Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

Directory of Open Access Journals (Sweden)

Raj Victor

2011-08-01

Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.

Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

Science.gov (United States)

2011-01-01

Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061

Pattern of hormone receptors and human epidermal growth factor ...

African Journals Online (AJOL)

Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

Science.gov (United States)

Laporta, Robert F.; Taichman, Lorne B.

1982-06-01

Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

Sulindac metabolites inhibit epidermal growth factor receptor activation and expression

Directory of Open Access Journals (Sweden)

Ahnen Dennis

2005-01-01

Full Text Available Abstract Background Regular use of nonsteroidal anti-inflammatory drugs (NSAIDs is associated with a decreased mortality from colorectal cancer (CRC. NSAIDs induce apoptotic cell death in colon cancer cells in vitro and inhibit growth of neoplastic colonic mucosa in vivo however, the biochemical mechanisms required for these growth inhibitory effects are not well defined. We previously reported that metabolites of the NSAID sulindac downregulate extracellular-signal regulated kinase 1/2 (ERK1/2 signaling and that this effect is both necessary and sufficient for the apoptotic effects of these drugs. The goal of this project was to specifically test the hypothesis that sulindac metabolites block activation and/or expression of the epidermal growth factor (EGF receptor (EGFR. Methods HT29 human colon cancer cells were treated with EGF, alone, or in the presence of sulindac sulfide or sulindac sulfone. Cells lysates were assayed by immunoblotting for phosphorylated EGFR (pEGFR, pY1068, total EGFR, phosphorylated ERK1/2 (pERK1/2, total ERK1/2, activated caspase-3, and α-tubulin. Results EGF treatment rapidly induced phosphorylation of both EGFR and ERK1/2 in HT29 colon cancer cells. Pretreatment with sulindac metabolites for 24 h blocked EGF-induced phosphorylation of both EGFR and ERK1/2 and decreased total EGFR protein expression. Under basal conditions, downregulation of pEGFR and total EGFR was detected as early as 12 h following sulindac sulfide treatment and persisted through at least 48 h. Sulindac sulfone induced downregulation of pEGFR and total EGFR was detected as early as 1 h and 24 h, respectively, following drug treatment, and persisted through at least 72 h. EGFR downregulation by sulindac metabolites was observed in three different CRC cell lines, occurred prior to the observed downregulation of pERK1/2 and induction of apoptosis by these drugs, and was not dependent of caspase activation. Conclusion These results suggest that

Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

International Nuclear Information System (INIS)

Hirata, Y.; Orth, D.N.

1981-01-01

Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

Epidermal growth factor receptor-induced activato protein 1 activity controls density-dependent growht inhibition in normal rat kidney fibroblasts.

NARCIS (Netherlands)

Hornberg, J.J.; Dekker, H.; Peters, P.H.J.; Langerak, P.; Westerhoff, H.V.; Lankelma, J.; Zoelen, E.J.J.

2006-01-01

Density-dependent growth inhibition secures tissue homeostasis. Dysfunction of the mechanisms, which regulate this type of growth control is a major cause of neoplasia. In confluent normal rat kidney (NRK) fibroblasts, epidermal growth factor (EGF) receptor levels decline, ultimately rendering these

Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

NARCIS (Netherlands)

Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

1988-01-01

In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

Science.gov (United States)

Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

2017-05-01

Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

Radiosensitivity of normal human epidermal cells in culture

International Nuclear Information System (INIS)

Dover, R.; Potten, C.S.

1983-01-01

Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

Science.gov (United States)

Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

2013-02-01

Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

NARCIS (Netherlands)

M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

1997-01-01

textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

Science.gov (United States)

Bolívar-Flores, Y J; Kuri-Harcuch, W

1999-08-01

Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

Inhibition of epidermal cell proliferation by borderline rays

Energy Technology Data Exchange (ETDEWEB)

Born, W [Freiburg Univ.; Daikeler, G

1976-08-01

Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

Science.gov (United States)

Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

2014-03-01

To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

Science.gov (United States)

Kappus, H; Reinhold, C

1994-04-01

Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

Science.gov (United States)

Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

International Nuclear Information System (INIS)

Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen

2013-01-01

Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions

DEFF Research Database (Denmark)

Perrais, Michaël; Chen, Xiao; Perez-Moreno, Mirna

2007-01-01

growth inhibitory signals. To address this question, we have selectively formed E-cadherin homophilic bonds at the cell surface of isolated epithelial cells by using functionally active recombinant E-cadherin protein attached to microspheres. We find that E-cadherin ligation alone reduces the frequency...... of cells entering the S phase, demonstrating that E-cadherin ligation directly transduces growth inhibitory signals. E-cadherin binding to beta-catenin is required for cell growth inhibition, but beta-catenin/T-cell factor transcriptional activity is not involved in growth inhibition resulting from...... homophilic binding. Neither E-cadherin binding to p120-catenin nor beta-catenin binding to alpha-catenin, and thereby the actin cytoskeleton, is required for growth inhibition. E-cadherin ligation also inhibits epidermal growth factor (EGF) receptor-mediated growth signaling by a beta...

Phenobarbital indirectly activates the constitutive active androstane receptor (CAR) by inhibition of epidermal growth factor receptor signaling.

Science.gov (United States)

Mutoh, Shingo; Sobhany, Mack; Moore, Rick; Perera, Lalith; Pedersen, Lee; Sueyoshi, Tatsuya; Negishi, Masahiko

2013-05-07

Phenobarbital is a central nervous system depressant that also indirectly activates nuclear receptor constitutive active androstane receptor (CAR), which promotes drug and energy metabolism, as well as cell growth (and death), in the liver. We found that phenobarbital activated CAR by inhibiting epidermal growth factor receptor (EGFR) signaling. Phenobarbital bound to EGFR and potently inhibited the binding of EGF, which prevented the activation of EGFR. This abrogation of EGFR signaling induced the dephosphorylation of receptor for activated C kinase 1 (RACK1) at Tyr(52), which then promoted the dephosphorylation of CAR at Thr(38) by the catalytic core subunit of protein phosphatase 2A. The findings demonstrated that the phenobarbital-induced mechanism of CAR dephosphorylation and activation is mediated through its direct interaction with and inhibition of EGFR.

Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

DEFF Research Database (Denmark)

Bor, M V; Sørensen, B S; Vinter-Jensen, L

2000-01-01

BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

Influence of epidermal hydration on the friction of human skin against textiles

OpenAIRE

Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

2008-01-01

Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

OpenAIRE

Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

2013-01-01

Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

Science.gov (United States)

Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

2018-01-01

Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

Influence of epidermal hydration on the friction of human skin against textile

NARCIS (Netherlands)

Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

2008-01-01

Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

Science.gov (United States)

Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

2006-08-01

Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

Epidermal Growth Factor Receptor in Pancreatic Cancer

International Nuclear Information System (INIS)

Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

2011-01-01

Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

Directory of Open Access Journals (Sweden)

Kynan T. Lawlor

2015-11-01

Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

INHIBITION OF PROTEIN TYROSINE PHOSPHATASE ACTIVITY MEDIATES EPIDERMAL GROWTH FACTOR RECEPTOR SIGNALING IN HUMAN AIRWAY EPITHELIAL CELLS

Science.gov (United States)

Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

International Nuclear Information System (INIS)

Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

2011-01-01

Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

International Nuclear Information System (INIS)

Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

1997-01-01

This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

Directory of Open Access Journals (Sweden)

Yung-Yi Lee

2013-06-01

Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

Emerging role of epidermal growth factor receptor inhibition in therapy for advanced malignancy: focus on NSCLC

International Nuclear Information System (INIS)

Langer, Corey J.

2004-01-01

Combination chemotherapy regimens have emerged as the standard approach in advanced non-small-cell lung cancer. Meta-analyses have demonstrated a 2-month increase in median survival after platinum-based therapy vs. best supportive care, and an absolute 10% improvement in the 1-year survival rate. Just as importantly, cytotoxic therapy has produced benefits in symptom control and quality of life. Newer agents, including the taxanes, vinorelbine, gemcitabine, and irinotecan, have expanded our therapeutic options in the treatment of advanced non-small-cell lung cancer. Despite their contributions, we have reached a therapeutic plateau, with response rates seldom exceeding 30-40% in cooperative group studies and 1-year survival rates stable between 30% and 40%. It is doubtful that substituting one agent for another in various combinations will lead to any further improvement in these rates. The thrust of current research has focused on targeted therapy, and epidermal growth factor receptor inhibition is one of the most promising clinical strategies. Epidermal growth factor receptor inhibitors currently under investigation include the small molecules gefitinib (Iressa, ZD1839) and erlotinib (Tarceva, OSI-774), as well as monoclonal antibodies such as cetuximab (IMC-225, Erbitux). Agents that have only begun to undergo clinical evaluation include CI-1033, an irreversible pan-erbB tyrosine kinase inhibitor, and PKI166 and GW572016, both examples of dual kinase inhibitors (inhibiting epidermal growth factor receptor and Her2). Preclinical models have demonstrated synergy for all these agents in combination with either chemotherapy or radiotherapy, leading to great enthusiasm regarding their ultimate contribution to lung cancer therapy. However, serious clinical challenges persist. These include the identification of the optimal dose(s); the proper integration of these agents into popular, established cytotoxic regimens; and the selection of the optimal setting(s) in which

New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

Science.gov (United States)

Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien

2015-01-01

Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

Directory of Open Access Journals (Sweden)

Rong-Dih Lin

2015-12-01

Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

Science.gov (United States)

Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

2004-12-03

The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

International Nuclear Information System (INIS)

Hanson, D.; DeLeo, V.

1990-01-01

Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

Expression of epidermal growth factor receptors in human endometrial carcinoma

DEFF Research Database (Denmark)

Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

1993-01-01

Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

International Nuclear Information System (INIS)

Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

2013-01-01

High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

Science.gov (United States)

Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

2018-05-01

The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

Epidermal growth factor receptor inhibition reduces angiogenesis via hypoxia-inducible factor-1α and Notch1 in head neck squamous cell carcinoma.

Directory of Open Access Journals (Sweden)

Wei-Ming Wang

Full Text Available Angiogenesis, a marker of cancer development, affects response to radiotherapy sensibility. This preclinical study aims to understand the receptor tyrosine kinase-mediated angiogenesis in head neck squamous cell carcinoma (HNSCC. The receptor tyrosine kinase activity in a transgenic mouse model of HNSCC was assessed. The anti-tumorigenetic and anti-angiogenetic effects of cetuximab-induced epidermal growth factor receptor (EGFR inhibition were investigated in xenograft and transgenic mouse models of HNSCC. The signaling transduction of Notch1 and hypoxia-inducible factor-1α (HIF-1α was also analyzed. EGFR was overexpressed and activated in the Tgfbr1/Pten deletion (2cKO mouse model of HNSCC. Cetuximab significantly delayed tumor onset by reducing tumor angiogenesis. This drug exerted similar effects on heterotopic xenograft tumors. In the human HNSCC tissue array, increased EGFR expression correlated with increased HIF-1α and micro vessel density. Cetuximab inhibited tumor-induced angiogenesis in vitro and in vivo by significantly downregulating HIF-1α and Notch1. EGFR is involved in the tumor angiogenesis of HNSCC via the HIF-1α and Notch1 pathways. Therefore, targeting EGFR by suppressing hypoxia- and Notch-induced angiogenesis may benefit HNSCC therapy.

Expression of PML tumor suppressor in A 431 cells reduces cellular growth by inhibiting the epidermal growth factor receptor expression

International Nuclear Information System (INIS)

Vallian, S.; Chang, K.S.

2004-01-01

Our previous studies showed that the promyelocytic leukemia, PML, protein functions as a cellular and growth suppressor. Transient expression of PML was also found to repress the activity of the epidermal growth factor receptor gene promoter. In this study we have examined the effects of PML on A431 cells, which express a high level of + protein. The PML gene was introduced into the cells using the adenovirus-mediated gene transfer system. Western blot analysis on the extracts from the cells expressing PML showed a significant repression in the expression of the epidermal growth factor receptor protein. The cells were examined for growth and DNA synthesis. The data showed a marked reduction in both growth and DNA synthesis rate in the cells expressing PML compared with the control cells. Furthermore, in comparison with the controls, the cells expressing PML were found to be more in G1 phase, fewer in S and about the same number in the G2/M phase. This data clearly demonstrated that the repression of epidermal growth factor receptor expression in A 431 cells by PML was associated with inhibition of cell growth and alteration of the cell cycle distribution, suggesting a novel mechanism for the known growth inhibitory effects of PML

Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

International Nuclear Information System (INIS)

Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

2011-01-01

Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity

International Nuclear Information System (INIS)

Lowe, N.J.; Breeding, J.

1982-01-01

Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study

Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

Science.gov (United States)

Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

2003-12-01

Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

International Nuclear Information System (INIS)

Graem, N.

1986-01-01

Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

International Nuclear Information System (INIS)

Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

2010-01-01

Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

Science.gov (United States)

Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

2015-06-01

Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

Epidermal growth factor receptor in primary human lung cancer

International Nuclear Information System (INIS)

Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

1996-01-01

Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

Energy Technology Data Exchange (ETDEWEB)

Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

2016-07-08

Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

Toxic epidermal necrolysis successfully treated with etanercept.

Science.gov (United States)

Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

2009-03-01

Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

International Nuclear Information System (INIS)

Verrando, P.; Ortonne, J.P.

1985-01-01

Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

Effect of vasoactive intestinal polypeptide and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands

DEFF Research Database (Denmark)

Poulsen, Steen Seier

1984-01-01

The effect of VIP and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands was investigated in the rat. Vasoactive intestinal polypeptide infused in doses of 10 and 100 ng/kg/h significantly increased epidermal growth factor and bicarbonate output......, but the concentrations did not change. Somatostatin infused at doses of 1, 10, 100 and 1000 ng/kg/h against a background of VIP 100 ng/kg/h inhibited in dose-dependent fashion the stimulated epidermal growth factor and bicarbonate outputs from rat Brunner's gland pouches. Also basal secretion was inhibited...... growth factor and bicarbonate from Brunner's glands, an effect which is inhibited by somatostatin. A possible role for somatostatin in the control of Brunner's gland secretion is suggested....

Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

Energy Technology Data Exchange (ETDEWEB)

Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

2017-02-01

Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

Science.gov (United States)

Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

2012-05-01

Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

Directory of Open Access Journals (Sweden)

Philpott Michael P

2010-02-01

Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

Assessment of the Developmental Toxicity of Epidermal Growth ...

African Journals Online (AJOL)

Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

Human milk glycoconjugates that inhibit pathogens.

Science.gov (United States)

Newburg, D S

1999-02-01

Breast-fed infants have lower incidence of diarrhea, respiratory disease, and otitis media. The protection by human milk has long been attributed to the presence of secretory IgA. However, human milk contains large numbers and amounts of complex carbohydrates, including glycoproteins, glycolipids, glycosaminoglycans, mucins, and especially oligosaccharides. The oligosaccharides comprise the third most abundant solid constituent of human milk, and contain a myriad of structures. Complex carbohydrate moieties of glycoconjugates and oligosaccharides are synthesized by the many glycosyltransferases in the mammary gland; those with homology to cell surface glycoconjugate pathogen receptors may inhibit pathogen binding, thereby protecting the nursing infant. Several examples are reviewed: A fucosyloligosaccharide inhibits the diarrheagenic effect of stable toxin of Escherichia coli. A different fucosyloligosaccharide inhibits infection by Campylobacter jejuni. Binding of Streptococcus pneumoniae and of enteropathogenic E. coli to their respective receptors is inhibited by human milk oligosaccharides. The 46-kD glycoprotein, lactadherin, inhibits rotavirus binding and infectivity. Low levels of lactadherin in human milk are associated with a higher incidence of symptomatic rotavirus in breast-fed infants. A mannosylated glycopeptide inhibits binding by enterohemorrhagic E. coli. A glycosaminoglycan inhibits binding of gp120 to CD4, the first step in HIV infection. Human milk mucin inhibits binding by S-fimbriated E. coli. The ganglioside, GM1, reduces diarrhea production by cholera toxin and labile toxin of E. coli. The neutral glycosphingolipid, Gb3, binds to Shigatoxin. Thus, many complex carbohydrates of human milk may be novel antipathogenic agents, and the milk glycoconjugates and oligosaccharides may be a major source of protection for breastfeeding infants.

Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

Energy Technology Data Exchange (ETDEWEB)

Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

2000-02-01

The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

International Nuclear Information System (INIS)

Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

2000-01-01

The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

DEFF Research Database (Denmark)

Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

2003-01-01

alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

International Nuclear Information System (INIS)

Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN

2014-01-01

Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

DEFF Research Database (Denmark)

Fismen, S; Hedberg, A; Fenton, K A

2009-01-01

Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells.

Science.gov (United States)

Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon

2017-02-04

Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

Directory of Open Access Journals (Sweden)

Minyong Kang

2017-02-01

Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy.

Science.gov (United States)

Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi

2013-02-01

We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

Science.gov (United States)

Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

2012-01-01

Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

Directory of Open Access Journals (Sweden)

Daniela GUZMÁN-URIBE

Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

Vaccination targeting human HER3 alters the phenotype of infiltrating T cells and responses to immune checkpoint inhibition.

Science.gov (United States)

Osada, Takuya; Morse, Michael A; Hobeika, Amy; Diniz, Marcio A; Gwin, William R; Hartman, Zachary; Wei, Junping; Guo, Hongtao; Yang, Xiao-Yi; Liu, Cong-Xiao; Kaneko, Kensuke; Broadwater, Gloria; Lyerly, H Kim

2017-01-01

Expression of human epidermal growth factor family member 3 (HER3), a critical heterodimerization partner with EGFR and HER2, promotes more aggressive biology in breast and other epithelial malignancies. As such, inhibiting HER3 could have broad applicability to the treatment of EGFR- and HER2-driven tumors. Although lack of a functional kinase domain limits the use of receptor tyrosine kinase inhibitors, HER3 contains antigenic targets for T cells and antibodies. Using novel human HER3 transgenic mouse models of breast cancer, we demonstrate that immunization with recombinant adenoviral vectors encoding full length human HER3 (Ad-HER3-FL) induces HER3-specific T cells and antibodies, alters the T cell infiltrate in tumors, and influences responses to immune checkpoint inhibitions. Both preventative and therapeutic Ad-HER3-FL immunization delayed tumor growth but were associated with both intratumoral PD-1 expressing CD8 + T cells and regulatory CD4 + T cell infiltrates. Immune checkpoint inhibition with either anti-PD-1 or anti-PD-L1 antibodies increased intratumoral CD8 + T cell infiltration and eliminated tumor following preventive vaccination with Ad-HER3-FL vaccine. The combination of dual PD-1/PD-L1 and CTLA4 blockade slowed the growth of tumor in response to Ad-HER3-FL in the therapeutic model. We conclude that HER3-targeting vaccines activate HER3-specific T cells and induce anti-HER3 specific antibodies, which alters the intratumoral T cell infiltrate and responses to immune checkpoint inhibition.

Genistein inhibits proliferation of colon cancer cells by attenuating a negative effect of epidermal growth factor on tumor suppressor FOXO3 activity

International Nuclear Information System (INIS)

Qi, Wentao; Weber, Christopher R; Wasland, Kaarin; Savkovic, Suzana D

2011-01-01

Soy consumption is associated with a lower incidence of colon cancer which is believed to be mediated by one of its of components, genistein. Genistein may inhibit cancer progression by inducing apoptosis or inhibiting proliferation, but mechanisms are not well understood. Epidermal growth factor (EGF)-induced proliferation of colon cancer cells plays an important role in colon cancer progression and is mediated by loss of tumor suppressor FOXO3 activity. The aim of this study was to assess if genistein exerts anti-proliferative properties by attenuating the negative effect of EGF on FOXO3 activity. The effect of genistein on proliferation stimulated by EGF-mediated loss of FOXO3 was examined in human colonic cancer HT-29 cells. EGF-induced FOXO3 phosphorylation and translocation were assessed in the presence of genistein. EGF-mediated loss of FOXO3 interactions with p53 (co-immunoprecipitation) and promoter of p27kip1 (ChIP assay) were examined in presence of genistein in cells with mutated p53 (HT-29) and wild type p53 (HCT116). Silencing of p53 determined activity of FOXO3 when it is bound to p53. Genistein inhibited EGF-induced proliferation, while favoring dephosphorylation and nuclear retention of FOXO3 (active state) in colon cancer cells. Upstream of FOXO3, genistein acts via the PI3K/Akt pathway to inhibit EGF-stimulated FOXO3 phosphorylation (i.e. favors active state). Downstream, EGF-induced disassociation of FOXO3 from mutated tumor suppressor p53, but not wild type p53, is inhibited by genistein favoring FOXO3-p53(mut) interactions with the promoter of the cell cycle inhibitor p27kip1 in colon cancer cells. Thus, the FOXO3-p53(mut) complex leads to elevated p27kip1 expression and promotes cell cycle arrest. These novel anti-proliferative mechanisms of genistein suggest a possible role of combining genistein with other chemoreceptive agents for the treatment of colon cancer

Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

NARCIS (Netherlands)

Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

2003-01-01

Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

3',5'-Cyclic diguanylic acid (c-di-GMP) inhibits basal and growth factor-stimulated human colon cancer cell proliferation

International Nuclear Information System (INIS)

Karaolis, David K.R.; Cheng, Kunrong; Lipsky, Michael; Elnabawi, Ahmed; Catalano, Jennifer; Hyodo, Mamoru; Hayakawa, Yoshihiro; Raufman, Jean-Pierre

2005-01-01

The novel cyclic dinucleotide, 3',5'-cyclic diguanylic acid, cGpGp (c-di-GMP), is a naturally occurring small molecule that regulates important signaling mechanisms in prokaryotes. Recently, we showed that c-di-GMP has 'drug-like' properties and that c-di-GMP treatment might be a useful antimicrobial approach to attenuate the virulence and pathogenesis of Staphylococcus aureus and prevent or treat infection. In the present communication, we report that c-di-GMP (≤50 μM) has striking properties regarding inhibition of cancer cell proliferation in vitro. c-di-GMP inhibits both basal and growth factor (acetylcholine and epidermal growth factor)-induced cell proliferation of human colon cancer (H508) cells. Toxicity studies revealed that exposure of normal rat kidney cells and human neuroblastoma cells to c-di-GMP at biologically relevant doses showed no lethal cytotoxicity. Cyclic dinucleotides, such as c-di-GMP, represent an attractive and novel 'drug-platform technology' that can be used not only to develop new antimicrobial agents, but also to develop novel therapeutic agents to prevent or treat cancer

Genistein-mediated inhibition of glycosaminoglycan synthesis, which corrects storage in cells of patients suffering from mucopolysaccharidoses, acts by influencing an epidermal growth factor-dependent pathway

Directory of Open Access Journals (Sweden)

Barańska Sylwia

2009-03-01

Full Text Available Abstract Background Mucopolysaccharidoses (MPS are inherited metabolic disorders caused by mutations leading to dysfunction of one of enzymes involved in degradation of glycosaminoglycans (GAGs. Due to their impaired degradation, GAGs accumulate in cells of patients, which results in dysfunction of tissues and organs. Substrate reduction therapy is one of potential treatment of these diseases. It was demonstrated previously that genistein (4', 5, 7-trihydroxyisoflavone inhibits synthesis and reduces levels of GAGs in cultures of fibroblasts of MPS patients. Recent pilot clinical study indicated that such a therapy may be effective in MPS III (Sanfilippo syndrome. Methods To learn on details of the molecular mechanism of genistein-mediated inhibition of GAG synthesis, efficiency of this process was studied by measuring of incorporation of labeled sulfate, storage of GAGs in lysosomes was estimated by using electron microscopic techniques, and efficiency of phosphorylation of epidermal growth factor (EGF receptor was determined by using an ELISA-based assay with fluorogenic substrates. Results Effects of genistein on inhibition of GAG synthesis and accumulation in fibroblasts from patients suffering from various MPS types were abolished in the presence of an excess of EGF, and were partially reversed by an increased concentration of genistein. No such effects were observed when an excess of 17β-estradiol was used instead of EGF. Moreover, EGF-mediated stimulation of phsophorylation of the EGF receptor was impaired in the presence of genistein in both wild-type and MPS fibroblasts. Conclusion The results presented in this report indicate that the mechanism of genistein-mediated inhibition of GAG synthesis operates through epidermal growth factor (EGF-dependent pathway.

MECHANISM OF PROTEIN TYROSINE PHOSPHATASE INHIBITION IN HUMAN AIRWAY EPITHELIAL CELLS (HAEC) EXPOSED TO ZN2+

Science.gov (United States)

A number of studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to Zn2+ inhibits protein tyrosine phosphatase (PTP) activity and leads to activation of epidermal growth factor receptor (EGFR) signaling in ...

Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

DEFF Research Database (Denmark)

Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

1996-01-01

Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

Science.gov (United States)

Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

1990-12-01

We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

Epidermal stem cells: location, potential and contribution to cancer.

Science.gov (United States)

Ambler, C A; Määttä, A

2009-01-01

Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

Directory of Open Access Journals (Sweden)

Jinyang Wang

2018-05-01

Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells.

Science.gov (United States)

Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo

2017-10-01

The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

International Nuclear Information System (INIS)

Yoshito, Daniele

2011-01-01

For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

International Nuclear Information System (INIS)

Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

2009-01-01

Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

Combined inhibition of EMMPRIN and epidermal growth factor receptor prevents the growth and migration of head and neck squamous cell carcinoma cells.

Science.gov (United States)

Suzuki, Shinsuke; Ishikawa, Kazuo

2014-03-01

It has been reported that the epidermal growth factor receptor (EGFR) expression is associated with the extracellular matrix metalloproteinase inducer (EMMPRIN) in some solid tumors; however, the relationship of EMMPRIN with EGFR in head and neck cancers is not fully understood. To determine the relationship between EMMPRIN and EGFR in head and neck squamous cell carcinoma (HNSCC), HNSCC cells were stimulated with epidermal growth factor (EGF), a ligand of EGFR. EMMPRIN expression in HNSCC cells was upregulated by EGF. In addition, EGF stimulation induced HNSCC cell invasion and MMP-9 expression. This increase in invasion and MMP-9 expression was abrogated by downmodulation of EMMPRIN. Furthermore, to determine the effects of combined EMMPRIN and EGFR targeting in HNSCC, HNSCC cells were treated with an EMMPRIN function-blocking antibody and the EGFR inhibitor AG1478. This combined treatment resulted in greater inhibition of HNSCC cell proliferation and migration compared with the individual agents alone. These results suggest that EMMPRIN mediates EGFR-induced tumorigenicity and that combined targeting of EMMPRIN and EGFR may be an efficacious treatment approach.

Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

International Nuclear Information System (INIS)

Kang, Khong Bee; Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong

2012-01-01

Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)–Akt-DNA–dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H 2 AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H 2 AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G 2 /M arrest and increased γ-H 2 AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H 2 AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are resistant to irradiation

Gefitinib radiosensitizes stem-like glioma cells: inhibition of epidermal growth factor receptor-Akt-DNA-PK signaling, accompanied by inhibition of DNA double-strand break repair.

Science.gov (United States)

Kang, Khong Bee; Zhu, Congju; Wong, Yin Ling; Gao, Qiuhan; Ty, Albert; Wong, Meng Cheong

2012-05-01

We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H(2)AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H(2)AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G(2)/M arrest and increased γ-H(2)AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H(2)AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Stem-like gliomaspheres are resistant to irradiation-induced cytotoxicity, G(2)/M arrest, and DNA DSBs, compared with nonstem

Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

Energy Technology Data Exchange (ETDEWEB)

Kang, Khong Bee, E-mail: dmskkb@nccs.com.sg [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore); Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore)

2012-05-01

Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, {gamma}-H{sub 2}AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, {gamma}-H{sub 2}AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G{sub 2}/M arrest and increased {gamma}-H{sub 2}AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased {gamma}-H{sub 2}AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are

The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

International Nuclear Information System (INIS)

Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung

2012-01-01

Highlights: ► HBP sequence identified from HB-EGF has cell penetration activity. ► HBP inhibits the NF-κB dependent inflammatory responses. ► HBP directly blocks phosphorylation and degradation of IκBα. ► HBP inhibits nuclear translocation of NF-κB p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

Hybrid Enhanced Epidermal SpaceSuit Design Approaches

Science.gov (United States)

Jessup, Joseph M.

A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

Science.gov (United States)

Chaudhuri, R K; Bojanowski, K

2017-10-01

The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

International Nuclear Information System (INIS)

Dailey, G.E.; Kraus, J.W.; Orth, D.N.

1978-01-01

Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

Tight junction regulates epidermal calcium ion gradient and differentiation

International Nuclear Information System (INIS)

Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

2011-01-01

Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

Directory of Open Access Journals (Sweden)

Yu-Ping Hsiao

2015-01-01

Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

Human Sulfatase 2 inhibits in vivo tumor growth of MDA-MB-231 human breast cancer xenografts

International Nuclear Information System (INIS)

Peterson, Sarah M; Concino, Michael F; Liaw, Lucy; Martini, Paolo GV; Iskenderian, Andrea; Cook, Lynette; Romashko, Alla; Tobin, Kristen; Jones, Michael; Norton, Angela; Gómez-Yafal, Alicia; Heartlein, Michael W

2010-01-01

Extracellular human sulfatases modulate growth factor signaling by alteration of the heparin/heparan sulfate proteoglycan (HSPG) 6-O-sulfation state. HSPGs bind to numerous growth factor ligands including fibroblast growth factors (FGF), epidermal growth factors (EGF), and vascular endothelial growth factors (VEGF), and are critically important in the context of cancer cell growth, invasion, and metastasis. We hypothesized that sulfatase activity in the tumor microenvironment would regulate tumor growth in vivo. We established a model of stable expression of sulfatases in the human breast cancer cell line MDA-MB-231 and purified recombinant human Sulfatase 2 (rhSulf2) for exogenous administration. In vitro studies were performed to measure effects on breast cancer cell invasion and proliferation, and groups were statistically compared using Student's t-test. The effects of hSulf2 on tumor progression were tested using in vivo xenografts with two methods. First, MDA-MB-231 cells stably expressing hSulf1, hSulf2, or both hSulf1/hSulf2 were grown as xenografts and the resulting tumor growth and vascularization was compared to controls. Secondly, wild type MDA-MB-231 xenografts were treated by short-term intratumoral injection with rhSulf2 or vehicle during tumor growth. Ultrasound analysis was also used to complement caliper measurement to monitor tumor growth. In vivo studies were statistically analyzed using Student's t test. In vitro, stable expression of hSulf2 or administration of rhSulf2 in breast cancer cells decreased cell proliferation and invasion, corresponding to an inhibition of ERK activation. Stable expression of the sulfatases in xenografts significantly suppressed tumor growth, with complete regression of tumors expressing both hSulf1 and hSulf2 and significantly smaller tumor volumes in groups expressing hSulf1 or hSulf2 compared to control xenografts. Despite significant suppression of tumor volume, sulfatases did not affect vascular

Synergistic Induction of Cyclooxygenase-2 by Transforming Growth Factor-β1 and Epidermal Growth Factor Inhibits Apoptosis in Epithelial Cells

Directory of Open Access Journals (Sweden)

Debabrata Saha

1999-12-01

Full Text Available Increased expression of cyclooxygenase-2 (COX-2 expression has been observed in several human tumor types and in selected animal and cell culture models of carcinogenesis, including lung cancer. Increased expression of COX-2 and production of prostaglandins appear to provide a survival advantage to transformed cells through the inhibition of apoptosis, increased attachment to extracellular matrix, increased invasiveness, the stimulation of angiogenesis. In the present studies, we found that transforming growth factor β1 (TGF-β1 and epidermal growth factor (EGF synergistically induced the expression of COX-2 and prostaglandin E2 (PGE2 production in mink lung epithelial (Mvi Lu cells. EGF, but not PDGF or IGF-1, was able to inhibit TGF-β1-induced apoptosis in Mvi Lu cells and this effect was blocked by NS-398, a selective inhibitor of COX-2 activity, suggesting a possible role for COX-2 in the anti-apoptosic effect of EGF receptor ligands. The combination of TGF-β1 and EGF also significantly induced COX-2 expression in rat intestinal epithelial (RIE-1 cells and completely prevented sodium butyrate (NaBu-induced apoptosis. The synergistic induction of COX-2 by TGF-β1 and EGF was not observed in R1B-L17 cells, a line derived from Mvi Lu cells that lacks the TGF-β type-I receptor. AG1478, a selective inhibitor of EGF receptor tyrosine kinase activity, completely suppressed the induction of COX-2 expression by either EGF or TGF-β1+EGF. Also, PD98059, a specific inhibitor of MEK/ERK pathway, SB203580, a specific inhibitor of p38 MAPK activity, significantly inhibited the induction of COX-2 in response to combined EGF and TGF-β1. These results suggest an important collaborative interaction of TGF-β1 and EGF signaling in the induction of COX-2 and prostaglandin production in Mv1Lu cells.

Fatty acids are required for epidermal permeability barrier function.

Science.gov (United States)

Mao-Qiang, M; Elias, P M; Feingold, K R

1993-08-01

The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

EGFR-inhibition enhances apoptosis in irradiated human head and neck xenograft tumors independent of effects on DNA repair

NARCIS (Netherlands)

Stegeman, H.; Span, P.N.; Cockx, S.C.; Peters, J.P.W.; Rijken, P.F.J.W.; Kogel, A.J. van der; Kaanders, J.H.A.M.; Bussink, J.

2013-01-01

Epidermal growth factor receptor (EGFR) inhibition using cetuximab improves the efficacy of radiotherapy in only a subgroup of head and neck squamous cell carcinoma (HNSCC) patients. Therefore, to improve patient selection a better understanding of tumor characteristics that affect treatment is

Predicting human epidermal melanin concentrations for different skin tones

CSIR Research Space (South Africa)

Smit, Jacoba E

2011-07-01

Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

Growth of melanocytes in human epidermal cell cultures

International Nuclear Information System (INIS)

Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

1990-01-01

Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

DEFF Research Database (Denmark)

Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten

2011-01-01

To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

International Nuclear Information System (INIS)

Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

1997-01-01

Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

Effect and Mechanism of EGFL7 Downregulation in Human Osteosarcoma Cells on the Biological Function of Co-cultured HUVEC

Directory of Open Access Journals (Sweden)

Xia Li

2018-03-01

epidermal growth factor-like domain 7 in U2OS could significantly inhibit the migration, adhesion, and angiogenic ability of co-cultured human umbilical vein endothelial cells. In addition, the expressions of phosphoinositide 3-kinase, phospho-Akt, and vascular endothelial growth factor in human umbilical vein endothelial cells decreased after co-culturing with epidermal growth factor-like domain 7-knockdown U2OS. Conclusion: Epidermal growth factor-like domain 7-knockdown U2OS cells inhibit the migration, adhesion, and angiogenesis of co-cultured human umbilical vein endothelial cells by diminishing phosphoinositide 3-kinase, Akt signaling pathway activity and vascular endothelial growth factor expression.

Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

Science.gov (United States)

Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

2005-01-01

The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

"Cut-and-paste" manufacture of multiparametric epidermal electronic systems

Science.gov (United States)

Lu, Nanshu; Yang, Shixuan; Wang, Pulin

2016-05-01

Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

Science.gov (United States)

Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

2011-10-01

Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

Effects of soap-water wash on human epidermal penetration.

Science.gov (United States)

Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

2016-08-01

Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

NARCIS (Netherlands)

van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.

2014-01-01

Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

NARCIS (Netherlands)

van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

Science.gov (United States)

Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

2010-01-01

This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

Grafting of human epidermal cells, presence and perspectives

Czech Academy of Sciences Publication Activity Database

Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

2001-01-01

Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

Science.gov (United States)

Kremer, M; Lang, E; Berger, A C

2000-09-01

Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

Science.gov (United States)

Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

2016-02-01

Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

International Nuclear Information System (INIS)

Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

1997-01-01

Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

Human erythrocytes inhibit complement-mediated solubilization of immune complexes by human serum

International Nuclear Information System (INIS)

Dorval, B.L.

1987-01-01

The aim of this study was to develop an autologus human system to evaluate the effects of human erythrocytes on solubilization of immune complex precipitates (IC) by human serum. Incubation of IC with fresh human serum or guinea pig serum resulted in solubilization of IC. When packed erythrocytes were added to human serum or guinea pig serum binding of IC to the erythrocyte occurred and IC solubilization was inhibited significantly (p <.025). Sheep erythrocytes did not bind IC or inhibit IC solubilization. To evaluate the role of human erythrocyte complement receptor (CR1) on these findings, human erythrocytes were treated with trypsin or anti-CR1 antibodies. Both treatments abrogated IC binding to human erythrocytes but did not affect the ability of the human erythrocyte to inhibit IC solubilization. Radioimmunoassay was used to measure C3, C4 and C5 activation in human serum after incubation with IC, human erythrocytes, human erythrocytes plus IC, whole blood or in whole blood plus IC

Effects of epidermal growth factor receptor kinase inhibition on radiation response in canine osteosarcoma cells.

Science.gov (United States)

Mantovani, Fernanda B; Morrison, Jodi A; Mutsaers, Anthony J

2016-05-31

Radiation therapy is a palliative treatment modality for canine osteosarcoma, with transient improvement in analgesia observed in many cases. However there is room for improvement in outcome for these patients. It is possible that the addition of sensitizing agents may increase tumor response to radiation therapy and prolong quality of life. Epidermal growth factor receptor (EGFR) expression has been documented in canine osteosarcoma and higher EGFR levels have been correlated to a worse prognosis. However, effects of EGFR inhibition on radiation responsiveness in canine osteosarcoma have not been previously characterized. This study examined the effects of the small molecule EGFR inhibitor erlotinib on canine osteosarcoma radiation responses, target and downstream protein expression in vitro. Additionally, to assess the potential impact of treatment on tumor angiogenesis, vascular endothelial growth factor (VEGF) levels in conditioned media were measured. Erlotinib as a single agent reduced clonogenic survival in two canine osteosarcoma cell lines and enhanced the impact of radiation in one out of three cell lines investigated. In cell viability assays, erlotinib enhanced radiation effects and demonstrated single agent effects. Erlotinib did not alter total levels of EGFR, nor inhibit downstream protein kinase B (PKB/Akt) activation. On the contrary, erlotinib treatment increased phosphorylated Akt in these osteosarcoma cell lines. VEGF levels in conditioned media increased after erlotinib treatment as a single agent and in combination with radiation in two out of three cell lines investigated. However, VEGF levels decreased with erlotinib treatment in the third cell line. Erlotinib treatment promoted modest enhancement of radiation effects in canine osteosarcoma cells, and possessed activity as a single agent in some cell lines, indicating a potential role for EGFR inhibition in the treatment of a subset of osteosarcoma patients. The relative radioresistance of

UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

International Nuclear Information System (INIS)

Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

1996-01-01

UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography.

Science.gov (United States)

Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique

2014-10-01

While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment

Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

Science.gov (United States)

Mohammedsaeed, Walaa; McBain, Andrew J.; Cruickshank, Sheena M.

2014-01-01

Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. PMID:25015889

Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

DEFF Research Database (Denmark)

Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

2005-01-01

The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

International Nuclear Information System (INIS)

Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

1975-01-01

Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

Response of human epidermal keratinocytes to UV light

International Nuclear Information System (INIS)

Kartasova, A.A.

1987-01-01

This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

Science.gov (United States)

Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

2008-12-01

Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

Epidermal growth factor and its receptors in human pancreatic carcinoma

International Nuclear Information System (INIS)

Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

1990-01-01

The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

Science.gov (United States)

Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

2014-01-01

We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

DEFF Research Database (Denmark)

Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

2003-01-01

In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

[Progress in epidermal stem cells].

Science.gov (United States)

Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

2010-03-01

Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

NARCIS (Netherlands)

Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.

2007-01-01

PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

A cyclic peptide derived from alpha-fetoprotein inhibits the proliferative effects of the epidermal growth factor and estradiol in MCF7 cells.

Science.gov (United States)

Torres, Cristian; Antileo, Elmer; Epuñán, Maráa José; Pino, Ana María; Valladares, Luis Emilio; Sierralta, Walter Daniel

2008-06-01

A cyclic peptide derived from the active domain of alpha-fetoprotein (AFP) significantly inhibited the proliferation of MCF7 cells stimulated with the epidermal growth factor (EGF) or estradiol (E2). The action of these three agents on cell growth was independent of the presence of calf serum in the culture medium. Our results demonstrated that the cyclic peptide interfered markedly with the regulation of MAPK by activated c-erbB2. The cyclic peptide showed no effect on the E2-stimulated release of matrix metalloproteinases 2 and 9 nor on the shedding of heparin-binding EGF into the culture medium. We propose that the AFP-derived cyclic peptide represents a valuable novel antiproliferative agent for treating breast cancer.

Inhibition in the Human Auditory Cortex.

Directory of Open Access Journals (Sweden)

Koji Inui

Full Text Available Despite their indispensable roles in sensory processing, little is known about inhibitory interneurons in humans. Inhibitory postsynaptic potentials cannot be recorded non-invasively, at least in a pure form, in humans. We herein sought to clarify whether prepulse inhibition (PPI in the auditory cortex reflected inhibition via interneurons using magnetoencephalography. An abrupt increase in sound pressure by 10 dB in a continuous sound was used to evoke the test response, and PPI was observed by inserting a weak (5 dB increase for 1 ms prepulse. The time course of the inhibition evaluated by prepulses presented at 10-800 ms before the test stimulus showed at least two temporally distinct inhibitions peaking at approximately 20-60 and 600 ms that presumably reflected IPSPs by fast spiking, parvalbumin-positive cells and somatostatin-positive, Martinotti cells, respectively. In another experiment, we confirmed that the degree of the inhibition depended on the strength of the prepulse, but not on the amplitude of the prepulse-evoked cortical response, indicating that the prepulse-evoked excitatory response and prepulse-evoked inhibition reflected activation in two different pathways. Although many diseases such as schizophrenia may involve deficits in the inhibitory system, we do not have appropriate methods to evaluate them; therefore, the easy and non-invasive method described herein may be clinically useful.

Epidermal Growth Factor and Intestinal Barrier Function

Directory of Open Access Journals (Sweden)

Xiaopeng Tang

2016-01-01

Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis

International Nuclear Information System (INIS)

Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.

1986-01-01

Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers

Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

Energy Technology Data Exchange (ETDEWEB)

Yoshito, Daniele

2011-07-01

For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

Peptide inhibition of human cytomegalovirus infection

Directory of Open Access Journals (Sweden)

Morris Cindy A

2011-02-01

Full Text Available Abstract Background Human cytomegalovirus (HCMV is the most prevalent congenital viral infection in the United States and Europe causing significant morbidity and mortality to both mother and child. HCMV is also an opportunistic pathogen in immunocompromised individuals, including human immunodeficiency virus (HIV- infected patients with AIDS, and solid organ and allogeneic stem cell transplantation recipients. Current treatments for HCMV-associated diseases are insufficient due to the emergence of drug-induced resistance and cytotoxicity, necessitating novel approaches to limit HCMV infection. The aim of this study was to develop therapeutic peptides targeting glycoprotein B (gB, a major glycoprotein of HCMV that is highly conserved across the Herpesviridae family, that specifically inhibit fusion of the viral envelope with the host cell membrane preventing HCMV entry and infection. Results Using the Wimley-White Interfacial Hydrophobicity Scale (WWIHS, several regions within gB were identified that display a high potential to interact with lipid bilayers of cell membranes and hydrophobic surfaces within proteins. The ability of synthetic peptides analogous to WWIHS-positive sequences of HCMV gB to inhibit viral infectivity was evaluated. Human foreskin fibroblasts (HFF were infected with the Towne-GFP strain of HCMV (0.5 MOI, preincubated with peptides at a range of concentrations (78 nm to 100 μM, and GFP-positive cells were visualized 48 hours post-infection by fluorescence microscopy and analyzed quantitatively by flow cytometry. Peptides that inhibited HCMV infection demonstrated different inhibitory concentration curves indicating that each peptide possesses distinct biophysical properties. Peptide 174-200 showed 80% inhibition of viral infection at a concentration of 100 μM, and 51% and 62% inhibition at concentrations of 5 μM and 2.5 μM, respectively. Peptide 233-263 inhibited infection by 97% and 92% at concentrations of 100 �

Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

International Nuclear Information System (INIS)

Korc, M.; Magun, B.E.

1985-01-01

PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

Inhibition of EGF processing in responsive and nonresponsive human fibroblasts

International Nuclear Information System (INIS)

Schaudies, R.P.; Wray, H.L.

1988-01-01

We have examined the proteolytic processing of radiolabeled epidermal growth factor (EGF) in EGF growth-responsive human foreskin fibroblasts (HFF) versus EGF nonresponsive human fetal lung fibroblasts (HFL). Previous studies have shown that both cell lines demonstrate similar binding affinities and numbers of binding sites, as well as similar rates of internalization and degradation of the bound, radiolabeled hormone. We have used nondenaturing electrophoresis to compare how these two cell lines process EGF at its carboxy terminus. EGF lacking either one [des-(53)-EGF] or six [des (48-53)-EGF] carboxy terminal amino acids could be distinguished by this method. Chloroquine or leupeptin were added to the incubation system in an attempt to accentuate potential differences in hormonal processing between the responsive and nonresponsive cell lines. In the absence of inhibitors, the responsive and nonresponsive cells generated similar distributions of processed forms of EGF after 30-minutes incubation. However, after 4-hours incubation in the constant presence of 125I-EGF, the electrophoretic profiles of extracted hormone were substantially different. The radiolabel within the responsive cells, as well as that released from them, migrated predominantly at the dye front, indicating complete degradation of EGF. In contrast, the majority of the radiolabel within the nonresponsive cells migrated as partially processed forms of hormone, while the released radiolabel migrated at the dye front. Addition of chloroquine to either cell line inhibited processing of EGF beyond removal of the carboxyl terminal arginine residue. Both intact 125I-EGF, and 125I-EGF lacking the carboxyl terminal arginine were released from chloroquine-treated cells in a ratio equal to that present in the intact cells

Bioactive potency of epidermal mucus extracts from greasy grouper, Epinephelus tauvina (Forsskal, 1775

Directory of Open Access Journals (Sweden)

Ganesh Manikantan

2016-07-01

Full Text Available Objective: To study the bio-potency of epidermal mucus from Epinephelus tauvina. Methods: Mucus was extracted with acidic, organic and aqueous solvents. Protein, carbohydrate, lipid, amino acid and fatty acid content of mucus extracts were quantified by UV-spectrophotometer, high performance liquid chromatography and gas chromatographymass spectrometer, respectively. Antimicrobial activity was tested against five human and fish pathogens by using agar well diffusion method. The molecular weight of peptides was determined using sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The haemolytic activity of extracts was tested against chick, goat, cow and human red blood cell. Results: Protein contributed with maximum of 26.25% in crude mucus. Arginine was recorded maximum of (133.9 nmol/mL in crude mucus. 2,4,6-Decatrienoic acid and bis (a-chloroethyl sulfone were confirmed in organic extract. The antimicrobial activity of acidic extract was significant. Among the human pathogens, maximum zone of inhibition [(26.0 ± 0.3 mm] was observed against Proteus mirabilis. Whereas, among fish pathogens maximum zone of inhibition [(25.0 ± 0.1 mm] was observed against Vibrio parahemolyticus. The activity of other two extracts was not remarkable. The molecular weight of peptides ranged from 115.5– 37.1 kDa in acidic extract was determined. Chicken and goat blood were found to be highly vulnerable to the lysis. Conclusions: The whole mucus could be a promising source with numerous bioactivepotency. Consequently, this preliminary information suggested that mucus is a source of novel antimicrobial agents for fish and human health related applications.

Stepwise Progress in Epidermal Growth Factor Receptor/Radiation Studies for Head and Neck Cancer

International Nuclear Information System (INIS)

Harari, Paul M.

2007-01-01

The U.S. Food and Drug Administration approval of four new epidermal growth factor receptor (EGFR) inhibitors for cancer therapy (cetuximab, panitumumab, gefitinib, and erlotinib) over the last 3 years is a remarkable milestone in oncology. Indeed, molecular inhibition of EGFR signaling represents one of the most promising current arenas for the development of molecular-targeted cancer therapies. Epidermal growth factor receptor inhibitors from both the monoclonal antibody and tyrosine kinase inhibitor class have demonstrated clinical activity in the treatment of a broad spectrum of common human malignancies. For the discipline of radiation oncology, the 2006 report of a phase III trial demonstrating a survival advantage for advanced head and neck cancer patients with the addition of weekly cetuximab during a 7-week course of radiation is particularly gratifying. Indeed, this is the first phase III trial to confirm a survival advantage with the addition of a molecular-targeted agent to radiation. Furthermore, this result seems to have been achieved with only a modest increment in overall treatment toxicity and with very high compliance to the prescribed treatment regimen. Nevertheless, much remains to be learned regarding the rational integration of EGFR inhibitors into cancer treatment regimens, as well as methods to optimize the selection of patients most likely to benefit from EGFR inhibitor strategies

Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis.

Science.gov (United States)

McKnight, Braden; Seidel, Rachel; Moy, Ron

2015-10-01

Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

Primary structure of the human follistatin precursor and its genomic organization

International Nuclear Information System (INIS)

Shimasaki, Shunichi; Koga, Makoto; Esch, F.

1988-01-01

Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. By use of the recently characterized porcine follistatin cDNA as a probe to screen a human testis cDNA library and a genomic library, the structure of the complete human follistatin precursor as well as its genomic organization have been determined. Three of eight cDNA clones that were sequenced predicted a precursor with 344 amino acids, whereas the remaining five cDNA clones encoded a 317 amino acid precursor, resulting from alternative splicing of the precursor mRNA. Mature follistatins contain four contiguous domains that are encoded by precisely separated exons; three of the domains are highly similar to each other, as well as to human epidermal growth factor and human pancreatic secretory trypsin inhibitor. The genomic organization of the human follistatin is similar to that of the human epidermal growth factor gene and thus supports the notion of exon shuffling during evolution

Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

Science.gov (United States)

Rastogi, Anshu; Pospísil, Pavel

2010-08-01

All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

Science.gov (United States)

Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

2017-05-01

High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

Epidermal growth in the bottlenose dolphin, Tursiops truncatus

International Nuclear Information System (INIS)

Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

1985-01-01

Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

Epidermal growth in the bottlenose dolphin, Tursiops truncatus

Energy Technology Data Exchange (ETDEWEB)

Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

1985-07-01

Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.

Science.gov (United States)

Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

2017-01-01

Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

Melittin suppresses HIF-1α/VEGF expression through inhibition of ERK and mTOR/p70S6K pathway in human cervical carcinoma cells.

Directory of Open Access Journals (Sweden)

Jae-Moon Shin

Full Text Available OBJECTIVE: Melittin (MEL, a major component of bee venom, has been associated with various diseases including arthritis, rheumatism and various cancers. In this study, the anti-angiogenic effects of MEL in CaSki cells that were responsive to the epidermal growth factor (EGF were examined. METHODOLOGY/PRINCIPAL FINDINGS: MEL decreased the EGF-induced hypoxia-inducible factor-1α (HIF-1α protein and significantly regulated angiogenesis and tumor progression. We found that inhibition of the HIF-1α protein level is due to the shortened half-life by MEL. Mechanistically, MEL specifically inhibited the EGF-induced HIF-1α expression by suppressing the phosphorylation of ERK, mTOR and p70S6K. It also blocked the EGF-induced DNA binding activity of HIF-1α and the secretion of the vascular endothelial growth factor (VEGF. Furthermore, the chromatin immunoprecipitation (ChIP assay revealed that MEL reduced the binding of HIF-1α to the VEGF promoter HRE region. The anti-angiogenesis effects of MEL were confirmed through a matrigel plus assay. CONCLUSIONS: MEL specifically suppressed EGF-induced VEGF secretion and new blood vessel formation by inhibiting HIF-1α. These results suggest that MEL may inhibit human cervical cancer progression and angiogenesis by inhibiting HIF-1α and VEGF expression.

Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

International Nuclear Information System (INIS)

Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

2005-01-01

The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

Science.gov (United States)

Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

2017-10-01

Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

BDNF/TrkB signaling protects HT-29 human colon cancer cells from EGFR inhibition

International Nuclear Information System (INIS)

Brunetto de Farias, Caroline; Heinen, Tiago Elias; Pereira dos Santos, Rafael; Abujamra, Ana Lucia; Schwartsmann, Gilberto

2012-01-01

Highlights: ► BDNF protected HT-29 colorectal cancer cells from the antitumor effect of cetuximab. ► TrkB inhibition potentiated the antitumor effect of cetuximab. ► BDNF/TrkB signaling might be involved in resistance to anti-EGFR therapy. -- Abstract: The clinical success of targeted treatment of colorectal cancer (CRC) is often limited by resistance to anti-epidermal growth factor receptor (EGFR) therapy. The neurotrophin brain-derived neurotrophic factor (BDNF) and its receptor TrkB have recently emerged as anticancer targets, and we have previously shown increased BDNF levels in CRC tumor samples. Here we report the findings from in vitro experiments suggesting that BDNF/TrkB signaling can protect CRC cells from the antitumor effects of EGFR blockade. The anti-EGFR monoclonal antibody cetuximab reduced both cell proliferation and the mRNA expression of BDNF and TrkB in human HT-29 CRC cells. The inhibitory effect of cetuximab on cell proliferation and survival was counteracted by the addition of human recombinant BDNF. Finally, the Trk inhibitor K252a synergistically enhanced the effect of cetuximab on cell proliferation, and this effect was blocked by BDNF. These results provide the first evidence that increased BDNF/TrkB signaling might play a role in resistance to EGFR blockade. Moreover, it is possible that targeting TrkB could potentiate the anticancer effects of anti-EGFR therapy.

Internalization mechanisms of the epidermal growth factor receptor after activation with different ligands.

Directory of Open Access Journals (Sweden)

Lasse Henriksen

Full Text Available The epidermal growth factor receptor (EGFR regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF and transforming growth factor-α (TGF-α. For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF or betacellulin (BTC was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown.

Internalization Mechanisms of the Epidermal Growth Factor Receptor after Activation with Different Ligands

Science.gov (United States)

Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther

2013-01-01

The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148

Flow cytometry of human primary epidermal and follicular keratinocytes.

Science.gov (United States)

Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

2008-02-19

The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

Screening of plant extracts for human tyrosinase inhibiting effects.

Science.gov (United States)

Kim, M; Park, J; Song, K; Kim, H G; Koh, J-S; Boo, Y C

2012-04-01

Screening for tyrosinase (TYR) inhibitors potentially useful for control of skin pigmentation has been hampered by the limited availability of human TYR. To overcome this hurdle, we have established human embryonic kidney (HEK293)-TYR cells that constitutively express human TYR. In the current study, we assayed human TYR inhibition activities of 50 plant extracts using the lysates of transformed HEK293-TYR cells. The strongest inhibition of human TYR was shown by the extract of Vaccinium bracteatum Thunberg, followed by the extract of Morus bombycis Koidzumi. The former extract did not inhibit mushroom TYR activity whereas significant inhibition was observed with the latter extract, demonstrating the importance of using human TYR in the screening for human TYR inhibitors. Upon liquid-liquid partitioning of the extract from V. bracteatum, the active constituents were enriched in the ethyl acetate fraction, and the subsequent preparatory thin-layer chromatography identified p-coumaric acid (PCA) as the main active constituent. The hypo-pigmentation of PCA was verified in the MelanoDerm™ Skin Model. This study demonstrates that transformed HEK293-TYR cells could expedite the discovery of human TYR-specific inhibitors from natural sources which might be useful in the control of skin pigmentation. © 2012 The Authors. ICS © 2012 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Icotinib inhibits EGFR signaling and alleviates psoriasis-like symptoms in animal models.

Science.gov (United States)

Tan, Fenlai; Yang, Guiqun; Wang, Yanping; Chen, Haibo; Yu, Bo; Li, He; Guo, Jing; Huang, Xiaoling; Deng, Yifang; Yu, Pengxia; Ding, Lieming

2018-02-01

To investigate the effects of icotinib hydrochloride and a derivative cream on epidermal growth factor receptor (EGFR) signaling and within animal psoriasis models, respectively. The effect of icotinib on EGFR signaling was examined in HaCaT cells, while its effect on angiogenesis was tested in chick embryo chorioallantoic membranes (CAM). The effectiveness of icotinib in treating psoriasis was tested in three psoriasis models, including diethylstilbestrol-treated mouse vaginal epithelial cells, mouse tail granular cell layer formation, and propranolol-induced psoriasis-like features in guinea pig ear skin. Icotinib treatment blocked EGFR signaling and reduced HaCaT cell viability as well as suppressed CAM angiogenesis. Topical application of icotinib ameliorated psoriasis-like histological characteristics in mouse and guinea pig psoriasis models. Icotinib also significantly inhibited mouse vaginal epithelium mitosis, promoted mouse tail squamous epidermal granular layer formation, and reduced the thickness of the horny layer in propranolol treated auricular dorsal surface of guinea pig. We conclude that icotinib can effectively inhibit psoriasis in animal models. Future clinical studies should be conducted to explore the therapeutic effects of icotinb in humans. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

In Vitro Responsiveness of Glioma Cell Lines to Multimodality Treatment With Radiotherapy, Temozolomide, and Epidermal Growth Factor Receptor Inhibition With Cetuximab

International Nuclear Information System (INIS)

Combs, Stephanie E.; Schulz-Ertner, Daniela; Roth, Wilfried; Herold-Mende, Christel; Debus, Juergen; Weber, Klaus-Josef

2007-01-01

Background: The majority of glioblastoma multiforme (GBM) cells express the epidermal growth factor receptor (EGFR). The present study evaluates the combination of temozolomide (TMZ), EGFR inhibition, and radiotherapy (RT) in GBM cell lines. Methods and Materials: Human GBM cell lines U87, LN229, LN18, NCH 82, and NCH 89 were treated with various combinations of TMZ, RT, and the monoclonal EGFR antibody cetuximab. Responsiveness of glioma cells to the combination treatment was measured by clonogenic survival. Results: Overall, double and triple combinations of RT, TMZ, and cetuximab lead to additive cytotoxic effects (independent toxicity). A notable exception was observed for U87 and LN 18 cell lines, where the combination of TMZ and cetuximab showed substantial antagonism. Interestingly, in these two cell lines, the combination of RT with cetuximab resulted in a substantial increase in cell killing over that expected for independent toxicity. The triple combination with RT, cetuximab, and TMZ was nearly able to overcome the antagonism for the TMZ/cetuximab combination in U87, however only marginally in LN18, GBM cell lines. Conclusion: It appears that EGFR expression is not correlated with cytotoxic effects exerted by cetuximab. Combination treatment with TMZ, cetuximab and radiation resulted in independent toxicity in three out of five cell lines evaluated, the antagonistic effect of the TMZ/cetuximab combination in two cell lines could indicate that TMZ preferentially kills cetuximab-resistant cells, suggesting for some cross-talk between toxicity mechanisms. Expression of EGFR was no surrogate marker for responsiveness to cetuximab, alone or in combination with RT and TMZ

Modulation of Regorafenib effects on HCC cell lines by epidermal growth factor.

Science.gov (United States)

D'Alessandro, Rosalba; Refolo, Maria Grazia; Lippolis, Catia; Carella, Nicola; Messa, Caterina; Cavallini, Aldo; Carr, Brian Irving

2015-06-01

Blood platelet numbers are correlated to growth and aggressiveness of several tumor types, including hepatocellular carcinoma (HCC). We previously found that platelet lysates (hPLs) also stimulated growth and migration, and antagonized the growth-inhibitory and apoptotic effects of both Sorafenib and Regorafenib, two multikinase inhibitors, on three HCC cell lines. In this study, in vitro function of human epidermal growth factor (EGF) with and without Sorafenib or Regorafenib was investigated. An ELISA kit was used to evaluate the EGF concentrations in hPLs. In vitro function of EGF was assessed with proliferation MTT test. Apoptosis assay, scratch assays, and Transwell assays were performed for apoptosis, invasion, and migration, respectively. MAPK Activation Kit was used to explore MAPK phosphorylation. EGF antagonized the growth inhibition of Regorafenib on three HCC cell lines. Regorafenib-mediated growth inhibition was blocked by 70 % when the cells were pre-treated with EGF. EGF also blocked Regorafenib-induced apoptosis, as well as Regorafenib-induced decreases in cell migration and invasion. The EGF effects were in turn antagonized by concomitant addition to the cultures of EGF receptor antagonist Erlotinib, showing that the EGF receptor was involved in the mechanisms of EGF-mediated blocking of Regorafenib effects. Erlotinib also partially blocked the effects of hPLs in antagonizing Regorafenib-mediated growth inhibition, showing that EGF was an important component of hPL actions. All these results show that EGF antagonized Regorafenib-mediated growth and migration inhibition and apoptosis induction in HCC cells and reinforce the idea that microenvironment can influence cancer drug actions.

Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

Science.gov (United States)

Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

2018-01-01

The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Kinetics of growth and differentiation of cultured human epidermal keratinocytes

International Nuclear Information System (INIS)

Albers, K.M.

1985-01-01

A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

Photoprotective Properties of Isothiocyanate and Nitrile Glucosinolate Derivatives From Meadowfoam (Limnanthes alba Against UVB Irradiation in Human Skin Equivalent

Directory of Open Access Journals (Sweden)

Evan L. Carpenter

2018-05-01

Full Text Available Exposure to ultraviolet B (UVB irradiation of the skin leads to numerous dermatological concerns including skin cancer and accelerated aging. Natural product glucosinolate derivatives, like sulforaphane, have been shown to exhibit chemopreventive and photoprotective properties. In this study, we examined meadowfoam (Limnanthes alba glucosinolate derivatives, 3-methoxybenzyl isothiocyanate (MBITC and 3-methoxyphenyl acetonitrile (MPACN, for their activity in protecting against the consequences of UV exposure. To that end, we have exposed human primary epidermal keratinocytes (HPEKs and 3D human skin reconstructed in vitro (EpiDermTM FT-400 to UVB insult and investigated whether MBITC and MPACN treatment ameliorated the harmful effects of UVB damage. Activity was determined by the compounds’ efficacy in counteracting UVB-induced DNA damage, matrix-metalloproteinase (MMP expression, and proliferation. We found that in monolayer cultures of HPEK, MBITC and MPACN did not protect against a UVB-induced loss in proliferation and MBITC itself inhibited cell proliferation. However, in human reconstructed skin-equivalents, MBITC and MPACN decrease epidermal cyclobutane pyrimidine dimers (CPDs and significantly reduce total phosphorylated γH2A.X levels. Both MBITC and MPACN inhibit UVB-induced MMP-1 and MMP-3 expression indicating their role to prevent photoaging. Both compounds, and MPACN in particular, showed activity against UVB-induced proliferation as indicated by fewer epidermal PCNA+ cells and prevented UVB-induced hyperplasia as determined by a reduction in reconstructed skin epidermal thickness (ET. These data demonstrate that MBITC and MPACN exhibit promising anti-photocarcinogenic and anti-photoaging properties in the skin microenvironment and could be used for therapeutic interventions.

Internalization mechanisms of the epidermal growth factor receptor after activation with different ligands

DEFF Research Database (Denmark)

Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe

2013-01-01

after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist....... Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown...... fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand...

How x rays inhibit amphibian limb regeneration

International Nuclear Information System (INIS)

Maden, M.; Wallace, H.

1976-01-01

The effects of an inhibiting dose of 2,000 rad of x-rays on the regenerating limbs of axolotl larvae have been examined in a histological and cytological study. Particular attention was paid to the mitotic indices of normal and irradiated epidermal and blastemal cells. Both the characteristic pattern of epidermal mitotic stimulation which normally follows amputation and the later increase in blastemal mitoses are suppressed by irradiation. In most cells the effects are permanent, but in a small proportion a mitotic delay is induced and upon subsequent division chromosome damage in the form of micronuclei is revealed. Thus irradiated cells which do divide almost certainly die. These results are discussed in relation to other theories of x-ray inhibition of regeneration with particular reference to the view that irradiated cells can be reactivated

Epidermal Inclusion Cysts of The Breast

Directory of Open Access Journals (Sweden)

Amir R. Motabar

2009-02-01

Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

Science.gov (United States)

Denda, Mitsuhiro; Tsutsumi, Moe

2014-04-01

Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

Directory of Open Access Journals (Sweden)

Grégory Caignard

2009-09-01

Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

Epidermal growth factor receptor expression in urinary bladder cancer

Directory of Open Access Journals (Sweden)

Dayalu S.L. Naik

2011-01-01

Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

DEFF Research Database (Denmark)

Green, M R; Couchman, J R

1985-01-01

, the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

Amlexanox Blocks the Interaction between S100A4 and Epidermal Growth Factor and Inhibits Cell Proliferation.

Directory of Open Access Journals (Sweden)

Ching Chang Cho

Full Text Available The human S100A4 protein binds calcium, resulting in a change in its conformation to promote the interaction with its target protein. Human epidermal growth factor (EGF is the target protein of S100A4 and a critical ligand of the receptor EGFR. The EGF/EGFR system promotes cell survival, differentiation, and growth by activating several signaling pathways. Amlexanox is an anti-inflammatory and anti-allergic drug that is used to treat recurrent aphthous ulcers. In the present study, we determined that amlexanox interacts with S100A4 using heteronuclear single quantum correlation titration. We elucidated the interactions of S100A4 with EGF and amlexanox using fluorescence and nuclear magnetic resonance spectroscopy. We generated two binary models (for the S100A4-EGF and S100A4-amlexanox complexes and observed that amlexanox and EGF share a similar binding region in mS100A4. We also used a WST-1 assay to investigate the bioactivity of S100A4, EGF, and amlexanox, and found that amlexanox blocks the binding between S100A4 and EGF, and is therefore useful for the development of new anti-proliferation drugs.

Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance

Science.gov (United States)

Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou

2018-05-01

Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

Induction of a chloracne phenotype in an epidermal equivalent model by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is dependent on aryl hydrocarbon receptor activation and is not reproduced by aryl hydrocarbon receptor knock down.

Science.gov (United States)

Forrester, Alison R; Elias, Martina S; Woodward, Emma L; Graham, Mark; Williams, Faith M; Reynolds, Nick J

2014-01-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a potent activator of the aryl hydrocarbon receptor (AhR) and causes chloracne in humans. The pathogenesis and role of AhR in chloracne remains incompletely understood. To elucidate the mechanisms contributing to the development of the chloracne-like phenotype in a human epidermal equivalent model and identify potential biomarkers. Using primary normal human epidermal keratinocytes (NHEK), we studied AhR activation by XRE-luciferase, AhR degradation and CYP1A1 induction. We treated epidermal equivalents with high affinity TCDD or two non-chloracnegens: β-naphthoflavone (β-NF) and 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE). Using Western blotting and immunochemistry for filaggrin (FLG), involucrin (INV) and transglutaminase-1 (TGM-1), we compared the effects of the ligands on keratinocyte differentiation and development of the chloracne-like phenotype by H&E. In NHEKs, activation of an XRE-luciferase and CYP1A1 protein induction correlated with ligand binding affinity: TCDD>β-NF>ITE. AhR degradation was induced by all ligands. In epidermal equivalents, TCDD induced a chloracne-like phenotype, whereas β-NF or ITE did not. All three ligands induced involucrin and TGM-1 protein expression in epidermal equivalents whereas FLG protein expression decreased following treatment with TCDD and β-NF. Inhibition of AhR by α-NF blocked TCDD-induced AhR activation in NHEKs and blocked phenotypic changes in epidermal equivalents; however, AhR knock down did not reproduce the phenotype. Ligand-induced CYP1A1 and AhR degradation did not correlate with their chloracnegenic potential, indicating that neither CYP1A1 nor AhR are suitable biomarkers. Mechanistic studies showed that the TCDD-induced chloracne-like phenotype depends on AhR activation whereas AhR knock down did not appear sufficient to induce the phenotype. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier

Targeting tumor cell invasion and dissemination in vivo by an aptamer that inhibits urokinase-type plasminogen activator through a novel multifunctional mechanism

DEFF Research Database (Denmark)

Botkjaer, Kenneth A; Deryugina, Elena I; Dupont, Daniel Miotto

2012-01-01

, because the topology of the proteases' active sites are highly similar. In an effort to generate highly specific uPA inhibitors with new inhibitory modalities, we isolated uPA-binding RNA aptamers by screening a library of 35 nucleotides long 2'-fluoro-pyrimidine RNA molecules using a version of human pro......-uPA lacking the epidermal growth factor-like and kringle domains as bait. One pro-uPA-binding aptamer sequence, referred to as upanap-126, proved to be highly specific for human uPA. Upanap-126 delayed the proteolytic conversion of human pro-uPA to active uPA, but did not inhibit plasminogen activation...... catalyzed by two-chain uPA. The aptamer also inhibited the binding of pro-uPA to uPAR and the binding of vitronectin to the preformed pro-uPA/uPAR complex, both in cell-free systems and on cell surfaces. Furthermore, upanap-126 inhibited human tumor cell invasion in vitro in the Matrigel assay and in vivo...

BDNF/TrkB signaling protects HT-29 human colon cancer cells from EGFR inhibition

Energy Technology Data Exchange (ETDEWEB)

Brunetto de Farias, Caroline [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Children' s Cancer Institute, 90420-140 Porto Alegre, RS (Brazil); Laboratory of Neuropharmacology and Neural Tumor Biology, Department of Pharmacology, Institute for Basic Health Sciences, Federal University of Rio Grande do Sul, 90050-170 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Heinen, Tiago Elias; Pereira dos Santos, Rafael [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Laboratory of Neuropharmacology and Neural Tumor Biology, Department of Pharmacology, Institute for Basic Health Sciences, Federal University of Rio Grande do Sul, 90050-170 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Abujamra, Ana Lucia [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Children' s Cancer Institute, 90420-140 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Schwartsmann, Gilberto [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Department of Internal Medicine, School of Medicine, Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); and others

2012-08-24

Highlights: Black-Right-Pointing-Pointer BDNF protected HT-29 colorectal cancer cells from the antitumor effect of cetuximab. Black-Right-Pointing-Pointer TrkB inhibition potentiated the antitumor effect of cetuximab. Black-Right-Pointing-Pointer BDNF/TrkB signaling might be involved in resistance to anti-EGFR therapy. -- Abstract: The clinical success of targeted treatment of colorectal cancer (CRC) is often limited by resistance to anti-epidermal growth factor receptor (EGFR) therapy. The neurotrophin brain-derived neurotrophic factor (BDNF) and its receptor TrkB have recently emerged as anticancer targets, and we have previously shown increased BDNF levels in CRC tumor samples. Here we report the findings from in vitro experiments suggesting that BDNF/TrkB signaling can protect CRC cells from the antitumor effects of EGFR blockade. The anti-EGFR monoclonal antibody cetuximab reduced both cell proliferation and the mRNA expression of BDNF and TrkB in human HT-29 CRC cells. The inhibitory effect of cetuximab on cell proliferation and survival was counteracted by the addition of human recombinant BDNF. Finally, the Trk inhibitor K252a synergistically enhanced the effect of cetuximab on cell proliferation, and this effect was blocked by BDNF. These results provide the first evidence that increased BDNF/TrkB signaling might play a role in resistance to EGFR blockade. Moreover, it is possible that targeting TrkB could potentiate the anticancer effects of anti-EGFR therapy.

Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

Science.gov (United States)

Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

2013-09-07

Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

Directory of Open Access Journals (Sweden)

ZhenZhen Hu

Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

International Nuclear Information System (INIS)

Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong

2016-01-01

The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

Science.gov (United States)

Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

2016-06-21

Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

Inhibitors of the epidermal growth factor receptor in apple juice extract.

Science.gov (United States)

Kern, Melanie; Tjaden, Zeina; Ngiewih, Yufanyi; Puppel, Nicole; Will, Frank; Dietrich, Helmut; Pahlke, Gudrun; Marko, Doris

2005-04-01

The polyphenol-rich extract of a consumer-relevant apple juice blend was found to potently inhibit the growth of the human colon cancer cell line HT29 in vitro. The epidermal growth factor receptor (EGFR) and its subsequent signaling cascade play an important role in the regulation of cell proliferation in HT29 cells. The protein tyrosine kinase activity of an EGFR preparation was effectively inhibited by the polyphenol-rich apple juice extract. Treatment of intact cells with this extract resulted in the suppression of the subsequent mitogen-activated protein kinase cascade. Amongst the so far identified apple juice constituents, the proanthocyanidins B1 and B2 as well as quercetin-3-glc (isoquercitrin) and quercetin-3-gal (hyperoside) were found to possess substantial EGFR-inhibitory properties. However, as to be expected from the final concentration of these potential EGFR inhibitors in the original polyphenol-rich extract, a synthetic mixture of the apple juice constituents identified and available so far, including both proanthocyanidins and the quercetin glycosides, showed only marginal inhibitory effects on the EGFR. These results permit the assumption that yet unknown constituents contribute substantially to the potent EGFR-inhibitory properties of polyphenol-rich apple juice extract. In summary, the polyphenol composition of apple juice possesses promising growth-inhibitory properties, affecting proliferation-associated signaling cascades in colon tumor cells.

Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

Science.gov (United States)

Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

2016-09-01

Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells.

Science.gov (United States)

Yanagihara, K; Cheng, H; Cheng, P W

2000-01-01

Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

Berberine Reduces cAMP-Induced Chloride Secretion in T84 Human Colonic Carcinoma Cells through Inhibition of Basolateral KCNQ1 Channels.

LENUS (Irish Health Repository)

Alzamora, Rodrigo

2011-01-01

Berberine is a plant alkaloid with multiple pharmacological actions, including antidiarrhoeal activity and has been shown to inhibit Cl(-) secretion in distal colon. The aims of this study were to determine the molecular signaling mechanisms of action of berberine on Cl(-) secretion and the ion transporter targets. Monolayers of T84 human colonic carcinoma cells grown in permeable supports were placed in Ussing chambers and short-circuit current measured in response to secretagogues and berberine. Whole-cell current recordings were performed in T84 cells using the patch-clamp technique. Berberine decreased forskolin-induced short-circuit current in a concentration-dependent manner (IC(50) 80 ± 8 μM). In apically permeabilized monolayers and whole-cell current recordings, berberine inhibited a cAMP-dependent and chromanol 293B-sensitive basolateral membrane K(+) current by 88%, suggesting inhibition of KCNQ1 K(+) channels. Berberine did not affect either apical Cl(-) conductance or basolateral Na(+)-K(+)-ATPase activity. Berberine stimulated p38 MAPK, PKCα and PKA, but had no effect on p42\\/p44 MAPK and PKCδ. However, berberine pre-treatment prevented stimulation of p42\\/p44 MAPK by epidermal growth factor. The inhibitory effect of berberine on Cl(-) secretion was partially blocked by HBDDE (∼65%), an inhibitor of PKCα and to a smaller extent by inhibition of p38 MAPK with SB202190 (∼15%). Berberine treatment induced an increase in association between PKCα and PKA with KCNQ1 and produced phosphorylation of the channel. We conclude that berberine exerts its inhibitory effect on colonic Cl(-) secretion through inhibition of basolateral KCNQ1 channels responsible for K(+) recycling via a PKCα-dependent pathway.

Berberine Reduces cAMP-Induced Chloride Secretion in T84 Human Colonic Carcinoma Cells through Inhibition of Basolateral KCNQ1 Channels.

LENUS (Irish Health Repository)

Alzamora, Rodrigo

2012-02-01

Berberine is a plant alkaloid with multiple pharmacological actions, including antidiarrhoeal activity and has been shown to inhibit Cl(-) secretion in distal colon. The aims of this study were to determine the molecular signaling mechanisms of action of berberine on Cl(-) secretion and the ion transporter targets. Monolayers of T84 human colonic carcinoma cells grown in permeable supports were placed in Ussing chambers and short-circuit current measured in response to secretagogues and berberine. Whole-cell current recordings were performed in T84 cells using the patch-clamp technique. Berberine decreased forskolin-induced short-circuit current in a concentration-dependent manner (IC(50) 80 +\\/- 8 muM). In apically permeabilized monolayers and whole-cell current recordings, berberine inhibited a cAMP-dependent and chromanol 293B-sensitive basolateral membrane K(+) current by 88%, suggesting inhibition of KCNQ1 K(+) channels. Berberine did not affect either apical Cl(-) conductance or basolateral Na(+)-K(+)-ATPase activity. Berberine stimulated p38 MAPK, PKCalpha and PKA, but had no effect on p42\\/p44 MAPK and PKCdelta. However, berberine pre-treatment prevented stimulation of p42\\/p44 MAPK by epidermal growth factor. The inhibitory effect of berberine on Cl(-) secretion was partially blocked by HBDDE ( approximately 65%), an inhibitor of PKCalpha and to a smaller extent by inhibition of p38 MAPK with SB202190 ( approximately 15%). Berberine treatment induced an increase in association between PKCalpha and PKA with KCNQ1 and produced phosphorylation of the channel. We conclude that berberine exerts its inhibitory effect on colonic Cl(-) secretion through inhibition of basolateral KCNQ1 channels responsible for K(+) recycling via a PKCalpha-dependent pathway.

Cocoa Procyanidins Suppress Transformation by Inhibiting Mitogen-activated Protein Kinase Kinase*S⃞

Science.gov (United States)

Kang, Nam Joo; Lee, Ki Won; Lee, Dong Eun; Rogozin, Evgeny A.; Bode, Ann M.; Lee, Hyong Joo; Dong, Zigang

2008-01-01

Cocoa was shown to inhibit chemically induced carcinogenesis in animals and exert antioxidant activity in humans. However, the molecular mechanisms of the chemopreventive potential of cocoa and its active ingredient(s) remain unknown. Here we report that cocoa procyanidins inhibit neoplastic cell transformation by suppressing the kinase activity of mitogen-activated protein kinase kinase (MEK). A cocoa procyanidin fraction (CPF) and procyanidin B2 at 5 μg/ml and 40 μm, respectively, inhibited 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced neoplastic transformation of JB6 P+ mouse epidermal (JB6 P+) cells by 47 and 93%, respectively. The TPA-induced promoter activity and expression of cyclooxygenase-2, which is involved in tumor promotion and inflammation, were dose-dependently inhibited by CPF or procyanidin B2. The activation of activator protein-1 and nuclear factor-κB induced by TPA was also attenuated by CPF or procyanidin B2. The TPA-induced phosphorylation of MEK, extracellular signal-regulated kinase, and p90 ribosomal s6 kinase was suppressed by CPF or procyanidin B2. In vitro and ex vivo kinase assay data demonstrated that CPF or procyanidin B2 inhibited the kinase activity of MEK1 and directly bound with MEK1. CPF or procyanidin B2 suppressed JB6 P+ cell transformation induced by epidermal growth factor or H-Ras, both of which are known to be involved in MEK/ERK signal activation. In contrast, theobromine (up to 80 μm) had no effect on TPA-induced transformation, cyclooxygenase-2 expression, the transactivation of activator protein-1 or nuclear factor-κB, or MEK. Notably, procyanidin B2 exerted stronger inhibitory effects compared with PD098059 (a well known pharmacological inhibitor of MEK) on MEK1 activity and neoplastic cell transformation. PMID:18519570

A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

DEFF Research Database (Denmark)

Celis, J E; Madsen, Peder; Rasmussen, H H

1991-01-01

A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

Epidermal CYP2 family cytochromes P450

International Nuclear Information System (INIS)

Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

2004-01-01

Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

Directory of Open Access Journals (Sweden)

Santosh Kumar

2015-01-01

Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

International Nuclear Information System (INIS)

Stromberg, K.; Hudgins, W.R.

1986-01-01

Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

Ultrathin epidermal strain sensor based on an elastomer nanosheet with an inkjet-printed conductive polymer

Science.gov (United States)

Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori

2017-08-01

To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.

Combination treatment with ionising radiation and gefitinib ('Iressa', ZD1839), an epidermal growth factor receptor (EGFR) inhibitor, significantly inhibits bladder cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Colquhoun, AJ; Mchugh, LA; Tulchinsky, E.; Kriajevska, M.; Mellon, JK

2007-01-01

External beam radiotherapy (EBRT) is the principal bladder-preserving monotherapy for muscle-invasive bladder cancer. Seventy percent of muscle-invasive bladder cancers express epidermal growth factor receptor (EGFR), which is associated with poor prognosis. Ionising radiation (IR) stimulates EGFR causing activation of cytoprotective signalling cascades and thus may be an underlying cause of radioresistance in bladder tumours. We assessed the ability of IR to activate EGFR in bladder cancer cells and the effect of the anti-EGFR therapy, gefitinib on potential radiation-induced activation. Subsequently we assessed the effect of IR on signalling pathways downstream of EGFR. Finally we assessed the activity of gefitinib as a monotherapy, and in combination with IR, using clonogenic assay in vitro, and a murine model in vivo. IR activated EGFR and gefitinib partially inhibited this activation. Radiation-induced activation of EGFR activated the MAPK and Akt pathways. Gefitinib partially inhibited activation of the MAPK pathway but not the Akt pathway. Treatment with combined gefitinib and IR significantly inhibited bladder cancer cell colony formation more than treatment with gefitinib alone (p=0.001-0.03). J82 xenograft tumours treated with combined gefitinib and IR showed significantly greater growth inhibition than tumours treated with IR alone (p=0.04). Combining gefitinib and IR results in significantly greater inhibition of invasive bladder cancer cell colony formation in vitro and significantly greater tumour growth inhibition in vivo. Given the high frequency of EGFR expression by bladder tumours and the low toxicity of gefitinib there is justification to translate this work into a clinical trial. (author)

Human Adipose Mesenchymal Cells Inhibit Melanocyte Differentiation and the Pigmentation of Human Skin via Increased Expression of TGF-β1.

Science.gov (United States)

Klar, Agnes S; Biedermann, Thomas; Michalak, Katarzyna; Michalczyk, Teresa; Meuli-Simmen, Claudia; Scherberich, Arnaud; Meuli, Martin; Reichmann, Ernst

2017-12-01

There is accumulating evidence that interactions between epidermal melanocytes and stromal cells play an important role in the regulation of skin pigmentation. In this study we established a pigmented dermo-epidermal skin model, melDESS, of human origin to investigate the effects of distinct stromal cells on melanogenesis. melDESS is a complex, clinically relevant skin equivalent composed of an epidermis containing both melanocytes and keratinocytes. Its dermal compartment consists either of adipose tissue-derived stromal cells, dermal fibroblasts (Fbs), or a mixture of both cell types. These skin substitutes were transplanted for 5 weeks on the backs of immuno-incompetent rats and analyzed. Gene expression and Western blot analyses showed a significantly higher expression of transforming growth factor-β1 by adipose tissue-derived stromal cells compared with dermal Fbs. In addition, we showed that melanocytes responded to the increased levels of transforming growth factor-β1 by down-regulating the expression of key melanogenic enzymes such as tyrosinase. This caused decreased melanin synthesis and, consequently, greatly reduced pigmentation of melDESS. The conclusions are of utmost clinical relevance, namely that adipose tissue-derived stromal cells derived from the hypodermis fail to appropriately interact with epidermal melanocytes, thus preventing the sustainable restoration of the patient's native skin color in bioengineered skin grafts. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Mechanisms of caffeine-induced inhibition of UVB carcinogenesis

Directory of Open Access Journals (Sweden)

Allan H Conney

2013-06-01

Full Text Available Sunlight-induced nonmelanoma skin cancer is the most prevalent cancer in the United States with more than 2 million cases per year. Several studies have shown an inhibitory effect of caffeine administration on UVB-induced skin cancer in mice, and these studies are paralleled by epidemiology studies that indicate an inhibitory effect of coffee drinking on nonmelanoma skin cancer in humans. Strikingly, decaffeinated coffee consumption had no such inhibitory effect.Mechanism studies indicate that caffeine has a sunscreen effect that inhibits UVB-induced formation of thymine dimers and sunburn lesions in the epidermis of mice. In addition, caffeine administration has a biological effect that enhances UVB-induced apoptosis thereby enhancing the elimination of damaged precancerous cells, and caffeine administration also enhances apoptosis in tumors. Caffeine administration enhances UVB-induced apoptosis by p53-dependent and p53-independent mechanisms. Exploration of the p53-independent effect indicated that caffeine administration enhanced UVB-induced apoptosis by inhibiting the UVB-induced increase in ATR-mediated formation of phospho-Chk1 (Ser345 and abolishing the UVB-induced decrease in cyclin B1 which resulted in caffeine-induced premature and lethal mitosis in mouse skin. In studies with cultured primary human keratinocytes, inhibition of ATR with siRNA against ATR inhibited Chk1 phosphorylation and enhanced UVB-induced apoptosis. Transgenic mice with decreased epidermal ATR function that were irradiated chronically with UVB had 69% fewer tumors at the end of the study compared with irradiated littermate controls with normal ATR function. These results, which indicate that genetic inhibition of ATR (like pharmacologic inhibition of ATR via caffeine inhibits UVB-induced carcinogenesis and supports the concept that ATR-mediated phosphorylation of Chk1 is an important target for caffeine’s inhibitory effect on UVB-induced carcinogenesis.

Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor receptor 2-dependent and other solid tumors.

Science.gov (United States)

Gandhi, Leena; Bahleda, Rastislav; Tolaney, Sara M; Kwak, Eunice L; Cleary, James M; Pandya, Shuchi S; Hollebecque, Antoine; Abbas, Richat; Ananthakrishnan, Revathi; Berkenblit, Anna; Krygowski, Mizue; Liang, Yali; Turnbull, Kathleen W; Shapiro, Geoffrey I; Soria, Jean-Charles

2014-01-10

Human epidermal growth factor (HER) -mediated signaling is critical in many cancers, including subsets of breast and lung cancer. HER family members signal via the phosphatidylinositide 3-kinase (PI3K) -AKT/protein kinase B-mammalian target of rapamycin (mTOR) cascade; mTOR activation is critical for the expression of multiple contributors to tumor growth and invasion. On the basis of preclinical data suggesting synergy of HER2 inhibition and mTOR inhibition in breast and lung cancer models, we conducted a phase I combination study of neratinib, a small-molecule irreversible pan-HER tyrosine kinase inhibitor, and temsirolimus, an mTOR inhibitor, in patients with advanced solid tumors. This study enrolled patients to dosing combinations of neratinib and temsirolimus. The primary objective was to estimate the toxicity contour of the combination and establish recommended phase II doses. Sixty patients were treated on 12 of 16 possible dosing combinations. Diarrhea was the most common drug-related (93%) and dose-limiting toxicity (DLT), constituting four of 10 DLTs. Dose-limiting grade 3 metabolic abnormalities were also observed. Other frequent drug-related toxicities included nausea, stomatitis (both 53%), and anemia (48%). Two maximum-tolerated dose combinations were identified: 200 mg of neratinib/25 mg of temsirolimus and 160 mg of neratinib/50 mg of temsirolimus. Responses were noted in patients with HER2-amplified breast cancer resistant to trastuzumab, HER2-mutant non-small-cell lung cancer, and tumor types without identified mutations in the HER-PI3K-mTOR pathway. The combination of neratinib and temsirolimus was tolerable and demonstrated antitumor activity in multiple tumor types, warranting further evaluation.

Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

Science.gov (United States)

Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

2015-03-01

Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

DEFF Research Database (Denmark)

Boone, Marc; Draye, Jean Pierre; Verween, Gunther

2014-01-01

While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...

Inhibition of human aromatase complex (CYP19) by antiepileptic drugs

DEFF Research Database (Denmark)

Jacobsen, Naja Wessel; Halling-Sørensen, Bent; Birkved, Franziska Maria A Kramer

2008-01-01

of 1.4-49.7 mM. Carbamazepine, gabapentin, primidone, topiramate and vigabatrin showed no inhibition. Additionally, binary drug combinations were tested to investigate if combination therapy could potentiate the aromatase inhibition. Additive inhibition was seen in combination experiments...... with valproate and phenobarbital. When adding carbamazepine to a range of valproate concentrations no additional inhibition was seen. The data for some of the AEDs show that side effects on steroid synthesis in humans due to inhibition of aromatase should be considered....

Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat

Directory of Open Access Journals (Sweden)

Roberta Sartori

2016-06-01

Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.

Epidermal protection with cryogen spray cooling during high fluence pulsed dye laser irradiation: an ex vivo study.

Science.gov (United States)

Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B

2000-01-01

Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.

Retinoid inhibition of in vitro invasion of human amnion basement membrane by human tumor cells

International Nuclear Information System (INIS)

Fazely, F.; Ledinko, N.; Smith, D.J.

1986-01-01

The biological activity of retinoids was assayed in an in vitro quantitative assay of human tumor cell invasion using human amnion basement membrane (BM). The effects measured were the inhibition of tumor cell migration through the BM and tumor cell degradative enzyme activity on 14 C-proline labeled collagenous and noncollagenous components of the BM. The human lung carcinoma A549 or the human Ewing's sarcoma TC-106 cell lines treated with retinoids for two days were incubated on the BM in the absence of retinoids. A dose-dependent inhibition of cell invasion was produced by retinoids. Among the retinoids tested, the most powerful was retinol acetate which inhibited invasion by 50% of A549 cells at a concentration of 0.009 μg/mL, and of TC-106 cells at 0.07 μg/mL. Retinol acetate inhibited A549 and TC-106 cell growth by approximately 50% at levels over 100-fold higher than those needed for antiinvasive activity. Retinol acetate was about 20 times more potent than retinoic acid and 30 times more potent than retinol palmitate. The model system will be useful for investigating antiinvasive activity of other retinoids as well as other compounds

Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

Energy Technology Data Exchange (ETDEWEB)

Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

2015-03-01

Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

International Nuclear Information System (INIS)

Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

2015-01-01

Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

A review of toxic epidermal necrolysis management in Japan

Directory of Open Access Journals (Sweden)

Yuri Kinoshita

2017-01-01

Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

Inhibition by nucleosides of glucose-transport activity in human erythrocytes.

OpenAIRE

Jarvis, S M

1988-01-01

The interaction of nucleosides with the glucose carrier of human erythrocytes was examined by studying the effect of nucleosides on reversible cytochalasin B-binding activity and glucose transport. Adenosine, inosine and thymidine were more potent inhibitors of cytochalasin B binding to human erythrocyte membranes than was D-glucose [IC50 (concentration causing 50% inhibition) values of 10, 24, 28 and 38 mM respectively]. Moreover, low concentrations of thymidine and adenosine inhibited D-glu...

Epidermal stem cells response to radiative genotoxic stress

International Nuclear Information System (INIS)

Marie, Melanie

2013-01-01

Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

Science.gov (United States)

Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

2018-03-15

Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

Luteoloside Inhibits Proliferation of Human Chronic Myeloid ...

African Journals Online (AJOL)

Purpose: To investigate the effects of luteoloside on the proliferation of human chronic ..... Zhang N, Wang D, Zhu Y, Wang J, Lin H. Inhibition ... Han X. Protection of Luteolin-7-O-Glucoside Against ... Hwang YJ, Lee EJ, Kim HR, Hwang KA.

Herbal medicines that benefit epidermal permeability barrier function

Directory of Open Access Journals (Sweden)

Lizhi Hu

2015-06-01

Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

Fisetin inhibits epidermal growth factor-induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression.

Science.gov (United States)

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa

2017-01-01

Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.

Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

International Nuclear Information System (INIS)

Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.

1998-01-01

The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

Relationship between the ability of sunscreens containing 2-ethylhexyl-4'-methoxycinnamate to protect against UVR-induced inflammation, depletion of epidermal Langerhans (Ia+) cells and suppression of alloactivating capacity of murine skin in vivo.

Science.gov (United States)

Walker, S L; Morris, J; Chu, A C; Young, A R

1994-01-01

The UVB sunscreen 2-ethylhexyl-4'-methoxycinnamate was evaluated in hairless albino mouse skin for its ability to inhibit UVR-induced (i) oedema, (ii) epidermal Langerhans cell (Ia+) depletion and (iii) suppression of the alloactivating capacity of epidermal cells (mixed epidermal cell-lymphocyte reaction, MECLR). The sunscreen, prepared at 9% in ethanol or a cosmetic lotion, was applied prior to UVB/UVA irradiation. In some experiments there was a second application halfway through the irradiation. Single applications in both vehicles gave varying degrees of protection from oedema and Langerhans cell depletion but afforded no protection from suppression of MECLR. When the sunscreens were applied twice there was improved protection from oedema and Langerhans cell depletion and complete protection was afforded from suppression of MECLR. There was a clear linear relationship between Langerhans cell numbers and oedema with and without sunscreen application. The relationship between Langerhans cell numbers and MECLR was more complex. These data confirm published discrepancies between protection from oedema (a model for human erythema) and endpoints with immunological significance, but show that 2-ethylhexyl-4'-methoxycinnamate can afford complete immunoprotection, although protection is dependent on the application rate and vehicle.

Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

International Nuclear Information System (INIS)

Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

2003-01-01

A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

Bovine Lactoferrampin, Human Lactoferricin, and Lactoferrin 1-11 Inhibit Nuclear Translocation of HIV Integrase.

Science.gov (United States)

Wang, Winston Yan; Wong, Jack Ho; Ip, Denis Tsz Ming; Wan, David Chi Cheong; Cheung, Randy Chifai; Ng, Tzi Bun

2016-08-01

This study aimed to investigate fragments derived from human and bovine lactoferrins for ability to inhibit nuclear translocation of HIV-1 integrase. It was shown that human lactoferricin, human lactoferrin 1-11, and bovine lactoferrampin reduced nuclear distribution of HIV-1 integrase. Bovine lactoferrampin could inhibit both the activity and nuclear translocation of HIV-1 integrase. Human lactoferrampin, bovine lactoferricin, and bovine lactoferrin 1-11 had no effect on HIV-1 integrase nuclear translocation. Human lactoferrampin which inhibited the activity of integrase did not prevent its nuclear translocation. Human lactoferricin and lactoferrin 1-11 did not inhibit HIV-1 integrase nuclear translocation despite their ability to attenuate the enzyme activity. The discrepancy between the findings on reduction of HIV-1 activity and inhibition of nuclear translocation of HIV-1 integrase was due to the different mechanisms involved. A similar reasoning can also be applied to the different inhibitory potencies of the milk peptides on different HIV enzymes, i.e., nuclear translocation.

Epidermal growth factor receptor inhibition by anti-CD147 therapy in cutaneous squamous cell carcinoma.

Science.gov (United States)

Frederick, John W; Sweeny, Larissa; Hartman, Yolanda; Zhou, Tong; Rosenthal, Eben L

2016-02-01

Advanced cutaneous squamous cell carcinoma (SCC) is an uncommon and aggressive malignancy. As a result, there is limited understanding of its biology and pathogenesis. CD147 and epidermal growth factor receptor (EGFR) have been identified as oncologically important targets, but their relationship remains undefined in cutaneous SCC. Multiple cutaneous SCC cell lines (Colo-16, SRB-1, and SRB-12), were treated in vitro with a range of chimeric anti-CD147 monoclonal antibody (mAb) (0, 50, 100, and 200 µg/mL) or transfected with a small interfering RNA against CD147 (SiCD147). Cell proliferation, migration (scratch wound healing assay), and protein expression was then assessed. In vivo, Colo-16 flank xenografts were treated anti-CD147 mAb (150 µg i.p. triweekly). After treatment with anti-CD147 (200 µg/mL), there was a significant decrease in proliferation for all cell lines relative to controls (p CD147 (200 µg/mL) resulted in decreased cell migration for all cell lines, with an average of 43% reduction in closure compared to controls (p CD147 antibody therapy and siRNA mediated reduction in CD147 expression were both found to decrease protein expression of EGFR, which correlated with a reduction in downstream total and phosphorylated protein kinase B (pAKT). Tumor growth in vivo was reduced for both the anti-CD147 treatment group and the SiCD147 group relative to controls. Inhibition and downregulation of CD147 in cutaneous SCC resulted in suppression of the malignant phenotype in vitro and in vivo, which may be mediated in part by an alteration in EGFR expression. As a result, CD147 may serve as a potential therapeutic target for advanced cutaneous SCC. © 2014 Wiley Periodicals, Inc.

Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

Science.gov (United States)

Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

2013-01-01

Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice

Directory of Open Access Journals (Sweden)

Azahara Rodríguez-Luna

2017-12-01

Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.

Sprouty regulates cell migration by inhibiting the activation of Rac1 GTPase

International Nuclear Information System (INIS)

Poppleton, Helen M.; Edwin, Francis; Jaggar, Laura; Ray, Ramesh; Johnson, Leonard R.; Patel, Tarun B.

2004-01-01

Sprouty (SPRY) protein negatively modulates fibroblast growth factor and epidermal growth factor actions. We showed that human SPRY2 inhibits cell growth and migration in response to serum and several growth factors. Using rat intestinal epithelial (IEC-6) cells, we investigated the involvement of the Rho family of GTPases, RhoA, Rac1, and cdc42 in SPRY2-mediated inhibition of cell migration and proliferation. The ability of TAT-tagged SPRY2 to inhibit proliferation and migration of IEC-6 cells transfected with constitutively active mutants of RhoA(G14V), Rac1(G12V), and cdc42 (F28L) was determined. Constitutively active RhoA(G14V), Rac1(G12V), or cdc42(F28L) did not protect cells from the anti-proliferative actions of TAT-SPRY2. The ability of TAT-hSPRY2 to inhibit migration was not altered by of RhoA(G14V) and cdc42(F28L). However, Rac1(G12V) obliterated the ability of SPRY2 to inhibit cell autonomous or serum-induced migration. Also, the activation of endogenous Rac1 was attenuated by TAT-SPRY2. Thus, SPRY2 mediates its anti-migratory actions by inhibiting Rac1 activation

Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

KAUST Repository

Cai, Yichen

2017-06-16

Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

KAUST Repository

Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

2017-01-01

Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

DEFF Research Database (Denmark)

Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

2003-01-01

a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

International Nuclear Information System (INIS)

Zhou, Yan; Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing; Zhong, Hua

2016-01-01

Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

Energy Technology Data Exchange (ETDEWEB)

Zhou, Yan [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China); Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing [Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Zhong, Hua, E-mail: eddiedong8@hotmail.com [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China)

2016-11-01

Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

Science.gov (United States)

Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

2011-09-01

Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

Toxic epidermal necrolysis and Stevens-Johnson syndrome

Directory of Open Access Journals (Sweden)

French Lars E

2010-12-01

Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

Fisetin inhibits epidermal growth factor–induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression

Science.gov (United States)

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen

2017-01-01

Purpose Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)–induced cell migration and the underlying mechanisms remain unclear. Methods Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription–PCR (RT–PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Results Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Conclusions Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1–dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases. PMID:29296070

Early events elicited by Bombesin and structurally related peptides in quiescent Swiss 3T3 cells. I. Activation of protein kinase C and inhibition of epidermal growth factor binding

International Nuclear Information System (INIS)

Zachary, I.; Sinnett-Smith, J.W.; Rozengurt, E.

1986-01-01

Addition of bombesin to quiescent cultures of Swiss 3T3 cells caused a rapid increase in the phosphorylation of an M/sub r/ 80,000 cellular protein (designated 80k). The effect was both concentration and time dependent. The 80k phosphoproteins generated in response to bombesin and to phorbol 12,13-dibutyrate were identical as judged by one- and two-dimensional PAGE and by peptide mapping after partial proteolysis with Staphylococcus aureus V8 protease. In addition, prolonged pretreatment of 3T3 cells with phorbol 12,13-dibutyrate, which leads to the disappearance of protein kinase C activity, blocked the ability of bombesin to stimulate 80k. Bombesin also caused a rapid (1 min) inhibition of 125 I-labeled epidermal growth factor ( 125 I-EGF) binding to Swiss 3T3 cells. The inhibition was both concentration and temperature dependent and resulted from a marked decrease in the affinity of the EGF receptor for its ligand. These results strongly suggest that these responses are mediated by specific high-affinity receptors that recognize the peptides of the bombesin family in Swiss 3T3 cells. While an increase in cytosolic Ca 2+ concentration does not mediate the bombesin inhibition of 125 I-EGF binding, the activation of protein kinase C in intact Swiss 3T3 cells by peptides of the bombesin family may lead to rapid inhibition of the binding of 125 I-EGF to its cellular receptor

Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

Energy Technology Data Exchange (ETDEWEB)

Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

1988-03-01

The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

Inhibition of phospholipase A2 from human plasma by sodium bisulfite

International Nuclear Information System (INIS)

Wiggins, C.W.; Franson, R.C.

1987-01-01

The anti-oxidant sodium bisulfite has been shown to inhibit acid active(lysosomal), non-Ca ++ -dependent phospholipase A 2 (PLA 2 ), and to interact reversibly with unsaturated fatty acids, altering their chromatographic mobility. The authors examined the effect of bisulfite on neutral active, Ca ++ -dependent PLA 2 from human plasma. Using [1- 14 C]oleate-labelled autoclaved E. coli as substrate, PLA 2 activity was inhibited in a dose-dependent manner by bisulfite. Maximal inhibition occurred at 100μM bisulfite. Preincubation of plasma for 0-30 minutes with bisulfite resulted in a time-dependent increase in PLA 2 inhibition. Preincubation of substrate with bisulfite had no such effect. When the plasma PLA 2 was purified 25-fold by SP-Sephadex chromatography it was no longer inhibited by bisulfite. The SP-Sephadex wash through fraction, which contained greater than 95% of the applied protein but not PLA 2 activity, did not inhibit the purified enzyme. When incubated with bisulfite however, the SP-wash through fraction produced dose-dependent inhibition of the purified enzyme. These results indicate that sodium bisulfite inhibits human plasma PLA 2 , in vitro, indirectly by interaction with a factor(s) present in plasma and suggests that anti-oxidants may similarly influence expression of extracellular PLA 2 in vivo

The inhibition of the Human Immunodeficiency Virus type 1 activity by crude and purified human pregnancy plug mucus and mucins in an inhibition assay

Directory of Open Access Journals (Sweden)

Schoeman Leann

2008-05-01

Full Text Available Abstract Background The female reproductive tract is amongst the main routes for Human Immunodeficiency Virus (HIV transmission. Cervical mucus however is known to protect the female reproductive tract from bacterial invasion and fluid loss and regulates and facilitates sperm transport to the upper reproductive tract. The purpose of this study was to purify and characterize pregnancy plug mucins and determine their anti-HIV-1 activity in an HIV inhibition assay. Methods Pregnancy plug mucins were purified by caesium chloride density-gradient ultra-centrifugation and characterized by Western blotting analysis. The anti-HIV-1 activities of the crude pregnancy plug mucus and purified pregnancy plug mucins was determined by incubating them with HIV-1 prior to infection of the human T lymphoblastoid cell line (CEM SS cells. Results The pregnancy plug mucus had MUC1, MUC2, MUC5AC and MUC5B. The HIV inhibition assay revealed that while the purified pregnancy plug mucins inhibit HIV-1 activity by approximately 97.5%, the crude pregnancy plug mucus failed to inhibit HIV-1 activity. Conclusion Although it is not clear why the crude sample did not inhibit HIV-1 activity, it may be that the amount of mucins in the crude pregnancy plug mucus (which contains water, mucins, lipids, nucleic acids, lactoferrin, lysozyme, immunoglobulins and ions, is insufficient to cause viral inhibition or aggregation.

The phosphatase inhibitor menadione (vitamin K3) protects cells from EGFR inhibition by erlotinib and cetuximab.

Science.gov (United States)

Perez-Soler, Roman; Zou, Yiyu; Li, Tianhong; Ling, Yi He

2011-11-01

Skin toxicity is the main side effect of epidermal growth factor receptor (EGFR) inhibitors, often leading to dose reduction or discontinuation. We hypothesized that phosphatase inhibition in the skin keratinocytes may prevent receptor dephosphorylation caused by EGFR inhibitors and be used as a new potential strategy for the prevention or treatment of this side effect. Menadione (Vitamin K3) was used as the prototype compound to test our hypothesis. HaCat human skin keratinocyte cells and A431 human squamous carcinoma cells were used. EGFR inhibition was measured by Western blotting and immunofluorescence. Phosphatase inhibition and reactive oxygen species (ROS) generation were measured by standard ELISA and fluorescence assays. Menadione caused significant and reversible EGFR activation in a dose-dependent manner starting at nontoxic concentrations. EGFR activation by menadione was associated with reversible protein tyrosine phosphatase inhibition, which seemed to be mediated by ROS generation as exposure to antioxidants prevented both menadione-induced ROS generation and phosphatase inhibition. Short-term coincubation of cells with nontoxic concentrations of menadione and the EGFR inhibitors erlotinib or cetuximab prevented EGFR dephosphorylation. Seventy-two-hour coincubation of cells with the highest nontoxic concentration of menadione and erlotinib provided for a fourfold cell growth inhibitory protection in HaCat human keratinocyte cells. Menadione at nontoxic concentrations causes EGFR activation and prevents EGFR dephosphorylation by erlotinib and cetuximab. This effect seems to be mediated by ROS generation and secondary phosphatase inhibition. Mild oxidative stress in skin keratinocytes by topical menadione may protect the skin from the toxicity secondary to EGFR inhibitors without causing cytotoxicity. ©2011 AACR

99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.

Science.gov (United States)

Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad

2017-04-01

Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.

ITE inhibits growth of human pulmonary artery endothelial cells.

Science.gov (United States)

Pang, Ling-Pin; Li, Yan; Zou, Qing-Yun; Zhou, Chi; Lei, Wei; Zheng, Jing; Huang, Shi-An

2017-10-01

Pulmonary arterial hypertension (PAH), a deadly disorder is associated with excessive growth of human pulmonary artery endothelial (HPAECs) and smooth muscle (HPASMCs) cells. Current therapies primarily aim at promoting vasodilation, which only ameliorates clinical symptoms without a cure. 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE) is an endogenous aryl hydrocarbon receptor (AhR) ligand, and mediates many cellular function including cell growth. However, the roles of ITE in human lung endothelial cells remain elusive. Herein, we tested a hypothesis that ITE inhibits growth of human pulmonary artery endothelial cells via AhR. Immunohistochemistry was performed to localize AhR expression in human lung tissues. The crystal violet method and MTT assay were used to determine ITE's effects on growth of HPAECs. The AhR activation in HPAECs was confirmed using Western blotting and RT-qPCR. The role of AhR in ITE-affected proliferation of HPAECs was assessed using siRNA knockdown method followed by the crystal violet method. Immunohistochemistry revealed that AhR was present in human lung tissues, primarily in endothelial and smooth muscle cells of pulmonary veins and arteries, as well as in bronchial and alveolar sac epithelia. We also found that ITE dose- and time-dependently inhibited proliferation of HPAECs with a maximum inhibition of 83% at 20 µM after 6 days of treatment. ITE rapidly decreased AhR protein levels, while it increased mRNA levels of cytochrome P450 (CYP), family 1, member A1 (CYP1A1) and B1 (CYP1B1), indicating activation of the AhR/CYP1A1 and AhR/CYP1B1 pathways in HPAECs. The AhR siRNA significantly suppressed AhR protein expression, whereas it did not significantly alter ITE-inhibited growth of HPAECs. ITE suppresses growth of HPAECs independent of AhR, suggesting that ITE may play an important role in preventing excessive growth of lung endothelial cells.

Isolation of a human anti-epidermal growth factor receptor Fab antibody, EG-19-11, with subnanomolar affinity from naïve immunoglobulin repertoires using a hierarchical antibody library system.

Science.gov (United States)

Hur, Byung-ung; Yoon, Jae-bong; Liu, Li-Kun; Cha, Sang-hoon

2010-11-30

Specific antibodies that possess a subnanomolar affinity are very difficult to obtain from human naïve immunoglobulin repertoires without the use of lengthy affinity optimization procedures. Here, we designed a hierarchical phage-displayed antibody library system to generate an enormous diversity of combinatorial Fab fragments (6×10(17)) and attempted to isolate high-affinity Fabs against the human epidermal growth factor receptor (EGFR). A primary antibody library, designated HuDVFab-8L, comprising 4.5×10(9) human naïve heavy chains and eight unspecified human naïve light chains was selected against the EGFR-Fc protein by biopanning, and four anti-EGFR Fab clones were isolated. Because one of the Fab clones, denoted EG-L2-11, recognized a native EGFR expressed on A431 cells, the heavy chain of the Fab was shuffled with a human naïve light chain repertoire with a diversity of 1.4×10(8) and selected a second time against the EGFR-Fc protein again. One EG-L2-11 variant, denoted EG-19-11, recognized an EGFR epitope that was almost the same as that bound by cetuximab and had a K(D) of approximately 540 pM for soluble EGFR, which is about 7-fold higher than that of the FabC225 derived from cetuximab. This variant was also internalized by A431 cells, likely via receptor-mediated endocytosis, and it efficiently inhibited EGF-mediated tyrosine phosphorylation of the EGFR. These results demonstrate that the use of our hierarchical antibody library system is advantageous in generating fully human antibodies especially with a therapeutic purpose. Copyright © 2010 Elsevier B.V. All rights reserved.

Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

International Nuclear Information System (INIS)

Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando

1999-01-01

The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

NARCIS (Netherlands)

Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.

2015-01-01

Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis

Physiological markers of motor inhibition during human behavior

Science.gov (United States)

Duque, Julie; Greenhouse, Ian; Labruna, Ludovica; Ivry, Richard B.

2017-01-01

Transcranial magnetic stimulation (TMS) studies in humans have shown that many behaviors engage processes that suppress excitability within the corticospinal tract. Inhibition of the motor output pathway has been extensively studied in the context of action stopping, where a planned movement needs to be abruptly aborted. Recent TMS work has also revealed markers of motor inhibition during the preparation of movement. Here, we review the evidence for motor inhibition during action stopping and action preparation, focusing on studies that have used TMS to monitor changes in the excitability of the corticospinal pathway. We discuss how these physiological results have motivated theoretical models of how the brain selects actions, regulates movement initiation and execution, and switches from one state to another. PMID:28341235

Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

Directory of Open Access Journals (Sweden)

Santosh K Katiyar

Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

Neutralization of IL-8 prevents the induction of dermatologic adverse events associated with the inhibition of epidermal growth factor receptor

DEFF Research Database (Denmark)

Bangsgaard, Nannie; Houtkamp, Mischa; Schuurhuis, Danita H

2012-01-01

Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance to treatm......Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance......, characterized by acute follicular neutrophil-rich hair follicle inflammation, and thus mimicked adverse events induced by systemic administration of EGFR inhibitors. In this model, we tested the hypothesis that neutrophils, attracted by IL-8, play a central role in the observed rash. Indeed, concomitant local...

Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

Directory of Open Access Journals (Sweden)

Qian Zhao

2015-12-01

Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

International Nuclear Information System (INIS)

Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

2006-01-01

Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

Comparison of oxime reactivation and aging of nerve agent-inhibited monkey and human acetylcholinesterases.

Science.gov (United States)

Luo, Chunyuan; Tong, Min; Maxwell, Donald M; Saxena, Ashima

2008-09-25

Non-human primates are valuable animal models that are used for the evaluation of nerve agent toxicity as well as antidotes and results from animal experiments are extrapolated to humans. It has been demonstrated that the efficacy of an oxime primarily depends on its ability to reactivate nerve agent-inhibited acetylcholinesterase (AChE). If the in vitro oxime reactivation of nerve agent-inhibited animal AChE is similar to that of human AChE, it is likely that the results of an in vivo animal study will reliably extrapolate to humans. Therefore, the goal of this study was to compare the aging and reactivation of human and different monkey (Rhesus, Cynomolgus, and African Green) AChEs inhibited by GF, GD, and VR. The oximes examined include the traditional oxime 2-PAM, two H-oximes HI-6 and HLo-7, and the new candidate oxime MMB4. Results indicate that oxime reactivation of all three monkey AChEs was very similar to human AChE. The maximum difference in the second-order reactivation rate constant between human and three monkey AChEs or between AChEs from different monkey species was 5-fold. Aging rate constants of GF-, GD-, and VR-inhibited monkey AChEs were very similar to human AChE except for GF-inhibited monkey AChEs, which aged 2-3 times faster than the human enzyme. The results of this study suggest that all three monkey species are suitable animal models for nerve agent antidote evaluation since monkey AChEs possess similar biochemical/pharmacological properties to human AChE.

Pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

Energy Technology Data Exchange (ETDEWEB)

Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A

1998-01-01

The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.

Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

Energy Technology Data Exchange (ETDEWEB)

Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

2016-03-15

Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

Recombinant human prion protein inhibits prion propagation in vitro.

Science.gov (United States)

Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan

2013-10-09

Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

Science.gov (United States)

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

mTOR Inhibition Induces EGFR Feedback Activation in Association with Its Resistance to Human Pancreatic Cancer

Directory of Open Access Journals (Sweden)

Feng Wei

2015-02-01

Full Text Available The mammalian target of rapamycin (mTOR is dysregulated in diverse cancers and contributes to tumor progression and drug resistance. The first generation of mTOR inhibitors have failed to show clinical efficiency in treating pancreatic cancers due in part to the feedback relief of the insulin-like growth factor-1 receptor (IGF-1R-AKT signaling pathway. The second generation of mTOR inhibitors, such as AZD8055, could inhibit AKT activation upon mTOR complex 2 (mTORC2 inhibition. However, whether this generation of mTOR inhibitors can obtain satisfactory activities in pancreatic cancer therapy remains unclear. In this study, we found AZD8055 did not show great improvement compared with everolimus, AZD8055 induced a temporal inhibition of AKT kinase activities and AKT was then rephosphorylated. Additionally, we found that AZD8055-induced transient AKT inhibition increased the expression and activation of epidermal growth factor receptor (EGFR by releasing its transcriptional factors Fork-head box O 1/3a (FoxO1/3a, which might contribute to cell resistance to AZD8055. The in vitro and in vivo experiments further indicated the combination of AZD8055 and erlotinib synergistically inhibited the mTORC1/C2 signaling pathway, EGFR/AKT feedback activation, and cell growth, as well as suppressed the progression of pancreatic cancer in a xenograft model. This study provides a rationale and strategy for overcoming AZD8055 resistance by a combined treatment with the EGFR inhibitor erlotinib in pancreatic cancer therapy.

Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

Science.gov (United States)

Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

2013-12-01

The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Vaccine-induced toxic epidermal necrolysis: A case and systematic review

OpenAIRE

Chahal, Dev; Aleshin, Maria; Turegano, Mamina; Chiu, Melvin; Worswick, Scott

2018-01-01

Background: Erythema multiforme (EM), Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are cutaneous hypersensitivityreactions that develop in response to specific triggers such as medications and certain infections. Vaccines, which undergo rigorous safety testing prior to use in humans, are a rare cause of SJS/TEN and little is known about the frequency of such events and corresponding pathogenesis. Objective: Herein, we discuss a case of suspected TEN in a 19-yea...

An epidermal equivalent assay for identification and ranking potency of contact sensitizers

Energy Technology Data Exchange (ETDEWEB)

Gibbs, Susan, E-mail: S.Gibbs@VUMC.nl [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Corsini, Emanuela [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Spiekstra, Sander W. [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Galbiati, Valentina [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Fuchs, Horst W. [CellSystems GmbH, Troisdorf (Germany); DeGeorge, George; Troese, Matthew [MB Research Labs, Spinnerstown, PA (United States); Hayden, Patrick; Deng, Wei [MatTek Corporation, Ashland, MA (United States); Roggen, Erwin [3Rs Management and Consultancy (Denmark)

2013-10-15

The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC{sub 50}) with human and animal data showed a superior correlation with human DSA{sub 05} (μg/cm{sup 2}) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA{sub 05} = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA{sub 05} data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency �

An epidermal equivalent assay for identification and ranking potency of contact sensitizers

International Nuclear Information System (INIS)

Gibbs, Susan; Corsini, Emanuela; Spiekstra, Sander W.; Galbiati, Valentina; Fuchs, Horst W.; DeGeorge, George; Troese, Matthew; Hayden, Patrick; Deng, Wei; Roggen, Erwin

2013-01-01

The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC 50 ) with human and animal data showed a superior correlation with human DSA 05 (μg/cm 2 ) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA 05 = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA 05 data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency • EC50 (chemical

Inhibition of nitric oxide synthesis enhances leukocyte rolling and adhesion in human microvasculature

Directory of Open Access Journals (Sweden)

Hossain Mokarram

2012-07-01

Full Text Available Abstract Background Nitric oxide (NO is a multifunctional signaling molecule that regulates important cellular events in inflammation including leukocyte recruitment. Previous studies have shown that pharmacological inhibition of NO synthesis induces leukocyte recruitment in various in vitro and animal models. However, it is not known whether NO modulation has similar effects on leukocyte-endothelial cell interactions within the human microvasculature. The present study explored the effect of systemic L-NAME treatment on leukocyte recruitment in the SCID-hu mouse model. Methods Human skin xenografts were transplanted in SCID mice to study human leukocyte dynamics in human vasculature. Early events of human leukocyte recruitment in human vasculature were studied using intravital microscopy. NO synthesis was pharmacologically inhibited using NG-nitro-L-arginine methyl ester (L-NAME. Immunohistochemical analysis was performed to elucidate E-selectin expression in human xenograft skin. Human neutrophil-endothelial cell interactions were also studied in an in vitro flow chamber assay system. P- and E-selectin expression on cultured human umbilical vein endothelial cells (HUVECs was measured using ELISA. Platelet-activating factor (PAF synthesis was detected using a TLC-based assay. Results L-NAME treatment significantly enhanced the rolling and adhesion of human leukocytes to the human vasculature. Functional blocking of P- and E-selectins significantly inhibited rolling but not adhesion induced by inhibition of NO synthesis. Systemic L-NAME treatment enhanced E-selectin expression in human xenograft skin. L-NAME treatment significantly enhanced P- and E-selectin expression on HUVECs. L-NAME treatment did not significantly modify neutrophil rolling or adhesion to HUVECs indicating that L-NAME−induced subtle P- and E-selectin expression was insufficient to elicit dynamic neutrophil-HUVEC interactions in vitro. Moreover, synthesis of endothelial

Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

DEFF Research Database (Denmark)

Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter

2012-01-01

by treatment with trastuzumab (20 nM). This resulted in inhibition of cardiomyocyte proliferation, but interestingly only in hypoxic cells. Co-treatment of HL-1 cells with HB-EGF (10 nM) but not with NRG-1 (5 ng/ml) rescued the cardiomyocytes from HER2 inhibition. HL-1 cardiomyocytes exposed to hypoxia...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

Epidermal growth factor receptor antibody plus recombinant human endostatin in treatment of hepatic metastases after remnant gastric cancer resection

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.

Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

Energy Technology Data Exchange (ETDEWEB)

Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu

1999-04-01

The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

Epidermal growth factor pathway substrate 15, Eps15

DEFF Research Database (Denmark)

Salcini, A E; Chen, H; Iannolo, G

1999-01-01

Eps15 was originally identified as a substrate for the kinase activity of the epidermal growth factor receptor (EGFR). Eps15 has a tripartite structure comprising a NH2-terminal portion, which contains three EH domains, a central putative coiled-coil region, and a COOH-terminal domain containing...... multiple copies of the amino acid triplet Aspartate-Proline-Phenylalanine. A pool of Eps15 is localized at clathrin coated pits where it interacts with the clathrin assembly complex AP-2 and a novel AP-2 binding protein, Epsin. Perturbation of Eps15 and Epsin function inhibits receptor-mediated endocytosis...... of EGF and transferrin, demonstrating that both proteins are components of the endocytic machinery. Since the family of EH-containing proteins is implicated in various aspects of intracellular sorting, biomolecular strategies aimed at interfering with these processes can now be envisioned...

Apple juice inhibits human low density lipoprotein oxidation.

Science.gov (United States)

Pearson, D A; Tan, C H; German, J B; Davis, P A; Gershwin, M E

1999-01-01

Dietary phenolic compounds, ubiquitous in vegetables and fruits and their juices possess antioxidant activity that may have beneficial effects on human health. The phenolic composition of six commercial apple juices, and of the peel (RP), flesh (RF) and whole fresh Red Delicious apples (RW), was determined by high performance liquid chromatography (HPLC), and total phenols were determined by the Folin-Ciocalteau method. HPLC analysis identified and quantified several classes of phenolic compounds: cinnamates, anthocyanins, flavan-3-ols and flavonols. Phloridzin and hydroxy methyl furfural were also identified. The profile of phenolic compounds varied among the juices. The range of concentrations as a percentage of total phenolic concentration was: hydroxy methyl furfural, 4-30%; phloridzin, 22-36%; cinnamates, 25-36%; anthocyanins, n.d.; flavan-3-ols, 8-27%; flavonols, 2-10%. The phenolic profile of the Red Delicious apple extracts differed from those of the juices. The range of concentrations of phenolic classes in fresh apple extracts was: hydroxy methyl furfural, n.d.; phloridzin, 11-17%; cinnamates, 3-27%; anthocyanins, n.d.-42%; flavan-3-ols, 31-54%; flavonols, 1-10%. The ability of compounds in apple juices and extracts from fresh apple to protect LDL was assessed using an in vitro copper catalyzed human LDL oxidation system. The extent of LDL oxidation was determined as hexanal production using static headspace gas chromatography. The apple juices and extracts, tested at 5 microM gallic acid equivalents (GAE), all inhibited LDL oxidation. The inhibition by the juices ranged from 9 to 34%, and inhibition by RF, RW and RP was 21, 34 and 38%, respectively. Regression analyses revealed no significant correlation between antioxidant activity and either total phenolic concentration or any specific class of phenolics. Although the specific components in the apple juices and extracts that contributed to antioxidant activity have yet to be identified, this study

Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

Science.gov (United States)

Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

2016-12-01

: Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

DEFF Research Database (Denmark)

Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

2013-01-01

The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

Epidermal growth factor in alkali-burned corneal epithelial wound healing.

Science.gov (United States)

Singh, G; Foster, C S

1987-06-15

We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

Science.gov (United States)

Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

2014-01-01

Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

Directory of Open Access Journals (Sweden)

Michelle T Juarez

2011-12-01

Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

Conformable liquid metal printed epidermal electronics for smart physiological monitoring and simulation treatment

Science.gov (United States)

Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing

2018-03-01

Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.

Gemcitabine Plus Docetaxel Versus Docetaxel in Patients With Predominantly Human Epidermal Growth Factor Receptor 2-Negative Locally Advanced or Metastatic Breast Cancer: A Randomized, Phase III Study by the Danish Breast Cancer Cooperative Group

DEFF Research Database (Denmark)

Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H

2011-01-01

PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned...

TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

Directory of Open Access Journals (Sweden)

Aurélie Hayez

Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

Piroxicam inhibits Masitinib-induced cyclooxygenase 2 expression in oral squamous cell carcinoma cells in vitro.

Science.gov (United States)

Rathore, Kusum; Alexander, Mary; Cekanova, Maria

2014-08-01

Development and characterization of animal models for human cancers is important for the improvement of diagnosis and therapy. The oral squamous cell carcinoma (OSCC) of domestic animals resembles human OSCC in many aspects; thus, cell lines derived from OSCC of cats and dogs are a valuable model for human OSCC. We characterized 1 feline OSCC (FeOSCC-Sidney) and 1 canine OSCC (K9OSCC-Abby) cell line and compared their characteristics with human OSCC cell line hSCC-25. We calculated the doubling time of the new OSCC cell lines and evaluated the expression profiles of cancer-related markers and cell-cycle proteins such as c-kit, platelet-derived growth factor receptor, vascular endothelial growth factor receptor, epidermal growth factor receptor, cyclooxygenase (COX)-1, COX-2, and p27 by immunocytochemistry and Western blot analysis. We evaluated the effects of novel receptor tyrosine kinase inhibitor (Masitinib, AB1010) and the nonsteroidal anti-inflammatory drug piroxicam on the previously mentioned OSCC cells. Interestingly, AB1010 increased expression levels of COX-2 in all tested OSCCs. Cotreatment of piroxicam with Masitinib significantly inhibited cell proliferation of OSCC as compared to either drug alone through the c-kit and AKT signaling pathways. Piroxicam inhibited Masitinib-induced COX-2 expression in all tested OSCCs. Therefore, targeting these two signaling pathways simultaneously was more efficient for inhibition of OSCCs across these species. Copyright © 2014 Mosby, Inc. All rights reserved.

Fatty acid synthase inhibition in human breast cancer cells leads to malonyl-CoA-induced inhibition of fatty acid oxidation and cytotoxicity.

Science.gov (United States)

Thupari, J N; Pinn, M L; Kuhajda, F P

2001-07-13

Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.

Epidermal growth factor in the rat prostate

DEFF Research Database (Denmark)

Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

1998-01-01

Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

EFFICACY EVALUATION OF A MONOCLONAL ANTIBODY AGAINST THE EPIDERMAL GROWTH FACTORS RECEPTOR IN THE MODEL OF SUBCUTANEOUS XENOGRAFT IN IMMUNODEFICIENT MICE

Directory of Open Access Journals (Sweden)

Ya. Yu. Ustyugov

2015-01-01

Full Text Available This article presents the results of the comparative antitumor efficacy study of two test articles of therapeutic humanized monoclonal antibodies against epidermal growth factor receptor (EGFR manufactured by Russian biopharmaceutical company CJSC “Biocad” and the commercial drug “Erbitux®” (Merck, Germany in subcutaneous xenografts model using human epidermoid carcinoma A431NS cell line. EGFR overexpression in epithelial tumor cells is a commonly known fact that determines use of this receptor as a target for therapeutic monoclonal antibodies. The basic mechanism of action of such drugs is blocking of epithelial cells proliferation through competitive binding to EGFR. Evaluation of tumor growth dynamics in immunodeficient (Nu/Nu mice was performed during in vivo experiment using two parameters: tumor growth index and tumor growth inhibition (TGI, %. The results received with used study design show that antitumor effects of the test articles manufactured by CJSC “Biocad” and the commercial comparator drug “Erbitux®” estimated by values of TGI and tumor growth index are comparable.

Intranasal epidermal growth factor treatment rescues neonatal brain injury

Science.gov (United States)

Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio

2014-02-01

There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.

Gemfibrozil, a Lipid-lowering Drug, Inhibits the Induction of Nitric-oxide Synthase in Human Astrocytes*

Science.gov (United States)

Pahan, Kalipada; Jana, Malabendu; Liu, Xiaojuan; Taylor, Bradley S.; Wood, Charles; Fischer, Susan M.

2007-01-01

Gemfibrozil, a lipid-lowering drug, inhibited cytokine-induced production of NO and the expression of inducible nitric-oxide synthase (iNOS) in human U373MG astroglial cells and primary astrocytes. Similar to gemfibrozil, clofibrate, another fibrate drug, also inhibited the expression of iNOS. Inhibition of human iNOS promoter-driven luciferase activity by gemfibrozil in cytokine-stimulated U373MG astroglial cells suggests that this compound inhibits the transcription of iNOS. Since gemfibrozil is known to activate peroxisome proliferator-activated receptor-α (PPAR-α), we investigated the role of PPAR-α in gemfibrozil-mediated inhibition of iNOS. Gemfibrozil induced peroxisome proliferator-responsive element (PPRE)-dependent luciferase activity, which was inhibited by the expression of ΔhPPAR-α, the dominant-negative mutant of human PPAR-α. However, ΔhPPAR-α was unable to abrogate gemfibrozil-mediated inhibition of iNOS suggesting that gemfibrozil inhibits iNOS independent of PPAR-α. The human iNOS promoter contains consensus sequences for the binding of transcription factors, including interferon-γ (IFN-γ) regulatory factor-1 (IRF-1) binding to interferon-stimulated responsive element (ISRE), signal transducer and activator of transcription (STAT) binding to γ-activation site (GAS), nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and CCAAT/enhancer-binding protein β (C/EBPβ); therefore, we investigated the effect of gemfibrozil on the activation of these transcription factors. The combination of interleukin (IL)-1β and IFN-γ induced the activation of NF-κB, AP-1, C/EBPβ, and GAS but not that of ISRE, suggesting that IRF-1 may not be involved in cytokine-induced expression of iNOS in human astrocytes. Interestingly, gemfibrozil strongly inhibited the activation of NF-κB, AP-1, and C/EBPβ but not that of GAS in cytokine-stimulated astroglial cells. These results suggest that gemfibrozil inhibits the induction of iNOS probably by

Genetic analysis of Ras genes in epidermal development and tumorigenesis

Science.gov (United States)

Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

2013-01-01

Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

International Nuclear Information System (INIS)

Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

2006-01-01

Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

International Nuclear Information System (INIS)

Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

1988-01-01

Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

Retinoid inhibition of in vitro invasion of human amnion basement membrane by human tumor cells

International Nuclear Information System (INIS)

Fazely, F.

1988-01-01

The effects measured were the inhibition of tumor cell migration through the basement membrane (BM) and tumor cell degradative enzyme activity on 3 H-proline labeled collagenous and non collagenous components of the BM. The human lung carcinoma A549 or the human Ewing's sarcoma TC-106 cell lines treated with retinoids for two days were incubated on the BM in the absence of retinoids. A dose-dependent inhibition of cell invasion was produced by retinoids. Among the retinoids tested the most powerful was retinol acetate which inhibited invasion by 50% of A549 cells at a concentration of 0.09 μg/ml, and TC-106 cells at 0.08 μg/ml. Retinol acetate inhibited A549 and TC-106 cell growth by approximately 50% at levels almost 100-fold higher than those needed for antiinvasive activity. Retinol acetate was about 20 times more potent than retinoic acid and 30 times more than retinol palmitate. Furthermore, A549 cells treated with retinol acetate, under conditions whereby an anti-invasive state was induced,showed an increase in the number of cellular retinoic acid binding proteins (CRABP), a decrease in the activity of type IV collagenase and ectosialyltransferase, and no change in the activity of transglutaminase

Inhibition of adipocytogenesis by canonical WNT signaling in human mesenchymal stem cells

International Nuclear Information System (INIS)

Shen, Longxiang; Glowacki, Julie; Zhou, Shuanhu

2011-01-01

The WNT signaling pathway plays important roles in the self-renewal and differentiation of mesenchymal stem cells (MSCs). Little is known about WNT signaling in adipocyte differentiation of human MSCs. In this study, we tested the hypothesis that canonical and non-canonical WNTs differentially regulate in vitro adipocytogenesis in human MSCs. The expression of adipocyte gene PPARγ2, lipoprotein lipase, and adipsin increased during adipocytogenesis of hMSCs. Simultaneously, the expression of canonical WNT2, 10B, 13, and 14 decreased, whereas non-canonical WNT4 and 11 increased, and WNT5A was unchanged. A small molecule WNT mimetic, SB-216763, increased accumulation of β-catenin protein, inhibited induction of WNT4 and 11 and inhibited adipocytogenesis. In contrast, knockdown of β-catenin with siRNA resulted in spontaneous adipocytogenesis. These findings support the view that canonical WNT signaling inhibits and non-canonical WNT signaling promotes adipocytogenesis in adult human marrow-derived mesenchymal stem cells.

Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

International Nuclear Information System (INIS)

Khan, I.U.; Boehm, K.D.; Elmets, C.A.

1993-01-01

Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is increased in osteoarthritis and regulates chondrocyte catabolic and anabolic activities

Science.gov (United States)

Long, D.L.; Ulici, V.; Chubinskaya, S.; Loeser, R.F.

2015-01-01

Objective We determined if the epidermal growth factor receptor ligand HB-EGF is produced in cartilage and if it regulates chondrocyte anabolic or catabolic activity. Methods HB-EGF expression was measured by quantitative PCR using RNA isolated from mouse knee joint tissues and from normal and OA human chondrocytes. Immunohistochemistry was performed on normal and OA human cartilage and meniscus sections. Cultured chondrocytes were treated with fibronectin fragments (FN-f) as a catabolic stimulus and osteogenic protein 1 (OP-1) as an anabolic stimulus. Effects of HB-EGF on cell signaling were analyzed by immunoblotting of selected signaling proteins. MMP-13 was measured in conditioned media, proteoglycan synthesis was measured by sulfate incorporation, and matrix gene expression by quantitative PCR. Results HB-EGF expression was increased in 12-month old mice at 8 weeks after surgery to induce OA and increased amounts of HB-EGF were noted in human articular cartilage from OA knees. FN-f stimulated chondrocyte HB-EGF expression and HB-EGF stimulated chondrocyte MMP-13 production. However, HB-EGF was not required for FN-f stimulation of MMP-13 production. HB-EGF activated the ERK and p38 MAP kinases and stimulated phosphorylation of Smad1 at an inhibitory serine site which was associated with inhibition of OP-1 mediated proteoglycan synthesis and reduced aggrecan (ACAN) but not COL2A1 expression. Conclusion HB-EGF is a new factor identified in OA cartilage that promotes chondrocyte catabolic activity while inhibiting anabolic activity suggesting it could contribute to the catabolic-anabolic imbalance seen in OA cartilage. PMID:25937027

Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

NARCIS (Netherlands)

Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

2000-01-01

Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

DEFF Research Database (Denmark)

Kuntsche, Judith; Herre, Angela; Fahr, Alfred

2013-01-01

barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

Dermal matrix proteins initiate re-epithelialization but are not sufficient for coordinated epidermal outgrowth in a new fish skin culture model.

Science.gov (United States)

Matsumoto, Reiko; Sugimoto, Masazumi

2007-02-01

We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.

Immune sensitization against epidermal antigens in polymorphous light eruption

International Nuclear Information System (INIS)

Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

1991-01-01

To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

Phospho-aspirin (MDC-22) inhibits breast cancer in preclinical animal models: an effect mediated by EGFR inhibition, p53 acetylation and oxidative stress

International Nuclear Information System (INIS)

Huang, Liqun; Wong, Chi C; Mackenzie, Gerardo G; Sun, Yu; Cheng, Ka Wing; Vrankova, Kvetoslava; Alston, Ninche; Ouyang, Nengtai; Rigas, Basil

2014-01-01

The anticancer properties of aspirin are restricted by its gastrointestinal toxicity and its limited efficacy. Therefore, we synthesized phospho-aspirin (PA-2; MDC-22), a novel derivative of aspirin, and evaluated its chemotherapeutic and chemopreventive efficacy in preclinical models of triple negative breast cancer (TNBC). Efficacy of PA-2 was evaluated in human breast cancer cells in vitro, and in orthotopic and subcutaneous TNBC xenografts in nude mice. Mechanistic studies were also carried out to elucidate the mechanism of action of PA-2. PA-2 inhibited the growth of TNBC cells in vitro more potently than aspirin. Treatment of established subcutaneous TNBC xenografts (MDA-MB-231 and BT-20) with PA-2 induced a strong growth inhibitory effect, resulting in tumor stasis (79% and 90% inhibition, respectively). PA-2, but not aspirin, significantly prevented the development of orthotopic MDA-MB-231 xenografts (62% inhibition). Mechanistically, PA-2: 1) inhibited the activation of epidermal growth factor receptor (EGFR) and suppressed its downstream signaling cascades, including PI3K/AKT/mTOR and STAT3; 2) induced acetylation of p53 at multiple lysine residues and enhanced its DNA binding activity, leading to cell cycle arrest; and 3) induced oxidative stress by suppressing the thioredoxin system, consequently inhibiting the activation of the redox sensitive transcription factor NF-κB. These molecular alterations were observed in vitro and in vivo, demonstrating their relevance to the anticancer effect of PA-2. Our findings demonstrate that PA-2 possesses potent chemotherapeutic efficacy against TNBC, and is also effective in its chemoprevention, warranting further evaluation as an anticancer agent

Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine.

Science.gov (United States)

Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E

2017-01-01

Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

International Nuclear Information System (INIS)

Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

2014-01-01

Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

Energy Technology Data Exchange (ETDEWEB)

Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

2014-10-15

Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

Vaginal Lactobacillus Inhibits HIV-1 Replication in Human Tissues Ex Vivo

Directory of Open Access Journals (Sweden)

Rogers A. Ñahui Palomino

2017-05-01

Full Text Available Lactobacillus species, which dominate vaginal microbiota of healthy reproductive-age women, lower the risks of sexually transmitted infections, including the risk of human immunodeficiency virus (HIV acquisition. The exact mechanisms of this protection remain to be understood. Here, we investigated these mechanisms in the context of human cervico-vaginal and lymphoid tissues ex vivo. We found that all six Lactobacillus strains tested in these systems significantly suppressed HIV type-1 (HIV-1 infection. We identified at least three factors that mediated this suppression: (i Acidification of the medium. The pH of the undiluted medium conditioned by lactobacilli was between 3.8 and 4.6. Acidification of the culture medium with hydrochloric acid (HCl to this pH in control experiments was sufficient to abrogate HIV-1 replication. However, the pH of the Lactobacillus-conditioned medium (CM diluted fivefold, which reached ∼6.9, was also suppressive for HIV-1 infection, while in control experiments HIV-1 infection was not abrogated when the pH of the medium was brought to 6.9 through the use of HCl. This suggested the existence of other factors responsible for HIV-1 inhibition by lactobacilli. (ii Lactic acid. There was a correlation between the concentration of lactic acid in the Lactobacillus-CM and its ability to suppress HIV-1 infection in human tissues ex vivo. Addition of lactic acid isomers D and L to tissue culture medium at the concentration that corresponded to their amount released by lactobacilli resulted in HIV-1 inhibition. Isomer L was produced in higher quantities than isomer D and was mostly responsible for HIV-1 inhibition. These results indicate that lactic acid, in particular its L-isomer, inhibits HIV-1 independently of lowering of the pH. (iii Virucidal effect. Incubation of HIV-1 in Lactobacillus-CM significantly suppressed viral infectivity for human tissues ex vivo. Finally, lactobacilli adsorb HIV-1, serving as a sink

Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

African Journals Online (AJOL)

Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

Harman inhibits the removal of pyrimidine dimers from the DNA of human cells

International Nuclear Information System (INIS)

Castellani, A.; Setlow, R.B.

1981-01-01

Normal human fibroblasts were UV-irradiated and incubated for 6 hr with harman. The losses of sites, in the extracted DNA, sensitive to a UV specific endonuclease were determined as precision measures of the excision of UV-induced pyrimidine dimers. Harman inhibited excision, rising from approx. 30% inhibition at 200 μM to 75% inhibition at 500 μM

Lipid-Lowering Pharmaceutical Clofibrate Inhibits Human Sweet Taste

Science.gov (United States)

Kochem, Matthew

2017-01-01

T1R2-T1R3 is a heteromeric receptor that binds sugars, high potency sweeteners, and sweet taste blockers. In rodents, T1R2-T1R3 is largely responsible for transducing sweet taste perception. T1R2-T1R3 is also expressed in non-taste tissues, and a growing body of evidence suggests that it helps regulate glucose and lipid metabolism. It was previously shown that clofibric acid, a blood lipid-lowering drug, binds T1R2-T1R3 and inhibits its activity in vitro. The purpose of this study was to determine whether clofibric acid inhibits sweetness perception in humans and is, therefore, a T1R2-T1R3 antagonist in vivo. Fourteen participants rated the sweetness intensity of 4 sweeteners (sucrose, sucralose, Na cyclamate, acesulfame K) across a broad range of concentrations. Each sweetener was prepared in solution neat and in mixture with either clofibric acid or lactisole. Clofibric acid inhibited sweetness of every sweetener. Consistent with competitive binding, inhibition by clofibric acid was diminished with increasing sweetener concentration. This study provides in vivo evidence that the lipid-lowering drug clofibric acid inhibits sweetness perception and is, therefore, a T1R carbohydrate receptor inhibitor. Our results are consistent with previous in vitro findings. Given that T1R2-T1R3 may in part regulate glucose and lipid metabolism, future studies should investigate the metabolic effects of T1R inhibition. PMID:27742692

IL-17 inhibits chondrogenic differentiation of human mesenchymal stem cells.

Directory of Open Access Journals (Sweden)

Masahiro Kondo

Full Text Available OBJECTIVE: Mesenchymal stem cells (MSCs can differentiate into cells of mesenchymal lineages, such as osteoblasts and chondrocytes. Here we investigated the effects of IL-17, a key cytokine in chronic inflammation, on chondrogenic differentiation of human MSCs. METHODS: Human bone marrow MSCs were pellet cultured in chondrogenic induction medium containing TGF-β3. Chondrogenic differentiation was detected by cartilage matrix accumulation and chondrogenic marker gene expression. RESULTS: Over-expression of cartilage matrix and chondrogenic marker genes was noted in chondrogenic cultures, but was inhibited by IL-17 in a dose-dependent manner. Expression and phosphorylation of SOX9, the master transcription factor for chondrogenesis, were induced within 2 days and phosphorylated SOX9 was stably maintained until day 21. IL-17 did not alter total SOX9 expression, but significantly suppressed SOX9 phosphorylation in a dose-dependent manner. At day 7, IL-17 also suppressed the activity of cAMP-dependent protein kinase A (PKA, which is known to phosphorylate SOX9. H89, a selective PKA inhibitor, also suppressed SOX9 phosphorylation, expression of chondrogenic markers and cartilage matrix, and also decreased chondrogenesis. CONCLUSIONS: IL-17 inhibited chondrogenesis of human MSCs through the suppression of PKA activity and SOX9 phosphorylation. These results suggest that chondrogenic differentiation of MSCs can be inhibited by a mechanism triggered by IL-17 under chronic inflammation.

Regulation of the ligand-dependent activation of the epidermal growth factor receptor by calmodulin

DEFF Research Database (Denmark)

Li, Hongbing; Panina, Svetlana; Kaur, Amandeep

2012-01-01

Calmodulin (CaM) is the major component of calcium signaling pathways mediating the action of various effectors. Transient increases in the intracellular calcium level triggered by a variety of stimuli lead to the formation of Ca2+/CaM complexes, which interact with and activate target proteins....... In the present study the role of Ca2+/CaM in the regulation of the ligand-dependent activation of the epidermal growth factor receptor (EGFR) has been examined in living cells. We show that addition of different cell permeable CaM antagonists to cultured cells or loading cells with a Ca2+ chelator inhibited...

Demonstration of tyrosinase in the vitiligo skin of human beings by a sensitive fluorometric method as well as by 14C(U)-L-tyrosine incorporation into melanin

International Nuclear Information System (INIS)

Husain, I.; Vijayan, E.; Ramaiah, A.; Pasricha, J.S.; Madan, N.C.

1982-01-01

Tyrosinase activity (Monophenol, dihydroxyphenylalanine: oxygen oxidoreductase EC 1.14.18.1) in vitiligo and normal epidermal homogenates of skin from human beings was measured by estimating beta 3,4-dihydroxyphenylalanine (dopa) by a highly sensitive fluorometric method described in this paper. The tyrosine activity in the vitiligo skin was about 4 to 37% of corresponding normal skin. The activity of tyrosinase in normal human skin from different individuals and from different regions of the body was in the range of 4 to 140 picomoles of beta 3,4-dihydroxyphenylalanine formed per min/mg protein of epidermal homogenate. The enzyme from vitiligo and normal skin was severely inhibited by substance(s) of low molecular weight. The enzyme exhibits a lag of about 4 hr in the absence of added beta 3,4-dihydroxyphenylalanine and 1 hr in presence of 5 microM dopa. Tyrosinase from the normal and vitiligo skin was inhibited by excess concentration of tyrosine. The homogenates from vitiligo skin could synthesize melanin from C14(U)-L-Tyrosine. The rate of tyrosine incorporation into melanin by the epidermal homogenates is increased by 3,4-dihydroxyphenylalanine (dopa) disproportionate to its effect on tyrosinase activity. Based on the data presented in this paper it is concluded that melanocytes are present in the vitiligo skin. A tentative hypothesis is put forward to explain the lack of melanin synthesis by the vitiligo skin under in vivo conditions, although melanocytes are present

Foliar Epidermal Studies of Plants in Euphorbiaceae

Directory of Open Access Journals (Sweden)

H. A. Thakur

2014-03-01

Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

Science.gov (United States)

Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

2018-03-27

Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

Science.gov (United States)

Ali, F; Khan, A Q; Khan, R; Sultana, S

2016-02-01

Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

Sickle erythrocytes inhibit human endothelial cell DNA synthesis

International Nuclear Information System (INIS)

Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K.

1990-01-01

Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling

Inhibition of isolated human myometrium contractility by minoxidil and reversal by glibenclamide.

Science.gov (United States)

Prabhakaran, S S; Dhanasekar, K R; Thomas, E; Jose, R; Peedicayil, J; Samuel, P

2010-03-01

This study investigated the ability of the antihypertensive drug minoxidil to inhibit potassium chloride (KCl)-induced contractility of the isolated human myometrium. Twelve strips of myometrium obtained from 12 patients who underwent hysterectomy were triggered to contract with 55 mM KCl before and after incubation with 3 concentrations (1, 3 and 10 microM) of minoxidil. The percent inhibition by minoxidil on the extent of contraction, and the area under the contractile curve of KCl-induced contraction of the myometrial strips was determined. Furthermore, the effect of 10 microM glibenclamide on the inhibition generated by 3 microM minoxidil on KCl-induced contractility was studied. It was found that minoxidil produced a concentration-dependent inhibition of KCl-induced contractility of the myometrium and that glibenclamide reversed this inhibitory effect. These results suggest that the inhibitory effect of minoxidil on isolated human myometrium contractility may prove useful in clinical conditions requiring relaxation of the myometrium. 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

Energy Technology Data Exchange (ETDEWEB)

Wang, Ping; Guliaev, Anton B.; Hang, Bo

2006-02-28

Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

Inflammasome Inhibition Suppresses Alveolar Cell Permeability Through Retention of Neuregulin-1 (NRG-1

Directory of Open Access Journals (Sweden)

Rajanbabu Venugopal

2015-07-01

Full Text Available Background: Neuregulin (NRG-1-human epidermal receptor (HER-2 signaling pathway is a key regulator of IL-1β-mediated pulmonary inflammation and epithelial permeability. The inflammasome is a newly discovered molecular platform required for caspase-1 activation and maturation of IL-1β. However, the role of the inflammasome in NRG-1-HER2 signaling-mediated alveolar cell permeability is unknown. Methods: The inflammasome was activated or inhibited in THP-1 cells; supernatants from these cells were added to A549 cells and human small airway epithelial cells (HSAEC. The protein expression of NRG-1 and phospho-HER2 (pHER2 were measured by Western blot analysis and epithelial permeability was measured using Lucifer yellow dye. Results: Results reveal that alveolar permeability in A549 cells and HSAEC is increased when treated with supernatants of inflammasome-activated THP-1 cells. Alveolar permeability is significantly suppressed when treated with supernatant of inflammasome-inhibited THP-1 cells. Inflammasome-mediated permeability is decreased when A549 cells and HSAEC are pretreated with IL-1β receptor antagonist (IL-1βRA. In addition, HER2 kinase inhibitor AG825 or NRG-1 inhibitor TAPI inhibits inflammasome-mediated permeability in A549 cells and HSAEC demonstrating critical roles of IL-1β, NRG-1, and HER2 in inflammasome-mediated alveolar permeability. Conclusion: These findings suggest that inflammasome-induced alveolar cell permeability is mediated by NRG-1/HER2 signaling through IL-1β regulation.

Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.

Science.gov (United States)

Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei

2015-07-28

To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.

Association of Polymorphisms in Connective Tissue Growth Factor and Epidermal Growth Factor Receptor Genes With Human Longevity.

Science.gov (United States)

Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J

2017-08-01

Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

Directory of Open Access Journals (Sweden)

Boér K

2016-10-01

Full Text Available Katalin Boér Department of Medical Oncology, Szent Margit Hospital, Budapest, Hungary Abstract: Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6 inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2-ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant

MiR-1254 inhibits proliferation, migration and invasion of human ...

African Journals Online (AJOL)

MiR-1254 inhibits proliferation, migration and invasion of human brain tumour cell lines. ... The transcripts were analysed by real-time polymerase chain reaction (RT-PCR) ... Over-expression of miR- 1254 also led to significant decrease in cell ...

Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

DEFF Research Database (Denmark)

Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

2010-01-01

Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

Vanadate monomers and dimers both inhibit the human prostatic acid phosphatase.

Science.gov (United States)

Crans, D C; Simone, C M; Saha, A K; Glew, R H

1989-11-30

A combination of enzyme kinetics and 51V NMR spectroscopy was used to identify the species of vanadate that inhibits acid phosphatases. Monomeric vanadate was shown to inhibit wheat germ and potato acid phosphatases. At pH 5.5, the vanadate dimer inhibits the human prostatic acid phosphatase whereas at pH 7.0 it is the vanadate monomer that inhibits this enzyme. The pH-dependent shift in the affinity of the prostatic phosphatase for vanadate is presumably due to deprotonation of an amino acid side chain in or near the binding site resulting in a conformational change in the protein. pH may be a subtle effector of the insulin-like vanadate activity in biological systems and may explain some of the differences in selectivity observed with the protein phosphatases.

Propolin C Inhibited Migration and Invasion via Suppression of EGFR-Mediated Epithelial-to-Mesenchymal Transition in Human Lung Cancer Cells

Directory of Open Access Journals (Sweden)

Jih-Tung Pai

2018-01-01

Full Text Available Controlling lung cancer cell migration and invasion via epithelial-to-mesenchymal transition (EMT through the regulation of epidermal growth factor receptor (EGFR signaling pathway has been demonstrated. Searching biological active phytochemicals to repress EGFR-regulated EMT might prevent lung cancer progression. Propolis has been used as folk medicine in many countries and possesses anti-inflammatory, antioxidant, and anticancer activities. In this study, the antimigration and anti-invasion activities of propolin C, a c-prenylflavanone from Taiwanese propolis, were investigated on EGFR-regulated EMT signaling pathway. Cell migration and invasion activities were dose-dependently suppressed by noncytotoxic concentration of propolin C. Downregulations of vimentin and snail as well as upregulation of E-cadherin expressions were through the inhibition of EGFR-mediated phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt and extracellular signal-regulated kinase (ERK signaling pathway in propolin C-treated cells. In addition, EGF-induced migration and invasion were suppressed by propolin C-treated A549 lung cancer cells. No significant differences in E-cadherin expression were observed in EGF-stimulated cells. Interestingly, EGF-induced expressions of vimentin, snail, and slug were suppressed through the inhibition of PI3K/Akt and ERK signaling pathway in propolin C-treated cells. Inhibition of cell migration and invasion by propolin C was through the inhibition of EGF/EGFR-mediated signaling pathway, followed by EMT suppression in lung cancer.

Human mesenchymal stem cells inhibit osteoclastogenesis through osteoprotegerin production.

Science.gov (United States)

Oshita, Koichi; Yamaoka, Kunihiro; Udagawa, Nobuyuki; Fukuyo, Shunsuke; Sonomoto, Koshiro; Maeshima, Keisuke; Kurihara, Ryuji; Nakano, Kazuhisa; Saito, Kazuyoshi; Okada, Yosuke; Chiba, Kenji; Tanaka, Yoshiya

2011-06-01

Mesenchymal stem cells (MSCs) have been proposed to be a useful tool for treatment of rheumatoid arthritis (RA), not only because of their multipotency but also because of their immunosuppressive effect on lymphocytes, dendritic cells, and other proinflammatory cells. Since bone destruction caused by activated osteoclasts occurs in RA, we undertook the present study to investigate the effect of MSCs on osteoclast function and differentiation in order to evaluate their potential use in RA therapy. Human MSCs and peripheral blood mononuclear cells were cultured under cell-cell contact-free conditions with osteoclast induction medium. Differentiation into osteoclast-like cells was determined by tartrate-resistant acid phosphatase staining and expression of osteoclast differentiation markers. The number of osteoclast-like cells was decreased and expression of cathepsin K and nuclear factor of activated T cells c1 (NF-ATc1) was down-regulated by the addition of either MSCs or a conditioned medium obtained from MSCs. Osteoprotegerin (OPG) was constitutively produced by MSCs and inhibited osteoclastogenesis. However, osteoclast differentiation was not fully recovered upon treatment with either anti-OPG antibody or OPG small interfering RNA, suggesting that OPG had only a partial role in the inhibitory effect of MSCs. Moreover, bone-resorbing activity of osteoclast-like cells was partially recovered by addition of anti-OPG antibody into the conditioned medium. The present results indicate that human MSCs constitutively produce OPG, resulting in inhibition of osteoclastogenesis and expression of NF-ATc1 and cathepsin K in the absence of cell-cell contact. Therefore, we conclude that human MSCs exert a suppressive effect on osteoclastogenesis, which may be beneficial in inhibition of joint damage in RA. Copyright © 2011 by the American College of Rheumatology.

Antiviral activity of human lactoferrin: inhibition of alphavirus interaction with heparan sulfate

International Nuclear Information System (INIS)

Waarts, Barry-Lee; Aneke, Onwuchekwa J.C.; Smit, Jolanda M.; Kimata, Koji; Bittman, Robert; Meijer, Dirk K.F.; Wilschut, Jan

2005-01-01

Human lactoferrin is a component of the non-specific immune system with distinct antiviral properties. We used alphaviruses, adapted to interaction with heparan sulfate (HS), as a tool to investigate the mechanism of lactoferrin's antiviral activity. Lactoferrin inhibited infection of BHK-21 cells by HS-adapted, but not by non-adapted, Sindbis virus (SIN) or Semliki Forest virus (SFV). Lactoferrin also inhibited binding of radiolabeled HS-adapted viruses to BHK-21 cells or liposomes containing lipid-conjugated heparin as a receptor analog. On the other hand, low-pH-induced fusion of the viruses with liposomes, which occurs independently of virus-receptor interaction, was unaffected. Studies involving preincubation of virus or cells with lactoferrin suggested that the protein does not bind to the virus, but rather blocks HS-moieties on the cell surface. Charge-modified human serum albumin, with a net positive charge, had a similar antiviral effect against HS-adapted SIN and SFV, suggesting that the antiviral activity of lactoferrin is related to its positive charge. It is concluded that human lactoferrin inhibits viral infection by interfering with virus-receptor interaction rather than by affecting subsequent steps in the viral cell entry or replication processes

Inhibition of autophagy induced by proteasome inhibition increases cell death in human SHG-44 glioma cells.

Science.gov (United States)

Ge, Peng-Fei; Zhang, Ji-Zhou; Wang, Xiao-Fei; Meng, Fan-Kai; Li, Wen-Chen; Luan, Yong-Xin; Ling, Feng; Luo, Yi-Nan

2009-07-01

The ubiquitin-proteasome system (UPS) and lysosome-dependent macroautophagy (autophagy) are two major intracellular pathways for protein degradation. Recent studies suggest that proteasome inhibitors may reduce tumor growth and activate autophagy. Due to the dual roles of autophagy in tumor cell survival and death, the effect of autophagy on the destiny of glioma cells remains unclear. In this study, we sought to investigate whether inhibition of the proteasome can induce autophagy and the effects of autophagy on the fate of human SHG-44 glioma cells. The proteasome inhibitor MG-132 was used to induce autophagy in SHG-44 glioma cells, and the effect of autophagy on the survival of SHG-44 glioma cells was investigated using an autophagy inhibitor 3-MA. Cell viability was measured by MTT assay. Apoptosis and cell cycle were detected by flow cytometry. The expression of autophagy related proteins was determined by Western blot. MG-132 inhibited cell proliferation, induced cell death and cell cycle arrest at G(2)/M phase, and activated autophagy in SHG-44 glioma cells. The expression of autophagy-related Beclin-1 and LC3-I was significantly up-regulated and part of LC3-I was converted into LC3-II. However, when SHG-44 glioma cells were co-treated with MG-132 and 3-MA, the cells became less viable, but cell death and cell numbers at G(2)/M phase increased. Moreover, the accumulation of acidic vesicular organelles was decreased, the expression of Beclin-1 and LC3 was significantly down-regulated and the conversion of LC3-II from LC3-I was also inhibited. Inhibition of the proteasome can induce autophagy in human SHG-44 glioma cells, and inhibition of autophagy increases cell death. This discovery may shed new light on the effect of autophagy on modulating the fate of SHG-44 glioma cells.Acta Pharmacologica Sinica (2009) 30: 1046-1052; doi: 10.1038/aps.2009.71.

Adrenergic effects on secretion of epidermal growth factor from Brunner's glands

DEFF Research Database (Denmark)

Poulsen, Steen Seier

1985-01-01

The influence of the sympathetic nervous system and adrenergic agonists on flow rate and secretion of epidermal growth factor (EGF) from Brunner's glands has been investigated in the rat. Chemical sympathectomy by administration of 6-hydroxydopamine increased volume secretion and output of EGF from...... Brunner's glands but depleted the glands of EGF. Infusion of noradrenaline, an alpha-adrenergic agonist, inhibited basal and vasoactive intestinal polypeptide (VIP) stimulated flow rate and output of EGF from Brunner's glands and increased the amount of EGF in the tissue. Vasoactive intestinal polypeptide...... also increased the amount of EGF in Brunner's gland tissue and this was unchanged after simultaneous infusion of VIP and noradrenaline as well as VIP and isoproterenol, a beta-adrenergic agonist. Isoproterenol had no effect on basal and VIP stimulated secretion of EGF from Brunner's glands...

Biochemistry of epidermal stem cells.

Science.gov (United States)

Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

2013-02-01

The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

Biochemistry of epidermal stem cells☆

Science.gov (United States)

Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

2014-01-01

Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

Science.gov (United States)

Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

2014-10-15

Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

Telomerase inhibition effectively targets mouse and human AML stem cells and delays relapse following chemotherapy

DEFF Research Database (Denmark)

Bruedigam, Claudia; Bagger, Frederik Otzen; Heidel, Florian H.

2014-01-01

(-/-) LSCs express a specific gene expression signature that can be identified in human AML patient cohorts and is positively correlated with patient survival following chemotherapy. In xenografts of primary human AML, genetic or pharmacological inhibition of telomerase targets LSCs, impairs leukemia...... progression, and delays relapse following chemotherapy. Altogether, these results establish telomerase inhibition as an effective strategy for eliminating AML LSCs....

Evolution of dinosaur epidermal structures.

Science.gov (United States)

Barrett, Paul M; Evans, David C; Campione, Nicolás E

2015-06-01

Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells.

Science.gov (United States)

Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han

2011-11-09

Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

Potent inhibition of cytochrome P450 2B6 by sibutramine in human liver microsomes.

Science.gov (United States)

Bae, Soo Hyeon; Kwon, Min Jo; Choi, Eu Jin; Zheng, Yu Fen; Yoon, Kee Dong; Liu, Kwang-Hyeon; Bae, Soo Kyung

2013-09-05

The present study was performed to evaluate the potency and specificity of sibutramine as an inhibitor of the activities of nine human CYP isoforms in liver microsomes. Using a cocktail assay, the effects of sibutramine on specific marker reactions of the nine CYP isoforms were measured in human liver microsomes. Sibutramine showed potent inhibition of CYP2B6-mediated bupropion 6-hydroxylation with an IC50 value of 1.61μM and Ki value of 0.466μM in a competitive manner at microsomal protein concentrations of 0.25mg/ml; this was 3.49-fold more potent than the typical CYP2B6 inhibitor thio-TEPA (Ki=1.59μM). In addition, sibutramine slightly inhibited CYP2C19 activity (Ki=16.6μM, noncompetitive inhibition) and CYP2D6 activity (Ki=15.7μM, noncompetitive inhibition). These observations indicated 35.6- and 33.7-fold decreases in inhibition potency, respectively, compared with that of CYP2B6 by sibutramine. However, no inhibition of CYP1A2, CYP2A6, CYP2C8, CYP2C9, CYP2D6, or CYP2E1 activities was observed. In addition, the CYP2B6 inhibitory potential of sibutramine was enhanced at a lower microsomal protein concentration of 0.05mg/ml. After 30min preincubation of human liver microsomes with sibutramine in the presence of NADPH, no shift in IC50 was observed in terms of inhibition of the activities of the nine CYPs, suggesting that sibutramine is not a time-dependent inactivator. These observations suggest that sibutramine is a selective and potent inhibitor of CYP2B6 in vitro, whereas inhibition of other CYPs is substantially lower. These in vitro data support the use of sibutramine as a well-known inhibitor of CYP2B6 for routine screening of P450 reversible inhibition when human liver microsomes are used as the enzyme source. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

PPARγ ligand ciglitazone inhibits TNFα-induced ICAM-1 in human airway smooth muscle cells

Directory of Open Access Journals (Sweden)

Chien-Da Huang

2014-08-01

Full Text Available Background: Modification of human airway smooth muscle (ASM function by proinflammatory cytokines has been regarded as a potential mechanism underlying bronchial hyperresponsiveness in asthma. Human ASM cells express intercellular adhesion molecule (ICAM-1 in response to cytokines. Synthetic ligands for peroxisome proliferator-activated receptor (PPARγ reportedly possess anti-inflammatory and immunomodulatory properties. In this study, we examined whether ciglitazone, a synthetic PPARγ ligand, can modulate the basal and tumor necrosis factor (TNFα-induced ICAM1 gene expression in human ASM cells. Methods: Human ASM cells were treated with TNFα. ICAM-1 expression was assessed by flow cytometry and reverse transcriptase-polymerase chain reaction (RT-PCR analysis. PPARγ activity was inhibited by target-specific small interfering (si RNA targeting PPARγ and GW9662, a PPARγ antagonist. Activity of nuclear factor (NF-κB was assessed by using immunoblot analysis, immune-confocal images, and electrophoretic mobility shift assay (EMSA. Results: By flow cytometry, ciglitazone alone had no effect on ICAM-1 expression in ASM cells, but inhibited ICAM-1 expression in response to TNFα (10 ng/ml in a dose-dependent manner (1-10 μM. It also inhibited TNFα-induced ICAM1 gene expression by RT-PCR analysis. Knockdown of PPARγ gene by target-specific siRNA targeting PPARγ enhanced ICAM-1 expression and the inhibitory effect of ciglitazone on TNFα-induced ICAM-1 expression was reversed by PPARγ siRNA and GW9662. SN-50 (10 μg/ml, an inhibitor for nuclear translocation of NF-κB, inhibited TNFα-induced ICAM-1 expression. Ciglitazone did not prevent TNFα-induced degradation of the cytosolic inhibitor of NF-κB (IκB, but inhibited the nuclear translocation of p65 induced by TNFα and suppressed the NF-κB/DNA binding activity. Conclusion: These findings suggest that ciglitazone inhibits TNFα-induced ICAM1 gene expression in human ASM cells through

Long-term organ culture of rabbit skin: Effect of EGF on epidermal structure in vitro

International Nuclear Information System (INIS)

Kondo, S.; Hozumi, Y.; Aso, K.

1990-01-01

A method is described for maintaining the epidermal structure of normal rabbit ear skin explants in organ culture for up to 12 weeks. Split-thickness skin specimens were put in diffusion chambers made of either millipore filters or bovine collagen membranes, and then submitted to a roller tube culture at 15 rpm and 36 degrees C. The culture medium was Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal calf serum (FCS) + 0.4 micrograms/ml hydrocortisone. The gas used in the culture tube was air + 5% CO2. Autoradiography revealed the incorporation of [3H]-glycine into the 68-kD keratin band of explants for up to 12 weeks, indicating that normal keratinization was maintained throughout the entire culture period. The turnover time of the epidermis from basal layer to granular layer was around 7 d in both the early and late stages of culture. The addition of epidermal growth factor (EGF) to the culture caused the epidermis to become acanthotic with orthokeratosis, but with high concentrations of EGF (greater than or equal to 10 ng/ml) parakeratosis and increased proliferation of the epidermis occurred. Dexamethasone (DMS) strongly inhibited the EGF effect

Non-small-cell lung cancer cells combat epidermal growth factor receptor tyrosine kinase inhibition through immediate adhesion-related responses

Directory of Open Access Journals (Sweden)

Wang HY

2016-05-01

Full Text Available Hsian-Yu Wang,1,2 Min-Kung Hsu,3,4 Kai-Hsuan Wang,1 Ching-Ping Tseng,2,4 Feng-Chi Chen,3,4 John T-A Hsu1,4 1Institute of Biotechnology and Pharmaceutical Research, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 2Institute of Molecular Medicine and Bioengineering, National Chiao Tung University (NCTU, Hsinchu, 3Division of Biostatistics and Bioinformatics, Institute of Population Health Sciences, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 4Department of Biological Science and Technology, National Chiao Tung University (NCTU, Hsinchu, Taiwan, Republic of China Background: Epidermal growth factor receptor (EGFR tyrosine kinase inhibitors (TKIs, such as gefitinib, erlotinib, and afatinib, have greatly improved treatment efficacy in non-small cell lung cancer (NSCLC patients with drug-sensitive EGFR mutations. However, in some TKI responders, the benefits of such targeted therapies are limited by the rapid development of resistance, and strategies to overcome this resistance are urgently needed. Studies of drug resistance in cancer cells typically involve long term in vitro induction to obtain stably acquired drug-resistant cells followed by elucidation of resistance mechanisms, but the immediate responses of cancer cells upon drug treatment have been ignored. The aim of this study was to investigate the immediate responses of NSCLC cells upon treatment with EGFR TKIs.Results: Both NSCLC cells, ie, PC9 and H1975, showed immediate enhanced adhesion-related responses as an apoptosis-countering mechanism upon first-time TKI treatment. By gene expression and pathway analysis, adhesion-related pathways were enriched in gefitinib-treated PC9 cells. Pathway inhibition by small-hairpin RNAs or small-molecule drugs revealed that within hours of EGFR TKI treatment, NSCLC cells used adhesion-related responses to combat the drugs. Importantly, we show here that the Src family inhibitor, dasatinib, dramatically inhibits

Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

International Nuclear Information System (INIS)

Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

2008-01-01

The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

Prolyl oligopeptidase inhibition-induced growth arrest of human gastric cancer cells

Energy Technology Data Exchange (ETDEWEB)

Suzuki, Kanayo [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Sakaguchi, Minoru, E-mail: sakaguti@gly.oups.ac.jp [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Tanaka, Satoshi [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Yoshimoto, Tadashi [Department of Life Science, Setsunan University, 17-8 Ikeda-Nakamachi, Neyagawa, Osaka 572-8508 (Japan); Takaoka, Masanori [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan)

2014-01-03

Highlights: •We examined the effects of prolyl oligopeptidase (POP) inhibition on p53 null gastric cancer cell growth. •POP inhibition-induced cell growth suppression was associated with an increase in a quiescent G{sub 0} state. •POP might regulate the exit from and/or reentry into the cell cycle. -- Abstract: Prolyl oligopeptidase (POP) is a serine endopeptidase that hydrolyzes post-proline peptide bonds in peptides that are <30 amino acids in length. We recently reported that POP inhibition suppressed the growth of human neuroblastoma cells. The growth suppression was associated with pronounced G{sub 0}/G{sub 1} cell cycle arrest and increased levels of the CDK inhibitor p27{sup kip1} and the tumor suppressor p53. In this study, we investigated the mechanism of POP inhibition-induced cell growth arrest using a human gastric cancer cell line, KATO III cells, which had a p53 gene deletion. POP specific inhibitors, 3-((4-[2-(E)-styrylphenoxy]butanoyl)-L-4-hydroxyprolyl)-thiazolidine (SUAM-14746) and benzyloxycarbonyl-thioprolyl-thioprolinal, or RNAi-mediated POP knockdown inhibited the growth of KATO III cells irrespective of their p53 status. SUAM-14746-induced growth inhibition was associated with G{sub 0}/G{sub 1} cell cycle phase arrest and increased levels of p27{sup kip1} in the nuclei and the pRb2/p130 protein expression. Moreover, SUAM-14746-mediated cell cycle arrest of KATO III cells was associated with an increase in the quiescent G{sub 0} state, defined by low level staining for the proliferation marker, Ki-67. These results indicate that POP may be a positive regulator of cell cycle progression by regulating the exit from and/or reentry into the cell cycle by KATO III cells.

The biologic role of ganglioside in neuronal differentiation--effects of GM1 ganglioside on human neuroblastoma SH-SY5Y cells.

OpenAIRE

Lee, M. C.; Lee, W. S.; Park, C. S.; Juhng, S. W.

1994-01-01

Human neuroblastoma SH-SY5Y cell is a cloned cell line which has many attractive features for the study of neuronal proliferation and neurite outgrowth, because it has receptors for insulin, IGF-I and PDGF. Gangliosides are sialic acid containing glycosphingolipids which form an integral part of the plasma membrane of many mammalian cells. They inhibit cell growth mediated by tyrosine kinase receptors and ligand-stimulated tyrosine kinase activity, and autophosphorylation of EGF(epidermal gro...

Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer.

Science.gov (United States)

Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

2017-12-01

Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

CTRP6 inhibits fibrogenesis in TGF-β1-stimulated human dermal fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Fan, Rong-hui, E-mail: fan_ronghuixa@163.com [Department of Burn and Plastic Surgery, Shaanxi Provincial People’s Hospital, Xi’an 710068 (China); Zhu, Xiu-mei; Sun, Yao-wen [Department of Burn and Plastic Surgery, Shaanxi Provincial People’s Hospital, Xi’an 710068 (China); Peng, Hui-zi [Department of Cosmetology Plastic Surgery, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi 710061 (China); Wu, Hang-li; Gao, Wen-jie [Department of Burn and Plastic Surgery, Shaanxi Provincial People’s Hospital, Xi’an 710068 (China)

2016-07-08

Skin fibrosis is characterized by excessive proliferation of fibroblasts and overproduction of extracellular matrix (ECM). C1q/tumor necrosis factor-related protein 6 (CTRP6), a member of CTRPs, has been involved in the development of cardiac fibrosis. However, the function and detailed regulatory mechanism of CTRP6 in skin fibrosis remain unclear. The aim of this study was to investigate the effect of CTRP6 on the activation of human dermal fibroblasts. Our results showed that CTRP6 was lowly expressed in scar tissues and transforming growth factor-β1 (TGF-β1)-treated dermal fibroblasts. CTRP6 overexpression significantly inhibited the proliferation of dermal fibroblasts, as well as suppressed the expression of ECM in TGF-β1-treated dermal fibroblasts. Furthermore, CTRP6 overexpression markedly inhibited TGF-β1-induced phosphorylation of Smad3 in dermal fibroblasts. In conclusion, the data reported here demonstrate that CTRP6 is able to inhibit the proliferation and ECM expression in human dermal fibroblasts through suppressing the TGF-β1/Smad3 signaling pathway. These findings suggest that CTRP6 may be a potential therapeutic target for the prevention of skin fibrosis. -- Highlights: •CTRP6 expression was decreased in scar tissues and TGF-β1-treated dermal fibroblasts. •CTRP6 inhibits TGF-β1-induced the proliferation of dermal fibroblasts. •CTRP6 inhibits expression of collagen type I and α-SMA. •CTRP6 inhibits the activation of TGF-β1/Smad3 signaling pathway in dermal fibroblasts.

CTRP6 inhibits fibrogenesis in TGF-β1-stimulated human dermal fibroblasts

International Nuclear Information System (INIS)

Fan, Rong-hui; Zhu, Xiu-mei; Sun, Yao-wen; Peng, Hui-zi; Wu, Hang-li; Gao, Wen-jie

2016-01-01

Skin fibrosis is characterized by excessive proliferation of fibroblasts and overproduction of extracellular matrix (ECM). C1q/tumor necrosis factor-related protein 6 (CTRP6), a member of CTRPs, has been involved in the development of cardiac fibrosis. However, the function and detailed regulatory mechanism of CTRP6 in skin fibrosis remain unclear. The aim of this study was to investigate the effect of CTRP6 on the activation of human dermal fibroblasts. Our results showed that CTRP6 was lowly expressed in scar tissues and transforming growth factor-β1 (TGF-β1)-treated dermal fibroblasts. CTRP6 overexpression significantly inhibited the proliferation of dermal fibroblasts, as well as suppressed the expression of ECM in TGF-β1-treated dermal fibroblasts. Furthermore, CTRP6 overexpression markedly inhibited TGF-β1-induced phosphorylation of Smad3 in dermal fibroblasts. In conclusion, the data reported here demonstrate that CTRP6 is able to inhibit the proliferation and ECM expression in human dermal fibroblasts through suppressing the TGF-β1/Smad3 signaling pathway. These findings suggest that CTRP6 may be a potential therapeutic target for the prevention of skin fibrosis. -- Highlights: •CTRP6 expression was decreased in scar tissues and TGF-β1-treated dermal fibroblasts. •CTRP6 inhibits TGF-β1-induced the proliferation of dermal fibroblasts. •CTRP6 inhibits expression of collagen type I and α-SMA. •CTRP6 inhibits the activation of TGF-β1/Smad3 signaling pathway in dermal fibroblasts.

Inhibition of human anthracycline reductases by emodin — A possible remedy for anthracycline resistance

International Nuclear Information System (INIS)

Hintzpeter, Jan; Seliger, Jan Moritz; Hofman, Jakub; Martin, Hans-Joerg; Wsol, Vladimir; Maser, Edmund

2016-01-01

The clinical application of anthracyclines, like daunorubicin and doxorubicin, is limited by two factors: dose-related cardiotoxicity and drug resistance. Both have been linked to reductive metabolism of the parent drug to their metabolites daunorubicinol and doxorubicinol, respectively. These metabolites show significantly less anti-neoplastic properties as their parent drugs and accumulate in cardiac tissue leading to chronic cardiotoxicity. Therefore, we aimed to identify novel and potent natural inhibitors for anthracycline reductases, which enhance the anticancer effect of anthracyclines by preventing the development of anthracycline resistance. Human enzymes responsible for the reductive metabolism of daunorubicin were tested for their sensitivity towards anthrachinones, in particular emodin and anthraflavic acid. Intense inhibition kinetic data for the most effective daunorubicin reductases, including IC 50 - and K i -values, the mode of inhibition, as well as molecular docking, were compiled. Subsequently, a cytotoxicity profile and the ability of emodin to reverse daunorubicin resistance were determined using multiresistant A549 lung cancer and HepG2 liver cancer cells. Emodin potently inhibited the four main human daunorubicin reductases in vitro. Further, we could demonstrate that emodin is able to synergistically sensitize human cancer cells towards daunorubicin at clinically relevant concentrations. Therefore, emodin may yield the potential to enhance the therapeutic effectiveness of anthracyclines by preventing anthracycline resistance via inhibition of the anthracycline reductases. In symphony with its known pharmacological properties, emodin might be a compound of particular interest in the management of anthracycline chemotherapy efficacy and their adverse effects. - Highlights: • Natural and synthetic compounds were identified as inhibitors for human daunorubicin reductases. • Emodin is a potent inhibitor for human daunorubicin reductases. �

Acute effects of cocaine and cannabis on response inhibition in humans: an ERP investigation

NARCIS (Netherlands)

Spronk, D.B.; De Bruijn, E.R.; van Wel, J.H.; Ramaekers, J.G.; Verkes, R.J.

2016-01-01

Substance abuse has often been associated with alterations in response inhibition in humans. Not much research has examined how the acute effects of drugs modify the neurophysiological correlates of response inhibition, or how these effects interact with individual variation in trait levels of

Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

International Nuclear Information System (INIS)

Bell, C.W.

1987-01-01

Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

Metformin and Its Sulfenamide Prodrugs Inhibit Human Cholinesterase Activity

Directory of Open Access Journals (Sweden)

Magdalena Markowicz-Piasecka

2017-01-01

Full Text Available The results of epidemiological and pathophysiological studies suggest that type 2 diabetes mellitus (T2DM may predispose to Alzheimer’s disease (AD. The two conditions present similar glucose levels, insulin resistance, and biochemical etiologies such as inflammation and oxidative stress. The diabetic state also contributes to increased acetylcholinesterase (AChE activity, which is one of the factors leading to neurodegeneration in AD. The aim of this study was to assess in vitro the effects of metformin, phenformin, and metformin sulfenamide prodrugs on the activity of human AChE and butyrylcholinesterase (BuChE and establish the type of inhibition. Metformin inhibited 50% of the AChE activity at micromolar concentrations (2.35 μmol/mL, mixed type of inhibition and seemed to be selective towards AChE since it presented low anti-BuChE activity. The tested metformin prodrugs inhibited cholinesterases (ChE at nanomolar range and thus were more active than metformin or phenformin. The cyclohexyl sulfenamide prodrug demonstrated the highest activity towards both AChE (IC50 = 890 nmol/mL, noncompetitive inhibition and BuChE (IC50 = 28 nmol/mL, mixed type inhibition, while the octyl sulfenamide prodrug did not present anti-AChE activity, but exhibited mixed inhibition towards BuChE (IC50 = 184 nmol/mL. Therefore, these two bulkier prodrugs were concluded to be the most selective compounds for BuChE over AChE. In conclusion, it was demonstrated that biguanides present a novel class of inhibitors for AChE and BuChE and encourages further studies of these compounds for developing both selective and nonselective inhibitors of ChEs in the future.

Inhibition of insulin-like growth factor-1 receptor signaling enhances growth-inhibitory and proapoptotic effects of gefitinib (Iressa) in human breast cancer cells

International Nuclear Information System (INIS)

Camirand, Anne; Zakikhani, Mahvash; Young, Fiona; Pollak, Michael

2005-01-01

Gefitinib (Iressa, ZD 1839, AstraZeneca) blocks the tyrosine kinase activity of the epidermal growth factor receptor (EGFR) and inhibits proliferation of several human cancer cell types including breast cancer. Phase II clinical trials with gefitinib monotherapy showed an objective response of 9 to 19% in non-small-cell lung cancer patients and less than 10% for breast cancer, and phase III results have indicated no benefit of gefitinib in combination with chemotherapy over chemotherapy alone. In order to improve the antineoplastic activity of gefitinib, we investigated the effects of blocking the signalling of the insulin-like growth factor 1 receptor (IGF-1R), a tyrosine kinase with a crucial role in malignancy that is coexpressed with EGFR in most human primary breast carcinomas. AG1024 (an inhibitor of IGF-1R) was used with gefitinib for treatment of MDA468, MDA231, SK-BR-3, and MCF-7 breast cancer lines, which express similar levels of IGF-1R but varying levels of EGFR. Proliferation assays, apoptosis induction studies, and Western blot analyses were conducted with cells treated with AG1024 and gefitinib as single agents and in combination. Gefitinib and AG1024 reduced proliferation in all lines when used as single agents, and when used in combination revealed an additive-to-synergistic effect on cell growth inhibition. Flow cytometry measurements of cells stained with annexin V-propidium iodide and cells stained for caspase-3 activation indicated that adding an IGF-1R-targeting strategy to gefitinib results in higher levels of apoptosis than are achieved with gefitinib alone. Gefitinib either reduced or completely inhibited p42/p44 Erk kinase phosphorylation, depending on the cell line, while Akt phosphorylation was reduced by a combination of the two agents. Overexpression of IGF-1R in SK-BR-3 cells was sufficient to cause a marked enhancement in gefitinib resistance. These results indicate that IGF-1R signaling reduces the antiproliferative effects of

Secretion of human epidermal growth factor (EGF) in autotrophic culture by a recombinant hydrogen-utilizing bacterium, Pseudomonas pseudoflava, carrying broad-host-range EGF secretion vector pKSEGF2.

OpenAIRE

Hayase, N; Ishiyama, A; Niwano, M

1994-01-01

We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...

Cardiac glycosides induce cell death in human cells by inhibiting general protein synthesis.

Directory of Open Access Journals (Sweden)

Andrea Perne

2009-12-01

Full Text Available Cardiac glycosides are Na(+/K(+-pump inhibitors widely used to treat heart failure. They are also highly cytotoxic, and studies have suggested specific anti-tumor activity leading to current clinical trials in cancer patients. However, a definitive demonstration of this putative anti-cancer activity and the underlying molecular mechanism has remained elusive.Using an unbiased transcriptomics approach, we found that cardiac glycosides inhibit general protein synthesis. Protein synthesis inhibition and cytotoxicity were not specific for cancer cells as they were observed in both primary and cancer cell lines. These effects were dependent on the Na(+/K(+-pump as they were rescued by expression of a cardiac glycoside-resistant Na(+/K(+-pump. Unlike human cells, rodent cells are largely resistant to cardiac glycosides in vitro and mice were found to tolerate extremely high levels.The physiological difference between human and mouse explains the previously observed sensitivity of human cancer cells in mouse xenograft experiments. Thus, published mouse xenograft models used to support anti-tumor activity for these drugs require reevaluation. Our finding that cardiac glycosides inhibit protein synthesis provides a mechanism for the cytotoxicity of CGs and raises concerns about ongoing clinical trials to test CGs as anti-cancer agents in humans.

Baicalein inhibits the migration and invasive properties of human hepatoma cells

International Nuclear Information System (INIS)

Chiu, Yung-Wei; Lin, Tseng-Hsi; Huang, Wen-Shih; Teng, Chun-Yuh; Liou, Yi-Sheng; Kuo, Wu-Hsien; Lin, Wea-Lung; Huang, Hai-I; Tung, Jai-Nien; Huang, Chih-Yang; Liu, Jer-Yuh; Wang, Wen-Hung; Hwang, Jin-Ming

2011-01-01

Flavonoids have been demonstrated to exert health benefits in humans. We investigated whether the flavonoid baicalein would inhibit the adhesion, migration, invasion, and growth of human hepatoma cell lines, and we also investigated its mechanism of action. The separate effects of baicalein and baicalin on the viability of HA22T/VGH and SK-Hep1 cells were investigated for 24 h. To evaluate their invasive properties, cells were incubated on matrigel-coated transwell membranes in the presence or absence of baicalein. We examined the effect of baicalein on the adhesion of cells, on the activation of matrix metalloproteinases (MMPs), protein kinase C (PKC), and p38 mitogen-activated protein kinase (MAPK), and on tumor growth in vivo. We observed that baicalein suppresses hepatoma cell growth by 55%, baicalein-treated cells showed lower levels of migration than untreated cells, and cell invasion was significantly reduced to 28%. Incubation of hepatoma cells with baicalein also significantly inhibited cell adhesion to matrigel, collagen I, and gelatin-coated substrate. Baicalein also decreased the gelatinolytic activities of the matrix metalloproteinases MMP-2, MMP-9, and uPA, decreased p50 and p65 nuclear translocation, and decreased phosphorylated I-kappa-B (IKB)-β. In addition, baicalein reduced the phosphorylation levels of PKCα and p38 proteins, which regulate invasion in poorly differentiated hepatoma cells. Finally, when SK-Hep1 cells were grown as xenografts in nude mice, intraperitoneal (i.p.) injection of baicalein induced a significant dose-dependent decrease in tumor growth. These results demonstrate the anticancer properties of baicalein, which include the inhibition of adhesion, invasion, migration, and proliferation of human hepatoma cells in vivo. - Highlight: → Baicalein inhibits several essential steps in the onset of metastasis.

Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles

International Nuclear Information System (INIS)

Teimoori, Salma; Seesuay, Watee; Jittavisutthikul, Surasak; Chaisri, Urai; Sookrung, Nitat; Densumite, Jaslan; Saelim, Nawannaporn; Chulanetra, Monrat; Maneewatch, Santi; Chaicumpa, Wanpen

2016-01-01

A direct acting anti-Ebola agent is needed. VP40, a conserved protein across Ebolavirus (EBOV) species has several pivotal roles in the virus life cycle. Inhibition of VP40 functions would lessen the virion integrity and interfere with the viral assembly, budding, and spread. In this study, cell penetrable human scFvs (HuscFvs) that bound to EBOV VP40 were produced by phage display technology. Gene sequences coding for VP40-bound-HuscFvs were subcloned from phagemids into protein expression plasmids downstream to a gene of cell penetrating peptide, i.e., nonaarginine (R9). By electron microscopy, transbodies from three clones effectively inhibited egress of the Ebola virus-like particles from human hepatic cells transduced with pseudo-typed-Lentivirus particles carrying EBOV VP40 and GP genes. Computerized simulation indicated that the effective HuscFvs bound to multiple basic residues in the cationic patch of VP40 C-terminal domain which are important in membrane-binding for viral matrix assembly and virus budding. The transbodies bound also to VP40 N-terminal domain and L domain peptide encompassed the PTAPPEY (WW binding) motif, suggesting that they might confer VP40 function inhibition through additional mechanism(s). The generated transbodies are worthwhile tested with authentic EBOV before developing to direct acting anti-Ebola agent for preclinical and clinical trials. - Highlights: • Cell penetrable human scFvs (transbodies) to Ebolavirus (EBOV) VP40 were produced. • The transbodies inhibited egress of EBOV-like particles (VLPs) from human hepatocytes. • They interacted with VP40 CTD basic residues important for plasma membrane binding. • And hence interfere with viral matrix assembly and viral progeny budding. • This is the first report on human antibodies that target intracellular EBOV VP40.

Inhibition of endogenous lactate turnover with lactate infusion in humans

International Nuclear Information System (INIS)

Searle, G.L.; Feingold, K.R.; Hsu, F.S.; Clark, O.H.; Gertz, E.W.; Stanley, W.C.

1989-01-01

The extent to which lactate infusion may inhibit endogenous lactate production, though previously considered, has never been critically assessed. To examine this proposition, single injection tracer methodology (U- 14 C Lactate) has been used for the estimation of lactate kinetics in 12 human subjects under basal conditions and with the infusion of sodium lactate. The basal rate of lactate turnover was measured on a day before the study with lactate infusion, and averaged 63.7 + 5.5 mg/kg/h. Six of these individuals received a stable lactate infusion at an approximate rate of 160 mg/kg/h, while the remaining six individuals were infused at the approximate rate of 100 mg/kg/h. It has been found that stable lactate infused at rates approximating 160 mg/kg/h consistently produced a complete inhibition of endogenous lactate production. Infusion of lactate at 100 mg/kg/h caused a lesser and more variable inhibition of endogenous lactate production (12% to 64%). In conclusion, lactate infusion significantly inhibits endogenous lactate production

Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

Science.gov (United States)

Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

2018-01-01

Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.

Science.gov (United States)

Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un

2008-09-01

Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.

Single-wall carbon nanohorns (SWNHs) inhibited proliferation of human glioma cells and promoted its apoptosis

Energy Technology Data Exchange (ETDEWEB)

Li, Yunjun [The Military General Hospital of Beijing PLA, Affiliated Bayi Brain Hospital (China); Zhang, Jinqian, E-mail: jingwanghou@yahoo.com.cn [Capital Medical University, Institute of Infectious Diseases, Beijing Ditan Hospital (China); Zhao, Ming [Peking University, Department of Chemical Biology, School of Pharmaceutical Sciences (China); Shi, Zujin [Peking University, Beijing National Laboratory for Molecular Sciences, State Key Laboratory of Rare Earth Materials Chemistry and Applications, College of Chemistry and Molecular Engineering (China); Chen, Xin; He, Xihui; Han, Nanyin, E-mail: jingwanghou@sina.com [Peking University, Department of Chemical Biology, School of Pharmaceutical Sciences (China); Xu, Ruxiang, E-mail: everbright999@163.com [The Military General Hospital of Beijing PLA, Affiliated Bayi Brain Hospital (China)

2013-08-15

Although single-wall carbon nanohorns (SWNHs) have been demonstrated to accumulate to cytotoxic levels within organs of various animal models and cell types, they have been exploited for cancer therapies. The role of SWNHs in human glioma cell lines was unclear. To address this question, the research about direct role of SWNHs on the growth, proliferation, and apoptosis of human glioma cell lines (U87, U251, and U373) had been performed. Our results indicate that particle size of SWNHs in water is between 342 and 712 nm, the films of SEM show that SWNHs on PS surface are individual particles. SWNHs significantly delayed mitotic entry of human glioma cell lines cells, and inhibited its proliferation in a time- and dose-dependent manner. SWNHs induced a significant increase in G1 phase and inhibition of S phase followed the gradually increasing concentrations. SWNHs in human glioma cell lines cells significantly induced apoptosis followed by their gradually increasing concentrations. The TEM images showed that individual spherical SWNHs particles smaller than 100 nm in diameters were localized inside lysosomes of human glioma cell lines. SWNHs inhibited mitotic entry, growth, and proliferation of human glioma cell lines, and promoted its apoptosis. SWNHs may be a novel opportunity or method for the research on treatment of human glioma.

Single-wall carbon nanohorns (SWNHs) inhibited proliferation of human glioma cells and promoted its apoptosis

Science.gov (United States)

Li, Yunjun; Zhang, Jinqian; Zhao, Ming; Shi, Zujin; Chen, Xin; He, Xihui; Han, Nanyin; Xu, Ruxiang

2013-08-01

Although single-wall carbon nanohorns (SWNHs) have been demonstrated to accumulate to cytotoxic levels within organs of various animal models and cell types, they have been exploited for cancer therapies. The role of SWNHs in human glioma cell lines was unclear. To address this question, the research about direct role of SWNHs on the growth, proliferation, and apoptosis of human glioma cell lines (U87, U251, and U373) had been performed. Our results indicate that particle size of SWNHs in water is between 342 and 712 nm, the films of SEM show that SWNHs on PS surface are individual particles. SWNHs significantly delayed mitotic entry of human glioma cell lines cells, and inhibited its proliferation in a time- and dose-dependent manner. SWNHs induced a significant increase in G1 phase and inhibition of S phase followed the gradually increasing concentrations. SWNHs in human glioma cell lines cells significantly induced apoptosis followed by their gradually increasing concentrations. The TEM images showed that individual spherical SWNHs particles smaller than 100 nm in diameters were localized inside lysosomes of human glioma cell lines. SWNHs inhibited mitotic entry, growth, and proliferation of human glioma cell lines, and promoted its apoptosis. SWNHs may be a novel opportunity or method for the research on treatment of human glioma.

Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

International Nuclear Information System (INIS)

Ansel, J.C.; Luger, T.A.; Green, I.

1983-01-01

Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

Inhibition of DNA repair in ultraviolet-irradiated human cells by hydroxyurea

International Nuclear Information System (INIS)

Francis, A.A.; Carrier, W.L.; Smith, D.P.; Regan, J.D.; Blevins, R.D.

1979-01-01

The effect on DNA repair in ultraviolet-irradiated human skin fibroblasts by hydroxyurea has been examined in this study using three independent methods for measuring DNA repair: the 5-bromodeoxyuridine photolysis assay which measures DNA repair replication, chromatographic measurement of thymine-containing dimers, and measurement of specific ultraviolet-endonuclease-sensitive sites in irradiated DNA. Little effect on hydroxyurea was observed at the concentration of 2mM, which is often used to inhibit semiconservative DNA synthesis; however, 10 mM hydroxyurea resulted in marked inhibition (65-70%) of excision repair. This inhibition was accompanied by a possible doubling in the size of the repaired region. The accumulation of large numbers of single-strand breaks following ultraviolet irradiation and hydroxyurea incubation seen by other investigators was not observed with the normal skin fibroblasts used in this study. A comparison of hydroxyurea effects on the different DNA repair assays indicates inhibition of one step in DNA repair also results in varying degrees of inhibition of other steps as well. (Auth.)

Inhibition of DNA repair in ultraviolet-irradiated human cells by hydroxyurea

Energy Technology Data Exchange (ETDEWEB)

Francis, A.A. (Oak Ridge National Lab., TN); Blevins, R.D.; Carrier, W.L.; Smith, D.P.; Regan, J.D.

1979-01-01

The effect on DNA repair in ultraviolet-irradiated human skin fibroblasts by hydroxyurea has been examined in this study using three independent methods for measuring DNA repair: the 5-bromodeoxyuridine photolysis assay which measures DNA repair replication, chromatographic measurement of thymine-containing dimers, and measurement of specific ultraviolet-endonuclease-sensitive sites in irradiated DNA. Little effect of hydroxyurea was observed at the concentration of 2 mM, which is often used to inhibit semiconservative DNA synthesis; however, 10 mM hydroxyurea resulted in marked inhibition (65 to 70%) of excision repair. This inhibition was accompanied by a possible doubling in the size of the repaired region. The accumulation of large numbers of single-strand breaks following ultraviolet irradiation and hydroxyurea incubation seen by other investigators was not observed with the normal skin fibroblasts used in this study. A comparison of hydroxyurea effects on the different DNA repair assays indicates inhibition of one step in DNA repair also results in varying degrees of inhibition of other steps as well.

A novel role of RASSF9 in maintaining epidermal homeostasis.

Directory of Open Access Journals (Sweden)

Chiou-Mei Lee

Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

Energy Technology Data Exchange (ETDEWEB)

Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)

2017-09-15

To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.

Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

International Nuclear Information System (INIS)

Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo

2017-01-01

To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers

Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

International Nuclear Information System (INIS)

Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana

2008-01-01

Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

Inhibition of fatty acid metabolism reduces human myeloma cells proliferation.

Directory of Open Access Journals (Sweden)

José Manuel Tirado-Vélez

Full Text Available Multiple myeloma is a haematological malignancy characterized by the clonal proliferation of plasma cells. It has been proposed that targeting cancer cell metabolism would provide a new selective anticancer therapeutic strategy. In this work, we tested the hypothesis that inhibition of β-oxidation and de novo fatty acid synthesis would reduce cell proliferation in human myeloma cells. We evaluated the effect of etomoxir and orlistat on fatty acid metabolism, glucose metabolism, cell cycle distribution, proliferation, cell death and expression of G1/S phase regulatory proteins in myeloma cells. Etomoxir and orlistat inhibited β-oxidation and de novo fatty acid synthesis respectively in myeloma cells, without altering significantly glucose metabolism. These effects were associated with reduced cell viability and cell cycle arrest in G0/G1. Specifically, etomoxir and orlistat reduced by 40-70% myeloma cells proliferation. The combination of etomoxir and orlistat resulted in an additive inhibitory effect on cell proliferation. Orlistat induced apoptosis and sensitized RPMI-8226 cells to apoptosis induction by bortezomib, whereas apoptosis was not altered by etomoxir. Finally, the inhibitory effect of both drugs on cell proliferation was associated with reduced p21 protein levels and phosphorylation levels of retinoblastoma protein. In conclusion, inhibition of fatty acid metabolism represents a potential therapeutic approach to treat human multiple myeloma.

Epidermal Growth Factor Enhances Cellular Uptake of Polystyrene Nanoparticles by Clathrin-Mediated Endocytosis.

Science.gov (United States)

Phuc, Le Thi Minh; Taniguchi, Akiyoshi

2017-06-19

The interaction between nanoparticles and cells has been studied extensively, but most research has focused on the effect of various nanoparticle characteristics, such as size, morphology, and surface charge, on the cellular uptake of nanoparticles. In contrast, there have been very few studies to assess the influence of cellular factors, such as growth factor responses, on the cellular uptake efficiency of nanoparticles. The aim of this study was to clarify the effects of epidermal growth factor (EGF) on the uptake efficiency of polystyrene nanoparticles (PS NPs) by A431 cells, a human carcinoma epithelial cell line. The results showed that EGF enhanced the uptake efficiency of A431 cells for PS NPs. In addition, inhibition and localization studies of PS NPs and EGF receptors (EGFRs) indicated that cellular uptake of PS NPs is related to the binding of EGF-EGFR complex and PS NPs. Different pathways are used to enter the cells depending on the presence or absence of EGF. In the presence of EGF, cellular uptake of PS NPs is via clathrin-mediated endocytosis, whereas, in the absence of EGF, uptake of PS NPs does not involve clathrin-mediated endocytosis. Our findings indicate that EGF enhances cellular uptake of PS NPs by clathrin-mediated endocytosis. This result could be important for developing safe nanoparticles and their safe use in medical applications.

Epidermal Growth Factor Enhances Cellular Uptake of Polystyrene Nanoparticles by Clathrin-Mediated Endocytosis

Directory of Open Access Journals (Sweden)

Le Thi Minh Phuc

2017-06-01

Full Text Available The interaction between nanoparticles and cells has been studied extensively, but most research has focused on the effect of various nanoparticle characteristics, such as size, morphology, and surface charge, on the cellular uptake of nanoparticles. In contrast, there have been very few studies to assess the influence of cellular factors, such as growth factor responses, on the cellular uptake efficiency of nanoparticles. The aim of this study was to clarify the effects of epidermal growth factor (EGF on the uptake efficiency of polystyrene nanoparticles (PS NPs by A431 cells, a human carcinoma epithelial cell line. The results showed that EGF enhanced the uptake efficiency of A431 cells for PS NPs. In addition, inhibition and localization studies of PS NPs and EGF receptors (EGFRs indicated that cellular uptake of PS NPs is related to the binding of EGF–EGFR complex and PS NPs. Different pathways are used to enter the cells depending on the presence or absence of EGF. In the presence of EGF, cellular uptake of PS NPs is via clathrin-mediated endocytosis, whereas, in the absence of EGF, uptake of PS NPs does not involve clathrin-mediated endocytosis. Our findings indicate that EGF enhances cellular uptake of PS NPs by clathrin-mediated endocytosis. This result could be important for developing safe nanoparticles and their safe use in medical applications.

Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

Directory of Open Access Journals (Sweden)

Kazuhiko Arima

2015-01-01

Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

Directory of Open Access Journals (Sweden)

Yanase Toshihiko

2010-06-01

Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

Inhibition of human anthracycline reductases by emodin — A possible remedy for anthracycline resistance

Energy Technology Data Exchange (ETDEWEB)

Hintzpeter, Jan, E-mail: hintzpeter@toxi.uni-kiel.de [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany); Seliger, Jan Moritz [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany); Hofman, Jakub [Department of Biochemical Sciences, Faculty of Pharmacy in Hradec Kralove, Charles University in Prague, Heyrovskeho 1203, 50005 Hradec Kralove (Czech Republic); Martin, Hans-Joerg [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany); Wsol, Vladimir [Department of Biochemical Sciences, Faculty of Pharmacy in Hradec Kralove, Charles University in Prague, Heyrovskeho 1203, 50005 Hradec Kralove (Czech Republic); Maser, Edmund [Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, 24105 Kiel (Germany)

2016-02-15

The clinical application of anthracyclines, like daunorubicin and doxorubicin, is limited by two factors: dose-related cardiotoxicity and drug resistance. Both have been linked to reductive metabolism of the parent drug to their metabolites daunorubicinol and doxorubicinol, respectively. These metabolites show significantly less anti-neoplastic properties as their parent drugs and accumulate in cardiac tissue leading to chronic cardiotoxicity. Therefore, we aimed to identify novel and potent natural inhibitors for anthracycline reductases, which enhance the anticancer effect of anthracyclines by preventing the development of anthracycline resistance. Human enzymes responsible for the reductive metabolism of daunorubicin were tested for their sensitivity towards anthrachinones, in particular emodin and anthraflavic acid. Intense inhibition kinetic data for the most effective daunorubicin reductases, including IC{sub 50}- and K{sub i}-values, the mode of inhibition, as well as molecular docking, were compiled. Subsequently, a cytotoxicity profile and the ability of emodin to reverse daunorubicin resistance were determined using multiresistant A549 lung cancer and HepG2 liver cancer cells. Emodin potently inhibited the four main human daunorubicin reductases in vitro. Further, we could demonstrate that emodin is able to synergistically sensitize human cancer cells towards daunorubicin at clinically relevant concentrations. Therefore, emodin may yield the potential to enhance the therapeutic effectiveness of anthracyclines by preventing anthracycline resistance via inhibition of the anthracycline reductases. In symphony with its known pharmacological properties, emodin might be a compound of particular interest in the management of anthracycline chemotherapy efficacy and their adverse effects. - Highlights: • Natural and synthetic compounds were identified as inhibitors for human daunorubicin reductases. • Emodin is a potent inhibitor for human daunorubicin

Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

International Nuclear Information System (INIS)

Taichman, L.B.; Setlow, R.B.

1979-01-01

Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

Tyrphostin AG1478 Inhibits Encephalomyocarditis Virus and Hepatitis C Virus by Targeting Phosphatidylinositol 4-Kinase IIIα

NARCIS (Netherlands)

Dorobantu, Cristina M.; Harak, Christian; Klein, Rahel; van der Linden, Lonneke; Strating, Jeroen R. P. M.; van der Schaar, Hilde M.; Lohmann, Volker; van Kuppeveld, Frank J. M.

2016-01-01

Encephalomyocarditis virus (EMCV), like hepatitis C virus (HCV), requires phosphatidylinositol 4-kinase IIIα (PI4KA) for genome replication. Here, we demonstrate that tyrphostin AG1478, a known epidermal growth factor receptor (EGFR) inhibitor, also inhibits PI4KA activity, both in vitro and in

A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

Directory of Open Access Journals (Sweden)

Jihene Elloumi-Mseddi

2014-01-01

Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

An Epidermal Biosensor for Carcinoembryonic Antigen

National Research Council Canada - National Science Library

Schwartz, Pauline

2001-01-01

...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

Characterization of a receptor for human monocyte-derived neutrophil chemotactic factor/interleukin-8

International Nuclear Information System (INIS)

Grob, P.M.; David, E.; Warren, T.C.; DeLeon, R.P.; Farina, P.R.; Homon, C.A.

1990-01-01

Monocyte-derived neutrophil chemotactic factor/interleukin-8 (MDNCF/IL-8) is an 8,000-dalton protein produced by monocytes which exhibits activity as a chemoattractant for neutrophils with maximal activity achieved at a concentration of 50 ng/ml. This polypeptide has been iodinated by chloramine-T methodology (350 Ci/mM), and specific receptors for MDNCF/IL-8 have been detected on human neutrophils, U937 cells, THP-1 cells, and dimethyl sulfoxide-differentiated HL-60 cells. The binding of MDNCF/IL-8 to human neutrophils is not inhibited by interleukin-1 alpha, tumor necrosis factor-alpha, insulin, or epidermal growth factor. In addition, chemoattractants such as C5a, fMet-Leu-Phe, leukotriene B4, and platelet-activating factor fail to inhibit binding, suggesting that MDNCF/IL-8 utilizes a unique receptor. The receptor for MDNCF/IL-8 is apparently glycosylated since ligand binding is inhibited by the presence of wheat germ agglutinin, a lectin with a binding specificity for N-acetylglucosamine and neuraminic acid. Steady state binding experiments indicate Kd values of 4 and 0.5 nM and receptor numbers of 75,000 and 7,400 for human neutrophils and differentiated HL-60 cells, respectively. 125I-MDNCF/IL-8 bound to human neutrophils is rapidly internalized and subsequently released from cells as trichloroacetic acid-soluble radioactivity. Affinity labeling experiments suggest that the human neutrophil MDNCF/IL-8 receptor exhibits a mass of approximately 58,000 daltons

Epidermal growth factor receptor mediated proliferation depends on increased lipid droplet density regulated via a negative regulatory loop with FOXO3/Sirtuin6

Energy Technology Data Exchange (ETDEWEB)

Penrose, Harrison; Heller, Sandra; Cable, Chloe [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Makboul, Rania [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Pathology Department, Assiut University, Assiut (Egypt); Chadalawada, Gita; Chen, Ying [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States); Crawford, Susan E. [Department of Pathology, Saint Louis University School of Medicine, 1402 South Grand Blvd, Saint Louis, MO 63104 (United States); Savkovic, Suzana D., E-mail: ssavkovi@tulane.edu [Department of Pathology and Laboratory Medicine, Tulane University School of Medicine, 1430 Tulane Ave SL-79, New Orleans, LA 70112 (United States)

2016-01-15

The proliferation of colon cancer cells is mediated in part by epidermal growth factor receptor (EGFR) signaling and requires sustained levels of cellular energy to meet its high metabolic needs. Intracellular lipid droplets (LDs) are a source of energy used for various cellular functions and they are elevated in density in human cancer, yet their regulation and function are not well understood. Here, in human colon cancer cells, EGF stimulates increases in LD density, which depends on EGFR expression and activation as well as the individual cellular capacity for lipid synthesis. Increases in LDs are blockaded by inhibition of PI3K/mTOR and PGE2 synthesis, supporting their dependency on select upstream pathways. In colon cancer cells, silencing of the FOXO3 transcription factor leads to down regulation of SIRT6, a negative regulator of lipid synthesis, and consequent increases in the LD coat protein PLIN2, revealing that increases in LDs depend on loss of FOXO3/SIRT6. Moreover, EGF stimulates loss of FOXO3/SIRT6, which is blockaded by the inhibition of upstream pathways as well as lipid synthesis, revealing existence of a negative regulatory loop between LDs and FOXO3/SIRT6. Elevated LDs are utilized by EGF treatment and their depletion through the inhibition of lipid synthesis or silencing of PLIN2 significantly attenuates proliferation. This novel mechanism of proliferative EGFR signaling leading to elevated LD density in colon cancer cells could potentially be therapeutically targeted for the treatment of tumor progression. - Highlights: • In colon cancer cells, EGFR activation leads to increases in LD density. • EGFR signaling includes PI3K/mTOR and PGE2 leading to lipid synthesis. • Increases in LDs are controlled by a negative regulatory loop with FOXO3/SIRT6. • EGFR mediated colon cancer cell proliferation depends on increased LD density.

Epidermal growth factor receptor mediated proliferation depends on increased lipid droplet density regulated via a negative regulatory loop with FOXO3/Sirtuin6

International Nuclear Information System (INIS)

Penrose, Harrison; Heller, Sandra; Cable, Chloe; Makboul, Rania; Chadalawada, Gita; Chen, Ying; Crawford, Susan E.; Savkovic, Suzana D.

2016-01-01

The proliferation of colon cancer cells is mediated in part by epidermal growth factor receptor (EGFR) signaling and requires sustained levels of cellular energy to meet its high metabolic needs. Intracellular lipid droplets (LDs) are a source of energy used for various cellular functions and they are elevated in density in human cancer, yet their regulation and function are not well understood. Here, in human colon cancer cells, EGF stimulates increases in LD density, which depends on EGFR expression and activation as well as the individual cellular capacity for lipid synthesis. Increases in LDs are blockaded by inhibition of PI3K/mTOR and PGE2 synthesis, supporting their dependency on select upstream pathways. In colon cancer cells, silencing of the FOXO3 transcription factor leads to down regulation of SIRT6, a negative regulator of lipid synthesis, and consequent increases in the LD coat protein PLIN2, revealing that increases in LDs depend on loss of FOXO3/SIRT6. Moreover, EGF stimulates loss of FOXO3/SIRT6, which is blockaded by the inhibition of upstream pathways as well as lipid synthesis, revealing existence of a negative regulatory loop between LDs and FOXO3/SIRT6. Elevated LDs are utilized by EGF treatment and their depletion through the inhibition of lipid synthesis or silencing of PLIN2 significantly attenuates proliferation. This novel mechanism of proliferative EGFR signaling leading to elevated LD density in colon cancer cells could potentially be therapeutically targeted for the treatment of tumor progression. - Highlights: • In colon cancer cells, EGFR activation leads to increases in LD density. • EGFR signaling includes PI3K/mTOR and PGE2 leading to lipid synthesis. • Increases in LDs are controlled by a negative regulatory loop with FOXO3/SIRT6. • EGFR mediated colon cancer cell proliferation depends on increased LD density.

Tumor necrosis factor-alpha inhibits differentiation of myogenic cells in human urethral rhabdosphincter.

Science.gov (United States)

Shinohara, Mayuka; Sumino, Yasuhiro; Sato, Fuminori; Kiyono, Tohru; Hashimoto, Naohiro; Mimata, Hiromitsu

2017-06-01

To examine the inhibitory effects of tumor necrosis factor-α on myogenic differentiation of human urethral rhabdosphincter cells. A rhabdosphincter sample was obtained from a patient who underwent total cystectomy. To expand the lifespan of the primary cultured cells, rhabdosphincter myogenic cells were immortalized with mutated cyclin-dependent kinase 4, cyclin D1 and telomerase. The differential potential of the cells was investigated. The transfected human rhabdosphincter cells were induced for myogenic differentiation with recombinant human tumor necrosis factor-α and/or the tumor necrosis factor-α antagonist etanercept at different concentrations, and activation of signaling pathways was monitored. Human rhabdosphincter cells were selectively cultured for at least 40 passages. Molecular analysis confirmed the expression of myosin heavy chain, which is a specific marker of differentiated muscle cells, significantly increased after differentiation induction. Although tumor necrosis factor-α treatment reduced the myosin heavy chain expression in a concentration-dependent manner, etanercept inhibited this suppression. Tumor necrosis factor-α suppressed phosphorylation of protein kinase B and p38, whereas etanercept pretreatment promoted phosphorylation and myosin heavy chain expression in a concentration-dependent manner. Tumor necrosis factor-α inhibits differentiation of urethral rhabdosphincter cells in part through the p38 mitogen-activated protein kinase and phosphoinositide 3-kinase pathways. Inhibition of tumor necrosis factor-α might be a useful strategy to treat stress urinary incontinence. © 2017 The Japanese Urological Association.

The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology

DEFF Research Database (Denmark)

Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J

2017-01-01

The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....

Optimal allocation of leaf epidermal area for gas exchange

OpenAIRE

de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.

2016-01-01

Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...

An Epidermal Biosensor for Carcinoembryonic Antigen

National Research Council Canada - National Science Library

Schwartz, Pauline

2003-01-01

...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

Inhibition of Neoplastic Transformation and Chemically-Induced Skin Hyperplasia in Mice by Traditional Chinese Medicinal Formula Si-Wu-Tang

Directory of Open Access Journals (Sweden)

Mandy M. Liu

2017-03-01

Full Text Available Exploring traditional medicines may lead to the development of low-cost and non-toxic cancer preventive agents. Si-Wu-Tang (SWT, comprising the combination of four herbs, Rehmanniae, Angelica, Chuanxiong, and Paeoniae, is one of the most popular traditional Chinese medicines for women’s diseases. In our previous studies, the antioxidant Nrf2 pathways were strongly induced by SWT in vitro and in vivo. Since Nrf2 activation has been associated with anticarcinogenic effects, the purpose of this study is to evaluate SWT’s activity of cancer prevention. In the Ames test, SWT demonstrated an antimutagenic activity against mutagenicity induced by the chemical carcinogen 7,12-dimethylbenz(aanthracene (DMBA. In JB6 P+ cells, a non-cancerous murine epidermal model for studying tumor promotion, SWT inhibited epidermal growth factor (EGF-induced neoplastic transformation. The luciferase reporter gene assays demonstrated that SWT suppressed EGF-induced AP-1 and TNF-α-induced NF-κB activation, which are essential factors involved in skin carcinogenesis. In a DMBA-induced skin hyperplasia assay in ‘Sensitivity to Carcinogenesis’ (SENCAR mice, both topical and oral SWT inhibited DMBA-induced epidermal hyperplasia, expression of the proliferation marker Proliferating cell nuclear antigen (PCNA, and H-ras mutations. These findings demonstrate, for the first time, that SWT prevents tumor promoter and chemical-induced carcinogenesis in vitro and in vivo, partly by inhibiting DNA damage and blocking the activation of AP-1 and NF-κB.

Inhibition of nuclear factor-kappa B activation decreases survival of Mycobacterium tuberculosis in human macrophages.

Directory of Open Access Journals (Sweden)

Xiyuan Bai

Full Text Available Nuclear factor-kappa B (NFκB is a ubiquitous transcription factor that mediates pro-inflammatory responses required for host control of many microbial pathogens; on the other hand, NFκB has been implicated in the pathogenesis of other inflammatory and infectious diseases. Mice with genetic disruption of the p50 subunit of NFκB are more likely to succumb to Mycobacterium tuberculosis (MTB. However, the role of NFκB in host defense in humans is not fully understood. We sought to examine the role of NFκB activation in the immune response of human macrophages to MTB. Targeted pharmacologic inhibition of NFκB activation using BAY 11-7082 (BAY, an inhibitor of IκBα kinase or an adenovirus construct with a dominant-negative IκBα significantly decreased the number of viable intracellular mycobacteria recovered from THP-1 macrophages four and eight days after infection. The results with BAY were confirmed in primary human monocyte-derived macrophages and alveolar macrophages. NFκB inhibition was associated with increased macrophage apoptosis and autophagy, which are well-established killing mechanisms of intracellular MTB. Inhibition of the executioner protease caspase-3 or of the autophagic pathway significantly abrogated the effects of BAY. We conclude that NFκB inhibition decreases viability of intracellular MTB in human macrophages via induction of apoptosis and autophagy.

Comparative sensitivity of human and rat neural cultures to chemical-induced inhibition of neurite outgrowth

Energy Technology Data Exchange (ETDEWEB)

Harrill, Joshua A.; Freudenrich, Theresa M.; Robinette, Brian L.; Mundy, William R., E-mail: mundy.william@epa.gov

2011-11-15

There is a need for rapid, efficient and cost-effective alternatives to traditional in vivo developmental neurotoxicity testing. In vitro cell culture models can recapitulate many of the key cellular processes of nervous system development, including neurite outgrowth, and may be used as screening tools to identify potential developmental neurotoxicants. The present study compared primary rat cortical cultures and human embryonic stem cell-derived neural cultures in terms of: 1) reproducibility of high content image analysis based neurite outgrowth measurements, 2) dynamic range of neurite outgrowth measurements and 3) sensitivity to chemicals which have been shown to inhibit neurite outgrowth. There was a large increase in neurite outgrowth between 2 and 24 h in both rat and human cultures. Image analysis data collected across multiple cultures demonstrated that neurite outgrowth measurements in rat cortical cultures were more reproducible and had higher dynamic range as compared to human neural cultures. Human neural cultures were more sensitive than rat cortical cultures to chemicals previously shown to inhibit neurite outgrowth. Parallel analysis of morphological (neurite count, neurite length) and cytotoxicity (neurons per field) measurements were used to detect selective effects on neurite outgrowth. All chemicals which inhibited neurite outgrowth in rat cortical cultures did so at concentrations which did not concurrently affect the number of neurons per field, indicating selective effects on neurite outgrowth. In contrast, more than half the chemicals which inhibited neurite outgrowth in human neural cultures did so at concentrations which concurrently decreased the number of neurons per field, indicating that effects on neurite outgrowth were secondary to cytotoxicity. Overall, these data demonstrate that the culture models performed differently in terms of reproducibility, dynamic range and sensitivity to neurite outgrowth inhibitors. While human neural

Comparative sensitivity of human and rat neural cultures to chemical-induced inhibition of neurite outgrowth

International Nuclear Information System (INIS)

Harrill, Joshua A.; Freudenrich, Theresa M.; Robinette, Brian L.; Mundy, William R.

2011-01-01

There is a need for rapid, efficient and cost-effective alternatives to traditional in vivo developmental neurotoxicity testing. In vitro cell culture models can recapitulate many of the key cellular processes of nervous system development, including neurite outgrowth, and may be used as screening tools to identify potential developmental neurotoxicants. The present study compared primary rat cortical cultures and human embryonic stem cell-derived neural cultures in terms of: 1) reproducibility of high content image analysis based neurite outgrowth measurements, 2) dynamic range of neurite outgrowth measurements and 3) sensitivity to chemicals which have been shown to inhibit neurite outgrowth. There was a large increase in neurite outgrowth between 2 and 24 h in both rat and human cultures. Image analysis data collected across multiple cultures demonstrated that neurite outgrowth measurements in rat cortical cultures were more reproducible and had higher dynamic range as compared to human neural cultures. Human neural cultures were more sensitive than rat cortical cultures to chemicals previously shown to inhibit neurite outgrowth. Parallel analysis of morphological (neurite count, neurite length) and cytotoxicity (neurons per field) measurements were used to detect selective effects on neurite outgrowth. All chemicals which inhibited neurite outgrowth in rat cortical cultures did so at concentrations which did not concurrently affect the number of neurons per field, indicating selective effects on neurite outgrowth. In contrast, more than half the chemicals which inhibited neurite outgrowth in human neural cultures did so at concentrations which concurrently decreased the number of neurons per field, indicating that effects on neurite outgrowth were secondary to cytotoxicity. Overall, these data demonstrate that the culture models performed differently in terms of reproducibility, dynamic range and sensitivity to neurite outgrowth inhibitors. While human neural

[4-t-butylphenyl]-N-(4-imidazol-1-yl phenyl)sulfonamide (ISCK03) inhibits SCF/c-kit signaling in 501mel human melanoma cells and abolishes melanin production in mice and brownish guinea pigs.

Science.gov (United States)

Na, Yong Joo; Baek, Heung Su; Ahn, Soo Mi; Shin, Hyun Jung; Chang, Ih-Seop; Hwang, Jae Sung

2007-09-01

It is well known that c-kit is related to pigmentation as well as to the oncology target protein. The objective of this study was to discover a skin-whitening agent that regulates c-kit activity. We have developed a high-throughput screening system using recombinant human c-kit protein. Approximately 10,000 synthetic compounds were screened for their effect on c-kit activity. Phenyl-imidazole sulfonamide derivatives showed inhibitory activity on c-kit phosphorylation in vitro. The effects of one derivative, [4-t-butylphenyl]-N-(4-imidazol-1-yl phenyl)sulfonamide (ISCK03), on stem-cell factor (SCF)/c-kit cellular signaling in 501mel human melanoma cells were examined further. Pretreatment of 501mel cells with ISCK03 inhibited SCF-induced c-kit phosphorylation dose dependently. ISCK03 also inhibited p44/42 ERK mitogen-activated protein kinase (MAPK) phosphorylation, which is known to be involved in SCF/c-kit downstream signaling. However ISCK03 did not inhibit hepatocyte growth factor (HGF)-induced phosphorylation of p44/42 ERK proteins. To determine the in vivo potency of ISCK03, it was orally administered to depilated C57BL/6 mice. Interestingly, oral administration of ISCK03 induced the dose-dependent depigmentation of newly regrown hair, and this was reversed with cessation of ISCK03 treatment. Finally, to investigate whether the inhibitory effect of ISCK03 on SCF/c-kit signaling abolished UV-induced pigmentation, ISCK03 was applied to UV-induced pigmented spots on brownish guinea pig skin. The topical application of ISCK03 promoted the depigmentation of UV-induced hyperpigmented spots. Fontana-Masson staining analysis showed epidermal melanin was diminished in spots treated with ISCK03. These results indicate that phenyl-imidazole sulfonamide derivatives are potent c-kit inhibitors and might be used as skin-whitening agents.

Potent inhibition of human neutrophil activations by bractelactone, a novel chalcone from Fissistigma bracteolatum

Energy Technology Data Exchange (ETDEWEB)

Wu, Yang-Chang [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Graduate Institute of Integrated Medicine, College of Chinese Medicine, China Medical University, Taichung 404, Taiwan (China); Sureshbabu, Munisamy; Fang, Yao-Ching; Wu, Yi-Hsiu [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Lan, Yu-Hsuan [School of Pharmacy, China Medical University, Taichung 404, Taiwan (China); Chang, Fang-Rong [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Chang, Ya-Wen [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Hwang, Tsong-Long, E-mail: htl@mail.cgu.edu.tw [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chinese Herbal Medicine Research Team, Healthy Aging Research Center, Chang Gung University, Kweishan, Taoyuan 333, Taiwan (China)

2013-02-01

Fissistigma bracteolatum is widely used in traditional medicine to treat inflammatory diseases. However, its active components and mechanisms of action remain unclear. In this study, (3Z)-6,7-dihydroxy-4-methoxy-3-(phenylmethylidene)-5-(3-phenylpropanoyl) -1-benzofuran-2(3H) (bractelactone), a novel chalcone from F. bracteolatum, showed potent inhibitory effects against superoxide anion (O{sub 2}{sup ·−}) production, elastase release, and CD11b expression in formyl-L-methionyl-L-leucyl-L-phenylalanine (FMLP)-induced human neutrophils. However, bractelactone showed only weak inhibition of phorbol myristate acetate-caused O{sub 2}{sup ·−} production. The peak cytosolic calcium concentration ([Ca{sup 2+}]{sub i}) was unaltered by bractelactone in FMLP-induced neutrophils, but the decay time of [Ca{sup 2+}]{sub i} was significantly shortened. In a calcium-free solution, changes in [Ca{sup 2+}]{sub i} caused by the addition of extracellular Ca{sup 2+} were inhibited by bractelactone in FMLP-activated cells. In addition, bractelactone did not alter the phosphorylation of p38 MAPK, ERK, JNK, or AKT or the concentration of cAMP. These results suggest that bractelactone selectively inhibits store-operated calcium entry (SOCE). In agreement with this concept, bractelactone suppressed sustained [Ca{sup 2+}]{sub i} changes in thapsigargin-activated neutrophils. Furthermore, bractelactone did not alter FMLP-induced formation of inositol 1,4,5-triphosphate. Taken together, our results demonstrate that the anti-inflammatory effects of bractelactone, an active ingredient of F. bracteolatum, in human neutrophils are through the selective inhibition of SOCE. Highlights: ► Bractelactone isolated from Fissistigma bracteolatum. ► Bractelactone inhibited FMLP-induced human neutrophil activations. ► Bractelactone had no effect on IP3 formation. ► Bractelactone did not alter MAPKs, AKT, and cAMP pathways. ► Bractelactone inhibited store-operated calcium entry.

Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

Science.gov (United States)

Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

2014-01-01

Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

Directory of Open Access Journals (Sweden)

Sarah Papiorek

Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

Epidermal growth factor inhibits rat pancreatic cell proliferation, causes acinar cell hypertrophy, and prevents caerulein-induced desensitization of amylase release.

Science.gov (United States)

Morisset, J; Larose, L; Korc, M

1989-06-01

The in vivo effects of epidermal growth factor (EGF) on pancreatic growth and digestive enzyme concentrations were compared with the actions of the pancreatic secretagogue caerulein in the adult rat. EGF (10 micrograms/kg BW) did not alter pancreatic weight or protein content. However, this concentration of EGF inhibited [3H]thymidine incorporation into DNA by 44%, decreased DNA content by 20%, and increased the concentrations of amylase, chymotrypsinogen, and protein by 106%, 232%, and 42%, respectively. Pancreatic acini prepared from EGF-treated rats exhibited a characteristic secretory response to caerulein that was superimposable to that obtained in acini from saline-treated rats. In both groups of acini half-maximal and maximal stimulation of amylase release occurred at approximately 5 pM and 50 pM caerulein, respectively. In contrast to EGF, caerulein (1 microgram/kg BW) increased pancreatic weight by 29% and protein content by 59%, and enhanced [3H]thymidine incorporation into DNA by 70%. Although caerulein increased the concentrations of pancreatic amylase and chymotrypsinogen by 38% and 297%, respectively, pancreatic acini prepared from caerulein-treated rats were less sensitive to the actions of caerulein in vitro when compared with acini from control rats. Indeed, the EC50 was shift from 4.8 pM to 9.8 pM after 4 days of treatment. EGF potentiated the actions of caerulein on pancreatic weight, protein content, and chymotrypsinogen concentration, and prevented the caerulein-induced alteration in the secretory responsiveness of the acinar cell. Conversely, caerulein reversed the inhibitory effect of EGF on thymidine incorporation. These findings suggest that EGF may modulate the trophic effects of certain gastrointestinal hormones, and may participate in the regulation of pancreatic exocrine function in vivo.

Mechanisms of inhibition of DNA replication by ultraviolet light in normal human and xeroderma pigmentosum fibroblasts

International Nuclear Information System (INIS)

Kaufmann, W.K.; Cleaver, J.E.

1981-01-01

The inhibition of DNA replication in ultraviolet-irradiated human fibroblasts was characterized by quantitative analysis of radiation-induced alterations in the steady-state distribution of sizes of pulse-labeled, nascent DNA. Low, noncytotoxic fluences rapidly produced an inhibition of DNA synthesis in half-replicon-size replication intermediates. With time, the inhibition produced by low fluences spread progressively to include multi-replicon-size intermediates. The results indicate that ultraviolet radiation inhibits the initiation of DNA synthesis in replicons. Higher cytotoxic fluences inhibited DNA synthesis in operating replicons. Xeroderma pigmentosum fibroblasts with deficiencies in DNA excision repair exhibited an inhibition of replicon initiation after low radiation fluences, indicating the effect was not solely dependent upon operation of the nucleotidyl excision repair pathway. Owing to their inability to remove pyrimidine dimers ahead of DNA growing points, the repair-deficient cells also were more sensitive than normal cells to the ultraviolet-induced inhibition of chain elongation. Xeroderma pigmentosum cells belonging to the variant class were even more sensitive to inhibition of chain elongation despite their ability to remove pyrimidine dimers. The analysis suggested that normal and repair-deficient human fibroblasts either are able to rapidly bypass certain dimers or these dimers are not recognized by the chain elongation machinery. (author)

Estrogen receptor beta signaling inhibits PDGF induced human airway smooth muscle proliferation.

Science.gov (United States)

Ambhore, Nilesh Sudhakar; Katragadda, Rathnavali; Raju Kalidhindi, Rama Satyanarayana; Thompson, Michael A; Pabelick, Christina M; Prakash, Y S; Sathish, Venkatachalem

2018-04-20

Airway smooth muscle (ASM) cell hyperplasia driven by persistent inflammation is a hallmark feature of remodeling in asthma. Sex steroid signaling in the lungs is of considerable interest, given epidemiological data showing more asthma in pre-menopausal women and aging men. Our previous studies demonstrated that estrogen receptor (ER) expression increases in asthmatic human ASM; however, very limited data are available regarding differential roles of ERα vs. ERβ isoforms in human ASM cell proliferation. In this study, we evaluated the effect of selective ERα and ERβ modulators on platelet-derived growth factor (PDGF)-stimulated ASM proliferation and the mechanisms involved. Asthmatic and non-asthmatic primary human ASM cells were treated with PDGF, 17β-estradiol, ERα-agonist and/or ERβ-agonist and/or G-protein-coupled estrogen receptor 30 (GPR30/GPER) agonist and proliferation was measured using MTT and CyQuant assays followed by cell cycle analysis. Transfection of small interfering RNA (siRNA) ERα and ERβ significantly altered the human ASM proliferation. The specificity of siRNA transfection was confirmed by Western blot analysis. Gene and protein expression of cell cycle-related antigens (PCNA and Ki67) and C/EBP were measured by RT-PCR and Western analysis, along with cell signaling proteins. PDGF significantly increased ASM proliferation in non-asthmatic and asthmatic cells. Treatment with PPT showed no significant effect on PDGF-induced proliferation, whereas WAY interestingly suppressed proliferation via inhibition of ERK1/2, Akt, and p38 signaling. PDGF-induced gene expression of PCNA, Ki67 and C/EBP in human ASM was significantly lower in cells pre-treated with WAY. Furthermore, WAY also inhibited PDGF-activated PCNA, C/EBP, cyclin-D1, and cyclin-E. Overall, we demonstrate ER isoform-specific signaling in the context of ASM proliferation. Activation of ERβ can diminish remodeling in human ASM by inhibiting pro-proliferative signaling pathways

Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

International Nuclear Information System (INIS)

Gradishar, William J

2016-01-01

Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed

Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

Directory of Open Access Journals (Sweden)

Kyounghwan Lee

2015-04-01

Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

Proteinases of human epidermis; a possible mechanism for polymorphonuclear leukocyte chemotaxis

Energy Technology Data Exchange (ETDEWEB)

Levine, N; Hatcher, V B; Lazarus, G S [Albert Einstein Coll. of Medicine, Bronx, N.Y. (USA); Montefiore Hospital, New York (USA); Duke Univ., Durham, N.C. (USA))

1976-12-08

Three neutral proteinases (EC 3.4.-,-) and cathepsin D have been identified in human epidermis utilizing a highly sensitive radioactive method. The proteinases were extracted in 1.0 M KCl and 0.1% Triton X-100 and separated by Sephadex G-75 chromatography. The neutral proteinase peaks were all inhibited by diisopropyl fluorophosphate and thus were serine proteinases. Incubation of the enzyme fractions with (/sup 3/H)diisopropyl fluorophosphate followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that the two larger molecular weight proteinases were enzyme mixtures. The small molecular weight (/sup 3/H)diisopropyl fluorophosphate proteinase migrated as a single band. Injection of the small molecular weight neutral proteinase into rabbit skin produced a polymorphonuclear leukocyte infiltration and edema. The reaction was not observed with the diisopropul fluorophosphate-inhibited enzyme fraction. The release of neutral proteinases may be one of the signal events in the epidermal inflammatory response.

Inhibition of histamine and eicosanoid release from dispersed human lung cells in vitro by quinotolast.

Science.gov (United States)

Okayama, Y; Hiroi, J; Lau, L C; Church, M K

1995-12-01

We have examined the effects of a new anti-allergic drug, quinotolast [sodium 5-(4-oxo-1-phenoxy-4H-quinolizine-3-carboxamido) yetrazolate monohydrate], in inhibiting the release of histamine and the generation of leukotriene (LT) C4 and prostaglandin (PG) D2 from dispersed human lung cells and compared this with those of its active metabolite in the rat, hydroxy quinotolast, and reference drugs, tranilast and sodium cromoglycate (SCG). Quinotolast in the concentration range of 1-100 micrograms/ml inhibited histamine and LTC4 release in a concentration-dependent manner. The inhibitory effect of quinotolast on histamine release from dispersed lung cells was largely independent of the preincubation period, no tachyphylaxis being observed. Hydroxy quinotolast and tranilast showed a weak inhibition of histamine release only when the drugs were added to the cells simultaneously with anti-IgE challenge. Quinotolast, 100 micrograms/ml, and SCG, 1 mM, significantly inhibited PGD2 and LTC4 release. Quinotolast inhibited PGD2 release by 100% and LTC4 release by 54%, whereas SCG inhibited PDG2 release by 33% and LTC4 release by 100%. No cross-tachyphylaxis between quinotolast and SCG was observed. The results demonstrated that quinotolast showed a significant inhibition of inflammatory mediators from human dispersed lung cells, suggesting that quinotolast is a good candidate for a clinical anti-allergic drug.

Inhibition of rat, mouse, and human glutathione S-transferase by eugenol and its oxidation products

NARCIS (Netherlands)

Rompelberg, C.J.M.; Ploemen, J.H.T.M.; Jespersen, S.; Greef, J. van der; Verhagen, H.; Bladeren, P.J. van

1996-01-01

The irreversible and reversible inhibition of glutathione S-transferases (GSTs) by eugenol was studied in rat, mouse and man. Using liver cytosol of human, rat and mouse, species differences were found in the rate of irreversible inhibition of GSTs by eugenol in the presence of the enzyme

Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

International Nuclear Information System (INIS)

Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

2008-01-01

Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

DEFF Research Database (Denmark)

Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

2014-01-01

The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

Co-delivery of paclitaxel and cetuximab by nanodiamond enhances mitotic catastrophe and tumor inhibition.

Science.gov (United States)

Lin, Yu-Wei; Raj, Emmanuel Naveen; Liao, Wei-Siang; Lin, Johnson; Liu, Kuang-Kai; Chen, Ting-Hua; Cheng, Hsiao-Chun; Wang, Chi-Ching; Li, Lily Yi; Chen, Chinpiao; Chao, Jui-I

2017-08-29

The poor intracellular uptake and non-specific binding of anticancer drugs into cancer cells are the bottlenecks in cancer therapy. Nanocarrier platforms provide the opportunities to improve the drug efficacy. Here we show a carbon-based nanomaterial nanodiamond (ND) that carried paclitaxel (PTX), a microtubule inhibitor, and cetuximab (Cet), a specific monoclonal antibody against epidermal growth factor receptor (EGFR), inducing mitotic catastrophe and tumor inhibition in human colorectal cancer (CRC). ND-PTX blocked the mitotic progression, chromosomal separation, and induced apoptosis in the CRC cells; however, NDs did not induce these effects. Conjugation of ND-PTX with Cet (ND-PTX-Cet) was specifically binding to the EGFR-positive CRC cells and enhanced the mitotic catastrophe and apoptosis induction. Besides, ND-PTX-Cet markedly decreased tumor size in the xenograft EGFR-expressed human CRC tumors of nude mice. Moreover, ND-PTX-Cet induced the mitotic marker protein phospho-histone 3 (Ser10) and apoptotic protein active-caspase 3 for mitotic catastrophe and apoptosis. Taken together, this study demonstrated that the co-delivery of PTX and Cet by ND enhanced the effects of mitotic catastrophe and apoptosis in vitro and in vivo, which may be applied in the human CRC therapy.

Inhibition of hexokinase-2 with targeted liposomal 3-bromopyruvate in an ovarian tumor spheroid model of aerobic glycolysis

Directory of Open Access Journals (Sweden)

Gandham SK

2015-07-01

Full Text Available Srujan Kumar Gandham, Meghna Talekar, Amit Singh, Mansoor M Amiji Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA, USA Background: The objective of this study was to evaluate the expression levels of glycolytic markers, especially hexokinase-2 (HK2, using a three-dimensional multicellular spheroid model of human ovarian adenocarcinoma (SKOV-3 cells and to develop an epidermal growth factor receptor-targeted liposomal formulation for improving inhibition of HK2 and the cytotoxicity of 3-bromopyruvate (3-BPA. Methods: Multicellular SKOV-3 tumor spheroids were developed using the hanging drop method and expression levels of glycolytic markers were examined. Non-targeted and epidermal growth factor receptor-targeted liposomal formulations of 3-BPA were formulated and characterized. Permeability and cellular uptake of the liposomal formulations in three-dimensional SKOV-3 spheroids was evaluated using confocal microscopy. The cytotoxicity and HK2 inhibition potential of solution form of 3-BPA was compared to the corresponding liposomal formulation by using cell proliferation and HK2 enzymatic assays. Results: SKOV-3 spheroids were reproducibly developed using the 96-well hanging drop method, with an average size of 900 µm by day 5. HK2 enzyme activity levels under hypoxic conditions were found to be higher than under normoxic conditions (P<0.0001, Student’s t-test, unpaired and two-tailed. Liposomal formulations (both non-targeted and targeted of 3-BPA showed a more potent inhibitory effect (P<0.001, Student’s t-test, unpaired and two-tailed at a dose of 50 µM than the aqueous solution form at 3, 6, and 24 hours post administration. Similarly, the cytotoxic activity 3-BPA at various concentrations (10 µM–100 µM showed that the liposomal formulations had an enhanced cytotoxic effect of 2–5-fold (P<0.0001, Student’s t-test, unpaired and two-tailed when compared to the aqueous solution form

The aryl hydrocarbon receptor ligand ITE inhibits TGFβ1-induced human myofibroblast differentiation.

Science.gov (United States)

Lehmann, Geniece M; Xi, Xia; Kulkarni, Ajit A; Olsen, Keith C; Pollock, Stephen J; Baglole, Carolyn J; Gupta, Shikha; Casey, Ann E; Huxlin, Krystel R; Sime, Patricia J; Feldon, Steven E; Phipps, Richard P

2011-04-01

Fibrosis can occur in any human tissue when the normal wound healing response is amplified. Such amplification results in fibroblast proliferation, myofibroblast differentiation, and excessive extracellular matrix deposition. Occurrence of these sequelae in organs such as the eye or lung can result in severe consequences to health. Unfortunately, medical treatment of fibrosis is limited by a lack of safe and effective therapies. These therapies may be developed by identifying agents that inhibit critical steps in fibrotic progression; one such step is myofibroblast differentiation triggered by transforming growth factor-β1 (TGFβ1). In this study, we demonstrate that TGFβ1-induced myofibroblast differentiation is blocked in human fibroblasts by a candidate endogenous aryl hydrocarbon receptor (AhR) ligand 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE). Our data show that ITE disrupts TGFβ1 signaling by inhibiting the nuclear translocation of Smad2/3/4. Although ITE functions as an AhR agonist, and biologically persistent AhR agonists, such as 2,3,7,8-tetrachlorodibenzo-p-dioxin, cause severe toxic effects, ITE exhibits no toxicity. Interestingly, ITE effectively inhibits TGFβ1-driven myofibroblast differentiation in AhR(-/-) fibroblasts: Its ability to inhibit TGFβ1 signaling is AhR independent. As supported by the results of this study, the small molecule ITE inhibits myofibroblast differentiation and may be useful clinically as an antiscarring agent. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

[Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

Science.gov (United States)

Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

1992-07-01

Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure

OpenAIRE

Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

2017-01-01

The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report fo...

The epidermal growth factor receptor (EGFr) as a target for in situ radiation therapy

International Nuclear Information System (INIS)

Vallis, K.A.; Reilly, R.M.

2003-01-01

In situ radiation therapy traditionally involves the use of a monoclonal antibody (mAb) directed against a specific tumor-associated antigen and labeled with α-particle emitter such as 131-I. An alternative strategy is to use a low molecular weight peptide rather than a mAb as the carrier molecule. Also, recent evidence shows that radioactive elements that emit Auger electrons may be useful for inducing receptor/cell-specific cytotoxicity. Auger electrons provide low energy emissions (<10-20 keV). Although they have a short range in tissue (a few mm), Auger electrons have a high rate of energy deposition that is comparable to high linear energy transfer radiation such as -particles. Human epidermal growth factor (hEGF) is a natural peptide ligand for EGFr, which is frequently overexpressed in breast cancer. EGF is rapidly internalized and translocated to the cell nucleus following binding to EGFr. We are developing a strategy of EGF conjugated to an Auger electron-emitting radionuclide, 111-In, as a treatment for EGFr-overexpressing breast cancers. This strategy has several advantages over the mAb approach, as EGF is an endogenous peptide and should not be immunogenic. Also, its small molecular size should facilitate extravasation and tumor penetration. We have shown that 111In-hEGF is highly and selectively radiotoxic to MDA-MB-468 human breast cancer cells overexpressing EGFr but was not radiotoxic to MCF-7 breast cancer cells with a 100-fold lower level of EGFr expression. We have also demonstrated that 111-In-hEGF was greater than 80-fold more potent on a molar concentration basis at inhibiting the growth of MDA-MB-468 breast cancer cells than paclitaxel (IC50 70 pM vs. 6 nM respectively) and greater than 400-fold more potent than doxorubicin (IC50 20 nM). We have evaluated the therapeutic efficacy of 111-In-hEGF in athymic mice implanted subcutaneously with MDA-MB-468 breast cancer xenografts. Tumour growth was strongly inhibited following administration of

Tissue remodeling induced by hypersecreted epidermal growth factor and amphiregulin in the airway after an acute asthma attack.

Science.gov (United States)

Enomoto, Yukinori; Orihara, Kanami; Takamasu, Tetsuya; Matsuda, Akio; Gon, Yasuhiro; Saito, Hirohisa; Ra, Chisei; Okayama, Yoshimichi

2009-11-01

Epidermal growth factor receptor ligands, such as epidermal growth factor (EGF) and amphiregulin, may play key roles in tissue remodeling in asthma. However, the kinetics of EGF and amphiregulin secretion in the airway after an acute asthma attack and the effect of prolonged airway exposure to these ligands on airway remodeling are unknown. To measure the EGF and amphiregulin concentrations in sputa obtained from patients with asthma under various conditions, and to examine the effects of EGF and amphiregulin on the proliferation or differentiation of airway structural cells. Epidermal growth factor and amphiregulin levels were measured by ELISA in sputum specimens collected from 14 hospitalized children with asthma during an acute asthma attack, 13 stable outpatients with asthma, 8 healthy control children, and 7 children with respiratory tract infections. The effects of EGF and amphiregulin on the proliferation and/or differentiation of normal human bronchial epithelial cells (NHBE), bronchial smooth muscle cells (BSMC), and normal human lung fibroblasts (NHLF) were examined. The sputum levels of EGF were significantly higher for about a week after an acute asthma attack compared with the levels in stable subjects with asthma and control subjects. In contrast, upregulation of amphiregulin in the sputa of patients with asthma was observed only during the acute attack. EGF caused proliferation of NHBE, BSMC, and NHLF, whereas amphiregulin induced proliferation of only NHBE. Prolonged exposure of NHBE to EGF and amphiregulin induced mucous cell metaplasia in an IL-13-independent manner. Acute asthma attacks are associated with hypersecretion of EGF and amphiregulin in the airway. Recurrent acute attacks may aggravate airway remodeling.

The induction of apoptosis in pre-malignant keratinocytes by omega-3 polyunsaturated fatty acids docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) is inhibited by albumin.

Science.gov (United States)

Nikolakopoulou, Zacharoula; Shaikh, Mushfiq Hassan; Dehlawi, Hebah; Michael-Titus, Adina Teodora; Parkinson, Eric Kenneth

2013-04-12

The long chain omega-3 polyunsaturated fatty acids (PUFA) have been reported to exert anti-cancer effects. At this study we tested the effect of the omega-3 PUFA, docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), on pre-malignant keratinocytes growth in the well-characterised human pre-malignant epidermal cell line, HaCaT and attempted to identify a PUFA serum antagonist. Both EPA and DHA inhibited HaCaT growth and induced apoptosis. At the 10% (v/v) foetal bovine serum (FBS) medium, limited growth inhibition (3-20% for 50μM DHA and EPA respectively) and negligible apoptosis were observed with PUFA use. However, at 3% (v/v) FBS medium, 30-50μM of PUFA caused impressive levels of growth inhibition (82-83% for 50μM DHA and EPA respectively) and increase of apoptosis (8-19% increase in 72h). None of the numerous serum growth factors present in FBS or the antioxidant n-tert-butyl-α-phenylnitrone could inhibit the PUFA-induced cytotoxicity. In contrast, bovine and human albumin (0.1-0.3%, w/v) significantly antagonized the growth inhibitory and apoptosis-inducing effects of PUFA. In conclusion, we have shown for the first time that omega-3 PUFA inhibit the growth and induce apoptosis of pre-malignant keratinocytes and identified albumin as a major antagonistic factor in serum that could limit their effectiveness at pharmacologically-achievable doses. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks

Directory of Open Access Journals (Sweden)

Sang Wha Kim

2014-03-01

Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.

UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling.

Science.gov (United States)

Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B

2013-08-20

At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.

Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

Directory of Open Access Journals (Sweden)

Wen-Hung Chung

2010-01-01

Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

Oxytetracycline Inhibits Mucus Secretion and Inflammation in Human Airway Epithelial Cells.

Science.gov (United States)

Shah, Said Ahmad; Ishinaga, Hajime; Takeuchi, Kazuhiko

2017-01-01

Oxytetracycline is a broad-spectrum antibiotic, but its nonantibacterial effects in the human respiratory tract are unknown. In this study, the effects of oxytetracycline on mucus secretion and inflammation were examined by PCR and ELISA in the human airway epithelial cell line NCI-H292. Oxytetracycline (10 μg/mL) significantly inhibited TNF-α-induced MUC5AC gene expression and MUC5AC protein levels in NCI-H292 cells. It also downregulated IL-8 and IL-1β gene expression and IL-1β protein levels. Our findings demonstrated that oxytetracycline suppressed mucus production and inflammation in human respiratory epithelial cells, providing further evidence for the usefulness of oxytetracycline for human airway inflammatory diseases. © 2017 S. Karger AG, Basel.

Rapamycin causes growth arrest and inhibition of invasion in human chondrosarcoma cells.

Science.gov (United States)

Song, Jian; Wang, Xiaobo; Zhu, Jiaxue; Liu, Jun

2016-01-01

Chondrosarcoma is a highly malignant tumor that is characterized by a potent capacity to invade locally and cause distant metastasis and notable for its lack of response to conventional chemotherapy or radiotherapy. Rapamycin, the inhibitor of mammalian target of rapamycin (mTOR), is a valuable drug with diverse clinical applications and regulates many cellular processes. However, the effects of rapamycin on cell growth and invasion of human chondrosarcoma cells are not well known. We determined the effect of rapamycin on cell proliferation, cell cycle arrest and invasion by using MTS, flow cytometry and invasion assays in two human chondrosarcoma cell lines, SW1353 and JJ012. Cell cycle regulatory and invasion-related genes' expression analysis was performed by quantitative RT-PCR (qRT-PCR). We also evaluated the effect of rapamycin on tumor growth by using mice xenograph models. Rapamycin significantly inhibited the cell proliferation, induced cell cycle arrest and decreased the invasion ability of human chondrosarcoma cells. Meanwhile, rapamycin modulated the cell cycle regulatory and invasion-related genes' expression. Furthermore, the tumor growth of mice xenograph models with human chondrosarcoma cells was significantly inhibited by rapamycin. These results provided further insight into the role of rapamycin in chondrosarcoma. Therefore, rapamycin targeted therapy may be a potential treatment strategy for chondrosarcoma.

Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.

Science.gov (United States)

Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P

2003-11-01

C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the

Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis

Science.gov (United States)

Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin

2016-01-01

Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054

Aliphatic alcohols in spirits inhibit phagocytosis by human monocytes.

Science.gov (United States)

Pál, László; Árnyas, Ervin M; Bujdosó, Orsolya; Baranyi, Gergő; Rácz, Gábor; Ádány, Róza; McKee, Martin; Szűcs, Sándor

2015-04-01

A large volume of alcoholic beverages containing aliphatic alcohols is consumed worldwide. Previous studies have confirmed the presence of ethanol-induced immunosuppression in heavy drinkers, thereby increasing susceptibility to infectious diseases. However, the aliphatic alcohols contained in alcoholic beverages might also impair immune cell function, thereby contributing to a further decrease in microbicidal activity. Previous research has shown that aliphatic alcohols inhibit phagocytosis by granulocytes but their effect on human monocytes has not been studied. This is important as they play a crucial role in engulfment and killing of pathogenic microorganisms and a decrease in their phagocytic activity could lead to impaired antimicrobial defence in heavy drinkers. The aim of this study was to measure monocyte phagocytosis following their treatment with those aliphatic alcohols detected in alcoholic beverages. Monocytes were separated from human peripheral blood and phagocytosis of opsonized zymosan particles by monocytes treated with ethanol and aliphatic alcohols individually and in combination was determined. It was shown that these alcohols could suppress the phagocytic activity of monocytes in a concentration-dependent manner and when combined with ethanol, they caused a further decrease in phagocytosis. Due to their additive effects, it is possible that they may inhibit phagocytosis in a clinically meaningful way in alcoholics and episodic heavy drinkers thereby contribute to their increased susceptibility to infectious diseases. However, further research is needed to address this question.

Probenecid inhibits α-adrenergic receptor-mediated vasoconstriction in the human leg vasculature

DEFF Research Database (Denmark)

Nyberg, Michael Permin; Piil, Peter Bergmann; Kiehn, Oliver Thistrup

2018-01-01

to α1- and α2-adrenergic receptor stimulation in the human forearm and leg vasculature of young healthy male subjects (23±3 years). By use of immunolabeling and confocal microscopy, Panx1 channels were found to be expressed in vascular smooth muscle cells of arterioles in human leg skeletal muscle....... Probenecid treatment increased (Padrenergic receptor stimulation) by ≈15%, whereas the response to the α1-agonist phenylephrine was unchanged. Inhibition...

EGFR Activation Mediates Inhibition of Axon Regeneration by Myelin and Chondroitin Sulfate Proteoglycans

Science.gov (United States)

Koprivica, Vuk; Cho, Kin-Sang; Park, Jong Bae; Yiu, Glenn; Atwal, Jasvinder; Gore, Bryan; Kim, Jieun A.; Lin, Estelle; Tessier-Lavigne, Marc; Chen, Dong Feng; He, Zhigang

2005-10-01

Inhibitory molecules associated with myelin and the glial scar limit axon regeneration in the adult central nervous system (CNS), but the underlying signaling mechanisms of regeneration inhibition are not fully understood. Here, we show that suppressing the kinase function of the epidermal growth factor receptor (EGFR) blocks the activities of both myelin inhibitors and chondroitin sulfate proteoglycans in inhibiting neurite outgrowth. In addition, regeneration inhibitors trigger the phosphorylation of EGFR in a calcium-dependent manner. Local administration of EGFR inhibitors promotes significant regeneration of injured optic nerve fibers, pointing to a promising therapeutic avenue for enhancing axon regeneration after CNS injury.

Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues

International Nuclear Information System (INIS)

Shakin, S.H.; Liebhaber, S.A.

1987-01-01

The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation

Rapid Visualization of Human Tumor Xenografts through Optical Imaging with a Near-Infrared Fluorescent Anti–Epidermal Growth Factor Receptor Nanobody

Directory of Open Access Journals (Sweden)

Sabrina Oliveira

2012-01-01

Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.

Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

Energy Technology Data Exchange (ETDEWEB)

Manwaring, John, E-mail: manwaring.jd@pg.com [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Rothe, Helga [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany); Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A. [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Hewitt, Nicola J. [SWS, Erzhausen (Germany); Goebel, Carsten [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany)

2015-09-01

Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K{sub m} and V{sub max} values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C{sub max} was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human

Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

International Nuclear Information System (INIS)

Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A.; Hewitt, Nicola J.; Goebel, Carsten

2015-01-01

Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K m and V max values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C max was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human skin explants and

Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields.

Science.gov (United States)

Collard, J-F; Hinsenkamp, M

2015-05-01

We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

Giant epidermal inclusion cyst in the male breast: A case report

Energy Technology Data Exchange (ETDEWEB)

KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)

2017-03-15

Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.

In vitro dermal and epidermal cellular response to titanium alloy implants fabricated with electron beam melting.

Science.gov (United States)

Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H

2014-10-01

Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

Naloxone inhibits superoxide but not enzyme release by human neutrophils

International Nuclear Information System (INIS)

Simpkins, C.; Alailima, S.; Tate, E.

1986-01-01

The release of toxic oxygen metabolites and enzymes by phagocytic cells is thought to play a role in the multisystemic tissue injury of sepsis. Naloxone protects septic animals. We have found that at concentrations administered to animals (10 -7 to 10 -4 M), naloxone inhibited (p 2 - ) by human neutrophils (HN), stimulated with N-formyl methionyl leucyl phenylalanine (FMLP). Naloxone had no effect on cell viability. Maximum inhibition was 65% of the total O 2 - released (13.1 nMoles/8 min/320,000 cells). FMLP-stimulated release of beta-glucoronidase or lysozyme was not altered by naloxone. Naloxone had no effect on the binding of 3 H FMLP to HN. Using 3 H naloxone and various concentrations of unlabeled naloxone higher affinity (K/sub D/ = 12nM) and lower affinity (K/sub D/ = 4.7 x 10 -5 ) binding sites were detected. The K/sub D/ of the low affinity site corresponded to the ED 50 for naloxone inhibition of O 2 - (1 x 10 -5 M). Binding to this low affinity site was decreased by (+) naloxone, beta-endorphin and N acetyl beta-endorphin, but not by leu-enkephalin, thyrotropin releasing factor, prostaglandin D 2 or E 2 . Conclusions: (1) naloxone inhibits FMLP-stimulated O 2 but not enzyme release, (2) this inhibition is not due to alteration of FMLP receptor binding, (3) naloxone may act via a low affinity binding site which is ligand specific, and (4) a higher affinity receptor is present on HN

Inhibition by Commercial Aminoglycosides of Human Connexin Hemichannels Expressed in Bacteria

Directory of Open Access Journals (Sweden)

Mariana C. Fiori

2017-11-01

Full Text Available In addition to gap junctional channels that mediate cell-to-cell communication, connexins form hemichannels that are present at the plasma membrane. Since hemichannels are permeable to small hydrophilic compounds, including metabolites and signaling molecules, their abnormal opening can cause or contribute to cell damage in disorders such as cardiac infarct, stroke, deafness, skin diseases, and cataracts. Therefore, hemichannels are potential pharmacological targets. A few aminoglycosides, well-known broad-spectrum antibiotics, have been shown to inhibit hemichannels. Here, we tested several commercially available aminoglycosides for inhibition of human connexin hemichannels using a cell-based bacterial growth complementation assay that we developed recently. We found that kanamycin A, kanamycin B, geneticin, neomycin, and paromomycin are effective inhibitors of hemichannels formed by connexins 26, 43, and 46 (Cx26, Cx43, and Cx46. Because of the >70 years of clinical experience with aminoglycosides and the fact that several of the aminoglycosides tested here have been used in humans, they are promising starting points for the development of effective connexin hemichannel inhibitors.

Modulation of recurrent inhibition from knee extensors to ankle motoneurones during human walking

DEFF Research Database (Denmark)

Lamy, Jean-Charles; Iglesias, Caroline; Lackmy, Alexandra

2008-01-01

The neural control for muscle coordination during human locomotion involves spinal and supraspinal networks, but little is known about the exact mechanisms implicated. The present study focused on modulation of heteronymous recurrent inhibition from knee extensors to ankle motoneurones at different...... times in the gait cycle, when quadriceps (Quad) muscle activity overlaps that in tibialis anterior (TA) and soleus (Sol). The effects of femoral nerve stimulation on ankle motoneurones were investigated during treadmill walking and during tonic co-contraction of Quad and TA/Sol while standing. Recurrent...... inhibition of TA motoneurones depended on the level of background EMG, and was similar during walking and standing for matched background EMG levels. On the other hand, recurrent inhibition in Sol was reduced in early stance, with respect to standing, and enhanced in late stance. Reduced inhibition in Sol...

Cyclooxygenase inhibition improves endothelial vasomotor dysfunction of visceral adipose arterioles in human obesity

Science.gov (United States)

Farb, Melissa G.; Tiwari, Stephanie; Karki, Shakun; Ngo, Doan TM; Carmine, Brian; Hess, Donald T.; Zuriaga, Maria A.; Walsh, Kenneth; Fetterman, Jessica L.; Hamburg, Naomi M.; Vita, Joseph A.; Apovian, Caroline M.; Gokce, Noyan

2013-01-01

Objective The purpose of this study was to determine whether cyclooxygenase inhibition improves vascular dysfunction of adipose microvessels from obese humans. Design and Methods In 20 obese subjects (age 37±12 yrs, BMI 47±8 kg/m2) we collected subcutaneous and visceral fat during bariatric surgery and characterized adipose depot-specific gene expression, endothelial cell phenotype, and microvascular function. Vasomotor function was assessed in response to endothelium-dependent agonists using videomicroscopy of small arterioles from fat. Results Arterioles from visceral fat exhibited impaired endothelium-dependent, acetylcholine-mediated vasodilation, compared to the subcutaneous depot (p<0.001). Expression of mRNA transcripts relevant to the cyclooxygenase pathway were upregulated in visceral compared to subcutaneous fat. Pharmacological inhibition of cyclooxygenase with indomethacin improved endothelium-dependent vasodilator function of arterioles from visceral fat by 2-fold (p=0.01), whereas indomethacin had no effect in the subcutaneous depot. Indomethacin increased activation via serine-1177 phosphorylation of endothelial nitric oxide synthase in response to acetylcholine in endothelial cells from visceral fat. Inhibition of endothelial nitric oxide synthase with Nω-nitro-L-arginine methyl ester abrogated the effects of cyclooxygenase-inhibition suggesting that vascular actions of indomethacin were related to increased nitric oxide bioavailability. Conclusions Our findings suggest that cyclooxygenase-mediated vasoconstrictor prostanoids partly contribute to endothelial dysfunction of visceral adipose arterioles in human obesity. PMID:23640904

Comparative Genomics Identifies Epidermal Proteins Associated with the Evolution of the Turtle Shell.

Science.gov (United States)

Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

2016-03-01

The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Automated measurement of epidermal thickness from optical coherence tomography images using line region growing

Science.gov (United States)

Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk

2010-02-01

Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.

Reactivation of organophosphate-inhibited human acetylcholinesterase by isonitrosoacetone (MINA): a kinetic analysis.

Science.gov (United States)

Worek, Franz; Thiermann, Horst

2011-11-15

Treatment of poisoning by highly toxic organophosphorus compounds (OP) with atropine and an acetylcholinesterase (AChE) reactivator (oxime) is of limited effectiveness in case of different nerve agents and pesticides. One challenge is the reactivation of OP-inhibited brain AChE which shows inadequate success with charged pyridinium oximes. Recent studies with high doses of the tertiary oxime isonitrosoacetone (MINA) indicated a beneficial effect on central and peripheral AChE and on survival in nerve agent poisoned guinea pigs. Now, an in vitro study was performed to determine the reactivation kinetics of MINA with tabun-, sarin-, cyclosarin-, VX- and paraoxon-inhibited human AChE. MINA showed an exceptionally low affinity to inhibited AChE but, with the exception of tabun-inhibited AChE, a moderate to high reactivity. In comparison to the pyridinium oximes obidoxime, 2-PAM and HI-6 the affinity and reactivity of MINA was in most cases lower and in relation to the most effective reactivators, the second order reactivation constant of MINA was 500 to 3400-fold lower. Hence, high in vivo MINA concentrations would be necessary to achieve at least partial reactivation. This assumption corresponds to in vivo data showing a dose-dependent effect on reactivation and survival in animals. In view, of the toxic potential of MINA in animals human studies would be necessary to determine the tolerability and pharmacokinetics of MINA in order to enable a proper assessment of the value of this oxime as an antidote in OP poisoning. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

DEFF Research Database (Denmark)

Kamstrup, M.; Faurschou, A.; Gniadecki, R.

2008-01-01

In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

Degradation of Epidermal Growth Factor Receptor Mediates Dasatinib-Induced Apoptosis in Head and Neck Squamous Cell Carcinoma Cells

Directory of Open Access Journals (Sweden)

Yu-Chin Lin

2012-06-01

Full Text Available Epidermal growth factor receptor (EGFR is an important oncoprotein that promotes cell growth and proliferation. Dasatinib, a bcr-abl inhibitor, has been approved clinically for the treatment of chronic myeloid leukemia and demonstrated to be effective against solid tumors in vitro through Src inhibition. Here, we disclose that EGFR degradation mediated dasatinib-induced apoptosis in head and neck squamous cell carcinoma (HNSCC cells. HNSCC cells, including Ca9-22, FaDu, HSC3, SAS, SCC-25, and UMSCC1, were treated with dasatinib, and cell viability, apoptosis, and underlying signal transduction were evaluated. Dasatinib exhibited differential sensitivities against HNSCC cells. Growth inhibition and apoptosis were correlated with its inhibition on Akt, Erk, and Bcl-2, irrespective of Src inhibition. Accordingly, we found that down-regulation of EGFR was a determinant of dasatinib sensitivity. Lysosome inhibitor reversed dasatinib-induced EGFR down-regulation, and c-cbl activity was increased by dasatinib, indicating that dasatinib-induced EGFR down-regulation might be through c-cbl-mediated lysosome degradation. Increased EGFR activation by ligand administration rescued cells from dasatinib-induced apoptosis, whereas inhibition of EGFR enhanced its apoptotic effect. Estrogen receptor α (ERα was demonstrated to play a role in Bcl-2 expression, and dasatinib inhibited ERα at the pretranslational level. ERα was associated with EGFR in dasatinib-treated HNSCC cells. Furthermore, the xenograft model showed that dasatinib inhibited HSC3 tumor growth through in vivo down-regulation of EGFR and ERα. In conclusion, degradation of EGFR is a novel mechanism responsible for dasatinib-induced apoptosis in HNSCC cells.

Human-Phosphate-Binding-Protein inhibits HIV-1 gene transcription and replication

Directory of Open Access Journals (Sweden)

Candolfi Ermanno

2011-07-01

Full Text Available Abstract The Human Phosphate-Binding protein (HPBP is a serendipitously discovered lipoprotein that binds phosphate with high affinity. HPBP belongs to the DING protein family, involved in various biological processes like cell cycle regulation. We report that HPBP inhibits HIV-1 gene transcription and replication in T cell line, primary peripherical blood lymphocytes and primary macrophages. We show that HPBP is efficient in naïve and HIV-1 AZT-resistant strains. Our results revealed HPBP as a new and potent anti HIV molecule that inhibits transcription of the virus, which has not yet been targeted by HAART and therefore opens new strategies in the treatment of HIV infection.

A novel small peptide as an epidermal growth factor receptor targeting ligand for nanodelivery in vitro

Directory of Open Access Journals (Sweden)

Han CY

2013-04-01

Full Text Available Cui-yan Han,1,2 Li-ling Yue,2 Ling-yu Tai,1 Li Zhou,2 Xue-yan Li,2 Gui-hua Xing,2 Xing-gang Yang,1 Ming-shuang Sun,1 Wei-san Pan1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, People’s Republic of China; 2Qiqihar Medical University, Qiqihar, People’s Republic of China Abstract: The epidermal growth factor receptor (EGFR serves an important function in the proliferation of tumors in humans and is an effective target for the treatment of cancer. In this paper, we studied the targeting characteristics of small peptides (AEYLR, EYINQ, and PDYQQD that were derived from three major autophosphorylation sites of the EGFR C-terminus domain in vitro. These small peptides were labeled with fluorescein isothiocyanate (FITC and used the peptide LARLLT as a positive control, which bound to putative EGFR selected from a virtual peptide library by computer-aided design, and the independent peptide RALEL as a negative control. Analyses with flow cytometry and an internalization assay using NCI-H1299 and K562 with high EGFR and no EGFR expression, respectively, indicated that FITC-AEYLR had high EGFR targeting activity. Biotin-AEYLR that was specifically bound to human EGFR proteins demonstrated a high affinity for human non-small-cell lung tumors. We found that AEYLR peptide-conjugated, nanostructured lipid carriers enhanced specific cellular uptake in vitro during a process that was apparently mediated by tumor cells with high-expression EGFR. Analysis of the MTT assay indicated that the AEYLR peptide did not significantly stimulate or inhibit the growth activity of the cells. These findings suggest that, when mediated by EGFR, AEYLR may be a potentially safe and efficient delivery ligand for targeted chemotherapy, radiotherapy, and gene therapy. Keywords: EGFR, small peptide, tumor targeting, lung cancer, NLC

Inhibition of platelet [3H]- imipramine binding by human plasma protein fractions

International Nuclear Information System (INIS)

Strijewski, A.; Chudzik, J.; Tang, S.W.

1988-01-01

Inhibition of high-affinity [ 3 H]-imipramine binding to platelet membranes by human plasma fractions and isolated plasma proteins was investigated. Several plasma proteins were found to contribute to the observed apparent inhibition and this contribution was assessed in terms of inhibitor units. Alpha 1 acid glycoprotein, high density and low density lipoprotein, IgG and α 1 -antitrypsin were identified as effective non-specific inhibitors. Alpha-1-acid glycoprotein was confirmed to be the most potent plasma protein inhibitor. Cohn fractions were evaluated for the presence of the postulated endocoid of [ 3 H]-imipramine binding site

Impaired degradation followed by enhanced recycling of epidermal growth factor receptor caused by hypo-phosphorylation of tyrosine 1045 in RBE cells

International Nuclear Information System (INIS)

Gui, Anping; Kobayashi, Akira; Motoyama, Hiroaki; Kitazawa, Masato; Takeoka, Michiko; Miyagawa, Shinichi

2012-01-01

Since cholangiocarcinoma has a poor prognosis, several epidermal growth factor receptor (EGFR)-targeted therapies with antibody or small molecule inhibitor treatment have been proposed. However, their effect remains limited. The present study sought to understand the molecular genetic characteristics of cholangiocarcinoma related to EGFR, with emphasis on its degradation and recycling. We evaluated EGFR expression and colocalization by immunoblotting and immunofluorescence, cell surface EGFR expression by fluorescence-activated cell sorting (FACS), and EGFR ubiquitination and protein binding by immunoprecipitation in the human cholangiocarcinoma RBE and immortalized cholangiocyte MMNK-1 cell lines. Monensin treatment and Rab11a depletion by siRNA were adopted for inhibition of EGFR recycling. Upon stimulation with EGF, ligand-induced EGFR degradation was impaired and the expression of phospho-tyrosine 1068 and phospho-p44/42 MAPK was sustained in RBE cells as compared with MMNK-1 cells. In RBE cells, the process of EGFR sorting for lysosomal degradation was blocked at the early endosome stage, and non-degradated EGFR was recycled to the cell surface. A disrupted association between EGFR and the E3 ubiquitin ligase c-Cbl, as well as hypo-phosphorylation of EGFR at tyrosine 1045 (Tyr1045), were also observed in RBE cells. In RBE cells, up-regulation of EGFR Tyr1045 phosphorylation is a potentially useful molecular alteration in EGFR-targeted therapy. The combination of molecular-targeted therapy determined by the characteristics of individual EGFR phosphorylation events and EGFR recycling inhibition show promise in future treatments of cholangiocarcinoma

EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

African Journals Online (AJOL)

Administrator

stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Guo, Lei [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Xiao, Yongsheng [Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States); Wang, Yinsheng, E-mail: yinsheng.wang@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States)

2014-05-15

Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA

Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

Science.gov (United States)

Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

1989-10-15

The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

Impaired epidermal wound healing in vivo upon inhibition or deletion of Rac1

DEFF Research Database (Denmark)

Tscharntke, Michael; Pofahl, Ruth; Chrostek-Grashoff, Anna

2007-01-01

inhibited on collagen I and, to a lesser extent, on fibronectin. Stroboscopic analysis of cell dynamics (SACED) of N17Rac1 transgenic and control keratinocytes identified decreased lamella-protrusion persistence in connection with increased ruffle frequency as a probable mechanism for the observed...

[Effects of icotinib hydrochloride on the proliferation and apoptosis of human lung cancer cell lines].

Science.gov (United States)

Ma, Li; Han, Xiao-hong; Wang, Shuai; Wang, Jian-fei; Shi, Yuan-kai

2012-09-25

To explore the effects of icotinib on the proliferation and apoptosis of various lung cancer cell lines. Human lung cancer cell lines HCC827, H1650, H1975, A549 and human epidermal cancer cell line A431 were treated in vitro with icotinib or gefitinib at a concentration gradient of 0 - 40 µmol/L. Their proliferation effects were analyzed by the thiazolyl blue (MTT) assay and the apoptotic effects detected by flow cytometer. The downstream signaling proteins were detected by Western blot. The median inhibitory concentrations (IC(50)) of icotinib for A431 and HCC827 cell lines were (0.04 ± 0.02) and (0.15 ± 0.06) µmol/L respectively. No significant differences existed between the inhibitions of gefitinib and icotinib on A431, HCC827, H1650, H1975 and A549 cell lines (all P > 0.05). Compared with H1650, H1975 and A549 cell lines, icotinib significantly inhibited A431 (P = 0.009, 0.005 and 0.000) and HCC827 (P = 0.001, 0.001 and 0.000) cell lines. And it lowered the expressions of p-AKT, p-ERK and survivin protein expression through the inhibited activity of p-EGFR protein. Icotinib can arrest the proliferation of lung adenocarcinoma cells with EGFR mutation or over-expression by inhibiting the signal pathways of AKT-ERK and survivin.

High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

Directory of Open Access Journals (Sweden)

Yi Ma

2016-01-01

Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

Science.gov (United States)

Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

2016-01-01

Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

Directory of Open Access Journals (Sweden)

Sabita N. Saldanha

2015-12-01

Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

Gemcitabine inhibits proliferation and induces apoptosis in human pancreatic cancer PANC-1 cells.

Science.gov (United States)

Yong-Xian, Gui; Xiao-Huan, Li; Fan, Zhang; Guo-Fang, Tian

2016-10-01

The aim of the study is to investigate the underlying molecular mechanisms by which gemcitabine (gem) inhibits proliferation and induces apoptosis in human pancreatic cancer PANC-1 cells in vitro. After PANC-1 cells had been treated by indicated concentration (0, 5, and 25 mg/L) of gem for 48 h, cell proliferation was evaluated by 3'-(4, 5 dimethyl-thiazol-2-yl)-2, 5-diphenyl tetrazolium bromide assay; cell morphology was observed by transmission electron microscopy; Expression of c-IAP2 and Bcl-2 proteins was analyzed by Western blot; the activity of caspase-3 and -9 was detected by spectrophotometry. Gem significantly inhibited cell proliferation and could induce apoptosis of human pancreatic cancer PANC-1 cells, with a dose-dependent manner. Western blot analysis showed that gem significantly reduced c-IAP2 and Bcl-2 proteins expression level (P PANC-1 cells. Gem could induce apoptosis of human pancreatic cancer PANC-1 cells, probably through downregulating c-IAP2 and Bcl-2 expression levels, and at the same time activating caspase-3 and -9.