or hSulf2 compared to control xenografts. Despite significant suppression of tumor volume, sulfatases did not affect vascular

  7. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  8. Functional imaging of human epidermal growth factor receptor 2-positive metastatic breast cancer using (64)Cu-DOTA-trastuzumab PET.

    Science.gov (United States)

    Mortimer, Joanne E; Bading, James R; Colcher, David M; Conti, Peter S; Frankel, Paul H; Carroll, Mary I; Tong, Shan; Poku, Erasmus; Miles, Joshua K; Shively, John E; Raubitschek, Andrew A

    2014-01-01

    Women with human epidermal growth factor receptor 2 (HER2)-positive breast cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. Assessment of HER2 status in recurrent disease is usually made by core needle biopsy of a single lesion, which may not represent the larger tumor mass or other sites of disease. Our long-range goal is to develop PET of radiolabeled trastuzumab for systemically assessing tumor HER2 expression and identifying appropriate use of anti-HER2 therapies. The purpose of this study was to evaluate PET/CT of (64)Cu-DOTA-trastuzumab for detecting and measuring tumor uptake of trastuzumab in patients with HER2-positive metastatic breast cancer. Eight women with biopsy-confirmed HER2-positive metastatic breast cancer and no anti-HER2 therapy for 4 mo or longer underwent complete staging, including (18)F-FDG PET/CT. For 6 of the 8 patients, (64)Cu-DOTA-trastuzumab injection (364-512 MBq, 5 mg of trastuzumab) was preceded by trastuzumab infusion (45 mg). PET/CT (PET scan duration 1 h) was performed 21-25 (day 1) and 47-49 (day 2) h after (64)Cu-DOTA-trastuzumab injection. Scan fields of view were chosen on the basis of (18)F-FDG PET/CT. Tumor detection sensitivity and uptake analyses were limited to lesions identifiable on CT; lesions visualized relative to adjacent tissue on PET were considered PET-positive. Radiolabel uptake in prominent lesions was measured as maximum single-voxel standardized uptake value (SUVmax). Liver uptake of (64)Cu was reduced approximately 75% with the 45-mg trastuzumab predose, without significant effect on tumor uptake. The study included 89 CT-positive lesions. Detection sensitivity was 77%, 89%, and 93% for day 1, day 2, and (18)F-FDG, respectively. On average, tumor uptake was similar for (64)Cu-DOTA-trastuzumab and (18)F-FDG (SUVmax and range, 8.1 and 3.0-22.5 for day 1 [n = 48]; 8.9 and 0.9-28.9 for day 2 [n = 38]; 9.7 and 3.3-25.4 for (18)F-FDG [n = 56]), but same-lesion SUVmax was not correlated

  9. Lipid-Lowering Pharmaceutical Clofibrate Inhibits Human Sweet Taste

    Science.gov (United States)

    Kochem, Matthew

    2017-01-01

    T1R2-T1R3 is a heteromeric receptor that binds sugars, high potency sweeteners, and sweet taste blockers. In rodents, T1R2-T1R3 is largely responsible for transducing sweet taste perception. T1R2-T1R3 is also expressed in non-taste tissues, and a growing body of evidence suggests that it helps regulate glucose and lipid metabolism. It was previously shown that clofibric acid, a blood lipid-lowering drug, binds T1R2-T1R3 and inhibits its activity in vitro. The purpose of this study was to determine whether clofibric acid inhibits sweetness perception in humans and is, therefore, a T1R2-T1R3 antagonist in vivo. Fourteen participants rated the sweetness intensity of 4 sweeteners (sucrose, sucralose, Na cyclamate, acesulfame K) across a broad range of concentrations. Each sweetener was prepared in solution neat and in mixture with either clofibric acid or lactisole. Clofibric acid inhibited sweetness of every sweetener. Consistent with competitive binding, inhibition by clofibric acid was diminished with increasing sweetener concentration. This study provides in vivo evidence that the lipid-lowering drug clofibric acid inhibits sweetness perception and is, therefore, a T1R carbohydrate receptor inhibitor. Our results are consistent with previous in vitro findings. Given that T1R2-T1R3 may in part regulate glucose and lipid metabolism, future studies should investigate the metabolic effects of T1R inhibition. PMID:27742692

  10. Antisense imaging of epidermal growth factor-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 human breast cancer xenografts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)

    2003-09-01

    Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor

  11. Isolation of a human anti-epidermal growth factor receptor Fab antibody, EG-19-11, with subnanomolar affinity from naïve immunoglobulin repertoires using a hierarchical antibody library system.

    Science.gov (United States)

    Hur, Byung-ung; Yoon, Jae-bong; Liu, Li-Kun; Cha, Sang-hoon

    2010-11-30

    Specific antibodies that possess a subnanomolar affinity are very difficult to obtain from human naïve immunoglobulin repertoires without the use of lengthy affinity optimization procedures. Here, we designed a hierarchical phage-displayed antibody library system to generate an enormous diversity of combinatorial Fab fragments (6×10(17)) and attempted to isolate high-affinity Fabs against the human epidermal growth factor receptor (EGFR). A primary antibody library, designated HuDVFab-8L, comprising 4.5×10(9) human naïve heavy chains and eight unspecified human naïve light chains was selected against the EGFR-Fc protein by biopanning, and four anti-EGFR Fab clones were isolated. Because one of the Fab clones, denoted EG-L2-11, recognized a native EGFR expressed on A431 cells, the heavy chain of the Fab was shuffled with a human naïve light chain repertoire with a diversity of 1.4×10(8) and selected a second time against the EGFR-Fc protein again. One EG-L2-11 variant, denoted EG-19-11, recognized an EGFR epitope that was almost the same as that bound by cetuximab and had a K(D) of approximately 540 pM for soluble EGFR, which is about 7-fold higher than that of the FabC225 derived from cetuximab. This variant was also internalized by A431 cells, likely via receptor-mediated endocytosis, and it efficiently inhibited EGF-mediated tyrosine phosphorylation of the EGFR. These results demonstrate that the use of our hierarchical antibody library system is advantageous in generating fully human antibodies especially with a therapeutic purpose. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Physiological markers of motor inhibition during human behavior

    Science.gov (United States)

    Duque, Julie; Greenhouse, Ian; Labruna, Ludovica; Ivry, Richard B.

    2017-01-01

    Transcranial magnetic stimulation (TMS) studies in humans have shown that many behaviors engage processes that suppress excitability within the corticospinal tract. Inhibition of the motor output pathway has been extensively studied in the context of action stopping, where a planned movement needs to be abruptly aborted. Recent TMS work has also revealed markers of motor inhibition during the preparation of movement. Here, we review the evidence for motor inhibition during action stopping and action preparation, focusing on studies that have used TMS to monitor changes in the excitability of the corticospinal pathway. We discuss how these physiological results have motivated theoretical models of how the brain selects actions, regulates movement initiation and execution, and switches from one state to another. PMID:28341235

  13. Early events elicited by Bombesin and structurally related peptides in quiescent Swiss 3T3 cells. I. Activation of protein kinase C and inhibition of epidermal growth factor binding

    International Nuclear Information System (INIS)

    Zachary, I.; Sinnett-Smith, J.W.; Rozengurt, E.

    1986-01-01

    Addition of bombesin to quiescent cultures of Swiss 3T3 cells caused a rapid increase in the phosphorylation of an M/sub r/ 80,000 cellular protein (designated 80k). The effect was both concentration and time dependent. The 80k phosphoproteins generated in response to bombesin and to phorbol 12,13-dibutyrate were identical as judged by one- and two-dimensional PAGE and by peptide mapping after partial proteolysis with Staphylococcus aureus V8 protease. In addition, prolonged pretreatment of 3T3 cells with phorbol 12,13-dibutyrate, which leads to the disappearance of protein kinase C activity, blocked the ability of bombesin to stimulate 80k. Bombesin also caused a rapid (1 min) inhibition of 125 I-labeled epidermal growth factor ( 125 I-EGF) binding to Swiss 3T3 cells. The inhibition was both concentration and temperature dependent and resulted from a marked decrease in the affinity of the EGF receptor for its ligand. These results strongly suggest that these responses are mediated by specific high-affinity receptors that recognize the peptides of the bombesin family in Swiss 3T3 cells. While an increase in cytosolic Ca 2+ concentration does not mediate the bombesin inhibition of 125 I-EGF binding, the activation of protein kinase C in intact Swiss 3T3 cells by peptides of the bombesin family may lead to rapid inhibition of the binding of 125 I-EGF to its cellular receptor

  14. Metformin and Its Sulfenamide Prodrugs Inhibit Human Cholinesterase Activity

    Directory of Open Access Journals (Sweden)

    Magdalena Markowicz-Piasecka

    2017-01-01

    Full Text Available The results of epidemiological and pathophysiological studies suggest that type 2 diabetes mellitus (T2DM may predispose to Alzheimer’s disease (AD. The two conditions present similar glucose levels, insulin resistance, and biochemical etiologies such as inflammation and oxidative stress. The diabetic state also contributes to increased acetylcholinesterase (AChE activity, which is one of the factors leading to neurodegeneration in AD. The aim of this study was to assess in vitro the effects of metformin, phenformin, and metformin sulfenamide prodrugs on the activity of human AChE and butyrylcholinesterase (BuChE and establish the type of inhibition. Metformin inhibited 50% of the AChE activity at micromolar concentrations (2.35 μmol/mL, mixed type of inhibition and seemed to be selective towards AChE since it presented low anti-BuChE activity. The tested metformin prodrugs inhibited cholinesterases (ChE at nanomolar range and thus were more active than metformin or phenformin. The cyclohexyl sulfenamide prodrug demonstrated the highest activity towards both AChE (IC50 = 890 nmol/mL, noncompetitive inhibition and BuChE (IC50 = 28 nmol/mL, mixed type inhibition, while the octyl sulfenamide prodrug did not present anti-AChE activity, but exhibited mixed inhibition towards BuChE (IC50 = 184 nmol/mL. Therefore, these two bulkier prodrugs were concluded to be the most selective compounds for BuChE over AChE. In conclusion, it was demonstrated that biguanides present a novel class of inhibitors for AChE and BuChE and encourages further studies of these compounds for developing both selective and nonselective inhibitors of ChEs in the future.

  15. Inhibition of autophagy induced by proteasome inhibition increases cell death in human SHG-44 glioma cells.

    Science.gov (United States)

    Ge, Peng-Fei; Zhang, Ji-Zhou; Wang, Xiao-Fei; Meng, Fan-Kai; Li, Wen-Chen; Luan, Yong-Xin; Ling, Feng; Luo, Yi-Nan

    2009-07-01

    The ubiquitin-proteasome system (UPS) and lysosome-dependent macroautophagy (autophagy) are two major intracellular pathways for protein degradation. Recent studies suggest that proteasome inhibitors may reduce tumor growth and activate autophagy. Due to the dual roles of autophagy in tumor cell survival and death, the effect of autophagy on the destiny of glioma cells remains unclear. In this study, we sought to investigate whether inhibition of the proteasome can induce autophagy and the effects of autophagy on the fate of human SHG-44 glioma cells. The proteasome inhibitor MG-132 was used to induce autophagy in SHG-44 glioma cells, and the effect of autophagy on the survival of SHG-44 glioma cells was investigated using an autophagy inhibitor 3-MA. Cell viability was measured by MTT assay. Apoptosis and cell cycle were detected by flow cytometry. The expression of autophagy related proteins was determined by Western blot. MG-132 inhibited cell proliferation, induced cell death and cell cycle arrest at G(2)/M phase, and activated autophagy in SHG-44 glioma cells. The expression of autophagy-related Beclin-1 and LC3-I was significantly up-regulated and part of LC3-I was converted into LC3-II. However, when SHG-44 glioma cells were co-treated with MG-132 and 3-MA, the cells became less viable, but cell death and cell numbers at G(2)/M phase increased. Moreover, the accumulation of acidic vesicular organelles was decreased, the expression of Beclin-1 and LC3 was significantly down-regulated and the conversion of LC3-II from LC3-I was also inhibited. Inhibition of the proteasome can induce autophagy in human SHG-44 glioma cells, and inhibition of autophagy increases cell death. This discovery may shed new light on the effect of autophagy on modulating the fate of SHG-44 glioma cells.Acta Pharmacologica Sinica (2009) 30: 1046-1052; doi: 10.1038/aps.2009.71.

  16. IL-17 inhibits chondrogenic differentiation of human mesenchymal stem cells.

    Directory of Open Access Journals (Sweden)

    Masahiro Kondo

    Full Text Available OBJECTIVE: Mesenchymal stem cells (MSCs can differentiate into cells of mesenchymal lineages, such as osteoblasts and chondrocytes. Here we investigated the effects of IL-17, a key cytokine in chronic inflammation, on chondrogenic differentiation of human MSCs. METHODS: Human bone marrow MSCs were pellet cultured in chondrogenic induction medium containing TGF-β3. Chondrogenic differentiation was detected by cartilage matrix accumulation and chondrogenic marker gene expression. RESULTS: Over-expression of cartilage matrix and chondrogenic marker genes was noted in chondrogenic cultures, but was inhibited by IL-17 in a dose-dependent manner. Expression and phosphorylation of SOX9, the master transcription factor for chondrogenesis, were induced within 2 days and phosphorylated SOX9 was stably maintained until day 21. IL-17 did not alter total SOX9 expression, but significantly suppressed SOX9 phosphorylation in a dose-dependent manner. At day 7, IL-17 also suppressed the activity of cAMP-dependent protein kinase A (PKA, which is known to phosphorylate SOX9. H89, a selective PKA inhibitor, also suppressed SOX9 phosphorylation, expression of chondrogenic markers and cartilage matrix, and also decreased chondrogenesis. CONCLUSIONS: IL-17 inhibited chondrogenesis of human MSCs through the suppression of PKA activity and SOX9 phosphorylation. These results suggest that chondrogenic differentiation of MSCs can be inhibited by a mechanism triggered by IL-17 under chronic inflammation.

  17. Structure and function of the Juxta membrane domain of the human epidermal growth factor receptor by NMR spectroscopy

    International Nuclear Information System (INIS)

    Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.

    2005-10-01

    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor

  18. The biological activity of the human epidermal growth factor receptor is positively regulated by its C-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Velu, T; Martin, P

    1991-01-01

    mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...

  19. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  20. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    International Nuclear Information System (INIS)

    Gradishar, William J

    2016-01-01

    Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed

  1. Establishment and characterization of a new cell line, FPS-1, derived from human undifferentiated pleomorphic sarcoma, overexpressing epidermal growth factor receptor and cyclooxygenase-2.

    Science.gov (United States)

    Hakozaki, Michiyuki; Hojo, Hiroshi; Sato, Michiko; Tajino, Takahiro; Yamada, Hitoshi; Kikuchi, Shinichi; Abe, Masafumi

    2006-01-01

    Undifferentiated pleomorphic sarcoma (UPS) is among the most common soft tissue sarcomas in adults. In order to improve its aggressive course or prognosis and establish new therapeutic methods, molecular genetic and biological characterizations of UPS are required. A new human UPS cell line (FPS-1) was established from UPS of the upper arm of a 79-year-old man. The cell line has been maintained for over 14 months with more than 60 passages. FPS-1 cells were characterized using molecular biological methods. FPS-1 cells showed the same morphological and immunophenotypical characteristics as the primary tumor. Cytogenetic and molecular analyses revealed a nonsense mutation in exon 6 of the p53 gene. Epidermal growth factor receptor (EGFR) and cyclooxygenase-2 (COX-2) were expressed in FPS-1 cells. FPS-1 cells might be useful for investigating biological behavior and developing new molecular targeting antitumor drugs for UPS with EGFR or COX-2 expression.

  2. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    International Nuclear Information System (INIS)

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.

    2007-01-01

    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile

  3. Trastuzumab beyond progression in human epidermal growth factor receptor 2-positive advanced breast cancer: a german breast group 26/breast international group 03-05 study

    DEFF Research Database (Denmark)

    von Minckwitz, Gunter; du Bois, Andreas; Schmidt, Marcus

    2009-01-01

    PURPOSE: Trastuzumab shows clinical activity in human epidermal growth factor receptor 2 (HER-2)-positive early and advanced breast cancer. In the German Breast Group 26/Breast International Group 03-05 trial, we investigated if trastuzumab treatment should be continued beyond progression. METHODS......: Patients with HER-2-positive breast cancer that progresses during treatment with trastuzumab were randomly assigned to receive capecitabine (2,500 mg/m(2) body-surface area on days 1 through 14 [1,250 mg/m(2) semi-daily]) alone or with continuation of trastuzumab (6 mg/kg body weight) in 3-week cycles....... The primary end point was time to progression. RESULTS: We randomly assigned 78 patients to capecitabine and 78 patients to capecitabine plus trastuzumab. Sixty-five events and 38 deaths in the capecitabine group and 62 events and 33 deaths in the capecitabine-plus-trastuzumab group occurred during 15...

  4. Prognostic significance of equivocal human epidermal growth factor receptor 2 results and clinical utility of alternative chromosome 17 genes in patients with invasive breast cancer: A cohort study.

    Science.gov (United States)

    Sneige, Nour; Hess, Kenneth R; Multani, Asha S; Gong, Yun; Ibrahim, Nuhad K

    2017-04-01

    The 2013 testing guidelines for determining the human epidermal growth factor receptor 2 (HER2) status include new cutoff points for the HER2/chromosome enumeration probe 17 (CEP17) ratio and the average HER2 copy number per cell, and they recommend using a reflex test with alternative chromosome 17 probes (Ch17Ps) to resolve equivocal HER2 results. This study sought to determine the clinical utility of alternative Ch17Ps in equivocal cases and the effects of equivocal results and/or a change in the HER2 status on patients' outcomes. The University of Texas MD Anderson Cancer Center database of HER2 dual-probe fluorescence in situ hybridization results from 2000 to 2010 was searched for cases of invasive breast cancer with HER2/CEP17 ratios Cancer 2017;123:1115-1123. © 2016 American Cancer Society. © 2016 American Cancer Society.

  5. Vaccination targeting human HER3 alters the phenotype of infiltrating T cells and responses to immune checkpoint inhibition.

    Science.gov (United States)

    Osada, Takuya; Morse, Michael A; Hobeika, Amy; Diniz, Marcio A; Gwin, William R; Hartman, Zachary; Wei, Junping; Guo, Hongtao; Yang, Xiao-Yi; Liu, Cong-Xiao; Kaneko, Kensuke; Broadwater, Gloria; Lyerly, H Kim

    2017-01-01

    Expression of human epidermal growth factor family member 3 (HER3), a critical heterodimerization partner with EGFR and HER2, promotes more aggressive biology in breast and other epithelial malignancies. As such, inhibiting HER3 could have broad applicability to the treatment of EGFR- and HER2-driven tumors. Although lack of a functional kinase domain limits the use of receptor tyrosine kinase inhibitors, HER3 contains antigenic targets for T cells and antibodies. Using novel human HER3 transgenic mouse models of breast cancer, we demonstrate that immunization with recombinant adenoviral vectors encoding full length human HER3 (Ad-HER3-FL) induces HER3-specific T cells and antibodies, alters the T cell infiltrate in tumors, and influences responses to immune checkpoint inhibitions. Both preventative and therapeutic Ad-HER3-FL immunization delayed tumor growth but were associated with both intratumoral PD-1 expressing CD8 + T cells and regulatory CD4 + T cell infiltrates. Immune checkpoint inhibition with either anti-PD-1 or anti-PD-L1 antibodies increased intratumoral CD8 + T cell infiltration and eliminated tumor following preventive vaccination with Ad-HER3-FL vaccine. The combination of dual PD-1/PD-L1 and CTLA4 blockade slowed the growth of tumor in response to Ad-HER3-FL in the therapeutic model. We conclude that HER3-targeting vaccines activate HER3-specific T cells and induce anti-HER3 specific antibodies, which alters the intratumoral T cell infiltrate and responses to immune checkpoint inhibition.

  6. Human erythrocytes inhibit complement-mediated solubilization of immune complexes by human serum

    International Nuclear Information System (INIS)

    Dorval, B.L.

    1987-01-01

    The aim of this study was to develop an autologus human system to evaluate the effects of human erythrocytes on solubilization of immune complex precipitates (IC) by human serum. Incubation of IC with fresh human serum or guinea pig serum resulted in solubilization of IC. When packed erythrocytes were added to human serum or guinea pig serum binding of IC to the erythrocyte occurred and IC solubilization was inhibited significantly (p <.025). Sheep erythrocytes did not bind IC or inhibit IC solubilization. To evaluate the role of human erythrocyte complement receptor (CR1) on these findings, human erythrocytes were treated with trypsin or anti-CR1 antibodies. Both treatments abrogated IC binding to human erythrocytes but did not affect the ability of the human erythrocyte to inhibit IC solubilization. Radioimmunoassay was used to measure C3, C4 and C5 activation in human serum after incubation with IC, human erythrocytes, human erythrocytes plus IC, whole blood or in whole blood plus IC

  7. Inhibition of endogenous lactate turnover with lactate infusion in humans

    International Nuclear Information System (INIS)

    Searle, G.L.; Feingold, K.R.; Hsu, F.S.; Clark, O.H.; Gertz, E.W.; Stanley, W.C.

    1989-01-01

    The extent to which lactate infusion may inhibit endogenous lactate production, though previously considered, has never been critically assessed. To examine this proposition, single injection tracer methodology (U- 14 C Lactate) has been used for the estimation of lactate kinetics in 12 human subjects under basal conditions and with the infusion of sodium lactate. The basal rate of lactate turnover was measured on a day before the study with lactate infusion, and averaged 63.7 + 5.5 mg/kg/h. Six of these individuals received a stable lactate infusion at an approximate rate of 160 mg/kg/h, while the remaining six individuals were infused at the approximate rate of 100 mg/kg/h. It has been found that stable lactate infused at rates approximating 160 mg/kg/h consistently produced a complete inhibition of endogenous lactate production. Infusion of lactate at 100 mg/kg/h caused a lesser and more variable inhibition of endogenous lactate production (12% to 64%). In conclusion, lactate infusion significantly inhibits endogenous lactate production

  8. Recombinant human prion protein inhibits prion propagation in vitro.

    Science.gov (United States)

    Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan

    2013-10-09

    Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.

  9. Inhibition of fatty acid metabolism reduces human myeloma cells proliferation.

    Directory of Open Access Journals (Sweden)

    José Manuel Tirado-Vélez

    Full Text Available Multiple myeloma is a haematological malignancy characterized by the clonal proliferation of plasma cells. It has been proposed that targeting cancer cell metabolism would provide a new selective anticancer therapeutic strategy. In this work, we tested the hypothesis that inhibition of β-oxidation and de novo fatty acid synthesis would reduce cell proliferation in human myeloma cells. We evaluated the effect of etomoxir and orlistat on fatty acid metabolism, glucose metabolism, cell cycle distribution, proliferation, cell death and expression of G1/S phase regulatory proteins in myeloma cells. Etomoxir and orlistat inhibited β-oxidation and de novo fatty acid synthesis respectively in myeloma cells, without altering significantly glucose metabolism. These effects were associated with reduced cell viability and cell cycle arrest in G0/G1. Specifically, etomoxir and orlistat reduced by 40-70% myeloma cells proliferation. The combination of etomoxir and orlistat resulted in an additive inhibitory effect on cell proliferation. Orlistat induced apoptosis and sensitized RPMI-8226 cells to apoptosis induction by bortezomib, whereas apoptosis was not altered by etomoxir. Finally, the inhibitory effect of both drugs on cell proliferation was associated with reduced p21 protein levels and phosphorylation levels of retinoblastoma protein. In conclusion, inhibition of fatty acid metabolism represents a potential therapeutic approach to treat human multiple myeloma.

  10. Gemcitabine Plus Docetaxel Versus Docetaxel in Patients With Predominantly Human Epidermal Growth Factor Receptor 2-Negative Locally Advanced or Metastatic Breast Cancer: A Randomized, Phase III Study by the Danish Breast Cancer Cooperative Group

    DEFF Research Database (Denmark)

    Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H

    2011-01-01

    PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned...

  11. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  12. ITE inhibits growth of human pulmonary artery endothelial cells.

    Science.gov (United States)

    Pang, Ling-Pin; Li, Yan; Zou, Qing-Yun; Zhou, Chi; Lei, Wei; Zheng, Jing; Huang, Shi-An

    2017-10-01

    Pulmonary arterial hypertension (PAH), a deadly disorder is associated with excessive growth of human pulmonary artery endothelial (HPAECs) and smooth muscle (HPASMCs) cells. Current therapies primarily aim at promoting vasodilation, which only ameliorates clinical symptoms without a cure. 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE) is an endogenous aryl hydrocarbon receptor (AhR) ligand, and mediates many cellular function including cell growth. However, the roles of ITE in human lung endothelial cells remain elusive. Herein, we tested a hypothesis that ITE inhibits growth of human pulmonary artery endothelial cells via AhR. Immunohistochemistry was performed to localize AhR expression in human lung tissues. The crystal violet method and MTT assay were used to determine ITE's effects on growth of HPAECs. The AhR activation in HPAECs was confirmed using Western blotting and RT-qPCR. The role of AhR in ITE-affected proliferation of HPAECs was assessed using siRNA knockdown method followed by the crystal violet method. Immunohistochemistry revealed that AhR was present in human lung tissues, primarily in endothelial and smooth muscle cells of pulmonary veins and arteries, as well as in bronchial and alveolar sac epithelia. We also found that ITE dose- and time-dependently inhibited proliferation of HPAECs with a maximum inhibition of 83% at 20 µM after 6 days of treatment. ITE rapidly decreased AhR protein levels, while it increased mRNA levels of cytochrome P450 (CYP), family 1, member A1 (CYP1A1) and B1 (CYP1B1), indicating activation of the AhR/CYP1A1 and AhR/CYP1B1 pathways in HPAECs. The AhR siRNA significantly suppressed AhR protein expression, whereas it did not significantly alter ITE-inhibited growth of HPAECs. ITE suppresses growth of HPAECs independent of AhR, suggesting that ITE may play an important role in preventing excessive growth of lung endothelial cells.

  13. Naloxone inhibits superoxide but not enzyme release by human neutrophils

    Energy Technology Data Exchange (ETDEWEB)

    Simpkins, C.; Alailima, S.; Tate, E.

    1986-03-01

    The release of toxic oxygen metabolites and enzymes by phagocytic cells is thought to play a role in the multisystemic tissue injury of sepsis. Naloxone protects septic animals. We have found that at concentrations administered to animals (10/sup -7/ to 10/sup -4/M), naloxone inhibited (p < .001) the release of superoxide (O/sub 2//sup -/) by human neutrophils (HN), stimulated with N-formyl methionyl leucyl phenylalanine (FMLP). Naloxone had no effect on cell viability. Maximum inhibition was 65% of the total O/sub 2//sup -/ released (13.1 nMoles/8 min/320,000 cells). FMLP-stimulated release of beta-glucoronidase or lysozyme was not altered by naloxone. Naloxone had no effect on the binding of /sup 3/H FMLP to HN. Using /sup 3/H naloxone and various concentrations of unlabeled naloxone higher affinity (K/sub D/ = 12nM) and lower affinity (K/sub D/ = 4.7 x 10/sup -5/) binding sites were detected. The K/sub D/ of the low affinity site corresponded to the ED/sub 50/ for naloxone inhibition of O/sub 2//sup -/ (1 x 10/sup -5/M). Binding to this low affinity site was decreased by (+) naloxone, beta-endorphin and N acetyl beta-endorphin, but not by leu-enkephalin, thyrotropin releasing factor, prostaglandin D/sub 2/ or E/sub 2/. Conclusions: (1) naloxone inhibits FMLP-stimulated O/sub 2/ but not enzyme release, (2) this inhibition is not due to alteration of FMLP receptor binding, (3) naloxone may act via a low affinity binding site which is ligand specific, and (4) a higher affinity receptor is present on HN.

  14. Naloxone inhibits superoxide but not enzyme release by human neutrophils

    International Nuclear Information System (INIS)

    Simpkins, C.; Alailima, S.; Tate, E.

    1986-01-01

    The release of toxic oxygen metabolites and enzymes by phagocytic cells is thought to play a role in the multisystemic tissue injury of sepsis. Naloxone protects septic animals. We have found that at concentrations administered to animals (10 -7 to 10 -4 M), naloxone inhibited (p 2 - ) by human neutrophils (HN), stimulated with N-formyl methionyl leucyl phenylalanine (FMLP). Naloxone had no effect on cell viability. Maximum inhibition was 65% of the total O 2 - released (13.1 nMoles/8 min/320,000 cells). FMLP-stimulated release of beta-glucoronidase or lysozyme was not altered by naloxone. Naloxone had no effect on the binding of 3 H FMLP to HN. Using 3 H naloxone and various concentrations of unlabeled naloxone higher affinity (K/sub D/ = 12nM) and lower affinity (K/sub D/ = 4.7 x 10 -5 ) binding sites were detected. The K/sub D/ of the low affinity site corresponded to the ED 50 for naloxone inhibition of O 2 - (1 x 10 -5 M). Binding to this low affinity site was decreased by (+) naloxone, beta-endorphin and N acetyl beta-endorphin, but not by leu-enkephalin, thyrotropin releasing factor, prostaglandin D 2 or E 2 . Conclusions: (1) naloxone inhibits FMLP-stimulated O 2 but not enzyme release, (2) this inhibition is not due to alteration of FMLP receptor binding, (3) naloxone may act via a low affinity binding site which is ligand specific, and (4) a higher affinity receptor is present on HN

  15. Herceptin Enhances the Antitumor Effect of Natural Killer Cells on Breast Cancer Cells Expressing Human Epidermal Growth Factor Receptor-2

    Directory of Open Access Journals (Sweden)

    Xiao Tian

    2017-10-01

    Full Text Available Optimal adoptive cell therapy (ACT should contribute to effective cancer treatment. The unique ability of natural killer (NK cells to kill cancer cells independent of major histocompatibility requirement makes them suitable as ACT tools. Herceptin, an antihuman epidermal growth factor receptor-2 (anti-HER2 monoclonal antibody, is used to treat HER2+ breast cancer. However, it has limited effectiveness and possible severe cardiotoxicity. Given that Herceptin may increase the cytotoxicity of lymphocytes, we explored the possible augmentation of NK cell cytotoxicity against HER2+ breast cancer cells by Herceptin. We demonstrated that Herceptin could interact with CD16 on NK cells to expand the cytotoxic NK (specifically, CD56dim cell population. Additionally, Herceptin increased NK cell migration and cytotoxicity against HER2+ breast cancer cells. In a pilot study, Herceptin-treated NK cells shrunk lung nodular metastasis in a woman with HER2+ breast cancer who could not tolerate the cardiotoxic side effects of Herceptin. Our findings support the therapeutic potential of Herceptin-treated NK cells in patients with HER2+ and Herceptin-intolerant breast cancer.

  16. Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

    Science.gov (United States)

    Rastogi, Anshu; Pospísil, Pavel

    2010-08-01

    All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

  17. Human mesenchymal stem cells inhibit osteoclastogenesis through osteoprotegerin production.

    Science.gov (United States)

    Oshita, Koichi; Yamaoka, Kunihiro; Udagawa, Nobuyuki; Fukuyo, Shunsuke; Sonomoto, Koshiro; Maeshima, Keisuke; Kurihara, Ryuji; Nakano, Kazuhisa; Saito, Kazuyoshi; Okada, Yosuke; Chiba, Kenji; Tanaka, Yoshiya

    2011-06-01

    Mesenchymal stem cells (MSCs) have been proposed to be a useful tool for treatment of rheumatoid arthritis (RA), not only because of their multipotency but also because of their immunosuppressive effect on lymphocytes, dendritic cells, and other proinflammatory cells. Since bone destruction caused by activated osteoclasts occurs in RA, we undertook the present study to investigate the effect of MSCs on osteoclast function and differentiation in order to evaluate their potential use in RA therapy. Human MSCs and peripheral blood mononuclear cells were cultured under cell-cell contact-free conditions with osteoclast induction medium. Differentiation into osteoclast-like cells was determined by tartrate-resistant acid phosphatase staining and expression of osteoclast differentiation markers. The number of osteoclast-like cells was decreased and expression of cathepsin K and nuclear factor of activated T cells c1 (NF-ATc1) was down-regulated by the addition of either MSCs or a conditioned medium obtained from MSCs. Osteoprotegerin (OPG) was constitutively produced by MSCs and inhibited osteoclastogenesis. However, osteoclast differentiation was not fully recovered upon treatment with either anti-OPG antibody or OPG small interfering RNA, suggesting that OPG had only a partial role in the inhibitory effect of MSCs. Moreover, bone-resorbing activity of osteoclast-like cells was partially recovered by addition of anti-OPG antibody into the conditioned medium. The present results indicate that human MSCs constitutively produce OPG, resulting in inhibition of osteoclastogenesis and expression of NF-ATc1 and cathepsin K in the absence of cell-cell contact. Therefore, we conclude that human MSCs exert a suppressive effect on osteoclastogenesis, which may be beneficial in inhibition of joint damage in RA. Copyright © 2011 by the American College of Rheumatology.

  18. EGFR-inhibition enhances apoptosis in irradiated human head and neck xenograft tumors independent of effects on DNA repair

    NARCIS (Netherlands)

    Stegeman, H.; Span, P.N.; Cockx, S.C.; Peters, J.P.W.; Rijken, P.F.J.W.; Kogel, A.J. van der; Kaanders, J.H.A.M.; Bussink, J.

    2013-01-01

    Epidermal growth factor receptor (EGFR) inhibition using cetuximab improves the efficacy of radiotherapy in only a subgroup of head and neck squamous cell carcinoma (HNSCC) patients. Therefore, to improve patient selection a better understanding of tumor characteristics that affect treatment is

  19. Human Diversity in a Cell Surface Receptor that Inhibits Autophagy.

    Science.gov (United States)

    Chaudhary, Anu; Leite, Mara; Kulasekara, Bridget R; Altura, Melissa A; Ogahara, Cassandra; Weiss, Eli; Fu, Wenqing; Blanc, Marie-Pierre; O'Keeffe, Michael; Terhorst, Cox; Akey, Joshua M; Miller, Samuel I

    2016-07-25

    Mutations in genes encoding autophagy proteins have been associated with human autoimmune diseases, suggesting that diversity in autophagy responses could be associated with disease susceptibility or severity. A cellular genome-wide association study (GWAS) screen was performed to explore normal human diversity in responses to rapamycin, a microbial product that induces autophagy. Cells from several human populations demonstrated variability in expression of a cell surface receptor, CD244 (SlamF4, 2B4), that correlated with changes in rapamycin-induced autophagy. High expression of CD244 and receptor activation with its endogenous ligand CD48 inhibited starvation- and rapamycin-induced autophagy by promoting association of CD244 with the autophagy complex proteins Vps34 and Beclin-1. The association of CD244 with this complex reduced Vps34 lipid kinase activity. Lack of CD244 is associated with auto-antibody production in mice, and lower expression of human CD244 has previously been implicated in severity of human rheumatoid arthritis and systemic lupus erythematosus, indicating that increased autophagy as a result of low levels of CD244 may alter disease outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Apple juice inhibits human low density lipoprotein oxidation.

    Science.gov (United States)

    Pearson, D A; Tan, C H; German, J B; Davis, P A; Gershwin, M E

    1999-01-01

    Dietary phenolic compounds, ubiquitous in vegetables and fruits and their juices possess antioxidant activity that may have beneficial effects on human health. The phenolic composition of six commercial apple juices, and of the peel (RP), flesh (RF) and whole fresh Red Delicious apples (RW), was determined by high performance liquid chromatography (HPLC), and total phenols were determined by the Folin-Ciocalteau method. HPLC analysis identified and quantified several classes of phenolic compounds: cinnamates, anthocyanins, flavan-3-ols and flavonols. Phloridzin and hydroxy methyl furfural were also identified. The profile of phenolic compounds varied among the juices. The range of concentrations as a percentage of total phenolic concentration was: hydroxy methyl furfural, 4-30%; phloridzin, 22-36%; cinnamates, 25-36%; anthocyanins, n.d.; flavan-3-ols, 8-27%; flavonols, 2-10%. The phenolic profile of the Red Delicious apple extracts differed from those of the juices. The range of concentrations of phenolic classes in fresh apple extracts was: hydroxy methyl furfural, n.d.; phloridzin, 11-17%; cinnamates, 3-27%; anthocyanins, n.d.-42%; flavan-3-ols, 31-54%; flavonols, 1-10%. The ability of compounds in apple juices and extracts from fresh apple to protect LDL was assessed using an in vitro copper catalyzed human LDL oxidation system. The extent of LDL oxidation was determined as hexanal production using static headspace gas chromatography. The apple juices and extracts, tested at 5 microM gallic acid equivalents (GAE), all inhibited LDL oxidation. The inhibition by the juices ranged from 9 to 34%, and inhibition by RF, RW and RP was 21, 34 and 38%, respectively. Regression analyses revealed no significant correlation between antioxidant activity and either total phenolic concentration or any specific class of phenolics. Although the specific components in the apple juices and extracts that contributed to antioxidant activity have yet to be identified, this study

  1. Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Lei [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Xiao, Yongsheng [Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States); Wang, Yinsheng, E-mail: yinsheng.wang@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States)

    2014-05-15

    Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA

  2. Acute inhibition of iron bioavailability by zinc: studies in humans.

    Science.gov (United States)

    Olivares, Manuel; Pizarro, Fernando; Ruz, Manuel; de Romaña, Daniel López

    2012-08-01

    Iron (Fe) and zinc (Zn) deficiencies constitute two of the most important nutritional and public health problems affecting developing countries. Combined supplementation or fortification with Zn and Fe are strategies that can be used to improve the Zn and Fe status of a population. However, there is concern about potential negative interactions between these two micronutrients due to a competitive binding to DMT1 and Zip14 transporter. Studies performed in humans have shown an inhibitory effect of Zn on Fe absorption when both minerals are given together as a solution in fasting conditions. We found that at low doses of iron (0.5 mg) the threshold for the inhibition of iron bioavailability was at a Zn:Fe wt/wt ratio ≥5.9:1, whereas at higher doses of Fe (10 mg) this inhibition occurred at 1:1 Zn:Fe wt/wt ratio. This differential response could be explained by the variation in the abundance of both cations as they compete for a limited number of shared transporters at the enterocyte. Conflicting results have been obtained when this interaction was studied in different food matrices. A negative interaction was not observed when Fe and Zn were provided in a composite hamburger meal, premature formula, human milk, or cow milk. A decrease on Fe absorption was observed in only 1 of 3 studies when Fe and Zn were supplied in wheat flour. The possibility of a negative interaction should be considered for supplementation or fortification programs with both microminerals.

  3. Aliphatic alcohols in spirits inhibit phagocytosis by human monocytes.

    Science.gov (United States)

    Pál, László; Árnyas, Ervin M; Bujdosó, Orsolya; Baranyi, Gergő; Rácz, Gábor; Ádány, Róza; McKee, Martin; Szűcs, Sándor

    2015-04-01

    A large volume of alcoholic beverages containing aliphatic alcohols is consumed worldwide. Previous studies have confirmed the presence of ethanol-induced immunosuppression in heavy drinkers, thereby increasing susceptibility to infectious diseases. However, the aliphatic alcohols contained in alcoholic beverages might also impair immune cell function, thereby contributing to a further decrease in microbicidal activity. Previous research has shown that aliphatic alcohols inhibit phagocytosis by granulocytes but their effect on human monocytes has not been studied. This is important as they play a crucial role in engulfment and killing of pathogenic microorganisms and a decrease in their phagocytic activity could lead to impaired antimicrobial defence in heavy drinkers. The aim of this study was to measure monocyte phagocytosis following their treatment with those aliphatic alcohols detected in alcoholic beverages. Monocytes were separated from human peripheral blood and phagocytosis of opsonized zymosan particles by monocytes treated with ethanol and aliphatic alcohols individually and in combination was determined. It was shown that these alcohols could suppress the phagocytic activity of monocytes in a concentration-dependent manner and when combined with ethanol, they caused a further decrease in phagocytosis. Due to their additive effects, it is possible that they may inhibit phagocytosis in a clinically meaningful way in alcoholics and episodic heavy drinkers thereby contribute to their increased susceptibility to infectious diseases. However, further research is needed to address this question.

  4. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    International Nuclear Information System (INIS)

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K.

    1990-01-01

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling

  5. Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando

    1999-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

  6. Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu

    1999-04-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

  7. Inhibition of canonical WNT signaling attenuates human leiomyoma cell growth

    Science.gov (United States)

    Ono, Masanori; Yin, Ping; Navarro, Antonia; Moravek, Molly B.; Coon, John S.; Druschitz, Stacy A.; Gottardi, Cara J.; Bulun, Serdar E.

    2014-01-01

    Objective Dysregulation of WNT signaling plays a central role in tumor cell growth and progression. Our goal was to assess the effect of three WNT/β-catenin pathway inhibitors, Inhibitor of β-Catenin And TCF4 (ICAT), niclosamide, and XAV939 on the proliferation of primary cultures of human uterine leiomyoma cells. Design Prospective study of human leiomyoma cells obtained from myomectomy or hysterectomy. Setting University research laboratory. Patient(s) Women (n=38) aged 27–53 years undergoing surgery. Intervention(s) Adenoviral ICAT overexpression or treatment with varying concentrations of niclosamide or XAV939. Main Outcome Measure(s) Cell proliferation, cell death, WNT/β-catenin target gene expression or reporter gene regulation, β-catenin levels and cellular localization. Result(s) ICAT, niclosamide, or XAV939 inhibit WNT/β-catenin pathway activation and exert anti-proliferative effects in primary cultures of human leiomyoma cells. Conclusion(s) Three WNT/β-catenin pathway inhibitors specifically block human leiomyoma growth and proliferation, suggesting that the canonical WNT pathway may be a potential therapeutic target for the treatment of uterine leiomyoma. Our findings provide rationale for further preclinical and clinical evaluation of ICAT, niclosamide, and XAV939 as candidate anti-tumor agents for uterine leiomyoma. PMID:24534281

  8. Rapid Visualization of Human Tumor Xenografts through Optical Imaging with a Near-Infrared Fluorescent Anti–Epidermal Growth Factor Receptor Nanobody

    Directory of Open Access Journals (Sweden)

    Sabrina Oliveira

    2012-01-01

    Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.

  9. Epidermal growth factor inhibits glycyl sarcosine transport and hPepT1 expression in a human intestinal cell line

    DEFF Research Database (Denmark)

    Nielsen, Carsten Uhd; Amstrup, Jan; Steffansen, Bente

    2001-01-01

    Intestinal oligopeptide transporter, growth factor, immunocytochemistry, laser scanning confocal microscopy......Intestinal oligopeptide transporter, growth factor, immunocytochemistry, laser scanning confocal microscopy...

  10. Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line

    DEFF Research Database (Denmark)

    Nielsen, C U; Amstrup, J; Steffansen, B

    2001-01-01

    (max) decreased from 2.61 +/- 0.4 to 1.06 +/- 0.1 nmol x cm(-2) x min(-1) (n = 3, P PepT1 mRNA (using glucose-6-phosphate dehydrogenase mRNA as control......) in cells treated with EGF. Western blotting indicated a decrease in hPepT1 protein in cell lysates. We conclude that EGF treatment decreases Gly-Sar transport in Caco-2 cells by decreasing the number of peptide transporter molecules in the apical membrane....

  11. Retinoid inhibition of in vitro invasion of human amnion basement membrane by human tumor cells

    International Nuclear Information System (INIS)

    Fazely, F.; Ledinko, N.; Smith, D.J.

    1986-01-01

    The biological activity of retinoids was assayed in an in vitro quantitative assay of human tumor cell invasion using human amnion basement membrane (BM). The effects measured were the inhibition of tumor cell migration through the BM and tumor cell degradative enzyme activity on 14 C-proline labeled collagenous and noncollagenous components of the BM. The human lung carcinoma A549 or the human Ewing's sarcoma TC-106 cell lines treated with retinoids for two days were incubated on the BM in the absence of retinoids. A dose-dependent inhibition of cell invasion was produced by retinoids. Among the retinoids tested, the most powerful was retinol acetate which inhibited invasion by 50% of A549 cells at a concentration of 0.009 μg/mL, and of TC-106 cells at 0.07 μg/mL. Retinol acetate inhibited A549 and TC-106 cell growth by approximately 50% at levels over 100-fold higher than those needed for antiinvasive activity. Retinol acetate was about 20 times more potent than retinoic acid and 30 times more potent than retinol palmitate. The model system will be useful for investigating antiinvasive activity of other retinoids as well as other compounds

  12. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  13. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  14. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  15. Effects of Thermal Resistance on One-Dimensional Thermal Analysis of the Epidermal Flexible Electronic Devices Integrated with Human Skin

    Science.gov (United States)

    Li, He; Cui, Yun

    2017-12-01

    Nowadays, flexible electronic devices are increasingly used in direct contact with human skin to monitor the real-time health of human body. Based on the Fourier heat conduction equation and Pennes bio-heat transfer equation, this paper deduces the analytical solutions of one - dimensional heat transfer for flexible electronic devices integrated with human skin under the condition of a constant power. The influence of contact thermal resistance between devices and skin is considered as well. The corresponding finite element model is established to verify the correctness of analytical solutions. The results show that the finite element analysis agrees well with the analytical solution. With bigger thermal resistance, temperature increase of skin surface will decrease. This result can provide guidance for the design of flexible electronic devices to reduce the negative impact that exceeding temperature leave on human skin.

  16. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo

    2014-01-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  17. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection

    International Nuclear Information System (INIS)

    Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.

    1986-01-01

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients

  18. Comet assay in reconstructed 3D human epidermal skin models—investigation of intra- and inter-laboratory reproducibility with coded chemicals

    Science.gov (United States)

    Pfuhler, Stefan

    2013-01-01

    Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594

  19. Recommendations on disease management for patients with advanced human epidermal growth factor receptor 2-positive breast cancer and brain metastases: American Society of Clinical Oncology clinical practice guideline.

    Science.gov (United States)

    Ramakrishna, Naren; Temin, Sarah; Chandarlapaty, Sarat; Crews, Jennie R; Davidson, Nancy E; Esteva, Francisco J; Giordano, Sharon H; Gonzalez-Angulo, Ana M; Kirshner, Jeffrey J; Krop, Ian; Levinson, Jennifer; Modi, Shanu; Patt, Debra A; Perez, Edith A; Perlmutter, Jane; Winer, Eric P; Lin, Nancy U

    2014-07-01

    To provide formal expert consensus-based recommendations to practicing oncologists and others on the management of brain metastases for patients with human epidermal growth factor receptor 2 (HER2) -positive advanced breast cancer. The American Society of Clinical Oncology (ASCO) convened a panel of medical oncology, radiation oncology, guideline implementation, and advocacy experts and conducted a systematic review of the literature. When that failed to yield sufficiently strong quality evidence, the Expert Panel undertook a formal expert consensus-based process to produce these recommendations. ASCO used a modified Delphi process. The panel members drafted recommendations, and a group of other experts joined them for two rounds of formal ratings of the recommendations. No studies or existing guidelines met the systematic review criteria; therefore, ASCO conducted a formal expert consensus-based process. Patients with brain metastases should receive appropriate local therapy and systemic therapy, if indicated. Local therapies include surgery, whole-brain radiotherapy, and stereotactic radiosurgery. Treatments depend on factors such as patient prognosis, presence of symptoms, resectability, number and size of metastases, prior therapy, and whether metastases are diffuse. Other options include systemic therapy, best supportive care, enrollment onto a clinical trial, and/or palliative care. Clinicians should not perform routine magnetic resonance imaging (MRI) to screen for brain metastases, but rather should have a low threshold for MRI of the brain because of the high incidence of brain metastases among patients with HER2-positive advanced breast cancer. © 2014 by American Society of Clinical Oncology.

  20. From bench to bedside: What do we know about hormone receptor-positive and human epidermal growth factor receptor 2-positive breast cancer?

    Science.gov (United States)

    Wu, Victoria Shang; Kanaya, Noriko; Lo, Chiao; Mortimer, Joanne; Chen, Shiuan

    2015-09-01

    Breast cancer is a heterogeneous disease. Thanks to extensive efforts from research scientists and clinicians, treatment for breast cancer has advanced into the era of targeted medicine. With the use of several well-established biomarkers, such as hormone receptors (HRs) (i.e., estrogen receptor [ER] and progesterone receptor [PgR]) and human epidermal growth factor receptor-2 (HER2), breast cancer patients can be categorized into multiple subgroups with specific targeted treatment strategies. Although therapeutic strategies for HR-positive (HR+) HER2-negative (HER2-) breast cancer and HR-negative (HR-) HER2-positive (HER2+) breast cancer are well-defined, HR+ HER2+ breast cancer is still an overlooked subgroup without tailored therapeutic options. In this review, we have summarized the molecular characteristics, etiology, preclinical tools and therapeutic options for HR+ HER2+ breast cancer. We hope to raise the attention of both the research and the medical community on HR+ HER2+ breast cancer, and to advance patient care for this subtype of disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Characteristics and treatment of human epidermal growth factor receptor 2 positive breast cancer: 43,485 cases from the National Cancer Database treated in 2010 and 2011.

    Science.gov (United States)

    Killelea, Brigid K; Chagpar, Anees B; Horowitz, Nina R; Lannin, Donald R

    2017-02-01

    Although identification of human epidermal growth factor receptor 2 (Her2) positive breast cancer represents one of the greatest advances over the past 3 decades, it has not been studied extensively on a national level. The National Cancer Database is a joint project of the American Cancer Society and the American College of Surgeons and contains data on about 70% of the cancer cases in the United States. Data on Her2 have been collected since 2010 and was used for this study. Of 298,937 cases of invasive breast cancer with known Her2 status diagnosed in 2010 and 2011, 43,485 (14.5%) were Her2 positive. Her2 positivity was greatest in Asian/Pacific Islanders and least in non-Hispanic Whites and was markedly more common in younger women. The incidence of Her2 positive tumors ranged from a low of 13.9% in the Mountain West region to a high of 16.0% in the West South Central region (P breast preservation (odds ratio = .78, confidence interval = .76 to .80). Her2 positive tumors have distinct epidemiologic, clinical, and treatment characteristics. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Human epidermal growth factor receptor 2 testing in invasive breast cancer: should histological grade, type and oestrogen receptor status influence the decision to repeat testing?

    Science.gov (United States)

    Rakha, Emad A; Pigera, Marian; Shin, Sandra J; D'Alfonso, Timothy; Ellis, Ian O; Lee, Andrew H S

    2016-07-01

    The recent American Society of Clinical Oncology/College of American Pathologists guidelines for human epidermal growth factor receptor 2 (HER2) testing in breast cancer recommend repeat testing based on tumour grade, tumour type, and hormone receptor status. The aim of this study was to test the value of these criteria. HER2 status was concordant in the core biopsies and excision specimens in 392 of 400 invasive carcinomas. The major reasons for discordance were amplification around the cut-off for positivity and tumour heterogeneity. Of 116 grade 3 carcinomas that were HER2-negative in the core biopsy, four were HER2-positive in the excision specimen. Three of these four either showed borderline negative amplification in the core biopsy or were heterogeneous. None of the 55 grade 1 carcinomas were HER2-positive. Review of repeat testing of HER2 in routine practice suggested that it may also be of value for multifocal tumours and if recommended by the person assessing the in-situ hybridization. Mandatory repeat HER2 testing of grade 3 HER2-negative carcinomas is not appropriate. This is particularly true if repeat testing is performed after borderline negative amplification in the core biopsy or in HER2-negative heterogeneous carcinomas. © 2015 John Wiley & Sons Ltd.

  3. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  4. Real world cost of human epidermal receptor 2-positive metastatic breast cancer patients: a longitudinal incidence-based observational costing study in the Netherlands and Belgium.

    Science.gov (United States)

    Frederix, G W J; Severens, J L; Hövels, A M; van Hasselt, J G C; Hooiveld, M J J; Neven, P; Raaijmakers, J A M; Schellens, J H M

    2015-05-01

    Currently, no country-specific metastatic breast cancer (MBC) observational costing data are available for the Netherlands and Belgium. Our aim is to describe country-specific resource use and costs of human epidermal receptor 2 (HER-2)-positive MBC in the Netherlands and Belgium, making use of real-world data. The eligibility period for patient selection was from April 2004 to April 2010. Inclusion and retrospective data collection begins at the time of first diagnosis of HER-2-positive MBC during the eligibility period and ends 24 months post-index diagnosis of MBC or at patient death. We identified 88 eligible patients in the Netherlands and 44 patients in Belgium. The total costs of medical treatment and other resource use utilisation per patient was €48,301 in the Netherlands and €37,431 in Belgium. Majority of costs was related to the use of trastuzumab in both countries, which was 50% of the total costs in the Netherlands and 56% in Belgium respectively. Our study provides estimates of resource use and costs for HER-2-positive MBC in the Netherlands and Belgium. We noticed various differences in resource use patterns between both countries demonstrating caution is needed when transferring cost estimates between countries. © 2014 John Wiley & Sons Ltd.

  5. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  6. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  7. Progesterone receptor (PR) polyproline domain (PPD) mediates inhibition of epidermal growth factor receptor (EGFR) signaling in non-small cell lung cancer cells.

    Science.gov (United States)

    Kawprasertsri, Sornsawan; Pietras, Richard J; Marquez-Garban, Diana C; Boonyaratanakornkit, Viroj

    2016-05-01

    Recent evidence has suggested a possible role for progesterone receptor (PR) in the progression of non-small cell lung cancer (NSCLC). However, little is known concerning roles of PR in NSCLC. PR contains a polyproline domain (PPD), which directly binds to the SH3 domain of signaling molecules. Because PPD-SH3 interactions are essential for EGFR signaling, we hypothesized that the presence of PR-PPD interfered with EGFR-mediated signaling and cell proliferation. We examined the role of PR-PPD in cell proliferation and signaling by stably expressing PR-B, or PR-B with disrupting mutations in the PPD (PR-BΔSH3), from a tetracycline-regulated promoter in A549 NSCLC cells. PR-B dose-dependently inhibited cell growth in the absence of ligand, and progestin (R5020) treatment further suppressed the growth. Treatment with RU486 abolished PR-B- and R5020-mediated inhibition of cell proliferation. Expression of PR-BΔSH3 and treatment with R5020 or RU486 had no effect on cell proliferation. Furthermore, PR-B expression but not PR-BΔSH3 expression reduced EGF-induced A549 proliferation and activation of ERK1/2, in the absence of ligand. Taken together, our data demonstrated the significance of PR extranuclear signaling through PPD interactions in EGFR-mediated proliferation and signaling in NSCLC. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. DMSO inhibits human platelet activation through cyclooxygenase-1 inhibition. A novel agent for drug eluting stents?

    International Nuclear Information System (INIS)

    Asmis, Lars; Tanner, Felix C.; Sudano, Isabella; Luescher, Thomas F.; Camici, Giovanni G.

    2010-01-01

    Background: DMSO is routinely infused together with hematopoietic cells in patients undergoing myeloablative therapy and was recently found to inhibit smooth muscle cells proliferation and arterial thrombus formation in the mouse by preventing tissue factor (TF), a key activator of the coagulation cascade. This study was designed to investigate whether DMSO prevents platelet activation and thus, whether it may represent an interesting agent to be used on drug eluting stents. Methods and results: Human venous blood from healthy volunteers was collected in citrated tubes and platelet activation was studied by cone and platelet analyzer (CPA) and rapid-platelet-function-assay (RPFA). CPA analysis showed that DMSO-treated platelets exhibit a lower adherence in response to shear stress (-15.54 ± 0.9427%, n = 5, P < 0.0001 versus control). Additionally, aggregometry studies revealed that DMSO-treated, arachidonate-stimulated platelets had an increased lag phase (18.0% ± 4.031, n = 9, P = 0.0004 versus control) as well as a decreased maximal aggregation (-6.388 ± 2.212%, n = 6, P = 0.0162 versus control). Inhibitory action of DMSO could be rescued by exogenous thromboxane A2 and was mediated, at least in part, by COX-1 inhibition. Conclusions: Clinically relevant concentrations of DMSO impair platelet activation by a thromboxane A2-dependent, COX-1-mediated effect. This finding may be crucial for the previously reported anti-thrombotic property displayed by DMSO. Our findings support a role for DMSO as a novel drug to prevent not only proliferation, but also thrombotic complications of drug eluting stents.

  9. Melittin suppresses HIF-1α/VEGF expression through inhibition of ERK and mTOR/p70S6K pathway in human cervical carcinoma cells.

    Directory of Open Access Journals (Sweden)

    Jae-Moon Shin

    Full Text Available OBJECTIVE: Melittin (MEL, a major component of bee venom, has been associated with various diseases including arthritis, rheumatism and various cancers. In this study, the anti-angiogenic effects of MEL in CaSki cells that were responsive to the epidermal growth factor (EGF were examined. METHODOLOGY/PRINCIPAL FINDINGS: MEL decreased the EGF-induced hypoxia-inducible factor-1α (HIF-1α protein and significantly regulated angiogenesis and tumor progression. We found that inhibition of the HIF-1α protein level is due to the shortened half-life by MEL. Mechanistically, MEL specifically inhibited the EGF-induced HIF-1α expression by suppressing the phosphorylation of ERK, mTOR and p70S6K. It also blocked the EGF-induced DNA binding activity of HIF-1α and the secretion of the vascular endothelial growth factor (VEGF. Furthermore, the chromatin immunoprecipitation (ChIP assay revealed that MEL reduced the binding of HIF-1α to the VEGF promoter HRE region. The anti-angiogenesis effects of MEL were confirmed through a matrigel plus assay. CONCLUSIONS: MEL specifically suppressed EGF-induced VEGF secretion and new blood vessel formation by inhibiting HIF-1α. These results suggest that MEL may inhibit human cervical cancer progression and angiogenesis by inhibiting HIF-1α and VEGF expression.

  10. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans

    NARCIS (Netherlands)

    Stacey, Martin; Chang, Gin-Wen; Davies, John Q.; Kwakkenbos, Mark J.; Sanderson, Ralph D.; Hamann, Jörg; Gordon, Siamon; Lin, Hsi-Hsien

    2003-01-01

    Using multivalent protein probes, an evolutionarily conserved endogenous ligand for EMR2, a human myeloid cell-restricted EGF-TM7 receptor, was identified on the surface of a number of adherent cell lines. In addition, in situ staining of the ligand has revealed specific in vivo patterns consistent

  11. Inhibition of the epidermal growth factor receptor in bladder cancer cells treated with the DNA-damaging drug etoposide markedly increases apoptosis

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Nexo, Ebba

    2007-01-01

    : The bladder cancer cell lines RT4 and T24, representing low- and high-malignancy grades respectively, were treated with VP16 (10 or 50 microM) and the level of apoptosis determined using a commercial kit. EGFR receptor activity was determined by western blotting using antibodies against phosphorylated EGFR....... The EGFR was either activated by heparin-binding (HB)-EGF (1 nM) or inhibited with the specific EGFR inhibitor gefitinib (1 or 5 microM). The pan-caspase inhibitor Z-VAD (30 microM) was used to test the involvement of caspase activity. RESULTS: Treatment of T24 bladder cancer cells with VP16 (50 micro...... suggest that activation of the EGFR induced a cell-survival function when bladder cancer cells were treated with the DNA-damaging drug VP16, and that combined treatment with VP16 and the EGFR inhibitor gefitinib might improve the efficacy of treatment. Udgivelsesdato: 2007-Jan...

  12. UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

    International Nuclear Information System (INIS)

    Olsen, W.M.; Elgjo, K.

    1990-01-01

    A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

  13. Isocyanides inhibit human heme oxygenases at the verdoheme stage.

    Science.gov (United States)

    Evans, John P; Kandel, Sylvie; Ortiz de Montellano, Paul R

    2009-09-22

    Heme oxygenases (HO) catalyze the oxidative cleavage of heme to generate biliverdin, CO, and free iron. In humans, heme oxygenase-1 (hHO-1) is overexpressed in tumor tissues, where it helps to protect cancer cells from anticancer agents, while HOs in fungal pathogens, such as Candida albicans, function as the primary means of iron acquisition. Thus, HO can be considered a potential therapeutic target for certain diseases. In this study, we have examined the equilibrium binding of three isocyanides, isopropyl, n-butyl, and benzyl, to the two major human HO isoforms (hHO-1 and hHO-2), Candida albicans HO (CaHmx1), and human cytochrome P450 CYP3A4 using electronic absorption spectroscopy. Isocyanides coordinate to both ferric and ferrous HO-bound heme, with tighter binding by the more hydrophobic isocyanides and 200-300-fold tighter binding to the ferrous form. Benzyl isocyanide was the strongest ligand to ferrous heme in all the enzymes. Because the dissociation constants (KD) of the ligands for ferrous heme-hHO-1 were below the limit of accuracy for equilibrium titrations, stopped-flow kinetic experiments were used to measure the binding parameters of the isocyanides to ferrous hHO-1. Steady-state activity assays showed that benzyl isocyanide was the most potent uncompetitive inhibitor with respect to heme with a KI = 0.15 microM for hHO-1. Importantly, single turnover assays revealed that the reaction was completely stopped by coordination of the isocyanide to the verdoheme intermediate rather than to the ferric heme complex. Much tighter binding of the inhibitor to the verdoheme intermediate differentiates it from inhibition of, for example, CYP3A4 and offers a possible route to more selective inhibitor design.

  14. Isocyanides Inhibit Human Heme Oxygenases at the Verdoheme Stage†

    Science.gov (United States)

    Evans, John P.; Kandel, Sylvie; Ortiz de Montellano, Paul R.

    2010-01-01

    Heme oxygenases (HO) catalyze the oxidative cleavage of heme to generate biliverdin, CO, and free iron. In humans, heme oxygenase-1 (hHO-1) is overexpressed in tumor tissues, where it helps to protect cancer cells from anticancer agents, while HOs in fungal pathogens, such as Candida albicans, function as the primary means of iron acquisition. Thus, HO can be considered a potential therapeutic target for certain diseases. In this study, we have examined the equilibrium binding of three isocyanides; isopropyl, n-butyl, and benzyl, to the two major human HO isoforms (hHO-1 and hHO-2), Candida albicans HO (CaHmx1), and human cytochrome P450 CYP3A4 using electronic absorption spectroscopy. Isocyanides coordinate to both ferric and ferrous HO-bound heme, with tighter binding by the more hydrophobic isocyanides, and 200-300-fold tighter binding to the ferrous form. Benzyl isocyanide was the strongest ligand to ferrous heme in all the enzymes. Because the dissociation constants (KD) of the ligands for ferrous heme-hHO-1 were below the limit of accuracy for equilibrium titrations, stopped-flow kinetic experiments were used to measure the binding parameters of the isocyanides to ferrous hHO-1. Steady-state activity assays showed that benzyl isocyanide was the most potent uncompetitive inhibitor with respect to heme with a KI = 0.15 μM for hHO-1. Importantly, single turnover assays revealed that the reaction was completely stopped by coordination of the isocyanide to the verdoheme intermediate rather than to the ferric heme complex. Much tighter binding of the inhibitor to the verdoheme intermediate differentiates it from inhibition of, for example, CYP3A4 and offers a possible route to more selective inhibitor design. PMID:19694439

  15. A variety of human monoclonal antibodies against epidermal growth factor receptor isolated from a phage antibody library.

    Science.gov (United States)

    Kurosawa, Gene; Kondo, Mariko; Kurosawa, Yoshikazu

    2016-11-04

    When the technology for constructing human antibody (Ab) libraries using a phage-display system was developed, many researchers in Ab-related fields anticipated that it would be widely applied to the development of pharmaceutical drugs against various diseases, including cancers. However, successful examples of such applications are very limited. Moreover, researchers who utilize phage-display technology now show divergent ways of thinking about phage Ab libraries. For example, there is debate about what should be the source of V H and V L genes for the construction of libraries to cover the whole repertoire of Abs present in the human body. In the immune system, the introduction of mutations into V genes followed by selection based on binding activity, termed Ab maturation, is required for the production of Abs exhibiting high affinity to the antigen (Ag). Therefore, introduction of mutations and selection are required for isolation of Abs with high affinity after isolation of clones from phage Ab libraries. We constructed a large human Ab library termed AIMS, developed a screening method termed ICOS, and succeeded in isolating many human monoclonal Abs (mAbs) that specifically and strongly bind to various tumor-associated Ags. Eight anti-EGFR mAbs were included, which we characterized. These mAbs showed various different activities against EGFR-expressing cancer cells. In this paper, we describe these data and discuss the possibility and necessity that the mAbs isolated from the AIMS library might be developed as therapeutic drugs against cancers without introduction of mutations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Retinoid inhibition of in vitro invasion of human amnion basement membrane by human tumor cells

    International Nuclear Information System (INIS)

    Fazely, F.

    1988-01-01

    The effects measured were the inhibition of tumor cell migration through the basement membrane (BM) and tumor cell degradative enzyme activity on 3 H-proline labeled collagenous and non collagenous components of the BM. The human lung carcinoma A549 or the human Ewing's sarcoma TC-106 cell lines treated with retinoids for two days were incubated on the BM in the absence of retinoids. A dose-dependent inhibition of cell invasion was produced by retinoids. Among the retinoids tested the most powerful was retinol acetate which inhibited invasion by 50% of A549 cells at a concentration of 0.09 μg/ml, and TC-106 cells at 0.08 μg/ml. Retinol acetate inhibited A549 and TC-106 cell growth by approximately 50% at levels almost 100-fold higher than those needed for antiinvasive activity. Retinol acetate was about 20 times more potent than retinoic acid and 30 times more than retinol palmitate. Furthermore, A549 cells treated with retinol acetate, under conditions whereby an anti-invasive state was induced,showed an increase in the number of cellular retinoic acid binding proteins (CRABP), a decrease in the activity of type IV collagenase and ectosialyltransferase, and no change in the activity of transglutaminase

  17. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  18. Reformulating sunscreen cosmetics with better water resistance and efficacy to inhibit trans-epidermal water loss in response to global warming and climate change

    International Nuclear Information System (INIS)

    Sucgang, Raymond J.; Manalili, Jenalyn; Mañago, Sarah; Janio, Jonick; Ching, Maricar; Moya, Esperanza; Cruz, Luzviminda

    2015-01-01

    Three inhouse developed skin care formulations and four commercial formulations were tried out on dermatomed porcine skins for wettability and emoliency. Surface applied skin care formulations are alleged to reduce transepidermal water loss (TEWL). Sunscreens/sunblocks absorb or reflect the sun’s ultraviolet (UV) radiation on skin exposed to sunlight and thus helps protect against sunburn. Measurements of water resistance of topical application are normally done using contact angle measurements and swimming pool immersion approaches. TEWL is measured using vapometers. None of the conventional methods directly measure TEWL and water wash out rates. In this study, the effectiveness of skin moisturizers to inhibit TEWL was tested using tritiated water as radioactive tracer on degreased porcine skins. Topical emollients were applied on the epidermises of the skins and the skins were mounted epidermis facing down. Tritiated water was dropped on the top side of the skins and tritium activity concentrations of the moisture that passed through were measured. A modified immersion method was also developed as a screening tool to identify water resistant formulations. Sunscreens labelled with tritiated water were applied on the skin surfaces. The skins were immersed in water (distilled and sea water were compared) and aliquots of the water were counted for tritium every hour for 3 hours. Hydrophobicities of the formulations were predicted by the amounts of tritium that leached out from the skins. (author)

  19. Harman inhibits the removal of pyrimidine dimers from the DNA of human cells

    International Nuclear Information System (INIS)

    Castellani, A.; Setlow, R.B.

    1981-01-01

    Normal human fibroblasts were UV-irradiated and incubated for 6 hr with harman. The losses of sites, in the extracted DNA, sensitive to a UV specific endonuclease were determined as precision measures of the excision of UV-induced pyrimidine dimers. Harman inhibited excision, rising from approx. 30% inhibition at 200 μM to 75% inhibition at 500 μM

  20. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin

    2014-01-01

    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  1. Polybrene inhibits human mesenchymal stem cell proliferation during lentiviral transduction.

    Directory of Open Access Journals (Sweden)

    Paul Lin

    Full Text Available Human mesenchymal stem cells (hMSCs can be engineered to express specific genes, either for their use in cell-based therapies or to track them in vivo over long periods of time. To obtain long-term expression of these genes, a lentivirus- or retrovirus-mediated cell transduction is often used. However, given that the efficiency with these viruses is typically low in primary cells, additives such as polybrene are always used for efficient viral transduction. Unfortunately, as presented here, exposure to polybrene alone at commonly used concentratons (1-8 µg/mL negatively impacts hMSC proliferation in a dose-dependent manner as measured by CyQUANT, EdU incorporation, and cell cycle analysis. This inhibition of proliferation was observable in culture even 3 weeks after exposure. Culturing the cells in the presence of FGF-2, a potent mitogen, did not abrogate this negative effect of polybrene. In fact, the normally sharp increase in hMSC proliferation that occurs during the first days of exposure to FGF-2 was absent at 4 µg/mL or higher concentrations of polybrene. Similarly, the effect of stimulating cell proliferation under simulated hypoxic conditions was also decreased when cells were exposed to polybrene, though overall proliferation rates were higher. The negative influence of polybrene was, however, reduced when the cells were exposed to polybrene for a shorter period of time (6 hr vs 24 hr. Thus, careful evaluation should be done when using polybrene to aid in lentiviral transduction of human MSCs or other primary cells, especially when cell number is critical.

  2. Downregulation of CCR1 inhibits human hepatocellular carcinoma cell invasion

    International Nuclear Information System (INIS)

    Wu Xiaofeng; Fan Jia; Wang Xiaoying; Zhou Jian; Qiu Shuangjian; Yu Yao; Liu Yinkun; Tang Zhaoyou

    2007-01-01

    CC chemokine receptor 1 (CCR1) has an important role in the recruitment of leukocytes to the site of inflammation. The migration and metastasis of tumor cells shares many similarities with leukocyte trafficking, which is mainly regulated by chemokine receptor-ligand interactions. CCR1 is highly expressed in hepatocellular carcinoma (HCC) cells and tissues with unknown functions. In this study, we silenced CCR1 expression in the human HCC cell line HCCLM3 using artificial microRNA (miRNA)-mediated RNA interference (RNAi) and examined the invasiveness and proliferation of CCR1-silenced HCCLM3 cells and the matrix metalloproteinase (MMP) activity. The miRNA-mediated knockdown expression of CCR1 significantly inhibited the invasive ability of HCCLM3 cells, but had only a minor effect on the cellular proliferation rate. Moreover, CCR1 knockdown significantly reduced the secretion of MMP-2. Together, these findings indicate that CCR1 has an important role in HCCLM3 invasion and that CCR1 might be a new target of HCC treatment

  3. Everolimus Plus Endocrine Therapy for Postmenopausal Women With Estrogen Receptor-Positive, Human Epidermal Growth Factor Receptor 2-Negative Advanced Breast Cancer: A Clinical Trial.

    Science.gov (United States)

    Royce, Melanie; Bachelot, Thomas; Villanueva, Cristian; Özgüroglu, Mustafa; Azevedo, Sergio J; Cruz, Felipe Melo; Debled, Marc; Hegg, Roberto; Toyama, Tatsuya; Falkson, Carla; Jeong, Joon; Srimuninnimit, Vichien; Gradishar, William J; Arce, Christina; Ridolfi, Antonia; Lin, Chinjune; Cardoso, Fatima

    2018-03-22

    Cotargeting the mammalian target of rapamycin pathway and estrogen receptor may prevent or delay endocrine resistance in patients receiving first-line treatment for advanced breast cancer. To investigate the combination of everolimus plus endocrine therapy in first-line and second-line treatment settings for postmenopausal women with estrogen receptor-positive, human epidermal growth receptor 2-negative advanced breast cancer. In the multicenter, open-label, single-arm, phase 2 BOLERO-4 (Breast Cancer Trials of Oral Everolimus) clinical trial, 245 patients were screened for eligibility; 202 were enrolled between March 7, 2013, and December 17, 2014. A median follow-up of 29.5 months had been achieved by the data cutoff date (December 17, 2016). Patients received first-line treatment with everolimus, 10 mg/d, plus letrozole, 2.5 mg/d. Second-line treatment with everolimus, 10 mg/d, plus exemestane, 25 mg/d, was offered at the investigator's discretion upon initial disease progression. The primary end point was investigator-assessed progression-free survival in the first-line setting per Response Evaluation Criteria in Solid Tumors, version 1.0. Safety was assessed in patients who received at least 1 dose of study medication and at least 1 postbaseline safety assessment. A total of 202 women treated in the first-line setting had a median age of 64.0 years (interquartile range, 58.0-70.0 years) with metastatic (194 [96.0%]) or locally advanced (8 [4.0%]) breast cancer. Median progression-free survival was 22.0 months (95% CI, 18.1-25.1 months) with everolimus and letrozole. Median overall survival was not reached; 24-month estimated overall survival rate was 78.7% (95% CI, 72.1%-83.9%). Fifty patients started second-line treatment; median progression-free survival was 3.7 months (95% CI, 1.9-7.4 months). No new safety signals were observed. In the first-line setting, the most common all-grade adverse event was stomatitis (139 [68.8%]); the most common grade 3 to 4

  4. Phase II study of paclitaxel given once per week along with trastuzumab and pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer.

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-02-10

    The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.

  5. Molecular subclassification determined by human papillomavirus and epidermal growth factor receptor status is associated with the prognosis of oropharyngeal squamous cell carcinoma.

    Science.gov (United States)

    Nakano, Takafumi; Yamamoto, Hidetaka; Nakashima, Torahiko; Nishijima, Toshimitsu; Satoh, Masanobu; Hatanaka, Yui; Shiratsuchi, Hideki; Yasumatsu, Ryuji; Toh, Satoshi; Komune, Shizuo; Oda, Yoshinao

    2016-04-01

    Human papillomavirus (HPV) infection is an indicator of good response to chemoradiotherapy in oropharyngeal squamous cell carcinoma (OPSCC), and epidermal growth factor receptor (EGFR) is a molecular-therapeutic target in head and neck squamous cell carcinoma. Here we investigated the prevalence and prognostic significance of HPV infection and EGFR alteration in OPSCC. We analyzed the presence of high-risk HPV using in situ hybridization, protein expressions of p16 and EGFR using immunohistochemistry, and the EGFR gene copy number gain using chromogenic in situ hybridization (CISH) in 105 cases of OPSCC. The biopsy specimens before chemoradiotherapy were used for these analyses. HPV infection and p16 protein overexpression were detected in 53.3% and 52.4% of the OPSCCs, and each factor was associated with better overall survival (P = .0026 and P = .0026) and nonkeratinizing histology (P = .0002 and P = .0004), respectively. EGFR gene copy number gain (high polysomy or amplification) was detected in 12.4% of the OPSCCs and was correlated with EGFR protein overexpression (P = .0667) and worse overall survival (P CISH positive) were mutually exclusive. The HPV-negative/EGFR CISH-positive OPSCCs had significantly worse overall survival than did the HPV-positive/EGFR CISH-negative OPSCCs and HPV-negative/EGFR CISH-negative OPSCCs (P CISH-negative OPSCCs had favorable prognosis irrespective of HPV infection. Our results suggest that EGFR gene copy number gain-positive tumors represent an HPV-negative, aggressive subgroup of OPSCCs. The molecular subclassification of OPSCCs based on HPV infection and EGFR status may serve as important information for appropriate therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. The curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive breast cancer: A meta-analysis.

    Science.gov (United States)

    Shao, Minghai; Zhang, Chi; Qin, Qin; Zhang, Zhaoyue; Zhu, Hongcheng; Di, Xiaoke; Sun, Xinchen

    2017-09-01

    This meta-analysis was designed to fully assess the curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive (HER2+) breast cancer (BC). English articles were retrieved through searching Cochrane library, PubMed, and Embase databases updated to February 2017. Studies were selected based on the inclusion and exclusion criteria. The curative effects of radiotherapy-based therapies forHER2+ BC patients were assessed using hazard rates (HRs) or odds ratios (ORs), as well as their 95% confidence intervals (CIs). In addition, Egger test was used to assess publication bias, followed by sensitivity analysis. All statistic methods were conducted using R 3.12 software. A total of 9 eligible studies were included into this meta-analysis, which involved 2236 HER2+ BC patients. Egger test showed that the eligible studies had no publication bias (t = 2.198, P = .05918). Sensitivity analysis demonstrated that the results were stable. HER2+ BC patients in radiotherapy group had lower locoregional recurrences than those in other groups. Moreover, meta-analysis showed that no significant difference was found between HER2+ BC patients in radiotherapy group and other groups on the 1-year overall survival (P = 0.5263, I = 65.4%), 3-year overall survival (P = 0.4591, I = 0), and 5-year overall survival (P = 0.06277, I = 0). Radiotherapy-based therapies might have certain advantages in treating HER2+ BC patients.

  7. Disease management patterns for postmenopausal women in Europe with hormone-receptor-positive, human epidermal growth factor receptor-2 negative advanced breast cancer.

    Science.gov (United States)

    André, Fabrice; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Baladi, Jean-Francois; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Jerusalem, Guy

    2014-06-01

    International guidelines for hormone-receptor-positive (HR(+)), human epidermal growth factor receptor-2 negative (HER2(-)) advanced breast cancer (BC) recommend sequential lines of hormonal therapy (HT), and only recommend chemotherapy for patients with extensive visceral involvement or rapidly progressive disease. This study evaluated actual physician-reported treatments for advanced BC in Europe. We conducted a retrospective chart review of 355 postmenopausal women with HR(+), HER2(-) advanced BC who progressed on ≥1 line of HT (adjuvant or advanced) and completed ≥1 line of chemotherapy (advanced). Treatment choice was evaluated for each line of therapy. Of 355 patients, 111 (31%) received first-line chemotherapy, whereas 218 (61%) and 26 (7%) switched from HT to chemotherapy in second and third line, respectively. More patients receiving first-line HT had bone metastases (73% vs 27% chemotherapy). Patients treated with first-line chemotherapy had more brain (12% vs 3% HT) or extensive liver (13% vs 6% HT) metastases. Subgroup analysis of 188 patients who received first-line HT and had de novo advanced BC or relapsed/recurrent disease more than 1 year after adjuvant therapy found that the majority (89%; n = 167) of these patients switched to chemotherapy in second line. However, among these 167 patients, 27% had no significant changes in metastases between first and second line. Among the 73% of patients who had significant changes in metastases, 20% had no brain metastases or extensive visceral disease. Our study suggests that the guideline-recommended use of multiple HT lines is open to interpretation and that optimal treatment for European postmenopausal women with HR(+), HER2(-) advanced BC who responded to HT may not be achieved.

  8. Patterns of resource utilization and cost for postmenopausal women with hormone-receptor–positive, human epidermal growth factor receptor-2–negative advanced breast cancer in Europe

    International Nuclear Information System (INIS)

    Jerusalem, Guy; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Ricci, Jean-François; Andre, Fabrice

    2015-01-01

    Healthcare resource utilization in breast cancer varies by disease characteristics and treatment choices. However, lack of clarity in guidelines can result in varied interpretation and heterogeneous treatment management and costs. In Europe, the extent of this variability is unclear. Therefore, evaluation of chemotherapy use and costs versus hormone therapy across Europe is needed. This retrospective chart review (N = 355) examined primarily direct costs for chemotherapy versus hormone therapy in postmenopausal women with hormone-receptor–positive (HR+), human epidermal growth factor receptor-2–negative (HER2–) advanced breast cancer across 5 European countries (France, Germany, The Netherlands, Belgium, and Sweden). Total direct costs across the first 3 treatment lines were approximately €10 000 to €14 000 lower for an additional line of hormone therapy-based treatment versus switching to chemotherapy-based treatment. Direct cost difference between chemotherapy-based and hormone therapy-based regimens was approximately €1900 to €2500 per month. Chemotherapy-based regimens were associated with increased resource utilization (managing side effects; concomitant targeted therapy use; and increased frequencies of hospitalizations, provider visits, and monitoring tests). The proportion of patients taking sick leave doubled after switching from hormone therapy to chemotherapy. These results suggest chemotherapy is associated with increased direct costs and potentially with increased indirect costs (lower productivity of working patients) versus hormone therapy in HR+, HER2– advanced breast cancer. The online version of this article (doi:10.1186/s12885-015-1762-3) contains supplementary material, which is available to authorized users

  9. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    Science.gov (United States)

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Gene expression profiling of histologically normal breast tissue in females with human epidermal growth factor receptor 2‑positive breast cancer.

    Science.gov (United States)

    Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan

    2015-02-01

    Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.

  11. Gene protein detection platform--a comparison of a new human epidermal growth factor receptor 2 assay with conventional immunohistochemistry and fluorescence in situ hybridization platforms.

    Science.gov (United States)

    Stålhammar, Gustav; Farrajota, Pedro; Olsson, Ann; Silva, Cristina; Hartman, Johan; Elmberger, Göran

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are widely used semiquantitative assays for selecting breast cancer patients for HER2 antibody therapy. However, both techniques have been shown to have disadvantages. Our aim was to test a recent automated technique of combined IHC and brightfield dual in situ hybridization-gene protein detection platform (GPDP)-in breast cancer HER2 protein, gene, and chromosome 17 centromere status evaluations, comparing the results in accordance to the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from both 2007 and 2013. The GPDP technique performance was evaluated on 52 consecutive whole slide invasive breast cancer cases with HER2 IHC 2/3+ scoring results. Applying in turns the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from 2007 and 2013 to both FISH and GPDP DISH assays, the HER2 gene amplification results showed 100% concordance among amplified/nonamplified cases, but there was a shift in 4 cases toward positive from equivocal results and toward equivocal from negative results. This might be related to the emphasis on the average HER2 copy number in the 2013 criteria. HER2 expression by IVD market IHC kit (Pathway®) has a strong correlation with GPDP HER2 protein, including a full concordance for all cases scored as 3+ and a reduction from 2+ to 1+ in 7 cases corresponding to nonamplified cases. Gene protein detection platform HER2 protein "solo" could have spared the need for 7 FISH studies. In addition, the platform offered advantages on interpretation reassurance including selecting areas for counting gene signals paralleled with protein IHC expression, on heterogeneity detection, interpretation time, technical time, and tissue expense. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  13. Safety and efficacy of neratinib in combination with capecitabine in patients with metastatic human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Saura, Cristina; Garcia-Saenz, Jose A; Xu, Binghe; Harb, Wael; Moroose, Rebecca; Pluard, Timothy; Cortés, Javier; Kiger, Corinne; Germa, Caroline; Wang, Kongming; Martin, Miguel; Baselga, José; Kim, Sung-Bae

    2014-11-10

    Neratinib is a potent irreversible pan-tyrosine kinase inhibitor with antitumor activity and acceptable tolerability in patients with human epidermal growth factor receptor 2 (HER2) -positive breast cancer. A multinational, open-label, phase I/II trial was conducted to determine the maximum-tolerated dose (MTD) of neratinib plus capecitabine in patients with solid tumors (part one) and to evaluate the safety and efficacy of neratinib plus capecitabine in patients with HER2-positive metastatic breast cancer (part two). Part one was a 3 + 3 dose-escalation study in which patients with advanced solid tumors received oral neratinib once per day continuously plus capecitabine twice per day on days 1 to 14 of a 21-day cycle at predefined dose levels. In part two, patients with trastuzumab-pretreated HER2-positive metastatic breast cancer received neratinib plus capecitabine at the MTD. The primary end point in part two was objective response rate (ORR). In part one (n = 33), the combination of neratinib 240 mg per day plus capecitabine 1,500 mg/m(2) per day was defined as the MTD, which was further evaluated in part 2 (n = 72). The most common drug-related adverse events were diarrhea (88%) and palmar-plantar erythrodysesthesia syndrome (48%). In part two, the ORR was 64% (n = 39 of 61) in patients with no prior lapatinib exposure and 57% (n = 4 of 7) in patients previously treated with lapatinib. Median progression-free survival was 40.3 and 35.9 weeks, respectively. Neratinib in combination with capecitabine had a manageable toxicity profile and showed promising antitumor activity in patients with HER2-positive metastatic breast cancer pretreated with trastuzumab and lapatinib. © 2014 by American Society of Clinical Oncology.

  14. Human Papillomavirus and Epidermal Growth Factor Receptor in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma: Correlation With Dynamic Contrast-Enhanced MRI Parameters.

    Science.gov (United States)

    Choi, Yoon Seong; Park, Mina; Kwon, Hyeong Ju; Koh, Yoon Woo; Lee, Seung-Koo; Kim, Jinna

    2016-02-01

    The objective of this study was to investigate differences in dynamic contrast-enhanced MRI (DCE-MRI) parameters on the basis of the status of human papillomavirus (HPV) and epidermal growth factor receptor (EGFR) biomarkers in patients with squamous cell carcinoma (SCC) of the oral cavity and oropharynx by use of histogram analysis. A total of 22 consecutive patients with oral cavity and oropharyngeal SCC underwent DCE-MRI before receiving treatment. DCE parameter maps of the volume transfer constant (K(trans)), the flux rate constant (kep), and the extravascular extracellular volume fraction (ve) were obtained. The histogram parameters were calculated using the entire enhancing tumor volume and were compared between the patient subgroups on the basis of HPV and EGFR biomarker statuses. The cumulative histogram parameters of K(trans) and kep showed lower values in the HPV-negative and EFGR-overexpression group than in the HPV-positive EGFR-negative group. These differences were statistically significant for the mean (p = 0.009), 25th, 50th, and 75th percentile values of K(trans) and for the 25th percentile value of kep when correlated with HPV status in addition to the mean K(trans) value (p = 0.047) and kep value (p = 0.004) when correlated with EGFR status. No statistically significant difference in ve was found on the basis of HPV and EGFR status. DCE-MRI is useful for the assessment of the tumor microenvironment associated with HPV and EGFR biomarkers before treatment of patients with oral cavity and oropharyngeal SCC.

  15. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model.

    Science.gov (United States)

    den Reijer, P M; Haisma, E M; Lemmens-den Toom, N A; Willemse, J; Koning, R I; Koning, R A; Demmers, J A A; Dekkers, D H W; Rijkers, E; El Ghalbzouri, A; Nibbering, P H; van Wamel, W

    2016-01-01

    The ability of Staphylococcus aureus to successfully colonize (a)biotic surfaces may be explained by biofilm formation and the actions of virulence factors. The aim of the present study was to establish the presence of 52 proteins, including virulence factors such as alpha-toxin, during biofilm formation of five different (methicillin resistant) S. aureus strains on Leiden human epidermal models (LEMs) and polystyrene surfaces (PS) using a competitive Luminex-based assay. All five S. aureus strains formed biofilms on PS, whereas only three out of five strains formed biofilms on LEMs. Out of the 52 tested proteins, six functionally diverse proteins (ClfB, glucosaminidase, IsdA, IsaA, SACOL0688 and nuclease) were detected in biofilms of all strains on both PS and LEMs. At the same time, four toxins (alpha-toxin, gamma-hemolysin B and leukocidins D and E), two immune modulators (formyl peptide receptor-like inhibitory protein and Staphylococcal superantigen-like protein 1), and two other proteins (lipase and LytM) were detectable in biofilms by all five S. aureus strains on LEMs, but not on PS. In contrast, fibronectin-binding protein B (FnbpB) was detectable in biofilms by all S. aureus biofilms on PS, but not on LEMs. These data were largely confirmed by the results from proteomic and transcriptomic analyses and in case of alpha-toxin additionally by GFP-reporter technology. Functionally diverse virulence factors of (methicillin-resistant) S. aureus are present during biofilm formation on LEMs and PS. These results could aid in identifying novel targets for future treatment strategies against biofilm-associated infections.

  16. Utility of the CPS+EG staging system in hormone receptor-positive, human epidermal growth factor receptor 2-negative breast cancer treated with neoadjuvant chemotherapy.

    Science.gov (United States)

    Marmé, Frederik; Lederer, Bianca; Blohmer, Jens-Uwe; Costa, Serban Dan; Denkert, Carsten; Eidtmann, Holger; Gerber, Bernd; Hanusch, Claus; Hilfrich, Jörn; Huober, Jens; Jackisch, Christian; Kümmel, Sherko; Loibl, Sibylle; Paepke, Stefan; Untch, Michael; von Minckwitz, Gunter; Schneeweiss, Andreas

    2016-01-01

    Pathologic complete response after neoadjuvant chemotherapy (NACT) correlates with overall survival (OS) in primary breast cancer. A recently described staging system based on pre-treatment clinical stage (CS), final pathological stage (PS), estrogen receptor (ER) status and nuclear grade (NG) leads to a refined estimation of prognosis in unselected patients. Its performance in luminal type breast cancers has not been determined. This study investigates the clinical utility of this CPS+EG score when restricted to hormone receptor-positive (HR+)/human epidermal growth factor receptor 2-negative (HER2-) patients and compares the results to a cohort of unselected patients. The CPS+EG score was calculated for 6637 unselected patients and 2454 patients with HR+/HER2- tumours who received anthracycline/taxane-based NACT within 8 prospective German trials. Five-year disease-free survival (DFS) and OS were 75.6% and 84.1% for the unselected cohort and 80.6% and 87.8% for the HR+/HER2- subgroup, respectively. The CPS+EG system distinguished different prognostic groups with 5-year DFS ranging from 0% to 91%. The CPS+EG system leads to an improved categorisation of patients by outcome compared to CS, PS, ER or NG alone. When applying the CPS+EG score to the HR+/HER2- subgroup, a shift to lower scores was observed compared to the overall population, but 5-year DFS and OS for the individual scores were identical to that observed in the overall population. In HR+/HER2- patients, the CPS+EG staging system retains its ability to facilitate a refined stratification of patients according to outcome. It can help to select candidates for post-neoadjuvant clinical trials in luminal breast cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. The Effect of Adjuvant Trastuzumab on Locoregional Recurrence of Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer Treated with Mastectomy.

    Science.gov (United States)

    Lanning, Ryan M; Morrow, Monica; Riaz, Nadeem; McArthur, Heather L; Dang, Chau; Moo, Tracy-Ann; El-Tamer, Mahmoud; Krause, Kate; Siu, Chun; Hsu, Meier; Zhang, Zhigang; Pei, Xin; McCormick, Beryl; Powell, Simon N; Ho, Alice

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) overexpression was associated with locoregional recurrence (LRR) in the preadjuvant trastuzumab era. This study aimed to examine the effect of trastuzumab on LRR in mastectomy patients and whether it varied with postmastectomy radiation (PMRT). From the authors' institutional database, 501 women with stages I-III HER2-positive breast cancer who underwent mastectomy from 1998 to 2007 were identified. A landmark analysis was performed to compare two cohorts: 170 women who received trastuzumab and 281 who did not. Kaplan-Meier methods were used to estimate locoregional recurrence-free survival (LRRFS). A propensity score analysis was used to balance the treatment groups with respect to multiple covariates. Analogous methods were used to study the effect of PMRT. The women in the trastuzumab group were more likely to be node positive and to receive systemic therapy or PMRT (p < 0.01). The 5-year LRRFS was 98 % in the trastuzumab troup versus 94 % in the no trastuzumab group [hazard ratio (HR) 0.31; 95 % confidence interval (CI) 0.09-1.09; p = 0.07]. After adjustment for multiple covariates, including receipt of chemotherapy and PMRT, trastuzumab decreased LRR rates (HR 0.21; 95 % CI 0.04-0.94; p = 0.04). Among the women who received PMRT, trastuzumab reduced the 5-year LRR rate (0 vs 5 %; p = 0.06). Among those who did not receive PMRT, trastuzumab did not significantly decrease LRR (3 vs 6 %; p = 0.26). High rates of locoregional control (5-year rate, 98 %) were observed among patients who received trastuzumab and mastectomy ± PMRT. Trastuzumab decreased LRR in HER2-positive women who received mastectomy and PMRT, suggesting that the largest benefit is seen in a higher-risk subset of patients.

  18. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  19. Reactive oxygen species-mediated DNA damage and apoptosis in human skin epidermal cells after exposure to nickel nanoparticles.

    Science.gov (United States)

    Alarifi, Saud; Ali, Daoud; Alakhtani, Saad; Al Suhaibani, Entissar S; Al-Qahtani, Ahmed A

    2014-01-01

    Nickel nanoparticles (NiNPs) are increasingly used in various applications due to their unique properties. However, there is little information concerning the toxicity of NiNPs in the human skin cell (A431). The present study was designed to investigate the cytotoxicity, apoptosis, and DNA damage due to NiNPs in A431 cells. A cellular proliferative capacity test showed that NiNPs induce significant cytotoxicity in a dose- and time-dependent manner. NiNPs were also found to induce oxidative stress evidenced by the generation of reactive oxygen species (ROS) and depletion of glutathione (GSH). Further, co-treatment with the antioxidant N-acetylcysteine (NAC) mitigated the ROS generation due to NiNPs, suggesting the potential mechanism of oxidative stress. NiNPs also induced significant elevation of lipid peroxidation, catalase, and superoxide dismutase and caspase-3 activity in A431 cells. In addition, NAC suppressed NiNP-induced caspase-3 activity. DNA fragmentation analysis using the comet assay showed that the NiNPs cause genotoxicity in a dose- and time-dependent manner. Therefore, the study points out the capability of the NiNPs to induce oxidative stress resulting in apoptosis and genotoxicity. This study warrants more careful assessment of NiNPs before their industrial applications.

  20. Telomerase inhibition effectively targets mouse and human AML stem cells and delays relapse following chemotherapy

    DEFF Research Database (Denmark)

    Bruedigam, Claudia; Bagger, Frederik Otzen; Heidel, Florian H.

    2014-01-01

    (-/-) LSCs express a specific gene expression signature that can be identified in human AML patient cohorts and is positively correlated with patient survival following chemotherapy. In xenografts of primary human AML, genetic or pharmacological inhibition of telomerase targets LSCs, impairs leukemia...... progression, and delays relapse following chemotherapy. Altogether, these results establish telomerase inhibition as an effective strategy for eliminating AML LSCs....

  1. Expression and Prognostic Significance of Human Epidermal Growth Factor Receptors 1, 2 and 3 in Periampullary Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Jacob Elebro

    Full Text Available Periampullary adenocarcinoma, including pancreatic cancer, is a heterogeneous group of tumours with dismal prognosis, for which there is an urgent need to identify novel treatment strategies. The human epithelial growth factor receptors EGFR, HER2 and HER3 have been studied in several tumour types, and HER-targeting drugs have a beneficial effect on survival in selected types of cancer. However, these effects have not been evident in pancreatic cancer, and remain unexplored in other types of periampullary cancer. The prognostic impact of HER-expression in these cancers also remains unclear. The aim of this study was therefore to examine the expression and prognostic value of EGFR, HER2 and HER3 in periampullary cancer, with particular reference to histological subtype. To this end, protein expression of EGFR, HER2 and HER3, and HER2 gene amplification was assessed by immunohistochemistry and silver in situ hybridization, respectively, on tissue microarrays with tumours from 175 periampullary adenocarcinomas, with follow-up data on recurrence-free survival (RFS and overall survival (OS for up to 5 years. EGFR expression was similar in pancreatobiliary (PB and intestinal (I type tumours, but high HER2 and HER3 expression was significantly more common in I-type tumours. In PB-type cases receiving adjuvant gemcitabine, but not in untreated cases, high EGFR expression was significantly associated with a shorter OS and RFS, with a significant treatment interaction in relation to OS (pinteraction = 0.042. In I-type cases, high EGFR expression was associated with a shorter OS and RFS in univariable, but not in multivariable, analysis. High HER3 expression was associated with a prolonged RFS in univariable, but not in multivariable, analysis. Neither HER2 protein expression nor gene amplification was prognostic. The finding of a potential interaction between the expression of EGFR and response to adjuvant chemotherapy in PB-type tumours needs validation

  2. In vitro human epidermal permeation of nicotine from electronic cigarette refill liquids and implications for dermal exposure assessment.

    Science.gov (United States)

    Frasch, H Frederick; Barbero, Ana M

    2017-11-01

    Nicotine plus flavorings in a propylene glycol (PG) vehicle are the components of electronic cigarette liquids (e-liquids), which are vaporized and inhaled by the user. Dermal exposure to nicotine and e-liquids may occur among workers in mixing and filling of e-cigarettes in the manufacturing process. Inadvertent skin contact among consumers is also a concern. In vitro nicotine permeation studies using heat-separated human epidermis were performed with surrogate and two commercial e-liquids, neat and aqueous nicotine donor formulations. Steady-state fluxes (J ss ), and lag times (t lag ) were measured for each formulation. In addition, transient (4 h) exposure and finite dose (1-10 μl/cm 2 ) experiments were undertaken using one commercial e-liquid. Average J ss (μg/cm 2 /h) from formulations were: nicotine in PG (24 mg/ml): 3.97; commercial e-liquid containing menthol (25 mg/ml nicotine): 10.2; commercial e-liquid containing limonene (25 mg/ml nicotine): 23.7; neat nicotine: 175. E-liquid lag times ranged from 5 to 10 h. Absorbed fraction of nicotine from finite doses was ≈0.3 at 48 h. The data were applied to transient exposure and finite dose dermal exposure assessment models and to a simple pharmacokinetic model. Three illustrative exposure scenarios demonstrate use of the data to predict systemic uptake and plasma concentrations from dermal exposure. The data demonstrate the potential for significant nicotine absorption through skin contact with e-cigarette refill solutions and the neat nicotine used to mix them.

  3. Reverse resistance to radiation in KYSE-150R esophageal carcinoma cell after epidermal growth factor receptor signal pathway inhibition by cetuximab

    International Nuclear Information System (INIS)

    Jing Zhao; Gong Ling; Xie Congying; Zhang Li; Su Huafang; Deng Xia; Wu Shixiu

    2009-01-01

    Background and purpose: The purpose of our study is to examine the capacity of cetuximab to reverse radiation resistance and investigate molecular mechanisms in human radiation-resistant esophageal carcinoma cell line KYSE-150R. Materials and methods: The radioresistant cell line KYSE-150R was established by using fractionated irradiation (FIR). The KYSE-150R cell line was exposed to radiation, treatment with cetuximab, and combined treatment. Cell cycle distribution and apoptosis were analyzed using flow cytometry. Radiation survival was analyzed using clonogenic assays. RT 2 profiler TM PCR array was performed to analyze EGF/PDGF signaling pathway genes. Results: The established esophageal carcinoma cell line KYSE-150R showed higher radioresistance than parental cell line. Cetuximab could reverse the radiation resistance of KYSE-150R cells. Cell cycle analysis showed that combination with radiation and cetuximab resulted in the accumulation of cells in G1 and G2/M phases, with the reduction of cells within the S phase. Cetuximab enhanced the apoptosis induced by radiation. RT 2 profiler TM array showed that some intracellular signaling genes deriving from EGF/PDGF signaling pathway regulated by cetuximab. Conclusions: Irradiation combined with EGFR blocked by cetuximab may reverse the resistance to radiation in radioresistant esophageal carcinoma cell. The mechanisms may include cell cycle perturbation and enhancement of radiation-induced apoptosis. Further studies are needed to evaluate the role of cetuximab in combination with radiotherapy in the management of esophageal carcinoma.

  4. Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

    International Nuclear Information System (INIS)

    Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

    2011-01-01

    Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

  5. Inhibiting DNA-PKCS radiosensitizes human osteosarcoma cells

    International Nuclear Information System (INIS)

    Mamo, Tewodros; Mladek, Ann C.; Shogren, Kris L.; Gustafson, Carl; Gupta, Shiv K.; Riester, Scott M.; Maran, Avudaiappan; Galindo, Mario; Wijnen, Andre J. van; Sarkaria, Jann N.; Yaszemski, Michael J.

    2017-01-01

    Osteosarcoma survival rate has not improved over the past three decades, and the debilitating side effects of the surgical treatment suggest the need for alternative local control approaches. Radiotherapy is largely ineffective in osteosarcoma, indicating a potential role for radiosensitizers. Blocking DNA repair, particularly by inhibiting the catalytic subunit of DNA-dependent protein kinase (DNA-PK CS ), is an attractive option for the radiosensitization of osteosarcoma. In this study, the expression of DNA-PK CS in osteosarcoma tissue specimens and cell lines was examined. Moreover, the small molecule DNA-PK CS inhibitor, KU60648, was investigated as a radiosensitizing strategy for osteosarcoma cells in vitro. DNA-PK CS was consistently expressed in the osteosarcoma tissue specimens and cell lines studied. Additionally, KU60648 effectively sensitized two of those osteosarcoma cell lines (143B cells by 1.5-fold and U2OS cells by 2.5-fold). KU60648 co-treatment also altered cell cycle distribution and enhanced DNA damage. Cell accumulation at the G2/M transition point increased by 55% and 45%, while the percentage of cells with >20 γH2AX foci were enhanced by 59% and 107% for 143B and U2OS cells, respectively. These results indicate that the DNA-PK CS inhibitor, KU60648, is a promising radiosensitizing agent for osteosarcoma. - Highlights: • DNA-PKcs is consistently expressed in human osteosarcoma tissue and cell lines. • The DNA-PKcs inhibitor, KU60648, effectively radiosensitizes osteosarcoma cells. • Combining KU60648 with radiation increases G2/M accumulation and DNA damage.

  6. Epidermal Growth Factor Cytoplasmic Domain Affects ErbB Protein Degradation by the Lysosomal and Ubiquitin-Proteasome Pathway in Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Aleksandra Glogowska

    2012-05-01

    Full Text Available The cytoplasmic domains of EGF-like ligands, including EGF cytoplasmic domain (EGFcyt, have important biological functions. Using specific constructs and peptides of human EGF cytoplasmic domain, we demonstrate that EGFcyt facilitates lysosomal and proteasomal protein degradation, and this coincided with growth inhibition of human thyroid and glioma carcinoma cells. EGFcyt and exon 22–23-encoded peptide (EGF22.23 enhanced procathepsin B (procathB expression and procathB-mediated lysosomal degradation of EGFR/ErbB1 as determined by inhibitors for procathB and the lysosomal ATPase inhibitor BafA1. Presence of mbEGFctF, EGFcyt, EGF22.23, and exon 23-encoded peptides suppressed the expression of the deubiqitinating enzyme ubiquitin C-terminal hydrolase-L1 (UCH-L1. This coincided with hyperubiquitination of total cellular proteins and ErbB1/2 and reduced proteasome activity. Upon small interfering RNA-mediated silencing of endogenously expressed UCH-L1, a similar hyperubiquitinylation phenotype, reduced ErbB1/2 content, and attenuated growth was observed. The exon 23-encoded peptide region of EGFcyt was important for these biologic actions. Structural homology modeling of human EGFcyt showed that this molecular region formed an exposed surface loop. Peptides derived from this EGFcyt loop structure may aid in the design of novel peptide therapeutics aimed at inhibiting growth of cancer cells.

  7. Inhibition of human lung adenocarcinoma growth using survivint34a ...

    Indian Academy of Sciences (India)

    Prakash

    knockdown, survivin-directed vaccines (Pisarev et al. 2003), ... Endotoxin levels of the plasmid DNA prepared were determined by .... power fields/slide). ... inhibition of angiogenesis and directly increase apoptosis of .... α-induced apoptosis.

  8. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  9. Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer.

    Science.gov (United States)

    Cheng, Qing; Chang, Jeffrey T; Geradts, Joseph; Neckers, Leonard M; Haystead, Timothy; Spector, Neil L; Lyerly, H Kim

    2012-04-17

    Although human epidermal growth factor receptor 2 (HER2) positive or estrogen receptor (ER) positive breast cancers are treated with clinically validated anti-HER2 or anti-estrogen therapies, intrinsic and acquired resistance to these therapies appears in a substantial proportion of breast cancer patients and new therapies are needed. Identification of additional molecular factors, especially those characterized by aggressive behavior and poor prognosis, could prioritize interventional opportunities to improve the diagnosis and treatment of breast cancer. We compiled a collection of 4,010 breast tumor gene expression data derived from 23 datasets that have been posted on the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. We performed a genome-scale survival analysis using Cox-regression survival analyses, and validated using Kaplan-Meier Estimates survival and Cox Proportional-Hazards Regression survival analyses. We conducted a genome-scale analysis of chromosome alteration using 481 breast cancer samples obtained from The Cancer Genome Atlas (TCGA), from which combined expression and copy number data were available. We assessed the correlation between somatic copy number alterations and gene expression using analysis of variance (ANOVA). Increased expression of each of the heat shock protein (HSP) 90 isoforms, as well as HSP transcriptional factor 1 (HSF1), was correlated with poor prognosis in different subtypes of breast cancer. High-level expression of HSP90AA1 and HSP90AB1, two cytoplasmic HSP90 isoforms, was driven by chromosome coding region amplifications and were independent factors that led to death from breast cancer among patients with triple-negative (TNBC) and HER2-/ER+ subtypes, respectively. Furthermore, amplification of HSF1 was correlated with higher HSP90AA1 and HSP90AB1 mRNA expression among the breast cancer cells without amplifications of these two genes. A collection of HSP90AA1, HSP90AB1 and HSF

  10. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania.

    Science.gov (United States)

    Mwakigonja, Amos Rodger; Lushina, Nyanda Elias; Mwanga, Ally

    2017-01-01

    Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu) expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH). A cross-sectional study of female breast post-modified radical mastectomy (MRM)/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January-December 2013). Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER), and progesterone (PgR) receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS). A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18-75 years and mean age was 48.36 years. Majority (64.3%) were in the 36-55 years age-group. Histologically, most (88.6%) women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78%) were stage three. Due to logistical constrains, 75.7% ( n  = 53/70) cases where immunostained for hormones including 43.4% (ER+), 26.4% (PgR+), and 28% (ER+/PgR+). Furthermore, 65.7% ( n  = 46/70) cases were immunostained for HER-2 and 15.2% ( n  = 7/46) were positive, 45.6% were triple negative (ER-,PgR-,HER2-), 23.9% (ER+,PgR+,HER2-) or luminal B, 2.2% (ER+,PgR-,HER2+),13% (ER-,PgR-,HER2+) and 15% (ER+,PgR-,HER2-) with none being triple positive. Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion of triple negative breast carcinomas (TNBC) is

  11. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Amos Rodger Mwakigonja

    2017-11-01

    Full Text Available Abstract Background Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH. Methods A cross-sectional study of female breast post-modified radical mastectomy (MRM/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January–December 2013. Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER, and progesterone (PgR receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS. Results A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18–75 years and mean age was 48.36 years. Majority (64.3% were in the 36–55 years age-group. Histologically, most (88.6% women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78% were stage three. Due to logistical constrains, 75.7% (n = 53/70 cases where immunostained for hormones including 43.4% (ER+, 26.4% (PgR+, and 28% (ER+/PgR+. Furthermore, 65.7% (n = 46/70 cases were immunostained for HER-2 and 15.2% (n = 7/46 were positive, 45.6% were triple negative (ER-,PgR-,HER2-, 23.9% (ER+,PgR+,HER2- or luminal B, 2.2% (ER+,PgR-,HER2+,13% (ER-,PgR-,HER2+ and 15% (ER+,PgR-,HER2- with none being triple positive. Conclusions Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion

  12. Budget impact analysis of everolimus for the treatment of hormone receptor positive, human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer in the United States.

    Science.gov (United States)

    Xie, Jipan; Diener, Melissa; De, Gourab; Yang, Hongbo; Wu, Eric Q; Namjoshi, Madhav

    2013-01-01

    To estimate the budget impact of everolimus as the first and second treatment option after letrozole or anastrozole (L/A) failure for post-menopausal women with hormone receptor positive (HR+), human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer (ABC). Pharmacy and medical budget impacts (2011 USD) were estimated over the first year of everolimus use in HR+, HER2- ABC from a US payer perspective. Epidemiology data were used to estimate target population size. Pre-everolimus entry treatment options included exemestane, fulvestrant, and tamoxifen. Pre- and post-everolimus entry market shares were estimated based on market research and assumptions. Drug costs were based on wholesale acquisition cost. Patients were assumed to be on treatment until progression or death. Annual medical costs were calculated as the average of pre- and post-progression medical costs weighted by the time in each period, adjusted for survival. One-way and two-way sensitivity analyses were conducted to assess the model robustness. In a hypothetical 1,000,000 member plan, 72 and 159 patients were expected to be candidates for everolimus treatment as first and second treatment option, respectively, after L/A failure. The total budget impact for the first year post-everolimus entry was $0.044 per member per month [PMPM] (pharmacy budget: $0.058 PMPM; medical budget: -$0.014 PMPM), assuming 10% of the target population would receive everolimus. The total budget impacts for the first and second treatment options after L/A failure were $0.014 PMPM (pharmacy budget: $0.018; medical budget: -$0.004) and $0.030 PMPM (pharmacy budget: $0.040; medical budget: -$0.010), respectively. Results remained robust in sensitivity analyses. Assumptions about some model input parameters were necessary and may impact results. Increased pharmacy costs for HR+, HER2- ABC following everolimus entry are expected to be partially offset by reduced medical service costs. Pharmacy and total

  13. Relationship between body mass index and the expression of hormone receptors or human epidermal growth factor receptor 2 with respect to breast cancer survival

    International Nuclear Information System (INIS)

    Jeon, Ye Won; Kang, Su Hwan; Park, Min Ho; Lim, Woosung; Cho, Se Heun; Suh, Young Jin

    2015-01-01

    The association between body mass index (BMI) at the time of breast cancer diagnosis and the prognosis of breast cancer patients remains controversial. Furthermore, the association between BMI and prognosis with respect to different breast cancer subtypes is not clearly defined. We analyzed data from 41,021 invasive breast cancer patients between January 1988 and February 2008 from the Korean Breast Cancer Registry (KBCR) database. Overall survival (OS) and breast cancer-specific survival (BCSS) were analyzed using the Kaplan-Meier method and Cox’s proportional hazard regression model among all patients and specific breast cancer subtypes with respect to BMI categories. A U-shaped association between BMI and mortality was observed in the total cohort. Underweight and obese individuals exhibited worse OS (hazard ratio, 1.23 [95 % confidence interval {CI}, 1.05 to 1.44] and 1.29 [1.13 to 1.48], respectively) and BCSS (1.26 [1.03 to 1.54] and 1.21 [1.02 to 1.43], respectively) than normal-weight individuals. In the estrogen receptor (ER) and/or progesterone receptor (PR)+/human epidermal growth factor receptor 2 (HER2) - subgroup, obese individuals exhibited worse OS (1.48 [1.18 to 1.85]) and BCSS (1.31 [1.13 to 1.52]) than normal-weight individuals. Conversely, in the ER and PR-/HER2+ subgroup, underweight individuals exhibited worse OS (1.68 [1.12 to 2.47]) and BCSS (1.79 [1.11 to 2.90]) than normal-weight individuals. We observed a U-shaped relationship between BMI at diagnosis and poor OS and BCSS among all breast cancer patients. However, obesity in the ER and/or PR+/HER2- subgroup and underweight in the ER and PR-/HER2+ subgroup were poor prognostic factors. Therefore, BMI at diagnosis and breast cancer subtype should be considered simultaneously in various treatment decision processes and surveillance schedules

  14. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer.

    Science.gov (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R

    2017-04-01

    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Translational Breast Cancer Research Consortium (TBCRC) 022: A Phase II Trial of Neratinib for Patients With Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer and Brain Metastases.

    Science.gov (United States)

    Freedman, Rachel A; Gelman, Rebecca S; Wefel, Jeffrey S; Melisko, Michelle E; Hess, Kenneth R; Connolly, Roisin M; Van Poznak, Catherine H; Niravath, Polly A; Puhalla, Shannon L; Ibrahim, Nuhad; Blackwell, Kimberly L; Moy, Beverly; Herold, Christina; Liu, Minetta C; Lowe, Alarice; Agar, Nathalie Y R; Ryabin, Nicole; Farooq, Sarah; Lawler, Elizabeth; Rimawi, Mothaffar F; Krop, Ian E; Wolff, Antonio C; Winer, Eric P; Lin, Nancy U

    2016-03-20

    Evidence-based treatments for metastatic, human epidermal growth factor receptor 2 (HER2)-positive breast cancer in the CNS are limited. Neratinib is an irreversible inhibitor of erbB1, HER2, and erbB4, with promising activity in HER2-positive breast cancer; however, its activity in the CNS is unknown. We evaluated the efficacy of treatment with neratinib in patients with HER2-positive breast cancer brain metastases in a multicenter, phase II open-label trial. Eligible patients were those with HER2-positive brain metastases (≥ 1 cm in longest dimension) who experienced progression in the CNS after one or more line of CNS-directed therapy, such as whole-brain radiotherapy, stereotactic radiosurgery, and/or surgical resection. Patients received neratinib 240 mg orally once per day, and tumors were assessed every two cycles. The primary endpoint was composite CNS objective response rate (ORR), requiring all of the following: ≥ 50% reduction in volumetric sum of target CNS lesions and no progression of non-target lesions, new lesions, escalating corticosteroids, progressive neurologic signs/symptoms, or non-CNS progression--the threshold for success was five of 40 responders. Forty patients were enrolled between February 2012 and June 2013; 78% of patients had previous whole-brain radiotherapy. Three women achieved a partial response (CNS objective response rate, 8%; 95% CI, 2% to 22%). The median number of cycles received was two (range, one to seven cycles), with a median progression-free survival of 1.9 months. Five women received six or more cycles. The most common grade ≥ 3 event was diarrhea (occurring in 21% of patients taking prespecified loperamide prophylaxis and 28% of those without prophylaxis). Patients in the study experienced a decreased quality of life over time. Although neratinib had low activity and did not meet our threshold for success, 12.5% of patients received six or more cycles. Studies combining neratinib with chemotherapy in patients

  16. Lapatinib or Trastuzumab Plus Taxane Therapy for Human Epidermal Growth Factor Receptor 2-Positive Advanced Breast Cancer: Final Results of NCIC CTG MA.31.

    Science.gov (United States)

    Gelmon, Karen A; Boyle, Frances M; Kaufman, Bella; Huntsman, David G; Manikhas, Alexey; Di Leo, Angelo; Martin, Miguel; Schwartzberg, Lee S; Lemieux, Julie; Aparicio, Samuel; Shepherd, Lois E; Dent, Susan; Ellard, Susan L; Tonkin, Katia; Pritchard, Kathleen I; Whelan, Timothy J; Nomikos, Dora; Nusch, Arnd; Coleman, Robert E; Mukai, Hirofumi; Tjulandin, Sergei; Khasanov, Rustem; Rizel, Shulamith; Connor, Anne P; Santillana, Sergio L; Chapman, Judith-Anne W; Parulekar, Wendy R

    2015-05-10

    The efficacy of lapatinib versus trastuzumab combined with taxanes in the first-line setting of human epidermal growth factor receptor 2 (HER2) -positive metastatic breast cancer (BC) is unknown. The MA.31 trial compared a combination of first-line anti-HER2 therapy (lapatinib or trastuzumab) and taxane therapy for 24 weeks, followed by the same anti-HER2 monotherapy until progression. Stratification was by prior (neo)adjuvant anti-HER2 therapy, prior (neo)adjuvant taxane, planned taxane, and liver metastases. The primary end point was intention-to-treat (ITT) progression-free survival (PFS), defined as time from random assignment to progression by RECIST (version 1.0) criteria, or death for patients with locally assessed HER2-positive tumors. The primary test statistic was a stratified log-rank test for noninferiority. PFS was also assessed for patients with centrally confirmed HER2-positive tumors. From July 17, 2008, to December 1, 2011, 652 patients were accrued from 21 countries, resulting in 537 patients with centrally confirmed HER2-positive tumors. Median follow-up was 21.5 months. Median ITT PFS was 9.0 months with lapatinib and 11.3 months with trastuzumab. By ITT analysis, PFS was inferior for lapatinib compared with trastuzumab, with a stratified hazard ratio (HR) of 1.37 (95% CI, 1.13 to 1.65; P = .001). In patients with centrally confirmed HER2-positive tumors, median PFS was 9.1 months with lapatinib and 13.6 months with trastuzumab (HR, 1.48; 95% CI, 1.20 to 1.83; P < .001). More grade 3 or 4 diarrhea and rash were observed with lapatinib (P < .001). PFS results were supported by the secondary end point of overall survival, with an ITT HR of 1.28 (95% CI, 0.95 to 1.72; P = .11); in patients with centrally confirmed HER2-positive tumors, the HR was 1.47 (95% CI, 1.03 to 2.09; P = .03). As first-line therapy for HER2-positive metastatic BC, lapatinib combined with taxane was associated with shorter PFS and more toxicity compared with trastuzumab

  17. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  18. 3-Bromopyruvate inhibits human gastric cancer tumor growth in nude mice via the inhibition of glycolysis.

    Science.gov (United States)

    Xian, Shu-Lin; Cao, Wei; Zhang, Xiao-Dong; Lu, Yun-Fei

    2015-02-01

    Tumor cells primarily depend upon glycolysis in order to gain energy. Therefore, the inhibition of glycolysis may inhibit tumor growth. Our previous study demonstrated that 3-bromopyruvate (3-BrPA) inhibited gastric cancer cell proliferation in vitro . However, the ability of 3-BrPA to suppress tumor growth in vivo, and its underlying mechanism, have yet to be elucidated. The aim of the present study was to investigate the inhibitory effect of 3-BrPA in an animal model of gastric cancer. It was identified that 3-BrPA exhibited strong inhibitory effects upon xenograft tumor growth in nude mice. In addition, the antitumor function of 3-BrPA exhibited a dose-effect association, which was similar to that of the chemotherapeutic agent, 5-fluorouracil. Furthermore, 3-BrPA exhibited low toxicity in the blood, liver and kidneys of the nude mice. The present study hypothesized that the inhibitory effect of 3-BrPA is achieved through the inhibition of hexokinase activity, which leads to the downregulation of B-cell lymphoma 2 (Bcl-2) expression, the upregulation of Bcl-2-associated X protein expression and the subsequent activation of caspase-3. These data suggest that 3-BrPA may be a novel therapy for the treatment of gastric cancer.

  19. INHIBITION OF SPONTANEOUS APOPTOSIS IN HUMAN BREAST CANCER

    Institute of Scientific and Technical Information of China (English)

    邵志敏; 江明; 吴炅; 余黎民; 韩企夏; 张延璆; 沈镇宙

    1996-01-01

    Breast tumorigenesis proceeds through an accumulation of specific genetic alteration. Breast malignant transformation is dependent on not only the rate of cell production but also on apoptcsis,a genetically prograined process of autonomous ceil death. We investigated whether breast tumorigenesis involved an altered susceptibility to apoptosis and proliferation by examining normal breast epithelium and breast cancer sampies. We found there is a great inhibition of spontaneous apoptosis in breast cancer ceils compared with normal breast epithelium. The inhibition of apoptosis in breast cancer may contribute to neoplastic transformation.

  20. Secretion of human epidermal growth factor (EGF) in autotrophic culture by a recombinant hydrogen-utilizing bacterium, Pseudomonas pseudoflava, carrying broad-host-range EGF secretion vector pKSEGF2.

    OpenAIRE

    Hayase, N; Ishiyama, A; Niwano, M

    1994-01-01

    We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...

  1. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT].

    Science.gov (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z

    2016-09-20

    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  2. The inhibition of the Human Immunodeficiency Virus type 1 activity by crude and purified human pregnancy plug mucus and mucins in an inhibition assay

    Directory of Open Access Journals (Sweden)

    Schoeman Leann

    2008-05-01

    Full Text Available Abstract Background The female reproductive tract is amongst the main routes for Human Immunodeficiency Virus (HIV transmission. Cervical mucus however is known to protect the female reproductive tract from bacterial invasion and fluid loss and regulates and facilitates sperm transport to the upper reproductive tract. The purpose of this study was to purify and characterize pregnancy plug mucins and determine their anti-HIV-1 activity in an HIV inhibition assay. Methods Pregnancy plug mucins were purified by caesium chloride density-gradient ultra-centrifugation and characterized by Western blotting analysis. The anti-HIV-1 activities of the crude pregnancy plug mucus and purified pregnancy plug mucins was determined by incubating them with HIV-1 prior to infection of the human T lymphoblastoid cell line (CEM SS cells. Results The pregnancy plug mucus had MUC1, MUC2, MUC5AC and MUC5B. The HIV inhibition assay revealed that while the purified pregnancy plug mucins inhibit HIV-1 activity by approximately 97.5%, the crude pregnancy plug mucus failed to inhibit HIV-1 activity. Conclusion Although it is not clear why the crude sample did not inhibit HIV-1 activity, it may be that the amount of mucins in the crude pregnancy plug mucus (which contains water, mucins, lipids, nucleic acids, lactoferrin, lysozyme, immunoglobulins and ions, is insufficient to cause viral inhibition or aggregation.

  3. Acute effects of cocaine and cannabis on response inhibition in humans: an ERP investigation

    NARCIS (Netherlands)

    Spronk, D.B.; De Bruijn, E.R.; van Wel, J.H.; Ramaekers, J.G.; Verkes, R.J.

    2016-01-01

    Substance abuse has often been associated with alterations in response inhibition in humans. Not much research has examined how the acute effects of drugs modify the neurophysiological correlates of response inhibition, or how these effects interact with individual variation in trait levels of

  4. Inhibition of rat, mouse, and human glutathione S-transferase by eugenol and its oxidation products

    NARCIS (Netherlands)

    Rompelberg, C.J.M.; Ploemen, J.H.T.M.; Jespersen, S.; Greef, J. van der; Verhagen, H.; Bladeren, P.J. van

    1996-01-01

    The irreversible and reversible inhibition of glutathione S-transferases (GSTs) by eugenol was studied in rat, mouse and man. Using liver cytosol of human, rat and mouse, species differences were found in the rate of irreversible inhibition of GSTs by eugenol in the presence of the enzyme

  5. Hemispheric asymmetry and somatotopy of afferent inhibition in healthy humans.

    NARCIS (Netherlands)

    Helmich, R.C.G.; Baumer, T.; Siebner, H.R.; Bloem, B.R.; Munchau, A.

    2005-01-01

    A conditioning electrical stimulus to a digital nerve can inhibit the motor-evoked potentials (MEPs) in adjacent hand muscles elicited by transcranial magnetic stimulation (TMS) to the contralateral primary motor cortex (M1) when given 25-50 ms before the TMS pulse. This is referred to as

  6. 3',5'-Cyclic diguanylic acid (c-di-GMP) inhibits basal and growth factor-stimulated human colon cancer cell proliferation

    International Nuclear Information System (INIS)

    Karaolis, David K.R.; Cheng, Kunrong; Lipsky, Michael; Elnabawi, Ahmed; Catalano, Jennifer; Hyodo, Mamoru; Hayakawa, Yoshihiro; Raufman, Jean-Pierre

    2005-01-01

    The novel cyclic dinucleotide, 3',5'-cyclic diguanylic acid, cGpGp (c-di-GMP), is a naturally occurring small molecule that regulates important signaling mechanisms in prokaryotes. Recently, we showed that c-di-GMP has 'drug-like' properties and that c-di-GMP treatment might be a useful antimicrobial approach to attenuate the virulence and pathogenesis of Staphylococcus aureus and prevent or treat infection. In the present communication, we report that c-di-GMP (≤50 μM) has striking properties regarding inhibition of cancer cell proliferation in vitro. c-di-GMP inhibits both basal and growth factor (acetylcholine and epidermal growth factor)-induced cell proliferation of human colon cancer (H508) cells. Toxicity studies revealed that exposure of normal rat kidney cells and human neuroblastoma cells to c-di-GMP at biologically relevant doses showed no lethal cytotoxicity. Cyclic dinucleotides, such as c-di-GMP, represent an attractive and novel 'drug-platform technology' that can be used not only to develop new antimicrobial agents, but also to develop novel therapeutic agents to prevent or treat cancer

  7. Local anesthetic-induced inhibition of human neutrophil priming: the influence of structure, lipophilicity, and charge

    NARCIS (Netherlands)

    Picardi, Susanne; Cartellieri, Sibylle; Groves, Danja; Hahnenekamp, Klaus; Gerner, Peter; Durieux, Marcel E.; Stevens, Markus F.; Lirk, Philipp; Hollmann, Markus W.

    2013-01-01

    Local anesthetics (LAs) are widely known for inhibition of voltage-gated sodium channels underlying their antiarrhythmic and antinociceptive effects. However, LAs have significant immunomodulatory properties and were shown to affect human neutrophil functions independent of sodium-channel blockade.

  8. Inhibition of human pancreatic and biliary output but not intestinal motility by physiological intraileal lipid loads

    DEFF Research Database (Denmark)

    Keller, Jutta; Holst, Jens Juul; Layer, Peter

    2005-01-01

    Lipid perfusion into the distal ileal lumen at supraphysiological loads inhibits pancreatic exocrine secretion and gastrointestinal motility in humans. In the present study, we sought to determine the effects of physiological postprandial intraileal lipid concentrations on endogenously stimulated...

  9. Inhibition by nucleosides of glucose-transport activity in human erythrocytes.

    OpenAIRE

    Jarvis, S M

    1988-01-01

    The interaction of nucleosides with the glucose carrier of human erythrocytes was examined by studying the effect of nucleosides on reversible cytochalasin B-binding activity and glucose transport. Adenosine, inosine and thymidine were more potent inhibitors of cytochalasin B binding to human erythrocyte membranes than was D-glucose [IC50 (concentration causing 50% inhibition) values of 10, 24, 28 and 38 mM respectively]. Moreover, low concentrations of thymidine and adenosine inhibited D-glu...

  10. The inhibition of repair in UV irradiated human cells

    International Nuclear Information System (INIS)

    Collins, A.R.S.; Schor, S.L.; Johnson, R.T.

    1977-01-01

    Three different assay procedures are used to determine the effects of hydroxyurea on excision repair in UV-irradiated HeLa cells. At the cytological level, incubation of UV-irradiated metaphase cells with hydroxyurea caused chromosome decondensation. Using a modified alkaline sucrose gradient sedimentation technique involving minimal lysis before centrifugation, a marked retardation was found in the sedimentation of DNA from UV-irradiated cells incubated for a short period with hydroxyurea. The effect of hydroxyurea on the incorporation of [ 3 H]thymidine by UV-irradiated G1 cells was found to depend on the concentration of thymidine present in the medium. The results point to an inhibition of repair DNA synthesis by hydroxyurea (or deoxyadenosine), at the level of the supply of DNA precursors, i.e. in the same way that these agents inhibit semiconservative DNA synthesis. In the presence of these inhibitors, single-strand gaps accumulate in the DNA

  11. Berberine Reduces cAMP-Induced Chloride Secretion in T84 Human Colonic Carcinoma Cells through Inhibition of Basolateral KCNQ1 Channels.

    LENUS (Irish Health Repository)

    Alzamora, Rodrigo

    2011-01-01

    Berberine is a plant alkaloid with multiple pharmacological actions, including antidiarrhoeal activity and has been shown to inhibit Cl(-) secretion in distal colon. The aims of this study were to determine the molecular signaling mechanisms of action of berberine on Cl(-) secretion and the ion transporter targets. Monolayers of T84 human colonic carcinoma cells grown in permeable supports were placed in Ussing chambers and short-circuit current measured in response to secretagogues and berberine. Whole-cell current recordings were performed in T84 cells using the patch-clamp technique. Berberine decreased forskolin-induced short-circuit current in a concentration-dependent manner (IC(50) 80 ± 8 μM). In apically permeabilized monolayers and whole-cell current recordings, berberine inhibited a cAMP-dependent and chromanol 293B-sensitive basolateral membrane K(+) current by 88%, suggesting inhibition of KCNQ1 K(+) channels. Berberine did not affect either apical Cl(-) conductance or basolateral Na(+)-K(+)-ATPase activity. Berberine stimulated p38 MAPK, PKCα and PKA, but had no effect on p42\\/p44 MAPK and PKCδ. However, berberine pre-treatment prevented stimulation of p42\\/p44 MAPK by epidermal growth factor. The inhibitory effect of berberine on Cl(-) secretion was partially blocked by HBDDE (∼65%), an inhibitor of PKCα and to a smaller extent by inhibition of p38 MAPK with SB202190 (∼15%). Berberine treatment induced an increase in association between PKCα and PKA with KCNQ1 and produced phosphorylation of the channel. We conclude that berberine exerts its inhibitory effect on colonic Cl(-) secretion through inhibition of basolateral KCNQ1 channels responsible for K(+) recycling via a PKCα-dependent pathway.

  12. Berberine Reduces cAMP-Induced Chloride Secretion in T84 Human Colonic Carcinoma Cells through Inhibition of Basolateral KCNQ1 Channels.

    LENUS (Irish Health Repository)

    Alzamora, Rodrigo

    2012-02-01

    Berberine is a plant alkaloid with multiple pharmacological actions, including antidiarrhoeal activity and has been shown to inhibit Cl(-) secretion in distal colon. The aims of this study were to determine the molecular signaling mechanisms of action of berberine on Cl(-) secretion and the ion transporter targets. Monolayers of T84 human colonic carcinoma cells grown in permeable supports were placed in Ussing chambers and short-circuit current measured in response to secretagogues and berberine. Whole-cell current recordings were performed in T84 cells using the patch-clamp technique. Berberine decreased forskolin-induced short-circuit current in a concentration-dependent manner (IC(50) 80 +\\/- 8 muM). In apically permeabilized monolayers and whole-cell current recordings, berberine inhibited a cAMP-dependent and chromanol 293B-sensitive basolateral membrane K(+) current by 88%, suggesting inhibition of KCNQ1 K(+) channels. Berberine did not affect either apical Cl(-) conductance or basolateral Na(+)-K(+)-ATPase activity. Berberine stimulated p38 MAPK, PKCalpha and PKA, but had no effect on p42\\/p44 MAPK and PKCdelta. However, berberine pre-treatment prevented stimulation of p42\\/p44 MAPK by epidermal growth factor. The inhibitory effect of berberine on Cl(-) secretion was partially blocked by HBDDE ( approximately 65%), an inhibitor of PKCalpha and to a smaller extent by inhibition of p38 MAPK with SB202190 ( approximately 15%). Berberine treatment induced an increase in association between PKCalpha and PKA with KCNQ1 and produced phosphorylation of the channel. We conclude that berberine exerts its inhibitory effect on colonic Cl(-) secretion through inhibition of basolateral KCNQ1 channels responsible for K(+) recycling via a PKCalpha-dependent pathway.

  13. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  14. Ebselen Reversibly Inhibits Human Glutamate Dehydrogenase at the Catalytic Site.

    Science.gov (United States)

    Jin, Yanhong; Li, Di; Lu, Shiying; Zhao, Han; Chen, Zhao; Hou, Wei; Ruan, Benfang Helen

    Human glutamate dehydrogenase (GDH) plays an important role in neurological diseases, tumor metabolism, and hyperinsulinism-hyperammonemia syndrome (HHS). However, there are very few inhibitors known for human GDH. Recently, Ebselen was reported to crosslink with Escherichia coli GDH at the active site cysteine residue (Cys321), but the sequence alignment showed that the corresponding residue is Ala329 in human GDH. To investigate whether Ebselen could be an inhibitor for human GDH, we cloned and expressed an N-terminal His-tagged human GDH in E. coli. The recombinant human GDH enzyme showed expected properties such as adenosine diphosphate activation and nicotinamide adenine dinucleotide/nicotinamide adenine dinucleotide phosphate dual recognition. Further, we developed a 2-(3-(2-methoxy-4-nitrophenyl)-2-(4-nitrophenyl)-2H-tetrazol-3-ium-5-yl) benzenesulfonate sodium salt (EZMTT)-based assay for human GDH, which was highly sensitive and is suitable for high-throughput screening for potent GDH inhibitors. In addition, ForteBio binding assays demonstrated that Ebselen is a reversible active site inhibitor for human GDH. Since Ebselen is a multifunctional organoselenium compound in Phase III clinical trials for inflammation, an Ebselen-based GDH inhibitor might be valuable for future drug discovery for HHS patients.

  15. Lipid-Lowering Pharmaceutical Clofibrate Inhibits Human Sweet Taste

    OpenAIRE

    Kochem, Matthew; Breslin, Paul A.S.

    2016-01-01

    T1R2-T1R3 is a heteromeric receptor that binds sugars, high potency sweeteners, and sweet taste blockers. In rodents, T1R2-T1R3 is largely responsible for transducing sweet taste perception. T1R2-T1R3 is also expressed in non-taste tissues, and a growing body of evidence suggests that it helps regulate glucose and lipid metabolism. It was previously shown that clofibric acid, a blood lipid-lowering drug, binds T1R2-T1R3 and inhibits its activity in vitro. The purpose of this study was to dete...

  16. Human milk oligosaccharides inhibit growth of group B Streptococcus

    NARCIS (Netherlands)

    Lin, Ann E; Autran, Chloe A; Szyszka, Alexandra; Escajadillo, Tamara; Huang, Mia; Godula, Kamil; Prudden, Anthony R; Boons, Geert-Jan; Lewis, Amanda L; Doran, Kelly S; Nizet, Victor; Bode, Lars

    2017-01-01

    Streptococcus agalactiae (group B Streptococcus, GBS) is a leading cause of invasive bacterial infections in newborns, typically acquired vertically during childbirth secondary to maternal vaginal colonization. Human milk oligosaccharides (HMOs) have important nutritional and biological activities

  17. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  18. Inhibition of human polymorphonuclear leukocyte function by components of human colostrum and mature milk.

    Science.gov (United States)

    Pickering, L K; Cleary, T G; Caprioli, R M

    1983-04-01

    To compare the effect of human colostrum (days 1 to 3 postpartum) and mature milk (days 170 +/- 24 postpartum) on the function of polymorphonuclear leukocytes (PMNL), Ficoll-Hypaque-separated PMNL from the blood of 60 healthy volunteers were incubated with whole colostrum, colostral lipid, and colostral aqueous phase from 30 mothers, or with mature whole milk and its separated components from 30 mothers, and tested for resting and zymosan-stimulated oxidative metabolism, functional activity, and the presence of Fc receptors. Stimulated oxygen consumption, quantitative nitroblue tetrazolium dye reduction, [1-(14)C]glucose utilization, and Fc receptors were significantly (P cells or cells exposed to the aqueous phase of colostrum. In contrast, PMNL exposed to whole mature milk or to its lipid or aqueous phase caused no significant decrease in any of these parameters when compared to nonexposed cells. In assays of phagocytosis, colostral PMNL or blood PMNL exposed to colostral lipid had a significant (P < 0.001) decrease in their ability to ingest [methyl-(3)H]thymidine-labeled Staphylococcus aureus when compared to non-lipid-exposed PMNL. Blood PMNL exposed to lipid from mature milk had no decrease in ability to ingest S. aureus. Analysis of total lipid and total and individual fatty acid content revealed a uniform increase in all components in mature milk when compared to colostrum. Lipid or lipid-soluble material present in human colostrum but not mature milk causes inhibition of phagocytosis and respiratory burst-related activities of PMNL.

  19. Bovine Lactoferrampin, Human Lactoferricin, and Lactoferrin 1-11 Inhibit Nuclear Translocation of HIV Integrase.

    Science.gov (United States)

    Wang, Winston Yan; Wong, Jack Ho; Ip, Denis Tsz Ming; Wan, David Chi Cheong; Cheung, Randy Chifai; Ng, Tzi Bun

    2016-08-01

    This study aimed to investigate fragments derived from human and bovine lactoferrins for ability to inhibit nuclear translocation of HIV-1 integrase. It was shown that human lactoferricin, human lactoferrin 1-11, and bovine lactoferrampin reduced nuclear distribution of HIV-1 integrase. Bovine lactoferrampin could inhibit both the activity and nuclear translocation of HIV-1 integrase. Human lactoferrampin, bovine lactoferricin, and bovine lactoferrin 1-11 had no effect on HIV-1 integrase nuclear translocation. Human lactoferrampin which inhibited the activity of integrase did not prevent its nuclear translocation. Human lactoferricin and lactoferrin 1-11 did not inhibit HIV-1 integrase nuclear translocation despite their ability to attenuate the enzyme activity. The discrepancy between the findings on reduction of HIV-1 activity and inhibition of nuclear translocation of HIV-1 integrase was due to the different mechanisms involved. A similar reasoning can also be applied to the different inhibitory potencies of the milk peptides on different HIV enzymes, i.e., nuclear translocation.

  20. Mechanisms of inhibition of DNA replication by ultraviolet light in normal human and xeroderma pigmentosum fibroblasts

    International Nuclear Information System (INIS)

    Kaufmann, W.K.; Cleaver, J.E.

    1981-01-01

    The inhibition of DNA replication in ultraviolet-irradiated human fibroblasts was characterized by quantitative analysis of radiation-induced alterations in the steady-state distribution of sizes of pulse-labeled, nascent DNA. Low, noncytotoxic fluences rapidly produced an inhibition of DNA synthesis in half-replicon-size replication intermediates. With time, the inhibition produced by low fluences spread progressively to include multi-replicon-size intermediates. The results indicate that ultraviolet radiation inhibits the initiation of DNA synthesis in replicons. Higher cytotoxic fluences inhibited DNA synthesis in operating replicons. Xeroderma pigmentosum fibroblasts with deficiencies in DNA excision repair exhibited an inhibition of replicon initiation after low radiation fluences, indicating the effect was not solely dependent upon operation of the nucleotidyl excision repair pathway. Owing to their inability to remove pyrimidine dimers ahead of DNA growing points, the repair-deficient cells also were more sensitive than normal cells to the ultraviolet-induced inhibition of chain elongation. Xeroderma pigmentosum cells belonging to the variant class were even more sensitive to inhibition of chain elongation despite their ability to remove pyrimidine dimers. The analysis suggested that normal and repair-deficient human fibroblasts either are able to rapidly bypass certain dimers or these dimers are not recognized by the chain elongation machinery. (author)

  1. Inhibition of phospholipase A2 from human plasma by sodium bisulfite

    International Nuclear Information System (INIS)

    Wiggins, C.W.; Franson, R.C.

    1987-01-01

    The anti-oxidant sodium bisulfite has been shown to inhibit acid active(lysosomal), non-Ca ++ -dependent phospholipase A 2 (PLA 2 ), and to interact reversibly with unsaturated fatty acids, altering their chromatographic mobility. The authors examined the effect of bisulfite on neutral active, Ca ++ -dependent PLA 2 from human plasma. Using [1- 14 C]oleate-labelled autoclaved E. coli as substrate, PLA 2 activity was inhibited in a dose-dependent manner by bisulfite. Maximal inhibition occurred at 100μM bisulfite. Preincubation of plasma for 0-30 minutes with bisulfite resulted in a time-dependent increase in PLA 2 inhibition. Preincubation of substrate with bisulfite had no such effect. When the plasma PLA 2 was purified 25-fold by SP-Sephadex chromatography it was no longer inhibited by bisulfite. The SP-Sephadex wash through fraction, which contained greater than 95% of the applied protein but not PLA 2 activity, did not inhibit the purified enzyme. When incubated with bisulfite however, the SP-wash through fraction produced dose-dependent inhibition of the purified enzyme. These results indicate that sodium bisulfite inhibits human plasma PLA 2 , in vitro, indirectly by interaction with a factor(s) present in plasma and suggests that anti-oxidants may similarly influence expression of extracellular PLA 2 in vivo

  2. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  3. Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

    Science.gov (United States)

    Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

    2006-08-01

    Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

  4. Gastric inhibitory polypeptide does not inhibit gastric emptying in humans

    DEFF Research Database (Denmark)

    Meier, Juris J; Goetze, Oliver; Anstipp, Jens

    2004-01-01

    ) = 0.15, P = 0.15 for intact GIP; r(2) = 0.21, P = 0.086 for total GIP). We conclude that gastric emptying does not appear to be influenced by GIP. The secretion of GIP after meal ingestion is not suppressed by its exogenous administration. The lack of effect of GIP on gastric emptying underlines......The insulinotropic gut hormone gastric inhibitory polypeptide (GIP) has been demonstrated to inhibit gastric acid secretion and was proposed to possess "enterogastrone" activity. GIP effects on gastric emptying have not yet been studied. Fifteen healthy male volunteers (23.9 +/- 3.3 yr, body mass....... Gastric emptying was calculated from the (13)CO(2) exhalation rates in breath samples collected over 360 min. Venous blood was drawn in 30-min intervals for the determination of glucose, insulin, C-peptide, and GIP (total and intact). Statistical calculations were made by use of repeated-measures ANOVA...

  5. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter

    1994-01-01

    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  6. Antisense inhibition of hyaluronan synthase-2 in human osteosarcoma cells inhibits hyaluronan retention and tumorigenicity

    International Nuclear Information System (INIS)

    Nishida, Yoshihiro; Knudson, Warren; Knudson, Cheryl B.; Ishiguro, Naoki

    2005-01-01

    Osteosarcoma is a common malignant bone tumor associated with childhood and adolescence. The results of numerous studies have suggested that hyaluronan plays an important role in regulating the aggressive behavior of various types of cancer cells. However, no studies have addressed hyaluronan with respect to osteosarcomas. In this investigation, the mRNA expression copy number of three mammalian hyaluronan synthases (HAS) was determined using competitive RT-PCR in the osteoblastic osteosarcoma cell line, MG-63. MG-63 are highly malignant osteosarcoma cells with an abundant hyaluronan-rich matrix. The results demonstrated that HAS-2 is the predominant HAS in MG-63. Accumulation of intracellular hyaluronan increased in association with the proliferative phase of these cells. The selective inhibition of HAS-2 mRNA in MG-63 cells by antisense phosphorothioate oligonucleotides resulted in reduced hyaluronan accumulation by these cells. As expected, the reduction in hyaluronan disrupted the assembly of cell-associated matrices. However, of most interest, coincident with the reduction in hyaluronan, there was a substantial decrease in cell proliferation, a decrease in cell motility and a decrease in cell invasiveness. These data suggest that hyaluronan synthesized by HAS-2 in MG-63 plays a crucial role in osteosarcoma cell proliferation, motility, and invasion

  7. Assessment of the Developmental Toxicity of Epidermal Growth ...

    African Journals Online (AJOL)

    Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

  8. Inhibition of proliferation, migration and invasion of human non ...

    African Journals Online (AJOL)

    Purpose: To determine the effect of phlomisoside F (PMF) on the proliferation, migration and invasion of human non-small cell lung cancer cell line A549 and explore the possible mechanisms. Methods: The anti-proliferative effect of PMF on A549 cells was determined by CCK-8. Subsequently, migration and invasion were ...

  9. Inhibition of diabetes in NOD mice by human pregnancy factor

    NARCIS (Netherlands)

    Khan, N.A.; Khan, A.; Savelkoul, H.F.J.; Benner, R.

    2001-01-01

    Clinical symptoms of Th1 mediated autoimmune diseases regress in many patients during pregnancy. A prominent feature of pregnancy is the presence of human chorionic gonadotrophin hormone (hCG) in blood and urine. In this report we tested the effect of clinical grade hCG (c-hCG) on the development of

  10. Milk Oligosaccharides Inhibit Human Rotavirus Infectivity in MA104 Cells.

    Science.gov (United States)

    Laucirica, Daniel R; Triantis, Vassilis; Schoemaker, Ruud; Estes, Mary K; Ramani, Sasirekha

    2017-09-01

    Background: Oligosaccharides in milk act as soluble decoy receptors and prevent pathogen adhesion to the infant gut. Milk oligosaccharides reduce infectivity of a porcine rotavirus strain; however, the effects on human rotaviruses are less well understood. Objective: In this study, we determined the effect of specific and abundant milk oligosaccharides on the infectivity of 2 globally dominant human rotavirus strains. Methods: Four milk oligosaccharides-2'-fucosyllactose (2'FL), 3'-sialyllactose (3'SL), 6'-sialyllactose (6'SL), and galacto-oligosaccharides-were tested for their effects on the infectivity of human rotaviruses G1P[8] and G2P[4] through fluorescent focus assays on African green monkey kidney epithelial cells (MA104 cells). Oligosaccharides were added at different time points in the infectivity assays. Infections in the absence of oligosaccharides served as controls. Results: When compared with infections in the absence of glycans, all oligosaccharides substantially reduced the infectivity of both human rotavirus strains in vitro; however, virus strain-specific differences in effects were observed. Compared with control infections, the maximum reduction in G1P[8] infectivity was seen with 2'FL when added after the onset of infection (62% reduction, P rotaviruses in MA104 cells, primarily through an effect on the virus. Although breastfed infants are directly protected, the addition of specific oligosaccharides to infant formula may confer these benefits to formula-fed infants. © 2017 American Society for Nutrition.

  11. Comparison of oxime reactivation and aging of nerve agent-inhibited monkey and human acetylcholinesterases.

    Science.gov (United States)

    Luo, Chunyuan; Tong, Min; Maxwell, Donald M; Saxena, Ashima

    2008-09-25

    Non-human primates are valuable animal models that are used for the evaluation of nerve agent toxicity as well as antidotes and results from animal experiments are extrapolated to humans. It has been demonstrated that the efficacy of an oxime primarily depends on its ability to reactivate nerve agent-inhibited acetylcholinesterase (AChE). If the in vitro oxime reactivation of nerve agent-inhibited animal AChE is similar to that of human AChE, it is likely that the results of an in vivo animal study will reliably extrapolate to humans. Therefore, the goal of this study was to compare the aging and reactivation of human and different monkey (Rhesus, Cynomolgus, and African Green) AChEs inhibited by GF, GD, and VR. The oximes examined include the traditional oxime 2-PAM, two H-oximes HI-6 and HLo-7, and the new candidate oxime MMB4. Results indicate that oxime reactivation of all three monkey AChEs was very similar to human AChE. The maximum difference in the second-order reactivation rate constant between human and three monkey AChEs or between AChEs from different monkey species was 5-fold. Aging rate constants of GF-, GD-, and VR-inhibited monkey AChEs were very similar to human AChE except for GF-inhibited monkey AChEs, which aged 2-3 times faster than the human enzyme. The results of this study suggest that all three monkey species are suitable animal models for nerve agent antidote evaluation since monkey AChEs possess similar biochemical/pharmacological properties to human AChE.

  12. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  13. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  14. Inhibiting the Ca2+ Influx Induced by Human CSF

    Directory of Open Access Journals (Sweden)

    Anna Drews

    2017-12-01

    Full Text Available One potential therapeutic strategy for Alzheimer’s disease (AD is to use antibodies that bind to small soluble protein aggregates to reduce their toxic effects. However, these therapies are rarely tested in human CSF before clinical trials because of the lack of sensitive methods that enable the measurement of aggregate-induced toxicity at low concentrations. We have developed highly sensitive single vesicle and single-cell-based assays that detect the Ca2+ influx caused by the CSF of individuals affected with AD and healthy controls, and we have found comparable effects for both types of samples. We also show that an extracellular chaperone clusterin; a nanobody specific to the amyloid-β peptide (Aβ; and bapineuzumab, a humanized monoclonal antibody raised against Aβ, could all reduce the Ca2+ influx caused by synthetic Aβ oligomers but are less effective in CSF. These assays could be used to characterize potential therapeutic agents in CSF before clinical trials.

  15. Serum protein inhibition of thyrotropin binding to human thyroid tissue

    International Nuclear Information System (INIS)

    Beall, G.N.; Chopra, I.J.; Solomon, D.H.; Kruger, S.R.

    1978-01-01

    We used a modificaton of the TSH radioreceptor assay to detect TSH-binding inhibition (TBI) activity in serum and serum fractions from normal subjects and patients with Graves' disease. TBI activity is present in normal IgG prepared by DEAE-Sephadex chromatography and in normal globulins prepared by precipitation at 1.6 M ammonium sulfate. Other normal serum proteins also had TBI activity when large concentrations were tested. Gel filtration chromatography and powder block electrophoresis were used to prepare fractions of normal and Graves' disease sera. In these fractions from normal serum, TBI activity was found in both γ-globulin and α-globulin-albumin fractions electrophoretically and in both 7S and 4S peaks from gel filtration. TBI activity from Graves' disease patients' sera was similarly distributed, but relatively more TBI accompanied the electrophoretic γ-globulins. Sepharose Protein-A and anti-IgG were used as immunoabsorbents to isolate and purify IgG from normal and Graves' disease sera. TBI activity in IgG was proportional to the IgG concentration, indicating that the TBI which migrates as a γ-globulin electrophoretically is an IgG and thus may possibly be an antibody. Inhibitory activity found in normal serum globulins and in the non-IgG fractions of both normal and abnormal sera seriously interferes with attempts to use the TSH radioreceptor assay to study the hypothesized anti-TSH receptor antibody in the serum of patients with Graves' disease

  16. Structural Basis of Human CYP51 Inhibition by Antifungal Azoles

    Energy Technology Data Exchange (ETDEWEB)

    Strushkevich, Natallia; Usanov, Sergey A.; Park, Hee-Won (Toronto); (IBC-Belarus)

    2010-09-22

    The obligatory step in sterol biosynthesis in eukaryotes is demethylation of sterol precursors at the C14-position, which is catalyzed by CYP51 (sterol 14-alpha demethylase) in three sequential reactions. In mammals, the final product of the pathway is cholesterol, while important intermediates, meiosis-activating sterols, are produced by CYP51. Three crystal structures of human CYP51, ligand-free and complexed with antifungal drugs ketoconazole and econazole, were determined, allowing analysis of the molecular basis for functional conservation within the CYP51 family. Azole binding occurs mostly through hydrophobic interactions with conservative residues of the active site. The substantial conformational changes in the B{prime} helix and F-G loop regions are induced upon ligand binding, consistent with the membrane nature of the protein and its substrate. The access channel is typical for mammalian sterol-metabolizing P450 enzymes, but is different from that observed in Mycobacterium tuberculosis CYP51. Comparison of the azole-bound structures provides insight into the relative binding affinities of human and bacterial P450 enzymes to ketoconazole and fluconazole, which can be useful for the rational design of antifungal compounds and specific modulators of human CYP51.

  17. Advanced Glycation End Products Inhibit the Proliferation of Human Umbilical Vein Endothelial Cells by Inhibiting Cathepsin D

    Directory of Open Access Journals (Sweden)

    Yuan Li

    2017-02-01

    Full Text Available We aimed to investigate the effect of advanced glycation end products (AGEs on the proliferation and migration ability of human umbilical vein endothelial cells (HUVECs. Cell proliferation was detected by methyl thiazolyl tetrazolium (MTT assay, real-time cell analyzer and 5-Ethynyl-2′-deoxyuridine (EdU staining. Cell migration was detected by wound-healing and transwell assay. AGEs significantly inhibited the proliferation and migration of HUVECs in a time-and dose-dependent way. Western blotting revealed that AGEs dramatically increased the expression of microtubule-associated protein 1 light chain 3 (LC3 II/I and p62. Immunofluorescence of p62 and acridine orange staining revealed that AGEs significantly increased the expression of p62 and the accumulation of autophagic vacuoles, respectively. Chloroquine (CQ could further promote the expression of LC3 II/I and p62, increase the accumulation of autophagic vacuoles and promote cell injury induced by AGEs. In addition, AGEs reduced cathepsin D (CTSD expression in a time-dependent way. Overexpression of wild-type CTSD significantly decreased the ratio of LC 3 II/I as well as p62 accumulation induced by AGEs, but overexpression of catalytically inactive mutant CTSD had no such effects. Only overexpression of wild-type CTSD could restore the proliferation of HUVECs inhibited by AGEs. However, overexpression of both wild-type CTSD and catalytically inactive mutant CTSD could promote the migration of HUVECs inhibited by AGEs. Collectively, our study found that AGEs inhibited the proliferation and migration in HUVECs and promoted autophagic flux, which in turn played a protective role against AGEs-induced cell injury. CTSD, in need of its catalytic activity, may promote proliferation in AGEs-treated HUVECs independent of the autophagy-lysosome pathway. Meanwhile, CTSD could improve the migration of AGEs-treated HUVECs regardless of its enzymatic activity.

  18. Advanced Glycation End Products Inhibit the Proliferation of Human Umbilical Vein Endothelial Cells by Inhibiting Cathepsin D.

    Science.gov (United States)

    Li, Yuan; Chang, Ye; Ye, Ning; Dai, Dongxue; Chen, Yintao; Zhang, Naijin; Sun, Guozhe; Sun, Yingxian

    2017-02-17

    We aimed to investigate the effect of advanced glycation end products (AGEs) on the proliferation and migration ability of human umbilical vein endothelial cells (HUVECs). Cell proliferation was detected by methyl thiazolyl tetrazolium (MTT) assay, real-time cell analyzer and 5-Ethynyl-2'-deoxyuridine (EdU) staining. Cell migration was detected by wound-healing and transwell assay. AGEs significantly inhibited the proliferation and migration of HUVECs in a time-and dose-dependent way. Western blotting revealed that AGEs dramatically increased the expression of microtubule-associated protein 1 light chain 3 (LC3) II/I and p62. Immunofluorescence of p62 and acridine orange staining revealed that AGEs significantly increased the expression of p62 and the accumulation of autophagic vacuoles, respectively. Chloroquine (CQ) could further promote the expression of LC3 II/I and p62, increase the accumulation of autophagic vacuoles and promote cell injury induced by AGEs. In addition, AGEs reduced cathepsin D (CTSD) expression in a time-dependent way. Overexpression of wild-type CTSD significantly decreased the ratio of LC 3 II/I as well as p62 accumulation induced by AGEs, but overexpression of catalytically inactive mutant CTSD had no such effects. Only overexpression of wild-type CTSD could restore the proliferation of HUVECs inhibited by AGEs. However, overexpression of both wild-type CTSD and catalytically inactive mutant CTSD could promote the migration of HUVECs inhibited by AGEs. Collectively, our study found that AGEs inhibited the proliferation and migration in HUVECs and promoted autophagic flux, which in turn played a protective role against AGEs-induced cell injury. CTSD, in need of its catalytic activity, may promote proliferation in AGEs-treated HUVECs independent of the autophagy-lysosome pathway. Meanwhile, CTSD could improve the migration of AGEs-treated HUVECs regardless of its enzymatic activity.

  19. Why Do SGLT2 inhibitors inhibit only 30-50% of renal glucose reabsorption in humans?

    Science.gov (United States)

    Liu, Jiwen Jim; Lee, TaeWeon; DeFronzo, Ralph A

    2012-09-01

    Sodium glucose cotransporter 2 (SGLT2) inhibition is a novel and promising treatment for diabetes under late-stage clinical development. It generally is accepted that SGLT2 mediates 90% of renal glucose reabsorption. However, SGLT2 inhibitors in clinical development inhibit only 30-50% of the filtered glucose load. Why are they unable to inhibit 90% of glucose reabsorption in humans? We will try to provide an explanation to this puzzle in this perspective analysis of the unique pharmacokinetic and pharmacodynamic profiles of SGLT2 inhibitors in clinical trials and examine possible mechanisms and molecular properties that may be responsible.

  20. Why Do SGLT2 Inhibitors Inhibit Only 30–50% of Renal Glucose Reabsorption in Humans?

    Science.gov (United States)

    Liu, Jiwen (Jim); Lee, TaeWeon; DeFronzo, Ralph A.

    2012-01-01

    Sodium glucose cotransporter 2 (SGLT2) inhibition is a novel and promising treatment for diabetes under late-stage clinical development. It generally is accepted that SGLT2 mediates 90% of renal glucose reabsorption. However, SGLT2 inhibitors in clinical development inhibit only 30–50% of the filtered glucose load. Why are they unable to inhibit 90% of glucose reabsorption in humans? We will try to provide an explanation to this puzzle in this perspective analysis of the unique pharmacokinetic and pharmacodynamic profiles of SGLT2 inhibitors in clinical trials and examine possible mechanisms and molecular properties that may be responsible. PMID:22923645

  1. Inhibition of histamine and eicosanoid release from dispersed human lung cells in vitro by quinotolast.

    Science.gov (United States)

    Okayama, Y; Hiroi, J; Lau, L C; Church, M K

    1995-12-01

    We have examined the effects of a new anti-allergic drug, quinotolast [sodium 5-(4-oxo-1-phenoxy-4H-quinolizine-3-carboxamido) yetrazolate monohydrate], in inhibiting the release of histamine and the generation of leukotriene (LT) C4 and prostaglandin (PG) D2 from dispersed human lung cells and compared this with those of its active metabolite in the rat, hydroxy quinotolast, and reference drugs, tranilast and sodium cromoglycate (SCG). Quinotolast in the concentration range of 1-100 micrograms/ml inhibited histamine and LTC4 release in a concentration-dependent manner. The inhibitory effect of quinotolast on histamine release from dispersed lung cells was largely independent of the preincubation period, no tachyphylaxis being observed. Hydroxy quinotolast and tranilast showed a weak inhibition of histamine release only when the drugs were added to the cells simultaneously with anti-IgE challenge. Quinotolast, 100 micrograms/ml, and SCG, 1 mM, significantly inhibited PGD2 and LTC4 release. Quinotolast inhibited PGD2 release by 100% and LTC4 release by 54%, whereas SCG inhibited PDG2 release by 33% and LTC4 release by 100%. No cross-tachyphylaxis between quinotolast and SCG was observed. The results demonstrated that quinotolast showed a significant inhibition of inflammatory mediators from human dispersed lung cells, suggesting that quinotolast is a good candidate for a clinical anti-allergic drug.

  2. Brassinosteroids inhibit in vitro angiogenesis in human endothelial cells

    Czech Academy of Sciences Publication Activity Database

    Rárová, L.; Zahler, S.; Liebl, J.; Kryštof, Vladimír; Sedlák, David; Bartůněk, Petr; Kohout, Ladislav; Strnad, Miroslav

    2012-01-01

    Roč. 77, č. 13 (2012), s. 1502-1509 ISSN 0039-128X R&D Projects: GA MŠk(CZ) LC06077 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50520514; CEZ:AV0Z40550506 Keywords : Angiogenesis * Human umbilical vein endothelial cells * Migration Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.803, year: 2012

  3. Humanized-VHH Transbodies that Inhibit HCV Protease and Replication

    Directory of Open Access Journals (Sweden)

    Surasak Jittavisutthikul

    2015-04-01

    Full Text Available There is a need for safe and broadly effective anti-HCV agents that can cope with genetic multiplicity and mutations of the virus. In this study, humanized-camel VHHs to genotype 3a HCV serine protease were produced and were linked molecularly to a cell penetrating peptide, penetratin (PEN. Human hepatic (Huh7 cells transfected with the JFH-1 RNA of HCV genotype 2a and treated with the cell penetrable nanobodies (transbodies had a marked reduction of the HCV RNA intracellularly and in their culture fluids, less HCV foci inside the cells and less amounts of HCV core antigen in culture supernatants compared with the infected cells cultured in the medium alone. The PEN-VHH-treated-transfected cells also had up-regulation of the genes coding for the host innate immune response (TRIF, TRAF3, IRF3, IL-28B and IFN-β, indicating that the cell penetrable nanobodies rescued the host innate immune response from the HCV mediated-suppression. Computerized intermolecular docking revealed that the VHHs bound to residues of the protease catalytic triad, oxyanion loop and/or the NS3 N-terminal portion important for non-covalent binding of the NS4A protease cofactor protein. The so-produced transbodies have high potential for testing further as a candidate for safe, broadly effective and virus mutation tolerable anti-HCV agents.

  4. Inhibition of Human Arginase I by Substrate adn Product Analogues

    Energy Technology Data Exchange (ETDEWEB)

    L Di Costanzo; M Ilies; K Thorn; D Christianson

    2011-12-31

    Human arginase I is a binuclear manganese metalloenzyme that catalyzes the hydrolysis of L-arginine to generate L-ornithine and urea. We demonstrate that N-hydroxy-L-arginine (NOHA) binds to this enzyme with K(d)=3.6 microM, and nor-N-hydroxy-L-arginine (nor-NOHA) binds with K(d)=517 nM (surface plasmon resonance) or K(d) approximately 50 nM (isothermal titration calorimetry). Crystals of human arginase I complexed with NOHA and nor-NOHA afford 2.04 and 1.55 A resolution structures, respectively, which are significantly improved in comparison with previously-determined structures of the corresponding complexes with rat arginase I. Higher resolution structures clarify the binding interactions of the inhibitors. Finally, the crystal structure of the complex with L-lysine (K(d)=13 microM) is reported at 1.90 A resolution. This structure confirms the importance of hydrogen bond interactions with inhibitor alpha-carboxylate and alpha-amino groups as key specificity determinants of amino acid recognition in the arginase active site.

  5. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  6. Inhibition of nitric oxide synthesis enhances leukocyte rolling and adhesion in human microvasculature

    Directory of Open Access Journals (Sweden)

    Hossain Mokarram

    2012-07-01

    Full Text Available Abstract Background Nitric oxide (NO is a multifunctional signaling molecule that regulates important cellular events in inflammation including leukocyte recruitment. Previous studies have shown that pharmacological inhibition of NO synthesis induces leukocyte recruitment in various in vitro and animal models. However, it is not known whether NO modulation has similar effects on leukocyte-endothelial cell interactions within the human microvasculature. The present study explored the effect of systemic L-NAME treatment on leukocyte recruitment in the SCID-hu mouse model. Methods Human skin xenografts were transplanted in SCID mice to study human leukocyte dynamics in human vasculature. Early events of human leukocyte recruitment in human vasculature were studied using intravital microscopy. NO synthesis was pharmacologically inhibited using NG-nitro-L-arginine methyl ester (L-NAME. Immunohistochemical analysis was performed to elucidate E-selectin expression in human xenograft skin. Human neutrophil-endothelial cell interactions were also studied in an in vitro flow chamber assay system. P- and E-selectin expression on cultured human umbilical vein endothelial cells (HUVECs was measured using ELISA. Platelet-activating factor (PAF synthesis was detected using a TLC-based assay. Results L-NAME treatment significantly enhanced the rolling and adhesion of human leukocytes to the human vasculature. Functional blocking of P- and E-selectins significantly inhibited rolling but not adhesion induced by inhibition of NO synthesis. Systemic L-NAME treatment enhanced E-selectin expression in human xenograft skin. L-NAME treatment significantly enhanced P- and E-selectin expression on HUVECs. L-NAME treatment did not significantly modify neutrophil rolling or adhesion to HUVECs indicating that L-NAME−induced subtle P- and E-selectin expression was insufficient to elicit dynamic neutrophil-HUVEC interactions in vitro. Moreover, synthesis of endothelial

  7. Diterpenoids from Tetraclinis articulata that inhibit various human leukocyte functions.

    Science.gov (United States)

    Barrero, Alejandro F; Quílez del Moral, José F; Lucas, Rut; Payá, Miguel; Akssira, Mohamed; Akaad, Said; Mellouki, Fouad

    2003-06-01

    Ten new compounds, eight of them pimarane derivatives (1-8), together with a menthane dimer (9) and a totarane diterpenoid (10), were isolated from the leaves and wood of Tetraclinis articulata. The structures of 1-10 were established by using spectroscopic techniques, including 2D NMR spectra. Pimaranes 1-5 were found to possess an unusual cis interannular union of the B and C rings, which, from a biogenetic perspective, could be derived from the hydration of a carbocation at C-8. Compounds 4-6 and a mixture of 7 and 11 modulated different human leukocyte functions at a concentration of 10 microM, mainly the degranulation process measured as myeloperoxidase release and, to a lesser extent, the superoxide production measured by chemiluminescence.

  8. Human Neutralizing Monoclonal Antibody Inhibition of Middle East Respiratory Syndrome Coronavirus Replication in the Common Marmoset.

    Science.gov (United States)

    Chen, Zhe; Bao, Linlin; Chen, Cong; Zou, Tingting; Xue, Ying; Li, Fengdi; Lv, Qi; Gu, Songzhi; Gao, Xiaopan; Cui, Sheng; Wang, Jianmin; Qin, Chuan; Jin, Qi

    2017-06-15

    Middle East respiratory syndrome coronavirus (MERS-CoV) infection in humans is highly lethal, with a fatality rate of 35%. New prophylactic and therapeutic strategies to combat human infections are urgently needed. We isolated a fully human neutralizing antibody, MCA1, from a human survivor. The antibody recognizes the receptor-binding domain of MERS-CoV S glycoprotein and interferes with the interaction between viral S and the human cellular receptor human dipeptidyl peptidase 4 (DPP4). To our knowledge, this study is the first to report a human neutralizing monoclonal antibody that completely inhibits MERS-CoV replication in common marmosets. Monotherapy with MCA1 represents a potential alternative treatment for human infections with MERS-CoV worthy of evaluation in clinical settings. © Crown copyright 2017.

  9. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  10. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  11. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  12. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial

    Science.gov (United States)

    Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C.; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I.; McCullough, Ann E.; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P.; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W.; Wolff, Antonio C.; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D.; Perez, Edith A.

    2016-01-01

    Background Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2–positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. Methods In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2–positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Results Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Conclusion Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. PMID:26598744

  13. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial.

    Science.gov (United States)

    Piccart-Gebhart, Martine; Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I; McCullough, Ann E; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W; Wolff, Antonio C; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D; Perez, Edith A

    2016-04-01

    Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2-positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2-positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. © 2015 by American Society of Clinical Oncology.

  14. Single-wall carbon nanohorns (SWNHs) inhibited proliferation of human glioma cells and promoted its apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yunjun [The Military General Hospital of Beijing PLA, Affiliated Bayi Brain Hospital (China); Zhang, Jinqian, E-mail: jingwanghou@yahoo.com.cn [Capital Medical University, Institute of Infectious Diseases, Beijing Ditan Hospital (China); Zhao, Ming [Peking University, Department of Chemical Biology, School of Pharmaceutical Sciences (China); Shi, Zujin [Peking University, Beijing National Laboratory for Molecular Sciences, State Key Laboratory of Rare Earth Materials Chemistry and Applications, College of Chemistry and Molecular Engineering (China); Chen, Xin; He, Xihui; Han, Nanyin, E-mail: jingwanghou@sina.com [Peking University, Department of Chemical Biology, School of Pharmaceutical Sciences (China); Xu, Ruxiang, E-mail: everbright999@163.com [The Military General Hospital of Beijing PLA, Affiliated Bayi Brain Hospital (China)

    2013-08-15

    Although single-wall carbon nanohorns (SWNHs) have been demonstrated to accumulate to cytotoxic levels within organs of various animal models and cell types, they have been exploited for cancer therapies. The role of SWNHs in human glioma cell lines was unclear. To address this question, the research about direct role of SWNHs on the growth, proliferation, and apoptosis of human glioma cell lines (U87, U251, and U373) had been performed. Our results indicate that particle size of SWNHs in water is between 342 and 712 nm, the films of SEM show that SWNHs on PS surface are individual particles. SWNHs significantly delayed mitotic entry of human glioma cell lines cells, and inhibited its proliferation in a time- and dose-dependent manner. SWNHs induced a significant increase in G1 phase and inhibition of S phase followed the gradually increasing concentrations. SWNHs in human glioma cell lines cells significantly induced apoptosis followed by their gradually increasing concentrations. The TEM images showed that individual spherical SWNHs particles smaller than 100 nm in diameters were localized inside lysosomes of human glioma cell lines. SWNHs inhibited mitotic entry, growth, and proliferation of human glioma cell lines, and promoted its apoptosis. SWNHs may be a novel opportunity or method for the research on treatment of human glioma.

  15. Single-wall carbon nanohorns (SWNHs) inhibited proliferation of human glioma cells and promoted its apoptosis

    Science.gov (United States)

    Li, Yunjun; Zhang, Jinqian; Zhao, Ming; Shi, Zujin; Chen, Xin; He, Xihui; Han, Nanyin; Xu, Ruxiang

    2013-08-01

    Although single-wall carbon nanohorns (SWNHs) have been demonstrated to accumulate to cytotoxic levels within organs of various animal models and cell types, they have been exploited for cancer therapies. The role of SWNHs in human glioma cell lines was unclear. To address this question, the research about direct role of SWNHs on the growth, proliferation, and apoptosis of human glioma cell lines (U87, U251, and U373) had been performed. Our results indicate that particle size of SWNHs in water is between 342 and 712 nm, the films of SEM show that SWNHs on PS surface are individual particles. SWNHs significantly delayed mitotic entry of human glioma cell lines cells, and inhibited its proliferation in a time- and dose-dependent manner. SWNHs induced a significant increase in G1 phase and inhibition of S phase followed the gradually increasing concentrations. SWNHs in human glioma cell lines cells significantly induced apoptosis followed by their gradually increasing concentrations. The TEM images showed that individual spherical SWNHs particles smaller than 100 nm in diameters were localized inside lysosomes of human glioma cell lines. SWNHs inhibited mitotic entry, growth, and proliferation of human glioma cell lines, and promoted its apoptosis. SWNHs may be a novel opportunity or method for the research on treatment of human glioma.

  16. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  17. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  18. Inhibition of human UDP-glucuronosyltransferase enzymes by lapatinib, pazopanib, regorafenib and sorafenib: Implications for hyperbilirubinemia.

    Science.gov (United States)

    Miners, John O; Chau, Nuy; Rowland, Andrew; Burns, Kushari; McKinnon, Ross A; Mackenzie, Peter I; Tucker, Geoffrey T; Knights, Kathleen M; Kichenadasse, Ganessan

    2017-04-01

    Kinase inhibitors (KIs) are a rapidly expanding class of drugs used primarily for the treatment of cancer. Data relating to the inhibition of UDP-glucuronosyltransferase (UGT) enzymes by KIs is sparse. However, lapatinib (LAP), pazopanib (PAZ), regorafenib (REG) and sorafenib (SOR) have been implicated in the development of hyperbilirubinemia in patients. This study aimed to characterise the role of UGT1A1 inhibition in hyperbilirubinemia and assess the broader potential of these drugs to perpetrate drug-drug interactions arising from UGT enzyme inhibition. Twelve recombinant human UGTs from subfamilies 1A and 2B were screened for inhibition by LAP, PAZ, REG and SOR. IC 50 values for the inhibition of all UGT1A enzymes, except UGT1A3 and UGT1A4, by the four KIs were enzyme identified to date. In vitro-in vivo extrapolation indicates that inhibition of UGT1A1 contributes significantly to the hyperbilirubinemia observed in patients treated with REG and SOR, but not with LAP and PAZ. Inhibition of other UGT1A1 substrates in vivo is likely. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Modulation of recurrent inhibition from knee extensors to ankle motoneurones during human walking

    DEFF Research Database (Denmark)

    Lamy, Jean-Charles; Iglesias, Caroline; Lackmy, Alexandra

    2008-01-01

    The neural control for muscle coordination during human locomotion involves spinal and supraspinal networks, but little is known about the exact mechanisms implicated. The present study focused on modulation of heteronymous recurrent inhibition from knee extensors to ankle motoneurones at different...... times in the gait cycle, when quadriceps (Quad) muscle activity overlaps that in tibialis anterior (TA) and soleus (Sol). The effects of femoral nerve stimulation on ankle motoneurones were investigated during treadmill walking and during tonic co-contraction of Quad and TA/Sol while standing. Recurrent...... inhibition of TA motoneurones depended on the level of background EMG, and was similar during walking and standing for matched background EMG levels. On the other hand, recurrent inhibition in Sol was reduced in early stance, with respect to standing, and enhanced in late stance. Reduced inhibition in Sol...

  20. Vanadate monomers and dimers both inhibit the human prostatic acid phosphatase.

    Science.gov (United States)

    Crans, D C; Simone, C M; Saha, A K; Glew, R H

    1989-11-30

    A combination of enzyme kinetics and 51V NMR spectroscopy was used to identify the species of vanadate that inhibits acid phosphatases. Monomeric vanadate was shown to inhibit wheat germ and potato acid phosphatases. At pH 5.5, the vanadate dimer inhibits the human prostatic acid phosphatase whereas at pH 7.0 it is the vanadate monomer that inhibits this enzyme. The pH-dependent shift in the affinity of the prostatic phosphatase for vanadate is presumably due to deprotonation of an amino acid side chain in or near the binding site resulting in a conformational change in the protein. pH may be a subtle effector of the insulin-like vanadate activity in biological systems and may explain some of the differences in selectivity observed with the protein phosphatases.

  1. Cordycepin Induces Apoptosis and Inhibits Proliferation of Human Lung Cancer Cell Line H1975 via Inhibiting the Phosphorylation of EGFR

    Directory of Open Access Journals (Sweden)

    Zheng Wang

    2016-09-01

    Full Text Available Cordycepin is an active component of the traditional Chinese medicine Cordyceps sinensis and Cordyceps militaris with notable anticancer activity. Though the prominent inhibitory activity was reported in different kinds of cancer cell lines, the concrete mechanisms remain elusive. It was reported that cordycepin could be converted into tri-phosphates in vivo to confuse a number of enzymes and interfere the normal cell function. For the inhibitory mechanism of EGFR inhibitors and the structure similarity of ATP and tri-phosphated cordycepin, human lung cancer cell line H1975 was employed to investigate the inhibitory effect of cordycepin. The results showed that cordycepin could inhibit cell proliferation and induce apoptosis in a dose-dependent manner. Cell cycle analysis revealed that H1975 cells could be arrested at the G0/G1 phase after cordycepin treatment. The expression levels of apoptosis-related protein Caspase-3 and Bcl-2 and phosphorylated expression levels of EGFR, AKT and ERK1/2 were all decreased compared with the control group stimulated with EGF. However, the protein expression levels of proapoptotic protein Bax and cleaved caspase-3 were increased. These results implied that cordycepin could inhibit cell proliferation and induce apoptosis via the EGFR signaling pathway. Our results indicated that there was potential to seek a novel EGFR inhibitor from cordycepin and its chemical derivatives.

  2. Comparative sensitivity of human and rat neural cultures to chemical-induced inhibition of neurite outgrowth

    Energy Technology Data Exchange (ETDEWEB)

    Harrill, Joshua A.; Freudenrich, Theresa M.; Robinette, Brian L.; Mundy, William R., E-mail: mundy.william@epa.gov

    2011-11-15

    There is a need for rapid, efficient and cost-effective alternatives to traditional in vivo developmental neurotoxicity testing. In vitro cell culture models can recapitulate many of the key cellular processes of nervous system development, including neurite outgrowth, and may be used as screening tools to identify potential developmental neurotoxicants. The present study compared primary rat cortical cultures and human embryonic stem cell-derived neural cultures in terms of: 1) reproducibility of high content image analysis based neurite outgrowth measurements, 2) dynamic range of neurite outgrowth measurements and 3) sensitivity to chemicals which have been shown to inhibit neurite outgrowth. There was a large increase in neurite outgrowth between 2 and 24 h in both rat and human cultures. Image analysis data collected across multiple cultures demonstrated that neurite outgrowth measurements in rat cortical cultures were more reproducible and had higher dynamic range as compared to human neural cultures. Human neural cultures were more sensitive than rat cortical cultures to chemicals previously shown to inhibit neurite outgrowth. Parallel analysis of morphological (neurite count, neurite length) and cytotoxicity (neurons per field) measurements were used to detect selective effects on neurite outgrowth. All chemicals which inhibited neurite outgrowth in rat cortical cultures did so at concentrations which did not concurrently affect the number of neurons per field, indicating selective effects on neurite outgrowth. In contrast, more than half the chemicals which inhibited neurite outgrowth in human neural cultures did so at concentrations which concurrently decreased the number of neurons per field, indicating that effects on neurite outgrowth were secondary to cytotoxicity. Overall, these data demonstrate that the culture models performed differently in terms of reproducibility, dynamic range and sensitivity to neurite outgrowth inhibitors. While human neural

  3. Comparative sensitivity of human and rat neural cultures to chemical-induced inhibition of neurite outgrowth

    International Nuclear Information System (INIS)

    Harrill, Joshua A.; Freudenrich, Theresa M.; Robinette, Brian L.; Mundy, William R.

    2011-01-01

    There is a need for rapid, efficient and cost-effective alternatives to traditional in vivo developmental neurotoxicity testing. In vitro cell culture models can recapitulate many of the key cellular processes of nervous system development, including neurite outgrowth, and may be used as screening tools to identify potential developmental neurotoxicants. The present study compared primary rat cortical cultures and human embryonic stem cell-derived neural cultures in terms of: 1) reproducibility of high content image analysis based neurite outgrowth measurements, 2) dynamic range of neurite outgrowth measurements and 3) sensitivity to chemicals which have been shown to inhibit neurite outgrowth. There was a large increase in neurite outgrowth between 2 and 24 h in both rat and human cultures. Image analysis data collected across multiple cultures demonstrated that neurite outgrowth measurements in rat cortical cultures were more reproducible and had higher dynamic range as compared to human neural cultures. Human neural cultures were more sensitive than rat cortical cultures to chemicals previously shown to inhibit neurite outgrowth. Parallel analysis of morphological (neurite count, neurite length) and cytotoxicity (neurons per field) measurements were used to detect selective effects on neurite outgrowth. All chemicals which inhibited neurite outgrowth in rat cortical cultures did so at concentrations which did not concurrently affect the number of neurons per field, indicating selective effects on neurite outgrowth. In contrast, more than half the chemicals which inhibited neurite outgrowth in human neural cultures did so at concentrations which concurrently decreased the number of neurons per field, indicating that effects on neurite outgrowth were secondary to cytotoxicity. Overall, these data demonstrate that the culture models performed differently in terms of reproducibility, dynamic range and sensitivity to neurite outgrowth inhibitors. While human neural

  4. Probenecid inhibits α-adrenergic receptor-mediated vasoconstriction in the human leg vasculature

    DEFF Research Database (Denmark)

    Nyberg, Michael Permin; Piil, Peter Bergmann; Kiehn, Oliver Thistrup

    2018-01-01

    to α1- and α2-adrenergic receptor stimulation in the human forearm and leg vasculature of young healthy male subjects (23±3 years). By use of immunolabeling and confocal microscopy, Panx1 channels were found to be expressed in vascular smooth muscle cells of arterioles in human leg skeletal muscle....... Probenecid treatment increased (Padrenergic receptor stimulation) by ≈15%, whereas the response to the α1-agonist phenylephrine was unchanged. Inhibition...

  5. MiR-1254 inhibits proliferation, migration and invasion of human ...

    African Journals Online (AJOL)

    MiR-1254 inhibits proliferation, migration and invasion of human brain tumour cell lines. ... The transcripts were analysed by real-time polymerase chain reaction (RT-PCR) ... Over-expression of miR- 1254 also led to significant decrease in cell ...

  6. Inhibition of uropathogenic biofilm growth on silicone rubber in human urine by lactobacilli - a teleologic approach

    NARCIS (Netherlands)

    Velraeds, MMC; van de Belt-Gritter, B; Busscher, HJ; Reid, G; van der Mei, HC

    2000-01-01

    The ability of three Lactobacillus strains to inhibit the adhesion and growth of naturally occurring uropathogens on silicone rubber was investigated in human urine. The importance of biosurfactant production by Lactobacillus in discouraging uropathogen growth was determined in relation to the

  7. Inhibition of ultraviolet irradiation response of human skin by topical phlogostatic compounds

    International Nuclear Information System (INIS)

    Weirich, E.G.; Lutz, U.C.

    1977-01-01

    By adaption of the model of UV dermatitis in human skin a test procedure has been developed which facilitates realistic assessment of topical contra-inflammatory activity of steroidal as well as non-steroidal compounds. Sixt typical skin drug agents were tested according to their reaction inhibition effect. (orig./MG) [de

  8. Inhibition of nuclear factor-kappa B activation decreases survival of Mycobacterium tuberculosis in human macrophages.

    Directory of Open Access Journals (Sweden)

    Xiyuan Bai

    Full Text Available Nuclear factor-kappa B (NFκB is a ubiquitous transcription factor that mediates pro-inflammatory responses required for host control of many microbial pathogens; on the other hand, NFκB has been implicated in the pathogenesis of other inflammatory and infectious diseases. Mice with genetic disruption of the p50 subunit of NFκB are more likely to succumb to Mycobacterium tuberculosis (MTB. However, the role of NFκB in host defense in humans is not fully understood. We sought to examine the role of NFκB activation in the immune response of human macrophages to MTB. Targeted pharmacologic inhibition of NFκB activation using BAY 11-7082 (BAY, an inhibitor of IκBα kinase or an adenovirus construct with a dominant-negative IκBα significantly decreased the number of viable intracellular mycobacteria recovered from THP-1 macrophages four and eight days after infection. The results with BAY were confirmed in primary human monocyte-derived macrophages and alveolar macrophages. NFκB inhibition was associated with increased macrophage apoptosis and autophagy, which are well-established killing mechanisms of intracellular MTB. Inhibition of the executioner protease caspase-3 or of the autophagic pathway significantly abrogated the effects of BAY. We conclude that NFκB inhibition decreases viability of intracellular MTB in human macrophages via induction of apoptosis and autophagy.

  9. Potent inhibition of cytochrome P450 2B6 by sibutramine in human liver microsomes.

    Science.gov (United States)

    Bae, Soo Hyeon; Kwon, Min Jo; Choi, Eu Jin; Zheng, Yu Fen; Yoon, Kee Dong; Liu, Kwang-Hyeon; Bae, Soo Kyung

    2013-09-05

    The present study was performed to evaluate the potency and specificity of sibutramine as an inhibitor of the activities of nine human CYP isoforms in liver microsomes. Using a cocktail assay, the effects of sibutramine on specific marker reactions of the nine CYP isoforms were measured in human liver microsomes. Sibutramine showed potent inhibition of CYP2B6-mediated bupropion 6-hydroxylation with an IC50 value of 1.61μM and Ki value of 0.466μM in a competitive manner at microsomal protein concentrations of 0.25mg/ml; this was 3.49-fold more potent than the typical CYP2B6 inhibitor thio-TEPA (Ki=1.59μM). In addition, sibutramine slightly inhibited CYP2C19 activity (Ki=16.6μM, noncompetitive inhibition) and CYP2D6 activity (Ki=15.7μM, noncompetitive inhibition). These observations indicated 35.6- and 33.7-fold decreases in inhibition potency, respectively, compared with that of CYP2B6 by sibutramine. However, no inhibition of CYP1A2, CYP2A6, CYP2C8, CYP2C9, CYP2D6, or CYP2E1 activities was observed. In addition, the CYP2B6 inhibitory potential of sibutramine was enhanced at a lower microsomal protein concentration of 0.05mg/ml. After 30min preincubation of human liver microsomes with sibutramine in the presence of NADPH, no shift in IC50 was observed in terms of inhibition of the activities of the nine CYPs, suggesting that sibutramine is not a time-dependent inactivator. These observations suggest that sibutramine is a selective and potent inhibitor of CYP2B6 in vitro, whereas inhibition of other CYPs is substantially lower. These in vitro data support the use of sibutramine as a well-known inhibitor of CYP2B6 for routine screening of P450 reversible inhibition when human liver microsomes are used as the enzyme source. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Human Adipose Mesenchymal Cells Inhibit Melanocyte Differentiation and the Pigmentation of Human Skin via Increased Expression of TGF-β1.

    Science.gov (United States)

    Klar, Agnes S; Biedermann, Thomas; Michalak, Katarzyna; Michalczyk, Teresa; Meuli-Simmen, Claudia; Scherberich, Arnaud; Meuli, Martin; Reichmann, Ernst

    2017-12-01

    There is accumulating evidence that interactions between epidermal melanocytes and stromal cells play an important role in the regulation of skin pigmentation. In this study we established a pigmented dermo-epidermal skin model, melDESS, of human origin to investigate the effects of distinct stromal cells on melanogenesis. melDESS is a complex, clinically relevant skin equivalent composed of an epidermis containing both melanocytes and keratinocytes. Its dermal compartment consists either of adipose tissue-derived stromal cells, dermal fibroblasts (Fbs), or a mixture of both cell types. These skin substitutes were transplanted for 5 weeks on the backs of immuno-incompetent rats and analyzed. Gene expression and Western blot analyses showed a significantly higher expression of transforming growth factor-β1 by adipose tissue-derived stromal cells compared with dermal Fbs. In addition, we showed that melanocytes responded to the increased levels of transforming growth factor-β1 by down-regulating the expression of key melanogenic enzymes such as tyrosinase. This caused decreased melanin synthesis and, consequently, greatly reduced pigmentation of melDESS. The conclusions are of utmost clinical relevance, namely that adipose tissue-derived stromal cells derived from the hypodermis fail to appropriately interact with epidermal melanocytes, thus preventing the sustainable restoration of the patient's native skin color in bioengineered skin grafts. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    Directory of Open Access Journals (Sweden)

    Philip Lazarovici

    2013-07-01

    Full Text Available In this study, we present the applicability of imaging epidermal growth factor (EGF receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR. The near infrared (NIR bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  12. The aryl hydrocarbon receptor ligand ITE inhibits TGFβ1-induced human myofibroblast differentiation.

    Science.gov (United States)

    Lehmann, Geniece M; Xi, Xia; Kulkarni, Ajit A; Olsen, Keith C; Pollock, Stephen J; Baglole, Carolyn J; Gupta, Shikha; Casey, Ann E; Huxlin, Krystel R; Sime, Patricia J; Feldon, Steven E; Phipps, Richard P

    2011-04-01

    Fibrosis can occur in any human tissue when the normal wound healing response is amplified. Such amplification results in fibroblast proliferation, myofibroblast differentiation, and excessive extracellular matrix deposition. Occurrence of these sequelae in organs such as the eye or lung can result in severe consequences to health. Unfortunately, medical treatment of fibrosis is limited by a lack of safe and effective therapies. These therapies may be developed by identifying agents that inhibit critical steps in fibrotic progression; one such step is myofibroblast differentiation triggered by transforming growth factor-β1 (TGFβ1). In this study, we demonstrate that TGFβ1-induced myofibroblast differentiation is blocked in human fibroblasts by a candidate endogenous aryl hydrocarbon receptor (AhR) ligand 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE). Our data show that ITE disrupts TGFβ1 signaling by inhibiting the nuclear translocation of Smad2/3/4. Although ITE functions as an AhR agonist, and biologically persistent AhR agonists, such as 2,3,7,8-tetrachlorodibenzo-p-dioxin, cause severe toxic effects, ITE exhibits no toxicity. Interestingly, ITE effectively inhibits TGFβ1-driven myofibroblast differentiation in AhR(-/-) fibroblasts: Its ability to inhibit TGFβ1 signaling is AhR independent. As supported by the results of this study, the small molecule ITE inhibits myofibroblast differentiation and may be useful clinically as an antiscarring agent. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  13. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    International Nuclear Information System (INIS)

    Goupille, Olivier; Penglong, Tipparat; Lefèvre, Carine; Granger, Marine; Kadri, Zahra; Fucharoen, Suthat; Maouche-Chrétien, Leila; Leboulch, Philippe; Chrétien, Stany

    2012-01-01

    Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  14. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    Energy Technology Data Exchange (ETDEWEB)

    Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)

    2012-12-07

    Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  15. Mechanism of inhibition of human secretory phospholipase A2 by flavonoids: rationale for lead design

    Science.gov (United States)

    Lättig, Jens; Böhl, Markus; Fischer, Petra; Tischer, Sandra; Tietböhl, Claudia; Menschikowski, Mario; Gutzeit, Herwig O.; Metz, Peter; Pisabarro, M. Teresa

    2007-08-01

    The human secretory phospholipase A2 group IIA (PLA2-IIA) is a lipolytic enzyme. Its inhibition leads to a decrease in eicosanoids levels and, thereby, to reduced inflammation. Therefore, PLA2-IIA is of high pharmacological interest in treatment of chronic diseases such as asthma and rheumatoid arthritis. Quercetin and naringenin, amongst other flavonoids, are known for their anti-inflammatory activity by modulation of enzymes of the arachidonic acid cascade. However, the mechanism by which flavonoids inhibit Phospholipase A2 (PLA2) remained unclear so far. Flavonoids are widely produced in plant tissues and, thereby, suitable targets for pharmaceutical extractions and chemical syntheses. Our work focuses on understanding the binding modes of flavonoids to PLA2, their inhibition mechanism and the rationale to modify them to obtain potent and specific inhibitors. Our computational and experimental studies focused on a set of 24 compounds including natural flavonoids and naringenin-based derivatives. Experimental results on PLA2-inhibition showed good inhibitory activity for quercetin, kaempferol, and galangin, but relatively poor for naringenin. Several naringenin derivatives were synthesized and tested for affinity and inhibitory activity improvement. 6-(1,1-dimethylallyl)naringenin revealed comparable PLA2 inhibition to quercetin-like compounds. We characterized the binding mode of these compounds and the determinants for their affinity, selectivity, and inhibitory potency. Based on our results, we suggest C(6) as the most promising position of the flavonoid scaffold to introduce chemical modifications to improve affinity, selectivity, and inhibition of PLA2-IIA by flavonoids.

  16. Potent inhibition of human neutrophil activations by bractelactone, a novel chalcone from Fissistigma bracteolatum

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yang-Chang [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Graduate Institute of Integrated Medicine, College of Chinese Medicine, China Medical University, Taichung 404, Taiwan (China); Sureshbabu, Munisamy; Fang, Yao-Ching; Wu, Yi-Hsiu [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Lan, Yu-Hsuan [School of Pharmacy, China Medical University, Taichung 404, Taiwan (China); Chang, Fang-Rong [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Chang, Ya-Wen [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Hwang, Tsong-Long, E-mail: htl@mail.cgu.edu.tw [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chinese Herbal Medicine Research Team, Healthy Aging Research Center, Chang Gung University, Kweishan, Taoyuan 333, Taiwan (China)

    2013-02-01

    Fissistigma bracteolatum is widely used in traditional medicine to treat inflammatory diseases. However, its active components and mechanisms of action remain unclear. In this study, (3Z)-6,7-dihydroxy-4-methoxy-3-(phenylmethylidene)-5-(3-phenylpropanoyl) -1-benzofuran-2(3H) (bractelactone), a novel chalcone from F. bracteolatum, showed potent inhibitory effects against superoxide anion (O{sub 2}{sup ·−}) production, elastase release, and CD11b expression in formyl-L-methionyl-L-leucyl-L-phenylalanine (FMLP)-induced human neutrophils. However, bractelactone showed only weak inhibition of phorbol myristate acetate-caused O{sub 2}{sup ·−} production. The peak cytosolic calcium concentration ([Ca{sup 2+}]{sub i}) was unaltered by bractelactone in FMLP-induced neutrophils, but the decay time of [Ca{sup 2+}]{sub i} was significantly shortened. In a calcium-free solution, changes in [Ca{sup 2+}]{sub i} caused by the addition of extracellular Ca{sup 2+} were inhibited by bractelactone in FMLP-activated cells. In addition, bractelactone did not alter the phosphorylation of p38 MAPK, ERK, JNK, or AKT or the concentration of cAMP. These results suggest that bractelactone selectively inhibits store-operated calcium entry (SOCE). In agreement with this concept, bractelactone suppressed sustained [Ca{sup 2+}]{sub i} changes in thapsigargin-activated neutrophils. Furthermore, bractelactone did not alter FMLP-induced formation of inositol 1,4,5-triphosphate. Taken together, our results demonstrate that the anti-inflammatory effects of bractelactone, an active ingredient of F. bracteolatum, in human neutrophils are through the selective inhibition of SOCE. Highlights: ► Bractelactone isolated from Fissistigma bracteolatum. ► Bractelactone inhibited FMLP-induced human neutrophil activations. ► Bractelactone had no effect on IP3 formation. ► Bractelactone did not alter MAPKs, AKT, and cAMP pathways. ► Bractelactone inhibited store-operated calcium entry.

  17. Combined inhibition of nitric oxide and prostaglandins reduces human skeletal muscle blood flow during exercise

    DEFF Research Database (Denmark)

    Boushel, Robert Christopher; Langberg, Henning; Gemmer, Carsten

    2002-01-01

    The vascular endothelium is an important mediator of tissue vasodilatation, yet the role of the specific substances, nitric oxide (NO) and prostaglandins (PG), in mediating the large increases in muscle perfusion during exercise in humans is unclear. Quadriceps microvascular blood flow......, respectively (P exercise in humans. These findings demonstrate an important synergistic role of NO and PG for skeletal muscle vasodilatation and hyperaemia during muscular contraction....... was quantified by near infrared spectroscopy and indocyanine green in six healthy humans during dynamic knee extension exercise with and without combined pharmacological inhibition of NO synthase (NOS) and PG by L-NAME and indomethacin, respectively. Microdialysis was applied to determine interstitial release...

  18. Inhibition of platelet [3H]- imipramine binding by human plasma protein fractions

    International Nuclear Information System (INIS)

    Strijewski, A.; Chudzik, J.; Tang, S.W.

    1988-01-01

    Inhibition of high-affinity [ 3 H]-imipramine binding to platelet membranes by human plasma fractions and isolated plasma proteins was investigated. Several plasma proteins were found to contribute to the observed apparent inhibition and this contribution was assessed in terms of inhibitor units. Alpha 1 acid glycoprotein, high density and low density lipoprotein, IgG and α 1 -antitrypsin were identified as effective non-specific inhibitors. Alpha-1-acid glycoprotein was confirmed to be the most potent plasma protein inhibitor. Cohn fractions were evaluated for the presence of the postulated endocoid of [ 3 H]-imipramine binding site

  19. Inhibition of human anthracycline reductases by emodin — A possible remedy for anthracycline resistance

    Energy Technology Data Exchange (ETDEWEB)

    Hintzpeter, Jan, E-mail: hintzpeter@toxi.uni-kiel.de [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany); Seliger, Jan Moritz [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany); Hofman, Jakub [Department of Biochemical Sciences, Faculty of Pharmacy in Hradec Kralove, Charles University in Prague, Heyrovskeho 1203, 50005 Hradec Kralove (Czech Republic); Martin, Hans-Joerg [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany); Wsol, Vladimir [Department of Biochemical Sciences, Faculty of Pharmacy in Hradec Kralove, Charles University in Prague, Heyrovskeho 1203, 50005 Hradec Kralove (Czech Republic); Maser, Edmund [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany)

    2016-02-15

    The clinical application of anthracyclines, like daunorubicin and doxorubicin, is limited by two factors: dose-related cardiotoxicity and drug resistance. Both have been linked to reductive metabolism of the parent drug to their metabolites daunorubicinol and doxorubicinol, respectively. These metabolites show significantly less anti-neoplastic properties as their parent drugs and accumulate in cardiac tissue leading to chronic cardiotoxicity. Therefore, we aimed to identify novel and potent natural inhibitors for anthracycline reductases, which enhance the anticancer effect of anthracyclines by preventing the development of anthracycline resistance. Human enzymes responsible for the reductive metabolism of daunorubicin were tested for their sensitivity towards anthrachinones, in particular emodin and anthraflavic acid. Intense inhibition kinetic data for the most effective daunorubicin reductases, including IC{sub 50}- and K{sub i}-values, the mode of inhibition, as well as molecular docking, were compiled. Subsequently, a cytotoxicity profile and the ability of emodin to reverse daunorubicin resistance were determined using multiresistant A549 lung cancer and HepG2 liver cancer cells. Emodin potently inhibited the four main human daunorubicin reductases in vitro. Further, we could demonstrate that emodin is able to synergistically sensitize human cancer cells towards daunorubicin at clinically relevant concentrations. Therefore, emodin may yield the potential to enhance the therapeutic effectiveness of anthracyclines by preventing anthracycline resistance via inhibition of the anthracycline reductases. In symphony with its known pharmacological properties, emodin might be a compound of particular interest in the management of anthracycline chemotherapy efficacy and their adverse effects. - Highlights: • Natural and synthetic compounds were identified as inhibitors for human daunorubicin reductases. • Emodin is a potent inhibitor for human daunorubicin

  20. Inhibition of human anthracycline reductases by emodin — A possible remedy for anthracycline resistance

    International Nuclear Information System (INIS)

    Hintzpeter, Jan; Seliger, Jan Moritz; Hofman, Jakub; Martin, Hans-Joerg; Wsol, Vladimir; Maser, Edmund

    2016-01-01

    The clinical application of anthracyclines, like daunorubicin and doxorubicin, is limited by two factors: dose-related cardiotoxicity and drug resistance. Both have been linked to reductive metabolism of the parent drug to their metabolites daunorubicinol and doxorubicinol, respectively. These metabolites show significantly less anti-neoplastic properties as their parent drugs and accumulate in cardiac tissue leading to chronic cardiotoxicity. Therefore, we aimed to identify novel and potent natural inhibitors for anthracycline reductases, which enhance the anticancer effect of anthracyclines by preventing the development of anthracycline resistance. Human enzymes responsible for the reductive metabolism of daunorubicin were tested for their sensitivity towards anthrachinones, in particular emodin and anthraflavic acid. Intense inhibition kinetic data for the most effective daunorubicin reductases, including IC 50 - and K i -values, the mode of inhibition, as well as molecular docking, were compiled. Subsequently, a cytotoxicity profile and the ability of emodin to reverse daunorubicin resistance were determined using multiresistant A549 lung cancer and HepG2 liver cancer cells. Emodin potently inhibited the four main human daunorubicin reductases in vitro. Further, we could demonstrate that emodin is able to synergistically sensitize human cancer cells towards daunorubicin at clinically relevant concentrations. Therefore, emodin may yield the potential to enhance the therapeutic effectiveness of anthracyclines by preventing anthracycline resistance via inhibition of the anthracycline reductases. In symphony with its known pharmacological properties, emodin might be a compound of particular interest in the management of anthracycline chemotherapy efficacy and their adverse effects. - Highlights: • Natural and synthetic compounds were identified as inhibitors for human daunorubicin reductases. • Emodin is a potent inhibitor for human daunorubicin reductases.

  1. In vitro inhibition of human papillomavirus following use of a carrageenan-containing vaginal gel.

    Science.gov (United States)

    Novetsky, Akiva P; Keller, Marla J; Gradissimo, Ana; Chen, Zigui; Morgan, Stephanie L; Xue, Xiaonan; Strickler, Howard D; Fernández-Romero, José A; Burk, Robert; Einstein, Mark H

    2016-11-01

    To assess in vitro efficacy of Divine 9, a carrageenan-based vaginal lubricant that is being studied as a microbicide to inhibit HPV16 pseudovirus (PsV) infection. Sexually active US women between 19 and 35years without prior HPV vaccination or cervical intraepithelial neoplasia were instructed to use Divine 9 vaginally with an applicator either before sex only or before and after intercourse. Women who applied a single dose of gel returned for cervicovaginal lavage (CVL) collection 1, 4 or 8-12h after intercourse versus those who applied gel before and after intercourse returned 1, 4 or 8-12h after the second gel dose. Carrageenan concentrations were assessed using an ELISA assay and the inhibitory activity was assessed using a PsV-based neutralization assay against HPV16 infection. Carrageenan concentrations and the percentage of PsV16 inhibition were compared using the Wilcoxon rank sum test. Thirteen women were enrolled and thirty specimens from different time-points were assessed. 87% of CVL samples had detectable carrageenans with levels decreasing over time from intercourse. 93% of CVL samples had detectable PsV16 inhibition with median inhibition of 97.5%. PsV16 inhibition decreased over time, but remained high, with median inhibition of 98.1%, 97.4% and 83.4% at 1, 4 and 8-12h, respectively. Higher carrageenan concentrations were associated with higher levels of PsV16 inhibition (rho=0.69). This is the first report of a human study investigating in vitro HPV inhibition of a carrageenan-based vaginal lubricant with CVL collected after sexual intercourse. We demonstrate excellent efficacy in preventing PsV16 infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Inhibiting actin depolymerization enhances osteoblast differentiation and bone formation in human stromal stem cells

    DEFF Research Database (Denmark)

    Chen, Li; Shi, Kaikai; Frary, Charles

    2015-01-01

    Remodeling of the actin cytoskeleton through actin dynamics is involved in a number of biological processes, but its role in human stromal (skeletal) stem cells (hMSCs) differentiation is poorly understood. In the present study, we demonstrated that stabilizing actin filaments by inhibiting gene...... expression of the two main actin depolymerizing factors (ADFs): Cofilin 1 (CFL1) and Destrin (DSTN) in hMSCs, enhanced cell viability and differentiation into osteoblastic cells (OB) in vitro, as well as heterotopic bone formation in vivo. Similarly, treating hMSC with Phalloidin, which is known to stabilize...... polymerized actin filaments, increased hMSCs viability and OB differentiation. Conversely, Cytocholasin D, an inhibitor of actin polymerization, reduced cell viability and inhibited OB differentiation of hMSC. At a molecular level, preventing Cofilin phosphorylation through inhibition of LIM domain kinase 1...

  3. Inhibition of human copper trafficking by a small molecule significantly attenuates cancer cell proliferation

    Science.gov (United States)

    Wang, Jing; Luo, Cheng; Shan, Changliang; You, Qiancheng; Lu, Junyan; Elf, Shannon; Zhou, Yu; Wen, Yi; Vinkenborg, Jan L.; Fan, Jun; Kang, Heebum; Lin, Ruiting; Han, Dali; Xie, Yuxin; Karpus, Jason; Chen, Shijie; Ouyang, Shisheng; Luan, Chihao; Zhang, Naixia; Ding, Hong; Merkx, Maarten; Liu, Hong; Chen, Jing; Jiang, Hualiang; He, Chuan

    2015-12-01

    Copper is a transition metal that plays critical roles in many life processes. Controlling the cellular concentration and trafficking of copper offers a route to disrupt these processes. Here we report small molecules that inhibit the human copper-trafficking proteins Atox1 and CCS, and so provide a selective approach to disrupt cellular copper transport. The knockdown of Atox1 and CCS or their inhibition leads to a significantly reduced proliferation of cancer cells, but not of normal cells, as well as to attenuated tumour growth in mouse models. We show that blocking copper trafficking induces cellular oxidative stress and reduces levels of cellular ATP. The reduced level of ATP results in activation of the AMP-activated protein kinase that leads to reduced lipogenesis. Both effects contribute to the inhibition of cancer cell proliferation. Our results establish copper chaperones as new targets for future developments in anticancer therapies.

  4. Cardiac glycosides induce cell death in human cells by inhibiting general protein synthesis.

    Directory of Open Access Journals (Sweden)

    Andrea Perne

    2009-12-01

    Full Text Available Cardiac glycosides are Na(+/K(+-pump inhibitors widely used to treat heart failure. They are also highly cytotoxic, and studies have suggested specific anti-tumor activity leading to current clinical trials in cancer patients. However, a definitive demonstration of this putative anti-cancer activity and the underlying molecular mechanism has remained elusive.Using an unbiased transcriptomics approach, we found that cardiac glycosides inhibit general protein synthesis. Protein synthesis inhibition and cytotoxicity were not specific for cancer cells as they were observed in both primary and cancer cell lines. These effects were dependent on the Na(+/K(+-pump as they were rescued by expression of a cardiac glycoside-resistant Na(+/K(+-pump. Unlike human cells, rodent cells are largely resistant to cardiac glycosides in vitro and mice were found to tolerate extremely high levels.The physiological difference between human and mouse explains the previously observed sensitivity of human cancer cells in mouse xenograft experiments. Thus, published mouse xenograft models used to support anti-tumor activity for these drugs require reevaluation. Our finding that cardiac glycosides inhibit protein synthesis provides a mechanism for the cytotoxicity of CGs and raises concerns about ongoing clinical trials to test CGs as anti-cancer agents in humans.

  5. Tumor necrosis factor-alpha inhibits differentiation of myogenic cells in human urethral rhabdosphincter.

    Science.gov (United States)

    Shinohara, Mayuka; Sumino, Yasuhiro; Sato, Fuminori; Kiyono, Tohru; Hashimoto, Naohiro; Mimata, Hiromitsu

    2017-06-01

    To examine the inhibitory effects of tumor necrosis factor-α on myogenic differentiation of human urethral rhabdosphincter cells. A rhabdosphincter sample was obtained from a patient who underwent total cystectomy. To expand the lifespan of the primary cultured cells, rhabdosphincter myogenic cells were immortalized with mutated cyclin-dependent kinase 4, cyclin D1 and telomerase. The differential potential of the cells was investigated. The transfected human rhabdosphincter cells were induced for myogenic differentiation with recombinant human tumor necrosis factor-α and/or the tumor necrosis factor-α antagonist etanercept at different concentrations, and activation of signaling pathways was monitored. Human rhabdosphincter cells were selectively cultured for at least 40 passages. Molecular analysis confirmed the expression of myosin heavy chain, which is a specific marker of differentiated muscle cells, significantly increased after differentiation induction. Although tumor necrosis factor-α treatment reduced the myosin heavy chain expression in a concentration-dependent manner, etanercept inhibited this suppression. Tumor necrosis factor-α suppressed phosphorylation of protein kinase B and p38, whereas etanercept pretreatment promoted phosphorylation and myosin heavy chain expression in a concentration-dependent manner. Tumor necrosis factor-α inhibits differentiation of urethral rhabdosphincter cells in part through the p38 mitogen-activated protein kinase and phosphoinositide 3-kinase pathways. Inhibition of tumor necrosis factor-α might be a useful strategy to treat stress urinary incontinence. © 2017 The Japanese Urological Association.

  6. Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles

    International Nuclear Information System (INIS)

    Teimoori, Salma; Seesuay, Watee; Jittavisutthikul, Surasak; Chaisri, Urai; Sookrung, Nitat; Densumite, Jaslan; Saelim, Nawannaporn; Chulanetra, Monrat; Maneewatch, Santi; Chaicumpa, Wanpen

    2016-01-01

    A direct acting anti-Ebola agent is needed. VP40, a conserved protein across Ebolavirus (EBOV) species has several pivotal roles in the virus life cycle. Inhibition of VP40 functions would lessen the virion integrity and interfere with the viral assembly, budding, and spread. In this study, cell penetrable human scFvs (HuscFvs) that bound to EBOV VP40 were produced by phage display technology. Gene sequences coding for VP40-bound-HuscFvs were subcloned from phagemids into protein expression plasmids downstream to a gene of cell penetrating peptide, i.e., nonaarginine (R9). By electron microscopy, transbodies from three clones effectively inhibited egress of the Ebola virus-like particles from human hepatic cells transduced with pseudo-typed-Lentivirus particles carrying EBOV VP40 and GP genes. Computerized simulation indicated that the effective HuscFvs bound to multiple basic residues in the cationic patch of VP40 C-terminal domain which are important in membrane-binding for viral matrix assembly and virus budding. The transbodies bound also to VP40 N-terminal domain and L domain peptide encompassed the PTAPPEY (WW binding) motif, suggesting that they might confer VP40 function inhibition through additional mechanism(s). The generated transbodies are worthwhile tested with authentic EBOV before developing to direct acting anti-Ebola agent for preclinical and clinical trials. - Highlights: • Cell penetrable human scFvs (transbodies) to Ebolavirus (EBOV) VP40 were produced. • The transbodies inhibited egress of EBOV-like particles (VLPs) from human hepatocytes. • They interacted with VP40 CTD basic residues important for plasma membrane binding. • And hence interfere with viral matrix assembly and viral progeny budding. • This is the first report on human antibodies that target intracellular EBOV VP40.

  7. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  8. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  9. CTRP6 inhibits fibrogenesis in TGF-β1-stimulated human dermal fibroblasts

    International Nuclear Information System (INIS)

    Fan, Rong-hui; Zhu, Xiu-mei; Sun, Yao-wen; Peng, Hui-zi; Wu, Hang-li; Gao, Wen-jie

    2016-01-01

    Skin fibrosis is characterized by excessive proliferation of fibroblasts and overproduction of extracellular matrix (ECM). C1q/tumor necrosis factor-related protein 6 (CTRP6), a member of CTRPs, has been involved in the development of cardiac fibrosis. However, the function and detailed regulatory mechanism of CTRP6 in skin fibrosis remain unclear. The aim of this study was to investigate the effect of CTRP6 on the activation of human dermal fibroblasts. Our results showed that CTRP6 was lowly expressed in scar tissues and transforming growth factor-β1 (TGF-β1)-treated dermal fibroblasts. CTRP6 overexpression significantly inhibited the proliferation of dermal fibroblasts, as well as suppressed the expression of ECM in TGF-β1-treated dermal fibroblasts. Furthermore, CTRP6 overexpression markedly inhibited TGF-β1-induced phosphorylation of Smad3 in dermal fibroblasts. In conclusion, the data reported here demonstrate that CTRP6 is able to inhibit the proliferation and ECM expression in human dermal fibroblasts through suppressing the TGF-β1/Smad3 signaling pathway. These findings suggest that CTRP6 may be a potential therapeutic target for the prevention of skin fibrosis. -- Highlights: •CTRP6 expression was decreased in scar tissues and TGF-β1-treated dermal fibroblasts. •CTRP6 inhibits TGF-β1-induced the proliferation of dermal fibroblasts. •CTRP6 inhibits expression of collagen type I and α-SMA. •CTRP6 inhibits the activation of TGF-β1/Smad3 signaling pathway in dermal fibroblasts.

  10. CTRP6 inhibits fibrogenesis in TGF-β1-stimulated human dermal fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Rong-hui, E-mail: fan_ronghuixa@163.com [Department of Burn and Plastic Surgery, Shaanxi Provincial People’s Hospital, Xi’an 710068 (China); Zhu, Xiu-mei; Sun, Yao-wen [Department of Burn and Plastic Surgery, Shaanxi Provincial People’s Hospital, Xi’an 710068 (China); Peng, Hui-zi [Department of Cosmetology Plastic Surgery, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi 710061 (China); Wu, Hang-li; Gao, Wen-jie [Department of Burn and Plastic Surgery, Shaanxi Provincial People’s Hospital, Xi’an 710068 (China)

    2016-07-08

    Skin fibrosis is characterized by excessive proliferation of fibroblasts and overproduction of extracellular matrix (ECM). C1q/tumor necrosis factor-related protein 6 (CTRP6), a member of CTRPs, has been involved in the development of cardiac fibrosis. However, the function and detailed regulatory mechanism of CTRP6 in skin fibrosis remain unclear. The aim of this study was to investigate the effect of CTRP6 on the activation of human dermal fibroblasts. Our results showed that CTRP6 was lowly expressed in scar tissues and transforming growth factor-β1 (TGF-β1)-treated dermal fibroblasts. CTRP6 overexpression significantly inhibited the proliferation of dermal fibroblasts, as well as suppressed the expression of ECM in TGF-β1-treated dermal fibroblasts. Furthermore, CTRP6 overexpression markedly inhibited TGF-β1-induced phosphorylation of Smad3 in dermal fibroblasts. In conclusion, the data reported here demonstrate that CTRP6 is able to inhibit the proliferation and ECM expression in human dermal fibroblasts through suppressing the TGF-β1/Smad3 signaling pathway. These findings suggest that CTRP6 may be a potential therapeutic target for the prevention of skin fibrosis. -- Highlights: •CTRP6 expression was decreased in scar tissues and TGF-β1-treated dermal fibroblasts. •CTRP6 inhibits TGF-β1-induced the proliferation of dermal fibroblasts. •CTRP6 inhibits expression of collagen type I and α-SMA. •CTRP6 inhibits the activation of TGF-β1/Smad3 signaling pathway in dermal fibroblasts.

  11. Prolyl oligopeptidase inhibition-induced growth arrest of human gastric cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Kanayo [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Sakaguchi, Minoru, E-mail: sakaguti@gly.oups.ac.jp [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Tanaka, Satoshi [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Yoshimoto, Tadashi [Department of Life Science, Setsunan University, 17-8 Ikeda-Nakamachi, Neyagawa, Osaka 572-8508 (Japan); Takaoka, Masanori [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan)

    2014-01-03

    Highlights: •We examined the effects of prolyl oligopeptidase (POP) inhibition on p53 null gastric cancer cell growth. •POP inhibition-induced cell growth suppression was associated with an increase in a quiescent G{sub 0} state. •POP might regulate the exit from and/or reentry into the cell cycle. -- Abstract: Prolyl oligopeptidase (POP) is a serine endopeptidase that hydrolyzes post-proline peptide bonds in peptides that are <30 amino acids in length. We recently reported that POP inhibition suppressed the growth of human neuroblastoma cells. The growth suppression was associated with pronounced G{sub 0}/G{sub 1} cell cycle arrest and increased levels of the CDK inhibitor p27{sup kip1} and the tumor suppressor p53. In this study, we investigated the mechanism of POP inhibition-induced cell growth arrest using a human gastric cancer cell line, KATO III cells, which had a p53 gene deletion. POP specific inhibitors, 3-((4-[2-(E)-styrylphenoxy]butanoyl)-L-4-hydroxyprolyl)-thiazolidine (SUAM-14746) and benzyloxycarbonyl-thioprolyl-thioprolinal, or RNAi-mediated POP knockdown inhibited the growth of KATO III cells irrespective of their p53 status. SUAM-14746-induced growth inhibition was associated with G{sub 0}/G{sub 1} cell cycle phase arrest and increased levels of p27{sup kip1} in the nuclei and the pRb2/p130 protein expression. Moreover, SUAM-14746-mediated cell cycle arrest of KATO III cells was associated with an increase in the quiescent G{sub 0} state, defined by low level staining for the proliferation marker, Ki-67. These results indicate that POP may be a positive regulator of cell cycle progression by regulating the exit from and/or reentry into the cell cycle by KATO III cells.

  12. 3-Bromopyruvate inhibits cell proliferation and induces apoptosis in CD133+ population in human glioma.

    Science.gov (United States)

    Xu, Dong-Qiang; Tan, Xiao-Yu; Zhang, Bao-Wei; Wu, Tao; Liu, Ping; Sun, Shao-Jun; Cao, Yin-Guang

    2016-03-01

    The study was aimed to investigate the role of 3-bromopyruvate in inhibition of CD133+ U87 human glioma cell population growth. The results demonstrated that 3-bromopyruvate inhibited the viability of both CD133+ and parental cells derived from U87 human glioma cell line. However, the 3-bromopyruvate-induced inhibition in viability was more prominent in CD133+ cells at 10 μM concentration after 48 h. Treatment of CD133+ cells with 3-bromopyruvate caused reduction in cell population and cell size, membrane bubbling, and degradation of cell membranes. Hoechst 33258 staining showed condensation of chromatin material and fragmentation of DNA in treated CD133+ cells after 48 h. 3-Bromopyruvate inhibited the migration rate of CD133+ cells significantly compared to the parental cells. Flow cytometry revealed that exposure of CD133+ cells to 3-bromopyruvate increased the cell population in S phase from 24.5 to 37.9 % with increase in time from 12 to 48 h. In addition, 3-bromopyruvate significantly enhanced the expression of Bax and cleaved caspase 3 in CD133+ cells compared to the parental cells. Therefore, 3-bromopyruvate is a potent chemotherapeutic agent for the treatment of glioma by targeting stem cells selectively.

  13. Inhibition of the differentiation of monocyte-derived dendritic cells by human gingival fibroblasts.

    Directory of Open Access Journals (Sweden)

    Sylvie Séguier

    Full Text Available We investigated whether gingival fibroblasts (GFs can modulate the differentiation and/or maturation of monocyte-derived dendritic cells (DCs and analyzed soluble factors that may be involved in this immune modulation. Experiments were performed using human monocytes in co-culture with human GFs in Transwell® chambers or using monocyte cultures treated with conditioned media (CM from GFs of four donors. The four CM and supernatants from cell culture were assayed by ELISA for cytokines involved in the differentiation of dendritic cells, such as IL-6, VEGF, TGFβ1, IL-13 and IL-10. The maturation of monocyte-derived DCs induced by LPS in presence of CM was also studied. Cell surface phenotype markers were analyzed by flow cytometry. In co-cultures, GFs inhibited the differentiation of monocyte-derived DCs and the strength of this blockade correlated with the GF/monocyte ratio. Conditioned media from GFs showed similar effects, suggesting the involvement of soluble factors produced by GFs. This inhibition was associated with a lower stimulatory activity in MLR of DCs generated with GFs or its CM. Neutralizing antibodies against IL-6 and VEGF significantly (P<0.05 inhibited the inhibitory effect of CM on the differentiation of monocytes-derived DCs and in a dose dependent manner. Our data suggest that IL-6 is the main factor responsible for the inhibition of DCs differentiation mediated by GFs but that VEGF is also involved and constitutes an additional mechanism.

  14. Inhibition of isolated human myometrium contractility by minoxidil and reversal by glibenclamide.

    Science.gov (United States)

    Prabhakaran, S S; Dhanasekar, K R; Thomas, E; Jose, R; Peedicayil, J; Samuel, P

    2010-03-01

    This study investigated the ability of the antihypertensive drug minoxidil to inhibit potassium chloride (KCl)-induced contractility of the isolated human myometrium. Twelve strips of myometrium obtained from 12 patients who underwent hysterectomy were triggered to contract with 55 mM KCl before and after incubation with 3 concentrations (1, 3 and 10 microM) of minoxidil. The percent inhibition by minoxidil on the extent of contraction, and the area under the contractile curve of KCl-induced contraction of the myometrial strips was determined. Furthermore, the effect of 10 microM glibenclamide on the inhibition generated by 3 microM minoxidil on KCl-induced contractility was studied. It was found that minoxidil produced a concentration-dependent inhibition of KCl-induced contractility of the myometrium and that glibenclamide reversed this inhibitory effect. These results suggest that the inhibitory effect of minoxidil on isolated human myometrium contractility may prove useful in clinical conditions requiring relaxation of the myometrium. 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

  15. Cyclooxygenase inhibition improves endothelial vasomotor dysfunction of visceral adipose arterioles in human obesity

    Science.gov (United States)

    Farb, Melissa G.; Tiwari, Stephanie; Karki, Shakun; Ngo, Doan TM; Carmine, Brian; Hess, Donald T.; Zuriaga, Maria A.; Walsh, Kenneth; Fetterman, Jessica L.; Hamburg, Naomi M.; Vita, Joseph A.; Apovian, Caroline M.; Gokce, Noyan

    2013-01-01

    Objective The purpose of this study was to determine whether cyclooxygenase inhibition improves vascular dysfunction of adipose microvessels from obese humans. Design and Methods In 20 obese subjects (age 37±12 yrs, BMI 47±8 kg/m2) we collected subcutaneous and visceral fat during bariatric surgery and characterized adipose depot-specific gene expression, endothelial cell phenotype, and microvascular function. Vasomotor function was assessed in response to endothelium-dependent agonists using videomicroscopy of small arterioles from fat. Results Arterioles from visceral fat exhibited impaired endothelium-dependent, acetylcholine-mediated vasodilation, compared to the subcutaneous depot (p<0.001). Expression of mRNA transcripts relevant to the cyclooxygenase pathway were upregulated in visceral compared to subcutaneous fat. Pharmacological inhibition of cyclooxygenase with indomethacin improved endothelium-dependent vasodilator function of arterioles from visceral fat by 2-fold (p=0.01), whereas indomethacin had no effect in the subcutaneous depot. Indomethacin increased activation via serine-1177 phosphorylation of endothelial nitric oxide synthase in response to acetylcholine in endothelial cells from visceral fat. Inhibition of endothelial nitric oxide synthase with Nω-nitro-L-arginine methyl ester abrogated the effects of cyclooxygenase-inhibition suggesting that vascular actions of indomethacin were related to increased nitric oxide bioavailability. Conclusions Our findings suggest that cyclooxygenase-mediated vasoconstrictor prostanoids partly contribute to endothelial dysfunction of visceral adipose arterioles in human obesity. PMID:23640904

  16. Inhibition of DNA repair in ultraviolet-irradiated human cells by hydroxyurea

    International Nuclear Information System (INIS)

    Francis, A.A.; Carrier, W.L.; Smith, D.P.; Regan, J.D.; Blevins, R.D.

    1979-01-01

    The effect on DNA repair in ultraviolet-irradiated human skin fibroblasts by hydroxyurea has been examined in this study using three independent methods for measuring DNA repair: the 5-bromodeoxyuridine photolysis assay which measures DNA repair replication, chromatographic measurement of thymine-containing dimers, and measurement of specific ultraviolet-endonuclease-sensitive sites in irradiated DNA. Little effect on hydroxyurea was observed at the concentration of 2mM, which is often used to inhibit semiconservative DNA synthesis; however, 10 mM hydroxyurea resulted in marked inhibition (65-70%) of excision repair. This inhibition was accompanied by a possible doubling in the size of the repaired region. The accumulation of large numbers of single-strand breaks following ultraviolet irradiation and hydroxyurea incubation seen by other investigators was not observed with the normal skin fibroblasts used in this study. A comparison of hydroxyurea effects on the different DNA repair assays indicates inhibition of one step in DNA repair also results in varying degrees of inhibition of other steps as well. (Auth.)

  17. Inhibition and recovery of DNA synthesis in human cells after exposure to ultraviolet light

    International Nuclear Information System (INIS)

    Painter, R.B.

    1985-01-01

    The inhibition of DNA synthesis in normal human cells by UV is a complex function of fluence because it has several causes. At low fluences, inhibition of replicon initiation is most important. This is made clear by the fact that it occurs to a lesser degree in cells from patients with ataxia telangiectasia (AT). Assuming that only leading strand synthesis is blocked by UV-induced lesions, single lesions between replicons in parental strands for leading strand synthesis inhibit DNA synthesis by acting as temporary blocks until they are replicated by extension of the lagging strand of the adjacent replicon. A more severe inhibition occurs when two lesions are induced between adjacent growing replicons, because one in four possible configurations may result in a long-lived unreplicated region (LLUR). In the absence of excision repair, these may eventually be replicated by activation of an otherwise unused origin within the LLUR. The frequency of LLURs increases steeply with fluence. Activation of normally unused origins to replicate LLURs may facilitate recovery from inhibition of DNA synthesis, but repair of lesions is probably more important. In excision-repair-defective cells, an LLUR without an origin to initiate its replication may be a lethal lesion. (orig.)

  18. Inhibition of DNA repair in ultraviolet-irradiated human cells by hydroxyurea

    Energy Technology Data Exchange (ETDEWEB)

    Francis, A.A. (Oak Ridge National Lab., TN); Blevins, R.D.; Carrier, W.L.; Smith, D.P.; Regan, J.D.

    1979-01-01

    The effect on DNA repair in ultraviolet-irradiated human skin fibroblasts by hydroxyurea has been examined in this study using three independent methods for measuring DNA repair: the 5-bromodeoxyuridine photolysis assay which measures DNA repair replication, chromatographic measurement of thymine-containing dimers, and measurement of specific ultraviolet-endonuclease-sensitive sites in irradiated DNA. Little effect of hydroxyurea was observed at the concentration of 2 mM, which is often used to inhibit semiconservative DNA synthesis; however, 10 mM hydroxyurea resulted in marked inhibition (65 to 70%) of excision repair. This inhibition was accompanied by a possible doubling in the size of the repaired region. The accumulation of large numbers of single-strand breaks following ultraviolet irradiation and hydroxyurea incubation seen by other investigators was not observed with the normal skin fibroblasts used in this study. A comparison of hydroxyurea effects on the different DNA repair assays indicates inhibition of one step in DNA repair also results in varying degrees of inhibition of other steps as well.

  19. PPARγ ligand ciglitazone inhibits TNFα-induced ICAM-1 in human airway smooth muscle cells

    Directory of Open Access Journals (Sweden)

    Chien-Da Huang

    2014-08-01

    Full Text Available Background: Modification of human airway smooth muscle (ASM function by proinflammatory cytokines has been regarded as a potential mechanism underlying bronchial hyperresponsiveness in asthma. Human ASM cells express intercellular adhesion molecule (ICAM-1 in response to cytokines. Synthetic ligands for peroxisome proliferator-activated receptor (PPARγ reportedly possess anti-inflammatory and immunomodulatory properties. In this study, we examined whether ciglitazone, a synthetic PPARγ ligand, can modulate the basal and tumor necrosis factor (TNFα-induced ICAM1 gene expression in human ASM cells. Methods: Human ASM cells were treated with TNFα. ICAM-1 expression was assessed by flow cytometry and reverse transcriptase-polymerase chain reaction (RT-PCR analysis. PPARγ activity was inhibited by target-specific small interfering (si RNA targeting PPARγ and GW9662, a PPARγ antagonist. Activity of nuclear factor (NF-κB was assessed by using immunoblot analysis, immune-confocal images, and electrophoretic mobility shift assay (EMSA. Results: By flow cytometry, ciglitazone alone had no effect on ICAM-1 expression in ASM cells, but inhibited ICAM-1 expression in response to TNFα (10 ng/ml in a dose-dependent manner (1-10 μM. It also inhibited TNFα-induced ICAM1 gene expression by RT-PCR analysis. Knockdown of PPARγ gene by target-specific siRNA targeting PPARγ enhanced ICAM-1 expression and the inhibitory effect of ciglitazone on TNFα-induced ICAM-1 expression was reversed by PPARγ siRNA and GW9662. SN-50 (10 μg/ml, an inhibitor for nuclear translocation of NF-κB, inhibited TNFα-induced ICAM-1 expression. Ciglitazone did not prevent TNFα-induced degradation of the cytosolic inhibitor of NF-κB (IκB, but inhibited the nuclear translocation of p65 induced by TNFα and suppressed the NF-κB/DNA binding activity. Conclusion: These findings suggest that ciglitazone inhibits TNFα-induced ICAM1 gene expression in human ASM cells through

  20. Fatty acid synthase inhibition in human breast cancer cells leads to malonyl-CoA-induced inhibition of fatty acid oxidation and cytotoxicity.

    Science.gov (United States)

    Thupari, J N; Pinn, M L; Kuhajda, F P

    2001-07-13

    Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.

  1. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  2. Semicarbazone EGA Inhibits Uptake of Diphtheria Toxin into Human Cells and Protects Cells from Intoxication

    Directory of Open Access Journals (Sweden)

    Leonie Schnell

    2016-07-01

    Full Text Available Diphtheria toxin is a single-chain protein toxin that invades human cells by receptor-mediated endocytosis. In acidic endosomes, its translocation domain inserts into endosomal membranes and facilitates the transport of the catalytic domain (DTA from endosomal lumen into the host cell cytosol. Here, DTA ADP-ribosylates elongation factor 2 inhibits protein synthesis and leads to cell death. The compound 4-bromobenzaldehyde N-(2,6-dimethylphenylsemicarbazone (EGA has been previously shown to protect cells from various bacterial protein toxins which deliver their enzymatic subunits from acidic endosomes to the cytosol, including Bacillus anthracis lethal toxin and the binary clostridial actin ADP-ribosylating toxins C2, iota and Clostridium difficile binary toxin (CDT. Here, we demonstrate that EGA also protects human cells from diphtheria toxin by inhibiting the pH-dependent translocation of DTA across cell membranes. The results suggest that EGA might serve for treatment and/or prevention of the severe disease diphtheria.

  3. Theophylline prevents NAD+ depletion via PARP-1 inhibition in human pulmonary epithelial cells

    International Nuclear Information System (INIS)

    Moonen, Harald J.J.; Geraets, Liesbeth; Vaarhorst, Anika; Bast, Aalt; Wouters, Emiel F.M.; Hageman, Geja J.

    2005-01-01

    Oxidative DNA damage, as occurs during exacerbations in chronic obstructive pulmonary disease (COPD), highly activates the nuclear enzyme poly(ADP-ribose)polymerase-1 (PARP-1). This can lead to cellular depletion of its substrate NAD + , resulting in an energy crisis and ultimately in cell death. Inhibition of PARP-1 results in preservation of the intracellular NAD + pool, and of NAD + -dependent cellular processes. In this study, PARP-1 activation by hydrogen peroxide decreased intracellular NAD + levels in human pulmonary epithelial cells, which was found to be prevented in a dose-dependent manner by theophylline, a widely used compound in the treatment of COPD. This enzyme inhibition by theophylline was confirmed in an ELISA using purified human PARP-1 and was found to be competitive by nature. These findings provide new mechanistic insights into the therapeutic effect of theophylline in oxidative stress-induced lung pathologies

  4. Mucus and Mucins: do they have a role in the inhibition of the human immunodeficiency virus?

    OpenAIRE

    Mall, Anwar Suleman; Habte, Habtom; Mthembu, Yolanda; Peacocke, Julia; de Beer, Corena

    2017-01-01

    Background Mucins are large O-linked glycosylated proteins which give mucus their gel-forming properties. There are indications that mucus and mucins in saliva, breast milk and in the cervical plug inhibit the human immunodeficiency virus (HIV-1) in an in vitro assay. Main body of abstract Crude mucus gels form continuous layers on the epithelial surfaces of the major internal tracts of the body and protect these epithelial surfaces against aggressive luminal factors such as hydrochloric acid...

  5. Intranasal epidermal growth factor treatment rescues neonatal brain injury

    Science.gov (United States)

    Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio

    2014-02-01

    There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.

  6. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  7. Vaginal Lactobacillus Inhibits HIV-1 Replication in Human Tissues Ex Vivo

    Directory of Open Access Journals (Sweden)

    Rogers A. Ñahui Palomino

    2017-05-01

    Full Text Available Lactobacillus species, which dominate vaginal microbiota of healthy reproductive-age women, lower the risks of sexually transmitted infections, including the risk of human immunodeficiency virus (HIV acquisition. The exact mechanisms of this protection remain to be understood. Here, we investigated these mechanisms in the context of human cervico-vaginal and lymphoid tissues ex vivo. We found that all six Lactobacillus strains tested in these systems significantly suppressed HIV type-1 (HIV-1 infection. We identified at least three factors that mediated this suppression: (i Acidification of the medium. The pH of the undiluted medium conditioned by lactobacilli was between 3.8 and 4.6. Acidification of the culture medium with hydrochloric acid (HCl to this pH in control experiments was sufficient to abrogate HIV-1 replication. However, the pH of the Lactobacillus-conditioned medium (CM diluted fivefold, which reached ∼6.9, was also suppressive for HIV-1 infection, while in control experiments HIV-1 infection was not abrogated when the pH of the medium was brought to 6.9 through the use of HCl. This suggested the existence of other factors responsible for HIV-1 inhibition by lactobacilli. (ii Lactic acid. There was a correlation between the concentration of lactic acid in the Lactobacillus-CM and its ability to suppress HIV-1 infection in human tissues ex vivo. Addition of lactic acid isomers D and L to tissue culture medium at the concentration that corresponded to their amount released by lactobacilli resulted in HIV-1 inhibition. Isomer L was produced in higher quantities than isomer D and was mostly responsible for HIV-1 inhibition. These results indicate that lactic acid, in particular its L-isomer, inhibits HIV-1 independently of lowering of the pH. (iii Virucidal effect. Incubation of HIV-1 in Lactobacillus-CM significantly suppressed viral infectivity for human tissues ex vivo. Finally, lactobacilli adsorb HIV-1, serving as a sink

  8. Phase II Study of Neoadjuvant Anthracycline-Based Regimens Combined With Nanoparticle Albumin-Bound Paclitaxel and Trastuzumab for Human Epidermal Growth Factor Receptor 2-Positive Operable Breast Cancer.

    Science.gov (United States)

    Tanaka, Satoru; Iwamoto, Mitsuhiko; Kimura, Kosei; Matsunami, Nobuki; Morishima, Hirotaka; Yoshidome, Katsuhide; Nomura, Takashi; Morimoto, Takashi; Yamamoto, Daigo; Tsubota, Yu; Kobayashi, Toshihiro; Uchiyama, Kazuhisa

    2015-06-01

    We treated patients with operable human epidermal growth factor receptor 2-positive breast cancer with neoadjuvant anthracycline regimens followed by nanoparticle albumin-bound paclitaxel plus trastuzumab. Of the 44 patients, 49% achieved a pathologic complete response (pCR). The pCR rate was 36% and 71% in the patients with estrogen receptor-positive and -negative cancer, respectively. Neoadjuvant therapy using this combination appears to be effective and safe. Introduction: Neoadjuvant chemotherapy plus trastuzumab. Neoadjuvant chemotherapy plus trastuzumab results in a 30% to 50% pathologic complete response (pCR) rate in human epidermal growth factor receptor 2 (HER2)-positive breast cancer and has been associated with improved therapeutic outcomes. Thus, the pCR rate can be useful in evaluating novel agents in this patient population. Nanoparticle albumin-bound (nab)-paclitaxel (PTX) can reduce the toxicity of PTX while maintaining its efficacy. The present study evaluated the activity and safety of nab-PTX as a neoadjuvant treatment of HER2(+) breast cancer. We treated patients with stage I to IIIA breast cancer using neoadjuvant epirubicin/cyclophosphamide (EC) or 5-fluorouracil/epirubicin/cyclophosphamide every 3 weeks (q3w) for 4 cycles, followed by nab-PTX (260 mg/m(2)) plus trastuzumab q3w for 4 cycles. The primary endpoint was the pCR rate. The secondary endpoints included the clinical response rate, disease-free survival, pathologic response rate (defined as pCR or minimal residual invasive disease only in the breast), breast-conserving surgery rate, and safety. Forty-six patients were enrolled. One patient met the exclusion criteria because of the coexistence of another malignant disease; therefore, we evaluated 45 patients in the entire study. One patient experienced rapid disease progression during EC therapy, leaving 44 patients evaluable for nab-PTX treatment. Of the 45 patients, 49% achieved a pCR. The pCR rate was 36% and 71% in those with

  9. Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.

    Science.gov (United States)

    Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P

    2003-11-01

    C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the

  10. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ping; Guliaev, Anton B.; Hang, Bo

    2006-02-28

    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  11. Saw palmetto extracts potently and noncompetitively inhibit human alpha1-adrenoceptors in vitro.

    Science.gov (United St