Lazzarano, Stefano; Lulli, Matteo; Fibbi, Gabriella; Margheri, Francesca; Papucci, Laura; Serrati, Simona; Witort, Ewa; Chilla, Anastasia; Lapucci, Andrea; Donnini, Martino; Quaglierini, Paolo; Romiti, Alice; Specogna, Rebecca; Del Rosso, Mario; Capaccioli, Sergio
2008-06-01
Angiogenesis underlies a variety of physiological processes and its possible deregulation during long term space exploration needs to be investigated. Angiogenesis is a multistep process of new blood capillary formation, where degradation of the extracellular matrix (ECM) by proteolytic enzymes, including uPA (urokinase plasminogen activator) and opening the way to migration of endothelial cells (EC), is critical. Plasminogen activation system regulates angiogenesis by both uPA-driven ECM degradation and uPA receptor (uPAR). Microgravity and low dose irradiations promote tissue neoangiogeenesis and neovascularization is often common occurence in ophthalmologic pathologies. We have designed and patented the uPAR antisense oligonucleotide (aODN) and evaluated its antiangiogenetic activity by EC cellular migration and capillary morphogenesis assays. The uPAR aODN treatment caused a 75% inhibition of human microvascular EC migration and a complete inhibition of capillary morphogenesis, suggesting its therapeutic application to prevent neoangiogenesis-related ophthalmologic pathologies during space exploration.
International Nuclear Information System (INIS)
Reigadas, Sandrine; Ventura, Michel; Andreola, Marie-Line; Michel, Justine; Gryaznov, Sergei; Tarrago-Litvak, Laura; Litvak, Simon; Astier-Gin, Therese
2003-01-01
We describe oligonucleotides (ODNs) that inhibit hepatitis C virus (HCV) RNA synthesis in vitro. From a series of 13 ODNs complementary to the 3'-end of the minus-strand HCV RNA, only 4 inhibited RNA synthesis with IC 50 values lower than 1 μM. The inhibition was sequence-specific, since no effect was observed when the ODNs were used with a noncomplementary template. The introduction of a 2'-O-methyl modification increased the inhibitor activity 11-fold (IC 50 = 50 nM) in just 1 (ODN7) of the 4 inhibitory ODNs. ODNs did not inhibit RNA synthesis by interfering with the elongation process as no short RNAs products were detected. We also show that ODN7 did not prevent binding of NS5B to the template or cause polymerase trapping by the duplex RNA/ODN. Our data demonstrate that ODN7 inhibits the initiation process, most probably by modifying structural features present at the 3'-end of the minus-strand RNA
Directory of Open Access Journals (Sweden)
Moizza Mansoor
2008-01-01
Full Text Available Antisense oligonucleotides (As-ODNs are single stranded, synthetically prepared strands of deoxynucleotide sequences, usually 18–21 nucleotides in length, complementary to the mRNA sequence of the target gene. As-ODNs are able to selectively bind cognate mRNA sequences by sequence-specific hybridization. This results in cleavage or disablement of the mRNA and, thus, inhibits the expression of the target gene. The specificity of the As approach is based on the probability that, in the human genome, any sequence longer than a minimal number of nucleotides (nt, 13 for RNA and 17 for DNA, normally occurs only once. The potential applications of As-ODNs are numerous because mRNA is ubiquitous and is more accessible to manipulation than DNA. With the publication of the human genome sequence, it has become theoretically possible to inhibit mRNA of almost any gene by As-ODNs, in order to get a better understanding of gene function, investigate its role in disease pathology and to study novel therapeutic targets for the diseases caused by dysregulated gene expression. The conceptual simplicity, the availability of gene sequence information from the human genome, the inexpensive availability of synthetic oligonucleotides and the possibility of rational drug design makes As-ODNs powerful tools for target identification, validation and therapeutic intervention. In this review we discuss the latest developments in antisense oligonucleotide design, delivery, pharmacokinetics and potential side effects, as well as its uses in target identification and validation, and finally focus on the current developments of antisense oligonucleotides in therapeutic intervention in various diseases.
Diesbach, Philippe de; Berens, Catherine; N’Kuli, Francisca; Monsigny, Michel; Sonveaux, Etienne; Wattiez, Ruddy; Courtoy, Pierre J.
2000-01-01
The low and unpredictable uptake and cytosolic transfer of oligonucleotides (ODN) is a major reason for their limited benefit. Improving the ODN potential for therapy and research requires a better understanding of their receptor-mediated endocytosis. We have undertaken to identify a membrane ODN receptor on HepG2 cells by ligand blotting of cell extracts with [(125)I]ODN and by photolabelling of living cells with a [(125)I]ODN-benzophenone conjugate. A major band at 66 kDa was identified by ...
Rapid Induction of Protective Immunity Against Biothreat Agents Using CPG-Based Oligonucleotides
National Research Council Canada - National Science Library
Klinman, Dennis
2003-01-01
This research project examines the ability of synthetic oligonucleotides (ODN) containing immunostimulatory "CpG motifs' to trigger the innate immune system, thereby improving the host's ability to survive infection by biowarfare agents...
Energy Technology Data Exchange (ETDEWEB)
Hason, Stanislav [Institute of Biophysics, Academy of Sciences of the Czech Republic, v.v.i. Kralovopolska 135, CZ-612 65 Brno (Czech Republic)], E-mail: hasons@ibp.cz; Vetterl, Vladimir [Institute of Biophysics, Academy of Sciences of the Czech Republic, v.v.i. Kralovopolska 135, CZ-612 65 Brno (Czech Republic); Fojta, Miroslav [Institute of Biophysics, Academy of Sciences of the Czech Republic, v.v.i. Kralovopolska 135, CZ-612 65 Brno (Czech Republic)], E-mail: fojta@ibp.cz
2008-02-15
For the first time it is shown that homopyrimidine oligodeoxynucleotides (ODNs) adsorbed at mercury or amalgam electrode surface can condensate upon applying negative potentials (around -1.35 V vs. Ag/AgCl/3M KCl). This 2D condensation resulted in formation of capacitance pits on the C-E curves resembling those observed earlier with monomeric nucleic acid bases, nucleosides and nucleotides. Differences in behavior of the condensed layers of dT{sub 30} and dC{sub 30} ODNs, reflecting different physico-chemical and electrochemical properties of thymine and cytosine, were observed. Formation of the ODN condensed film involved reorientation of the oligonucleotide molecules firmly adsorbed at the electrode and took place even in the absence of any ODN in the bulk of solution. Homopurine ODNs did not form these two-dimensional (2D) condensed monolayers under the same conditions. A preliminary thermodynamic analysis of the condensed ODN layers is presented.
International Nuclear Information System (INIS)
Xu, Qin; Zhang, Zhiyuan; Zhang, Ping; Chen, Wantao
2008-01-01
Antisense oligonucleotides against hTR (As-ODN-hTR) have shown promising results as treatment strategies for various human malignancies. All-trans retinoic acid (ATRA) is a signalling molecule with important roles in differentiation and apoptosis. Biological responses to ATRA are currently used therapeutically in various human cancers. The aim of this study was to evaluate the anti-tumor effects of As-ODN-hTR combined with ATRA in vivo. In situ human oral squamous cell carcinoma (OSCC) models were established by subcutaneous injection of Tca8113 cells. Mice were treated with sense oligonucleotides against hTR(S-ODN-hTR) alone, As-ODN-hTR alone, ATRA alone, As-ODN-hTR plus ATRA, or S-ODN-hTR plus ATRA. Tumor size and weight were assessed in the mice. Telomerase activity was detected by a TRAP assay, apoptotic cells were evaluated with a Tunel assay, the expression of apoptosis-related proteins (Bcl-2 and Bax) was evaluated by immunohistochemistry and ultrastructural morphological changes in the tumor specimen were examined. Both As-ODN-hTR and ATRA can significantly inhibit tumor growth in this OSCC xenograft solid-tumor model, and the combination of the two agents had a synergistic anti-tumorogenic effect. We also demonstrated that this anti-tumor effect correlated with inhibition of telomerase activity. Furthermore, significant increases in the number of apoptotic cells, typical apoptotic morphology and a downregulation of the anti-apoptotic protein, bcl-2 were observed in the treated tissues. The combination of As-ODN-hTR and ATRA has a synergistic anti-tumor effect. This anti-tumor effect can be mainly attributed to apoptosis induced by a decrease in telomerase activity. Bcl-2 plays an important role in this process. Therefore, combining As-ODN-hTR and ATRA may be an approach for the treatment of human oral squamous cell carcinoma
Effective intracellular delivery of oligonucleotides in order to make sense of antisense
Shi, FX; Hoekstra, D
2004-01-01
For more than two decades, antisense oligonucleotides (ODNs) have been used to modulate gene expression for the purpose of applications in cell biology and for development of novel sophisticated medical therapeutics. Conceptually, the antisense approach represents an elegant strategy, involving the
Directory of Open Access Journals (Sweden)
Ajay Kumar
2010-01-01
Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.
Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin
2010-08-01
Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.
Directory of Open Access Journals (Sweden)
Kankan Wang
2016-01-01
Full Text Available Precise genome editing in livestock is of great value for the fundamental investigation of disease modeling. However, genetically modified pigs carrying subtle point mutations were still seldom reported despite the rapid development of programmable endonucleases. Here, we attempt to investigate single-stranded oligonucleotides (ssODN mediated knockin by introducing two orthologous pathogenic mutations, p.E693G for Alzheimer's disease and p.G2019S for Parkinson's disease, into porcine APP and LRRK2 loci, respectively. Desirable homology-directed repair (HDR efficiency was achieved in porcine fetal fibroblasts (PFFs by optimizing the dosage and length of ssODN templates. Interestingly, incomplete HDR alleles harboring partial point mutations were observed in single-cell colonies, which indicate the complex mechanism of ssODN-mediated HDR. The effect of mutation-to-cut distance on incorporation rate was further analyzed by deep sequencing. We demonstrated that a mutation-to-cut distance of 11 bp resulted in a remarkable difference in HDR efficiency between two point mutations. Finally, we successfully obtained one cloned piglet harboring the orthologous p.C313Y mutation at the MSTN locus via somatic cell nuclear transfer (SCNT. Our proof-of-concept study demonstrated efficient ssODN-mediated incorporation of pathogenic point mutations in porcine somatic cells, thus facilitating further development of disease modeling and genetic breeding in pigs.
Wang, Keng; Tao, Lei; Su, Jianbing; Zhang, Yueyang; Zou, Binhua; Wang, Yiyuan; Li, Xiaojuan
2016-09-01
Objective To observe the immunosuppressive function of regulatory B cells (Bregs) in vitro after activated by CpG oligodeoxynucleotide (CpG-ODN) and anti-CD40 mAb. Methods Mice splenic CD5(+)CD1d(high)B cells and CD5(-)CD1d(low)B cells were sorted by flow cytometry. These B cells were first stimulated with CpG-ODN combined with anti-CD40 mAb for 24 hours, and then co-cultured with purified CD4(+)T cells. The interleukin 10 (IL-10) expression in the activated Bregs and other B cell subset, as well as the proliferation and interferon γ (IFN-γ) expression in the CD4(+) T cells activated by anti-CD3 mAb plus anti-CD28 mAb were determined by flow cytometry. Results CD5(+)CD1d(high) B cells activated by CpG-ODN plus anti-CD40 mAb blocked the up-regulated CD4(+)T proliferation and significantly reduced the IFN-γ level. At the same time, activated CD5(-)CD1d(low)B cells showed no inhibitory effect on CD4(+)T cells. Further study revealed that IL-10 expression in the CD5(+)CD1d(high) B cells were much higher than that in the CD5(-)CD1d(low)B cells after stimulated with CpG-ODN combined with anti-CD40 mAb for 24 hours. Conclusion CD5(+)CD1d(high) B cells activated by CpG-ODN combined with anti-CD40 mAb have immune inhibitory effects on CD4(+)T cell activation in vitro , which possibly due to IL-10 secretion.
In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide
International Nuclear Information System (INIS)
Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki
2004-01-01
The feasibility of intracellular mdr1 mRNA expression detection with radiolabeled antisense oligonucleotide (ODN) was investigated in the murine leukemia cell line, P388/S, and its subclonal, adriamycin-resistant cell line, P388/R. The expression level of mdr1 mRNA was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Existence of the multidrug resistance (MDR) phenomenon was assessed via cellular uptake of 99m Tc-sestamibi (MIBI), a known substrate for P-glycoprotein. A 15-mer phosphorothioate antisense ODN complementary to the sequences located at -1 to 14 of mdr1 mRNA and its corresponding sense ODN were conjugated with the cyclic anhydride of diethylene triamine penta-acetic acid (cDTPA) via an amino group linked to the terminal phosphate at the 5' end at pH 8-9. The DTPA-ODN complexes at concentrations of 0.1-17.4 μMwere reacted with 111 InCl 3 at pH 5 for 1 h. The hybridization affinity of labeled ODN was evaluated with size-exclusion high-performance liquid chromatography following incubation with the complementary sequence. Cellular uptake of labeled ODN was examined in vitro. Furthermore, enhancing effects of synthetic lipid carriers (Transfast) on transmembrane delivery of ODN were assessed. P388/R cells displayed intense mdr1 mRNA expression in comparison with P388/S cells. 99m Tc-MIBI uptake in P388/S cells was higher than that in P388/R cells. Specific radioactivity up to 1,634 MBq/nmol was achieved via elevation of added radioactivity relative to ODN molar amount. The hybridization affinity of antisense 111 In-ODN was preserved at approximately 85% irrespective of specific activity. Cellular uptake of antisense 111 In-ODN did not differ from that of sense 111 In-ODN in either P388/S cells or P388/R cells. However, lipid carrier incorporation significantly increased transmembrane delivery of 111 In-ODN; moreover, specific uptake of antisense 111 In-ODN was demonstrated in P388/R cells. Radiolabeling of ODN at high specific
Directory of Open Access Journals (Sweden)
Min Du
Full Text Available The functional role of murine TLR8 in the inflammatory response of the central nervous system (CNS remains unclear. Murine TLR8 does not appear to respond to human TLR7/8 agonists, due to a five amino acid deletion in the ectodomain. However, recent studies have suggested that murine TLR8 may be stimulated by alternate ligands, which include vaccinia virus DNA, phosphothioate oligodeoxynucleotides (ODNs or the combination of phosphothioate poly-thymidine oligonucleotides (pT-ODNs with TLR7/8 agonists. In the current study, we analyzed the ability of pT-ODNs to induce activation of murine glial cells in the presence or absence of TLR7/8 agonists. We found that TLR7/8 agonists induced the expression of glial cell activation markers and induced the production of multiple proinflammatory cytokines and chemokines in mixed glial cultures. In contrast, pT-ODNs alone induced only low level expression of two cytokines, CCL2 and CXCL10. The combination of pT-ODNs along with TLR7/8 agonists induced a synergistic response with substantially higher levels of proinflammatory cytokines and chemokines compared to CL075. This enhancement was not due to cellular uptake of the agonist, indicating that the pT-ODN enhancement of cytokine responses was due to effects on an intracellular process. Interestingly, this response was also not due to synergistic stimulation of both TLR7 and TLR8, as the loss of TLR7 abolished the activation of glial cells and cytokine production. Thus, pT-ODNs act in synergy with TLR7/8 agonists to induce strong TLR7-dependent cytokine production in glial cells, suggesting that the combination of pT-ODNs with TLR7 agonists may be a useful mechanism to induce pronounced glial activation in the CNS.
Directory of Open Access Journals (Sweden)
Hu Jim
2006-02-01
Full Text Available Abstract Background The cationic lipid Genzyme lipid (GL 67 is the current "gold-standard" for in vivo lung gene transfer. Here, we assessed, if GL67 mediated uptake of siRNAs and asODNs into airway epithelium in vivo. Methods Anti-lacZ and ENaC (epithelial sodium channel siRNA and asODN were complexed to GL67 and administered to the mouse airway epithelium in vivo Transfection efficiency and efficacy were assessed using real-time RT-PCR as well as through protein expression and functional studies. In parallel in vitro experiments were carried out to select the most efficient oligonucleotides. Results In vitro, GL67 efficiently complexed asODNs and siRNAs, and both were stable in exhaled breath condensate. Importantly, during in vitro selection of functional siRNA and asODN we noted that asODNs accumulated rapidly in the nuclei of transfected cells, whereas siRNAs remained in the cytoplasm, a pattern consistent with their presumed site of action. Following in vivo lung transfection siRNAs were only visible in alveolar macrophages, whereas asODN also transfected alveolar epithelial cells, but no significant uptake into conducting airway epithelial cells was seen. SiRNAs and asODNs targeted to β-galactosidase reduced βgal mRNA levels in the airway epithelium of K18-lacZ mice by 30% and 60%, respectively. However, this was insufficient to reduce protein expression. In an attempt to increase transfection efficiency of the airway epithelium, we increased contact time of siRNA and asODN using the in vivo mouse nose model. Although highly variable and inefficient, transfection of airway epithelium with asODN, but not siRNA, was now seen. As asODNs more effectively transfected nasal airway epithelial cells, we assessed the effect of asODN against ENaC, a potential therapeutic target in cystic fibrosis; no decrease in ENaC mRNA levels or function was detected. Conclusion This study suggests that although siRNAs and asODNs can be developed to inhibit
The endozepine ODN stimulates [3H]thymidine incorporation in cultured rat astrocytes
International Nuclear Information System (INIS)
Gandolfo, P.; Patte, C.; Thoumas, J.L.; Leprince, J.; Vaudry, H.; Tonon, M.C.
1999-01-01
High concentrations of diazepam-binding inhibitor (DBI) mRNA have been detected in astrocytoma, suggesting that DBI-derived peptides may play a role in glial cell proliferation. In the present study, we have investigated the effect of a processing product of DBI, the octadecaneuropeptide ODN, on DNA synthesis in cultured rat astrocytes. At very low concentrations (10 -14 to 10 -11 M), ODN caused a dose-dependent increase of [ 3 H]thymidine incorporation. At higher doses (10 -10 to 10 -5 M), the effect of ODN gradually declined. The central-type benzodiazepine receptor antagonist flumazenil (10 -6 M) completely suppressed the stimulatory action of ODN whereas the peripheral-type benzodiazepine receptor ligand, PK11195 (10 -6 M) had no effect. The ODN-induced stimulation of [ 3 H]thymidine incorporation was mimicked by methyl 6,7-dimethoxy-4-ethyl-β-carboline-3-carboxylate (DMCM). The GABA A receptor antagonist bicuculline (10 -4 M) suppressed the effect of both ODN and DMCM on DNA synthesis. Exposure of cultured astrocytes to the specific GABA A agonist 3APS (10 -10 to 10 -4 M) also induced a dose-related increase of [ 3 H]thymidine incorporation. The present study indicates that ODN, acting through central-type benzodiazepine receptors associated with the GABA A receptor complex, stimulates DNA synthesis in rat glial cells. These data provide evidence for an autocrine role of endozepines in the control of glial cell proliferation. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
The endozepine ODN stimulates [{sup 3}H]thymidine incorporation in cultured rat astrocytes
Energy Technology Data Exchange (ETDEWEB)
Gandolfo, P.; Patte, C.; Thoumas, J.L.; Leprince, J.; Vaudry, H.; Tonon, M.C. [European Institute for Peptide Research (IFRMP no. 23), Laboratory of Cellular and Molecular Neuroendocrinology, INSERM U 413, UA CNRS, University of Rouen, 76821 Mont-Saint-Aignan (France)
1999-05-15
High concentrations of diazepam-binding inhibitor (DBI) mRNA have been detected in astrocytoma, suggesting that DBI-derived peptides may play a role in glial cell proliferation. In the present study, we have investigated the effect of a processing product of DBI, the octadecaneuropeptide ODN, on DNA synthesis in cultured rat astrocytes. At very low concentrations (10{sup -14} to 10{sup -11} M), ODN caused a dose-dependent increase of [{sup 3}H]thymidine incorporation. At higher doses (10{sup -10} to 10{sup -5} M), the effect of ODN gradually declined. The central-type benzodiazepine receptor antagonist flumazenil (10{sup -6} M) completely suppressed the stimulatory action of ODN whereas the peripheral-type benzodiazepine receptor ligand, PK11195 (10{sup -6} M) had no effect. The ODN-induced stimulation of [{sup 3}H]thymidine incorporation was mimicked by methyl 6,7-dimethoxy-4-ethyl-{beta}-carboline-3-carboxylate (DMCM). The GABA{sub A} receptor antagonist bicuculline (10{sup -4} M) suppressed the effect of both ODN and DMCM on DNA synthesis. Exposure of cultured astrocytes to the specific GABA{sub A} agonist 3APS (10{sup -10} to 10{sup -4} M) also induced a dose-related increase of [{sup 3}H]thymidine incorporation. The present study indicates that ODN, acting through central-type benzodiazepine receptors associated with the GABA{sub A} receptor complex, stimulates DNA synthesis in rat glial cells. These data provide evidence for an autocrine role of endozepines in the control of glial cell proliferation. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T
2017-09-19
A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Suffys Philip N
2009-02-01
Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.
Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju
2017-06-27
Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Le Coquil Stéphanie
2011-04-01
Full Text Available Abstract Background The transcription factor STAT3 (signal transducer and activator of transcription 3 is frequently activated in tumor cells. Activated STAT3 forms homodimers, or heterodimers with other TFs such as NF-κB, which becomes activated. Cytoplasmic STAT3 dimers are activated by tyrosine phosphorylation; they interact with importins via a nuclear localization signal (NLS one of which is located within the DNA-binding domain formed by the dimer. In the nucleus, STAT3 regulates target gene expression by binding a consensus sequence within the promoter. STAT3-specific decoy oligonucleotides (STAT3-decoy ODN that contain this consensus sequence inhibit the transcriptional activity of STAT3, leading to cell death; however, their mechanism of action is unclear. Results The mechanism of action of a STAT3-decoy ODN was analyzed in the colon carcinoma cell line SW 480. These cells' dependence on activated STAT3 was verified by showing that cell death is induced by STAT3-specific siRNAs or Stattic. STAT3-decoy ODN was shown to bind activated STAT3 within the cytoplasm, and to prevent its translocation to the nucleus, as well as that of STAT3-associated NF-κB, but it did not prevent the nuclear transfer of STAT3 with mutations in its DNA-binding domain. The complex formed by STAT3 and the STAT3-decoy ODN did not associate with importin, while STAT3 alone was found to co-immunoprecipitate with importin. Leptomycin B and vanadate both trap STAT3 in the nucleus. They were found here to oppose the cytoplasmic trapping of STAT3 by the STAT3-decoy ODN. Control decoys consisting of either a mutated STAT3-decoy ODN or a NF-κB-specific decoy ODN had no effect on STAT3 nuclear translocation. Finally, blockage of STAT3 nuclear transfer correlated with the induction of SW 480 cell death. Conclusions The inhibition of STAT3 by a STAT3-decoy ODN, leading to cell death, involves the entrapment of activated STAT3 dimers in the cytoplasm. A mechanism is
Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan
2016-06-01
Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.
Investigating the CYP2E1 Potential Role in the Mechanisms Behind INH/LPS-Induced Hepatotoxicity
Directory of Open Access Journals (Sweden)
Hozeifa M. Hassan
2018-03-01
Full Text Available Tuberculosis (TB is one of the oldest infectious diseases that affected humankind and remains one of the world’s deadliest communicable diseases that could be considered as global emergency, but the discovery and development of isoniazid (INH in the 1950s paved the way to an effective single and/or combined first-line anti-TB therapy. However, administration of INH induces severe hepatic toxicity in some patients. Previously, we establish a rat model of INH hepatotoxicity utilizing the inflammatory stress theory, in which bacterial lipopolysaccharide (LPS potentially enhanced INH toxicity. These enhancing activities ranged between augmenting the inflammatory stress, oxidative stress, alteration of bile acid homeostasis, and CYP2E1 over-expression. Although pre-treatment with dexamethasone (DEX helped overcome both inflammatory and oxidative stress which ended-up in alleviation of LPS augmenting effects, but still minor toxicities were being detected, alongside with CYP2E1 over expression. This finding positively indicated the corner-stone role played by CYP2E1 in the pathogenesis of INH/LPS-induced liver damage. Therefore, we examined whether INH/LPS co-treatment with CYP2E1 inhibitor diallyl sulfide (DAS and DEX can protect against the INH/LPS-induced hepatotoxicity. Our results showed that pre-administration of both DAS and DEX caused significant reduction in serum TBA, TBil, and gamma-glutamyl transferase levels. Furthermore, the histopathological analysis showed that DAS and DEX could effectively reverse the liver lesions seen following INH/LPS treatment and protect against hepatic steatosis as indicated by absence of lipid accumulation. Pre-treatment with DAS alone could not completely block the CYP2E1 protein expression following INH/LPS treatment, as appeared in the immunoblotting and immunohistochemistry results. This is probably due to the fact that the combined enhancement activities of both INH and LPS on CYP2E1 protein expression
CpG-ODNs induces up-regulated expression of chemokine CCL9 in mouse macrophages and microglia
Digital Repository Service at National Institute of Oceanography (India)
Ravindran, C.; Cheng, Y.-C.; Liang, S.-M.
G-ODNs on macrophage/microglial cells are investigated. CpG-ODNs enhanced the expression of TLR9 mRNA of RAW264.7 macrophage and BV2 microglia cells time dependently. The expression of CCL9 of macrophages/microglia showed different responsiveness upon stimulation...
Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.
Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira
2014-02-01
We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Zhang, Juan; Chen, Minmin; Zhao, Xiqiu; Zhang, Min; Mao, Jinxiang; Cao, Xichuan; Zhang, Zhuoqi
2018-01-01
SBA-15 mesoporous silicate was synthesized and functionalized with 3-aminopropyl organic groups through a post-synthesis method. The materials were characterized consecutively by powder X-ray diffraction (XRD), N2 adsorption/desorption analysis and solid-state magic-angle spinning 29Si nuclear magnetic resonance (MAS NMR). Human c-myc anti-sense oligodeoxyneucleotide (AS-ODN) was selected as a model molecule to be loaded onto the surface of bare and functionalized SBA-15 via different loading conditions. It has been found that the amount of AS-ODN incorporated into the porous matrix is strongly dependent on the surface properties, pH of the loading solvent and AS-ODN concentration. The release behaviour of AS-ODN from modified SBA-15 materials was also investigated and depended on conditions chosen. Cellular uptake of the eluted AS-ODN into Hela cells was observed by fluorescent microscopy. The materials showed excellent cytocompatibility. The AS-ODN keeps full transfection and expression activities indicating its structural integrity. The functionalized SBA-15 is an excellent prospect as a biomedical material candidate for the future.
Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis
Energy Technology Data Exchange (ETDEWEB)
Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent (CNRS-UMR); (Einstein); (TAM)
2011-08-24
The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.
Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis.
Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C; Jacobs, William R; Kremer, Laurent
2010-12-01
The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA_T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development. © 2010 Blackwell Publishing Ltd.
Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A
2016-12-06
Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.
Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C
2018-04-06
Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Directory of Open Access Journals (Sweden)
Kmiec Eric B
2007-02-01
Full Text Available Abstract Background Single-stranded oligonucleotides (ssODN are used routinely to direct specific base alterations within mammalian genomes that result in the restoration of a functional gene. Despite success with the technique, recent studies have revealed that following repair events, correction frequencies decrease as a function of time, possibly due to a sustained activation of damage response signals in corrected cells that lead to a selective stalling. In this study, we use thymidine to slow down the replication rate to enhance repair frequency and to maintain substantial levels of correction over time. Results First, we utilized thymidine to arrest cells in G1 and released the cells into S phase, at which point specific ssODNs direct the highest level of correction. Next, we devised a protocol in which cells are maintained in thymidine following the repair reaction, in which the replication is slowed in both corrected and non-corrected cells and the initial correction frequency is retained. We also present evidence that cells enter a senescence state upon prolonged treatment with thymidine but this passage can be avoided by removing thymidine at 48 hours. Conclusion Taken together, we believe that thymidine may be used in a therapeutic fashion to enable the maintenance of high levels of treated cells bearing repaired genes.
Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean
2017-08-01
The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.
Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.
Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui
2011-02-28
To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P Panc-1 cells.
Khan, Akib Mahmud; Shawon, Jakaria; Halim, Mohammad A
2017-10-01
A major limitation in current molecular docking method is that of failure to account for receptor flexibility. Herein we report multiple receptor conformers based molecular docking as a practical alternative to account for the receptor flexibility. Multiple (forty) conformers of Mycobacterium Enoyl ACP Reductase (InhA) are generated from Molecular Dynamics simulation and twenty crystallographic structures of InhA bound to different inhibitors are obtained from the Protein Data Bank. Fluorine directed modifications are performed to currently available anti-tuberculosis drug ethionamide. The modified drugs are optimized using B3LYP 6-31G (d,p) level of theory. Dipole moment, frontier orbital gap and thermodynamical properties such as electronic energy, enthalpy and Gibbs free energy of these optimized drugs are investigated. These drugs are subsequently docked against the conformers of InhA. Molecular docking against multiple InhA conformations show variation in ligand binding affinity and suggest that Ser94, Gly96, Lys165 and Ile194 amino acids play critical role on strong drug-InhA interaction. Modified drug N1 showed greater binding affinity compared to EN in most conformations. Structure of PDB ID: 2NSD and snapshot conformer at 5.5ns show most favorable binding with N1 compared to other conformers. Fluorine participates in forming fluorine bonds and contributes significantly in increasing binding affinity. Our study reveal that addition of trifluoromethyl group explicitly shows promise in improving thermodynamic properties and in enhancing hydrogen bonding and non-bonded interactions. Molecular dynamics (MD) simulation show that EN and N1 remained in the binding pocket similar to the docked pose of EN-InhA and E1-InhA complexes and also suggested that InhA binds to its inhibitor in inhibitor-induced folding manner. ADMET calculations predict modified drugs to have improved pharmacokinetic properties. Our study concludes that multiple receptor conformers based
Lledó, S.; Alfonso, R.; Aliño, S. F.
2005-01-01
Aim: to test the efficacy of anti-k-ras and antitelomerase oligonucleotides for disabling colorectal cancer cell growth. Material and methods: an established human colorectal cancer cell line (SW 480, ATTC®) was used. Oligodeoxiribonucleotides (ODNs) have a phosphorotioate modification to ensure intracellular intake. We used an antitelomerase ODN (Telp5) and two anti-k-ras ODNs (AS-KRAS and ISIS). AS-KRAS is designed to join the k-ras oncogene's exon 1. ISIS links to the terminal transcriptio...
Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor
Directory of Open Access Journals (Sweden)
María Martínez-Hoyos
2016-06-01
Full Text Available Despite being one of the first antitubercular agents identified, isoniazid (INH is still the most prescribed drug for prophylaxis and tuberculosis (TB treatment and, together with rifampicin, the pillars of current chemotherapy. A high percentage of isoniazid resistance is linked to mutations in the pro-drug activating enzyme KatG, so the discovery of direct inhibitors (DI of the enoyl-ACP reductase (InhA has been pursued by many groups leading to the identification of different enzyme inhibitors, active against Mycobacterium tuberculosis (Mtb, but with poor physicochemical properties to be considered as preclinical candidates. Here, we present a series of InhA DI active against multidrug (MDR and extensively (XDR drug-resistant clinical isolates as well as in TB murine models when orally dosed that can be a promising foundation for a future treatment.
Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong
2017-10-01
Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.
Protection of CpG ODN 1826 against radiation pulmonary fibrosis in rats
International Nuclear Information System (INIS)
Li Xuan; Qiao Tiankui; Zhuang Xibing; Zhang Jihong
2014-01-01
Objective: To explore the protectional function of CpG ODN 1826 against radiation pulmonary fibrosis in rats. Methods: The rat left lung was exposed to 20 Gy of 6 MV X-rays for establishing a radiation pulmonary fibrosis model. SD rats were randomly divided into control group, irradiated group and intervention group, with 30 rats in each group. CpG ODN 1826 was intraperitoneally injected into rats at 0, 1, 2, 5 and 7 d post-irradiation. The rats were terminated at 5, 15, 30 and 90 d post-irradiation, and the lung indexes were recorded. Paraffin sections of the radiated lung were conducted with HE staining and Masson staining, the pulmonary fibrosis scores were recorded. The serum concentrations of TGF-β1 and hydroxyproline (Hyp) were measured. Results: The radiation pulmonary fibrosis rat model was successfully established. The lung indexes of the control group were lower than those of the irradiated and intervention groups at 5 d post-irradiation (t = 3.046, 2.252, P < 0.05). The lung indexes of the intervention group were lower than those of the irradiated group (t = 4.120, 5.226, 5.719, P < 0.05). Pulmonary fibrosis scores of intervention group were lower than those of irradiated group (t = 3.212, 4.959, P < 0.05). The serum concentrations of TGF-β1 of irradiated group were higher than those of the intervention group (t = 4.138, 5.924, 4.138, 5.924, P < 0.05). The Hyp in the lung of irradiated group was higher than that of intervention group (t = 7.527, 8.416, P < 0.05). Conclusions: CpG ODN1826 will not worse the radiation pulmonary fibrosis, on the contrary, it could reduce the serum concentrations of TGF-β1 and the lung content of Hyp in radiation pulmonary fibrosis, and protects rat against radiation pulmonary fibrosis. (authors)
Protection of Balb/c mice against infection with FMDV by immunostimulation with CpG oligonucleotides
DEFF Research Database (Denmark)
Kamstrup, Søren; Frimann, Tine; Barfoed, Annette Malene
2006-01-01
disease virus (FMDV). Susceptibility of Balb/c mice to infection with isolates from the different serotypes of FMDV was investigated, and, at the same time, the capacity of CpG ODN to modulate the infection was evaluated. Treatment with CpG significantly reduced viremia, disease and death in five of six...... serotypes, when compared to no treatment or treatment with a control ODN. The effect was observed when ODN was administered simultaneously with, or up to 12 h after, infection with FMDV, and lasted for 14 days post treatment. The potential application of CpG ODN for control of FMDV during an outbreak...
Neuroprotective effects of the gliopeptide ODN in an in vivo model of Parkinson's disease
DEFF Research Database (Denmark)
Bahdoudi, Seyma; Ghouili, Ikram; Hmiden, Mansour
2018-01-01
Parkinson's disease (PD) is a neurodegenerative disorder characterized by a progressive loss of dopamine (DA) neurons through apoptotic, inflammatory and oxidative stress mechanisms. The octadecaneuropeptide (ODN) is a diazepam-binding inhibitor (DBI)-derived peptide, expressed by astrocytes, which...
Directory of Open Access Journals (Sweden)
Suresha G. Shivalingamurthy
2018-05-01
Full Text Available In sugarcane, invertase enzymes play a key role in sucrose accumulation and are also involved in futile reactions where sucrose is continuously degraded during the pre- and post-harvest period, thereby reducing sugar yield and recovery. Invertase inhibitor (INVINH proteins play a key role in post-translation regulation of plant invertases through which sucrose hydrolysis is controlled. INVINH proteins are small (18 kDa members of the pectin methylesterase inhibitor superfamily and they are moderately conserved across plants. In the present study, we identified two INVINH genes from sugarcane, ShINH1 and ShINH2. In silico characterization of the encoded proteins revealed 43% sequence identity at the amino acid level, confirming the non-allelic nature of the proteins. The presence of putative signal peptide and subcellular targeting sequences revealed that ShINH1 and ShINH2 likely have apoplasmic and vacuolar localization, respectively. Experimental visualization of ShINH1–GFP revealed that ShINHI is indeed exported to the apoplast. Differential tissue-specific and developmental expression of ShINH1 between leaf, stalk, flower and root suggest that it plays a role in controlling source-sink metabolic regulation during sucrose accumulation in sugarcane. ShINH1 is expressed at relatively high levels in leaves and stalk compared to flowers and roots, and expression decreases significantly toward internodal maturity during stalk development. ShINH1 is expressed at variable levels in flowers with no specific association to floral maturity. Production of recombinant ShINH1 enabled experimental validation of protein function under in vitro conditions. Recombinant ShINH1 potently inhibited acid invertase (IC50 22.5 nM, making it a candidate for controlling pre- and post-harvest deterioration of sucrose in sugarcane. Our results indicate that ShINH1 and ShINH2 are likely to play a regulatory role in sucrose accumulation and contribute to the improvement
Jung, Myung-Hwa; Jung, Sung-Ju
2017-10-01
Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kostera J
2018-05-01
Full Text Available Joshua Kostera, Gregor Leckie, Klara Abravaya, Hong Wang Abbott Molecular, Abbott Laboratories, Des Plaines, IL, USA Introduction: The Abbott RealTime MTB RIF/INH Resistance Assay (RT MTB RIF/INH is an assay for the detection of rifampicin (RIF- and/or isoniazid (INH-resistant Mycobacterium tuberculosis (MTB. The assay can be used to test sputum, bronchial alveolar lavage, and N-Acetyl-L-Cysteine (NALC/NaOH pellets prepared from these samples. The assay can be used in direct testing mode, or in reflex mode following a MTB positive result produced by its companion assay, Abbott RT MTB. Methods: In this study, the direct testing mode was used to test paired sputum and NALC/NaOH pellets prepared from sputum collected from Bangladesh TB patients. One hundred and thirty two paired samples were tested. Results: The RT MTB RIF/INH inhibition rate was 0%. One hundred and twenty-two paired samples had results above the assay limit of detection and were analyzed by comparing with results from phenotypic drug sensitivity testing, GeneXpert MTB/RIF (Xpert, and MTBDR plus (Hain. RT MTB RIF/INH results were in good agreement with those of GeneXpert and Hain. Conclusion: The ability of this assay to detect RIF and INH resistance may contribute to the global control of multidrug resistant tuberculosis. Keywords: tuberculosis, rifampicin, isoniazid, resistance
Modulation of 5' splice site selection using tailed oligonucleotides carrying splicing signals
Directory of Open Access Journals (Sweden)
Elela Sherif
2006-01-01
Full Text Available Abstract Background We previously described the use of tailed oligonucleotides as a means of reprogramming alternative pre-mRNA splicing in vitro and in vivo. The tailed oligonucleotides that were used interfere with splicing because they contain a portion complementary to sequences immediately upstream of the target 5' splice site combined with a non-hybridizing 5' tail carrying binding sites for the hnRNP A1/A2 proteins. In the present study, we have tested the inhibitory activity of RNA oligonucleotides carrying different tail structures. Results We show that an oligonucleotide with a 5' tail containing the human β-globin branch site sequence inhibits the use of the 5' splice site of Bcl-xL, albeit less efficiently than a tail containing binding sites for the hnRNP A1/A2 proteins. A branch site-containing tail positioned at the 3' end of the oligonucleotide also elicited splicing inhibition but not as efficiently as a 5' tail. The interfering activity of a 3' tail was improved by adding a 5' splice site sequence next to the branch site sequence. A 3' tail carrying a Y-shaped branch structure promoted similar splicing interference. The inclusion of branch site or 5' splice site sequences in the Y-shaped 3' tail further improved splicing inhibition. Conclusion Our in vitro results indicate that a variety of tail architectures can be used to elicit splicing interference at low nanomolar concentrations, thereby broadening the scope and the potential impact of this antisense technology.
Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A
2017-07-05
Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.
A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.
Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M
2006-03-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.
Wu, Gui; Wu, Weigang; Zheng, Qixin; Li, Jingfeng; Zhou, Jianbo; Hu, Zhilei
2014-07-19
Local slow release implant provided long term and stable drug release in the lesion. The objective of this study was to fabricate biodegradable slow release INH/PLLA tablet via 3 dimensional printing technique (3DP) and to compare the drug release characteristics of three different structured tablets in vitro. Three different drug delivery systems (columnar-shaped tablet (CST), doughnut-shaped tablet (DST) and multilayer doughnut-shaped tablet (MDST)) were manufactured by the three dimensional printing machine and isoniazid was loaded into the implant. Dynamic soaking method was used to study the drug release characteristics of the three implants. MTT cytotoxicity test and direct contact test were utilized to study the biocompatibility of the implant. The microstructures of the implants' surfaces were observed with electron microscope. The PLLA powder in the tablet could be excellently combined through 3DP without disintegration. Electron microscope observations showed that INH distributed evenly on the surface of the tablet in a "nest-shaped" way, while the surface of the barrier layer in the multilayer doughnut shaped tablet was compact and did not contain INH. The concentration of INH in all of the three tablets were still higher than the effective bacteriostasis concentration (Isoniazid: 0.025 ~ 0.05 μg/ml) after 30 day's release in vitro. All of the tablets showed initial burst release of the INH in the early period. Drug concentration of MDST became stable and had little fluctuation starting from the 6th day of the release. Drug concentration of DST and CST decreased gradually and the rate of decrease in concentration was faster in DST than CST. MTT cytotoxicity test and direct contact test indicated that the INH-PLLA tablet had low cytotoxicity and favorable biocompatibility. Three dimensional printing technique was a reliable technique to fabricate complicated implants. Drug release pattern in MDST was the most stable among the three implants. It was
Semple, S C; Klimuk, S K; Harasym, T O; Dos Santos, N; Ansell, S M; Wong, K F; Maurer, N; Stark, H; Cullis, P R; Hope, M J; Scherrer, P
2001-02-09
Typical methods used for encapsulating antisense oligodeoxynucleotides (ODN) and plasmid DNA in lipid vesicles result in very low encapsulation efficiencies or employ cationic lipids that exhibit unfavorable pharmacokinetic and toxicity characteristics when administered intravenously. In this study, we describe and characterize a novel formulation process that utilizes an ionizable aminolipid (1,2-dioleoyl-3-dimethylammonium propane, DODAP) and an ethanol-containing buffer system for encapsulating large quantities (0.15--0.25 g ODN/g lipid) of polyanionic ODN in lipid vesicles. This process requires the presence of up to 40% ethanol (v/v) and initial formulation at acidic pH values where the DODAP is positively charged. In addition, the presence of a poly(ethylene glycol)-lipid was required during the formulation process to prevent aggregation. The 'stabilized antisense-lipid particles' (SALP) formed are stable on adjustment of the external pH to neutral pH values and the formulation process allows encapsulation efficiencies of up to 70%. ODN encapsulation was confirmed by nuclease protection assays and (31)P NMR measurements. Cryo-electron microscopy indicated that the final particles consisted of a mixed population of unilamellar and small multilamellar vesicles (80--140 nm diameter), the relative proportion of which was dependent on the initial ODN to lipid ratio. Finally, SALP exhibited significantly enhanced circulation lifetimes in mice relative to free antisense ODN, cationic lipid/ODN complexes and SALP prepared with quaternary aminolipids. Given the small particle sizes and improved encapsulation efficiency, ODN to lipid ratios, and circulation times of this formulation compared to others, we believe SALP represent a viable candidate for systemic applications involving nucleic acid therapeutics.
Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases
Directory of Open Access Journals (Sweden)
Xinxia Zhao
2016-03-01
Full Text Available Myostatin (MSTN is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs in tandem with single-stranded DNA oligonucleotides (ssODNs. We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals.
DEFF Research Database (Denmark)
Bon, Christel Le; Della Pia, Eduardo Antonio; Giusti, Fabrice
2014-01-01
'OligAPol' have been investigated. Grafting was performed by reacting an ODN carrying an amine-terminated arm with the carboxylates of A8-35. The use of OligAPol for trapping MPs and immobilizing them onto solid supports was tested using bacteriorhodopsin (BR) and the transmembrane domain of Escherichia...... coli outer membrane protein A (tOmpA) as model proteins. BR and OligAPol form water-soluble complexes in which BR remains in its native conformation. Hybridization of the ODN arm with a complementary ODN was not hindered by the assembly of OligAPol into particles, nor by its association with BR. BR....../OligAPol and tOmpA/OligAPol complexes could be immobilized onto either magnetic beads or gold nanoparticles grafted with the complementary ODN, as shown by spectroscopic measurements, fluorescence microscopy and the binding of anti-BR and anti-tOmpA antibodies. OligAPols provide a novel, highly versatile...
Directory of Open Access Journals (Sweden)
S. Lledó
2005-07-01
Full Text Available Aim: to test the efficacy of anti-k-ras and antitelomerase oligonucleotides for disabling colorectal cancer cell growth. Material and methods: an established human colorectal cancer cell line (SW 480, ATTC® was used. Oligodeoxiribonucleotides (ODNs have a phosphorotioate modification to ensure intracellular intake. We used an antitelomerase ODN (Telp5 and two anti-k-ras ODNs (AS-KRAS and ISIS. AS-KRAS is designed to join the k-ras oncogene's exon 1. ISIS links to the terminal transcription unit 5' of k-ras. Telp5 joins the template region of the hTR telomerase subunit. ODNs have been tested in different concentrations (1, 5, 10, 20 micromolar. Cell viability has been tested at 48 and 72 hours. Statistical analysis and graphic design were made with the statistical package "Analyzing Data with GraphPad Prism-1999", GraphPad Sofware Inc., San Diego CA©. We used the Student's t test for statistical analysis. Results: the lowest dose (1 µM was not effective. Using the highest dose (20 mM for 48 hours of combined AS-KRAS and Telp5 cell viability decreased to 99.67%. The rest of results varied depending on ODN type, dose, and exposure time. Conclusions: tested antisense ODNs stop colorectal cancer cell growth, and a combination of anti-telomerase and anti-k-ras is the most useful treatment. Efficacy is best with a higher dose and longer treatment period.Objetivo: evaluar la eficacia de oligonucleótidos anti k-ras y antitelomerasa para detener el crecimiento tumoral en el cáncer colorrectal. Material y métodos: se ha empleado una línea celular establecida de cáncer colorrectal humano (SW 480, ATTC®. Los oligodesoxirribonucleótidos (ODN utilizados en el presente trabajo presentan modificación fosforotioato con el fin de mejorar su estabilidad en presencia de fluidos biológicos. Hemos utilizado un ODN antitelomerasa (Telp5, y dos ODN anti k-ras (AS-KRAS e ISIS. AS-KRAS actúa en el exón 1 e ISIS actúa a nivel de la unidad terminal de
Zhao, Li; Shi, Jing; Sun, Ning; Tian, Shunlian; Meng, Xianfang; Liu, Xiaochun; Li, Lingli
2005-01-01
The effect of electroacupuncture (EA) on TRPM7 mRNA expression of focal cerebral ischemia in rats and further the role of EA in the relationship between TRPM7 and trkA pathway was investigated. Thirty SD rats were randomly divided into 5 groups : normal group, ischemia/reperfusion group, EA treated group (ischemic rats with EA treatment), TE infusion group (ischemic rats with EA treatment and TE buffer infusion), AS-ODN group (ischemic rats with EA treatment and antisense trkA oligonucleotide infusion). The stroke animal model was established by the modified method of middle cerebral artery occlusion. Antisense trkA oligonucleotide that blocked NGFs effects was injected into cerebroventricle before EA. The TRPM7 mRNA was detected by RT-PCR method. The results showed that there were low TRPM7 mRNA levels in cortex and hippocampus in normal group. Compared with normal group, TRPM7 mRNA expression was increased significantly in ischemia/reperfusion group (PPM7 mRNA was found in EA treated group in contrast to ischemia/reperfusion group (P<0.05). The expression of TRPM7 mRNA in AS-ODN group was remarkably increased compared with EA treated group and TE infusion group (P<0.05). The results indicated that TRPM7 channels in the ischemic cortex and hippocampus in rats might play a key role in ischemic brain injury. EA could reverse the overexpression of TRPM7 in cerebral ischemia/reperfusion rats. And the inhibitory effect of EA on TRPM7 channels might be through trkA pathway.
[Drug resistance reversal of HL-60/ADR cells by simultaneous suppression of XIAP and MRP].
Wang, Xiao-Fang; Wang, Chun; Qin, You-Wen; Yan, Shi-Ke; Gao, Yan-Rong
2006-12-01
This study was purposed to explore the mechanisms of drug resistance of HL-60/ADR cells and to compare the reversal drug-resistance effects of antisense oligonucleotides (AS ODN) of XIAP (X-linked inhibitor of apoptosis protein) and AS ODNs of MRP (multidrug resistance-associated protein) by use alone or in combination. Reverse transcription-PCR and Western blot were applied to detect the expression of XIAP, BCL-2, MRP and MDR1 in mRNA and protein levels of HL-60 cells and HL-60/ADR cells, respectively. Fully phosphorothioated AS ODN of XIAP and MRP was delivered into HL-60/ADR cells with Lipofectamine 2000 in the form of liposome-ODN complexes alone or in combination. CCK-8 cell viability assay was used to determine the effect of AS ODN of XIAP and MRP used alone or in combination on the chemotherapy sensitivity of HL-60/ADR cells to daunorubicin (DNR). Reverse transcription-PCR and Western blot were applied to examine the changes of XIAP, MRP in mRNA and protein levels respectively. The results showed that MRP and XIAP were both significantly higher in HL-60/ADR cells than those in HL-60 cells. AS ODN of XIAP and MRP down-regulated the expression of XIAP and MRP in HL-60/ADR cells and increased the sensitivity of HL-60/ADR cells to DNR, respectively. AS ODN of XIAP + MRP did not enhance the inhibition expression of XIAP in HL-60/ADR cells but increased the sensitivity of HL-60/ADR cells to DNR significantly as compared with AS ODN of XIAP (P MRP did not increase the concentration of DNR nor enhanced the inhibition expression of MRP in HL-60/ADR cells but increased the sensitivity of HL-60/ADR cells to DNR significantly (P MRP. It is concluded that both XIAP and MRP may be involved in the drug resistance mechanisms of HL-60/ADR cells. Drug-resistance of HL-60/ADR cells can be reversed significantly when antisense oligonucleotides of XIAP and MRP were used in combination.
Rapid Induction of Protective Immunity Against Biothreat Agents Using CPG-Based Oglionucleotides
National Research Council Canada - National Science Library
Klinman, Dennise
2001-01-01
This research project examines the ability of synthetic oligonucleotides (ODN) containing immunostimulatory 'CpG motifs' to trigger the innate immune system, thereby improving the host's ability to survive infection by biowarfare agents...
Rapid Induction of Protective Immunity Against Biothreat Agens Using CPG-Based Oglionucleotides
National Research Council Canada - National Science Library
Klinman, Dennis
1999-01-01
This research project examines the ability of synthetic oligonucleotides (ODN) containing immunostimulatory 'CpG' motifs to trigger the innate immune system, thereby improving the host's ability to survive infection by biowarfare agents...
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas
2014-02-27
Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.
Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka
2012-09-01
CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7
Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan
2017-12-01
Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.
The Medicinal Chemistry of Therapeutic Oligonucleotides.
Wan, W Brad; Seth, Punit P
2016-11-10
Oligonucleotide-based therapeutics have made rapid progress in the clinic for treatment of a variety of disease indications. Unmodified oligonucleotides are polyanionic macromolecules with poor drug-like properties. Over the past two decades, medicinal chemists have identified a number of chemical modification and conjugation strategies which can improve the nuclease stability, RNA-binding affinity, and pharmacokinetic properties of oligonucleotides for therapeutic applications. In this perspective, we present a summary of the most commonly used nucleobase, sugar and backbone modification, and conjugation strategies used in oligonucleotide medicinal chemistry.
Directory of Open Access Journals (Sweden)
Devita Kusdianingrum
2014-10-01
Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog
Kobayashi, Nobuaki; Hong, Choongman; Klinman, Dennis M.; Shirota, Hidekazu
2012-01-01
The primary goal of cancer immunotherapy is to elicit an immune response capable of eliminating the tumor. One approach towards accomplishing that goal utilizes general (rather than tumor-specific) immunomodulatory agents to boost the number and activity of pre-existing cytotoxic T lymphocytes. We find that the intra-tumoral injection of poly-G ODN has such an effect, boosting anti-tumor immunity and promoting tumor regression. The anti-tumor activity of polyguanosine (poly-G) oligonucleotides (ODN) was mediated through CD8 T cells in a TLR9 independent manner. Mechanistically, poly-G ODN directly induced the phosphorylation of Lck (an essential element of the T cell signaling pathway), thereby enhancing the production of IL-2 and CD8 T cell proliferation. These findings establish poly-G ODN as a novel type of cancer immunotherapy. PMID:23296706
Effects of INH, DNP, 2,4-D and CMU on the photosynthetic activity of barley and maize plants
International Nuclear Information System (INIS)
Fernandez, J.; Prieto, M. P.
1979-01-01
Determinations of the rate of photosynthesis were made in barley and maize leaves treated with INH, DNP, 2,4-D or CMU. 1 ppm of the chemicals in nutritive solutions was absorbed by roots during 24 or 48 hours in both dark and light conditions. After this period, photosynthetic activity, compensation point and 14 C O 2 assimilation were determined. Results show that INH increases the rate of photosynthesis, DNP and 2,4-D do not alter it sensibly and CMU acts as a strong inhibitor of photosynthesis. Some possible applications for ths obtention of labelled compounds by biosynthesis are discussed. (Author) 87 refs
Template-Directed Ligation of Peptides to Oligonucleotides
Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.
1996-01-01
Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.
Synthetic oligodeoxynucleotides (ODN) containing unmethylated Cytosine-Guanine (CpG) motifs mimic the immunostimulatory activity of bacterial DNA. CpG ODN directly stimulate B cells and plasmacytoid dendritic cells (pDC), promote the production of T Helper 1 cells (Th1) and pro-inflammatory cytokines, and trigger the maturation/activation of professional antigen presenting cells. The National Cancer Institute, Laboratory of Experimental Immunology, seeks interested parties to co- develop methods for inducing an immune response to tumors.
Directory of Open Access Journals (Sweden)
F Dabboussi
2015-01-01
Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.
Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.
Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn
2013-07-01
Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.
Electronic Structures of LNA Phosphorothioate Oligonucleotides
DEFF Research Database (Denmark)
Bohr, Henrik G.; Shim, Irene; Stein, Cy
2017-01-01
Important oligonucleotides in anti-sense research have been investigated in silico and experimentally. This involves quantum mechanical (QM) calculations and chromatography experiments on locked nucleic acid (LNA) phosphorothioate (PS) oligonucleotides. iso-potential electrostatic surfaces...
Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn
2013-01-01
Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986
International Nuclear Information System (INIS)
Zhang Yong; Chen Weizhen; Xie Yao; Gao Jinhui
2005-01-01
Objective: To provide experimental basis for antigene radiation therapy through exploring the effects of antigene strategy on androgen receptor (AR) expression and proliferation of prostate cancer cells. Methods: The triple-helix forming oligonucleotide (TFO) targeting 2447-2461nt of AR cDNA was designed and transfected LNCaP prostate cancer cells with liposome. 24-72 h after transfection, the cellular proliferation was detected by 3 H-thymidine (TdR) incorporation test, the expression of AR gene was examined by reverse transcription-polymerase chain reaction (RT-PCR) and expression of AR protein was performed by radioligand binding assay. The results of TFO were compared with antisense oligonucleotide (ASON). Results: At all time points, the AR expression levels in TFO group were markedly lower than that of ASON group (P<0.05). The inhibitory rate of TFO for cellular proliferation was significantly higher than that of ASON (P<0.05). Conclusion: The TFO was a potent inhibitor for AR expression and cell proliferation of LNCaP cells , and could be used in antigene radiotherapy. (authors)
International Nuclear Information System (INIS)
Celen, Burcu; Piskin, Erhan; Demirel, Goekhan
2011-01-01
The rapid and sensitive detection of DNA has recently attracted worldwide attention for a variety of disease diagnoses and detection of harmful bacteria in food and drink. In this paper, we carried out a comparative study based on surface plasmon resonance enhanced ellipsometry (SPREE) for the detection of oligodeoxynucleotides (ODNs) using micro- and nano-array platforms. The micro-arrayed surfaces were fabricated by a photolithography approach using different types of mask having varying size and shape. Well-ordered arrays of high aspect ratio polymeric nanotubes were also obtained using high molecular weight polystyrene (PS) and anodic aluminum oxide (AAO) membranes having 200 nm pore diameters. The SPREE sensors were then prepared by direct coupling of thiolated probe-ODNs, which contain suitable spacer arms, on gold-coated micro- and nano-arrayed surfaces. We experimentally demonstrated that, for the first time, gold-coated free standing polymeric nano-arrayed platforms can easily be produced and lead to a significant sensor sensitivity gain compared to that of the conventional SPREE surfaces of about four times. We believe that such an enhancement in sensor response could be useful for next generation sensor systems.
Celen, Burcu; Demirel, Gökhan; Piskin, Erhan
2011-04-01
The rapid and sensitive detection of DNA has recently attracted worldwide attention for a variety of disease diagnoses and detection of harmful bacteria in food and drink. In this paper, we carried out a comparative study based on surface plasmon resonance enhanced ellipsometry (SPREE) for the detection of oligodeoxynucleotides (ODNs) using micro- and nano-array platforms. The micro-arrayed surfaces were fabricated by a photolithography approach using different types of mask having varying size and shape. Well-ordered arrays of high aspect ratio polymeric nanotubes were also obtained using high molecular weight polystyrene (PS) and anodic aluminum oxide (AAO) membranes having 200 nm pore diameters. The SPREE sensors were then prepared by direct coupling of thiolated probe-ODNs, which contain suitable spacer arms, on gold-coated micro- and nano-arrayed surfaces. We experimentally demonstrated that, for the first time, gold-coated free standing polymeric nano-arrayed platforms can easily be produced and lead to a significant sensor sensitivity gain compared to that of the conventional SPREE surfaces of about four times. We believe that such an enhancement in sensor response could be useful for next generation sensor systems.
Immunostimulatory sutures that treat local disease recurrence following primary tumor resection
Energy Technology Data Exchange (ETDEWEB)
Intra, Janjira; Zhang Xueqing; Salem, Aliasger K [Division of Pharmaceutics, College of Pharmacy, University of Iowa, Iowa City, IA 52242 (United States); Williams, Robin L; Zhu Xiaoyan [Department of Surgery, Roy J and Lucille Carver College of Medicine, University of Iowa, Iowa City, IA 52242 (United States); Sandler, Anthony D, E-mail: aliasger-salem@uiowa.edu [Department of Surgery and Center for Cancer and Immunology Research, Children' s National Medical Center, Washington DC 20010 (United States)
2011-02-15
Neuroblastoma is a common childhood cancer that often results in progressive minimal residual disease after primary tumor resection. Cytosine-phosphorothioate-guanine oligonucleotides (CpG ODN) have been reported to induce potent anti-tumor immune responses. In this communication, we report on the development of a CpG ODN-loaded suture that can close up the wound following tumor excision and provide sustained localized delivery of CpG ODN to treat local disease recurrence. The suture was prepared by melt extruding a mixture of polylactic acid-co-glycolic acid (PLGA 75:25 0.47 dL g{sup -1}) pellets and CpG ODN 1826. Scanning electron microscopy images showed that the sutures were free of defects and cracks. UV spectrophotometry measurements at 260 nm showed that sutures provide sustained release of CpG ODN over 35 days. Syngeneic female A/J mice were inoculated subcutaneously with 1 x 10{sup 6} Neuro-2a murine neuroblastoma wild-type cells and tumors were grown between 5 to 10 mm before the tumors were excised. Wounds from the tumor resection were closed using CpG ODN-loaded sutures and/or polyglycolic acid Vicryl suture. Suppression of neuroblastoma recurrence and mouse survival were significantly higher in mice where wounds were closed using the CpG ODN-loaded sutures relative to all other groups. (communication)
Radio-marking and in vivo imagery of oligonucleotides
International Nuclear Information System (INIS)
Kuehnast, Bertrand
2000-01-01
This research thesis is part of activities aimed at the development of new molecules like oligonucleotides. Its first objective was the development and validation of a marking method with fluorine-18 of oligonucleotides for their in-vivo pharmacological assessment with positron emission tomography (PET). Further investigations addressed the use of iodine-125 for oligonucleotide marking purpose. This radio-marking, and in vivo and ex vivo imagery techniques are described, and their potential is highlighted for the pharmacological assessment of different oligonucleotides
Energy Technology Data Exchange (ETDEWEB)
Fernandez, J; Prieto, M P
1979-07-01
Determinations of the rate of photosynthesis were made in barley and maize leaves treated with INH, DNP, 2,4-D or CMU. 1 ppm of the chemicals in nutritive solutions was absorbed by roots during 24 or 48 hours in both dark and light conditions. After this period, photosynthetic activity, compensation point and 14{sup C}O{sub 2} assimilation were determined. Results show that INH increases the rate of photosynthesis, DNP and 2,4-D do not alter it sensibly and CMU acts as a strong inhibitor of photosynthesis. Some possible applications for ths obtention of labelled compounds by biosynthesis are discussed. (Author) 87 refs.
Directory of Open Access Journals (Sweden)
Alexander O Krogmann
Full Text Available Toll-like receptors (TLR of the innate immune system have been closely linked with the development of atherosclerotic lesions. TLR9 is activated by unmethylated CpG motifs within ssDNA, but also by CpG motifs in nucleic acids released during vascular apoptosis and necrosis. The role of TLR9 in vascular disease remains controversial and we sought to investigate the effects of a proinflammatory TLR9 stimulation in mice.TLR9-stimulation with high dose CpG ODN at concentrations between 6.25 nM to 30 nM induced a significant proinflammatory cytokine response in mice. This was associated with impaired reendothelialization upon acute denudation of the carotid and increased numbers of circulating endothelial microparticles, as a marker for amplified endothelial damage. Chronic TLR9 agonism in apolipoprotein E-deficient (ApoE-/- mice fed a cholesterol-rich diet increased aortic production of reactive oxygen species, the number of circulating endothelial microparticles, circulating sca-1/flk-1 positive cells, and most importantly augmented atherosclerotic plaque formation when compared to vehicle treated animals. Importantly, high concentrations of CpG ODN are required for these proatherogenic effects.Systemic stimulation of TLR9 with high dose CpG ODN impaired reendothelialization upon acute vascular injury and increased atherosclerotic plaque development in ApoE-/- mice. Further studies are necessary to fully decipher the contradictory finding of TLR9 agonism in vascular biology.
Peptide-LNA oligonucleotide conjugates
DEFF Research Database (Denmark)
Astakhova, I Kira; Hansen, Lykke Haastrup; Vester, Birte
2013-01-01
properties, peptides were introduced into oligonucleotides via a 2'-alkyne-2'-amino-LNA scaffold. Derivatives of methionine- and leucine-enkephalins were chosen as model peptides of mixed amino acid content, which were singly and doubly incorporated into LNA/DNA strands using highly efficient copper......(i)-catalyzed azide-alkyne cycloaddition (CuAAC) "click" chemistry. DNA/RNA target binding affinity and selectivity of the resulting POCs were improved in comparison to LNA/DNA mixmers and unmodified DNA controls. This clearly demonstrates that internal attachment of peptides to oligonucleotides can significantly...
Oligonucleotide-based theranostic nanoparticles in cancer therapy
Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban
2016-01-01
Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380
Rajabi, Mohsen; Struble, Evi; Zhou, Zhaohua; Karnaukhova, Elena
2012-01-01
Human C1-esterase inhibitor (C1-INH) is a multifunctional plasma protein with a wide range of inhibitory and non-inhibitory properties, mainly recognized as a key down-regulator of the complement and contact cascades. The potentiation of C1-INH by heparin and other glycosaminoglycans (GAGs) regulates a broad spectrum of C1-INH activities in vivo both in normal and disease states. SCOPE OF RESEARCH: We have studied the potentiation of human C1-INH by heparin using Surface Plasmon Resonance (SPR), circular dichroism (CD) and a functional assay. To advance a SPR for multiple-unit interaction studies of C1-INH we have developed a novel (consecutive double capture) approach exploring different immobilization and layout. Our SPR experiments conducted in three different design versions showed marked acceleration in C1-INH interactions with complement protease C1s as a result of potentiation of C1-INH by heparin (from 5- to 11-fold increase of the association rate). Far-UV CD studies suggested that heparin binding did not alter C1-INH secondary structure. Functional assay using chromogenic substrate confirmed that heparin does not affect the amidolytic activity of C1s, but does accelerate its consumption due to C1-INH potentiation. This is the first report that directly demonstrates a significant acceleration of the C1-INH interactions with C1s due to heparin by using a consecutive double capture SPR approach. The results of this study may be useful for further C-INH therapeutic development, ultimately for the enhancement of current C1-INH replacement therapies. Published by Elsevier B.V.
Decker, T; Schneller, F; Kronschnabl, M; Dechow, T; Lipford, G B; Wagner, H; Peschel, C
2000-05-01
CpG-oligodeoxynucleotides (CpG-ODN) have been shown to induce proliferation, cytokine production, and surface molecule regulation in normal and malignant human B cells. In the present study, we investigated the potential of CpG-ODN to induce functional high-affinity receptors in leukemic and normal B cells and the effects of costimulation with IL-2 on proliferation, cytokine secretion, and surface molecule regulation. Highly purified B cells from B-CLL patients and normal controls were stimulated with CpG-ODN with or without IL-2. Expression of CD25 was determined using FACS, and the presence of high-affinity IL-2 receptors was determined by scatchard analysis. Costimulatory effects of IL-2 and CpG-ODN were investigated using proliferation assays, ELISA (IL-6, TNF-alpha), and FACS analysis (CD80, CD86 expression). Reactivity of autologous and allogeneic T cells toward activated B-CLL cells was determined in mixed lymphocyte reactions and Interferon-gamma Elispot assays. The CpG-ODN DSP30 caused a significantly stronger induction of the IL-2 receptor alpha chain in malignant as compared with normal B cells (p = 0.03). This resulted in the expression of functional high-affinity IL-2 receptors in B-CLL cells, but fewer numbers of receptors with less affinity were expressed in normal B cells. Although addition of IL-2 to CpG-ODN-stimulated cells augmented proliferation in both normal B cells and B-CLL cells, no costimulatory effect on cytokine production or surface molecule expression could be observed in normal B cells. In contrast, TNF-alpha and IL-6 production was increased in B-CLL cells, and the expression of CD80 and CD86 was further enhanced when IL-2 was used as a costimulus. Autologous and allogeneic immune recognition of B-CLL cells stimulated with CpG-ODN and IL-2 was increased compared with B-CLL cells stimulated with CpG-ODN alone. Stimulation of B-CLL cells with CpG-ODN and IL-2 might be an attractive strategy for potential immunotherapies for B
Kostera, Joshua; Leckie, Gregor; Tang, Ning; Lampinen, John; Szostak, Magdalena; Abravaya, Klara; Wang, Hong
2016-12-01
Clinical management of drug-resistant tuberculosis patients continues to present significant challenges to global health. To tackle these challenges, the Abbott RealTime MTB RIF/INH Resistance assay was developed to accelerate the diagnosis of rifampicin and/or isoniazid resistant tuberculosis to within a day. This article summarizes the performance of the Abbott RealTime MTB RIF/INH Resistance assay; including reliability, analytical sensitivity, and clinical sensitivity/specificity as compared to Cepheid GeneXpert MTB/RIF version 1.0 and Hain MTBDRplus version 2.0. The limit of detection (LOD) of the Abbott RealTime MTB RIF/INH Resistance assay was determined to be 32 colony forming units/milliliter (cfu/mL) using the Mycobacterium tuberculosis (MTB) strain H37Rv cell line. For rifampicin resistance detection, the Abbott RealTime MTB RIF/INH Resistance assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Cepheid GeneXpert MTB/RIF. For isoniazid resistance detection, the assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Hain MTBDRplus. The performance data presented herein demonstrate that the Abbott RealTime MTB RIF/INH Resistance assay is a sensitive, robust, and reliable test for realtime simultaneous detection of first line anti-tuberculosis antibiotics rifampicin and isoniazid in patient specimens. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.
Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto
2013-03-14
The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].
Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides
Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.
1990-11-01
Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.
Synthesis and crystal structure of acid indium phosphite In(H3PO3)3
International Nuclear Information System (INIS)
Zakharova, B.S.; Chudinova, N.N.; Ilyhkhin, A.B.
1996-01-01
A group of isostructural acid phosphites of trivalent metals M(H 2 PO 3 ) 3 , where M 3 =V, Fe, Ga, In, was synthesized. Crystal structure of In(H 2 PO 3 ) 3 was determined. The compound crystallizes in hexagonal syngony, a = 8.414(2), c = 7.069(2) A, V = 433.3(2) A 3 , Z = 2, sp.gr. P6 3 . In (H 2 PO 3 ) 3 structure is of frame type. 9 refs.; 3 tabs
Electronic Structures of LNA Phosphorothioate Oligonucleotides
Directory of Open Access Journals (Sweden)
Henrik G. Bohr
2017-09-01
Full Text Available Important oligonucleotides in anti-sense research have been investigated in silico and experimentally. This involves quantum mechanical (QM calculations and chromatography experiments on locked nucleic acid (LNA phosphorothioate (PS oligonucleotides. iso-potential electrostatic surfaces are essential in this study and have been calculated from the wave functions derived from the QM calculations that provide binding information and other properties of these molecules. The QM calculations give details of the electronic structures in terms of e.g., energy and bonding, which make them distinguish or differentiate between the individual PS diastereoisomers determined by the position of sulfur atoms. Rules are derived from the electronic calculations of these molecules and include the effects of the phosphorothioate chirality and formation of electrostatic potential surfaces. Physical and electrochemical descriptors of the PS oligonucleotides are compared to the experiments in which chiral states on these molecules can be distinguished. The calculations demonstrate that electronic structure, electrostatic potential, and topology are highly sensitive to single PS configuration changes and can give a lead to understanding the activity of the molecules. Keywords: LNA phosphorothioate, DNA/LNA oligonucleotide, diastereoisomers, Hartree-Fock calculations, iso-potential surface, anion chromatograms
Sequence-dependent theory of oligonucleotide hybridization kinetics
International Nuclear Information System (INIS)
Marimuthu, Karthikeyan; Chakrabarti, Raj
2014-01-01
A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions
Effect of potassium channel modulators in mouse forced swimming test
Galeotti, Nicoletta; Ghelardini, Carla; Caldari, Bernardetta; Bartolini, Alessandro
1999-01-01
The effect of intracerebroventricular (i.c.v.) administration of different potassium channel blockers (tetraethylammonium, apamin, charybdotoxin, gliquidone), potassium channel openers (pinacidil, minoxidil, cromakalim) and aODN to mKv1.1 on immobility time was evaluated in the mouse forced swimming test, an animal model of depression. Tetraethylammonium (TEA; 5 μg per mouse i.c.v.), apamin (3 ng per mouse i.c.v.), charybdotoxin (1 μg per mouse i.c.v.) and gliquidone (6 μg per mouse i.c.v.) administered 20 min before the test produced anti-immobility comparable to that induced by the tricyclic antidepressants amitriptyline (15 mg kg−1 s.c.) and imipramine (30 mg kg−1 s.c.). By contrast pinacidil (10–20 μg per mouse i.c.v.), minoxidil (10–20 μg per mouse i.c.v.) and cromakalim (20–30 μg per mouse i.c.v.) increased immobility time when administered in the same experimental conditions. Repeated administration of an antisense oligonucleotide (aODN) to the mKv1.1 gene (1 and 3 nmol per single i.c.v. injection) produced a dose-dependent increase in immobility time of mice 72 h after the last injection. At day 7, the increasing effect produced by aODN disappeared. A degenerate mKv1.1 oligonucleotide (dODN), used as control, did not produce any effect in comparison with saline- and vector-treated mice. At the highest effective dose, potassium channels modulators and the mKv1.1 aODN did not impair motor coordination, as revealed by the rota rod test, nor did they modify spontaneous motility as revealed by the Animex apparatus. These results suggest that modulation of potassium channels plays an important role in the regulation of immobility time in the mouse forced swimming test. PMID:10323599
Silver and Cyanine Staining of Oligonucleotides in Polyacrylamide Gel.
Tang, Weizhong; Zhou, Huafu; Li, Wei
2015-01-01
To explore why some oligonucleotides in denaturing polyacrylamide gel could not be silver-stained, 134 different oligonucleotides were analyzed using denaturing polyacrylamide gel electrophoresis stained with silver and asymmetric cyanine. As a result, we found that the sensitivity of oligos (dA), (dC), (dG) and (dT) to silver staining could be ranged as (dA) > (dG) > (dC) > (dT) from high to low. It was unexpected that oligo (dT) was hard to be silver-stained. Moreover, the silver staining of an oligonucleotide containing base T could be partially or completely inhibited by base T. The inhibition of silver staining by base T was a competitive inhibition which could be affected by the amounts of the argyrophil nucleobase and base T, the cis-distance between the argyrophil nucleobase and base T, and the gel concentration. The changes of the intensity of an oligonucleotide band caused by the changes of DNA base composition were diverse and interesting. The intensity of some oligonucleotide bands would significantly change when the changes of DNA base composition accumulated to a certain extent (usually ≥ 4 nt). The sensitivity of cyanine staining of ≤ 11-nt long oligonucleotides could be enhanced about 250-fold by fixing the gels with methanol fixing solution.
A comparative analysis of measles virus RNA by oligonucleotide fingerprinting
International Nuclear Information System (INIS)
Stephenson, J.R.; Meulen, V. ter
1982-01-01
Isolates from two cases of acute measles, one case of acute measles encephalitis and three patients with subacute sclerosing panencephalitis were compared. This comparison was based upon the electrophoretic analysis of T 1 oligonucleotides from single-stranded, full-length RNA isolated from cytoplasmic nucleocapsids. Although all viruses have oligonucleotides in common, each isolate generated a unique pattern of oligonucleotides. However, no group of oligonucleotides was observed which would allow differentiation between viruses isolated from acute infections and those isolated from CNS diseases; indicating that probably all measles viruses differ in their nucleotide sequence, regardless of origin. (Author)
Jing, Weifang; Zhou, Jinrun; Wang, Chunyang; Qiu, Jianhua; Guo, Huijun; Li, Hongmei
2018-04-26
This study focuses on preparing the secretory recombinant J subgroup of avian leukosis virus (ALV-J) gp85 protein using Pichia pastoris and evaluating its immunoprotection as vaccine antigen combining with CpG-ODN adjuvant. The secretory recombinant plasmid pPIC9-gp85 containing ALV-J gp85 gene was designed and was transfected into the genome of P. pastoris (GS115) cells. The recombinant plasmid was expressed under the induction of methanol. The expressed products in the medium of the cells were purified and identified with endoglycosidase digestion assay and western blot mediated with monoclonal antibody (MAb) JE9. The purified product combining with CpG-ODN adjuvant was inoculated intramuscularly into 7-day-old chickens and three booster inoculations were performed on 21 days post first inoculation (dpfi), 42, and 56 dpfi. The antibody responses and cellular immune responses were detected, and the protective effects were analyzed after challenge with ALV-J. The results showed that the secretory pPIC9-gp85 plasmid was successfully constructed and could be stably expressed in GS115 cells. The expressed products were N-acetylglucosylated and could specifically combine with MAb (JE9). The secreted gp85 protein combining with CpG-ODN adjuvant could induce higher antibody response and spleen lymphocyte proliferation response and IFN-γ-inducing response, and could protect all the inoculated chickens against the viremia and the immunosuppressive lesions caused by ALV-J challenge. The results of neutralizing test in vitro suggested that the antisera with some ALV-J antibody titers could neutralize ALV-J strain and inhibit the growth of virus in vitro. The result of IFA showed that IgG antibody in the antisera could specifically combine with ALV-J strain in cells. It can be concluded that the secretory recombinant gp85 protein, as a new acetylglucosylated gp85 protein, was successfully prepared and combining with CpG-ODN adjuvant could protect the inoculated chickens
Energy Technology Data Exchange (ETDEWEB)
Kim, Min Ji; Hwang, Gil Tae [Kyungpook National University, Daegu (Korea, Republic of)
2016-08-15
Two new DNA probes bearing a fluorescent deoxyguanosine unit labeled with 2-ethynylfluorene (G{sup FL} )or 2-ethynylfluorenone (G{sup FO}) were synthesized and examined for their efficiency as quencher-free linear beacon probes. Oligodeoxynucleotides (ODNs) containing a G{sup FL} or G{sup FO} unit exhibit low thermal selectivity and few distinctive fluorescence changes upon duplex formation due to the syn conformation about the glycosidic bond. An exciplex emission was observed when the G{sup FL} unit of ODNs bearing adenine flanking bases was positioned opposite to the adenine nucleobases.
Oligonucleotide Therapy for Obstructive and Restrictive Respiratory Diseases
Directory of Open Access Journals (Sweden)
Wupeng Liao
2017-01-01
Full Text Available Inhaled oligonucleotide is an emerging therapeutic modality for various common respiratory diseases, including obstructive airway diseases like asthma and chronic obstructive pulmonary disease (COPD and restrictive airway diseases like idiopathic pulmonary fibrosis (IPF. The advantage of direct accessibility for oligonucleotide molecules to the lung target sites, bypassing systemic administration, makes this therapeutic approach promising with minimized potential systemic side effects. Asthma, COPD, and IPF are common chronic respiratory diseases, characterized by persistent airway inflammation and dysregulated tissue repair and remodeling, although each individual disease has its unique etiology. Corticosteroids have been widely prescribed for the treatment of asthma, COPD, and IPF. However, the effectiveness of corticosteroids as an anti-inflammatory drug is limited by steroid resistance in severe asthma, the majority of COPD cases, and pulmonary fibrosis. There is an urgent medical need to develop target-specific drugs for the treatment of these respiratory conditions. Oligonucleotide therapies, including antisense oligonucleotide (ASO, small interfering RNA (siRNA, and microRNA (miRNA are now being evaluated both pre-clinically and clinically as potential therapeutics. The mechanisms of action of ASO and siRNA are highly target mRNA specific, ultimately leading to target protein knockdown. miRNA has both biomarker and therapeutic values, and its knockdown by a miRNA antagonist (antagomir has a broader but potentially more non-specific biological outcome. This review will compile the current findings of oligonucleotide therapeutic targets, verified in various respiratory disease models and in clinical trials, and evaluate different chemical modification approaches to improve the stability and potency of oligonucleotides for the treatment of respiratory diseases.
Pan, Bifeng; Cui, Daxiang; Xu, Ping; Ozkan, Cengiz; Feng, Gao; Ozkan, Mihri; Huang, Tuo; Chu, Bingfeng; Li, Qing; He, Rong; Hu, Guohan
2009-03-01
With the aim of improving the amount and delivery efficiency of genes taken by carbon nanotubes into human cancer cells, different generations of polyamidoamine dendrimer modified multi-walled carbon nanotubes (dMNTs) were fabricated, and characterized by high-resolution transmission electron microscopy, atomic force microscopy, x-ray photoelectron spectroscopy, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis, revealing the presence of dendrimer capped on the surface of carbon nanotubes. The dMNTs fully conjugated with FITC-labeled antisense c-myc oligonucleotides (asODN), those resultant asODN-dMNTs composites were incubated with human breast cancer cell line MCF-7 cells and MDA-MB-435 cells, and liver cancer cell line HepG2 cells, and confirmed to enter into tumor cells within 15 min by laser confocal microscopy. These composites inhibited the cell growth in time- and dose-dependent means, and down-regulated the expression of the c-myc gene and C-Myc protein. Compared with the composites of CNT-NH2-asODN and dendrimer-asODN, no. 5 generation of dendrimer-modified MNT-asODN composites exhibit maximal transfection efficiencies and inhibition effects on tumor cells. The intracellular gene transport and uptake via dMNTs should be generic for the mammalian cell lines. The dMNTs have potentials in applications such as gene or drug delivery for cancer therapy and molecular imaging.
Energy Technology Data Exchange (ETDEWEB)
Pan Bifeng; Cui Daxiang; Xu Ping; Feng Gao; Huang Tuo; Li Qing; He Rong [Department of Bio-Nano-Science and Engineering, National Key Laboratory of Nano/Micro Fabrication Technology, Key Laboratory for Thin Film and Microfabrication of Ministry of Education, Institute of Micro-Nano Science and Technology, Shanghai JiaoTong University, 800 Dongchuan Road, Shanghai 200240 (China); Ozkan, Cengiz [Mechanical Engineering Department, University of California Riverside, 900 University Avenue-Riverside, CA 92521 (United States); Ozkan, Mihri [Electrical Engineering Department, University of California Riverside, 900 University Avenue, Riverside, CA 92521 (United States); Chu, Bingfeng [Department of Stomatology, General Hospital of PLA, 28 Fuxing Road, Beijing100853 (China); Hu Guohan [Department of Neurosurgery of Changzheng Hospital, 415 Fengyang Road, Second Military Medical University, Shanghai 20003 (China)], E-mail: dxcui@sjtu.edu.cn, E-mail: huguohan6504@sina.com
2009-03-25
With the aim of improving the amount and delivery efficiency of genes taken by carbon nanotubes into human cancer cells, different generations of polyamidoamine dendrimer modified multi-walled carbon nanotubes (dMNTs) were fabricated, and characterized by high-resolution transmission electron microscopy, atomic force microscopy, x-ray photoelectron spectroscopy, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis, revealing the presence of dendrimer capped on the surface of carbon nanotubes. The dMNTs fully conjugated with FITC-labeled antisense c-myc oligonucleotides (asODN), those resultant asODN-dMNTs composites were incubated with human breast cancer cell line MCF-7 cells and MDA-MB-435 cells, and liver cancer cell line HepG2 cells, and confirmed to enter into tumor cells within 15 min by laser confocal microscopy. These composites inhibited the cell growth in time- and dose-dependent means, and down-regulated the expression of the c-myc gene and C-Myc protein. Compared with the composites of CNT-NH{sub 2}-asODN and dendrimer-asODN, no. 5 generation of dendrimer-modified MNT-asODN composites exhibit maximal transfection efficiencies and inhibition effects on tumor cells. The intracellular gene transport and uptake via dMNTs should be generic for the mammalian cell lines. The dMNTs have potentials in applications such as gene or drug delivery for cancer therapy and molecular imaging.
International Nuclear Information System (INIS)
Pan Bifeng; Cui Daxiang; Xu Ping; Feng Gao; Huang Tuo; Li Qing; He Rong; Ozkan, Cengiz; Ozkan, Mihri; Chu, Bingfeng; Hu Guohan
2009-01-01
With the aim of improving the amount and delivery efficiency of genes taken by carbon nanotubes into human cancer cells, different generations of polyamidoamine dendrimer modified multi-walled carbon nanotubes (dMNTs) were fabricated, and characterized by high-resolution transmission electron microscopy, atomic force microscopy, x-ray photoelectron spectroscopy, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis, revealing the presence of dendrimer capped on the surface of carbon nanotubes. The dMNTs fully conjugated with FITC-labeled antisense c-myc oligonucleotides (asODN), those resultant asODN-dMNTs composites were incubated with human breast cancer cell line MCF-7 cells and MDA-MB-435 cells, and liver cancer cell line HepG2 cells, and confirmed to enter into tumor cells within 15 min by laser confocal microscopy. These composites inhibited the cell growth in time- and dose-dependent means, and down-regulated the expression of the c-myc gene and C-Myc protein. Compared with the composites of CNT-NH 2 -asODN and dendrimer-asODN, no. 5 generation of dendrimer-modified MNT-asODN composites exhibit maximal transfection efficiencies and inhibition effects on tumor cells. The intracellular gene transport and uptake via dMNTs should be generic for the mammalian cell lines. The dMNTs have potentials in applications such as gene or drug delivery for cancer therapy and molecular imaging.
Directory of Open Access Journals (Sweden)
Juan M. Rodríguez
2006-02-01
Full Text Available Oligonucleotides (ODNs of the PyNTTTTGT class directly stimulate B lymphocytes and plasmacytoid dendritic cells of the immune system of primates. Here we investigated the ability of the PyNTTTTGT ODN prototype IMT504 to regulate the expression of surface molecules and apoptosis in human B-chronic lymphocytic leukemia (CLL cells. The surface molecules CD25, CD40, CD80 and CD86 were up-regulated upon incubation of the B-CLL cells with IMT504. Co-stimulation with IL-2 resulted in further up-regulation. IMT504-activated B-CLL cells were also good stimulators of T cells in allogeneic mixed lymphocyte reactions and co-stimulation with IL-2 improved this stimulation capacity. Apoptosis of the B-CLL cells in vitro was also stimulated by incubation with IMT504. In this case, co-stimulation with IL-2 was not significant. Furthermore, B-CLL cells of all the patients studied developed an immunogenic phenotype and entered stimulated apoptosis upon in vitro incubation with IMT504 independently of the mutational status of their IgV H genes, becoming a good marker for tumor progression.Los oligonucleótidos (ODNs de tipo PyNTTTTGT estimulan directamente las células B y las células dendríticas plasmacitoides del sistema inmune de primates. En este trabajo, investigamos la habilidad del IMT504, prototipo de los ODN tipo PyNTTTTGT, para regular la expresión de moléculas de superficie y la apoptosis en células B de leucemia linfocítica crónica (LLC. La expresión de las moléculas de superficie CD25, CD40, CD80 y CD86 fue aumentada al incubar las células B-LLC con IMT504. La co-estimulación con IL-2 provocó un aumento mayor. Las células B-LLC activadas fueron buenas estimuladoras de las células T en cultivo mixto de linfocitos alogeneicos y la co-estimulación con IL-2 mejoró esta capacidad. La apoptosis de las células B-LLC también fue estimulada por incubación con IMT504. En este caso, la co-estimulación con IL-2 no fue significativa. Más a
Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis
Directory of Open Access Journals (Sweden)
Christoph Niemietz
2015-09-01
Full Text Available The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR, expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP. Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO and small interfering RNA (siRNA designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.
Raphel, Annette; Huber, John; Chandler, Carolyn; Vorenberg, Amy; Jones-Wilkins, Andy; Devey, Mark A.; Holford, Josie; Craig, Ian; Elam, Julie
2016-01-01
Ten years ago in July 2006, 64 mostly starry-eyed men and women attended the NAIS Institute for New Heads (INH) in order to learn the ropes of headship. These newly minted heads were filled with enthusiasm, commitment, and passion, along with humility and a bit of healthy trepidation. One core group connected under the careful guidance of…
Modern methods for the synthesis of peptide-oligonucleotide conjugates
International Nuclear Information System (INIS)
Zubin, Evgenii M; Oretskaya, Tat'yana S; Romanova, Elena A
2002-01-01
The published data on the methods of chemical solution and solid-phase synthesis of peptide-oligonucleotide conjugates are reviewed. The known methods are systematised and their advantages and disadvantages are considered. The approaches to the solution synthesis of peptide-oligonucleotide conjugates are systematised according to the type of chemical bonds between the fragments, whereas those to the solid-phase synthesis are classified according to the procedure used for the preparation of conjugates, viz., stepwise elongation of oligonucleotide and peptide chains on the same polymeric support or solid-phase condensation of two presynthesised fragments. The bibliography includes 141 references.
Venables, Noah C; Sellbom, Martin; Sourander, Andre; Kendler, Kenneth S; Joiner, Thomas E; Drislane, Laura E; Sillanmäki, Lauri; Elonheimo, Henrik; Parkkola, Kai; Multimaki, Petteri; Patrick, Christopher J
2015-04-30
Biobehavioral dispositions can serve as valuable referents for biologically oriented research on core processes with relevance to many psychiatric conditions. The present study examined two such dispositional variables-weak response inhibition (or disinhibition; INH-) and threat sensitivity (or fearfulness; THT+)-as predictors of the serious transdiagnostic problem of suicide risk in two samples: male and female outpatients from a U.S. clinic (N=1078), and a population-based male military cohort from Finland (N=3855). INH- and THT+ were operationalized through scores on scale measures of disinhibition and fear/fearlessness, known to be related to DSM-defined clinical conditions and brain biomarkers. Suicide risk was assessed by clinician ratings (clinic sample) and questionnaires (both samples). Across samples and alternative suicide indices, INH- and THT+ each contributed uniquely to prediction of suicide risk-beyond internalizing and externalizing problems in the case of the clinic sample where diagnostic data were available. Further, in both samples, INH- and THT+ interactively predicted suicide risk, with individuals scoring concurrently high on both dispositions exhibiting markedly augmented risk. Findings demonstrate that dispositional constructs of INH- and THT+ are predictive of suicide risk, and hold potential as referents for biological research on suicidal behavior. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields
Directory of Open Access Journals (Sweden)
Seyedeh Maryam Banihashemian
2013-09-01
Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.
Fully automated parallel oligonucleotide synthesizer
Czech Academy of Sciences Publication Activity Database
Lebl, M.; Burger, Ch.; Ellman, B.; Heiner, D.; Ibrahim, G.; Jones, A.; Nibbe, M.; Thompson, J.; Mudra, Petr; Pokorný, Vít; Poncar, Pavel; Ženíšek, Karel
2001-01-01
Roč. 66, č. 8 (2001), s. 1299-1314 ISSN 0010-0765 Institutional research plan: CEZ:AV0Z4055905 Keywords : automated oligonucleotide synthesizer Subject RIV: CC - Organic Chemistry Impact factor: 0.778, year: 2001
Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides
Golova, Julia B.; Chernov, Boris K.
2010-04-27
New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.
Effects of Atelocollagen Formulation Containing Oligonucleotide on Endothelial Permeability
Directory of Open Access Journals (Sweden)
Koji Hanai
2012-01-01
Full Text Available Atelocollagen is a major animal protein that is used as a highly biocompatible biomaterial. To date, atelocollagen has been used as an effective drug delivery technology to sustain the release of antitumor proteins and to enhance the antitumor activity of oligonucleotides in in vivo models. However, the biological effects of this technology are not fully understood. In the present study, we investigated the effects of atelocollagen on endothelial paracellular barrier function. An atelocollagen formulation containing oligonucleotides specifically increased the permeability of two types of endothelial cells, and the change was dependent on the molecular size, structure of the oligonucleotides used and the concentrations of the oligonucleotide and atelocollagen in the formulation. An immunohistochemical examination revealed that the formulation had effects on the cellular skeleton and intercellular structure although it did not affect the expression of adherens junction or tight junction proteins. These changes were induced through p38 MAP kinase signaling. It is important to elucidate the biological functions of atelocollagen in order to be able to exploit its drug delivery properties.
Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G
2018-05-01
Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.
Directory of Open Access Journals (Sweden)
Xiaolong Wang
Full Text Available Antisense oligonucleotides targeting microRNAs or their mRNA targets prove to be powerful tools for molecular biology research and may eventually emerge as new therapeutic agents. Synthetic oligonucleotides are often contaminated with highly homologous failure sequences. Synthesis of a certain oligonucleotide is difficult to scale up because it requires expensive equipment, hazardous chemicals and a tedious purification process. Here we report a novel thermocyclic reaction, polymerase-endonuclease amplification reaction (PEAR, for the amplification of oligonucleotides. A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease (PspGI cleavage releases monomeric duplex oligonucleotides. Each round of PEAR achieves over 100-fold amplification. The product can be used in one more round of PEAR directly, and the process can be further repeated. In addition to avoiding dangerous materials and improved product purity, this reaction is easy to scale up and amenable to full automation. PEAR has the potential to be a useful tool for large-scale production of antisense oligonucleotide drugs.
Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides
Tripathy, Sushant
Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing
Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.
Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin
2016-04-01
Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.
Functionalization of PVC membrane with ss oligonucleotides for a potentiometric biosensor.
Shishkanova, T V; Volf, R; Krondak, M; Král, V
2007-05-15
A novel application of a single stranded (ss) oligonucleotide as an active component of polymeric membrane in an ion-selective electrode (ISE) is described. The original oligonucleotides, oligo(dA)(15), modified by cholesterol, triphenylmethyl and hexadecyl derivatives, were immobilized into poly(vinyl chloride) (PVC) membrane using extraction protocol. In parallel, the adsorption protocol was used to immobilize unmodified oligo(dA)(15) on the PVC membrane based on tridodecylmethyammonium chloride (TDDMA(+)Cl(-)). Immobilization of ss oligonucleotide probe through spacer was more effective for the potentiometric detection of the hybridization between complementary oligonucleotides. It was found that cholesterol-oligo(dA)(15) modified membranes were sensitive toward complementary oligo(dT)(15) in the concentration range 2-80 nM at pH 7. An explanation for the detection mechanism is proposed.
Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.
Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro
2016-02-19
A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS.
Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays
DEFF Research Database (Denmark)
Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen
2003-01-01
with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added......Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer...... to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/....
Thermodynamics of Oligonucleotide Duplex Melting
Schreiber-Gosche, Sherrie; Edwards, Robert A.
2009-01-01
Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…
DEFF Research Database (Denmark)
Taskova, Maria; Madsen, Charlotte S.; Jensen, Knud J.
2017-01-01
Specific target binding and stability in diverse biological media is of crucial importance for applications of synthetic oligonucleotides as diagnostic and therapeutic tools. So far, these issues have been addressed by chemical modification of oligonucleotides and by conjugation with a peptide, m...... and makes internally labeled POCs an exciting object of study, i.e., showing high target specificity and simultaneous stability in biological media.......Specific target binding and stability in diverse biological media is of crucial importance for applications of synthetic oligonucleotides as diagnostic and therapeutic tools. So far, these issues have been addressed by chemical modification of oligonucleotides and by conjugation with a peptide......, most often at the terminal position of the oligonucleotide. Herein, we for the first time systematically investigate the influence of internally attached short peptides on the properties of antisense oligonucleotides. We report the synthesis and internal double labeling of 21-mer oligonucleotides...
International Nuclear Information System (INIS)
Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran
2016-01-01
Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer. - Highlights: • Core/shell type Iron oxide nanoparticles were used as a novel and efficient method. • This method increases exogenous DNA uptake by rooster spermatozoa. • Static magnetic field decreased DNA uptake by rooster spermatozoa.
Energy Technology Data Exchange (ETDEWEB)
Katebi, Samira; Esmaeili, Abolghasem, E-mail: aesmaeili@sci.ui.ac.ir; Ghaedi, Kamran
2016-03-15
Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer. - Highlights: • Core/shell type Iron oxide nanoparticles were used as a novel and efficient method. • This method increases exogenous DNA uptake by rooster spermatozoa. • Static magnetic field decreased DNA uptake by rooster spermatozoa.
Institute of Scientific and Technical Information of China (English)
岳少杰; 陶永光; 罗自强; 冯德云; 伍赶球
2001-01-01
Objective To investigate the relation between glutamate neurotoxicity and c-fos gene expression. Methods c-fos antisense oligonucleotides (AS ODN) was injected into the right lateral ventricles of 9 SD rats to block the c-fos gene expression in brain tissue. c-fos sense oligonucleotides (S ODN)was used a control. The numbers and morphology of neurons in both cerebral cortex and hippocampal CA1 were detected by MIAS-300 image analysing instrument. c-fos gene expression in brain was observed by immunohistochemical method. The content of water and electrolytes in the brain tissue and Ca2+ in the synapse were measured. Results The c-fos AS ODN blocked the c-fos gene expression and reduced the content of both water and sodium in brain tissue and Ca2+ in symptosome, thus alleviating the morphological damage in neuron. S ODN did not have such effect. Conclusion c-fos gene expression plays an important role in mediating the effect of glutamate neurotoxicity. Blocking the c-fos gene expression could antagonize glutamate neurotoxicity.%目的 探讨c-fos基因的表达在谷氨酸神经毒性中的作用。方法 在9只SD大鼠侧脑室注射c-fos反义寡核苷酸以阻断脑组织c-fos基因的表达,并用c-fos正义寡核苷酸为对照。观察脑组织中水、电解质含量和突触体内Ca2+浓度的变化,并采用细胞形态计量分析及免疫组织化学方法,观察大脑皮质、海马CA1区神经细胞数目、形态的变化及c-fos基因的表达。结果 c-fos反义寡核苷酸可有效地阻断脑组织c-fos基因的表达,降低脑组织c-fos阳性细胞率(9.4%±2.8%和74%±3%,P<0.01),抑制谷氨酸神经毒性所致的脑组织含水量(79.9%±0.4%和82.3%±0.8%,P<0.01)、钠(5.05 mg/g干重±0.39 mg/g干重和5.98 mg/g干重±0.50 mg/g干重,P<0.01)及细胞内Ca2+(176 nmol/L±35 nmol/L和344.12±50.13,P<0.01)含量的增加,抑制谷氨酸所致大脑皮质(157±10和145±7,P<0
Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku
2017-11-01
Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.
Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran
2016-03-01
Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (Prooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.
Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip
International Nuclear Information System (INIS)
Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong
2008-01-01
A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes
Folding Topology of a Short Coiled-Coil Peptide Structure Templated by an Oligonucleotide Triplex
DEFF Research Database (Denmark)
Lou, Chenguang; Christensen, Niels Johan; Martos Maldonado, Manuel Cristo
2017-01-01
by oligonucleotide duplex and triplex formation. POC synthesis was achieved by copper-free alkyne-azide cycloaddition between three oligonucleotides and a 23-mer peptide, which by itself exhibited multiple oligomeric states in solution. The oligonucleotide domain was designed to furnish a stable parallel triplex......, small-angle X-ray scattering (SAXS), and molecular modeling. Stabilizing cooperativity was observed between the trimeric peptide and the oligonucleotide triplex domains, and the overall molecular size (ca. 12nm) in solution was revealed to be independent of concentration. The topological folding...
DEFF Research Database (Denmark)
El-Sayed, Ahmed Ali; Pedersen, Erik B.; Khaireldin, Nahid Y.
2016-01-01
In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion of naphtha......In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion...... of naphthalimide (1H-benzo[de]isoquinoline-1,3(2H)-dione) as the intercalating nucleic acid. The stabilities of i-motif structures with inserted naphthalimide intercalating nucleotides were studied using UV melting temperatures (Tm) and circular dichroism spectra at different pH values and conditions (crowding...
Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O
2016-05-11
Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.
Directory of Open Access Journals (Sweden)
Kai Hoehlig
Full Text Available A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications.
Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.
Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang
2016-01-01
Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.
A Quantitative Tool for Producing DNA-Based Diagnostic Arrays
Energy Technology Data Exchange (ETDEWEB)
Tom J. Whitaker
2008-07-11
ODN. Studies were conducted using this technique and comparing the results of the radioactive label vs SIRIS measurements of Pt as a function of ODN length and distance of the Pt label from the attachment end. The SIRIS signal was not proportional to the amount of oligo attached to the surface as determined by the decay of the 33P label. We intentionally tested conditions under which one might expect the atomization efficiency to change and we believe this is the problem. Different lengths of oligos, and different placement of the label in the oligo affected the final signal. This obviously makes use of SIRIS as a quantitative tool for oligonucleotides problematic except under highly controlled situations.
Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June
2013-06-14
Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.
Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures
Energy Technology Data Exchange (ETDEWEB)
Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)
2016-10-15
Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.
International Nuclear Information System (INIS)
Wu Hanping; Feng Gansheng; Li Xin; Liang Huimin; Zheng Chuansheng
2003-01-01
Objective: To study the inhibitory effects of VEGF antisense oligodeoxynucleotides (asODN) on cultured Walker-256 cells' VEGF expression, and to observe the anti-tumor effects of intraarterial infusion of asODN mixed with lipiodol on rat liver cancer. Methods: VEGF asODN and sense ODN were added to the media of non-serum cultured Walker-256 cells, and the VEGF concentrations of the supernatants were detected by using ELISA 48 hours later. Cells of endothelial cell line ECV-304 were cultured in the supernatants. The growth of ECV-304 cells was observed by MTT method. 30 rats with Walker-256 carcinoma cells implanted into left liver lobe were randomly divided into 3 groups. 0.2 ml ultra-fluid lipiodol (UFLP group, n=10), 3OD asODN mixed with 0.2 ml ultra-fluid lipiodol (UFLP + asODN group, n=10), and 0.2 ml normal saline (control group, n=10) were infused into the hepatic artery. The volumes of tumors were measured by using MRI before and 7 days after the treatment. VEGF mRNA in cancerous and peri-cancerous tissues was detected by RT-PCR. The microvessel density (MVD) and VEGF expression were observed by immunohistochemistry. Results: asODN could inhibit Walker-256 cells' VEGF expression. The tumor growth rate was lower in UFLP + asODN group than that in UFLP and control groups [(140.1±33.8)%, (177.9±64.9)%, and (403.9± 69.4)%, respectively, F=60.02, P 0.05). The MVD in UFLP + asODN group (53.1±18.4) was significantly less than that of control group (73.2±20.4) and UFLP group (80.3±18.5) (F=5.44, P<0.05). Conclusion: VEGF asODN could inhibit VEGF expression of Walker-256 cells. It may be an antiangiogenesis therapy drug in malignant tumor. VEGF asODN mixed with UFLP in embolizing liver cancer could decrease liver cancer growth, VEGF expression, and microvessel density better than UFLP alone
Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.
2017-01-01
Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...
Challenges to oligonucleotides-based therapeutics for Duchenne muscular dystrophy
Directory of Open Access Journals (Sweden)
Goyenvalle Aurélie
2011-02-01
Full Text Available Abstract Antisense oligonucleotides are short nucleic acids designed to bind to specific messenger RNAs in order to modulate splicing patterns or inhibit protein translation. As such, they represent promising therapeutic tools for many disorders and have been actively developed for more than 20 years as a form of molecular medicine. Although significant progress has been made in developing these agents as drugs, they are yet not recognized as effective therapeutics and several hurdles remain to be overcome. Within the last few years, however, the prospect of successful oligonucleotides-based therapies has moved a step closer, in particular for Duchenne muscular dystrophy. Clinical trials have recently been conducted for this myopathy, where exon skipping is being used to achieve therapeutic outcomes. In this review, the recent developments and clinical trials using antisense oligonucleotides for Duchenne muscular dystrophy are discussed, with emphasis on the challenges ahead for this type of therapy, especially with regards to delivery and regulatory issues.
G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.
Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela
2015-09-22
Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.
International Nuclear Information System (INIS)
Zhang, Haimou; Qin, Gangjian; Liang, Gang; Li, Jinan; Chiu, Isaac; Barrington, Robert A.; Liu, Dongxu
2007-01-01
Increased expression of adhesion molecules by activated endothelium is a critical feature of vascular inflammation associated with the several diseases such as endotoxin shock and sepsis/septic shock. Our data demonstrated complement regulatory protein C1 inhibitor (C1INH) prevents endothelial cell injury. We hypothesized that C1INH has the ability of an anti-endothelial activation associated with suppression of expression of adhesion molecule(s). C1INH blocked leukocyte adhesion to endothelial cell monolayer in both static assay and flow conditions. In inflammatory condition, C1INH reduced vascular cell adhesion molecule (VCAM-1) expression associated with its cytoplasmic mRNA destabilization and nuclear transcription level. Studies exploring the underlying mechanism of C1INH-mediated suppression in VCAM-1 expression were related to reduction of NF-κB activation and nuclear translocation in an IκBα-dependent manner. The inhibitory effects were associated with reduction of inhibitor IκB kinase activity and stabilization of the NF-κB inhibitor IκB. These findings indicate a novel role for C1INH in inhibition of vascular endothelial activation. These observations could provide the basis for new therapeutic application of C1INH to target inflammatory processes in different pathologic situations
Avachat, Amelia M; Bhise, Satish B
2011-04-01
The front line antitubercular drugs rifampicin (RMP) and isoniazid (INH), when co-administered, face the problem of reduced bioavailability of RMP. Stabilization of RMP in the presence of INH under acidic environment may improve the bioavailability of RMP. In vitro degradation studies showed around 15-25% degradation of RMP under the aforesaid conditions if the ratio of RMP: INH is above 1:0.5.This degradation is reduced to less than 10% when the ratio of RMP: INH is below 1:0.25. Based on these findings, an innovative drug delivery system was designed with the immediate release of RMP and tailored prolonged release of INH. The bilayer tablets prepared with this concept were subjected to relative bioavailability studies in healthy human volunteers in an open label, balanced, randomized, single-dose, cross-over study under fasted state. A validated LC-MS/MS bioanalytical method was employed for estimation of RMP and INH in plasma. Bioavailability studies revealed that C(max) and AUC for RMP increased by 18 and 20%, respectively, confirming the above innovative concept. Even in the case of INH, AUC increased significantly by around 30% and thus time above minimum inhibitory concentration (MIC) would also increase, which may result in further improved clinical outcome.
Kupriushkin, M S; Pyshnyĭ, D V
2012-01-01
Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.
Triplex-forming ability of modified oligonucleotides
DEFF Research Database (Denmark)
Højland, Torben; Babu, Bolle Ravindra; Bryld, Torsten
2007-01-01
We present our studies on the ability of several different nucleotide analogs as triplex-forming oligonucleotides. The modifications tested include 4'-C-hydroxymethyl, LNA, 2'-amino-LNA and N2'-functionalized 2'-amino-LNA. Triplexes containing monomers of N2'-glycyl-functionalized 2'-amino-LNA ar...
Directory of Open Access Journals (Sweden)
Michael A Cook
Full Text Available BACKGROUND: Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. METHODOLOGY/PRINCIPAL FINDINGS: Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM, we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. CONCLUSIONS/SIGNIFICANCE: These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.
Backbone modified TBA analogues endowed with antiproliferative activity.
Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo
2017-05-01
The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.
Associating Oligonucleotides with Positively Charged Liposomes
Czech Academy of Sciences Publication Activity Database
Jurkiewicz, P.; Okruszek, A.; Hof, Martin; Langner, M.
2003-01-01
Roč. 8, č. 1 (2003), s. 77-84 ISSN 1425-8153 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : oligonucleotides * fluorescence correlation spectroscopy * DOTAP Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 0.455, year: 2003
THERAPEUTIC ANTISENSE OLIGONUCLEOTIDES AGAINST CANCER: HURDLING TO THE CLINIC
Directory of Open Access Journals (Sweden)
Pedro Miguel Duarte Moreno
2014-10-01
Full Text Available Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen, oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.
Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.
Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E
2005-02-01
Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. Copyright 2004 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Lykke Pedersen
2014-01-01
Full Text Available Antisense oligonucleotides complementary to RNA targets promise generality and ease of drug design. The first systemically administered antisense drug was recently approved for treatment and others are in clinical development. Chemical modifications that increase the hybridization affinity of oligonucleotides are reasoned to confer higher potency, i.e., modified oligonucleotides can be dosed at lower concentrations to achieve the same effect. Surprisingly, shorter and less affine oligonucleotides sometimes display increased potency. To explain this apparent contradiction, increased uptake or decreased propensity to form structures have been suggested as possible mechanisms. Here, we provide an alternative explanation that invokes only the kinetics behind oligonucleotide-mediated cleavage of RNA targets. A model based on the law of mass action predicts, and experiments support, the existence of an optimal binding affinity. Exaggerated affinity, and not length per se, is detrimental to potency. This finding clarifies how to optimally apply high-affinity modifications in the discovery of potent antisense oligonucleotide drugs.
Identification of clinically relevant viridans streptococci by an oligonucleotide array.
Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain
2005-04-01
Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.
Versatile functionalization of nanoelectrodes by oligonucleotides via pyrrole electrochemistry.
Descamps, Emeline; Nguyen, Khoa; Bouchain-Gautier, Christelle; Filoramo, Arianna; Goux-Capes, Laurence; Goffman, Marcello; Bourgoin, Jean-Philippe; Mailley, Pascal; Livache, Thierry
2010-11-15
Surface modification at the nanometer scale is a challenge for the future of molecular electronics. In particular, the precise anchoring and electrical addressing of biological scaffolds such as complex DNA nanonetworks is of importance for generating bio-directed assemblies of nano-objects for nanocircuit purposes. Herein, we consider the individual modification of nanoelectrodes with different oligonucleotide sequences by an electrochemically driven co-polymerization process of pyrrole and modified oligonucleotide sequences bearing pyrrole monomers. We demonstrate that this one-step technique presents the advantages of simplicity, localization of surface modification, mechanical, biological and chemical stability of the coatings, and high lateral resolution.
Review on investigations of antisense oligonucleotides with the use of mass spectrometry.
Studzińska, Sylwia
2018-01-01
Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.
Short hairpin-loop-structured oligodeoxynucleotides reduce HSV-1 replication
Directory of Open Access Journals (Sweden)
Heinrich Jochen
2009-04-01
Full Text Available Abstract The Herpes simplex virus (HSV is known as an infectious agent and widespread in the human population. The symptoms of HSV infections can range from mild to life threatening, especially in immune-compromised individuals. HSV infections are commonly treated with the guanosine analogue Aciclovir, but reports of resistance are increasing. Efforts are made to establish single-stranded antisense oligodeoxynucleotides (as and small interfering ribonucleic acids (siRNAs for antiviral treatment. Recently, another class of short interfering nucleic acids, partially double-stranded hairpin loop-structured 54 mer oligodeoxynucleotides (ODNs, was shown to allow hydrolysis of HIV RNA by binding to the viral RNA. This leads to a substrate for the viral RNase H. To assess the potential of such ODNs for inhibition of HSV-1 replication, five partially double-stranded ODNs were designed based on the sequences of known siRNAs against HSV-1 with antiviral activity. Three of them are directed against early and two against leaky late genes. Primary human lung fibroblasts, MRC-5, and African green monkey kidney cells, Vero, were transfected with ODNs and subsequently infected. The effect on HSV-1 replication was determined by analyzing the virus titer in cell culture supernatants by quantitative PCR and plaque assays. An inhibitory effect was observed with all five selected ODNs, with two cases showing statistical significance in both cell types. The observed effect was sequence-specific and dose dependent. In one case the ODN was more efficient than a previously described siRNA directed against the same target site in the mRNA of UL5, a component of the helicase/primase complex. HSV-1 virions and ODNs can be applied simultaneously without transfection reagent, but at a 50-fold higher concentration to Vero cells with similar efficiencies. The results underline the potential of partially double-stranded hairpin loop-structured ODNs as antiviral agents.
Detection of DNA oligonucleotides with base mutations by terahertz spectroscopy and microstructures.
Directory of Open Access Journals (Sweden)
Mingjie Tang
Full Text Available DNA oligonucleotides with a 5-base mutation at the 3'-terminus were investigated by terahertz (THz spectroscopy in a marker-free manner. The four single-stranded oligonucleotides with 17nt have been detected with specificity on a microfluidic chip, and corroborated by spectral measurements with split-ring resonators. The number of hydrogen bonds formed between the oligonucleotide and its surrounding water molecules, deemed a key contribution to the THz absorption of biological solutions, was explored by molecular dynamics simulations to explain the experimental findings. Our work underlies the feasibility of THz spectroscopy combined with microstructures for marker-free detection of DNA, which may form the basis of a prospective diagnostic tool for studying genic mutation.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian
2015-01-01
Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.
DEFF Research Database (Denmark)
Le, Bao T.; Hornum, Mick; Sharma, Pawan K.
2017-01-01
Chemically-modified antisense oligonucleotide-mediated exon-skipping has been validated as a therapeutic strategy for tackling several disease pathologies, particularly duchenne muscular dystrophy. To date, only sugar-modified and internucleotide linkage-modified oligonucleotide chemistries have...
Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito
2017-07-15
We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.
Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.
Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih
2014-02-01
Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.
Sparwasser, T; Vabulas, R M; Villmow, B; Lipford, G B; Wagner, H
2000-12-01
Receptors for conserved molecular patterns associated with microbial pathogens induce synthesis of co-stimulatory molecules and cytokines in immature dendritic cells (DC), as do antigen-reactive CD4 T helper cells via CD40 signaling. Once activated, antigen-presenting DC may activate CD8 T cell responses in a T helper cell-independent fashion. Using immunostimulatory CpG-oligonucleotides (ODN) mimicking bacterial CpG-DNA, we tested whether CpG-DNA bypasses the need for T helper cells in CTL responses towards proteins by directly activating antigen-presenting DC to transit into professional APC. We describe that immature DC in situ constitutively process soluble proteins and generate CD8 T cell determinants yet CD8 T cell responses remain abortive. Induction of primary antigen-specific CD8 cytotoxic T lymphocyte (CTL)-mediated responses becomes initiated in wild-type as well as T helper cell-deficient mice, provided soluble protein and CpG-ODN are draining into the same lymph node. Specifically we show that CpG-ODN trigger antigen-presenting immature DC within the draining lymph node to acutely up-regulate co-stimulatory molecules and produce IL-12. These results provide new insights for generating in vivo efficient CTL responses to soluble proteins which may influence vaccination strategies.
RNA detection in situ with FISH-STICs.
Sinnamon, John R; Czaplinski, Kevin
2014-02-01
The ability to detect RNA molecules in situ has long had important applications for molecular biological studies. Enzyme or dye-labeled antisense in vitro runoff transcripts and synthetic oligodeoxynucleotides (ODN) both have a proven track record of success, but each of these also has scientific and practical drawbacks and limitations to its use. We devised a means to use commercially synthesized oligonucleotides as RNA-FISH probes without further modification and show that such probes work well for detection of RNA in cultured cells. This approach can bind a high concentration of fluorescent ODN to a short stretch of an RNA using commercial DNA synthesis outlets available to any laboratory. We call this approach for creating in situ hybridization probes Fluorescence In Situ Hybridization with Sequential Tethered and Intertwined ODN Complexes (FISH-STICs). We demonstrate that one FISH-STIC probe can detect mRNA molecules in culture, and that probe detection can be improved by the addition of multiple probes that can be easily adapted for robust mRNA quantification. Using FISH-STICs, we demonstrate a nonoverlapping distribution for β-actin and γ-actin mRNA in cultured fibroblasts, and the detection of neuron-specific transcripts within cultured primary hippocampal neurons.
Thomsen, Dana; Lee, Chow H.
2014-01-01
Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3′UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862–3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862–3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions. PMID:24622399
Short G-rich oligonucleotides as a potential therapeutic for Huntington's Disease
Directory of Open Access Journals (Sweden)
Parekh-Olmedo Hetal
2006-10-01
Full Text Available Abstract Background Huntington's Disease (HD is an inherited autosomal dominant genetic disorder in which neuronal tissue degenerates. The pathogenesis of the disease appears to center on the development of protein aggregates that arise initially from the misfolding of the mutant HD protein. Mutant huntingtin (Htt is produced by HD genes that contain an increased number of glutamine codons within the first exon and this expansion leads to the production of a protein that misfolds. Recent studies suggest that mutant Htt can nucleate protein aggregation and interfere with a multitude of normal cellular functions. Results As such, efforts to find a therapy for HD have focused on agents that disrupt or block the mutant Htt aggregation pathway. Here, we report that short guanosine monotonic oligonucleotides capable of adopting a G-quartet structure, are effective inhibitors of aggregation. By utilizing a biochemical/immunoblotting assay as an initial screen, we identified a 20-mer, all G-oligonucleotide (HDG as an active molecule. Subsequent testing in a cell-based assay revealed that HDG was an effective inhibitor of aggregation of a fusion protein, comprised of a mutant Htt fragment and green fluorescent protein (eGFP. Taken together, our results suggest that a monotonic G-oligonucleotide, capable of adopting a G-quartet conformation is an effective inhibitor of aggregation. This oligonucleotide can also enable cell survival in PC12 cells overexpressing a mutant Htt fragment fusion gene. Conclusion Single-stranded DNA oligonucleotides capable of forming stable G-quartets can inhibit aggregation of the mutant Htt fragment protein. This activity maybe an important part of the pathogenecity of Huntington's Disease. Our results reveal a new class of agents that could be developed as a therapeutic approach for Huntington's Disease.
Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS
Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.
2012-06-01
A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.
i-Genome: A database to summarize oligonucleotide data in genomes
Directory of Open Access Journals (Sweden)
Chang Yu-Chung
2004-10-01
Full Text Available Abstract Background Information on the occurrence of sequence features in genomes is crucial to comparative genomics, evolutionary analysis, the analyses of regulatory sequences and the quantitative evaluation of sequences. Computing the frequencies and the occurrences of a pattern in complete genomes is time-consuming. Results The proposed database provides information about sequence features generated by exhaustively computing the sequences of the complete genome. The repetitive elements in the eukaryotic genomes, such as LINEs, SINEs, Alu and LTR, are obtained from Repbase. The database supports various complete genomes including human, yeast, worm, and 128 microbial genomes. Conclusions This investigation presents and implements an efficiently computational approach to accumulate the occurrences of the oligonucleotides or patterns in complete genomes. A database is established to maintain the information of the sequence features, including the distributions of oligonucleotide, the gene distribution, the distribution of repetitive elements in genomes and the occurrences of the oligonucleotides. The database can provide more effective and efficient way to access the repetitive features in genomes.
Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R
1996-03-01
In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.
Energy Technology Data Exchange (ETDEWEB)
Yu, Gi Weon; Kang, Yong Han [Dept. of Applied Chemistry, Hanyang University, Ansan (Korea, Republic of)
2016-11-15
This research focused on the method of using dimeric phosphoramidite blocks to synthesize oligonucleotides for development as oligonucleotide drugs. A 16-mer oligonucleotide with the randomly selected sequence of C*C*T*C*G*C *T*C*T*C*G*C*C* C*G*C was synthesized using CC, GC, and TC dimers, a combination of monomers and dimers, or only monomers as building blocks. Using dimer blocks in this synthetic method provided a significant decrease in critical impurities that had similar properties to the main product, which was confirmed by LC-MS and HPLC analysis.
Higuchi, Maiko; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira
2008-01-01
Nucleic acid-based drugs, such as antisense oligonucleotide, ribozyme, and small interfering RNA, are specific compounds that inhibit gene expression at the post-transcriptional level. To develop more effective nucleic acid-based drugs, we focused on photo-reactive antisense oligonucleotides. We have optimized the structure of psoralen-conjugated oligonucleotide to improve their sequence selectivity and photo-crosslinking efficiency. Previously, we reported that photo reactive oligonucleotides containing 2'-O-psoralenyl-methoxyethyl adenosine (2'-Ps-eom) showed drastic photo-reactivity with a strictly sequence specific manner in vitro. In this report, we evaluated the binding ability toward intracellular target mRNA. The 2'-Ps-eom selectively photo-cross-linked to the target mRNA extracted from cells. The 2'-Ps-eom also cross-linked to target mRNA in cells. Furthermore, 2'-Ps-eom did not cross-link to mRNA having a mismatch base. These results suggest that 2'-Ps-eom is a powerful antisense molecule to inhibit the expression of mRNA having a point mutation.
International Nuclear Information System (INIS)
Abel, B.; Aslan, K.
2012-01-01
This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization, where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan
2014-01-01
Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.
18F-labelling of oligonucleotides using succinimido 4-[18F]fluorobenzoat
International Nuclear Information System (INIS)
Hedberg, Elisabeth; Laangstroem, Bengt
1998-01-01
A general method for the labelling of oligodeoxynucleotide and oligonucleoside phosphorothioates in the 5'-position with the positron-emitting radionuclide 18 F (t 1/2 = 110 min) is described. The label was incorporated by the reaction of succinimido 4 -[ 18 F]fluorobenzoate 4 with oligonucleotides (18- and 20-mers) modified in the 5'-position with a hexylamine linker. Oligodeoxynucleotides 5'-GCT,AAG,CGA,TGC,CTC,CGT-3' (MTCa) and 5'-GAA,CCT,CTG,AGA,GTT,CAT,CT-3' (CROa) were labelled in 20±3 % (MTCa) and 13±3 % (CROa) radiochemical yields (non-isolated, decay-corrected and based on 4). Oligonucleoside phosphorotioates MTCa (S-MTCa) and CROa (S-CROa) were labelled in 9 and 7% isolated radiochemical yield, respectively (decay-corrected and based on 4). Labelled oligonucleotides and phosphorothioate analogues were separated from their unlabelled counterparts using reversed-phase perfusion chromatography. The molecular mass of a labelled oligonucleotide CROa was determined by ESI-MS after a mixed 18 F/ 19 F fluorobenzoate labelling experiment and corresponded with the expected structure. (au)
DEFF Research Database (Denmark)
Ries, Annika; Kumar, Rajesh; Lou, Chenguang
2016-01-01
Galactose-modified thymidine, LNA-T and 2'-amino-LNA-T nucleosides were synthesized, converted into the corresponding phosphoramidite derivatives and introduced into short oligonucleotides. Compared to the unmodified control strands, the galactose-modified oligonucleotides in general, and the N2'...
Positive regulation of plasmacytoid dendritic cell function via Ly49Q recognition of class I MHC
Tai, Lee-Hwa; Goulet, Marie-Line; Belanger, Simon; Toyama-Sorimachi, Noriko; Fodil-Cornu, Nassima; Vidal, Silvia M.; Troke, Angela D.; McVicar, Daniel W.; Makrigiannis, Andrew P.
2008-01-01
Plasmacytoid dendritic cells (pDCs) are an important source of type I interferon (IFN) during initial immune responses to viral infections. In mice, pDCs are uniquely characterized by high-level expression of Ly49Q, a C-type lectin-like receptor specific for class I major histocompatibility complex (MHC) molecules. Despite having a cytoplasmic immunoreceptor tyrosine-based inhibitory motif, Ly49Q was found to enhance pDC function in vitro, as pDC cytokine production in response to the Toll-like receptor (TLR) 9 agonist CpG-oligonucleotide (ODN) could be blocked using soluble monoclonal antibody (mAb) to Ly49Q or H-2Kb. Conversely, CpG-ODN–dependent IFN-α production by pDCs was greatly augmented upon receptor cross-linking using immobilized anti-Ly49Q mAb or recombinant H-2Kb ligand. Accordingly, Ly49Q-deficient pDCs displayed a severely reduced capacity to produce cytokines in response to TLR7 and TLR9 stimulation both in vitro and in vivo. Finally, TLR9-dependent antiviral responses were compromised in Ly49Q-null mice infected with mouse cytomegalovirus. Thus, class I MHC recognition by Ly49Q on pDCs is necessary for optimal activation of innate immune responses in vivo. PMID:19075287
Directory of Open Access Journals (Sweden)
Ingrid E C Verhaart
2014-01-01
Full Text Available Antisense-mediated exon skipping is currently in clinical development for Duchenne muscular dystrophy (DMD to amend the consequences of the underlying genetic defect and restore dystrophin expression. Due to turnover of compound, transcript, and protein, chronic treatment with effector molecules (antisense oligonucleotides will be required. To investigate the dynamics and persistence of antisense 2′-O-methyl phosphorothioate oligonucleotides, exon skipping, and dystrophin expression after dosing was concluded, mdx mice were treated subcutaneously for 8 weeks with 100 mg/kg oligonucleotides twice weekly. Thereafter, mice were sacrificed at different time points after the final injection (36 hours–24 weeks. Oligonucleotide half-life was longer in heart (~65 days compared with that in skeletal muscle, liver, and kidney (~35 days. Exon skipping half-lives varied between 33 and 53 days, whereas dystrophin protein showed a long half-life (>100 days. Oligonucleotide and exon-skipping levels peaked in the first week and declined thereafter. By contrast, dystrophin expression peaked after 3–8 weeks and then slowly declined, remaining detectable after 24 weeks. Concordance between levels of oligonucleotides, exon skipping, and proteins was observed, except in heart, wherein high oligonucleotide levels but low exon skipping and dystrophin expression were seen. Overall, these results enhance our understanding of the pharmacokinetics and pharmacodynamics of 2′-O-methyl phosphorothioate oligos used for the treatment of DMD.
Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako
2017-10-01
MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.
Directory of Open Access Journals (Sweden)
Roberta D'Agata
2017-01-01
Full Text Available Gold nanoparticles (AuNPs exhibit unique properties that can be modulated through a tailored surface functionalization, enabling their targeted use in biochemical sensing and medical diagnostics. In particular, streptavidin-modified AuNPs are increasingly used for biosensing purposes. We report here a study of AuNPs surface-functionalized with streptavidin-biotinylated oligonucleotide, focussing on the role played by the oligonucleotide probes in the stabilization/destabilization of the functionalized nanoparticle dispersion. The behaviour of the modified AuNP dispersion as a consequence of the competitive displacement of the biotinylated oligonucleotide has been investigated and the critical role of displaced oligonucletides in triggering the quasi one-dimensional aggregation of nanoparticles is demonstrated for the first time. The thorough understanding of the fundamental properties of bioconjugated AuNPs is of great importance for the design of highly sensitive and reliable functionalized AuNP-based assays.
2013-01-01
Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545
Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.
2010-01-01
Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts
Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc
2004-11-09
We present optical investigations on the conformation of oligonucleotide layers on Au surfaces. Our studies concentrate on the effect of varying surface coverage densities on the structural properties of layers of 12- and 24mer single-stranded DNA, tethered to the Au surface at one end while being labeled with a fluorescent marker at the opposing end. The distance-dependent energy transfer from the marker dye to the metal surface, which causes quenching of the observed fluorescence, is used to provide information on the orientation of the DNA strands relative to the surface. Variations in the oligonucleotide coverage density, as determined from electrochemical quantification, over 2 orders of magnitude are achieved by employing different preparation conditions. The observed enhancement in fluorescence intensity with increasing DNA coverage can be related to a model involving mutual steric interactions of oligonucleotides on the surface, as well as fluorescence quenching theory. Finally, the applicability of the presented concepts for investigations of heterogeneous monolayers is demonstrated by means of studying the coadsorption of mercaptohexanol onto DNA-modified Au surfaces.
Factor XI Antisense Oligonucleotide for Prevention of Venous Thrombosis
Büller, Harry R.; Bethune, Claudette; Bhanot, Sanjay; Gailani, David; Monia, Brett P.; Raskob, Gary E.; Segers, Annelise; Verhamme, Peter; Weitz, Jeffrey I.; Weitz, Jeffrey; Prins, Martin; Beenen, Ludo; Otten, Hans-Martin; Roos, Yvo; Slagboom, Ton; Vandenbriele, Christophe; Vanassche, Thomas; Dani, Vidhi; Schulz, Dan; Shapiro, Cara; Kwoh, Katherine; Jung, Bill; Gawinek-Samelczak, Agata; Kaemmer, Christina; Angelov, S.; Stavrev, V.; Kinov, P.; Dessouki, E.; Abuzgaya, F.; Baurovskis, A.; Peredistijs, A.; Petronis, S.; Danilyak, V.; Driagin, V.; Kuropatkin, G.; Parfeev, S.; Safronov, A.; Ankin, M.; Korzh, M.; Olinichenko, G.; Polivoda, A.; Shevchenko, V.; Sulyma, V.
2015-01-01
Background Experimental data indicate that reducing factor XI levels attenuates thrombosis without causing bleeding, but the role of factor XI in the prevention of postoperative venous thrombosis in humans is unknown. FXI-ASO (ISIS 416858) is a second-generation antisense oligonucleotide that
Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V
2010-01-01
The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.
Li, Huiyan; Sun, Xiaojuan; Xiao, Jinghua
2018-01-01
An excitatory-inhibitory recurrent neuronal network is established to numerically study the effect of inhibitory neurons on the synchronization degree of neuronal systems. The obtained results show that, with the number of inhibitory neurons and the coupling strength from an inhibitory neuron to an excitatory neuron increasing, inhibitory neurons can not only reduce the synchronization degree when the synchronization degree of the excitatory population is initially higher, but also enhance it when it is initially lower. Meanwhile, inhibitory neurons could also help the neuronal networks to maintain moderate synchronized states. In this paper, we call this effect as modulation effect of inhibitory neurons. With the obtained results, it is further revealed that the ratio of excitatory neurons to inhibitory neurons being nearly 4 : 1 is an economic and affordable choice for inhibitory neurons to realize this modulation effect.
Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy
Directory of Open Access Journals (Sweden)
Hongguang Sun
2014-01-01
Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.
Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.
Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O
1994-09-01
Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.
LNA-modified oligonucleotides mediate specific inhibition of microRNA function
DEFF Research Database (Denmark)
Ørom, Ulf Andersson; Kauppinen, Sakari; Lund, Anders H
2006-01-01
microRNAs are short, endogenous non-coding RNAs that act as post-transcriptional modulators of gene expression. Important functions for microRNAs have been found in the regulation of development, cellular proliferation and differentiation, while perturbed miRNA expression patterns have been...... observed in many human cancers. Here we present a method for specific inhibition of miRNA function through interaction with LNA-modified antisense oligonucleotides and report the specificity of this application. We show that LNA-modified oligonucleotides can inhibit exogenously introduced miRNAs with high...... specificity using a heterologous reporter assay, and furthermore demonstrate their ability to inhibit an endogenous miRNA in Drosophila melanogaster cells, leading to up-regulation of the cognate target protein. The method shows stoichiometric and reliable inhibition of the targeted miRNA and can thus...
DEFF Research Database (Denmark)
Bohlin, J; Skjerve, E; Ussery, David
2008-01-01
with here are mainly used to examine similarities between archaeal and bacterial DNA from different genomes. These methods compare observed genomic frequencies of fixed-sized oligonucleotides with expected values, which can be determined by genomic nucleotide content, smaller oligonucleotide frequencies......, or be based on specific statistical distributions. Advantages with these statistical methods include measurements of phylogenetic relationship with relatively small pieces of DNA sampled from almost anywhere within genomes, detection of foreign/conserved DNA, and homology searches. Our aim was to explore...... the reliability and best suited applications for some popular methods, which include relative oligonucleotide frequencies (ROF), di- to hexanucleotide zero'th order Markov methods (ZOM) and 2.order Markov chain Method (MCM). Tests were performed on distant homology searches with large DNA sequences, detection...
Characterization of rat brain NCAM mRNA using DNA oligonucleotide probes
DEFF Research Database (Denmark)
Andersson, A M; Gaardsvoll, H; Giladi, E
1990-01-01
A number of different isoforms of the neural cell adhesion molecule (NCAM) have been identified. The difference between these is due to alternative splicing of a single NCAM gene. In rat brain NCAM mRNAs with sizes of 7.4, 6.7, 5.2, 4.3 and 2.9 kb have been reported. We have synthesized six DNA...... oligonucleotides, that hybridize to different exons in the NCAM gene. Furthermore we have constructed three oligonucleotides, that exclusively hybridize to mRNAs lacking certain exons, by letting them consist of sequences adjacent to both sides of the splice sites. By means of these probes we have characterized...... the five NCAM mRNAs in rat brain....
Fernandez, Paula; Soria, Marcelo; Blesa, David; DiRienzo, Julio; Moschen, Sebastian; Rivarola, Maximo; Clavijo, Bernardo Jose; Gonzalez, Sergio; Peluffo, Lucila; Príncipi, Dario; Dosio, Guillermo; Aguirrezabal, Luis; García-García, Francisco; Conesa, Ana; Hopp, Esteban; Dopazo, Joaquín; Heinz, Ruth Amelia; Paniego, Norma
2012-01-01
Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs) curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de). The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons). The resulting Sunflower Unigen Resource (SUR version 1.0) was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls) and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (psunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement.
Development of Multiexon Skipping Antisense Oligonucleotide Therapy for Duchenne Muscular Dystrophy
Yokota, Toshifumi; Wood, Matthew J. A.
2013-01-01
Duchenne muscular dystrophy (DMD) is an incurable, X-linked progressive muscle degenerative disorder that results from the absence of dystrophin protein and leads to premature death in affected individuals due to respiratory and/or cardiac failure typically by age of 30. Very recently the exciting prospect of an effective oligonucleotide therapy has emerged which restores dystrophin protein expression to affected tissues in DMD patients with highly promising data from a series of clinical trials. This therapeutic approach is highly mutation specific and thus is personalised. Therefore DMD has emerged as a model genetic disorder for understanding and overcoming of the challenges of developing personalised genetic medicines. One of the greatest weaknesses of the current oligonucleotide approach is that it is a mutation-specific therapy. To address this limitation, we have recently demonstrated that exons 45–55 skipping therapy has the potential to treat clusters of mutations that cause DMD, which could significantly reduce the number of compounds that would need to be developed in order to successfully treat all DMD patients. Here we discuss and review the latest preclinical work in this area as well as a variety of accompanying issues, including efficacy and potential toxicity of antisense oligonucleotides, prior to human clinical trials. PMID:23984357
Lipid-modified G4-decoy oligonucleotide anchored to nanoparticles
DEFF Research Database (Denmark)
Cogoi, S; Jakobsen, U; Pedersen, E B
2016-01-01
KRAS is mutated in >90% of pancreatic ductal adenocarcinomas. As its inactivation leads to tumour regression, mutant KRAS is considered an attractive target for anticancer drugs. In this study we report a new delivery strategy for a G4-decoy oligonucleotide that sequesters MAZ, a transcription fa...
Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.
2017-08-01
Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.
Directory of Open Access Journals (Sweden)
Alain Destexhe
2010-03-01
Full Text Available Cortical neurons in vivo may operate in high-conductance states, in which the major part of the neuron's input conductance is due to synaptic activity, sometimes several-fold larger than the resting conductance. We examine here the contribution of inhibition in such high-conductance states. At the level of the absolute conductance values, several studies have shown that cortical neurons in vivo are characterized by strong inhibitory conductances. However, conductances are balanced and spiking activity is mostly determined by fluctuations, but not much is known about excitatory and inhibitory contributions to these fluctuations. Models and dynamic-clamp experiments show that, during high-conductance states, spikes are mainly determined by fluctuations of inhibition, or by inhibitory noise. This stands in contrast to low-conductance states, in which excitatory conductances determine spiking activity. To determine these contributions from experimental data, maximum likelihood methods can be designed and applied to intracellular recordings in vivo. Such methods indicate that action potentials are indeed mostly correlated with inhibitory fluctuations in awake animals. These results argue for a determinant role for inhibitory fluctuations in evoking spikes, and do not support feed-forward modes of processing, for which opposite patterns are predicted.
Directory of Open Access Journals (Sweden)
Muyrers Joep PP
2003-01-01
Full Text Available Abstract Background The phage protein pairs, RecE/RecT from Rac or Redα/Redβ from λ, initiate efficient double strand break repair (DSBR in Escherichia coli that has proven very useful for DNA engineering. These phage pairs initiate DSBR either by annealing or by another mechanism that is not defined. Results Here we report that these proteins also mediate single strand oligonucleotide repair (ssOR at high efficiencies. The ssOR activity, unlike DSBR, does not require a phage exonuclease (RecE or Redα but only requires a phage annealing protein (RecT or Redβ. Notably, the P22 phage annealing protein Erf, which does not mediate the same DSBR reactions, also delivers ssOR activity. By altering aspects of the oligonucleotides, we document length and design parameters that affect ssOR efficiency to show a simple relationship to homologies either side of the repair site. Notably, ssOR shows strand bias. Oligonucleotides that can prime lagging strand replication deliver more ssOR than their leading complements. This suggests a model in which the annealing proteins hybridize the oligonucleotides to single stranded regions near the replication fork. We also show that ssOR is a highly efficient way to engineer BACs and can be detected in a eukaryotic cell upon expression of a phage annealing protein. Conclusion Phage annealing proteins can initiate the recombination of single stranded oligonucleotides into endogenous targets in Escherichia coli at very high efficiencies. This expands the repertoire of useful DNA engineering strategies, shows promise for applications in eukaryotic cells, and has implications for the unanswered questions regarding DSBR mediated by RecE/RecT and Redα/Redβ.
DEFF Research Database (Denmark)
Nåbo, Lina J.; Madsen, Charlotte S.; Jensen, Knud J.
2015-01-01
Functionalized synthetic oligonucleotides are finding growing applications in research, clinical studies, and therapy. However, it is not easy to prepare them in a biocompatible and highly efficient manner. We report a new strategy to synthesize oligonucleotides with promising nucleic acid...... targeting and detection properties. We focus in particular on the pH sensitivity of these new probes and their high target specificity. For the first time, human copper(I)-binding chaperon Cox17 was applied to effectively catalyze click labeling of oligonucleotides. This was performed under ultramild...... conditions with fluorophore, peptide, and carbohydrate azide derivatives. In thermal denaturation studies, the modified probes showed specific binding to complementary DNA and RNA targets. Finally, we demonstrated the pH sensitivity of the new rhodamine-based fluorescent probes in vitro and rationalize our...
Oligonucleotide aptamers against tyrosine kinase receptors: Prospect for anticancer applications.
Camorani, Simona; Crescenzi, Elvira; Fedele, Monica; Cerchia, Laura
2018-04-01
Transmembrane receptor tyrosine kinases (RTKs) play crucial roles in cancer cell proliferation, survival, migration and differentiation. Area of intense research is searching for effective anticancer therapies targeting these receptors and, to date, several monoclonal antibodies and small-molecule tyrosine kinase inhibitors have entered the clinic. However, some of these drugs show limited efficacy and give rise to acquired resistance. Emerging highly selective compounds for anticancer therapy are oligonucleotide aptamers that interact with their targets by recognizing a specific three-dimensional structure. Because of their nucleic acid nature, the rational design of advanced strategies to manipulate aptamers for both diagnostic and therapeutic applications is greatly simplified over antibodies. In this manuscript, we will provide a comprehensive overview of oligonucleotide aptamers as next generation strategies to efficiently target RTKs in human cancers. Copyright © 2018 Elsevier B.V. All rights reserved.
Alsop, Eric B; Raymond, Jason
2013-01-01
Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.
Directory of Open Access Journals (Sweden)
Eric B Alsop
Full Text Available Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.
Directory of Open Access Journals (Sweden)
Tomcin S
2014-11-01
Full Text Available Stephanie Tomcin,1 Grit Baier,1 Katharina Landfester,1 Volker Mailänder1,21Max Planck Institute for Polymer Research, 2University Medical Center of the Johannes Gutenberg University, III Medical Clinic, Mainz, GermanyAbstract: For successful design of a nanoparticulate drug delivery system, the fate of the carrier and cargo need to be followed. In this work, we fluorescently labeled poly(n-butylcyanoacrylate (PBCA nanocapsules as a shell and separately an oligonucleotide (20 mer as a payload. The nanocapsules were formed by interfacial anionic polymerization on aqueous droplets generated by an inverse miniemulsion process. After uptake, the PBCA capsules were shown to be round-shaped, endosomal structures and the payload was successfully released. Cy5-labeled oligonucleotides accumulated at the mitochondrial membrane due to a combination of the high mitochondrial membrane potential and the specific molecular structure of Cy5. The specificity of this accumulation at the mitochondria was shown as the uncoupler dinitrophenol rapidly diminished the accumulation of the Cy5-labeled oligonucleotide. Importantly, a fluorescence resonance energy transfer investigation showed that the dye-labeled cargo (Cy3/Cy5-labeled oligonucleotides reached its target site without degradation during escape from an endosomal compartment to the cytoplasm. The time course of accumulation of fluorescent signals at the mitochondria was determined by evaluating the colocalization of Cy5-labeled oligonucleotides and mitochondrial markers for up to 48 hours. As oligonucleotides are an ideal model system for small interfering RNA PBCA nanocapsules demonstrate to be a versatile delivery platform for small interfering RNA to treat a variety of diseases.Keywords: drug delivery, mitochondria, miniemulsion, colocalization
Indian Academy of Sciences (India)
ODN7 and ODN17. 80-bp DNA. ODN8 and ODN18. 90-bp DNA. ODN9 and ODN19. 100-bp DNA. ODN10 and ODN20. Holliday junction. ODN21, ODN 22, ODN23 and ODN24. Replication fork. ODN 22, ODN 23, ODN 5 and ODN 6. 3' Flap. ODN 22, ODN 23 and ODN26. 5' Flap. ODN 22, ODN 23 and ODN27. 5' Overhang.
Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II; FINAL
International Nuclear Information System (INIS)
None
2000-01-01
The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank(reg s ign) finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5
Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop
2011-08-01
The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Maria Inês Moura Freixo
2004-02-01
Full Text Available Mycobacterium tuberculosis strains resistant to streptomycin (SM, isoniazid (INH, and/or rifampin (RIF as determined by the conventional Löwenstein-Jensen proportion method (LJPM were compared with the E test, a minimum inhibitory concentration susceptibility method. Discrepant isolates were further evaluated by BACTEC and by DNA sequence analyses for mutations in genes most often associated with resistance to these drugs (rpsL, katG, inhA, and rpoB. Preliminary discordant E test results were seen in 75% of isolates resistant to SM and in 11% to INH. Discordance improved for these two drugs (63% for SM and none for INH when isolates were re-tested but worsened for RIF (30%. Despite good agreement between phenotypic results and sequencing analyses, wild type profiles were detected on resistant strains mainly for SM and INH. It should be aware that susceptible isolates according to molecular methods might contain other mechanisms of resistance. Although reproducibility of the LJPM susceptibility method has been established, variable E test results for some M. tuberculosis isolates poses questions regarding its reproducibility particularly the impact of E test performance which may vary among laboratories despite adherence to recommended protocols. Further studies must be done to enlarge the evaluated samples and looked possible mutations outside of the hot spot sequenced gene among discrepant strains.
Sanstead, Paul J; Stevenson, Paul; Tokmakoff, Andrei
2016-09-14
Despite its important role in biology and nanotechnology, many questions remain regarding the molecular mechanism and dynamics by which oligonucleotides recognize and hybridize to their complementary sequence. The thermodynamics and kinetics of DNA oligonucleotide hybridization and dehybridization are often assumed to involve an all-or-nothing two-state dissociation pathway, but deviations from this behavior can be considerable even for short sequences. We introduce a new strategy to characterize the base-pair-specific thermal dissociation mechanism of DNA oligonucleotides through steady-state and time-resolved infrared spectroscopy. Experiments are interpreted with a lattice model to provide a structure-specific interpretation. This method is applied to a model set of self-complementary 10-base-pair sequences in which the placement of GC base pairs is varied in an otherwise AT strand. Through a combination of Fourier transform infrared and two-dimensional infrared spectroscopy, experiments reveal varying degrees of deviation from simple two-state behavior. As the temperature is increased, duplexes dissociate through a path in which the terminal bases fray, without any significant contribution from loop configurations. Transient temperature jump experiments reveal time scales of 70-100 ns for fraying and 10-30 μs for complete dissociation near the melting temperature. Whether or not frayed states are metastable intermediates or short-lived configurations during the full dissociation of the duplex is dictated by the nucleobase sequence.
Inhibitory coupling between inhibitory interneurons in the spinal cord dorsal horn
Directory of Open Access Journals (Sweden)
Ribeiro-da-Silva Alfredo
2009-05-01
Full Text Available Abstract Local inhibitory interneurons in the dorsal horn play an important role in the control of excitability at the segmental level and thus determine how nociceptive information is relayed to higher structures. Regulation of inhibitory interneuron activity may therefore have critical consequences on pain perception. Indeed, disinhibition of dorsal horn neuronal networks disrupts the balance between excitation and inhibition and is believed to be a key mechanism underlying different forms of pain hypersensitivity and chronic pain states. In this context, studying the source and the synaptic properties of the inhibitory inputs that the inhibitory interneurons receive is important in order to predict the impact of drug action at the network level. To address this, we studied inhibitory synaptic transmission in lamina II inhibitory interneurons identified under visual guidance in spinal slices taken from transgenic mice expressing enhanced green fluorescent protein (EGFP under the control of the GAD promoter. The majority of these cells fired tonically to a long depolarizing current pulse. Monosynaptically evoked inhibitory postsynaptic currents (eIPSCs in these cells were mediated by both GABAA and glycine receptors. Consistent with this, both GABAA and glycine receptor-mediated miniature IPSCs were recorded in all of the cells. These inhibitory inputs originated at least in part from local lamina II interneurons as verified by simultaneous recordings from pairs of EGFP+ cells. These synapses appeared to have low release probability and displayed potentiation and asynchronous release upon repeated activation. In summary, we report on a previously unexamined component of the dorsal horn circuitry that likely constitutes an essential element of the fine tuning of nociception.
Energy Technology Data Exchange (ETDEWEB)
Sebastiani, F.; Comez, L.; Sacchetti, F. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); CNR, Istituto Officina dei Materiali, Unità di Perugia, c/o Dipartimento di Fisica e Geologia, Università di Perugia, 06123 Perugia (Italy); Longo, M. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); Elettra—Sincrotrone Trieste, 34149 Basovizza, Trieste (Italy); Orecchini, A.; Petrillo, C.; Paciaroni, A., E-mail: alessandro.paciaroni@fisica.unipg.it [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); De Francesco, A. [CNR-IOM OGG c/o Institut Laue-Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France); Muthmann, M. [Jülich Centre for Neutron Science, Forschungszentrum Jülich GmbH, Outstation at Heinz Maier-Leibnitz Zentrum, Lichtenbergstrasse 1, 85747 Garching (Germany); Teixeira, S. C. M. [EPSAM, Keele University, Staffordshire ST5 5BG (United Kingdom); Institut Laue–Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France)
2015-07-07
The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.
Ikehara, M; Tezuka, T
1975-01-01
A dinucleoside monophosphate, 8,2'-anhydro-8-mercapto-9-beta-D-arabinofuranosyladenine phosphoryl-(3'-5')-inosine (AspI) was synthesized by the condensation of protected 8-mercapto-adenosine 2',3'-cyclic phosphate and 2',3'-isopropylideneinosine with diphenylphosphorochloridate. 8-Mercaptoadenosine 2',3'-cyclic phosphate was polymerized by using tetraphenyl pyrophosphate as the condensing reagent. As oligonucleotides, thus obtained, contained some uncyclized 8-mercaptoadenosine residues and were cleaved at these sites with 0.3N KOH. As 5'-phosphate was synthesized and polymerized with DCC to give oligonucleotides with chain lengths 2 to 9. PMID:170595
Gold nanocluster-based vaccines for dual-delivery of antigens and immunostimulatory oligonucleotides
Tao, Yu; Zhang, Yan; Ju, Enguo; Ren, Hui; Ren, Jinsong
2015-07-01
We here report a facile one-pot synthesis of fluorescent gold nanoclusters (AuNCs) via the peptide biomineralization method, which can elicit specific immunological responses. The as-prepared peptide-protected AuNCs (peptide-AuNCs) display strong red fluorescence, and more importantly, as compared to the peptide alone, the immune stimulatory ability of the resulting peptide-AuNCs can not only be retained, but can also be efficaciously enhanced. Moreover, through a dual-delivery of antigen peptides and cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs), the as-prepared peptide-AuNC-CpG conjugates can also act as smart self-vaccines to assist in the generation of high immunostimulatory activity, and be applied as a probe for intracellular imaging. Both in vitro and in vivo studies provide strong evidence that the AuNC-based vaccines may be utilized as safe and efficient immunostimulatory agents that are able to prevent and/or treat a variety of ailments.We here report a facile one-pot synthesis of fluorescent gold nanoclusters (AuNCs) via the peptide biomineralization method, which can elicit specific immunological responses. The as-prepared peptide-protected AuNCs (peptide-AuNCs) display strong red fluorescence, and more importantly, as compared to the peptide alone, the immune stimulatory ability of the resulting peptide-AuNCs can not only be retained, but can also be efficaciously enhanced. Moreover, through a dual-delivery of antigen peptides and cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs), the as-prepared peptide-AuNC-CpG conjugates can also act as smart self-vaccines to assist in the generation of high immunostimulatory activity, and be applied as a probe for intracellular imaging. Both in vitro and in vivo studies provide strong evidence that the AuNC-based vaccines may be utilized as safe and efficient immunostimulatory agents that are able to prevent and/or treat a variety of ailments. Electronic supplementary information (ESI
Energy Technology Data Exchange (ETDEWEB)
Awsiuk, K., E-mail: kamil.awsiuk@uj.edu.pl [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Rysz, J. [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Petrou, P. [Institute of Nuclear and Radiological Sciences and Technology, Energy and Safety, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece); Budkowski, A. [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Bernasik, A. [Faculty of Physics and Applied Computer Science, AGH-University of Science and Technology, Al. Mickiewicza 30, Kraków 30-059 (Poland); Kakabakos, S. [Institute of Nuclear and Radiological Sciences and Technology, Energy and Safety, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece); Marzec, M.M. [Faculty of Physics and Applied Computer Science, AGH-University of Science and Technology, Al. Mickiewicza 30, Kraków 30-059 (Poland); Raptis, I. [Institute for Advanced Materials, Physicochemical Processes, Nanotechnology and Microsystems, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece)
2014-01-30
To immobilize effectively oligonucleotide probes on SiO{sub 2} modified with (3-aminopropyl)triethoxysilane, four procedures based on streptavidin–biotin system are compared with Atomic Force Microscopy, Angle-Resolved X-ray Photoelectron Spectroscopy and Time-of-Flight Secondary Ion Mass Spectrometry. The first approach involves: adsorption of biotinylated Bovine Serum Albumin, blocking free surface sites with BSA, binding of streptavidin and biotinylated oligonucleotide (b-oligo). Final steps are exchanged in the second procedure with immobilization of preformed streptavidin–b-oligo conjugate. The third approach consists of streptavidin adsorption, blocking with BSA and b-oligo binding. Finally, streptavidin–b-oligo conjugate is immobilized directly within the fourth method. Surface coverage with biomolecules, determined from ARXPS, accords with average AFM height, and is anti-correlated with the intensity of Si+ ions. Higher biomolecular coverage was achieved during the last steps of the first (2.45(±0.38) mg/m{sup 2}) and second (1.31(±0.22) mg/m{sup 2}) approach, as compared to lower surface density resulting from the third (0.58(±0.20) mg/m{sup 2}) and fourth (0.41(±0.11) mg/m{sup 2}) method. Phosphorus atomic concentration indicates effectiveness of oligonucleotide immobilization. Secondary ions intensities, characteristic for oligonucleotides, streptavidin, BSA, and proteins, allow additional insight into overlayer composition. These measurements verify the ARXPS results and show the superiority of the first two immobilization approaches in terms of streptavidin and oligonucleotide density achieved onto the surface.
International Nuclear Information System (INIS)
Awsiuk, K.; Rysz, J.; Petrou, P.; Budkowski, A.; Bernasik, A.; Kakabakos, S.; Marzec, M.M.; Raptis, I.
2014-01-01
To immobilize effectively oligonucleotide probes on SiO 2 modified with (3-aminopropyl)triethoxysilane, four procedures based on streptavidin–biotin system are compared with Atomic Force Microscopy, Angle-Resolved X-ray Photoelectron Spectroscopy and Time-of-Flight Secondary Ion Mass Spectrometry. The first approach involves: adsorption of biotinylated Bovine Serum Albumin, blocking free surface sites with BSA, binding of streptavidin and biotinylated oligonucleotide (b-oligo). Final steps are exchanged in the second procedure with immobilization of preformed streptavidin–b-oligo conjugate. The third approach consists of streptavidin adsorption, blocking with BSA and b-oligo binding. Finally, streptavidin–b-oligo conjugate is immobilized directly within the fourth method. Surface coverage with biomolecules, determined from ARXPS, accords with average AFM height, and is anti-correlated with the intensity of Si+ ions. Higher biomolecular coverage was achieved during the last steps of the first (2.45(±0.38) mg/m 2 ) and second (1.31(±0.22) mg/m 2 ) approach, as compared to lower surface density resulting from the third (0.58(±0.20) mg/m 2 ) and fourth (0.41(±0.11) mg/m 2 ) method. Phosphorus atomic concentration indicates effectiveness of oligonucleotide immobilization. Secondary ions intensities, characteristic for oligonucleotides, streptavidin, BSA, and proteins, allow additional insight into overlayer composition. These measurements verify the ARXPS results and show the superiority of the first two immobilization approaches in terms of streptavidin and oligonucleotide density achieved onto the surface.
International Nuclear Information System (INIS)
Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo
2013-01-01
Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis
Tandem Oligonucleotide Probe Annealing and Elongation To Discriminate Viral Sequence
DEFF Research Database (Denmark)
Taskova, Maria; Uhd, Jesper; Miotke, Laura
2017-01-01
opportunities in transcriptome analysis, virology, and other fields. Herein, we report for the first time a "click" chemistry approach to oligonucleotide probe elongation as a novel approach to specifically detect a viral sequence. We hybridized a library of short, terminally labeled probes to Ebola virus RNA...
Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.
Directory of Open Access Journals (Sweden)
Mohammed Bakkali
Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein
Canello, Tamar; Ovadia, Haim; Refael, Miri; Zrihan, Daniel; Siegal, Tali; Lavon, Iris
2014-01-01
INTRODUCTION: Silencing of O(6)-methylguanine-DNA-methyltransferase (MGMT) in tumors, correlates with a better therapeutic response and with increased survival. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through binding of p65/NF-kappaB homodimers to the non-canonical NF-KappaB motif (MGMT-kappaB1) within MGMT enhancer. METHODS AND RESULTS: In an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA) modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN). Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to MGMT enhancer, the potential of the MGMT-kB1-LODN to enhance cell killing was studied in vitro in two glioma cell lines (T98G and U87) and a melanoma cell line (A375P). All three cell lines manifested a significant enhanced cell killing effect following exposure to temozolomide (TMZ) when first transfected with MGMT-kb1-LODN, and also induced a significant cell killing when administered as monotherapy. These results were confirmed also in-vivo on A375P Melanoma xenografts. Intratumoral (Intralesional - IL) injection of MGMT-kB1-LODN with or without IP injection of TMZ induced significant tumor growth inhibition either as a monotherapy or in combination with TMZ. The long-term effect of MGMT-kB1-LODN monotherapy was evaluated using a repetitive IL injection every 4 to 5 days for 55 days with either MGMT-κB1 LODN or control ODN or vehicle. A significant difference (p < 0.01) in tumor volume was obtained by MGMT-κB1-LODN compared to both control groups. Moreover, two out of the seven mice treated with MGMT-κB1-LODN demonstrated tumor regression by day 55 and no tumor recurrence was observed five months later. CONCLUSION: The results of these experiments show that the MGMT-kB1-LODN has a substantial antineoplastic effect when used either in combination with
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Directory of Open Access Journals (Sweden)
Gil Tae Hwang
2018-01-01
Full Text Available Sequence-specific detection of nucleic acids has been intensively studied in the field of molecular diagnostics. In particular, the detection and analysis of single-nucleotide polymorphisms (SNPs is crucial for the identification of disease-causing genes and diagnosis of diseases. Sequence-specific hybridization probes, such as molecular beacons bearing the fluorophore and quencher at both ends of the stem, have been developed to enable DNA mutation detection. Interestingly, DNA mutations can be detected using fluorescently labeled oligonucleotide probes with only one fluorophore. This review summarizes recent research on single-labeled oligonucleotide probes that exhibit fluorescence changes after encountering target nucleic acids, such as guanine-quenching probes, cyanine-containing probes, probes containing a fluorophore-labeled base, and microenvironment-sensitive probes.
Directory of Open Access Journals (Sweden)
Paula Fernandez
Full Text Available Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de. The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons. The resulting Sunflower Unigen Resource (SUR version 1.0 was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01 allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement.
Directory of Open Access Journals (Sweden)
Suzan M Hammond
2014-01-01
Full Text Available Splice switching oligonucleotides (SSOs induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, “ZEN™” to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2′-O-methyl (2′OMe oligonucleotide, increasing melting temperature and potency over unmodified 2′OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2′OMe phosphorothioate (PS oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2′OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.
Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah
2016-01-01
Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.
Characterization of peptide-oligonucleotide heteroconjugates by mass spectrometry.
Jensen, O N; Kulkarni, S; Aldrich, J V; Barofsky, D F
1996-01-01
Two peptide-oligothymidylic acids, prepared by joining an 11 residue synthetic peptide containing one internal carboxyl group (Asp side chain) to amino-linker-5'pdT6 and amino-linker-5'pdT10 oligonucleotides, were analyzed by matrix-assisted laser desorption/ionization (MALDI) on a linear time-of-flight mass spectrometer and by electrospray ionization (ESI) on a triple-quadrupole system. These synthetic compounds model peptide-nucleic acid heteroconjugates encountered in antisense research an...
Direct Mutagenesis of Thousands of Genomic Targets using Microarray-derived Oligonucleotides
DEFF Research Database (Denmark)
Bonde, Mads; Kosuri, Sriram; Genee, Hans Jasper
2015-01-01
Multiplex Automated Genome Engineering (MAGE) allows simultaneous mutagenesis of multiple target sites in bacterial genomes using short oligonucleotides. However, large-scale mutagenesis requires hundreds to thousands of unique oligos, which are costly to synthesize and impossible to scale-up by ...
DEFF Research Database (Denmark)
Straarup, Ellen Marie; Fisker, Niels; Hedtjärn, Maj
2010-01-01
-life as longer oligonucleotides. Pharmacology studies in both mice and non-human primates were conducted with a 13-mer LNA oligonucleotide against apoB, and the data showed that repeated dosing of the 13-mer at 1-2 mg/kg/week was sufficient to provide a significant and long lasting lowering of non...... using the LNA chemistry. Conclusively, we present a 13-mer LNA oligonucleotide with therapeutic potential that produce beneficial cholesterol lowering effect in non-human primates....
Technetium-99m labeled antisense oligonucleotide-noninvasive tumor imaging in mice
International Nuclear Information System (INIS)
Qin, G.M.; Zhang, Y.X.; An, R.; Gao, Z.R.; Cao, W.; Cao, G.X.; Hnatowich, D.J.
2002-01-01
Single-stranded RNA and DNA oligonucleotides may be useful as radiopharmaceuticals for antisense and other in vivo applications if convenient methods for stably attaching radionuclides such as 99m Tc can be developed. The c-myc oncogene works in cooperation with other oncogenes in a variety of malignant tumors. The concentration of c-myc messenger RNA increases rapidly 30 to 50 fold during DNA synthesis, thus making it a suitable target for following the progression of malignancy by noninvasive imaging with radiolabeled antisense oligonucleotide probes. Methods: 1 Oligonucleotide Conjugation: A solution of single stranded amine-derivatized DNA (100-1000μg) was prepared at a concentration of 2 mg/ml in 0.25M sodium bicarbonate, 1 M sodium chloride, 1mM EDTA, pH8.5. 2 Oligonucleotide Labeling: A fresh 50mg/ml solution of sodium tartrate was prepared in sterile 0.5 M ammonium The ability of the labeled DNA to hybridize to its complement was analyzed by Sep-Pak column chromatography before and after the addition of the complementary DNA. 3 Biodistribution and Tumor Imaging Studies: A colony of KM mice (15-20g) were inoculated with 1x10 6 Ehrlich carcinoma tumor cells in the right thigh, and the tumors were allowed to grow for 6-7 days to a size of 1.0-1.5 cm in diameter. Biodistribution studies were performed in 32 KM mice after 50 μCi per mouse of 99m Tc-labeled oncogene probes were injected intravenously. A total of 8 mice were injected intravenously in the tail vein with 1-2 mCi of 99m Tc-labeled sense or antisense probes, immobilized with ketamine hydrochloride and imaged periodically from 0.5hr to 24hr with a gamma camera. Results: Essentially complete conjugation was achieved by reverse-phase Sep-Pak C18 chromatography analysis. The labeled antisense DNA still remained the ability to hybridize with its complementary DNA. The highest accumulation of label was in the liver first, with the kidney and small bowel next. The injected activity localized in the lesion
Novel approaches to study low-energy electron-induced damage to DNA oligonucleotides
International Nuclear Information System (INIS)
Rackwitz, Jenny; Bald, Ilko; Ranković, Miloš Lj; Milosavljević, Aleksandar R
2015-01-01
The novel approach of DNA origami structures as templates for precise quantification of various well- defined oligonucleotides provides the opportunity to determine the sensitivity of complex DNA sequences towards low-energy electrons. (paper)
Preschool Inhibitory Control Predicts ADHD Group Status and Inhibitory Weakness in School.
Jacobson, Lisa A; Schneider, Heather; Mahone, E Mark
2017-12-26
Discriminative utility of performance measures of inhibitory control was examined in preschool children with and without ADHD to determine whether performance measures added to diagnostic prediction and to prediction of informant-rated day-to-day executive function. Children ages 4-5 years (N = 105, 61% boys; 54 ADHD, medication-naïve) were assessed using performance measures (Auditory Continuous Performance Test for Preschoolers-Commission errors, Conflicting Motor Response Test, NEPSY Statue) and caregiver (parent, teacher) ratings of inhibition (Behavior Rating Inventory of Executive Function-Preschool version). Performance measures and parent and teacher reports of inhibitory control significantly and uniquely predicted ADHD group status; however, performance measures did not add to prediction of group status beyond parent reports. Performance measures did significantly predict classroom inhibitory control (teacher ratings), over and above parent reports of inhibitory control. Performance measures of inhibitory control may be adequate predictors of ADHD status and good predictors of young children's classroom inhibitory control, demonstrating utility as components of clinical assessments. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Muller, E.
2002-01-01
Several oxidative processes induce the formation of DNA lesions. In order to evaluate the biological and structural significance of such damage, several DNA lesions were inserted into synthetic oligonucleotides at defined sites. The research work aimed at describing the preparation of oligonucleotides t hat contained DNA damage and the evaluation of the biological properties of the lesions. A first part described the incorporation of radiation-induced lesions, namely (5'S,6S)-5',6-cyclo-5,6-dihydro-2'-deoxyuridine and (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-desoxyuridine into oligonucleotides. The modified DNA fragments were characterised by several spectroscopic and biochemical analyses including ESI MS, MALDI-TOF MS, CLHP and enzymatic digestions. During in vitro DNA synthesis by Taq DNA polymerase and Klenow exo fragment, the pyrimidine cyclo-nucleosides were found to block the progression of the enzymes. Then, repair studies by ADN N glycosylases, operating in the base excision repair pathway, have shown that the anhydro-nucleoside lesions were not recognised nor excised by Fpg, endo III, endo VIII, yNtg1 yNtg2 and yOgg1. Interestingly, the Latococcus lactis Fpg protein recognises (formation of a non covalent complex) but do not excise the damage. The incorporation into oligonucleotides of the (5R*) and (5S*) diastereoisomers of 1-[2-deoxy-β-D-erythro-pentofuranosyl]-5-hydroxy-hydantoin, generated by several oxidative processes was then described. In vitro DNA replication assays using modified oligonucleotides matrix showed a lethal potential of the latter base damage. Repair studies by ADN N-glycosylases showed that the damage was substrate for Fpg, endo III, endo VIII, Ntg1, Ntg2 and Fpg-L1. The rates of excision as inferred from the determination of the Michaelis kinetics constants were found to be affected by the presence of the damage. MALDI-TOF MS was used in order to gain insights into mechanistic aspects of oligonucleotides cleavage by the
Energy Technology Data Exchange (ETDEWEB)
Guggenberg, Elisabeth von; Sader, Jayden A.; Wilson, John S.; Shahhosseini, Soraya; Koslowsky, Ingrid; Wuest, Frank [Edmonton PET Centre, Division of Oncologic Imaging, Department of Oncology, Cross Cancer Institute, 11560 University Ave, Edmonton, AB, T6G 1Z2 (Canada); Mercer, John R. [Edmonton PET Centre, Division of Oncologic Imaging, Department of Oncology, Cross Cancer Institute, 11560 University Ave, Edmonton, AB, T6G 1Z2 (Canada)], E-mail: johnmerc@cancerboard.ab.ca
2009-09-15
Alkylating agents have been shown to be very promising for the radiolabelling of oligonucleotides with fluorine-18. In this report we describe the fully automated synthesis of 2-bromo-N-[3-(2-[{sup 18}F]fluoropyridin-3-yloxy)propyl]acetamide ([{sup 18}F]FPyBrA) utilizing a modular synthesis unit. Reaction conditions for the coupling of this pyridine-based alkylating agent at the 5' end of a fully phosphorothioated random 20-mer DNA sequence were optimized to achieve very high radiochemical yields (>90%) and a maximum specific activity of 5-6 GBq/{mu}moL. The potential for rapid purification by solid phase extraction without need of chromatographic isolation of the radiolabelled oligonucleotide presents an overall benefit for the application of oligonucleotides in preclinical studies and potential clinical applications.
DEFF Research Database (Denmark)
Astakhova, Irina; Kumar, Santhosh T.; Wengel, Jesper
2011-01-01
efficiency of the resulting perylene-2'-amino-alpha-L-LNA monomer (T*) into synthetic oligonucleotides was significantly improved by replacement of the typically used 1H-tetrazole activator with pyridine hydrochloride. Generally, oligonucleotides containing monomer T* showed high binding affinity towards...... incorporations of monomers T* was quenched (quantum yield Phi(F) = 0.21) relative to duplexes of this probe with complementary DNA and RNA (Phi(F) = 0.42 and 0.35, respectively). On the contrary, a strong fluorescence quenching upon target binding was demonstrated by two short oligonucleotides of analogues...... sequences containing monomers T* at 5'- and 3'-terminal positions. We explain the hybridization-induced light-up effect observed for double-labeled probe by a reduction of fluorescence quenching due to precise positioning of the fluorophores within the double-stranded complexes. Furthermore, we propose...
Directory of Open Access Journals (Sweden)
Seyedeh Maryam Banihashemian
Full Text Available Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100, is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT. As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.
Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako
2015-12-16
MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.
Splice-correcting oligonucleotides restore BTK function in X-linked agammaglobulinemia model
DEFF Research Database (Denmark)
Bestas, Burcu; Moreno, Pedro M D; Blomberg, K Emelie M
2014-01-01
, splice-correcting oligonucleotides (SCOs) targeting mutated BTK transcripts for treating XLA. Both the SCO structural design and chemical properties were optimized using 2'-O-methyl, locked nucleic acid, or phosphorodiamidate morpholino backbones. In order to have access to an animal model of XLA, we...
Carlsson, Nils; Winge, Ann-Sofie; Engström, Sven; Akerman, Björn
2005-10-06
We used a cubic liquid crystal formed by the nonionic monoglyceride monoolein and water as a porous matrix for the electrophoresis of oligonucleotides. The diamond cubic phase is thermodynamically stable when in contact with a water-rich phase, which we exploit to run the electrophoresis in the useful submarine mode. Oligonucleotides are separated according to size and secondary structure by migration through the space-filling aqueous nanometer pores of the regular liquid crystal, but the comparatively slow migration means the cubic phase will not be a replacement for the conventional DNA gels. However, our demonstration that the cubic phase can be used in submarine electrophoresis opens up the possibility for a new matrix for electrophoresis of amphiphilic molecules. From this perspective, the results on the oligonucleotides show that water-soluble particles of nanometer size, typical for the hydrophilic parts of membrane-bound proteins, may be a useful separation motif. A charged contamination in the commercial sample of monoolein, most likely oleic acid that arises from its hydrolysis, restricts useful buffer conditions to a pH below 5.6.
Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P
2000-05-01
Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A
2018-06-05
Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.
Chen, I.-H.; Horikawa, S.; Xi, J.; Wikle, H. C.; Barbaree, J. M.; Chin, B. A.
2017-05-01
Phage based magneto-elastic (ME) biosensors have been shown to be able to rapidly detect Salmonella in various food systems to serve food pathogen monitoring purposes. In this ME biosensor platform, the free-standing strip-shaped magneto-elastic sensor is the transducer and the phage probe that recognizes Salmonella in food serves as the bio-recognition element. According to Sorokulova et al. at 2005, a developed oligonucleotide probe E2 was reported to have high specificity to Salmonella enterica Typhimurium. In the report, the specificity tests were focused in most of Enterobacterace groups outside of Salmonella family. Here, to understand the specificity of phage E2 to different Salmonella enterica serotypes within Salmonella Family, we further tested the specificity of the phage probe to thirty-two Salmonella serotypes that were present in the major foodborne outbreaks during the past ten years (according to Centers for Disease Control and Prevention). The tests were conducted through an Enzyme linked Immunosorbent Assay (ELISA) format. This assay can mimic probe immobilized conditions on the magnetoelastic biosensor platform and also enable to study the binding specificity of oligonucleotide probes toward different Salmonella while avoiding phage/ sensor lot variations. Test results confirmed that this oligonucleotide probe E2 was high specific to Salmonella Typhimurium cells but showed cross reactivity to Salmonella Tennessee and four other serotypes among the thirty-two tested Salmonella serotypes.
Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua
2016-01-26
Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application.
Shahmuradyan, Anna; Krull, Ulrich J
2016-03-15
Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.
The use of oligonucleotide probes for meningococcal serotype characterization
Directory of Open Access Journals (Sweden)
SACCHI Claudio Tavares
1998-01-01
Full Text Available In the present study we examine the potential use of oligonucleotide probes to characterize Neisseria meningitidis serotypes without the use of monoclonal antibodies (MAbs. Antigenic diversity on PorB protein forms the bases of serotyping method. However, the current panel of MAbs underestimated, by at least 50% the PorB variability, presumably because reagents for several PorB variable regions (VRs are lacking, or because a number of VR variants are not recognized by serotype-defining MAbs12. We analyzed the use of oligonucleotide probes to characterize serotype 10 and serotype 19 of N. meningitidis. The porB gene sequence for the prototype strain of serotype 10 was determined, aligned with 7 other porB sequences from different serotypes, and analysis of individual VRs were performed. The results of DNA probes 21U (VR1-A and 615U (VR3-B used against 72 N. meningitidis strains confirm that VR1 type A and VR3 type B encode epitopes for serotype-defined MAbs 19 and 10, respectively. The use of probes for characterizing serotypes possible can type 100% of the PorB VR diversity. It is a simple and rapid method specially useful for analysis of large number of samples.
2013-01-01
devices; however, DNA is not the only polymer that can take advantage of the specicity of the Watson – Crick base-pair to achieve these goals. Central to...14. ABSTRACT 16. SECURITY CLASSIFICATION OF: New nanoscale hetero-oligonucleotide tiles are assembled from DNA , RNA and morpholino oligos and...purified using size exclusion filtration. Homo-oligonucleotide tiles assembled from RP-cartridge processed DNA oligos are purified by nondenaturing gel
Thermoplastic polymers surfaces for Dip-Pen Nanolithography of oligonucleotides
International Nuclear Information System (INIS)
Suriano, Raffaella; Biella, Serena; Cesura, Federico; Levi, Marinella; Turri, Stefano
2013-01-01
Different thermoplastic polymers were spin-coated to prepare smooth surfaces for the direct deposition of end-group modified oligonucleotides by Dip-Pen Nanolithography. A study of the diffusion process was done in order to investigate the dependence of calibration coefficient and quality of deposited features on environmental parameters (temperature, relative humidity) and ink's molecular weight and functionality. The optimization of the process parameters led to the realization of high quality and density nanoarrays on plastics.
2013-01-01
Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different
Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression
Makino, Yuichi; Cao, Renhai; Svensson, Kristian; Bertilsson, Göran; Asman, Mikael; Tanaka, Hirotoshi; Cao, Yihai; Berkenstam, Anders; Poellinger, Lorenz
2001-11-01
Alteration of gene expression is a crucial component of adaptive responses to hypoxia. These responses are mediated by hypoxia-inducible transcription factors (HIFs). Here we describe an inhibitory PAS (Per/Arnt/Sim) domain protein, IPAS, which is a basic helix-loop-helix (bHLH)/PAS protein structurally related to HIFs. IPAS contains no endogenous transactivation function but demonstrates dominant negative regulation of HIF-mediated control of gene expression. Ectopic expression of IPAS in hepatoma cells selectively impairs induction of genes involved in adaptation to a hypoxic environment, notably the vascular endothelial growth factor (VEGF) gene, and results in retarded tumour growth and tumour vascular density in vivo. In mice, IPAS was predominantly expressed in Purkinje cells of the cerebellum and in corneal epithelium of the eye. Expression of IPAS in the cornea correlates with low levels of expression of the VEGF gene under hypoxic conditions. Application of an IPAS antisense oligonucleotide to the mouse cornea induced angiogenesis under normal oxygen conditions, and demonstrated hypoxia-dependent induction of VEGF gene expression in hypoxic corneal cells. These results indicate a previously unknown mechanism for negative regulation of angiogenesis and maintenance of an avascular phenotype.
Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan
2005-01-01
AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687
International Nuclear Information System (INIS)
Wallace, S.T.
1998-10-01
This Ph.D. thesis concerns the structural characterization of RNA. The work is split into two sections: 1) in vitro selection and characterization of RNAs which bind antibiotics and 2) crystal structure of a nuclease resistant RNA molecule used in antisense applications. Understanding antibiotic-RNA interactions is crucial in aiding rational drug design. We were interested in studying antibiotic interactions with RNAs small enough to characterize at the molecular and possibly at the atomic level. In order to do so, we previously performed in vitro selection to find small RNAs which bind to the peptide antibiotic viomycin and the aminoglycoside antibiotic streptomycin. The characterization of the viomycin-binding RNAs revealed the necessity of a pseudoknot-structure in order to interact with the antibiotic. The RNAs which were selected to interact with streptomycin require the presence of magnesium to bind the antibiotic. One of the RNAs, upon interacting with streptomycin undergoes a significant conformational change spanning the entire RNA sequence needed to bind the antibiotic. In a quest to design oligodeoxynucleotides (ODNs) which are able to specifically bid and inactivate the mRNA of a gene, it is necessary to fulfill two criteria: 1) increase binding affinity between the ODN and the target RNA and 2) increase the ODN's resistance to nuclease degradation. An ODN with an aminopropyl modification at the 2' position of its ribose has emerged as the most successful candidate at fulfilling both criteria. It is the most nuclease resistant modification known to date. We were interested in explaining how this modification is able to circumvent degradation by nucleases. A dodecamer containing a single 2'-O-aminopropyl modified nucleotide was crystallized and the structure was solved to a resolution of 1.6 A. In an attempt to explain the nuclease resistance, the crystal coordinates were modeled into the active exonuclease site of DNA polymerase I. We propose the
Directory of Open Access Journals (Sweden)
Magdalena Dzialo
2017-05-01
Full Text Available Chalcone synthase (CHS has been recognized as an essential enzyme in the phenylpropanoid biosynthesis pathway. Apart from the leading role in the production of phenolic compounds with many valuable biological activities beneficial to biomedicine, CHS is well appreciated in science. Genetic engineering greatly facilitates expanding knowledge on the function and genetics of CHS in plants. The CHS gene is one of the most intensively studied genes in flax. In our study, we investigated engineering of the CHS gene through genetic and epigenetic approaches. Considering the numerous restrictions concerning the application of genetically modified (GM crops, the main purpose of this research was optimization of the plant's modulation via epigenetics. In our study, plants modified through two methods were compared: a widely popular agrotransformation and a relatively recent oligodeoxynucleotide (ODN strategy. It was recently highlighted that the ODN technique can be a rapid and time-serving antecedent in quick analysis of gene function before taking vector-mediated transformation. In order to understand the molecular background of epigenetic variation in more detail and evaluate the use of ODNs as a tool for predictable and stable gene engineering, we concentrated on the integration of gene expression and gene-body methylation. The treatment of flax with a series of short oligonucleotides homologous to a different part of CHS gene isoforms revealed that those directed to regulatory gene regions (5′- and 3′-UTR activated gene expression, directed to non-coding region (introns caused gen activity reduction, while those homologous to a coding region may have a variable influence on its activity. Gene expression changes were accompanied by changes in its methylation status. However, only certain (CCGG motifs along the gene sequence were affected. The analyzed DNA motifs of the CHS flax gene are more accessible for methylation when located within a Cp
Chen, Wen; Djama, Zeinab Robleh; Coffey, Michael D; Martin, Frank N; Bilodeau, Guillaume J; Radmer, Lorien; Denton, Geoff; Lévesque, C André
2013-01-01
Most Phytophthora spp. are destructive plant pathogens; therefore, effective monitoring and accurate early detection are important means of preventing potential epidemics and outbreaks of diseases. In the current study, a membrane-based oligonucleotide array was developed that can detect Phytophthora spp. reliably using three DNA regions; namely, the internal transcribed spacer (ITS), the 5' end of cytochrome c oxidase 1 gene (cox1), and the intergenic region between cytochrome c oxidase 2 gene (cox2) and cox1 (cox2-1 spacer). Each sequence data set contained ≈250 sequences representing 98 described and 15 undescribed species of Phytophthora. The array was validated with 143 pure cultures and 35 field samples. Together, nonrejected oligonucleotides from all three markers have the ability to reliably detect 82 described and 8 undescribed Phytophthora spp., including several quarantine or regulated pathogens such as Phytophthora ramorum. Our results showed that a DNA array containing signature oligonucleotides designed from multiple genomic regions provided robustness and redundancy for the detection and differentiation of closely related taxon groups. This array has the potential to be used as a routine diagnostic tool for Phytophthora spp. from complex environmental samples without the need for extensive growth of cultures.
Differentiation of the seven major lyssavirus species by oligonucleotide microarray.
Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun
2012-03-01
An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.
PCR amplification on microarrays of gel immobilized oligonucleotides
Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei
2003-11-04
The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.
High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases
DEFF Research Database (Denmark)
Chen, Fuqiang; Pruett-Miller, Shondra M; Huang, Yuping
2011-01-01
Zinc-finger nucleases (ZFNs) have enabled highly efficient gene targeting in multiple cell types and organisms. Here we describe methods for using simple ssDNA oligonucleotides in tandem with ZFNs to efficiently produce human cell lines with three distinct genetic outcomes: (i) targeted point...
Analysis of oligonucleotide array experiments with repeated measures using mixed models
Directory of Open Access Journals (Sweden)
Getchell Thomas V
2004-12-01
Full Text Available Abstract Background Two or more factor mixed factorial experiments are becoming increasingly common in microarray data analysis. In this case study, the two factors are presence (Patients with Alzheimer's disease or absence (Control of the disease, and brain regions including olfactory bulb (OB or cerebellum (CER. In the design considered in this manuscript, OB and CER are repeated measurements from the same subject and, hence, are correlated. It is critical to identify sources of variability in the analysis of oligonucleotide array experiments with repeated measures and correlations among data points have to be considered. In addition, multiple testing problems are more complicated in experiments with multi-level treatments or treatment combinations. Results In this study we adopted a linear mixed model to analyze oligonucleotide array experiments with repeated measures. We first construct a generalized F test to select differentially expressed genes. The Benjamini and Hochberg (BH procedure of controlling false discovery rate (FDR at 5% was applied to the P values of the generalized F test. For those genes with significant generalized F test, we then categorize them based on whether the interaction terms were significant or not at the α-level (αnew = 0.0033 determined by the FDR procedure. Since simple effects may be examined for the genes with significant interaction effect, we adopt the protected Fisher's least significant difference test (LSD procedure at the level of αnew to control the family-wise error rate (FWER for each gene examined. Conclusions A linear mixed model is appropriate for analysis of oligonucleotide array experiments with repeated measures. We constructed a generalized F test to select differentially expressed genes, and then applied a specific sequence of tests to identify factorial effects. This sequence of tests applied was designed to control for gene based FWER.
Thermoplastic polymers surfaces for Dip-Pen Nanolithography of oligonucleotides
Energy Technology Data Exchange (ETDEWEB)
Suriano, Raffaella [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Biella, Serena, E-mail: serena.biella@polimi.it [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Cesura, Federico; Levi, Marinella; Turri, Stefano [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)
2013-05-15
Different thermoplastic polymers were spin-coated to prepare smooth surfaces for the direct deposition of end-group modified oligonucleotides by Dip-Pen Nanolithography. A study of the diffusion process was done in order to investigate the dependence of calibration coefficient and quality of deposited features on environmental parameters (temperature, relative humidity) and ink's molecular weight and functionality. The optimization of the process parameters led to the realization of high quality and density nanoarrays on plastics.
Kim, C-K; Joo, Y-T; Lee, E P; Park, Y K; Kim, H-J; Kim, S J
2013-09-01
The Korean Institute of Tuberculosis, Seoul, Republic of Korea. To develop a simple, direct drug susceptibility testing (DST) technique using Kudoh-modified Ogawa (KMO) medium. The critical concentrations of isoniazid (INH), rifampicin (RMP), kanamycin (KM) and ofloxacin (OFX) for KMO medium were calibrated by comparing the minimal inhibitory concentrations (MICs) against clinical isolates of Mycobacterium tuberculosis on KMO with those on Löwenstein-Jensen (LJ). The performance of the direct KMO DST technique was evaluated on 186 smear-positive sputum specimens and compared with indirect LJ DST. Agreement of MICs on direct vs. indirect DST was high for INH, RMP and OFX. KM MICs on KMO were ∼10 g/ml higher than those on LJ. The critical concentrations of INH, RMP, OFX and KM for KMO were therefore set at 0.2, 40.0, 2.0, and 40.0 g/ml. The evaluation of direct DST of smear-positive sputum specimens showed 100% agreement with indirect LJ DST for INH and RMP. However, the respective susceptible and resistant predictive values were 98.8% and 100% for OFX, and 100% and 80% for KM. Direct DST using KMO is useful, with clear advantages of a shorter turnaround time, procedural simplicity and low cost compared to indirect DST. It may be most indicated in resource-poor settings for programmatic management of drug-resistant tuberculosis.
The Diversity of Cortical Inhibitory Synapses
Directory of Open Access Journals (Sweden)
Yoshiyuki eKubota
2016-04-01
Full Text Available The most typical and well known inhibitory action in the cortical microcircuit is a strong inhibition on the target neuron by axo-somatic synapses. However, it has become clear that synaptic inhibition in the cortex is much more diverse and complicated. Firstly, at least ten or more inhibitory non-pyramidal cell subtypes engage in diverse inhibitory functions to produce the elaborate activity characteristic of the different cortical states. Each distinct non-pyramidal cell subtype has its own independent inhibitory function. Secondly, the inhibitory synapses innervate different neuronal domains, such as axons, spines, dendrites and soma, and their IPSP size is not uniform. Thus cortical inhibition is highly complex, with a wide variety of anatomical and physiological modes. Moreover, the functional significance of the various inhibitory synapse innervation styles and their unique structural dynamic behaviors differ from those of excitatory synapses. In this review, we summarize our current understanding of the inhibitory mechanisms of the cortical microcircuit.
Kostov, Ondřej; Páv, Ondřej; Rosenberg, Ivan
2017-09-18
This unit comprises the straightforward synthesis of protected 2'-deoxyribonucleoside-O-methyl-(H)-phosphinates in both 3'- and 5'-series. These compounds represent a new class of monomers compatible with the solid-phase synthesis of oligonucleotides using H-phosphonate chemistry and are suitable for the preparation of both 3'- and 5'-O-methylphosphonate oligonucleotides. The synthesis of 4-toluenesulfonyloxymethyl-(H)-phosphinic acid as a new reagent for the preparation of O-methyl-(H)-phosphinic acid derivatives is described. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
A new achiral reagent for the incorporation of multiple amino groups into oligonucleotides
DEFF Research Database (Denmark)
Behrens, Carsten; Petersen, Kenneth H.; Egholm, Michael
1995-01-01
The synthesis of a new functionalized achiral linker reagent (10) for the incorporation of multiple primary amino groups into oligonucleotides is described. The linker reagent is compatible with conventional DNA-synthesis following the phosphoramidite methodology, and the linker can be incorporated...
Chemically modified oligonucleotides with efficient RNase H response
DEFF Research Database (Denmark)
Vester, Birte; Boel, Anne Marie; Lobedanz, Sune
2008-01-01
Ten different chemically modified nucleosides were incorporated into short DNA strands (chimeric oligonucleotides ON3-ON12 and ON15-ON24) and then tested for their capacity to mediate RNAse H cleavage of the complementary RNA strand. The modifications were placed at two central positions directly...... in the RNase H cleaving region. The RNA strand of duplexes with ON3, ON5 and ON12 were cleaved more efficiently than the RNA strand of the DNA:RNA control duplex. There seems to be no correlation between the thermal stability between the duplexes and RNase H cleavage....
van Roon-Mom, Willeke M C; Roos, Raymund A C; de Bot, Susanne T
2018-04-01
On December 11 of 2017, Ionis Pharmaceuticals published a press release announcing dose-dependent reductions of mutant huntingtin protein in their HTTRx Phase 1/2a study in Huntington disease (HD) patients. The results from this Ionis trial have gained much attention from the patient community and the oligonucleotide therapeutics field, since it is the first trial targeting the cause of HD, namely the mutant huntingtin protein, using antisense oligonucleotides (ASOs). The press release also states that the primary endpoints of the study (safety and tolerability) were met, but does not contain data. This news follows the approval of another therapeutic ASO nusinersen (trade name Spinraza) for a neurological disease, spinal muscular atrophy, by the U.S. Food and Drug Administration and European Medicines Agency, in 2016 and 2017, respectively. Combined, this offers hope for the development of the HTTRx therapy for HD patients.
Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima
2014-01-01
Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.
Directory of Open Access Journals (Sweden)
Laia Ramos
Full Text Available Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb. Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14(q10;q10. Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.
Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima
2014-01-01
Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307
CTG repeat-targeting oligonucleotides for down-regulating Huntingtin expression
DEFF Research Database (Denmark)
Zaghloul, Eman M; Gissberg, Olof; Moreno, Pedro M D
2017-01-01
Huntington's disease (HD) is a fatal, neurodegenerative disorder in which patients suffer from mobility, psychological and cognitive impairments. Existing therapeutics are only symptomatic and do not significantly alter the disease progression or increase life expectancy. HD is caused by expansion....... Thus, reduction of both muHTT mRNA and protein levels would ideally be the most useful therapeutic option. We herein present a novel strategy for HD treatment using oligonucleotides (ONs) directly targeting the HTT trinucleotide repeat DNA. A partial, but significant and potentially long-term, HTT...
Mismatch oligonucleotides in human and yeast: guidelines for probe design on tiling microarrays
Directory of Open Access Journals (Sweden)
Jee Justin
2008-12-01
Full Text Available Abstract Background Mismatched oligonucleotides are widely used on microarrays to differentiate specific from nonspecific hybridization. While many experiments rely on such oligos, the hybridization behavior of various degrees of mismatch (MM structure has not been extensively studied. Here, we present the results of two large-scale microarray experiments on S. cerevisiae and H. sapiens genomic DNA, to explore MM oligonucleotide behavior with real sample mixtures under tiling-array conditions. Results We examined all possible nucleotide substitutions at the central position of 36-nucleotide probes, and found that nonspecific binding by MM oligos depends upon the individual nucleotide substitutions they incorporate: C→A, C→G and T→A (yielding purine-purine mispairs are most disruptive, whereas A→X were least disruptive. We also quantify a marked GC skew effect: substitutions raising probe GC content exhibit higher intensity (and vice versa. This skew is small in highly-expressed regions (± 0.5% of total intensity range and large (± 2% or more elsewhere. Multiple mismatches per oligo are largely additive in effect: each MM added in a distributed fashion causes an additional 21% intensity drop relative to PM, three-fold more disruptive than adding adjacent mispairs (7% drop per MM. Conclusion We investigate several parameters for oligonucleotide design, including the effects of each central nucleotide substitution on array signal intensity and of multiple MM per oligo. To avoid GC skew, individual substitutions should not alter probe GC content. RNA sample mixture complexity may increase the amount of nonspecific hybridization, magnify GC skew and boost the intensity of MM oligos at all levels.
Synthetic Nucleic Acid Analogues in Gene Therapy: An Update for Peptide–Oligonucleotide Conjugates
DEFF Research Database (Denmark)
Taskova, Maria; Mantsiou, Anna; Astakhova, Kira
2017-01-01
The main objective of this work is to provide an update on synthetic nucleic acid analogues and nanoassemblies as tools in gene therapy. In particular, the synthesis and properties of peptide–oligonucleotide conjugates (POCs), which have high potential in research and as therapeutics, are described...
Byrne, N. G.; Muir, T. C.
1985-01-01
The response of the bovine retractor penis (BRP) to stimulation of non-adrenergic, non-cholinergic (NANC) inhibitory nerves and to an inhibitory extract prepared from this muscle have been studied using intracellular microelectrode, sucrose gap and conventional mechanical recording techniques. Both inhibitory nerve stimulation and inhibitory extract hyperpolarized the membrane potential and relaxed spontaneous or guanethidine (3 X 10(-5) M)-induced tone. These effects were accompanied by an increase in membrane resistance. Following membrane potential displacement from an average value of -53 +/- 7 mV (n = 184; Byrne & Muir, 1984) inhibitory potentials to nerve stimulation were abolished at approximately -30 mV; there was no evidence of reversal. Displacement by inward hyperpolarizing current over the range -45 to -60 mV increased the inhibitory response to nerve stimulation and to inhibitory extract; at more negative potential values (above approximately -60 mV) the inhibitory potential decreased and was abolished (approximately -103 mV). There was no evidence of reversal. Removal of [K+]o reversibly reduced hyperpolarization to nerve stimulation and inhibitory extract. No enhancement was observed. Increasing the [K+]o to 20 mM reduced the inhibitory potential to nerve stimulation but this was restored by passive membrane hyperpolarization. Inhibitory potentials were obtained at membrane potential values exceeding that of the estimated EK (-49 mV). [Cl-]o-free or [Cl-]o-deficient solutions reduced and abolished (after some 20-25 min) the hyperpolarization produced by inhibitory nerve stimulation or inhibitory extract. The inhibitory potential amplitude following nerve stimulation was not restored by passive displacement of the membrane potential from -26 to -104 mV approximately. Ouabain (1-5 X 10(-5) M) reduced then (45-60 min later) abolished the inhibitory potential to nerve stimulation. The effects of this drug on the extract were not investigated. It is
Molecular imaging of atherosclerotic plaques with technetium-99m-labelled antisense oligonucleotides
International Nuclear Information System (INIS)
Qin Guangming; Zhang Yongxue; Cao Wei; An Rui; Gao Zairong; Xu Wendai; Zhang Kaijun; Li Guiling; Li Shuren
2005-01-01
The purpose of this study was to visualise experimental atherosclerotic lesions using radiolabelled antisense oligonucleotides (ASONs). Atherosclerosis was induced in New Zealand White rabbits fed 1% cholesterol for approximately 60 days. In vivo and ex vivo imaging was performed in atherosclerotic rabbits and normal control rabbits after i.v. injection of 92.5±18.5 MBq 99m Tc-labelled ASON or 99m Tc-labelled sense oligonucleotides. Immediately after the in vivo imaging, the animals were sacrificed and ex vivo imaging of the aortic specimens was performed. Biodistribution of radiolabelled c-mycASON was evaluated in vivo in atherosclerotic rabbits. Planar imaging revealed accumulation of 99m Tc-labelled c-mycASON in atherosclerotic lesions along the artery wall. Ex vivo imaging further demonstrated that the area of activity accumulation matched the area of atherosclerotic lesions. In contrast, no atherosclerotic lesions were found in the vessel wall and no positive imaging results were obtained in animals of the control group. This molecular imaging approach has potential for non-invasive imaging of atherosclerotic plaques at an early stage. (orig.)
International Nuclear Information System (INIS)
Rackwitz, J.; Rankovic, M.L.; Milosavljevic, A.R.; Bald, I.
2017-01-01
Low-energy electrons (LEEs) play an important role in DNA radiation damage. Here we present a method to quantify LEE induced strand breakage in well-defined oligonucleotide single strands in terms of absolute cross sections. An LEE irradiation setup covering electron energies <500 eV is constructed and optimized to irradiate DNA origami triangles carrying well-defined oligonucleotide target strands. Measurements are presented for 10.0 and 5.5 eV for different oligonucleotide targets. The determination of absolute strand break cross sections is performed by atomic force microscopy analysis. An accurate fluence determination ensures small margins of error of the determined absolute single strand break cross sections σ SSB . In this way, the influence of sequence modification with the radiosensitive 5-Fluorouracil ( 5F U) is studied using an absolute and relative data analysis. We demonstrate an increase in the strand break yields of 5F U containing oligonucleotides by a factor of 1.5 to 1.6 compared with non-modified oligonucleotide sequences when irradiated with 10 eV electrons. (authors)
Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H
2015-02-14
The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.
Directory of Open Access Journals (Sweden)
Tobias Zellweger
2001-01-01
Full Text Available BACKGROUND: Renal cell cancer (RCC is a chemoresistant disease with no active chemotherapeutic agent achieving objective response rates higher than 15%. Clusterin is a cell survival gene that increases in human renal tubular epithelial cells after various states of injury and disease. Downregulation of clusterin, using antisense oligonucleotides (ASO, has recently been shown to increase chemosensitivity in several prostate cancer models. The objectives in this study were to evaluate clusterin expression levels in human RCC and normal kidney tissue, and to test whether clusterin ASO could also enhance chemosensitivity in human RCC Caki-2 cells both in vitro and in vivo. METHODS: Immunohistochemical staining was used to characterize clusterin expression in 67 RCC and normal kidney tissues obtained from radical nephrectomy specimens. Northern blot analysis was used to assess changes in clusterin mRNA expression after ASO and paclitaxel treatment. The effects of combined clusterin ASO and paclitaxel treatment on Caki-2 cell growth was examined using an MTT assay. Athymic mice bearing Caki-2 tumors were treated with clusterin ASO alone, clusterin ASO plus paclitaxel, and mismatch control oligonucleotides plus paclitaxel, over a period of 28 days with measurement of tumor volumes once weekly over 8 weeks. RESULTS: Immunohistochemistry of normal and malignant kidney tissue sections of 67 patients demonstrated positive clusterin staining for almost all RCC (98% and an overexpression, compared to normal tissue, in a majority of RCC (69%. Clusterin ASO, but not mismatch control oligonucleotides, decreased clusterin mRNA expression in Caki-2 cells in a dosedependent and sequence-specific manner. Pretreatment of Caki-2 cells with clusterin ASO significantly enhanced chemosensitivity to paclitaxel in vitro. Characteristic apoptotic DNA laddering was observed after combined treatment with ASO plus paclitaxel, but not with either agent alone. In vivo
Directory of Open Access Journals (Sweden)
Jian Hao
2017-12-01
Full Text Available Inhibitory control may play an important part in prosocial behavior, such as donating behavior. However, it is not clear at what developmental stage inhibitory control becomes associated with donating behavior and which aspects of inhibitory control are related to donating behavior during development in early to middle childhood. The present study aimed to clarify these issues with two experiments. In Experiment 1, 103 3- to 5-year-old preschoolers completed cool (Stroop-like and hot (delay of gratification inhibitory control tasks and a donating task. The results indicated that there were no relationships between cool or hot inhibitory control and donating behavior in the whole group and each age group of the preschoolers. In Experiment 2, 140 elementary school children in Grades 2, 4, and 6 completed cool (Stroop-like and hot (delay of gratification inhibitory control tasks and a donating task. The results showed that inhibitory control was positively associated with donating behavior in the whole group. Cool and hot inhibitory control respectively predicted donating behavior in the second and sixth graders. Therefore, the present study reveals that donating behavior increasingly relies on specific inhibitory control, i.e., hot inhibitory control as children grow in middle childhood.
Hanagata, Nobutaka
2017-01-01
Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.
Panpradist, Nuttada; Beck, Ingrid A.; Chung, Michael H.; Kiarie, James N.; Frenkel, Lisa M.; Lutz, Barry R.
2016-01-01
Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207
Dissecting the hybridization of oligonucleotides to structured complementary sequences.
Peracchi, Alessio
2016-06-01
When oligonucleotides hybridize to long target molecules, the process is slowed by the secondary structure in the targets. The phenomenon has been analyzed in several previous studies, but many details remain poorly understood. I used a spectrofluorometric strategy, focusing on the formation/breaking of individual base pairs, to study the kinetics of association between a DNA hairpin and >20 complementary oligonucleotides ('antisenses'). Hybridization rates differed by over three orders of magnitude. Association was toehold-mediated, both for antisenses binding to the target's ends and for those designed to interact with the loop. Binding of these latter, besides being consistently slower, was affected to variable, non-uniform extents by the asymmetric loop structure. Divalent metal ions accelerated hybridization, more pronouncedly when nucleation occurred at the loop. Incorporation of locked nucleic acid (LNA) residues in the antisenses substantially improved the kinetics only when LNAs participated to the earliest hybridization steps. The effects of individual LNAs placed along the antisense indicated that the reaction transition state occurred after invading at least the first base pair of the stem. The experimental approach helps dissect hybridization reactions involving structured nucleic acids. Toehold-dependent, nucleation-invasion models appear fully appropriate for describing such reactions. Estimating the stability of nucleation complexes formed at internal toeholds is the major hurdle for the quantitative prediction of hybridization rates. While analyzing the mechanisms of a fundamental biochemical process (hybridization), this work also provides suggestions for the improvement of technologies that rely on such process. Copyright © 2016 Elsevier B.V. All rights reserved.
The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.
Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng
2017-05-01
Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.
Direct microcontact printing of oligonucleotides for biochip applications
Directory of Open Access Journals (Sweden)
Trévisiol E
2005-07-01
Full Text Available Abstract Background A critical step in the fabrication of biochips is the controlled placement of probes molecules on solid surfaces. This is currently performed by sequential deposition of probes on a target surface with split or solid pins. In this article, we present a cost-effective procedure namely microcontact printing using stamps, for a parallel deposition of probes applicable for manufacturing biochips. Results Contrary to a previous work, we showed that the stamps tailored with an elastomeric poly(dimethylsiloxane material did not require any surface modification to be able to adsorb oligonucleotides or PCR products. The adsorbed DNA molecules are subsequently printed efficiently on a target surface with high sub-micron resolution. Secondly, we showed that successive stamping is characterized by an exponential decay of the amount of transferred DNA molecules to the surface up the 4th print, then followed by a second regime of transfer that was dependent on the contact time and which resulted in reduced quality of the features. Thus, while consecutive stamping was possible, this procedure turned out to be less reproducible and more time consuming than simply re-inking the stamps between each print. Thirdly, we showed that the hybridization signals on arrays made by microcontact printing were 5 to 10-times higher than those made by conventional spotting methods. Finally, we demonstrated the validity of this microcontact printing method in manufacturing oligonucleotides arrays for mutations recognition in a yeast gene. Conclusion The microcontact printing can be considered as a new potential technology platform to pattern DNA microarrays that may have significant advantages over the conventional spotting technologies as it is easy to implement, it uses low cost material to make the stamp, and the arrays made by this technology are 10-times more sensitive in term of hybridization signals than those manufactured by conventional spotting
Czech Academy of Sciences Publication Activity Database
Hocková, Dana; Rosenbergová, Šárka; Ménová, Petra; Páv, Ondřej; Pohl, Radek; Novák, Pavel; Rosenberg, Ivan
2015-01-01
Roč. 13, č. 15 (2015), s. 4449-4458 ISSN 1477-0520 R&D Projects: GA ČR GAP207/11/0108; GA ČR GA13-26526S Institutional support: RVO:61388963 Keywords : acyclic nucleoside phosphonates * oligonucleotides * solid phase synthesis Subject RIV: CC - Organic Chemistry Impact factor: 3.559, year: 2015
de Vries, EFJ; Vroegh, J; Elsinga, PH; Vaalburg, W
Six fluorine-18-labeled alkylating agents were selected as potentially suitable synthons for the labeling of antisense oligonucleotides. The selected synthons were evaluated in a model reaction with the monomer adenosine 5'-O-thiomonophosphate. Of these synthons,
Maguire, Edward P.; Mitchell, Elizabeth A.; Greig, Scott J.; Corteen, Nicole; Balfour, David J. K.; Swinny, Jerome; Lambert, Jeremy J.; Belelli, Delia
2014-01-01
Alcohol abuse is a significant medical and social problem. Several neurotransmitter systems are implicated in ethanol's actions, with certain receptors and ion channels emerging as putative targets. The dorsal raphe (DR) nucleus is associated with the behavioral actions of alcohol, but ethanol actions on these neurons are not well understood. Here, using immunohistochemistry and electrophysiology we characterize DR inhibitory transmission and its sensitivity to ethanol. DR neurons exhibit inh...
Stimulation of dendritic cells enhances immune response after photodynamic therapy
Mroz, Pawel; Castano, Ana P.; Hamblin, Michael R.
2009-02-01
Photodynamic therapy (PDT) involves the administration of photosensitizers followed by illumination of the primary tumor with red light producing reactive oxygen species that cause vascular shutdown and tumor cell necrosis and apoptosis. Anti-tumor immunity is stimulated after PDT due to the acute inflammatory response, priming of the immune system to recognize tumor-associated antigens (TAA). The induction of specific CD8+ Tlymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. This process is however, often sub-optimal, in part due to tumor-induced DC dysfunction. Instead of DC that can become mature and activated and have a potent antigen-presenting and immune stimulating phenotype, immature dendritic cells (iDC) are often found in tumors and are part of an immunosuppressive milieu including regulatory T-cells and immunosuppressive cytokines such as TGF-beta and IL10. We here report on the use of a potent DC activating agent, an oligonucleotide (ODN) that contains a non-methylated CpG motif and acts as an agonist of toll like receptor (TLR) 9. TLR activation is a danger signal to notify the immune system of the presence of invading pathogens. CpG-ODN (but not scrambled non-CpG ODN) increased bone-marrow DC activation after exposure to PDT-killed tumor cells, and significantly increased tumor response to PDT and mouse survival after peri-tumoral administration. CpG may be a valuable immunoadjuvant to PDT especially for tumors that produce DC dysfunction.
Energy Technology Data Exchange (ETDEWEB)
Zheng Linfeng, E-mail: zhenglinfeng04@yahoo.com.cn [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Li Yujie, E-mail: yujieli01@yahoo.com.cn [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Wang Han, E-mail: bingowh@hotmail.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Zhao Jinglong, E-mail: jinglongz@yahoo.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Wang Xifu, E-mail: wangxiechen001@163.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Hu Yunsheng, E-mail: springmorninghu@163.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China); Zhang Guixiang, E-mail: guixiangzhang@sina.com [Department of Radiology, Shanghai First People' s Hospital, Medical College, Shanghai Jiaotong University, Hanning Road, 100, 200080 Shanghai (China)
2011-05-15
Purpose: To study the effects of combination of vascular endothelial growth factor (VEGF) antisense oligonucleotide therapy and radiotherapy on maxillofacial VX2 tumors in rabbits. Methods: We used 24 New Zealand white rabbits as a model to induce maxillofacial VX2 tumor. The rabbits were randomly divided into the following 4 groups: radiotherapy group (group A), treated with 16 Gy of radiotherapy; VEGF antisense oligonucleotide treatment group (group B), treated with an injection of 150 {mu}g of VEGF antisense oligonucleotide into the local tumor; VEGF antisense oligonucleotide combined with radiotherapy group (group C), treated with an injection of 150 {mu}g of VEGF antisense oligonucleotide into the local tumor immediately after 16 Gy of radiotherapy; and control group (group D), treated with an injection of 300 {mu}l 5% aqueous glucose solution into the local tumor. On days 3 and 14 after treatment, dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) was performed to calculate maximal enhancement ratio (MER), slope of enhancement (SLE), and tumor volume change. Rabbits were killed on day 14 to obtain samples for pathological examination and immunohistochemical staining for VEGF. Results: In group C, tumor volume was significantly reduced on day 14 after treatment, and the difference was statistically different as compared to that before treatment, on day 3 after treatment and other groups (P < 0.01). Values of both MER and SLE after treatment were significantly lower than the values before treatment (P < 0.05). Pathological specimen revealed tumor cell edema, bleeding, necrosis, vascular wall thickening and occlusion, and decreased VEGF expression. The immunohistochemical score (IHS) of group C was significantly different from groups A and D respectively (P < 0.05). Conclusion: Injecting the tumor with VEGF antisense oligonucleotide immediately after radiotherapy can enhance the curative effect on rabbit maxillofacial VX2 tumor, and DCE-MRI can serve
Oligonucleotides with 1,4-dioxane-based nucleotide monomers
DEFF Research Database (Denmark)
Madsen, Andreas S; Wengel, Jesper
2012-01-01
An epimeric mixture of H-phosphonates 5R and 5S has been synthesized in three steps from known secouridine 1. Separation of the epimers has been accomplished by RP-HPLC, allowing full characterization and incorporation of monomers X and Y into 9-mer oligonucleotides using H-phosphonates building...... blocks 5R and 5S, respectively. A single incorporation of either monomer X or monomer Y in the central position of a DNA 9-mer results in decreased thermal affinity toward both DNA and RNA complements (ΔT(m) = -3.5 °C/-3.5 °C for monomer X and ΔT(m) = -11.0 °C/-6.5 °C for monomer Y). CD measurements do...
Energy Technology Data Exchange (ETDEWEB)
Liu, Dengyou; Luo, Qimei [Science College of Hunan Agricultural University, Changsha 410128 (China); Deng, Fawen [The Fourth Hospital of Chansha, Changsha 410006 (China); Li, Zhen [Science College of Hunan Agricultural University, Changsha 410128 (China); Li, Benxiang, E-mail: 172170960@qq.com [Science College of Hunan Agricultural University, Changsha 410128 (China); Shen, Zhifa, E-mail: shenzhifa@wmu.edu.cn [Key Laboratory of Laboratory Medicine, Ministry of Education, Zhejiang Provincial Key Laboratory of Medical Genetics, College of Laboratory Medicine and Life Sciences, Wenzhou Medical University, Wenzhou 325035 (China)
2017-06-08
Highly sensitive and selective quantitation of a variety of proteins over a wide concentration range is highly desirable for increased accuracy of biomarker detection or for multidisease diagnostics. In the present contribution, using human immunoglobulin G (HIgG) as the model target protein, an electrochemical ultrasensitive immunosensing platform was developed based on the oligonucleotide self-assembled monolayer-mediated (OSAM) sensing interface. For this immunosensor, the “signal-on” signaling mechanism and enzymatic signal amplification effect were integrated into one sensing architecture. Moreover, the thiolated flexible single-stranded DNAs immobilized onto gold electrode surface not only performs the wobbling motion to facilitate the electron transfer between the electrode surface and biosensing layer but also fundamentally prohibiting the direct interaction of proteins with gold substrate. Thus, the electrochemical signal could be efficiently enhanced and the unspecific adsorption or cross-reaction might be eliminated. As a result, utilizing the newly-proposed immunosensor, the HIgG can be detected down to 0.5 ng/mL, and the high detection specificity is offered. The successful design of OSAM and the highly desirable detection capability of new immunosensor are expected to provide a perspective for fabricating new robust immunosensing platform and for promising potential of oligonucleotide probe in biological research and biomedical diagnosis. - Highlights: • An electrochemical ultrasensitive immunosensing platform was developed based on the oligonucleotide self-assembled monolayer (OASM). • OASM severs as a flexible monolayer to promote electron transfer and prohibits the direct interaction of proteins with gold substrate. • The electrochemical signal is efficiently enhanced and the unspecific adsorption or cross-reaction is eliminated. • Target protein can be detected down to 0.5 ng/mL, and the high detection specificity can be obtained.
Plasticity of cortical excitatory-inhibitory balance.
Froemke, Robert C
2015-07-08
Synapses are highly plastic and are modified by changes in patterns of neural activity or sensory experience. Plasticity of cortical excitatory synapses is thought to be important for learning and memory, leading to alterations in sensory representations and cognitive maps. However, these changes must be coordinated across other synapses within local circuits to preserve neural coding schemes and the organization of excitatory and inhibitory inputs, i.e., excitatory-inhibitory balance. Recent studies indicate that inhibitory synapses are also plastic and are controlled directly by a large number of neuromodulators, particularly during episodes of learning. Many modulators transiently alter excitatory-inhibitory balance by decreasing inhibition, and thus disinhibition has emerged as a major mechanism by which neuromodulation might enable long-term synaptic modifications naturally. This review examines the relationships between neuromodulation and synaptic plasticity, focusing on the induction of long-term changes that collectively enhance cortical excitatory-inhibitory balance for improving perception and behavior.
DEFF Research Database (Denmark)
Kumar, Rajesh; Ries, Annika; Wengel, Jesper
2017-01-01
A convenient method for the preparation of oligonucleotides containing internally-attached galactose and triantennary galactose units has been developed based on click chemistry between 2'-N-alkyne 2'-amino-LNA nucleosides and azido-functionalized galactosyl building blocks. The synthesized...
Detection of tmRNA molecules on microarrays at low temperatures using helper oligonucleotides
Directory of Open Access Journals (Sweden)
Palta Priit
2010-04-01
Full Text Available Abstract Background The hybridization of synthetic Streptococcus pneumoniae tmRNA on a detection microarray is slow at 34°C resulting in low signal intensities. Results We demonstrate that adding specific DNA helper oligonucleotides (chaperones to the hybridization buffer increases the signal strength at a given temperature and thus makes the specific detection of Streptococcus pneumoniae tmRNA more sensitive. No loss of specificity was observed at low temperatures compared to hybridization at 46°C. The effect of the chaperones can be explained by disruption of the strong secondary and tertiary structure of the target RNA by the selective hybridization of helper molecules. The amplification of the hybridization signal strength by chaperones is not necessarily local; we observed increased signal intensities in both local and distant regions of the target molecule. Conclusions The sensitivity of the detection of tmRNA at low temperature can be increased by chaperone oligonucleotides. Due to the complexity of RNA secondary and tertiary structures the effect of any individual chaperone is currently not predictable.
Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.
Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O
1994-01-01
Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed prelim...
Hanczyc, Piotr; Å kerman, Bjö rn; Nordé n, Bengt
2012-01-01
) spectroscopy. Oligonucleotides of lengths varying between 10 (3.4 nm) and 60 bases (20.4 nm) were investigated with respect to structural properties in the gel-like polymer environment. The DNA conformation as a function of relative humidity reveals a strong
Gonzalez-Barriga, A.; Mulders, S.A.M.; Giessen, J. van der; Hooijer, J.D.; Bijl, S.; Kessel, I.D.G. van; Beers, J. van; Deutekom, J.C. van; Fransen, J.A.M.; Wieringa, B.; Wansink, D.G.
2013-01-01
Myotonic dystrophy type 1 (DM1) is caused by DM protein kinase (DMPK) transcripts containing an expanded (CUG)n repeat. Antisense oligonucleotide (AON)-mediated suppression of these mutant RNAs is considered a promising therapeutic strategy for this severe disorder. Earlier, we identified a
Synthesis of modified oligonucleotides that contain purine and pyrimidine radio-induced base lesions
International Nuclear Information System (INIS)
Romieu, Anthony
1999-01-01
Different factors as oxidizing or carcinogenesis agents, UV and ionizing radiations,.... can generate a wide, spectrum of DNA base damages. In order to study the biochemical and structural features of these DNA damages, it is important to prepare short DNA fragments (20 to 50 bases long) bearing a single or several modifications at specific sites in their sequences. The chemical synthesis is a powerful tool to prepare such modified DNA fragments. This work focusses on the chemical incorporation of several modified nucleosides formed in DNA by ionizing radiations or by photo-sensitization. The first part of this study describes the preparation of a phosphoramidite synthon of 5-hydroxy-2'-deoxyuridine and its subsequent incorporation into synthetic oligonucleotides ranging from 14 to 33 bases long. In a second part (chapters Ill and IV), the synthesis and incorporation of original radiation-induced tandem lesions: the carbon-bridged cyclo-nucleosides are presented. Both (5'R)- and (5'S) diastereomers of 5',8-cyclo-2'-deoxyadenosine and 5',8-cyclo-2'-deoxyguanosine have been individually inserted into various different oligonucleotides (3 to 22 bases long) by using the standard phosphoramidite chemistry. The chemical incorporation of a pyrimidine analogue: (5'S, 6S)-5',6-cyclo-5,6-dihydro-thymidine has been also achieved. The loss of aromaticity of this modified nucleoside and its poor reactivity required the development of a synthetic strategy entirely different from that used for the preparation and subsequent incorporation of the phosphoramidite synthons of 5',8-cyclo-purine-2'-deoxyribo-nucleosides. The third part of this study deals with the synthesis of a phosphoramidite synthon of 4-hydroxy-8-oxo-4,8-dihydro-2'-deoxyguanosine. The two (4R)- and (4S)- diastereomers of this oxidized purine have been separated and individually inserted in several synthetic DNA fragments. No epimerization of C-4 position was observed during the solid-phase synthesis and during the
Impulsivity: A deficiency of inhibitory control?
Lansbergen, M.M.
2007-01-01
Impulsivity has been defined as acting without thinking. Impulsivity can be quantified by impulsivity questionnaires, but also by behavioral paradigms which tax inhibitory control. Previous research has repeatedly demonstrated deficient inhibitory control in psychopathological samples characterized
Directory of Open Access Journals (Sweden)
Maria Chiara Munisso
2014-01-01
Full Text Available The availability of fluorescent dyes and the advances in the optical systems for in vivo imaging have stimulated an increasing interest in developing new methodologies to study and quantify the biodistribution of labeled agents. However, despite these great achievements, we are facing significant challenges in determining if the observed fluorescence does correspond to the quantity of the dye in the tissues. In fact, although the far-red and near-infrared lights can propagate through several centimetres of tissue, they diffuse within a few millimetres as consequence of the elastic scattering of photons. In addition, when dye-labeled oligonucleotides form stable complex with cationic carriers, a large change in the fluorescence intensity of the dye is observed. Therefore, the measured fluorescence intensity is altered by the tissue heterogeneity and by the fluctuation of dye intensity. Hence, in this study a quantification strategy for fluorescence-labeled oligonucleotides was developed to solve these disadvantageous effects. Our results proved that upon efficient homogenization and dilution with chaotropic agents, such as guanidinium thiocyanate, it is possible to achieve a complete fluorescence intensity recovery. Furthermore, we demonstrated that this method has the advantage of good sensitivity and reproducibility, as well as easy handling of the tissue samples.
Jensen, Michael A; Davis, Ronald W
2018-03-27
There is a growing demand for sustainable methods in research and development, where instead of hazardous chemicals, an aqueous medium is chosen to perform biological reactions. In this Perspective, we examine the history and current methodology of using enzymes to generate artificial single-stranded DNA. By using traditional solid-phase phosphoramidite chemistry as a metric, we also explore criteria for the method of template-independent enzymatic oligonucleotide synthesis (TiEOS). As its key component, we delve into the biology of one of the most enigmatic enzymes, terminal deoxynucleotidyl transferase (TdT). As TdT is found to exponentially increase antigen receptor diversity in the vertebrate immune system by adding nucleotides in a template-free manner, researchers have exploited this function as an alternative to the phosphoramidite synthesis method. Though TdT is currently the preferred enzyme for TiEOS, its random nucleotide incorporation presents a barrier in synthesis automation. Taking a closer look at the TiEOS cycle, particularly the coupling step, we find it is comprised of additions > n+1 and deletions. By tapping into the physical and biochemical properties of TdT, we strive to further elucidate its mercurial behavior and offer ways to better optimize TiEOS for production-grade oligonucleotide synthesis.
Energy Technology Data Exchange (ETDEWEB)
Rull, Jordi [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France); CEA, iRTSV, LCBM, Grenoble 38054 (France); CNRS, UMR 5249, Grenoble (France); Nonglaton, Guillaume, E-mail: guillaume.nonglaton@cea.fr [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France); Costa, Guillaume; Fontelaye, Caroline [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France); Marchi-Delapierre, Caroline; Ménage, Stéphane [Université Grenoble Alpes, Grenoble F38000 (France); CEA, iRTSV, LCBM, Grenoble 38054 (France); CNRS, UMR 5249, Grenoble (France); Marchand, Gilles [Université Grenoble Alpes, Grenoble F38000 (France); CEA, LETI, MINATEC Campus, Grenoble Cedex 9 F38054 (France)
2015-11-01
Graphical abstract: - Highlights: • First example of grafting of 3,4-epoxybutyltrimethoxysilane (EBTMOS) onto silicon oxide by supercritical fluid deposition. • Extraordinary efficiency of the supercritical fluid deposition for the grafting of the EBTMOS compared with the conventional solution or vapor phase methodologies. • Demonstration of the efficiency of this functionalization process for the immobilization of amino-modified oligonucleotides. - Abstract: The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO{sub 2}) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric
TIA-1 RRM23 binding and recognition of target oligonucleotides.
Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A
2017-05-05
TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Scarascia, Giantommaso; Cheng, Hong; Harb, Moustapha; Hong, Pei-Ying
2017-01-01
for ensuring the efficiency of nitrification in water treatment systems. Hierarchical oligonucleotide primer extension (HOPE), previously developed to rapidly quantify relative abundances of specific microbial groups of interest, was applied in this study
Length and coverage of inhibitory decision rules
Alsolami, Fawaz
2012-01-01
Authors present algorithms for optimization of inhibitory rules relative to the length and coverage. Inhibitory rules have a relation "attribute ≠ value" on the right-hand side. The considered algorithms are based on extensions of dynamic programming. Paper contains also comparison of length and coverage of inhibitory rules constructed by a greedy algorithm and by the dynamic programming algorithm. © 2012 Springer-Verlag.
Energy Technology Data Exchange (ETDEWEB)
Mazzone, Amelia; Eisenman, Seth T.; Strege, Peter R. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Yao, Zhen [Laboratory of Molecular Genetics, UCSF, San Francisco, CA (United States); Ordog, Tamas; Gibbons, Simon J. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Farrugia, Gianrico, E-mail: farrugia.gianrico@mayo.edu [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States)
2012-10-19
from BALB/c mice following treatment with T16A{sub inh}-A01. Proliferation of the CFPAC-1 human cell-line was also reduced by T16A{sub inh}-A01. In organotypic cultures of smooth muscle strips from mouse jejunum, the proliferation of ICC was reduced but the total number of proliferating cells/confocal stack was not affected, suggesting that the inhibitory effect was specific for ICC. Conclusions: The selective Ano1 inhibitor T16A{sub inh}-A01 inhibited Ca{sup 2+}-activated Cl{sup -} currents, reduced the number of proliferating ICC in culture and inhibited proliferation in the pancreatic cancer cell line CFPAC-1. These data support the notion that chloride channels in general and Ano1 in particular are involved in the regulation of proliferation.
Directory of Open Access Journals (Sweden)
Punit P Seth
2012-01-01
Full Text Available We report the structure activity relationships of short 14-mer phosphorothioate gapmer antisense oligonucleotides (ASOs modified with α-L-locked nucleic acid (LNA and related modifications targeting phosphatase and tensin homologue (PTEN messenger RNA in mice. α-L-LNA represents the α-anomer of enantio-LNA and modified oligonucleotides show LNA like binding affinity for complementary RNA. In contrast to sequence matched LNA gapmer ASOs which showed elevations in plasma alanine aminotransferase (ALT levels indicative of hepatotoxicity, gapmer ASOs modified with α-L-LNA and related analogs in the flanks showed potent downregulation of PTEN messenger RNA in liver tissue without producing elevations in plasma ALT levels. However, the α-L-LNA ASO showed a moderate dose-dependent increase in liver and spleen weights suggesting a higher propensity for immune stimulation. Interestingly, replacing α-L-LNA nucleotides in the 3′- and 5′-flanks with R-5′-Me-α-L-LNA but not R-6′-Me- or 3′-Me-α-L-LNA nucleotides, reversed the drug induced increase in organ weights. Examination of structural models of dinucleotide units suggested that the 5′-Me group increases steric bulk in close proximity to the phosphorothioate backbone or produces subtle changes in the backbone conformation which could interfere with recognition of the ASO by putative immune receptors. Our data suggests that introducing steric bulk at the 5′-position of the sugar-phosphate backbone could be a general strategy to mitigate the immunostimulatory profile of oligonucleotide drugs. In a clinical setting, proinflammatory effects manifest themselves as injection site reactions and flu-like symptoms. Thus, a mitigation of these effects could increase patient comfort and compliance when treated with ASOs.
Development and production of an oligonucleotide MuscleChip: use for validation of ambiguous ESTs
Directory of Open Access Journals (Sweden)
Lanfranchi Gerolamo
2002-10-01
Full Text Available Abstract Background We describe the development, validation, and use of a highly redundant 120,000 oligonucleotide microarray (MuscleChip containing 4,601 probe sets representing 1,150 known genes expressed in muscle and 2,075 EST clusters from a non-normalized subtracted muscle EST sequencing project (28,074 EST sequences. This set included 369 novel EST clusters showing no match to previously characterized proteins in any database. Each probe set was designed to contain 20–32 25 mer oligonucleotides (10–16 paired perfect match and mismatch probe pairs per gene, with each probe evaluated for hybridization kinetics (Tm and similarity to other sequences. The 120,000 oligonucleotides were synthesized by photolithography and light-activated chemistry on each microarray. Results Hybridization of human muscle cRNAs to this MuscleChip (33 samples showed a correlation of 0.6 between the number of ESTs sequenced in each cluster and hybridization intensity. Out of 369 novel EST clusters not showing any similarity to previously characterized proteins, we focused on 250 EST clusters that were represented by robust probe sets on the MuscleChip fulfilling all stringent rules. 102 (41% were found to be consistently "present" by analysis of hybridization to human muscle RNA, of which 40 ESTs (39% could be genome anchored to potential transcription units in the human genome sequence. 19 ESTs of the 40 ESTs were furthermore computer-predicted as exons by one or more than three gene identification algorithms. Conclusion Our analysis found 40 transcriptionally validated, genome-anchored novel EST clusters to be expressed in human muscle. As most of these ESTs were low copy clusters (duplex and triplex in the original 28,000 EST project, the identification of these as significantly expressed is a robust validation of the transcript units that permits subsequent focus on the novel proteins encoded by these genes.
Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J
2012-06-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.
DEFF Research Database (Denmark)
RAMSING, NB; KUHL, M.; JØRGENSEN, BB
1993-01-01
The vertical distribution of sulfate-reducing bacteria (SRB) in photosynthetic biofilms from the trickling filter of a sewage treatment plant was investigated with oligonucleotide probes binding to 16S rRNA. To demonstrate the effect of daylight and photosynthesis and thereby of increased oxygen....... Fluorescent-dye-conjugated oligonucleotides were used as ''phylogenetic'' probes to identify single cells in the slices. Oligonucleotide sequences were selected which were complementary to short sequence elements (16 to 20 nucleotides) within the 16S rRNA of sulfate-reducing bacteria. The probes were labeled...... with fluorescein or rhodamine derivatives for subsequent visualization by epifluorescence microscopy. Five probes were synthesized for eukaryotes, eubacteria, SRB (including most species of the delta group of purple bacteria), Desulfobacter spp., and a nonhybridizing control. The SRB were unevenly distributed...
The frontal lobes and inhibitory function
International Nuclear Information System (INIS)
Konishi, Seiki
2011-01-01
Neuropsychological studies using traditional tasks of inhibitory functions, such as the Wisconsin card sorting test (WCST) and the Go/No-Go Task have revealed that the frontal lobe is responsible for several types of inhibitory functions. However, the detailed psychological nature of the inhibitory functions and the precise location of their critical foci within the frontal lobe remain to be investigated. Functional magnetic resonance imaging provides spatial and temporal resolution that allowed us to illuminate at least 4 frontal regions involved in inhibitory functions: the dorsolateral, ventrolateral, and rostral parts of the frontal lobe and the presupplementary motor area (preSMA). The ventrolateral part of the frontal lobe in the right hemisphere was activated during response inhibition. The preSMA in the left hemisphere was activated during inhibition of proactive interference immediately after the dimension changes of the WCST. The rostral part of the frontal lobe in the left hemisphere was activated during inhibition long after the dimension changes. The dorsolateral part of the frontal lobe in the left hemisphere was activated at the dimension changes in the first time, but not in the second time. These findings provide clues to our understanding of functional differentiation of inhibitory functions and their localization in the frontal lobe. (author)
Hole hopping rates in single strand oligonucleotides
Energy Technology Data Exchange (ETDEWEB)
Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)
2014-08-31
Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.
DEFF Research Database (Denmark)
Lou, Chenguang; Martos-Maldonado, Manuel C.; Madsen, Charlotte Stahl
2016-01-01
Peptide-based structures can be designed to yield artificial proteins with specific folding patterns and functions. Template-based assembly of peptide units is one design option, but the use of two orthogonal self-assembly principles, oligonucleotide triple helix and a coiled coil protein domain ...
Intravitreal Injection of Splice-switching Oligonucleotides to Manipulate Splicing in Retinal Cells
Directory of Open Access Journals (Sweden)
Xavier Gérard
2015-01-01
Full Text Available Leber congenital amaurosis is a severe hereditary retinal dystrophy responsible for neonatal blindness. The most common disease-causing mutation (c.2991+1655A>G; 10–15% creates a strong splice donor site that leads to insertion of a cryptic exon encoding a premature stop codon. Recently, we reported that splice-switching oligonucleotides (SSO allow skipping of the mutant cryptic exon and the restoration of ciliation in fibroblasts of affected patients, supporting the feasibility of a SSO-mediated exon skipping strategy to correct the aberrant splicing. Here, we present data in the wild-type mouse, which demonstrate that intravitreal administration of 2’-OMePS-SSO allows selective alteration of Cep290 splicing in retinal cells, including photoreceptors as shown by successful alteration of Abca4 splicing using the same approach. We show that both SSOs and Cep290 skipped mRNA were detectable for at least 1 month and that intravitreal administration of oligonucleotides did not provoke any serious adverse event. These data suggest that intravitreal injections of SSO should be considered to bypass protein truncation resulting from the c.2991+1655A>G mutation as well as other truncating mutations in genes which like CEP290 or ABCA4 have a mRNA size that exceed cargo capacities of US Food and Drug Administration (FDA-approved adeno-associated virus (AAV-vectors, thus hampering gene augmentation therapy.
Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José
2011-01-01
A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916
International Nuclear Information System (INIS)
Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.
1986-01-01
The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides
Pd0-Catalyzed Methyl Transfer on Nucleosides and Oligonucleotides, Envisaged as a PET Tracer
Directory of Open Access Journals (Sweden)
Eric Fouquet
2013-11-01
Full Text Available The methyl transfer reaction from activated monomethyltin, via a modified Stille coupling reaction, was studied under “ligandless” conditions on fully deprotected 5'-modified nucleosides and one dinucleotide. The reaction was optimized to proceed in a few minutes and quantitative yield, even under dilute conditions, thus affording a rapid and efficient new method for oligonucleotide labelling with carbon-11.
Oligonucleotide fishing for STAT6: cross-talk between IL-4 and chemokines
DEFF Research Database (Denmark)
Eriksen, K W; Nielsen, M; Kaltoft, K
2001-01-01
Signal transducer and activator of transcription 6 (STAT6) is essential for the biological activities of interleukin-4 (IL-4) and the development of allergic responses in mice. Here we report on a sensitive and specific assay for STAT6 activation in response to IL-4. We took advantage of double-s...... activation, whereas other chemokines and cytokines do not. In conclusion, our data show that oligonucleotide fishing is a supplementary tool for studying cytokine cross-talk at a genomic level....
Inhibitory effects of antimicrobial agents against Fusarium species.
Kawakami, Hideaki; Inuzuka, Hiroko; Hori, Nobuhide; Takahashi, Nobumichi; Ishida, Kyoko; Mochizuki, Kiyofumi; Ohkusu, Kiyofumi; Muraosa, Yasunori; Watanabe, Akira; Kamei, Katsuhiko
2015-08-01
We investigated the inhibitory effects of antibacterial, biocidal, and antifungal agents against Fusarium spp. Seven Fusarium spp: four F. falciforme (Fusarium solani species complex), one Fusarium spp, one Fusarium spp. (Fusarium incarnatum-equiseti species complex), and one F. napiforme (Gibberella fujikuroi species complex), isolated from eyes with fungal keratitis were used in this study. Their susceptibility to antibacterial agents: flomoxef, imipenem, gatifloxacin, levofloxacin, moxifloxacin, gentamicin, tobramycin, and Tobracin® (contained 3,000 μg/ml of tobramycin and 25 μg/ml of benzalkonium chloride (BAK), a biocidal agent: BAK, and antifungal agents: amphotericin B, pimaricin (natamycin), fluconazole, itraconazole, miconazole, voriconazole, and micafungin, was determined by broth microdilution tests. The half-maximal inhibitory concentration (IC50), 100% inhibitory concentration (IC100), and minimum inhibitory concentration (MIC) against the Fusarium isolates were determined. BAK had the highest activity against the Fusarium spp. except for the antifungal agents. Three fluoroquinolones and two aminoglycosides had inhibitory effects against the Fusarium spp. at relatively high concentrations. Tobracin® had a higher inhibitory effect against Fusarium spp. than tobramycin alone. Amphotericin B had the highest inhibitory effect against the Fusarium spp, although it had different degrees of activity against each isolate. Our findings showed that fluoroquinolones, aminoglycosides, and BAK had some degree of inhibitory effect against the seven Fusarium isolates, although these agents had considerably lower effect than amphotericin B. However, the inhibitory effects of amphotericin B against the Fusarium spp. varied for the different isolates. Further studies for more effective medications against Fusarium, such as different combinations of antibacterial, biocidal, and antifungal agents are needed. © The Author 2015. Published by Oxford University Press on
Holland, Joseph G; Geiger, Franz M
2012-06-07
The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.
Energy Technology Data Exchange (ETDEWEB)
Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)
2016-01-15
The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.
International Nuclear Information System (INIS)
Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu
2016-01-01
The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.
Czech Academy of Sciences Publication Activity Database
Riedl, Jan; Pohl, Radek; Ernsting, N. P.; Orság, Petr; Fojta, Miroslav; Hocek, Michal
2012-01-01
Roč. 3, č. 9 (2012), s. 2797-2806 ISSN 2041-6520 R&D Projects: GA ČR GA203/09/0317; GA ČR GBP206/12/G151 Institutional support: RVO:61388963 ; RVO:68081707 Keywords : DNA * oligonucleotides * polymerase * phthalimide * nucleotides * fluorescent labeling Subject RIV: CC - Organic Chemistry Impact factor: 8.314, year: 2012
Macrophage migration inhibitory factor as an incriminating agent in vitiligo.
Farag, Azza Gaber Antar; Hammam, Mostafa Ahmed; Habib, Mona SalahEldeen; Elnaidany, Nada Farag; Kamh, Mona Eaid
2018-03-01
Vitiligo is an autoimmune skin disorder in which the loss of melanocytes is mainly attributed to defective autoimmune mechanisms and, lately, there has been more emphasis on autoinflammatory mediators. Among these is the macrophage migration inhibitory factor, which is involved in many autoimmune skin diseases. However, little is known about the contribution of this factor to vitiligo vulgaris. To determine the hypothesized role of migration inhibitory factor in vitiligo via estimation of serum migration inhibitory factor levels and migration inhibitory factor mRNA concentrations in patients with vitiligo compared with healthy controls. We also aimed to assess whether there is a relationship between the values of serum migration inhibitory factor and/or migration inhibitory factor mRNA with disease duration, clinical type and severity in vitiligo patients. Evaluation of migration inhibitory factor serum level and migration inhibitory factor mRNA expression by ELISA and real-time PCR, respectively, were performed for 50 patients with different degrees of vitiligo severity and compared to 15 age- and gender-matched healthy volunteers as controls. There was a highly significant increase in serum migration inhibitory factor and migration inhibitory factor mRNA levels in vitiligo cases when compared to controls (pvitiligo patients, and each of them with duration and severity of vitiligo. In addition, patients with generalized vitiligo have significantly elevated serum migration inhibitory factor and mRNA levels than control subjects. Small number of investigated subjects. Migration inhibitory factor may have an active role in the development of vitiligo, and it may also be a useful index of disease severity. Consequently, migration inhibitory factor may be a new treatment target for vitiligo patients.
Hanczyc, Piotr
2012-04-24
We report that short, synthetic, double- as well as single-stranded DNA can be aligned in stretched humid poly(vinyl alcohol) (PVA) matrix, and the secondary structure (nucleobase orientation) can be characterized with linear dichroism (LD) spectroscopy. Oligonucleotides of lengths varying between 10 (3.4 nm) and 60 bases (20.4 nm) were investigated with respect to structural properties in the gel-like polymer environment. The DNA conformation as a function of relative humidity reveals a strong dependence of helical structure of DNA on PVA hydration level, results of relevance for nanotechnical studies of DNA-based supramolecular systems. Also, the PVA gel could provide possibilities to test models for nucleic acid interactions and distribution in cell contexts, including structural stability of genetic material in the cell and PVA-packaging for gene delivery. A method by which duplex oligonucleotides, with sequences designed to provide specific binding sites, become amenable to polarized-light spectroscopy opens up new possibilities for studying structure in DNA complexes with small adduct molecules as well as proteins. © 2012 American Chemical Society.
Kozlowska, Anna Karolina; Florczak, Anna; Smialek, Maciej; Dondajewska, Ewelina; Mackiewicz, Andrzej; Kortylewski, Marcin; Dams-Kozlowska, Hanna
2017-09-01
Cell-selective delivery and sensitivity to serum nucleases remain major hurdles to the clinical application of RNA-based oligonucleotide therapeutics, such as siRNA. Spider silk shows great potential as a biomaterial due to its biocompatibility and biodegradability. Self-assembling properties of silk proteins allow for processing into several different morphologies such as fibers, scaffolds, films, hydrogels, capsules and spheres. Moreover, bioengineering of spider silk protein sequences can functionalize silk by adding peptide moieties with specific features including binding or cell recognition domains. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics, such as CpG-siRNA. The MS2 bioengineered silk was functionalized with poly-lysine domain (KN) to generate hybrid silk MS2KN. CpG-siRNA efficiently bound to MS2KN in contrary to control MS2. Both MS2KN complexes and spheres protected CpG-siRNA from degradation by serum nucleases. CpG-siRNA molecules encapsulated into MS2KN spheres were efficiently internalized and processed by TLR9-positive macrophages. Importantly, CpG-STAT3siRNA loaded in silk spheres showed delayed and extended target gene silencing compared to naked oligonucleotides. The prolonged Stat3 silencing resulted in the more pronounced downregulation of interleukin 6 (IL-6), a proinflammatory cytokine and upstream activator of STAT3, which limits the efficacy of TLR9 immunostimulation. Our results demonstrate the feasibility of using spider silk spheres as a carrier of therapeutic nucleic acids. Moreover, the modified kinetic and activity of the CpG-STAT3siRNA embedded into silk spheres is likely to improve immunotherapeutic effects in vivo. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel
Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N
2011-04-01
Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.
DEFF Research Database (Denmark)
Moreno, Pedro M D; Geny, Sylvain; Pabon, Y Vladimir
2013-01-01
In spite of the many developments in synthetic oligonucleotide (ON) chemistry and design, invasion into double-stranded DNA (DSI) under physiological salt and pH conditions remains a challenge. In this work, we provide a new ON tool based on locked nucleic acids (LNAs), designed for strand invasi...
Self-restraint spillover: Inhibitory control disrupts appetite regulation among ruminators.
Schlinkert, Caroline; Koole, Sander L
2017-10-23
People can use inhibitory control to temporarily inhibit their personal preferences to achieve their long-term goals. According to the ego fixation model (Koole et al., 2014), ruminators have difficulties relaxing inhibitory control, leading them to continue inhibiting their personal needs, even when this is no longer required by the situation. Inhibitory control may thus disrupt healthy appetite regulation among ruminators. Among 324 Dutch undergraduate students (218 women; M age = 21.5), different inhibitory control states were manipulated by varying whether or not participants exerted inhibitory control (Study 1) or priming high versus low inhibitory control (Study 2). All participants then performed a food-tasting task. Healthy appetite regulation was defined as a positive correlation between level of food deprivation and preference for high-calorie foods. For taste ratings, the interaction between inhibitory control and rumination was significant in each study: Inhibitory control disrupted healthy appetite regulation in taste preferences among ruminators, but not among non-ruminators. For eating behavior, the same interaction effect was significant when the two studies were combined. Inhibitory control disrupts healthy appetite regulation among ruminators. These findings suggest the need for caution in interventions that rely on inhibitory control, especially among samples with compulsive thought tendencies. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Levy, N.J.; Kasper, D.L.
1986-01-01
The role of surface-bound type Ia group B Streptococcus (GBS) capsular polysaccharide in anti-body-independent binding of C1 and activation of the classic component pathway was investigated. In a radiolabeled bacterial-polymorphonuclear leukocyte (PMN) association assay, a measure of bacterial opsonization, preincubation of 3 H-type Ia GBS with purified F(ab') 2 to the organism blocked the association of the bacteria with PMN', and the inhibitory effect was dose dependent. The specificity of F(ab') 2 blocking was shown after adsorption of F(ab') 2 with type Ia polysaccharide-sensitized erythrocytes. Polysaccharide-adsorbed F(ab') 2 had a 70% decrease in ability to block the association of bacteria with PMN. Neuraminidase digestion removed 80% of the terminal sialic acid residues from the native polysaccharide. These neuraminidase-digested organisms had a 72% decrease in binding and transfer of purified C1 compared with non-enzyme-treated organisms. Type Ia capsular polysaccharide bound to sheep erythrocytes promoted classic complement pathway-mediated hemolysis of the cells. The role of C1 inhibitor (INH) in modulation of C1 activation by the organisms was investigated. The possibility existed that the C1 INH could be bound by the bacteria, allowing C1 activation to occur in the fluid phase. The inhibitor was purified from human serum, and its activity was measured before and after incubation with type Ia GBS. The organisms had no effect on C1 INH activity. Thus surface-bound capsular polysacchardie of type Ia GBS mediates C1 binding and classic pathway activation, and this does not involve the C1 INH
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
Syutsubo, K; Kishira, H; Harayama, S
2001-06-01
The genus Alcanivorax comprises diverse hydrocarbon-degrading marine bacteria. Novel 16S rRNA-targeted oligonucleotide DNA probes (ALV735 and ALV735-b) were developed to quantify two subgroups of the Alcanivorax/Fundibacter group by fluorescence in situ hybridization (FISH), and the conditions for the single-mismatch discrimination of the probes were optimized. The specificity of the probes was improved further using a singly mismatched oligonucleotide as a competitor. The growth of Alcanivorax cells in crude oil-contaminated sea water under the biostimulation condition was investigated by FISH with the probe ALV735, which targeted the main cluster of the Alcanivorax/Fundibacter group. The size of the Alcanivorax population increased with increasing incubation time and accounted for 91% of the 4',6-diamidino-2-phenylindole (DAPI) count after incubation for 2 weeks. The probes developed in this study are useful for detecting Alcanivorax populations in petroleum hydrocarbon-degrading microbial consortia.
Energy Technology Data Exchange (ETDEWEB)
Jansson, Christer; Sun, Chuanxin; Ghebramedhin, Haile; Hoglund, Anna-Stina; Jansson, Christer
2008-01-15
Antisense oligodeoxynucleotide (ODN) inhibition emerges as an effective means for probing gene function in plant cells. Employing this method we have established the importance of the SUSIBA2 transcription factor for regulation of starch synthesis in barley endosperm, and arrived at a model for the role of the SUSIBAs in sugar signaling and source-sink commutation during cereal endosperm development. In this addendum we provide additional data demonstrating the suitability of the antisense ODN technology in studies on starch branching enzyme activities in barley leaves. We also comment on the mechanism for ODN uptake in plant cells. Antisense ODNs are short (12-25 nt-long) stretches of single-stranded ODNs that hybridize to the cognate mRNA in a sequence-specific manner, thereby inhibiting gene expression. They are naturally occurring in both prokaryotes and eukaryotes where they partake in gene regulation and defense against viral infection. The mechanisms for antisense ODN inhibition are not fully understood but it is generally considered that the ODN either sterically interferes with translation or promotes transcript degradation by RNase H activation. The earliest indication of the usefulness of antisense ODN technology for the purposes of molecular biology and medical therapy was the demonstration in 1978 that synthetic ODNs complementary to Raos sarcoma virus could inhibit virus replication in tissue cultures of chick embryo fibroblasts. Since then the antisense ODN technology has been widely used in animal sciences and as an important emerging therapeutic approach in clinical medicine. However, antisense ODN inhibition has been an under-exploited strategy for plant tissues, although the prospects for plant cells in suspension cultures to take up single-stranded ODNs was reported over a decade ago. In 2001, two reports from Malho and coworker demonstrated the use of cationic-complexed antisense ODNs to suppress expression of genes encoding pollen
Flexible brain network reconfiguration supporting inhibitory control.
Spielberg, Jeffrey M; Miller, Gregory A; Heller, Wendy; Banich, Marie T
2015-08-11
The ability to inhibit distracting stimuli from interfering with goal-directed behavior is crucial for success in most spheres of life. Despite an abundance of studies examining regional brain activation, knowledge of the brain networks involved in inhibitory control remains quite limited. To address this critical gap, we applied graph theory tools to functional magnetic resonance imaging data collected while a large sample of adults (n = 101) performed a color-word Stroop task. Higher demand for inhibitory control was associated with restructuring of the global network into a configuration that was more optimized for specialized processing (functional segregation), more efficient at communicating the output of such processing across the network (functional integration), and more resilient to potential interruption (resilience). In addition, there were regional changes with right inferior frontal sulcus and right anterior insula occupying more central positions as network hubs, and dorsal anterior cingulate cortex becoming more tightly coupled with its regional subnetwork. Given the crucial role of inhibitory control in goal-directed behavior, present findings identifying functional network organization supporting inhibitory control have the potential to provide additional insights into how inhibitory control may break down in a wide variety of individuals with neurological or psychiatric difficulties.
Energy Technology Data Exchange (ETDEWEB)
Gao, Zhong Feng; Chen, Dong Mei [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Lei, Jing Lei [School of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China); Luo, Hong Qun, E-mail: luohq@swu.edu.cn [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li, Nian Bing, E-mail: linb@swu.edu.cn [Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China)
2015-10-15
Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. - Highlights: • Conformational switch of i-motif is used for the detection of glucose and urea. • The sensor can be regenerated. • The proposed method is successfully applied in real sample assay. • Our method is label-free and inexpensive.
Godinho, Bruno M D C; Gilbert, James W; Haraszti, Reka A; Coles, Andrew H; Biscans, Annabelle; Roux, Loic; Nikan, Mehran; Echeverria, Dimas; Hassler, Matthew; Khvorova, Anastasia
2017-12-01
Therapeutic oligonucleotides, such as small interfering RNAs (siRNAs), hold great promise for the treatment of incurable genetically defined disorders by targeting cognate toxic gene products for degradation. To achieve meaningful tissue distribution and efficacy in vivo, siRNAs must be conjugated or formulated. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligonucleotides in vivo. In this study, we describe a simple and reproducible methodology for the evaluation of in vivo blood/plasma PK profiles and tissue distribution of oligonucleotides. The method is based on serial blood microsampling from the saphenous vein, coupled to peptide nucleic acid hybridization assay for quantification of guide strands. Performed with minimal number of animals, this method allowed unequivocal detection and sensitive quantification without the need for amplification, or further modification of the oligonucleotides. Using this methodology, we compared plasma clearances and tissue distribution profiles of two different hydrophobically modified siRNAs (hsiRNAs). Notably, cholesterol-hsiRNA presented slow plasma clearances and mainly accumulated in the liver, whereas, phosphocholine-docosahexaenoic acid-hsiRNA was rapidly cleared from the plasma and preferably accumulated in the kidney. These data suggest that the PK/biodistribution profiles of modified hsiRNAs are determined by the chemical nature of the conjugate. Importantly, the method described in this study constitutes a simple platform to conduct pilot assessments of the basic clearance and tissue distribution profiles, which can be broadly applied for evaluation of new chemical variants of siRNAs and micro-RNAs.
Voluntary inhibitory motor control over involuntary tic movements.
Ganos, Christos; Rothwell, John; Haggard, Patrick
2018-03-06
Inhibitory control is crucial for normal adaptive motor behavior. In hyperkinesias, such as tics, disinhibition within the cortico-striato-thalamo-cortical loops is thought to underlie the presence of involuntary movements. Paradoxically, tics are also subject to voluntary inhibitory control. This puzzling clinical observation questions the traditional definition of tics as purely involuntary motor behaviors. Importantly, it suggests novel insights into tic pathophysiology. In this review, we first define voluntary inhibitory tic control and compare it with other notions of tic control from the literature. We then examine the association between voluntary inhibitory tic control with premonitory urges and review evidence linking voluntary tic inhibition to other forms of executive control of action. We discuss the somatotopic selectivity and the neural correlates of voluntary inhibitory tic control. Finally, we provide a scientific framework with regard to the clinical relevance of the study of voluntary inhibitory tic control within the context of the neurodevelopmental disorder of Tourette syndrome. We identify current knowledge gaps that deserve attention in future research. © 2018 International Parkinson and Movement Disorder Society. © 2018 International Parkinson and Movement Disorder Society.
Combining gene expression data from different generations of oligonucleotide arrays
Directory of Open Access Journals (Sweden)
Kong Sek
2004-10-01
Full Text Available Abstract Background One of the important challenges in microarray analysis is to take full advantage of previously accumulated data, both from one's own laboratory and from public repositories. Through a comparative analysis on a variety of datasets, a more comprehensive view of the underlying mechanism or structure can be obtained. However, as we discover in this work, continual changes in genomic sequence annotations and probe design criteria make it difficult to compare gene expression data even from different generations of the same microarray platform. Results We first describe the extent of discordance between the results derived from two generations of Affymetrix oligonucleotide arrays, as revealed in cluster analysis and in identification of differentially expressed genes. We then propose a method for increasing comparability. The dataset we use consists of a set of 14 human muscle biopsy samples from patients with inflammatory myopathies that were hybridized on both HG-U95Av2 and HG-U133A human arrays. We find that the use of the probe set matching table for comparative analysis provided by Affymetrix produces better results than matching by UniGene or LocusLink identifiers but still remains inadequate. Rescaling of expression values for each gene across samples and data filtering by expression values enhance comparability but only for few specific analyses. As a generic method for improving comparability, we select a subset of probes with overlapping sequence segments in the two array types and recalculate expression values based only on the selected probes. We show that this filtering of probes significantly improves the comparability while retaining a sufficient number of probe sets for further analysis. Conclusions Compatibility between high-density oligonucleotide arrays is significantly affected by probe-level sequence information. With a careful filtering of the probes based on their sequence overlaps, data from different
Electrical manipulation of oligonucleotides grafted to charged surfaces.
Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc
2006-09-21
The electrical manipulation of short DNA molecules on surfaces offers novel functionalities with fascinating possibilities in the field of bio-interfaces. Here we present systematic investigations of the electrical interactions which govern the structure of oligonucleotides on charged gold surfaces. Successively, we address influences of the applied field strength, the role of DC electrode potentials, in particular for polycrystalline surfaces, as well as screening effects of the surrounding electrolyte solution. Data obtained for single and double stranded DNA exhibit differences which can be attributed to the dissimilar flexibility of the different molecular conformations. A comparison of the experimental results with a basic model shows how the alignment of the molecules adjusts according to a balance between electrically induced ordering and stochastic thermal motions. The presented conclusions are expected to be of general relevance for the behaviour of polyelectrolytes exposed to localized electric fields at interfaces.
Optimal lipofection reagent varies with the molecular modifications of the DNA.
Conrad, A H; Behlke, M A; Jaffredo, T; Conrad, G W
1998-10-01
Cationic lipid reagents differ in their cytofection efficacy with different cell types. No evidence has addressed whether the same lipid reagent is best for different DNAs in a single cell line. Immortalized avian embryonic cardiomyocytes cultured in vitro were tested with 15 cationic lipid reagents using (A) a beta-gal expression plasmid, (B) a fluorescein-tagged, phosphorothioate-modified ODN B, (C) a fluorescein-tagged, ethoxy-modified ODN C with the same nucleotide sequence as ODN B, and (D) a fluorescein-tagged, phosphorothioate-modified ODN D with a different nucleotide sequence from ODNs B and C. Cytofection was scored as percent of cells expressing beta-gal activity or showing diffuse cellular fluorescence. The best lipid reagents for the phosphorothioate-modified ODNs were ODN-specific and markedly different from the best lipid reagents for the expression plasmid or for the ethoxy-modified ODN. These results suggest that the best cationic lipid reagent for a particular cell type varies with the physical and chemical form of the DNA being transfected into the cells.
International Nuclear Information System (INIS)
Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo
2015-01-01
Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity
Energy Technology Data Exchange (ETDEWEB)
Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: lxuhelen@163.com [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: liuzhiguo@fmmu.edu.cn [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)
2015-02-06
Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.
Lai, Cheng-Tsung; Li, Huei-Jiun; Yu, Weixuan; Shah, Sonam; Bommineni, Gopal R; Perrone, Victoria; Garcia-Diaz, Miguel; Tonge, Peter J; Simmerling, Carlos
2015-08-04
Slow-onset enzyme inhibitors are the subject of considerable interest as an approach to increasing the potency of pharmaceutical compounds by extending the residence time of the inhibitor on the target (the lifetime of the drug-receptor complex). However, rational modulation of residence time presents significant challenges because it requires additional mechanistic insight, such as the nature of the transition state for postbinding isomerization. Our previous work, based on X-ray crystallography, enzyme kinetics, and molecular dynamics simulation, suggested that the slow step in inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA involves a change in the conformation of the substrate binding loop from an open state in the initial enzyme-inhibitor complex to a closed state in the final enzyme-inhibitor complex. Here, we use multidimensional free energy landscapes for loop isomerization to obtain a computational model for the transition state. The results suggest that slow-onset inhibitors crowd key side chains on helices that slide past each other during isomerization, resulting in a steric clash. The landscapes become significantly flatter when residues involved in the steric clash are replaced with alanine. Importantly, this lower barrier can be increased by rational inhibitor redesign to restore the steric clash. Crystallographic studies and enzyme kinetics confirm the predicted effects on loop structure and flexibility, as well as inhibitor residence time. These loss and regain of function studies validate our mechanistic hypothesis for interactions controlling substrate binding loop isomerization, providing a platform for the future design of inhibitors with longer residence times and better in vivo potency. Similar opportunities for slow-onset inhibition via the same mechanism are identified in other pathogens.
Pretreatment of Mice with Oligonucleotide prop5 Protects Them from Influenza Virus Infections
Directory of Open Access Journals (Sweden)
Kang Li
2014-02-01
Full Text Available Influenza A virus is a successful parasite and requires host factors to complete its life cycle. Prop5 is an antisense oligonucleotide, targeting programmed cell death protein 5 (PDCD5. In this study, we tested the antiviral activity of prop5 against mouse-adapted A/FM/1/47 strain of influenza A virus in a mouse model. Prop5 intranasally administered the mice at dosages of 10 and 20 mg/kg/d at 24 h and 30 min before infection, provided 80% and 100% survival rates and prolonged mean survival days in comparison with influenza virus-infected mice (both p < 0.01. Moreover, viral titres in mice pretreated with prop5, at dose of 10 and 20 mg/kg/d, had declined significantly on day two, four, and six post-infection compared with the yields in infected mice (p < 0.05 or p < 0.01; lung index in mice pretreated with prop5 (20 mg/kg/d had been inhibited on day six post-infection (p < 0.05. Western blotting and immunohistochemistry showed that prop5 could down-regulate the PDCD5 protein expression levels in lung tissues of infected mice. These data indicate that antisense oligonucleotide prop5 is a promising drug for prophylaxis and control influenza virus infections and provides an insight into the host-pathogen interaction.
Shabanpoor, Fazel; Gait, Michael J
2013-11-11
We describe a general methodology for fluorescent labelling of peptide conjugates of phosphorodiamidate morpholino oligonucleotides (PMOs) by alkyne functionalization of peptides, subsequent conjugation to PMOs and labelling with a fluorescent compound (Cy5-azide). Two peptide-PMO (PPMO) examples are shown. No detrimental effect of such labelled PMOs was seen in a biological assay.
Directory of Open Access Journals (Sweden)
Renata De Paris
Full Text Available Protein receptor conformations, obtained from molecular dynamics (MD simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to
Bonaccio, Marialaura; Di Castelnuovo, Augusto; Bonanni, Americo; Costanzo, Simona; Persichillo, Mariarosaria; Cerletti, Chiara; Donati, Maria Benedetta; de Gaetano, Giovanni; Iacoviello, Licia
2017-11-08
There is lack of evidence about the likely impact of the economic crisis on dietary habits in Western societies. We aimed to assess dietary modifications that possibly occurred during the recession and to investigate major socioeconomic factors associated with such modifications. Cross-sectional analysis on 1829 subjects from the general population recruited in the larger INHES study (n = 9319) a telephone-based survey on nutrition and health conducted in Italy from 2010 to 2013. Association of socioeconomic (education, household income, occupation) with self-reported impact of the economic crisis on dietary habits was tested by multivariable logistic regression analysis. Low-educated subjects (OR = 2.30; 95% CI: 1.39-3.80), those with poor income (OR = 5.71; 95% CI: 3.68-8.85), and unemployed (OR = 3.93; 95% CI: 1.62-9.56) had higher odds of reporting undesirable dietary changes due to recession. Adherence to the Mediterranean diet was lower in subjects reporting a negative impact of the crisis on diet as compared to those declaring no effect, whereas the quality of grocery items was higher in the latter. Undesirable dietary changes due to the economic crisis were mainly reported by lower socioeconomic groups. Subjects perceiving a negative impact of the recession on their diet also showed a lower adherence to Mediterranean diet and reduced quality of grocery products. © The Author 2017. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
International Nuclear Information System (INIS)
Lloyd, R.V.; Jin, L.; Fields, K.
1990-01-01
We analyzed the distribution of chromogranins A and B in normal and neoplastic endocrine tissues with secretory granules using 35 S-labeled and biotin-labeled oligonucleotide probes by in situ hybridization (ISH). Both radioactive and nonradioactive probes detected messenger RNAs (mRNAs) in frozen and paraffin tissue sections. Endocrine tissues with variable immunoreactivities for chromogranin A protein, such as small-cell lung carcinomas, neuroblastomas, insulinomas, and parathyroid adenomas, expressed the mRNA for chromogranins A and B in most cells. Some technical problems with the biotinylated probes included nonspecific nuclear staining and endogenous alkaline phosphatase, which was not completely abolished by levamisole pretreatment. A differential distribution of chromogranins A and B was seen in pituitary prolactinomas, which expressed abundant chromogranin B but not chromogranin A mRNAs, and in parathyroid adenomas, which expressed abundant chromogranin A but only small amounts of chromogranin B mRNAs. These results indicate that ISH can be used to detect chromogranins A and B in endocrine tissues with radioactive and biotinylated oligonucleotide probes and that the mRNAs for chromogranin A and B are demonstrable in some tumors even when the chromogranin proteins cannot be detected by immunohistochemistry
Energy Technology Data Exchange (ETDEWEB)
Lloyd, R.V.; Jin, L.; Fields, K. (Univ. of Michigan, Ann Arbor (USA))
1990-01-01
We analyzed the distribution of chromogranins A and B in normal and neoplastic endocrine tissues with secretory granules using {sup 35}S-labeled and biotin-labeled oligonucleotide probes by in situ hybridization (ISH). Both radioactive and nonradioactive probes detected messenger RNAs (mRNAs) in frozen and paraffin tissue sections. Endocrine tissues with variable immunoreactivities for chromogranin A protein, such as small-cell lung carcinomas, neuroblastomas, insulinomas, and parathyroid adenomas, expressed the mRNA for chromogranins A and B in most cells. Some technical problems with the biotinylated probes included nonspecific nuclear staining and endogenous alkaline phosphatase, which was not completely abolished by levamisole pretreatment. A differential distribution of chromogranins A and B was seen in pituitary prolactinomas, which expressed abundant chromogranin B but not chromogranin A mRNAs, and in parathyroid adenomas, which expressed abundant chromogranin A but only small amounts of chromogranin B mRNAs. These results indicate that ISH can be used to detect chromogranins A and B in endocrine tissues with radioactive and biotinylated oligonucleotide probes and that the mRNAs for chromogranin A and B are demonstrable in some tumors even when the chromogranin proteins cannot be detected by immunohistochemistry.
Oligonucleotide Length-Dependent Formation of Virus-Like Particles.
Maassen, Stan J; de Ruiter, Mark V; Lindhoud, Saskia; Cornelissen, Jeroen J L M
2018-05-23
Understanding the assembly pathway of viruses can contribute to creating monodisperse virus-based materials. In this study, the cowpea chlorotic mottle virus (CCMV) is used to determine the interactions between the capsid proteins of viruses and their cargo. The assembly of the capsid proteins in the presence of different lengths of short, single-stranded (ss) DNA is studied at neutral pH, at which the protein-protein interactions are weak. Chromatography, electrophoresis, microscopy, and light scattering data show that the assembly efficiency and speed of the particles increase with increasing length of oligonucleotides. The minimal length required for assembly under the conditions used herein is 14 nucleotides. Assembly of particles containing such short strands of ssDNA can take almost a month. This slow assembly process enabled the study of intermediate states, which confirmed a low cooperative assembly for CCMV and allowed for further expansion of current assembly theories. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Harish Bokkasam
Full Text Available Molecular communication systems encounter similar constraints as telecommunications. In either case, channel crosstalk at the receiver end will result in information loss that statistical analysis cannot compensate. This is because in any communication channel there is a physical limit to the amount of information that can be transmitted. We present a novel and simple modified end amplification (MEA technique to generate reduced and defined amounts of specific information in form of short fragments from an oligonucleotide source that also contains unrelated and redundant information. Our method can be a valuable tool to investigate information overflow and channel capacity in biomolecular recognition systems.
Detection of autoimmune antibodies in localized scleroderma by synthetic oligonucleotide antigens
DEFF Research Database (Denmark)
Samuelsen, Simone; Jørgensen, Christian Damsgaard; Mellins, Elizabeth D
2018-01-01
In this study, we developed a series of synthetic oligonucleotides that allowed us to investigate the details on the antigen recognition by autoimmune antibodies in localized scleroderma subjects. Besides dramatically improved analytical specificity of the assay, our data suggests a potential...... linking for antibodies to DNA to the biological status of disease state in localized scleroderma. Moreover, introducing chemical modifications into short synthetic deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) molecules completely changed the binding titers of corresponding antibodies...... and their clinical relevance. The strongest observed effect was registered for the localized scleroderma skin damage index (LoSDI) on the IgG antibodies to TC dinucleotide-rich double-stranded antigen (p
Self-reported impulsivity and inhibitory control in problem gamblers.
Lorains, Felicity K; Stout, Julie C; Bradshaw, John L; Dowling, Nicki A; Enticott, Peter G
2014-01-01
Impulsivity is considered a core feature of problem gambling; however, self-reported impulsivity and inhibitory control may reflect disparate constructs. We examined self-reported impulsivity and inhibitory control in 39 treatment-seeking problem gamblers and 41 matched controls using a range of self-report questionnaires and laboratory inhibitory control tasks. We also investigated differences between treatment-seeking problem gamblers who prefer strategic (e.g., sports betting) and nonstrategic (e.g., electronic gaming machines) gambling activities. Treatment-seeking problem gamblers demonstrated elevated self-reported impulsivity, more go errors on the Stop Signal Task, and a lower gap score on the Random Number Generation task than matched controls. However, overall we did not find strong evidence that treatment-seeking problem gamblers are more impulsive on laboratory inhibitory control measures. Furthermore, strategic and nonstrategic problem gamblers did not differ from their respective controls on either self-reported impulsivity questionnaires or laboratory inhibitory control measures. Contrary to expectations, our results suggest that inhibitory dyscontrol may not be a key component for some treatment-seeking problem gamblers.
Recruitment of activation receptors at inhibitory NK cell immune synapses.
Directory of Open Access Journals (Sweden)
Nicolas Schleinitz
2008-09-01
Full Text Available Natural killer (NK cell activation receptors accumulate by an actin-dependent process at cytotoxic immune synapses where they provide synergistic signals that trigger NK cell effector functions. In contrast, NK cell inhibitory receptors, including members of the MHC class I-specific killer cell Ig-like receptor (KIR family, accumulate at inhibitory immune synapses, block actin dynamics, and prevent actin-dependent phosphorylation of activation receptors. Therefore, one would predict inhibition of actin-dependent accumulation of activation receptors when inhibitory receptors are engaged. By confocal imaging of primary human NK cells in contact with target cells expressing physiological ligands of NK cell receptors, we show here that this prediction is incorrect. Target cells included a human cell line and transfected Drosophila insect cells that expressed ligands of NK cell activation receptors in combination with an MHC class I ligand of inhibitory KIR. The two NK cell activation receptors CD2 and 2B4 accumulated and co-localized with KIR at inhibitory immune synapses. In fact, KIR promoted CD2 and 2B4 clustering, as CD2 and 2B4 accumulated more efficiently at inhibitory synapses. In contrast, accumulation of KIR and of activation receptors at inhibitory synapses correlated with reduced density of the integrin LFA-1. These results imply that inhibitory KIR does not prevent CD2 and 2B4 signaling by blocking their accumulation at NK cell immune synapses, but by blocking their ability to signal within inhibitory synapses.
Directory of Open Access Journals (Sweden)
Hasegawa Naoki
2009-09-01
Full Text Available Abstract Bacterial genome is characterized by frequent unmethylated cytosine-phosphate-guanine (CpG motifs. Deleterious effects can occur when synthetic oligodeoxynucleotides (ODN with unmethylated CpG dinucleotides (CpG-ODN are administered in a systemic fashion. We aimed to evaluate the effect of intratracheal CpG-ODN on lung inflammation and systemic inflammatory response. C57BL/6J mice received intratracheal administration of CpG-ODN (0.01, 0.1, 1.0, 10, or 100 μM or control ODN without CpG motif. Bronchoalveolar lavage (BAL fluid was obtained 3 or 6 h or 1, 2, 7, or 14 days after the instillation and subjected to a differential cell count and cytokine measurement. Lung permeability was evaluated as the BAL fluid-to-plasma ratio of the concentration of human serum albumin that was injected 1 h before euthanasia. Nuclear factor (NF-κB DNA binding activity was also evaluated in lung homogenates. Intratracheal administration of 10 μM or higher concentration of CpG-ODN induced significant inflammatory cell accumulation into the airspace. The peak accumulation of neutrophils and lymphocytes occurred 1 and 2 days after the CpG-ODN administration, respectively. Lung permeability was increased 1 day after the 10 μM CpG-ODN challenge. CpG-ODN also induced nuclear translocation of NF-κB and upregulation of various inflammatory cytokines in BAL fluid and plasma. Histopathology of the lungs and liver revealed acute lung injury and liver damage with necrosis, respectively. Control ODN without CpG motif did not induce any inflammatory change. Since intratracheal CpG-ODN induced acute lung injury as well as systemic inflammatory response, therapeutic strategies to neutralize bacterial DNA that is released after administration of bactericidal agents should be considered.
Bilingual Contexts Modulate the Inhibitory Control Network
Directory of Open Access Journals (Sweden)
Jing Yang
2018-03-01
Full Text Available The present functional magnetic resonance imaging (fMRI study investigated influences of language contexts on inhibitory control and the underlying neural processes. Thirty Cantonese–Mandarin–English trilingual speakers, who were highly proficient in Cantonese (L1 and Mandarin (L2, and moderately proficient in English (L3, performed a picture-naming task in three dual-language contexts (L1-L2, L2-L3, and L1-L3. After each of the three naming tasks, participants performed a flanker task, measuring contextual effects on the inhibitory control system. Behavioral results showed a typical flanker effect in the L2-L3 and L1-L3 condition, but not in the L1-L2 condition, which indicates contextual facilitation on inhibitory control performance by the L1-L2 context. Whole brain analysis of the fMRI data acquired during the flanker tasks showed more neural activations in the right prefrontal cortex and subcortical areas in the L2-L3 and L1-L3 condition on one hand as compared to the L1-L2 condition on the other hand, suggesting greater involvement of the cognitive control areas when participants were performing the flanker task in L2-L3 and L1-L3 contexts. Effective connectivity analyses displayed a cortical-subcortical-cerebellar circuitry for inhibitory control in the trilinguals. However, contrary to the right-lateralized network in the L1-L2 condition, functional networks for inhibitory control in the L2-L3 and L1-L3 condition are less integrated and more left-lateralized. These findings provide a novel perspective for investigating the interaction between bilingualism (multilingualism and inhibitory control by demonstrating instant behavioral effects and neural plasticity as a function of changes in global language contexts.
Decorrelation of Neural-Network Activity by Inhibitory Feedback
Einevoll, Gaute T.; Diesmann, Markus
2012-01-01
Correlations in spike-train ensembles can seriously impair the encoding of information by their spatio-temporal structure. An inevitable source of correlation in finite neural networks is common presynaptic input to pairs of neurons. Recent studies demonstrate that spike correlations in recurrent neural networks are considerably smaller than expected based on the amount of shared presynaptic input. Here, we explain this observation by means of a linear network model and simulations of networks of leaky integrate-and-fire neurons. We show that inhibitory feedback efficiently suppresses pairwise correlations and, hence, population-rate fluctuations, thereby assigning inhibitory neurons the new role of active decorrelation. We quantify this decorrelation by comparing the responses of the intact recurrent network (feedback system) and systems where the statistics of the feedback channel is perturbed (feedforward system). Manipulations of the feedback statistics can lead to a significant increase in the power and coherence of the population response. In particular, neglecting correlations within the ensemble of feedback channels or between the external stimulus and the feedback amplifies population-rate fluctuations by orders of magnitude. The fluctuation suppression in homogeneous inhibitory networks is explained by a negative feedback loop in the one-dimensional dynamics of the compound activity. Similarly, a change of coordinates exposes an effective negative feedback loop in the compound dynamics of stable excitatory-inhibitory networks. The suppression of input correlations in finite networks is explained by the population averaged correlations in the linear network model: In purely inhibitory networks, shared-input correlations are canceled by negative spike-train correlations. In excitatory-inhibitory networks, spike-train correlations are typically positive. Here, the suppression of input correlations is not a result of the mere existence of correlations between
International Nuclear Information System (INIS)
Maria Lina R; Budiman Bela; Andi Yasmon
2009-01-01
Handling and controlling of tuberculosis, a disease caused by Mycobacterium tuberculosis (MTB), is now complicated since there are many MTBs that are resistant against anti-tuberculosis drugs such as isoniazid. The drug resistance could occurred due to the inadequate and un-regular drug utilization that cause gene mutation of the drug target such as katG gene for isoniazid. The molecular biology techniques such as the PCR- dot blot hybridization with radioisotope ( 32 P) labeled oligonucleotide probe, has been reported as a technique that is more sensitive and rapid for detection of gene mutations related with drug resistances. Hence, the aim of this study was to apply the PCR- dot blot hybridization technique using 32 P labeled oligonucleotide probe for detection of single mutation at codon 315 of katG gene of MTBs that rise the isoniazid resistance. In this study, we used 89 sputum specimens and a standard MTB (MTB H 37 RV) as a control. DNA extractions were performed by the BOOM method and the phenol chloroform for sputum samples and standard MTB, respectively. Primers used for PCR technique were Pt8 and Pt9 and RTB59 and RTB36 for detecting tuberculosis causing Mycobacterium and the existence of katG gene, respectively. Both of the primers are specific for IS6110 region and katG gene, respectively. PCR products were detected by an agarose gel electrophoresis technique. Dot blot hybridization with 32 P-oligonucleotide probe 315mu was performed to detect mutation at codon 315 of tested samples. Results of the PCR using primer Pt8 and Pt9 showed that all sputum specimens had positive results. Mutation detection by PCR- dot blot hybridization with 32 P-oligonucleotide probe 315mu, revealed that 11 of 89 tested samples had a mutation at their codon 315 of katG gene. Based upon these results, it is concluded that PCR-dot blot hybridization with 32 P-oligonucleotide probe is a technique that is rapid and highly specific and sensitive for detection of mutation at codon
Somroop, Srinuan; Tongtawe, Pongsri; Chaisri, Urai; Tapchaisri, Pramuan; Chongsa-nguan, Manas; Srimanote, Potjanee; Chaicumpa, Wanpen
2006-12-01
An oral cholera vaccine made up of heat-treated recombinant cholera toxin (rCT), V. cholerae lipopolysaccharide (LPS), and recombinant toxin-co-regulated pili subunit A (rTcpA), entrapped in liposomes in the presence of unmethylated bacterial CpG-DNA (ODN#1826) was used to orally immunize a group of eight week old rats. A booster dose was given 14 days later. Control rats received placebo (vaccine diluent). The kinetics of the immune response were investigated by enumerating the antigen specific-antibody secreting cells (ASC) in the blood circulation and intestinal lamina propria using the ELISPOT assay and a histo-immunofluorescence assay (IFA), respectively. ASC of all antigenic specificities were detected in the blood of the vaccinated rats as early as two days after the booster dose. The numbers of LPS-ASC and TcpA-ASC in the blood were at their peak at day 3 post booster while the number of CT-ASC was highest at day 4 after the booster immunization. At day 13 post immunization, no ASC were detected in the blood. A several fold increase in the number of ASC of all antigenic specificities in the lamina propria above the background numbers of the control animals were found in all vaccinated rats at days 6 and 13 post booster (earlier and later time points were not studied). Vibriocidal antibody and specific antibodies to CT, LPS and TcpA were detected in 57.1% and 52.4%, 14.3%, and 19.0% of the orally vaccinated rats, respectively. The data indicated that rats orally primed with the vaccine could produce a rapid anamnestic response after re-exposure to the V. cholerae antigens. Thus, a single dose of the vaccine is expected to elicit a similar anamnestic immune response in people from cholera endemic areas who have been naturally primed to V. cholerae antigens, while two doses at a 14 day interval should be adequate for a traveler to a disease endemicarea.
Somatostatin-expressing inhibitory interneurons in cortical circuits
Directory of Open Access Journals (Sweden)
Iryna Yavorska
2016-09-01
Full Text Available Cortical inhibitory neurons exhibit remarkable diversity in their morphology, connectivity, and synaptic properties. Here, we review the function of somatostatin-expressing (SOM inhibitory interneurons, focusing largely on sensory cortex. SOM neurons also comprise a number of subpopulations that can be distinguished by their morphology, input and output connectivity, laminar location, firing properties, and expression of molecular markers. Several of these classes of SOM neurons show unique dynamics and characteristics, such as facilitating synapses, specific axonal projections, intralaminar input, and top-down modulation, which suggest possible computational roles. SOM cells can be differentially modulated by behavioral state depending on their class, sensory system, and behavioral paradigm. The functional effects of such modulation have been studied with optogenetic manipulation of SOM cells, which produces effects on learning and memory, task performance, and the integration of cortical activity. Different classes of SOM cells participate in distinct disinhibitory circuits with different inhibitory partners and in different cortical layers. Through these disinhibitory circuits, SOM cells help encode the behavioral relevance of sensory stimuli by regulating the activity of cortical neurons based on subcortical and intracortical modulatory input. Associative learning leads to long-term changes in the strength of connectivity of SOM cells with other neurons, often influencing the strength of inhibitory input they receive. Thus despite their heterogeneity and variability across cortical areas, current evidence shows that SOM neurons perform unique neural computations, forming not only distinct molecular but also functional subclasses of cortical inhibitory interneurons.
Do detour tasks provide accurate assays of inhibitory control?
Whiteside, Mark A.; Laker, Philippa R.; Beardsworth, Christine E.
2018-01-01
Transparent Cylinder and Barrier tasks are used to purportedly assess inhibitory control in a variety of animals. However, we suspect that performances on these detour tasks are influenced by non-cognitive traits, which may result in inaccurate assays of inhibitory control. We therefore reared pheasants under standardized conditions and presented each bird with two sets of similar tasks commonly used to measure inhibitory control. We recorded the number of times subjects incorrectly attempted to access a reward through transparent barriers, and their latencies to solve each task. Such measures are commonly used to infer the differential expression of inhibitory control. We found little evidence that their performances were consistent across the two different Putative Inhibitory Control Tasks (PICTs). Improvements in performance across trials showed that pheasants learned the affordances of each specific task. Critically, prior experience of transparent tasks, either Barrier or Cylinder, also improved subsequent inhibitory control performance on a novel task, suggesting that they also learned the general properties of transparent obstacles. Individual measures of persistence, assayed in a third task, were positively related to their frequency of incorrect attempts to solve the transparent inhibitory control tasks. Neophobia, Sex and Body Condition had no influence on individual performance. Contrary to previous studies of primates, pheasants with poor performance on PICTs had a wider dietary breadth assayed using a free-choice task. Our results demonstrate that in systems or taxa where prior experience and differences in development cannot be accounted for, individual differences in performance on commonly used detour-dependent PICTS may reveal more about an individual's prior experience of transparent objects, or their motivation to acquire food, than providing a reliable measure of their inhibitory control. PMID:29593115
Plume characteristics and dynamics of UV and IR laser-desorbed oligonucleotides.
Merrigan, Tony L; Timson, David J; Hunniford, C Adam; Catney, Martin; McCullough, Robert W
2012-05-01
Laser desorption of dye-tagged oligonucleotides was studied using laser-induced fluorescence imaging. Desorption with ultra violet (UV) and infra-red (IR) lasers resulted in forward directed plumes of molecules. In the case of UV desorption, the initial shot desorbed approximately seven-fold more material than subsequent shots. In contrast, the initial shot in IR desorption resulted in the ejection of less material compared to subsequent shots and these plumes had a component directed along the path of the laser. Thermal equilibrium of the molecules in the plume was achieved after approximately 25 μs with a spread in molecular temperature which was described by a modified Maxwell-Boltzmann equation. Copyright © 2012 Elsevier B.V. All rights reserved.
A non-covalent peptide-based strategy for ex vivo and in vivo oligonucleotide delivery.
Crombez, Laurence; Morris, May C; Heitz, Frederic; Divita, Gilles
2011-01-01
The dramatic acceleration in identification of new nucleic acid-based therapeutic molecules such as short interfering RNA (siRNA) and peptide-nucleic acid (PNA) analogues has provided new perspectives for therapeutic targeting of specific genes responsible for pathological disorders. However, the poor cellular uptake of nucleic acids together with the low permeability of the cell membrane to negatively charged molecules remain major obstacles to their clinical development. Several non-viral strategies have been proposed to improve the delivery of synthetic short oligonucleotides both in cultured cells and in vivo. Cell-penetrating peptides constitute very promising tools for non-invasive cellular import of oligonucleotides and analogs. We recently described a non-covalent strategy based on short amphiphatic peptides (MPG8/PEP3) that have been successfully applied ex vivo and in vivo for the delivery of therapeutic siRNA and PNA molecules. PEP3 and MPG8 form stable nanoparticles with PNA analogues and siRNA, respectively, and promote their efficient cellular uptake, independently of the endosomal pathway, into a wide variety of cell lines, including primary and suspension lines, without any associated cytotoxicity. This chapter describes easy-to-handle protocols for the use of MPG-8 or PEP-3-nanoparticle technologies for PNA and siRNA delivery into adherent and suspension cell lines as well as in vivo into cancer mouse models.
DEFF Research Database (Denmark)
Astakhova, I Kira; Wengel, Jesper
2013-01-01
Double-labeled oligonucleotide probes containing fluorophores interacting by energy-transfer mechanisms are essential for modern bioanalysis, molecular diagnostics, and in vivo imaging techniques. Although bright xanthene and cyanine dyes are gaining increased prominence within these fields, little...
Organizers of inhibitory synapses come of age.
Krueger-Burg, Dilja; Papadopoulos, Theofilos; Brose, Nils
2017-08-01
While the postsynaptic density of excitatory synapses is known to encompass a highly complex molecular machinery, the equivalent organizational structure of inhibitory synapses has long remained largely undefined. In recent years, however, substantial progress has been made towards identifying the full complement of organizational proteins present at inhibitory synapses, including submembranous scaffolds, intracellular signaling proteins, transsynaptic adhesion proteins, and secreted factors. Here, we summarize these findings and discuss future challenges in assigning synapse-specific functions to the newly discovered catalog of proteins, an endeavor that will depend heavily on newly developed technologies such as proximity biotinylation. Further advances are made all the more essential by growing evidence that links inhibitory synapses to psychiatric and neurological disorders. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sommariva, Michele; De Cecco, Loris; De Cesare, Michelandrea; Sfondrini, Lucia; Ménard, Sylvie; Melani, Cecilia; Delia, Domenico; Zaffaroni, Nadia; Pratesi, Graziella; Uva, Valentina; Tagliabue, Elda; Balsari, Andrea
2011-10-15
Synthetic oligodeoxynucleotides expressing CpG motifs (CpG-ODN) are a Toll-like receptor 9 (TLR9) agonist that can enhance the antitumor activity of DNA-damaging chemotherapy and radiation therapy in preclinical mouse models. We hypothesized that the success of these combinations is related to the ability of CpG-ODN to modulate genes involved in DNA repair. We conducted an in silico analysis of genes implicated in DNA repair in data sets obtained from murine colon carcinoma cells in mice injected intratumorally with CpG-ODN and from splenocytes in mice treated intraperitoneally with CpG-ODN. CpG-ODN treatment caused downregulation of DNA repair genes in tumors. Microarray analyses of human IGROV-1 ovarian carcinoma xenografts in mice treated intraperitoneally with CpG-ODN confirmed in silico findings. When combined with the DNA-damaging drug cisplatin, CpG-ODN significantly increased the life span of mice compared with individual treatments. In contrast, CpG-ODN led to an upregulation of genes involved in DNA repair in immune cells. Cisplatin-treated patients with ovarian carcinoma as well as anthracycline-treated patients with breast cancer who are classified as "CpG-like" for the level of expression of CpG-ODN modulated DNA repair genes have a better outcome than patients classified as "CpG-untreated-like," indicating the relevance of these genes in the tumor cell response to DNA-damaging drugs. Taken together, the findings provide evidence that the tumor microenvironment can sensitize cancer cells to DNA-damaging chemotherapy, thereby expanding the benefits of CpG-ODN therapy beyond induction of a strong immune response.
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-01-01
Full Text Available Nucleic acids are useful for biomedical targeting and sensing applications in which the molecular environment is different from that of a dilute aqueous solution. In this study, the influence of various types of mixed solutions of water and water-soluble organic compounds on RNA was investigated by measuring the catalytic activity of the hammerhead ribozyme and the thermodynamic stability of an oligonucleotide duplex. The compounds with a net neutral charge, such as poly(ethylene glycol, small primary alcohols, amide compounds, and aprotic solvent molecules, added at high concentrations changed the ribozyme-catalyzed RNA cleavage rate, with the magnitude of the effect dependent on the NaCl concentration. These compounds also changed the thermodynamic stability of RNA base pairs of an oligonucleotide duplex and its dependence on the NaCl concentration. Specific interactions with RNA molecules and reduced water activity could account for the inhibiting effects on the ribozyme catalysis and destabilizing effects on the duplex stability. The salt concentration dependence data correlated with the dielectric constant, but not with water activity, viscosity, and the size of organic compounds. This observation suggests the significance of the dielectric constant effects on the RNA reactions under molecular crowding conditions created by organic compounds.
Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.
Abe, Hiroshi; Kimura, Yasuaki
2018-01-01
Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.
Liu, Qiong; Xu, Wei; Qiu, Hai-rong; Wang, Rong; Yu, Hui; Fan, Lei; Miao, Kou-rong; Li, Jian-yong
2009-09-01
To explore the effect of CpG-oligodeoxynucleotides (ODN) in chromosome study of chronic lymphocytic leukemia (CLL). Blood or bone marrow cells of 70 CLL patients were cultured for 72 h with PHA, CpG-ODN and CpG-ODN combined with IL-2, respectively. Routine karyotype analysis with R banding technique and interphase fluorescence in situ hybridization (FISH) were performed. The metaphase number>or=20 was considered as successful stimulation, which in PHA, CpG-ODN and CpG-ODN combined IL-2 groups were 90.0%, 68.6% and 68.6%, respectively, and the detection rates of chromosome aberrations were 3.2%, 43.6% and 43.6%, respectively. The aberrations rates detected by interphase FISH with a panel of probes was 64.3%. CpG-ODN DSP30 can effectively raise the detection rate of chromosome aberrations in CLL patients.
Shabanpoor, Fazel; Hammond, Suzan M; Abendroth, Frank; Hazell, Gareth; Wood, Matthew J.A.
2017-01-01
Splice-switching antisense oligonucleotides are emerging treatments for neuromuscular diseases, with several splice-switching oligonucleotides (SSOs) currently undergoing clinical trials such as for Duchenne muscular dystrophy (DMD) and spinal muscular atrophy (SMA). However, the development of systemically delivered antisense therapeutics has been hampered by poor tissue penetration and cellular uptake, including crossing of the blood–brain barrier (BBB) to reach targets in the central nervous system (CNS). For SMA application, we have investigated the ability of various BBB-crossing peptides for CNS delivery of a splice-switching phosphorodiamidate morpholino oligonucleotide (PMO) targeting survival motor neuron 2 (SMN2) exon 7 inclusion. We identified a branched derivative of the well-known ApoE (141–150) peptide, which as a PMO conjugate was capable of exon inclusion in the CNS following systemic administration, leading to an increase in the level of full-length SMN2 transcript. Treatment of newborn SMA mice with this peptide-PMO (P-PMO) conjugate resulted in a significant increase in the average lifespan and gains in weight, muscle strength, and righting reflexes. Systemic treatment of adult SMA mice with this newly identified P-PMO also resulted in small but significant increases in the levels of SMN2 pre-messenger RNA (mRNA) exon inclusion in the CNS and peripheral tissues. This work provides proof of principle for the ability to select new peptide paradigms to enhance CNS delivery and activity of a PMO SSO through use of a peptide-based delivery platform for the treatment of SMA potentially extending to other neuromuscular and neurodegenerative diseases. PMID:28118087
Studzińska, Sylwia; Mounicou, Sandra; Szpunar, Joanna; Łobiński, Ryszard; Buszewski, Bogusław
2015-01-15
This text presents a novel method for the separation and detection of phosphorothioate oligonucleotides with the use of ion pair ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry The research showed that hexafluoroisopropanol/triethylamine based mobile phases may be successfully used when liquid chromatography is coupled with such elemental detection. However, the concentration of both HFIP and TEA influences the final result. The lower concentration of HFIP, the lower the background in ICP-MS and the greater the sensitivity. The method applied for the analysis of serum samples was based on high resolution inductively coupled plasma mass spectrometry. Utilization of this method allows determination of fifty times lower quantity of phosphorothioate oligonucleotides than in the case of quadrupole mass analyzer. Monitoring of (31)P may be used to quantify these compounds at the level of 80 μg L(-1), while simultaneous determination of sulfur is very useful for qualitative analysis. Moreover, the results presented in this paper demonstrate the practical applicability of coupling LC with ICP-MS in determining phosphorothioate oligonucleotides and their metabolites in serum within 7 min with a very good sensitivity. The method was linear in the concentration range between 0.2 and 3 mg L(-1). The limit of detection was in the range of 0.07 and 0.13 mg L(-1). Accuracy varied with concentration, but was in the range of 3%. Copyright © 2014 Elsevier B.V. All rights reserved.
A pilot investigation of acute inhibitory control training in cocaine users.
Alcorn, Joseph L; Pike, Erika; Stoops, William S; Lile, Joshua A; Rush, Craig R
2017-05-01
Disrupted response inhibition and presence of drug-cue attentional bias in cocaine-using individuals have predicted poor treatment outcomes. Inhibitory control training could help improve treatment outcomes by strengthening cognitive control. This pilot study assessed the effects of acute inhibitory control training to drug- and non-drug-related cues on response inhibition performance and cocaine-cue attentional bias in cocaine-using individuals. Participants who met criteria for a cocaine-use disorder underwent five sessions of inhibitory control training to either non-drug-related cues (i.e., rectangles) or cocaine cues (n=10/condition) in a single day. Response inhibition and attentional bias were assessed prior to and following training using the stop-signal task and visual-probe task with eye tracking, respectively. Training condition groups did not differ on demographics, inhibitory control training performance, response inhibition, or cocaine-cue attentional bias. Response inhibition performance improved as a function of inhibitory control training in both conditions. Cocaine-cue attentional bias was observed, but did not change as a function of inhibitory control training in either condition. Response inhibition in cocaine-using individuals was augmented by acute inhibitory control training, which may improve treatment outcomes through better behavioral inhibition. Future studies should investigate longer-term implementation of inhibitory control training, as well as combining inhibitory control training with other treatment modalities. Copyright © 2017 Elsevier B.V. All rights reserved.
Inhibitory ability of children with developmental dyscalculia.
Zhang, Huaiying; Wu, Hanrong
2011-02-01
Inhibitory ability of children with developmental dyscalculia (DD) was investigated to explore the cognitive mechanism underlying DD. According to the definition of developmental dyscalculia, 19 children with DD-only and 10 children with DD&RD (DD combined with reading disability) were selected step by step, children in two control groups were matched with children in case groups by gender and age, and the match ratio was 1:1. Psychological testing software named DMDX was used to measure inhibitory ability of the subjects. The differences of reaction time in number Stroop tasks and differences of accuracy in incongruent condition of color-word Stroop tasks and object inhibition tasks between DD-only children and their controls reached significant levels (P<0.05), and the differences of reaction time in number Stroop tasks between dyscalculic and normal children did not disappear after controlling the non-executive components. The difference of accuracy in color-word incongruent tasks between children with DD&RD and normal children reached significant levels (P<0.05). Children with DD-only confronted with general inhibitory deficits, while children with DD&RD confronted with word inhibitory deficits only.
Synthesis and antitubercular activity of isoniazid condensed with carbohydrate derivatives
Directory of Open Access Journals (Sweden)
Sílvia H. Cardoso
2009-01-01
Full Text Available A series of 13 compounds analogous of isoniazid condensed with carbohydrate was synthesized and evaluated for their in vitro antibacterial activity against Mycobacterium tuberculosis H37Rv using Alamar Blue susceptibility test and the activity expressed as the minimum inhibitory concentration (MIC90 in μg/mL. Several compounds exhibited antitubercular activity (0.31-3.12 μg/mL when compared with first line drugs such as isoniazid (INH and rifampicin (RIP and could be a good starting point to develop new compounds against tuberculosis.
Grineva, N I; Borovkova, T V; Sats, N V; Kurabekova, R M; Rozhitskaia, O S; Solov'ev, G Ia; Pantin, V I
1995-08-01
G11 mouse cells and SH2 rat cells transformed with simian adenovirus SA7 DNA showed inheritable oncogen-specific phenotypic normalization when treated with sense and antisense oligonucleotides complementary to long RNA sequences, plus or minus strands of the integrated adenovirus oncogenes E1A and E1B. Transitory treatment of the cells with the oligonucleotides in the absence of serum was shown to cause the appearance of normalized cell lines with fibroblastlike morphology, slower cell proliferation, and lack of ability to form colonies in soft agar. Proliferative activity and adhesion of the normalized cells that established cell lines were found to depend on the concentration of growth factors in the cultural medium. In some of the cell lines, an inhibition of transcription of the E1 oncogenes was observed. The normalization also produced cells that divided 2 - 5 times and died and cells that reverted to a transformed phenotype in 2 - 10 days. The latter appeared predominantly upon the action of the antisense oligonucleotides.
Steeg, E. van de; Läppchen, T.; Aguilera, B.; Jansen, H.T.; Muilwijk, D.; Vermue, R.; Hoorn, J.W. van der; Donato, K.; Rossin, R.; Visser, P.C. de; Vlaming, M.L.H.
2017-01-01
Antisense oligonucleotides (AONs) are promising candidates for treatment of Duchenne muscular dystrophy (DMD), a severe and progressive disease resulting in premature death. However, more knowledge on the pharmacokinetics of new AON drug candidates is desired for effective application in the clinic.
Sochacka, E
2001-01-01
In order to efficiently assess the chemical stability of modified nucleosides to the reagents and conditions of automated oligonucleotide synthesis, we designed, developed and tested a scheme in which the modified nucleoside, directly attached to a solid support, is exposed to the cyclic chemistry of the instrument. Stability of 2-thiouridine against different oxidizers was investigated. Tertbutyl hydroperoxide (1 M) in anhydrous acetonitrile was a more effective oxidizer for the incorporation of 2-thiouridine into oligonucleotide chains than the same oxidizer in methylene chloride. Carbon tetrachloride/water in the presence of a basic catalyst was superior in maintaining the thiocarbonyl function, but its utility for RNA synthesis has yet to be fully tested, whereas 2-phenylsulfonyloxaziridine was a very efficient reagent for oxidative desulfurization of 2-thiouridine.
Bannai, M; Ichikawa, M; Nishihara, M; Takahashi, M
1998-02-16
In the ventromedial hypothalamus (VMH), gamma-aminobutyric acid (GABA) plays a role in regulating feeding and running behaviors. The GABA synthetic enzyme, glutamic acid decarboxylase (GAD), consists of two isozymes, GAD65 and GAD67. In the present study, the phosphorothioated antisense oligodeoxynucleotides (ODNs) of each GAD isozyme were injected bilaterally into the VMH of male rats, and food intake, body weight and locomotor activity were monitored. ODNs were incorporated in the water-absorbent polymer (WAP, 0.2 nmol/microliter) so that ODNs were retained at the injection site. Each antisense ODN of GAD65 or GAD67 tended to reduce food intake on day 1 (day of injection=day 0) though not significantly. An injection combining both antisense ODNs significantly decreased food intake only on day 1, but body weight remained significantly lower than the control for 5 days. This suppression of body weight gain could be attributed to a significant increase in locomotor activity between days 3 and 5. Individual treatment with either ODNs did not change locomotor activity. The increase in daily locomotor activity in the group receiving the combined antisense ODNs occurred mainly during the light phase. Neither vehicle (WAP) nor control ODN affected food intake, body weight and locomotor activity. Histological studies indicated that antisense ODN distributed within 800 micron from the edge of the area where WAP was located 24 h after the injection gradually disappeared within days, but still remained within 300 micron m distance even 7 days after the injection. Antisense ODN was effectively incorporated by all the cell types examined, i.e., neurons, astrocytes and microglias. Further, HPLC analysis revealed that antisense ODNs of GAD isozymes, either alone or combined, decreased the content of GABA by 50% in VMH 24 h after the injection. These results indicate that suppression of GABA synthesis by either of the GAD isozymes is synergistically involved in suppressing food
Mui, B; Raney, S G; Semple, S C; Hope, M J
2001-09-01
The therapeutic benefit from phosphorothioate oligodeoxynucleotides (PS ODN) containing immune stimulatory sequences (ISS) has been demonstrated in animal models of cancer and infection. In particular, when CpG-containing PS ODN are administered to mice, activation of macrophages and dendritic, NK, T, and B cells occurs, resulting in the release of an array of cytokines, including interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor-alpha (TNF-alpha). We have previously described stabilized antisense-lipid particles (SALP) for the i.v. administration of antisense ODN [Biochim Biophys Acta (2001) 1510:152--166]. Given the propensity for SALP to target macrophages in vivo it was of interest to determine whether they could enhance the potency of CpG ODN to induce an immune response. In this report we show that when CpG-containing SALP are administered intravenously to ICR mice the plasma concentrations of IL-12, IFN-gamma, IL-6, monocyte chemoattractant protein-1, and TNF-alpha are greatly increased compared with the same dose of free ODN. The pattern of cytokine induction indicates that the immune response is T helper cell type 1-biased, similar to that observed for PS CpG ODN ISS in general. Furthermore, when phosphodiester (PO) ODN is substituted for PS ODN in the SALP formulation cytokine induction is even greater at the early time points, in marked contrast to free PO ODN, which is inactive. These results demonstrate that the immunogenicity of ISS is not only enhanced by encapsulation in lipid particles, which more closely mimic the way ISS DNA would normally be presented to antigen presenting cells by pathogens in vivo, but also SALP enable unmodified PO CpG ODN to be used as immune stimulants.
A New Achiral Linker Reagent for the Incorporation of Multiple Amino Groups Into Oligonucleotides
DEFF Research Database (Denmark)
1997-01-01
The present invention relates to a new functionalized achiral linker reagent for incorporating multiple primary amino groups or reporter groups into oligonucleotides following the phosphoramidite methodology. It is possible to substitute any ribodeoxynucleotide, deoxynucleotide, or nucleotide......-oxyl-2,2,5,5-tetramethylpyrrolidine), TEMPO (N-oxyl-2,2,6,6-tetramethylpiperidine), dinitrophenyl, texas red, tetramethyl rhodamine, 7-nitrobenzo-2-oxa-1-diazole (NBD), or pyrene. The present invention also relates to a solid phase support, e.g. a Controlled Pore Glass (CPG), immobilized linker reagent...
Advancements of antisense oligonucleotides in treatment of breast cancer
Institute of Scientific and Technical Information of China (English)
YANGShuan-Ping; SONGSan-Tai; 等
2003-01-01
Breast cancer is one kind of multi-gene related malignancy.Overexpression of some oncogenes such as HER-2(c-erbB-2,Neu),bcl-2/bcl-xL,protein kinase A(PKA),and transferrin receptor gene(TfR gene),etc significantly affect the prognosis of breast cancer.It was shown that specific suppression of the overexpressed genes above resulted in the improvement of the therapy of breast cancer.Antisense interference.one of useful tools for inhibiting the overexpression of specific oncogenes,was involved in the therapy of breast cancer in recent years. Data indicated that antisense oligonucleotides(ON)could inhibit specially the expression of the target genes on mRNA or protein levels in most of cases;some ON candidates showed encouraging therapeutic effects in vitro and in vivo on breast cancer cell lines or xenografts.Furthermore,the combination use of the antisense ON and normal chemotherapeutic agents indicated synergistic antitumor effects,which was probably the best utilization of antisense ON in the treatment of breast cancer.
Studzińska, Sylwia; Krzemińska, Katarzyna; Szumski, Michał; Buszewski, Bogusław
2016-07-01
The main aim of this study was the investigation of the influence of several ion pair reagents towards both the retention and the mass spectrometry sensitivity of phosphorothioate oligonucleotides. A cholesterol stationary phase was applied for the first time in the analysis of this group of compounds. The mobile phase composition was modified by changing the concentration and the type of amines and acetates or 1,1,1,3,3,3-hexafluoroisopropanol. It has been shown that the increase of amines concentration results in the retention factor increase for each oligonucleotide, on each adsorbent. The only exception was the mobile phase composed of triethylamine and 1,1,1,3,3,3-hexafluoroisopropanol. This is a consequence of interactions taking place between a cholesterol molecule and an alcohol. This effect was convenient when the mass spectrometry detection was applied, since it allowed an increase in the sensitivity. Moreover, optimization of the mobile phase composition and its impact on the efficiency of ionization process and on the sensitivity in mass spectrometry were also presented. The optimization of this new method, based on cholesterol stationary phase coupled with mass spectrometry detection, was finally applied for the determination of phosphorothioate oligonucleotides impurity in a real sample. Copyright © 2016 Elsevier B.V. All rights reserved.
Inhibitory Effects of Respiration Inhibitors on Aflatoxin Production
Directory of Open Access Journals (Sweden)
Shohei Sakuda
2014-03-01
Full Text Available Aflatoxin production inhibitors, which do not inhibit the growth of aflatoxigenic fungi, may be used to control aflatoxin without incurring a rapid spread of resistant strains. A respiration inhibitor that inhibits aflatoxin production was identified during a screening process for natural, aflatoxin-production inhibitors. This prompted us to evaluate respiration inhibitors as potential aflatoxin control agents. The inhibitory activities of four natural inhibitors, seven synthetic miticides, and nine synthetic fungicides were evaluated on aflatoxin production in Aspergillus parasiticus. All of the natural inhibitors (rotenone, siccanin, aptenin A5, and antimycin A inhibited fungal aflatoxin production with IC50 values around 10 µM. Among the synthetic miticides, pyridaben, fluacrypyrim, and tolfenpyrad exhibited strong inhibitory activities with IC50 values less than 0.2 µM, whereas cyflumetofen did not show significant inhibitory activity. Of the synthetic fungicides, boscalid, pyribencarb, azoxystrobin, pyraclostrobin, and kresoxim-methyl demonstrated strong inhibitory activities, with IC50 values less than 0.5 µM. Fungal growth was not significantly affected by any of the inhibitors tested at concentrations used. There was no correlation observed between the targets of respiration inhibitors (complexes I, II, and III and their IC50 values for aflatoxin-production inhibitory activity. This study suggests that respiration inhibitors, including commonly used pesticides, are useful for aflatoxin control.
Inhibitory Effects of Respiration Inhibitors on Aflatoxin Production
Sakuda, Shohei; Prabowo, Diyan Febri; Takagi, Keiko; Shiomi, Kazuro; Mori, Mihoko; Ōmura, Satoshi; Nagasawa, Hiromichi
2014-01-01
Aflatoxin production inhibitors, which do not inhibit the growth of aflatoxigenic fungi, may be used to control aflatoxin without incurring a rapid spread of resistant strains. A respiration inhibitor that inhibits aflatoxin production was identified during a screening process for natural, aflatoxin-production inhibitors. This prompted us to evaluate respiration inhibitors as potential aflatoxin control agents. The inhibitory activities of four natural inhibitors, seven synthetic miticides, and nine synthetic fungicides were evaluated on aflatoxin production in Aspergillus parasiticus. All of the natural inhibitors (rotenone, siccanin, aptenin A5, and antimycin A) inhibited fungal aflatoxin production with IC50 values around 10 µM. Among the synthetic miticides, pyridaben, fluacrypyrim, and tolfenpyrad exhibited strong inhibitory activities with IC50 values less than 0.2 µM, whereas cyflumetofen did not show significant inhibitory activity. Of the synthetic fungicides, boscalid, pyribencarb, azoxystrobin, pyraclostrobin, and kresoxim-methyl demonstrated strong inhibitory activities, with IC50 values less than 0.5 µM. Fungal growth was not significantly affected by any of the inhibitors tested at concentrations used. There was no correlation observed between the targets of respiration inhibitors (complexes I, II, and III) and their IC50 values for aflatoxin-production inhibitory activity. This study suggests that respiration inhibitors, including commonly used pesticides, are useful for aflatoxin control. PMID:24674936
A role for NF-κB–dependent gene transactivation in sunburn
Abeyama, Kazuhiro; Eng, William; Jester, James V.; Vink, Arie A.; Edelbaum, Dale; Cockerell, Clay J.; Bergstresser, Paul R.; Takashima, Akira
2000-01-01
Exposure of skin to ultraviolet (UV) radiation is known to induce NF-κB activation, but the functional role for this pathway in UV-induced cutaneous inflammation remains uncertain. In this study, we examined whether experimentally induced sunburn reactions in mice could be prevented by blocking UV-induced, NF-κB–dependent gene transactivation with oligodeoxynucleotides (ODNs) containing the NF-κB cis element (NF-κB decoy ODNs). UV-induced secretion of IL-1, IL-6, TNF-α, and VEGF by skin-derived cell lines was inhibited by the decoy ODNs, but not by the scrambled control ODNs. Systemic or local injection of NF-κB decoy ODNs also inhibited cutaneous swelling responses to UV irradiation. Moreover, local UV-induced inflammatory changes (swelling, leukocyte infiltration, epidermal hyperplasia, and accumulation of proinflammatory cytokines) were all inhibited specifically by topically applied decoy ODNs. Importantly, these ODNs had no effect on alternative types of cutaneous inflammation caused by irritant or allergic chemicals. These results indicate that sunburn reactions culminate from inflammatory events that are triggered by UV-activated transcription of NF-κB target genes, rather than from nonspecific changes associated with tissue damage. PMID:10862790
CpG-DNA enhancement the immune elicited as adjuvant of foot- and- mouth disease vaccine
Directory of Open Access Journals (Sweden)
Morshedi, A.
2010-01-01
Full Text Available In the present study the effect of the locally produced genetic adjuvant of ginea pig specific CpG-motif-containing oligodeoxynucleotide (CpG-ODN in an inactivated FMD virus vaccine was evaluated. Boosting the ginea pigs with FMD vaccine along with CpG-ODN adjuvant produced relatively higher ratio (5-fold of FMDV-specific IgG2a / IgG1 than those vaccinated in the absence of CpG-ODN. The neutralizing antibody (NA titer induced by FMD vaccine along with CpG-ODN adjuvant was significantly higher (8-fold than NA titer induced by the classical FMD vaccine in Alum adjuvant. The titer of NA and virus clearance from serum was consistently and significantly higher in animals primed with FMD vaccine and boosted by CpG-ODN than the classical FMD vaccine. The results of this study showed the potential of CpG-ODN as a genetic adjuvant to FMD vaccine in the development of Th1 responses.
International Nuclear Information System (INIS)
Kim, Gang-Il; Sung, Yun-Mo; Kim, Kyung-Woo; Oh, Min-Kyu
2009-01-01
High-sensitivity, high-specificity detection of platelet derived growth factor (PDGF)-BB was realized using the change in fluorescence resonance energy transfer (FRET) occurring between quantum dot (QD) donors and black hole quencher (BHQ) acceptors. CdSe/ZnS QD/mercaptoacetic acid (MAA)/PDGF aptamer bioconjugates were successfully synthesized using ligand exchange. Black hole quencher (BHQ)-bearing oligonucleotide molecules showing partial sequence matching to PDGF aptamer were attached to PDGF aptamers and photoluminescence (PL) quenching was obtained through FRET. By adding target PDGF-BB to the bioconjugates containing BHQs, PL recovery was detected due to detachment of BHQ-bearing oligonucleotide from the PDGF aptamer as a result of the difference in affinity to the PDGF aptamer. The detection limit of the sensor was ∼0.4 nM and the linearity was maintained up to 1.6 nM in the PL intensity versus concentration curve. Measurement of PL recovery was suggested as a strong tool for high-sensitivity detection of PDGF-BB. Epidermal growth factor (EGF), the negative control molecule, did not contribute to PL recovery due to lack of binding affinity to the PDGF aptamers, which demonstrates the selectivity of the biosensor.
Directory of Open Access Journals (Sweden)
Karima Relizani
2017-09-01
Full Text Available Antisense oligonucleotides (AONs hold promise for therapeutic splice-switching correction in many genetic diseases. However, despite advances in AON chemistry and design, systemic use of AONs is limited due to poor tissue uptake and sufficient therapeutic efficacy is still difficult to achieve. A novel class of AONs made of tricyclo-DNA (tcDNA is considered very promising for the treatment of Duchenne muscular dystrophy (DMD, a neuromuscular disease typically caused by frameshifting deletions or nonsense mutations in the gene-encoding dystrophin and characterized by progressive muscle weakness, cardiomyopathy, and respiratory failure in addition to cognitive impairment. Herein, we report the efficacy and toxicology profile of a 13-mer tcDNA in mdx mice. We show that systemic delivery of 13-mer tcDNA allows restoration of dystrophin in skeletal muscles and to a lower extent in the brain, leading to muscle function improvement and correction of behavioral features linked to the emotional/cognitive deficiency. More importantly, tcDNA treatment was generally limited to minimal glomerular changes and few cell necroses in proximal tubules, with only slight variation in serum and urinary kidney toxicity biomarker levels. These results demonstrate an encouraging safety profile for tcDNA, albeit typical of phosphorothiate AONs, and confirm its therapeutic potential for the systemic treatment of DMD patients. Keywords: antisense oligonucleotides, Duchenne muscular dystrophy, preclinical, splice switching, tcDNA-AONs
Moreira, Bernardo G; You, Yong; Owczarzy, Richard
2015-03-01
Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.
Wang, Zheng; Vora, Gary J; Stenger, David A
2004-07-01
Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.
Myostatin inhibitory region of fish (Paralichthys olivaceus) myostatin-1 propeptide.
Lee, Sang Beum; Kim, Jeong Hwan; Jin, Deuk-Hee; Jin, Hyung-Joo; Kim, Yong Soo
2016-01-01
Myostatin (MSTN) is a potent negative regulator of skeletal muscle growth, and its activity is suppressed by MSTN propeptide (MSTNpro), the N-terminal part of MSTN precursor cleaved during post-translational MSTN processing. The current study examined which region of flatfish (Paralichthys olivaceus) MSTN-1 propeptide (MSTN1pro) is critical for MSTN inhibition. Six different truncated forms of MSTN1pro containing N-terminal maltose binding protein (MBP) as a fusion partner were expressed in Escherichia coli, and partially purified by an affinity chromatography for MSTN-inhibitory activity examination. Peptides covering different regions of flatfish MSTN1pro were also synthesized for MSTN-inhibitory activity examination. A MBP-fused MSTN1pro region consisting of residues 45-100 had the same MSTN-inhibitory potency as the full sequence flatfish MSTN1pro (residues 23-265), indicating that the region of flatfish MSTN1pro consisting of residues 45-100 is sufficient to maintain the full MSTN-inhibitory capacity. A MBP-fused MSTN1pro region consisting of residues 45-80 (Pro45-80) also showed MSTN-inhibitory activity with a lower potency, and the Pro45-80 demonstrated its MSTN binding capacity in a pull-down assay, indicating that the MSTN-inhibitory capacity of Pro45-80 is due to its binding to MSTN. Flatfish MSTN1pro synthetic peptides covering residues 45-65, 45-70, and 45-80 demonstrated MSTN-inhibitory activities, but not the synthetic peptide covering residues 45-54, indicating that residues 45-65 of flatfish MSTN1pro are essential for MSTN inhibition. In conclusion, current study show that like the mammalian MSTNpro, the MSTN-inhibitory region of flatfish MSTN1pro resides near its N-terminus, and imply that smaller sizes of MSTNpro can be effectively used in various applications designed for MSTN inhibition. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Jensen, Pia Rosgaard; Andersen, Thomas Levin; Pennypacker, Brenda L
2014-01-01
performed a histomorphometric study of trabecular remodeling in vertebrae of estrogen-deficient rabbits treated or not with ODN or ALN, a model where ODN, but not ALN, was previously shown to preserve bone formation. In line with our hypothesis, we found that ODN treatment compared to ALN results...
Directory of Open Access Journals (Sweden)
Barbara M. Misof
2016-12-01
Full Text Available Odanacatib (ODN is a selective and reversible inhibitor of cathepsin K which is an important enzyme for the degradation of collagen I. Aim of the present work was the head-to-head comparison between the effects of ODN and alendronate (ALN on bone mineralization density distribution (BMDD, based on quantitative backscattered electron imaging in relation to changes in histomorphometric mineralizing surface per bone surface (MS/BS in 12–22 years old ovariectomized rhesus monkeys. Trabecular and cortical BMDD derived parameters from vertebrae and proximal tibiae were compared among vehicle (VEH, n = 8, odanacatib low dose (ODN-L, n = 8, odanacatib high dose (ODN-H, n = 8, and alendronate (ALN, n = 6 treated animals. Additionally, data from an intact, non-treated group of animals are shown (INT, n = 8. In trabecular bone from the vertebra and metaphyseal tibia, the BMDD of the ODN and ALN treatment groups was shifted toward higher mineralization densities (p < 0.001 consistent with the significant reduction of MS/BS (p < 0.05 in ODN-H and ALN compared to VEH. Vertebral trabecular CaMean (average degree of mineralization was significantly higher in ODN-L (+6.5%, ODN-H (+6.1%, and ALN (+6.7%, all p < 0.001. Tibial osteonal cortical bone revealed also significantly increased CaMean for ODN-L (+1.4%, p < 0.05, ODN-H (+2.2%, p < 0.05, and ALN (+3.4%, p < 0.001 versus VEH, while primary cortical bone (devoid of secondary osteons did not show any significant differences between the study groups. The percentage of primary bone area in the tibial cross-sections (on average 45 ± 12% was also not significantly different between the study groups (p = 0.232. No significant differences in any BMDD parameters of all studied skeletal sites between ODN and ALN treatment were found. Correlation analysis revealed that MS/BS was highly predictive for trabecular BMDD in vertebral bone. The higher MS/BS, the lower was CaMean. Our findings are
Directory of Open Access Journals (Sweden)
Małgorzata Darewicz
2014-08-01
Full Text Available The objectives of the present study were two-fold: first, to detect whether salmon protein fractions possess angiotensin I-converting enzyme (ACE inhibitory properties and whether salmon proteins can release ACE inhibitory peptides during a sequential in vitro hydrolysis (with commercial porcine enzymes and ex vivo digestion (with human gastrointestinal enzymes. Secondly, to evaluate the ACE inhibitory activity of generated hydrolysates. A two-step ex vivo and in vitro model digestion was performed to simulate the human digestion process. Salmon proteins were degraded more efficiently by porcine enzymes than by human gastrointestinal juices and sarcoplasmic proteins were digested/hydrolyzed more easily than myofibrillar proteins. The ex vivo digested myofibrillar and sarcoplasmic duodenal samples showed IC50 values (concentration required to decrease the ACE activity by 50% of 1.06 and 2.16 mg/mL, respectively. The in vitro hydrolyzed myofibrillar and sarcoplasmic samples showed IC50 values of 0.91 and 1.04 mg/mL, respectively. Based on the results of in silico studies, it was possible to identify 9 peptides of the ex vivo hydrolysates and 7 peptides of the in vitro hydrolysates of salmon proteins of 11 selected peptides. In both types of salmon hydrolysates, ACE-inhibitory peptides IW, IY, TVY and VW were identified. In the in vitro salmon protein hydrolysates an ACE-inhibitory peptides VPW and VY were also detected, while ACE-inhibitory peptides ALPHA, IVY and IWHHT were identified in the hydrolysates generated with ex vivo digestion. In our studies, we documented ACE inhibitory in vitro effects of salmon protein hydrolysates obtained by human and as well as porcine gastrointestinal enzymes.
Nootropic dipeptide noopept enhances inhibitory synaptic transmission in the hippocampus.
Povarov, I S; Kondratenko, R V; Derevyagin, V I; Ostrovskaya, R U; Skrebitskii, V G
2015-01-01
Application of nootropic agent Noopept on hippocampal slices from Wistar rats enhanced the inhibitory component of total current induced by stimulation of Shaffer collaterals in CA1 pyramidal neurons, but did not affect the excitatory component. A direct correlation between the increase in the amplitude of inhibitory current and agent concentration was found. The substance did not affect the release of inhibitory transmitters from terminals in the pyramidal neurons, which indicated changes in GABAergic interneurons.
Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih
2014-01-01
Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.
Directory of Open Access Journals (Sweden)
Omkar Byadgi
2014-01-01
Full Text Available Cytosine-guanine oligodeoxynucleotide (CpG ODN motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9 and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds and B (30 folds isoforms at 10 dpi (CpG ODN 1668 and MyD88 (21 folds at 6 dpv (CpG ODN 2395. Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.
Directory of Open Access Journals (Sweden)
Negin Saffarzadeh
2014-10-01
Full Text Available Objective(s: Although several chemical and physical methods for gene delivery have been introduced, their cytotoxicity, non-specific immune responses and the lack of biodegradability remain the main issues. In this study, hydroxyapatite nanoparticles (NPs and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE-modified hydroxyapatite NPs was coated with antisense oligonucleotide of E6 mRNA, and their uptakes into the cervical cancer cell line were evaluated. Materials and Methods: Calcium nitrate and diammonium phosphate were used for the synthesis of the hydroxyapatite nanoparticle. Thus, they were coated with polyethylene glycol (PEG, DOPE and antisense oligonucleotide of E6 mRNA using a cross-linker. Then, hydroxyapatite NPs and DOPE-modified hydroxyapatite NPs were incubated 48 hours with cervical cancer cells and their uptakes were evaluated by fluorescent microscopy. Results: The hydroxyapatite NPs had different shapes and some agglomeration with average size of 100 nm. The results showed DOPE-modified hydroxyapatite NPs had higher uptake than hydroxyapatite NPs (P
Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution
Kolb, V.; Orgel, L. E.; Miller, S. L. (Principal Investigator)
1994-01-01
We have prepared a [32P]-labled oligonucleotide probe carrying a free primary amine at its 3'-terminus. This probe is used to initiate polymerization of aziridine (ethyleneimine) in aqueous solution. The nature of the oligomeric products and the kinetics of their formation are then monitored by gel electrophoresis. Our results are generally consistent with those obtained using conventional techniques. We have also investigated the effect of polyanionic templates on the rate of oligomerization of aziridine. We find that water-soluble polyanions generally accelerate the polymerization. The sodium salt of polymethacrylic acid is the most effective of the templates that we studied. The methods introduced in this paper should be applicable to a variety of polymerization reactions in aqueous solution. They should greatly simplify the screening of potentially prebiotic polymerization reactions.
Residential Mobility, Inhibitory Control, and Academic Achievement in Preschool
Schmitt, Sara A.; Finders, Jennifer K.; McClelland, Megan M.
2015-01-01
Research Findings: The present study investigated the direct effects of residential mobility on children's inhibitory control and academic achievement during the preschool year. It also explored fall inhibitory control and academic skills as mediators linking residential mobility and spring achievement. Participants included 359 preschool children…
The Spectral Properties and Photostability of DNA, RNA and Oligonucleotides
International Nuclear Information System (INIS)
Kudrya, V.Yu.; Yashchuk, V.M.
2012-01-01
The present work discusses the results of comparative investigations of the optical absorption, luminescence, and photostability of the biomacromolecules (DNA, RNA), as well as synthetic poly- and oligonucleotides. The separate nucleotides in DNA and RNA are examined as almost independent absorbing centers. It is confirmed that the main triplet excitons traps responsible for the DNA phosphorescence emission are AT-complexes in DNA. In contrast to DNA, the main triplet excitons traps in RNA are adenosine bases. These bases are the most photostable against UV-irradiation as compared with all other nucleotides in both DNA and RNA. The fact of the photostability of adenosine bases and the AT-complex provides the existence of the DNA/RNA self-protection mechanisms against a damage caused by UV-irradiation. It is found the deoxyribonucleotides are more photostable than the corresponding ribonucleotides. So, the results presented here show that DNA is more photostable than RNA.
Liu, Peng; Fu, Zhaozong; Jiang, Jianming; Yuan, Liang; Lin, Zhen
2013-09-01
Medications compounded with isoniazid (INH) are usually applied to surgical sites at the completion of surgery to locally kill postoperative residual tubercle bacilli. However, the distribution and elimination of INH in the vertebrae in vivo are not known. In this study, isotope tracing was used in conjunction with high-pressure liquid chromatography (HPLC) to address this. INH and technetium-99 m-labeled INH were applied to the vertebrae of rabbits. After 2 and 6 h, osseous tissues containing INH, as determined by radionuclide imaging, were collected for detection with HPLC. The results showed that INH mainly stayed around the vertebrae 6 h after its application and did not permeate widely into the blood or other organs, except for the kidneys. The standard deviations of INH concentrations in the technetium-99 m-INH group were approximately four-fold smaller than those in the INH group. This method of coupling isotope tracing and HPLC can effectively limit experimental error during sample collection, allowing accurate and reliable identification of the concentration levels of INH in osseous tissues in vivo. Copyright © 2013 John Wiley & Sons, Ltd.
Population activity structure of excitatory and inhibitory neurons.
Bittner, Sean R; Williamson, Ryan C; Snyder, Adam C; Litwin-Kumar, Ashok; Doiron, Brent; Chase, Steven M; Smith, Matthew A; Yu, Byron M
2017-01-01
Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.
Population activity structure of excitatory and inhibitory neurons.
Directory of Open Access Journals (Sweden)
Sean R Bittner
Full Text Available Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.
Population activity structure of excitatory and inhibitory neurons
Doiron, Brent
2017-01-01
Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure. PMID:28817581
Wei, X X; Chu, J P; Zou, Y Z; Ru, N; Cui, S X; Bai, Y X
2015-12-22
The aim of this study was to investigate the effect of local administration of odanacatib (ODN) on orthodontic root resorption and the status of alveolar bone metabolism in rat molars. All specimens were scanned using microcomputed tomography and then the raw images were reconstructed. The total volume of the root resorption craters of the 60 g-NS (normal saline) group was higher than in the 60 g-ODN group and the control group. In the 60 g-NS group, the bone volume fraction values of alveolar bone were significantly decreased compared with the other 2 groups. There were no significant differences in the bone volume fraction values of the tibiae among the 3 groups. The results of tartrate-resistant acid phosphatase-positive (TRAP+) numbers showed that there was no difference between the 60 g-NS group and the 60 g-ODN group. The expression of cathepsin K was decreased significantly in the 60 g-ODN group. These results indicate that ODN reduces orthodontics-induced external root resorption and increases alveolar bone metabolism. This may be because ODN inhibits the activity of odontoclasts, but maintains the quantity of odontoclasts and enhances bone formation. ODN promotes local alveolar bone metabolism, but does not affect systemic bone metabolism.
Intrinsically-generated fluctuating activity in excitatory-inhibitory networks
Mastrogiuseppe, Francesca; Ostojic, Srdjan
2017-01-01
Recurrent networks of non-linear units display a variety of dynamical regimes depending on the structure of their synaptic connectivity. A particularly remarkable phenomenon is the appearance of strongly fluctuating, chaotic activity in networks of deterministic, but randomly connected rate units. How this type of intrinsically generated fluctuations appears in more realistic networks of spiking neurons has been a long standing question. To ease the comparison between rate and spiking networks, recent works investigated the dynamical regimes of randomly-connected rate networks with segregated excitatory and inhibitory populations, and firing rates constrained to be positive. These works derived general dynamical mean field (DMF) equations describing the fluctuating dynamics, but solved these equations only in the case of purely inhibitory networks. Using a simplified excitatory-inhibitory architecture in which DMF equations are more easily tractable, here we show that the presence of excitation qualitatively modifies the fluctuating activity compared to purely inhibitory networks. In presence of excitation, intrinsically generated fluctuations induce a strong increase in mean firing rates, a phenomenon that is much weaker in purely inhibitory networks. Excitation moreover induces two different fluctuating regimes: for moderate overall coupling, recurrent inhibition is sufficient to stabilize fluctuations; for strong coupling, firing rates are stabilized solely by the upper bound imposed on activity, even if inhibition is stronger than excitation. These results extend to more general network architectures, and to rate networks receiving noisy inputs mimicking spiking activity. Finally, we show that signatures of the second dynamical regime appear in networks of integrate-and-fire neurons. PMID:28437436
Kaura, Mamta; Kumar, Pawan; Hrdlicka, Patrick J
2014-07-03
Conformationally restricted nucleotides such as locked nucleic acid (LNA) are very popular as affinity-, specificity-, and stability-enhancing modifications in oligonucleotide chemistry to produce probes for nucleic acid targeting applications in molecular biology, biotechnology, and medicinal chemistry. Considerable efforts have been devoted in recent years to optimize the biophysical properties of LNA through additional modification of the sugar skeleton. We recently introduced C5-functionalization of LNA uridines as an alternative and synthetically more straightforward approach to improve the biophysical properties of LNA. In the present work, we set out to test the generality of this concept by studying the characteristics of oligonucleotides modified with four different C5-functionalized LNA cytidine and C8-functionalized LNA adenosine monomers. The results strongly suggest that C5-functionalization of LNA pyrimidines is indeed a viable approach for improving the binding affinity, target specificity, and/or enzymatic stability of LNA-modified ONs, whereas C8-functionalization of LNA adenosines is detrimental to binding affinity and specificity. These insights will impact the future design of conformationally restricted nucleotides for nucleic acid targeting applications.
DEFF Research Database (Denmark)
Lund, O S; Hansen, J E
1998-01-01
Oligodeoxynucleotides (ODNs) containing a variable number of 3' and 5' terminal phosphorothioate linkages were applied in free solution to cells infected by HIV-1. ODNs of 28 nt length were applied at up to 5 microM concentration. The ODNs were found to inhibit HIV-1 infection in a dose dependent...... by these modified chimers....
Enzyme inhibitory activity of selected Philippine plants
International Nuclear Information System (INIS)
Sasotona, Joseph S.; Hernandez, Christine C.
2015-01-01
In the Philippines, the number one cause of death are cardiovascular diseases. Diseases linked with inflammation are proliferating. This research aims to identify plant extracts that have potential activity of cholesterol-lowering, anti-hypertension, anti-gout, anti-inflammatory and fat blocker agents. Although there are commercially available drugs to treat the aforementioned illnesses, these medicine have adverse side-effects, aside from the fact that they are expensive. The results of this study will serve as added knowledge to contribute to the development of cheaper, more readily available, and effective alternative medicine. 100 plant extracts from different areas in the Philippines have been tested for potential inhibitory activity against Hydroxymethylglutaryl-coenzyme A (HMG-CoA), Lipoxygenase, and Xanthine Oxidase. The plant samples were labeled with codes and distributed to laboratories for blind testing. The effective concentration of the samples tested for Xanthine oxidase is 100 ppm. Samples number 9, 11, 14, 29, 43, 46, and 50 have shown significant inhibitory activity at 78.7%, 78.4%, 70%, 89.2%, 79%, 67.4%, and 67.5% respectively. Samples tested for Lipoxygenase inhibition were set at 33ppm. Samples number 2, 37, 901, 1202, and 1204 have shown significant inhibitory activity at 66, 84.9%, 88.55%, 93.3%, and 84.7% respectively. For HMG-CoA inhibition, the effective concentration of the samples used was 100 ppm. Samples number 1 and 10 showed significant inhibitory activity at 90.1% and 81.8% respectively. (author)
Time Course of Brain Network Reconfiguration Supporting Inhibitory Control.
Popov, Tzvetan; Westner, Britta U; Silton, Rebecca L; Sass, Sarah M; Spielberg, Jeffrey M; Rockstroh, Brigitte; Heller, Wendy; Miller, Gregory A
2018-05-02
Hemodynamic research has recently clarified key nodes and links in brain networks implementing inhibitory control. Although fMRI methods are optimized for identifying the structure of brain networks, the relatively slow temporal course of fMRI limits the ability to characterize network operation. The latter is crucial for developing a mechanistic understanding of how brain networks shift dynamically to support inhibitory control. To address this critical gap, we applied spectrally resolved Granger causality (GC) and random forest machine learning tools to human EEG data in two large samples of adults (test sample n = 96, replication sample n = 237, total N = 333, both sexes) who performed a color-word Stroop task. Time-frequency analysis confirmed that recruitment of inhibitory control accompanied by slower behavioral responses was related to changes in theta and alpha/beta power. GC analyses revealed directionally asymmetric exchanges within frontal and between frontal and parietal brain areas: top-down influence of superior frontal gyrus (SFG) over both dorsal ACC (dACC) and inferior frontal gyrus (IFG), dACC control over middle frontal gyrus (MFG), and frontal-parietal exchanges (IFG, precuneus, MFG). Predictive analytics confirmed a combination of behavioral and brain-derived variables as the best set of predictors of inhibitory control demands, with SFG theta bearing higher classification importance than dACC theta and posterior beta tracking the onset of behavioral response. The present results provide mechanistic insight into the biological implementation of a psychological phenomenon: inhibitory control is implemented by dynamic routing processes during which the target response is upregulated via theta-mediated effective connectivity within key PFC nodes and via beta-mediated motor preparation. SIGNIFICANCE STATEMENT Hemodynamic neuroimaging research has recently clarified regional structures in brain networks supporting inhibitory control. However, due to
Macfarlane, D E; Manzel, L
1998-02-01
Phosphorothioate oligodeoxynucleotides containing CpG (CpG-ODN) activate immune responses. We report that quinacrine, chloroquine, and structurally related compounds completely inhibit the antiapoptotic effect of CpG-ODN on WEHI 231 murine B lymphoma cells and inhibit CpG-ODN-induced secretion of IL-6 by WEHI 231. They also inhibit IL-6 synthesis and thymidine uptake by human unfractionated PBMC induced by CpG-ODN. The compounds did not inhibit LPS-induced responses. Half-maximal inhibition required 10 nM quinacrine or 100 nM chloroquine. Inhibition was noncompetitive with respect to CpG-ODN. Quinine, quinidine, and primaquine were much less powerful. Quinacrine was effective even when added after the CpG-ODN. Near-toxic concentrations of ammonia plus bafilomycin A1 (used to inhibit vesicular acidification) did not reduce the efficacy of the quinacrine, but the effects of both quinacrine and chloroquine were enhanced by inhibition of the multidrug resistance efflux pump by verapamil. Agents that bind to DNA, including propidium iodide, Hoechst dye 33258, and coralyne chloride did not inhibit CpG-ODN effect, nor did 4-bromophenacyl bromide, an inhibitor of phospholipase A2. Examination of the structure-activity relationship of seventy 4-aminoquinoline and 9-aminoacridine analogues reveals that increased activity was conferred by bulky hydrophobic substituents on positions 2 and 6 of the quinoline nucleus. No correlation was found between published antimalarial activity and ability to block CpG-ODN-induced effects. These results are discussed in the light of the ability of quinacrine and chloroquine to induce remission of rheumatoid arthritis and lupus erythematosus.
Longhurst, H J; Zanichelli, A; Caballero, T; Bouillet, L; Aberer, W; Maurer, M; Fain, O; Fabien, V; Andresen, I
2017-04-01
Icatibant is used to treat acute hereditary angioedema with C1 inhibitor deficiency types I/II (C1-INH-HAE types I/II) and has shown promise in angioedema due to acquired C1 inhibitor deficiency (C1-INH-AAE). Data from the Icatibant Outcome Survey (IOS) were analysed to evaluate the effectiveness of icatibant in the treatment of patients with C1-INH-AAE and compare disease characteristics with those with C1-INH-HAE types I/II. Key medical history (including prior occurrence of attacks) was recorded upon IOS enrolment. Thereafter, data were recorded retrospectively at approximately 6-month intervals during patient follow-up visits. In the icatibant-treated population, 16 patients with C1-INH-AAE had 287 attacks and 415 patients with C1-INH-HAE types I/II had 2245 attacks. Patients with C1-INH-AAE versus C1-INH-HAE types I/II were more often male (69 versus 42%; P = 0·035) and had a significantly later mean (95% confidence interval) age of symptom onset [57·9 (51·33-64·53) versus 14·0 (12·70-15·26) years]. Time from symptom onset to diagnosis was significantly shorter in patients with C1-INH-AAE versus C1-INH-HAE types I/II (mean 12·3 months versus 118·1 months; P = 0·006). Patients with C1-INH-AAE showed a trend for higher occurrence of attacks involving the face (35 versus 21% of attacks; P = 0·064). Overall, angioedema attacks were more severe in patients with C1-INH-HAE types I/II versus C1-INH-AAE (61 versus 40% of attacks were classified as severe to very severe; P types I/II, respectively. © 2016 British Society for Immunology.
Whole-cell hybridization of Methanosarcina cells with two new oligonucleotide probes
DEFF Research Database (Denmark)
Sørensen, A.H.; Torsvik, V.L.; Torsvik, T.
1997-01-01
Two new oligonucleotide probes targeting the 16S rRNA of the methanogenic genus Methanosarcina were developed. The probes have the following sequences (Escherichia coli numbering): probe SARCI551, 5'-GAC CCAATAATCACGATCAC-3', and probe SARCI645, 5'-TCCCGGTTCCAAGTCTGGC-3'. In situ hybridization...... with the fluorescently labelled probes required several modifications of standard procedures. Cells of Methanosarcina mazeii S-6 were found to lyse during the hybridization step if fixed in 3% formaldehyde and stored in 50% ethanol. Lysis was, however, not observed with cells fixed and stored in 1.6% formaldehyde-0.......85% NaCl. Extensive autofluorescence of the cells was found upon hybridization in the presence of 5 mM EDTA, but successful hybridization could be obtained without addition of this compound. The mounting agent Citifluor AF1, often used in conjugation with the fluorochrome fluorescein, was found to wash...
Staphylococcus aureus detection in blood samples by silica nanoparticle-oligonucleotides conjugates.
Borsa, Baris A; Tuna, Bilge G; Hernandez, Frank J; Hernandez, Luiza I; Bayramoglu, Gulay; Arica, M Yakup; Ozalp, V Cengiz
2016-12-15
A fast, specific and sensitive homogeneous assay for Staphylococcus aureus detection was developed by measuring the activity of secreted nuclease from the bacteria via a modified DNA oligonucleotide. As biosensor format, an effective system, Nanokeepers as previously reported, were used for triggered release of confined fluorophores, and hence specific detection of S. aureus on nuclease activity was obtained. The interference from blood components for fluorescent quantification was eliminated by a pre-purification by aptamer-functionalized silica magnetic nanoparticles. The reported assay system was exclusively formed by nucleic acid oligos and magnetic or mesoporous silica nanoparticles, that can be used on blood samples in a stepwise manner. The assay was successfully used as a sensing platform for the specific detection of S. aureus cells as low as 682 CFU in whole blood. Copyright © 2016 Elsevier B.V. All rights reserved.
Turner, D P; Connolly, B A
2000-12-15
The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.
A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.
Directory of Open Access Journals (Sweden)
Boyang Cao
Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.
A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.
Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei
2014-01-01
Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776
Comparative phytochemical and growth inhibitory studies on the leaf ...
African Journals Online (AJOL)
Comparative phytochemical and growth inhibitory studies on the leaf and root bark extracts of securinega Virosa (roxb ex. Willd) baill ... The growth inhibitory tests were carried out between 1-30 mg/ in a period of 24-96 h while the phytochemical screening was carried out on the plant parts using standard methods. At 24 h ...
Inhibitory control in childhood stuttering
Eggers, K.; de Nil, L.; Van den Bergh, B.R.H.
2013-01-01
Purpose The purpose of this study was to investigate whether previously reported parental questionnaire-based differences in inhibitory control (IC; Eggers, De Nil, & Van den Bergh, 2010) would be supported by direct measurement of IC using a computer task. Method Participants were 30 children who
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B
Optimization of inhibitory decision rules relative to length and coverage
Alsolami, Fawaz; Chikalov, Igor; Moshkov, Mikhail; Zielosko, Beata
2012-01-01
The paper is devoted to the study of algorithms for optimization of inhibitory rules relative to the length and coverage. In contrast with usual rules that have on the right-hand side a relation "attribute ≠ value", inhibitory rules have a relation
Correction of Spatial Bias in Oligonucleotide Array Data
Directory of Open Access Journals (Sweden)
Philippe Serhal
2013-01-01
Full Text Available Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs for each intended target, on average, correlate with their target’s true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users’ current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays. A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias.
Correction of Spatial Bias in Oligonucleotide Array Data
Lemieux, Sébastien
2013-01-01
Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs) for each intended target, on average, correlate with their target's true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users' current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays). A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias. PMID:23573083
Characterization of adjacent breast tumors using oligonucleotide microarrays
International Nuclear Information System (INIS)
Unger, Meredith A; Rishi, Mazhar; Clemmer, Virginia B; Hartman, Jennifer L; Keiper, Elizabeth A; Greshock, Joel D; Chodosh, Lewis A; Liebman, Michael N; Weber, Barbara L
2001-01-01
Current methodology often cannot distinguish second primary breast cancers from multifocal disease, a potentially important distinction for clinical management. In the present study we evaluated the use of oligonucleotide-based microarray analysis in determining the clonality of tumors by comparing gene expression profiles. Total RNA was extracted from two tumors with no apparent physical connection that were located in the right breast of an 87-year-old woman diagnosed with invasive ductal carcinoma (IDC). The RNA was hybridized to the Affymetrix Human Genome U95A Gene Chip ® (12,500 known human genes) and analyzed using the Gene Chip Analysis Suite ® 3.3 (Affymetrix, Inc, Santa Clara, CA, USA) and JMPIN ® 3.2.6 (SAS Institute, Inc, Cary, NC, USA). Gene expression profiles of tumors from five additional patients were compared in order to evaluate the heterogeneity in gene expression between tumors with similar clinical characteristics. The adjacent breast tumors had a pairwise correlation coefficient of 0.987, and were essentially indistinguishable by microarray analysis. Analysis of gene expression profiles from different individuals, however, generated a pairwise correlation coefficient of 0.710. Transcriptional profiling may be a useful diagnostic tool for determining tumor clonality and heterogeneity, and may ultimately impact on therapeutic decision making
Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro
2008-11-01
Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.
Zinker, Bradley A.; Rondinone, Cristina M.; Trevillyan, James M.; Gum, Rebecca J.; Clampit, Jill E.; Waring, Jeffrey F.; Xie, Nancy; Wilcox, Denise; Jacobson, Peer; Frost, Leigh; Kroeger, Paul E.; Reilly, Regina M.; Koterski, Sandra; Opgenorth, Terry J.; Ulrich, Roger G.; Crosby, Seth; Butler, Madeline; Murray, Susan F.; McKay, Robert A.; Bhanot, Sanjay; Monia, Brett P.; Jirousek, Michael R.
2002-01-01
The role of protein-tyrosine phosphatase 1B (PTP1B) in diabetes was investigated using an antisense oligonucleotide in ob/ob and db/db mice. PTP1B antisense oligonucleotide treatment normalized plasma glucose levels, postprandial glucose excursion, and HbA1C. Hyperinsulinemia was also reduced with improved insulin sensitivity. PTP1B protein and mRNA were reduced in liver and fat with no effect in skeletal muscle. Insulin signaling proteins, insulin receptor substrate 2 and phosphatidylinositol 3 (PI3)-kinase regulatory subunit p50α, were increased and PI3-kinase p85α expression was decreased in liver and fat. These changes in protein expression correlated with increased insulin-stimulated protein kinase B phosphorylation. The expression of liver gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and fructose-1,6-bisphosphatase was also down-regulated. These findings suggest that PTP1B modulates insulin signaling in liver and fat, and that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes. PMID:12169659
Whole genome DNA copy number changes identified by high density oligonucleotide arrays
Directory of Open Access Journals (Sweden)
Huang Jing
2004-05-01
Full Text Available Abstract Changes in DNA copy number are one of the hallmarks of the genetic instability common to most human cancers. Previous micro-array-based methods have been used to identify chromosomal gains and losses; however, they are unable to genotype alleles at the level of single nucleotide polymorphisms (SNPs. Here we describe a novel algorithm that uses a recently developed high-density oligonucleotide array-based SNP genotyping method, whole genome sampling analysis (WGSA, to identify genome-wide chromosomal gains and losses at high resolution. WGSA simultaneously genotypes over 10,000 SNPs by allele-specific hybridisation to perfect match (PM and mismatch (MM probes synthesised on a single array. The copy number algorithm jointly uses PM intensity and discrimination ratios between paired PM and MM intensity values to identify and estimate genetic copy number changes. Values from an experimental sample are compared with SNP-specific distributions derived from a reference set containing over 100 normal individuals to gain statistical power. Genomic regions with statistically significant copy number changes can be identified using both single point analysis and contiguous point analysis of SNP intensities. We identified multiple regions of amplification and deletion using a panel of human breast cancer cell lines. We verified these results using an independent method based on quantitative polymerase chain reaction and found that our approach is both sensitive and specific and can tolerate samples which contain a mixture of both tumour and normal DNA. In addition, by using known allele frequencies from the reference set, statistically significant genomic intervals can be identified containing contiguous stretches of homozygous markers, potentially allowing the detection of regions undergoing loss of heterozygosity (LOH without the need for a matched normal control sample. The coupling of LOH analysis, via SNP genotyping, with copy number
INHIBITORY EFFECT OF SALVIA SCLAREA
African Journals Online (AJOL)
rakoe
2011-11-02
Nov 2, 2011 ... This study demonstrated anti-herpes simplex virus (HSV) activity of lavender, sage and ... Green monkey kidney cells were protected from HSV-2 infection by ... The highest inhibitory effect against HSV-2 was observed after treatment ..... some nuclear-replicating eukaryotic DNA viruses with large genomes.
Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.
Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku
2012-11-01
Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.
DNA radio-induced tandem lesions: formation, introduction in oligonucleotides and repair
International Nuclear Information System (INIS)
Bourdat, Anne-Gaelle
2000-01-01
Cell killing induced by excited photosensitizers, ionizing radiation or radiomimetic drugs can not be only explained by the formation of single DNA lesions. Thus, multiply damaged sites, are likely to have harmful biological consequences. One example of tandem base damage induced by ".OH radical in X-irradiated aqueous solution of DNA oligomers is N-(2-deoxy-β-D-erythro-pentofuranosyl)-formyl-amine (dβF)/8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo). In order to investigate the biological significance of such a tandem lesion, both 8-oxodGuo and dβF were introduced in synthetic oligonucleotides at vicinal positions using the solid phase phosphoramidite method with the 'Pac phosphoramidite' chemistry. The purity of the synthetic DNA fragments and the integrity of modified nucleosides was confirmed using different complementary techniques: HPLC, PAGE, ESI MS, MALDI-TOF MS and capillary electrophoresis. Using the above synthetic substrates, investigations were carried out in order to determine the substrate specificity and the excision mechanism of three glycosylases involved in the base excision repair pathway: endonuclease III, Fpg and yOggl. Both tandem lesions were substrates for the BER enzymes. However, the tandem lesion are not completely excised by the repair enzymes. The rates of excision as inferred from the determination of the ratios of Vm/Km Michaelis kinetics constants were not found to be significantly affected by the presence of the tandem lesions. MALDI-TOF mass spectrometry was used in order to gain insights into mechanistic aspects of oligonucleotide cleavage by the BER enzymes. During in vitro DNA synthesis by Taq DNA polymerase, Klenow fragment exo- and DNA polymerase β, tandem base damage were found to block the progression of the enzymes. Finally, the level of tandem base damage in the DNA exposed to γ-ray using the liquid chromatography coupled to electro-spray ionization tandem mass spectrometry was determined. Both dβF-8-oxodGuo and 8
An evaluation of oligonucleotide-based therapeutic strategies for polyQ diseases
Directory of Open Access Journals (Sweden)
Fiszer Agnieszka
2012-03-01
Full Text Available Abstract Background RNA interference (RNAi and antisense strategies provide experimental therapeutic agents for numerous diseases, including polyglutamine (polyQ disorders caused by CAG repeat expansion. We compared the potential of different oligonucleotide-based strategies for silencing the genes responsible for several polyQ diseases, including Huntington's disease and two spinocerebellar ataxias, type 1 and type 3. The strategies included nonallele-selective gene silencing, gene replacement, allele-selective SNP targeting and CAG repeat targeting. Results Using the patient-derived cell culture models of polyQ diseases, we tested various siRNAs, and antisense reagents and assessed their silencing efficiency and allele selectivity. We showed considerable allele discrimination by several SNP targeting siRNAs based on a weak G-G or G-U pairing with normal allele and strong G-C pairing with mutant allele at the site of RISC-induced cleavage. Among the CAG repeat targeting reagents the strongest allele discrimination is achieved by miRNA-like functioning reagents that bind to their targets and inhibit their translation without substantial target cleavage. Also, morpholino analog performs well in mutant and normal allele discrimination but its efficient delivery to cells at low effective concentration still remains a challenge. Conclusions Using three cellular models of polyQ diseases and the same experimental setup we directly compared the performance of different oligonucleotide-based treatment strategies that are currently under development. Based on the results obtained by us and others we discussed the advantages and drawbacks of these strategies considering them from several different perspectives. The strategy aimed at nonallele-selective inhibiting of causative gene expression by targeting specific sequence of the implicated gene is the easiest to implement but relevant benefits are still uncertain. The gene replacement strategy that
DEFF Research Database (Denmark)
Koch, T.; Jacobsen, N.; Fensholdt, J.
2000-01-01
Ligand immobilization on solid surfaces is an essential step in fields such as diagnostics, bio sensor manufacturing, and new material sciences in general. In this paper a photochemical approach based on anthraquinone as the chromophore is presented. Photochemical procedures offer special...... advantages as they are able to generate highly reactive species in an orientation specific manner. As presented here, anthraquinone (AQ) mediated covalent DNA immobilization appears to be superior to currently known procedures. A synthetic procedure providing AQ-phosphoramidites is presented. These reagents...... facilitate AQ conjugation during routine DNA synthesis, thus enabling the AQ-oligonucleotides to be immobilized in a very convenient and efficient manner. AQ-conjugated PCR primers can be used directly in PCR. When the PCR is performed in solution, the amplicons can be immobilized after the PCR. Moreover...
International Nuclear Information System (INIS)
Klein, Dionne C.G.; Latz, Eicke; Espevik, Terje; Stokke, Bjorn T.
2010-01-01
Immunostimulatory CpG-DNA activates the innate immune system by binding to Toll-like receptor 9. Structurally different CpG-containing oligonucleotides trigger a different type of immune response while activating the same receptor. We therefore investigated the higher order structure of two different classes of immunostimulatory CpG-DNA. Class A, which contains a partly self-complementary sequence and poly-G ends, forms duplexes and nanoparticles in salt solution, while class B, which does not contain these features and is purely linear, does not form a duplex or nanoparticles. Results obtained here by high-resolution atomic force microscopy of classes A and B CpG-DNA, reflect these differences in secondary structure. Detailed structural analysis of the atomic force microscopy topographs is presented for two different sample preparation methods.
Energy Technology Data Exchange (ETDEWEB)
Klein, Dionne C.G., E-mail: dionne.c.g.klein@ntnu.no [Department of Physics, Norwegian University of Science and Technology, N-7491, Trondheim (Norway); Department of Cancer Research and Molecular Medicine, Norwegian University of Science and Technology, N-7489, Trondheim (Norway); Latz, Eicke [Department of Cancer Research and Molecular Medicine, Norwegian University of Science and Technology, N-7489, Trondheim (Norway); Division of Infectious Diseases and Immunology, University of Massachusetts Medical School, 364 Plantation Street, Worcester, MA 01605 (United States); Institute of Innate Immunity, University Hospitals, University of Bonn, Sigmund-Freud-Str. 25, 53127 Bonn (Germany); Espevik, Terje [Department of Cancer Research and Molecular Medicine, Norwegian University of Science and Technology, N-7489, Trondheim (Norway); Stokke, Bjorn T. [Department of Physics, Norwegian University of Science and Technology, N-7491, Trondheim (Norway)
2010-05-15
Immunostimulatory CpG-DNA activates the innate immune system by binding to Toll-like receptor 9. Structurally different CpG-containing oligonucleotides trigger a different type of immune response while activating the same receptor. We therefore investigated the higher order structure of two different classes of immunostimulatory CpG-DNA. Class A, which contains a partly self-complementary sequence and poly-G ends, forms duplexes and nanoparticles in salt solution, while class B, which does not contain these features and is purely linear, does not form a duplex or nanoparticles. Results obtained here by high-resolution atomic force microscopy of classes A and B CpG-DNA, reflect these differences in secondary structure. Detailed structural analysis of the atomic force microscopy topographs is presented for two different sample preparation methods.
COMPARATIVE EVALUATION OF INHIBITORY ACTIVITY OF ...
African Journals Online (AJOL)
Osondu
2013-02-26
Feb 26, 2013 ... especially the four bacteria isolates used in this study are present in the epiphgram of both normal and ... Keyword: Albino snail, Archachatina marginata, Inhibitory activity, Epiphgram, Bacteria isolate. Introduction .... evolution.
Inhibitory Effect of Gamma-Irradiated Chitosan on the Growth of Denitrifiers
Directory of Open Access Journals (Sweden)
Javier Vilcáez
2009-01-01
Full Text Available In order to find an environmentally benign substitute to hazardous inhibitory agents, the inhibitory effect of -irradiated chitosans against a mixed culture of denitrifying bacteria was experimentally evaluated. Unlike other studies using pure aerobic cultures, the observed effect was not a complete inhibition but a transient inhibition reflected by prolonged lag phases and reduced growth rates. Raw chitosan under acid conditions (pH 6.3 exerted the strongest inhibition followed by the 100 kGy and 500 kGy irradiated chitosans, respectively. Therefore, because the molecular weight of chitosan decreases with the degree of -irradiation, the inhibitory properties of chitosan due to its high molecular weight were more relevant than the inhibitory properties gained due to the modification of the surface charge and/or chemical structure by -irradiation. High dosage of -irradiated appeared to increase the growth of mixed denitrifying bacteria in acid pH media. However, in neutral pH media, high dosage of -irradiation appeared to enhance the inhibitory effect of chitosan.
Inhibitory Effect of Corn Silk on Skin Pigmentation
Sang Yoon Choi; Yeonmi Lee; Sung Soo Kim; Hyun Min Ju; Ji Hwoon Baek; Chul-Soo Park; Dong-Hyuk Lee
2014-01-01
In this study, the inhibitory effect of corn silk on melanin production was evaluated. This study was performed to investigate the inhibitory effect of corn silk on melanin production in Melan-A cells by measuring melanin production and protein expression. The corn silk extract applied on Melan-A cells at a concentration of 100 ppm decreased melanin production by 37.2% without cytotoxicity. This was a better result than arbutin, a positive whitening agent, which exhibited a 26.8% melanin prod...
Inhibitory Control Mediates the Association between Perceived Stress and Secure Relationship Quality
Directory of Open Access Journals (Sweden)
Toria Herd
2018-02-01
Full Text Available Past research has demonstrated negative associations between exposure to stressors and quality of interpersonal relationships among children and adolescents. Nevertheless, underlying mechanisms of this association remain unclear. Chronic stress has been shown to disrupt prefrontal functioning in the brain, including inhibitory control abilities, and evidence is accumulating that inhibitory control may play an important role in secure interpersonal relationship quality, including peer problems and social competence. In this prospective longitudinal study, we examine whether changes in inhibitory control, measured at both behavioral and neural levels, mediate the association between stress and changes in secure relationship quality with parents and peers. The sample included 167 adolescents (53% males who were first recruited at age 13 or 14 years and assessed annually three times. Adolescents’ inhibitory control was measured by their behavioral performance and brain activities, and adolescents self-reported perceived stress levels and relationship quality with mothers, fathers, and peers. Results suggest that behavioral inhibitory control mediates the association between perceived stress and adolescent’s secure relationship quality with their mothers and fathers, but not their peers. In contrast, given that stress was not significantly correlated with neural inhibitory control, we did not further test the mediation path. Our results highlight the role of inhibitory control as a process through which stressful life experiences are related to impaired secure relationship quality between adolescents and their mothers and fathers.
Herd, Toria; Li, Mengjiao; Maciejewski, Dominique; Lee, Jacob; Deater-Deckard, Kirby; King-Casas, Brooks; Kim-Spoon, Jungmeen
2018-01-01
Past research has demonstrated negative associations between exposure to stressors and quality of interpersonal relationships among children and adolescents. Nevertheless, underlying mechanisms of this association remain unclear. Chronic stress has been shown to disrupt prefrontal functioning in the brain, including inhibitory control abilities, and evidence is accumulating that inhibitory control may play an important role in secure interpersonal relationship quality, including peer problems and social competence. In this prospective longitudinal study, we examine whether changes in inhibitory control, measured at both behavioral and neural levels, mediate the association between stress and changes in secure relationship quality with parents and peers. The sample included 167 adolescents (53% males) who were first recruited at age 13 or 14 years and assessed annually three times. Adolescents' inhibitory control was measured by their behavioral performance and brain activities, and adolescents self-reported perceived stress levels and relationship quality with mothers, fathers, and peers. Results suggest that behavioral inhibitory control mediates the association between perceived stress and adolescent's secure relationship quality with their mothers and fathers, but not their peers. In contrast, given that stress was not significantly correlated with neural inhibitory control, we did not further test the mediation path. Our results highlight the role of inhibitory control as a process through which stressful life experiences are related to impaired secure relationship quality between adolescents and their mothers and fathers.
Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.
Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y
2017-09-01
Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Histamine release inhibitory activity of Piper nigrum leaf.
Hirata, Noriko; Naruto, Shunsuke; Inaba, Kazunori; Itoh, Kimihisa; Tokunaga, Masashi; Iinuma, Munekazu; Matsuda, Hideaki
2008-10-01
Oral administration of a methanolic extract of Piper nigrum leaf (PN-ext, 50, 200 and 500 mg/kg) showed a potent dose-dependent inhibition of dinitrofluorobenzene (DNFB)-induced cutaneous reaction at 1 h [immediate phase response (IPR)] after and 24 h [late phase response (LPR)] after DNFB challenge in mice which were passively sensitized with anti-dinitrophenyl (DNP) IgE antibody. Ear swelling inhibitory effect of PN-ext (50, 200 and 500 mg/kg, per os (p.o.)) on very late phase response (vLPR) in the model mice was significant but weaker than that on IPR. Oral administration of PN-ext (50, 200 and 500 mg/kg for 7 d) inhibited picryl chloride (PC)-induced ear swelling in PC sensitized mice. PN-ext exhibited in vitro inhibitory effect on compound 48/80-induced histamine release from rat peritoneal mast cells. Two lignans of PN-ext, (-)-cubebin (1) and (-)-3,4-dimethoxy-3,4-desmethylenedioxycubebin (2), were identified as major active principles having histamine release inhibitory activity.
2017-10-01
antibodies to 5 specifically blot wild-type C1INH in the pathologic polymers.. A FLAG tag was placed into the wild-type C1INH cDNA located immediately...resulted in decreased secretion of the 3x-FLAG-WT-C1INH when cotransfected with the mutant cDNA . This was an important confirmation of our...C1INH plus mutant C1INH cDNA in the presence or absence of a lactacystin, a proteasome inhibitor. As shown in figure 2, blocking degradation of
Czech Academy of Sciences Publication Activity Database
Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk
2015-01-01
Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015
Energy Technology Data Exchange (ETDEWEB)
Vries, E.F.J. de E-mail: e.f.j.de.vries@pet.azg.nl; Vroegh, Joke; Elsinga, P.H.; Vaalburg, Willem
2003-04-01
Six fluorine-18-labeled alkylating agents were selected as potentially suitable synthons for the labeling of antisense oligonucleotides. The selected synthons were evaluated in a model reaction with the monomer adenosine 5'-O-thiomonophosphate. Of these synthons, {alpha}-bromo-{alpha}'-[{sup 18}F]fluoro-m-xylene and N-(4-[{sup 18}F]fluorobenzyl)-2-bromoacetamide were found to be the most promising. Labeling with the former synthon was less complicated and time consuming and gave higher uncorrected overall yields. The latter synthon required smaller amounts of the costly precursor to achieve acceptable labeling yields.
Selective Covalent Conjugation of Phosphorothioate DNA Oligonucleotides with Streptavidin
Directory of Open Access Journals (Sweden)
Christof M. Niemeyer
2011-08-01
Full Text Available Protein-DNA conjugates have found numerous applications in the field of diagnostics and nanobiotechnology, however, their intrinsic susceptibility to DNA degradation by nucleases represents a major obstacle for many applications. We here report the selective covalent conjugation of the protein streptavidin (STV with phosphorothioate oligonucleotides (psDNA containing a terminal alkylthiolgroup as the chemically addressable linking unit, using a heterobifunctional NHS-/maleimide crosslinker. The psDNA-STV conjugates were synthesized in about 10% isolated yields. We demonstrate that the terminal alkylthiol group selectively reacts with the maleimide while the backbone sulfur atoms are not engaged in chemical conjugation. The novel psDNA-STV conjugates retain their binding capabilities for both biotinylated macromolecules and the complementary nucleic acid. Moreover, the psDNA-STV conjugate retained its binding capacity for complementary oligomers even after a nuclease digestion step, which effectively degrades deoxyribonucleotide oligomers and thus the binding capability of regular DNA-STV conjugates. The psDNA-STV therefore hold particular promise for applications e.g. in proteome research and novel biosensing devices, where interfering endogenous nucleic acids need to be removed from analytes by nuclease digestion.
Performa Inhibitory Control dengan Induksi Sing-a-Song Stress Test pada Dewasa Awal
Directory of Open Access Journals (Sweden)
Akhmad Kurniawan
2018-04-01
Full Text Available Inhibitory control is able to control attention by inhibiting internal tendencies and external influences. Inhibitory control is controlled by dorsolateral prefrontal cortex and anterior cingulate cortex, that can be affected by stress variable. Sing-a-Song Stress Test (SSST is a current method to induce stress that has never been practiced in study of inhibitory control. This study aimed to determine the effect of SSST against inhibitory control in early adult. Between subjects design was applied in this study. A number of 35 participants with age range from 17 to 21 years old were randomly assigned into experimental group (n = 17 and control group (n = 18. Inhibitory control was measured using Computerized Stroop Color-Word Test (CSCWT. Positive Affect and Negative Affect Schedule (PANAS was used to conduct a manipulation check. Independent-Samples T Test explained no significant effect of stress on inhibitory control (t = -0,117; p > 0,05.
On minimal inhibitory rules for almost all k-valued information systems
Moshkov, Mikhail; Skowron, Andrzej; Suraj, Zbigniew
2009-01-01
The minimal inhibitory rules for information systems can be used for construction of classifiers. We show that almost all information systems from a certain large class of information systems have relatively short minimal inhibitory rules. However
Directory of Open Access Journals (Sweden)
Xian Zheng
2017-08-01
Full Text Available ABSTRACT Odanacatib (ODN is a selective inhibitor of cathepsin K. The cysteine protease cathepsin K has been implicated in cardiac hypertrophy. Resistine is an adipokine which is identified to promote cardiac hypertrophy. Here, we hypothesize that ODN mitigates resistin-induced myocyte hypertrophy. Cell surface area and protein synthesis were measured after treatment with resistin and ODN in H9c2 cells. The expression of cardiomyocyte hypertrophy marker BNP and β-MHC was detected by RT-qPCR. The expression and phosphorylation of AMPK and LKB1 were analyzed with Western blot. Resistin could significantly increase cardiomyocyte cell surface area, protein synthesis, and embryonic gene BNP and β-MHC expression, inhibit phosphorylation of AMPK and LKB1. ODN could significantly reverse the effects of resistin. Collectively, our data suggest that ODN can inhibit cardiomyocyte hypertrophy induced by resistin and the underlying mechanism may be involved in LKB1/AMPK pathway.
Disruption of Trophic Inhibitory Signaling in Autism Sepctrum Disorders
2016-12-01
1 AWARD NUMBER: W81XWH-14-1-0433 TITLE: Disruption of Trophic Inhibitory Signaling in Autism Sepctrum Disorders PRINCIPAL INVESTIGATOR: Anis...SUBTITLE 5a. CONTRACT NUMBER Disruption of Trophic Inhibitory Signaling in Autism Sepctrum Disorders 5b. GRANT NUMBER W81XWH-14-1-0433 5c. PROGRAM...chloride co-transporters that control EGABA could be used as a corrective strategy for the synaptic and circuit disruptions demonstrated in the
Lactoferricin B-derived peptides with inhibitory effects on ECE-dependent vasoconstriction.
Fernández-Musoles, Ricardo; López-Díez, José Javier; Torregrosa, Germán; Vallés, Salvador; Alborch, Enrique; Manzanares, Paloma; Salom, Juan B
2010-10-01
Endothelin-converting enzyme (ECE), a key peptidase in the endothelin (ET) system, cleaves inactive big ET-1 to produce active ET-1, which binds to ET(A) receptors to exert its vasoconstrictor and pressor effects. ECE inhibition could be beneficial in the treatment of hypertension. In this study, a set of eight lactoferricin B (LfcinB)-derived peptides, previously characterized in our laboratory as angiotensin-converting enzyme (ACE) inhibitory peptides, was examined for their inhibitory effects on ECE. In vitro inhibitory effects on ECE activity were assessed using both the synthetic fluorogenic peptide substrate V (FPS V) and the natural substrate big ET-1. To study vasoactive effects, an ex vivo functional assay was developed using isolated rabbit carotid artery segments. With FPS V, only four LfcinB-derived peptides induced inhibition of ECE activity, whereas the eight peptides showed ECE inhibitory effects with big ET-1 as substrate. Regarding the ex vivo assays, six LfcinB-derived peptides showed inhibition of big ET-1-induced, ECE-dependent vasoconstriction. A positive correlation between the inhibitory effects of LfcinB-derived peptides on ECE activity when using big ET-1 and the inhibitory effects on ECE-dependent vasoconstriction was shown. ECE-independent vasoconstriction induced by ET-1 was not affected, thus discarding effects of LfcinB-derived peptides on ET(A) receptors or intracellular signal transduction mechanisms. In conclusion, a combined in vitro and ex vivo method to assess the effects of potentially antihypertensive peptides on the ET system has been developed and applied to show the inhibitory effects on ECE-dependent vasoconstriction of six LfcinB-derived peptides, five of which were dual vasopeptidase (ACE/ECE) inhibitors. Copyright © 2010 Elsevier Inc. All rights reserved.
Testosterone 5alpha-reductase inhibitory active constituents of Piper nigrum leaf.
Hirata, Noriko; Tokunaga, Masashi; Naruto, Shunsuke; Iinuma, Munekazu; Matsuda, Hideaki
2007-12-01
Previously we reported that Piper nigrum leaf extract showed a potent stimulation effect on melanogenesis and that (-)-cubebin (1) and (-)-3,4-dimethoxy-3,4-desmethylenedioxycubebin (2) were isolated as active constituents. As a part of our continuous studies on Piper species for the development of cosmetic hair-care agents, testosterone 5alpha-reductase inhibitory activity of aqueous ethanolic extracts obtained from several different parts of six Piper species, namely Piper nigrum, P. methysticum, P. betle, P. kadsura, P. longum, and P. cubeba, were examined. Among them, the extracts of P. nigrum leaf, P. nigrum fruit and P. cubeba fruit showed potent inhibitory activity. Activity-guided fractionation of P. nigrum leaf extract led to the isolation of 1 and 2. Fruits of P. cubeba contain 1 as a major lignan, thus inhibitory activity of the fruit may be attributable to 1. As a result of further assay on other known constituents of the cited Piper species, it was found that piperine, a major alkaloid amide of P. nigrum fruit, showed potent inhibitory activity, thus a part of the inhibitory activity of P. nigrum fruit may depend on piperine. The 5alpha-reductase inhibitory activities of 1 and piperine were found for the first time. In addition, the P. nigrum leaf extract showed in vivo anti-androgenic activity using the hair regrowth assay in testosterone sensitive male C57Black/6CrSlc strain mice.
Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.
Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng
2015-09-01
Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.
Preparation of ACE Inhibitory Peptides from Mytilus coruscus Hydrolysate Using Uniform Design
Directory of Open Access Journals (Sweden)
Jin-Chao Wu
2013-01-01
Full Text Available The angiotensin-I-converting enzyme (ACE inhibitory peptides from mussel, Mytilus coruscus, were investigated and the variable factors, protease concentration, hydrolysis time, pH, and temperature, were optimized using Uniform Design, a new statistical experimental method. The results proved that the hydrolysate of alkali proteases had high ACE-inhibitory activity, especially the alkali protease E1. Optimization by Uniform Design showed that the best hydrolysis conditions for preparation of ACE-inhibitory peptides from Mytilus coruscus were protease concentration of 36.0 U/mL, hydrolysis time of 2.7 hours, pH 8.2, and Temperature at 59.5°C, respectively. The verification experiments under optimum conditions showed that the ACE-inhibitory activity (91.3% were agreed closely with the predicted activity of 90.7%. The amino acid composition analysis of Mytilus coruscus ACE-inhibitory peptides proved that it had high percent of lysine, leucine, glycine, aspartic acid, and glutamic acid.
Respirable antisense oligonucleotides: a new drug class for respiratory disease
Directory of Open Access Journals (Sweden)
Tanaka Makoto
2000-12-01
Full Text Available Abstract Respirable antisense oligonucleotides (RASONs, which attenuate specific disease-associated mRNAs, represent a new class of respiratory therapeutics with considerable potential. RASONs overcome previous obstacles that have impeded the development of antisense therapeutics targeting diseases in other organ systems. RASONs are delivered directly to the target tissue via inhalation; their uptake seems to be enhanced by cationic properties inherent in pulmonary surfactant, and, because of the markedly different target properties of mRNA and proteins, they can have very long durations of effect compared with traditional drugs targeting the protein of the same gene. RASONs contain chemical modifications that decrease their degradation by cellular nucleases. However, total insensitivity to nucleases is probably not an optimal design criterion for RASONs, because moderate nuclease sensitivity can prevent their systemic delivery, decreasing the potential for systemic toxicity. EPI-2010 is a 21-mer phosphorothioate RASON that attenuates bronchoconstriction, inflammation and surfactant depletion in preclinical models of human asthma, has a duration of effect of seven days, and seems to undergo minimal systemic delivery.
Mechanism of inhibition of HIV-1 integrase by G-tetrad-forming oligonucleotides in Vitro.
Jing, N; Marchand, C; Liu, J; Mitra, R; Hogan, M E; Pommier, Y
2000-07-14
The G-tetrad-forming oligonucleotides and have been identified as potent inhibitors of human immunodeficiency virus type 1 integrase (HIV-1 IN) activity (Rando, R. F., Ojwang, J., Elbaggari, A., Reyes, G. R., Tinder, R., McGrath, M. S., and Hogan, M. E. (1995) J. Biol. Chem. 270, 1754-1760; Mazumder, A., Neamati, N., Ojwang, J. O., Sunder, S., Rando, R. F., and Pommier, Y. (1996) Biochemistry 35, 13762-13771; Jing, N., and Hogan, M. E. (1998) J. Biol. Chem. 273, 34992-34999). To understand the inhibition of HIV-1 IN activity by the G-quartet inhibitors, we have designed the oligonucleotides and, composed of three and four G-quartets with stem lengths of 19 and 24 A, respectively. The fact that increasing the G-quartet stem length from 15 to 24 A kept inhibition of HIV-1 IN activity unchanged suggests that the binding interaction occurs between a GTGT loop domain of the G-quartet inhibitors and a catalytic site of HIV-1 IN, referred to as a face-to-face interaction. Docking the NMR structure of (Jing and Hogan (1998)) into the x-ray structure of the core domain of HIV-1 IN, HIV-1 IN-(51-209) (Maignan, S., Guilloteau, J.-P. , Qing, Z.-L., Clement-Mella, C., and Mikol, V. (1998) J. Mol. Biol. 282, 359-368), was performed using the GRAMM program. The statistical distributions of hydrogen bonding between HIV-1 IN and were obtained from the analyses of 1000 random docking structures. The docking results show a high probability of interaction between the GTGT loop residues of the G-quartet inhibitors and the catalytic site of HIV-1 IN, in agreement with the experimental observation.
Dogs' reaction to inequity is affected by inhibitory control.
Brucks, Désirée; Range, Friederike; Marshall-Pescini, Sarah
2017-11-17
Inequity aversion is thought to act as a mechanism to ensure cooperation and has been studied in many different species, consistently revealing inter-individual variation. Inhibitory control has been proposed to act as one factor responsible for this variation since individuals need to inhibit performing the required action and/or refuse rewards in order to exhibit inequity aversion. Here, we investigated if dogs' sensitivity to inequity is affected by their capacity for inhibitory control, assessed in a test battery and questionnaire. Overall, dogs showing high compulsivity scores (i.e. repetitive behaviours independent of feedback) were more motivated to participate in the inequity task independent of the rewarding scheme. Dogs were more sensitive to inequity and individual contrast if they exhibited a slower decision speed in the inhibition tasks. Furthermore, less persistent and more impulsive dogs were more sensitive to reward inequity, potentially due to having a lower tolerance level for frustration. Results indicate that aspects of inhibitory control can explain the variation in dogs' inequity response, highlighting one of the mechanisms underlying responses to inequity. Emphasising the importance to design paradigms, which allow us to disentangle capacities to recognise inequity from the inability to react to it due to poor inhibitory control abilities.
Development of mercury (II) ion biosensors based on mercury-specific oligonucleotide probes.
Li, Lanying; Wen, Yanli; Xu, Li; Xu, Qin; Song, Shiping; Zuo, Xiaolei; Yan, Juan; Zhang, Weijia; Liu, Gang
2016-01-15
Mercury (II) ion (Hg(2+)) contamination can be accumulated along the food chain and cause serious threat to the public health. Plenty of research effort thus has been devoted to the development of fast, sensitive and selective biosensors for monitoring Hg(2+). Thymine was demonstrated to specifically combine with Hg(2+) and form a thymine-Hg(2+)-thymine (T-Hg(2+)-T) structure, with binding constant even higher than T-A Watson-Crick pair in DNA duplex. Recently, various novel Hg(2+) biosensors have been developed based on T-rich Mercury-Specific Oligonucleotide (MSO) probes, and exhibited advanced selectivity and excellent sensitivity for Hg(2+) detection. In this review, we explained recent development of MSO-based Hg(2+) biosensors mainly in 3 groups: fluorescent biosensors, colorimetric biosensors and electrochemical biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Lactoferricin-related peptides with inhibitory effects on ACE-dependent vasoconstriction.
Centeno, José M; Burguete, María C; Castelló-Ruiz, María; Enrique, María; Vallés, Salvador; Salom, Juan B; Torregrosa, Germán; Marcos, José F; Alborch, Enrique; Manzanares, Paloma
2006-07-26
A selection of lactoferricin B (LfcinB)-related peptides with an angiotensin I-converting enzyme (ACE) inhibitory effect have been examined using in vitro and ex vivo functional assays. Peptides that were analyzed included a set of sequence-related antimicrobial hexapeptides previously reported and two representative LfcinB-derived peptides. In vitro assays using hippuryl-L-histidyl-L-leucine (HHL) and angiotensin I as substrates allowed us to select two hexapeptides, PACEI32 (Ac-RKWHFW-NH2) and PACEI34 (Ac-RKWLFW-NH2), and also a LfcinB-derived peptide, LfcinB17-31 (Ac-FKCRRWQWRMKKLGA-NH2). Ex vivo functional assays using rabbit carotid arterial segments showed PACEI32 (both D- and L-enantiomers) and LfcinB17-31 have inhibitory effects on ACE-dependent angiotensin I-induced contraction. None of the peptides exhibited in vitro ACE inhibitory activity using bradykinin as the substrate. In conclusion, three bioactive lactoferricin-related peptides exhibit inhibitory effects on both ACE activity and ACE-dependent vasoconstriction with potential to modulate hypertension that deserves further investigation.
Directory of Open Access Journals (Sweden)
Michael E. Østergaard
2017-06-01
Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.
International Nuclear Information System (INIS)
Agarwal, R.K.; Agarwal, Himanshu; Prasad, Ram
1996-01-01
The synthesis, magnetic and spectral properties of trivalent lanthanide chlorides with N-isonicotinamidobenzalaldimine (INH-BENZ), N-isonicotinamidoanisalaldimine (INH-ANSL) and N-isonicotinamido-p-dimethylaminobenzalaldimine (INH-PDAB) are described. 13 refs., 2 tabs
Modifying Yeast Tolerance to Inhibitory Conditions of Ethanol Production Processes
DEFF Research Database (Denmark)
Caspeta, Luis; Castillo, Tania; Nielsen, Jens
2015-01-01
Saccharomyces cerevisiae strains having a broad range of substrate utilization, rapid substrate consumption, and conversion to ethanol, as well as good tolerance to inhibitory conditions are ideal for cost-competitive ethanol production from lignocellulose. A major drawback to directly design S....... cerevisiae tolerance to inhibitory conditions of lignocellulosic ethanol production processes is the lack of knowledge about basic aspects of its cellular signaling network in response to stress. Here, we highlight the inhibitory conditions found in ethanol production processes, the targeted cellular...... functions, the key contributions of integrated -omics analysis to reveal cellular stress responses according to these inhibitors, and current status on design-based engineering of tolerant and efficient S. cerevisiae strains for ethanol production from lignocellulose....
Crawford, Trevor J; Higham, Steve
2016-01-29
Dementia (most notably, Alzheimer's Disease) is often associated with impairments of both working memory and inhibitory control. However, it is unclear whether these are functionally distinct impairments. We addressed the issue of whether working memory and inhibitory control can be dissociated, using data from a sample of patients who were recruited in a longitudinal study (Crawford et al., 2013, 2015). The first case revealed a preserved working memory capacity together with poor inhibitory control in the anti-saccade task. A longitudinal follow-up revealed that the defective inhibitory control emerged 12-months before the dementia was evident on the mini-mental state examination assessment. A second case revealed a poor working memory together with a well-preserved level of inhibitory control. The dissociation of working memory and inhibitory control was confirmed statistically in 7 additional cases. These findings yield converging evidence that working memory and inhibitory control are distinct cognitive operations and challenges the Kimberg and Farah (2000) cognitive model of working memory. Copyright © 2015 Elsevier Ltd. All rights reserved.
Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc
2011-07-01
Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.
Battini, Swapna; Mannava, M K Chaitanya; Nangia, Ashwini
2018-06-01
The classic fixed-dose combination (FDC) of 4 tuberculosis drugs, namely rifampicin (RIF), isoniazid (INH), pyrazinamide (PZA), and ethambutol dihydrochloride (EDH) has the twin issues of physical stability and RIF cross-reaction in the 4-FDC. The major reason for these quality issues is the interaction between RIF and INH to yield isonicotinyl hydrazone in drug tablets. Pharmaceutical cocrystals of INH with caffeic acid (CFA) (PZA + EDH + RIF + INH-CFA cocrystal) and vanillic acid (VLA) (PZA + EDH + RIF + INH-VLA cocrystal) are able to stabilize the FDC formulation compared with the reference batch (PZA + EDH + RIF + INH). Stability studies under accelerated humidity and temperature stress conditions of 40°C and 75% relative humidity showed that the physical stability of the cocrystal formulation was superior by powder X-ray diffraction and scanning electron microscopy analysis, and chemical purity was analyzed by high-performance liquid chromatography. Changes in the composition and structure were monitored on samples drawn at 7, 15, 22, and 30 days of storage. FDC-INH-CFA cocrystal batch exhibited greater stability compared with FDC-INH-VLA cocrystal and FDC reference drug batches. The superior stability of INH-CFA cocrystal is attributed to the presence of stronger hydrogen bonds and cyclic O-H⋯O synthon in the crystal structure. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Defibrotide: An Oligonucleotide for Sinusoidal Obstruction Syndrome.
Aziz, May T; Kakadiya, Payal P; Kush, Samantha M; Weigel, Kylie; Lowe, Denise K
2018-02-01
To review the efficacy and safety of defibrotide as well as its pharmacology, mechanism of action, pharmacokinetics (PK), drug-drug interactions, dosing, cost considerations, and place in therapy. A PubMed search was performed through August 2017 using the terms defibrotide, oligonucleotide, hepatic veno-occlusive disease (VOD), sinusoidal obstruction syndrome (SOS), and hematopoietic cell transplantation (HCT). Other data sources were from references of identified studies, review articles, and conference abstracts plus manufacturer product labeling and website, the Food and Drug Administration website, and clinicaltrials.gov. English-language trials that examined defibrotide's pharmacodynamics, mechanism, PK, efficacy, safety, dosing, and cost-effectiveness were included. Trials have confirmed the safety and efficacy of defibrotide for treatment of VOD/SOS in adult and pediatric HCT patients, with complete response rates and day +100 overall survival rates ranging from 25.5% to 76% and 35% to 64%, respectively. The British Committee for Standards in Haematology/British Society for Blood and Marrow Transplantation Guidelines recommend defibrotide prophylaxis in pediatric and adult HCT patients with risk factors for VOD/SOS; however, its prophylactic use in the United States is controversial. Although there are efficacy data to support this strategy, cost-effectiveness data have not shown it to be cost-effective. Defibrotide has manageable toxicities, with low rates of grade 3 to 4 adverse effects. Defibrotide is the first medication approved in the United States for the treatment of adults and children with hepatic VOD/SOS, with renal or pulmonary dysfunction following HCT. Data evaluating defibrotide for VOD/SOS prevention are conflicting and have not shown cost-effectiveness.
International Nuclear Information System (INIS)
Sommerfelt, H.; Kalland, K.H.; Raj, P.; Moseley, S.L.; Bhan, M.K.; Bjorvatn, B.
1988-01-01
Restriction endonuclease-generated polynucleotide and synthetically produced oligonucleotide gene probes used in colony hybridization assays proved to be efficient for the detection and differentiation of enterotoxigenic Escherichia coli. To compare their relative efficiencies, these two sets of probes were radiolabeled with 32 P and were applied to 74 strains of E. coli with known enterotoxin profiles and to 156 previously unexamined E. coli isolates. The enterotoxigenic bacteria Vibrio cholerae O1, Vibrio cholerae non-O1 (NAG), Yersinia enterocolitica, and E. coli harboring the plasmid vectors of the polynucleotide gene probes were examined for further evaluation of probe specificity. The two classes of probes showed a perfect concordance in their specific detection and differentiation of enterotoxigenic E. coli. In the analysis of six strains, the signal strength on autoradiography after hybridization with oligonucleotides was weaker than that obtained after hybridization with polynucleotide probes. The probes did not hybridize with DNA from V. cholerae O1, V. cholerae non-O1 (NAG), or Y. enterocolitica. The strains of E. coli harboring the plasmid vectors of the polynucleotide gene probes were, likewise, negative in the hybridization assays
Energy Technology Data Exchange (ETDEWEB)
Sommerfelt, H.; Kalland, K.H.; Raj, P.; Moseley, S.L.; Bhan, M.K.; Bjorvatn, B.
1988-11-01
Restriction endonuclease-generated polynucleotide and synthetically produced oligonucleotide gene probes used in colony hybridization assays proved to be efficient for the detection and differentiation of enterotoxigenic Escherichia coli. To compare their relative efficiencies, these two sets of probes were radiolabeled with /sup 32/P and were applied to 74 strains of E. coli with known enterotoxin profiles and to 156 previously unexamined E. coli isolates. The enterotoxigenic bacteria Vibrio cholerae O1, Vibrio cholerae non-O1 (NAG), Yersinia enterocolitica, and E. coli harboring the plasmid vectors of the polynucleotide gene probes were examined for further evaluation of probe specificity. The two classes of probes showed a perfect concordance in their specific detection and differentiation of enterotoxigenic E. coli. In the analysis of six strains, the signal strength on autoradiography after hybridization with oligonucleotides was weaker than that obtained after hybridization with polynucleotide probes. The probes did not hybridize with DNA from V. cholerae O1, V. cholerae non-O1 (NAG), or Y. enterocolitica. The strains of E. coli harboring the plasmid vectors of the polynucleotide gene probes were, likewise, negative in the hybridization assays.
Directory of Open Access Journals (Sweden)
Ceyda Tunakan Dalgıç
2018-01-01
Full Text Available Hereditary angioedema due to C1-inhibitor deficiency (C1-INH-HAE is a rare, autosomal dominant disorder. The management of pregnant patients with C1-INH-HAE is a challenge for the physician. Intravenous plasma-derived nanofiltered C1-INH (pdC1INH is the only recommended option throughout pregnancy, postpartum, and breastfeeding period. In order to increase pregnancy rates, physicians use fertilization therapies increasing endogen levels of estrogens. Therefore, these techniques can provoke an increase in the number and severity of edema attacks in C1-INH-HAE. Our patient is a 32-year-old female, diagnosed with C1-INH-HAE type 1 since 2004. She had been taking danazol 50–200 mg/day for 9 years. Due to her pregnancy plans in 2013, danazol was discontinued. PdC1INH was prescribed regularly for prophylactic purpose. Triplet pregnancy occurred by in vitro fertilization using luteinizing hormone-releasing hormone (LHRH injections. In our patient, LHRH injections were done four times without causing any severe attack during in vitro fertilization. Angioedema did not worsen during pregnancy and delivery due to the prophylactic use of intravenous pdC1INH in our patient. According to the attack frequency and severity, there was no difference between the three pregnancy trimesters. To our knowledge, this is the first published case of C1-INH-HAE receiving in vitro fertilization therapies without any angioedema attacks during pregnancy and delivery and eventually having healthy triplets with the prophylactic use of intravenous pdC1INH.
Inhibitory effect of corn silk on skin pigmentation.
Choi, Sang Yoon; Lee, Yeonmi; Kim, Sung Soo; Ju, Hyun Min; Baek, Ji Hwoon; Park, Chul-Soo; Lee, Dong-Hyuk
2014-03-03
In this study, the inhibitory effect of corn silk on melanin production was evaluated. This study was performed to investigate the inhibitory effect of corn silk on melanin production in Melan-A cells by measuring melanin production and protein expression. The corn silk extract applied on Melan-A cells at a concentration of 100 ppm decreased melanin production by 37.2% without cytotoxicity. This was a better result than arbutin, a positive whitening agent, which exhibited a 26.8% melanin production inhibitory effect at the same concentration. The corn silk extract did not suppress tyrosinase activity but greatly reduced the expression of tyrosinase in Melan-A cells. In addition, corn silk extract was applied to the human face with hyperpigmentation, and skin color was measured to examine the degree of skin pigment reduction. The application of corn silk extract on faces with hyperpigmentation significantly reduced skin pigmentation without abnormal reactions. Based on the results above, corn silk has good prospects for use as a material for suppressing skin pigmentation.
Inhibitory Effect of Corn Silk on Skin Pigmentation
Directory of Open Access Journals (Sweden)
Sang Yoon Choi
2014-03-01
Full Text Available In this study, the inhibitory effect of corn silk on melanin production was evaluated. This study was performed to investigate the inhibitory effect of corn silk on melanin production in Melan-A cells by measuring melanin production and protein expression. The corn silk extract applied on Melan-A cells at a concentration of 100 ppm decreased melanin production by 37.2% without cytotoxicity. This was a better result than arbutin, a positive whitening agent, which exhibited a 26.8% melanin production inhibitory effect at the same concentration. The corn silk extract did not suppress tyrosinase activity but greatly reduced the expression of tyrosinase in Melan-A cells. In addition, corn silk extract was applied to the human face with hyperpigmentation, and skin color was measured to examine the degree of skin pigment reduction. The application of corn silk extract on faces with hyperpigmentation significantly reduced skin pigmentation without abnormal reactions. Based on the results above, corn silk has good prospects for use as a material for suppressing skin pigmentation.
Adherence with isoniazid for prevention of tuberculosis among HIV-infected adults in South Africa
Directory of Open Access Journals (Sweden)
Muller F James
2006-06-01
Full Text Available Abstract Background Tuberculosis (TB is the most common opportunistic infection in HIV-infected adults in developing countries. Isoniazid (INH is recommended for treatment of latent TB infection, however non-adherence is common. The purpose of this study was to apply in-house prepared isoniazid (INH urine test strips in a clinical setting, and identify predictors of positive test results in an adherence questionnaire in HIV-infected adults taking INH for prevention of TB. Methods Cross-sectional study of adherence using a questionnaire and urine test strips for detection of INH metabolites at two hospitals in Pietermaritzburg, South Africa. Participants were aged at least 18 years, HIV positive, and receiving INH for prevention of tuberculosis disease. Univariate and multivariate analyses are used to identify factors relevant to adherence. Results 301 consecutive patients were recruited. 28% of participants had negative urine tests. 32 (37.2%, 95% CI25.4, 45.0 of the 86 patients who received INH from peripheral pharmacies said the pharmacy had run out of INH at some time, compared with central hospital pharmacies (p = 0.0001. In univariate analysis, a negative test was associated with self-reported missed INH doses (p = 0.043. Each 12-hour increment since last reported dose increased the likelihood of a negative test by 34% (p = 0.0007. Belief in INH safety was associated with a positive test (p = 0.021. In multivariate analysis, patients who believed INH is important for prevention of TB disease were more likely to be negative (p = 0.0086. Conclusion Adequate drug availability at peripheral pharmacies remains an important intervention for TB prevention. Key questions may identify potentially non-adherent patients. In-house prepared urine tests strips are an effective and cheap method of objectively assessing INH adherence, and could be used an important tool in TB control programs.
Farkas, H; Martinez-Saguer, I; Bork, K; Bowen, T; Craig, T; Frank, M; Germenis, A E; Grumach, A S; Luczay, A; Varga, L; Zanichelli, A
2017-02-01
The consensus documents published to date on hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) have focused on adult patients. Many of the previous recommendations have not been adapted to pediatric patients. We intended to produce consensus recommendations for the diagnosis and management of pediatric patients with C1-INH-HAE. During an expert panel meeting that took place during the 9th C1 Inhibitor Deficiency Workshop in Budapest, 2015 (www.haenet.hu), pediatric data were presented and discussed and a consensus was developed by voting. The symptoms of C1-INH-HAE often present in childhood. Differential diagnosis can be difficult as abdominal pain is common in pediatric C1-INH-HAE, but also commonly occurs in the general pediatric population. The early onset of symptoms may predict a more severe subsequent course of the disease. Before the age of 1 year, C1-INH levels may be lower than in adults; therefore, it is advisable to confirm the diagnosis after the age of one year. All neonates/infants with an affected C1-INH-HAE family member should be screened for C1-INH deficiency. Pediatric patients should always carry a C1-INH-HAE information card and medicine for emergency use. The regulatory approval status of the drugs for prophylaxis and for acute treatment is different in each country. Plasma-derived C1-INH, recombinant C1-INH, and ecallantide are the only agents licensed for the acute treatment of pediatric patients. Clinical trials are underway with additional drugs. It is recommended to follow up patients in an HAE comprehensive care center. The pediatric-focused international consensus for the diagnosis and management of C1-INH-HAE patients was created. © 2016 The Authors. Allergy Published by John Wiley & Sons Ltd.
Phytochemical screening and in vitro acetylcholinesterase inhibitory ...
African Journals Online (AJOL)
Phytochemical screening and in vitro acetylcholinesterase inhibitory activity of seven plant extracts. Titilayo Johnson, Oduje A. Akinsanmi, Enoch J. Banbilbwa, Tijani A. Yahaya, Karima Abdulaziz, Kolade Omole ...
Directory of Open Access Journals (Sweden)
Kazuhito Tanabe
2011-01-01
Full Text Available A number of advances have been made in the development of modified oligodeoxynucleotides (ODNs, and chemical or physical properties of which are controlled by external stimuli. These intelligent ODNs are promising for the next generation of gene diagnostics and therapy. This paper focuses on the molecular design of artificial ODNs that are activated by X-irradiation and their applications to regulation of hybridization properties, conformation change, radiation-activated DNAzyme, and decoy molecules.
The Effect of Domestication on Inhibitory Control: Wolves and Dogs Compared
Marshall-Pescini, Sarah; Virányi, Zsófia; Range, Friederike
2015-01-01
Inhibitory control i.e. blocking an impulsive or prepotent response in favour of a more appropriate alternative, has been suggested to play an important role in cooperative behaviour. Interestingly, while dogs and wolves show a similar social organization, they differ in their intraspecific cooperation tendencies in that wolves rely more heavily on group coordination in regard to hunting and pup-rearing compared to dogs. Hence, based on the ‘canine cooperation’ hypothesis wolves should show better inhibitory control than dogs. On the other hand, through the domestication process, dogs may have been selected for cooperative tendencies towards humans and/or a less reactive temperament, which may in turn have affected their inhibitory control abilities. Hence, based on the latter hypothesis, we would expect dogs to show a higher performance in tasks requiring inhibitory control. To test the predictive value of these alternative hypotheses, in the current study two tasks; the ‘cylinder task’ and the ‘detour task’, which are designed to assess inhibitory control, were used to evaluate the performance of identically raised pack dogs and wolves. Results from the cylinder task showed a significantly poorer performance in wolves than identically-raised pack dogs (and showed that pack-dogs performed similarly to pet dogs with different training experiences), however contrary results emerged in the detour task, with wolves showing a shorter latency to success and less perseverative behaviour at the fence. Results are discussed in relation to previous studies using these paradigms and in terms of the validity of these two methods in assessing inhibitory control. PMID:25714840
AP-1 Oligodeoxynucleotides Reduce Aortic Elastolysis in a Murine Model of Marfan Syndrome.
Arif, Rawa; Zaradzki, Marcin; Remes, Anca; Seppelt, Philipp; Kunze, Reiner; Schröder, Hannes; Schwill, Simon; Ensminger, Stephan M; Robinson, Peter N; Karck, Matthias; Müller, Oliver J; Hecker, Markus; Wagner, Andreas H; Kallenbach, Klaus
2017-12-15
Marfan syndrome is characterized by high expression of matrix metalloproteinases (MMPs) in aortic smooth muscle cells (AoSMCs) associated with medial elastolysis and aortic root aneurysm. We aimed to reduce aortic elastolysis through decrease of MMP expression with decoy oligodeoxynucleotides (dODNs) neutralizing the transcription factor activating factor-1 (AP-1). AP-1 abundance in nuclear extracts as well as MMP-2 and MMP-9 expression were significantly increased in isolated mAoSMC of mgR/mgR Marfan mice compared to wild-type cells. Exposure to AP-1 neutralizing dODNs resulted in a significant reduction of basal and interleukin-1β-stimulated MMP expression and activity in mAoSMCs. Moreover, increased migration and formation of superoxide radical anions was substantially decreased in mAoSMCs by AP-1 dODN treatment. Aortic grafts from donor Marfan mice were treated with AP-1- dODN ex vivo and implanted as infrarenal aortic interposition grafts in mgR/mgR mice. Pretreatment of aortic grafts with AP-1 dODN led to reduced elastolysis, macrophage infiltration, and MMP activity. Permeability of the endothelial monolayer was increased for dODN in mgR/mgR aortae with observed loss of tight junction proteins ZO-1 and occludin, enabling dODN to reach the tunica media. Targeting AP-1 activity offers a new potential strategy to treat the vascular phenotype associated with Marfan syndrome. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Inhibitory control and moral emotions: relations to reparation in early and middle childhood.
Colasante, Tyler; Zuffianò, Antonio; Bae, Na Young; Malti, Tina
2014-01-01
This study examined links between inhibitory control, moral emotions (sympathy and guilt), and reparative behavior in an ethnically diverse sample of 4- and 8-year-olds (N = 162). Caregivers reported their children's reparative behavior, inhibitory control, and moral emotions through a questionnaire, and children reported their guilt feelings in response to a series of vignettes depicting moral transgressions. A hypothesized meditation model was tested with inhibitory control relating to reparative behavior through sympathy and guilt. In support of this model, results revealed that high levels of inhibitory control were associated with high levels of reparative behavior through high levels of sympathy and guilt. However, the mediation of inhibitory control to reparation through guilt was significant for 4-year-olds only. Results are discussed in relation to the temperamental, regulatory, and affective-moral precursors of reparative behavior in early and middle childhood.
Hunger, inhibitory control and distress-induced emotional eating.
van Strien, Tatjana; Ouwens, Machteld A; Engel, Carmen; de Weerth, Carolina
2014-08-01
Self-reported emotional eating has been found to significantly moderate distress-induced food intake, with low emotional eaters eating less after a stress task than after a control task and high emotional eaters eating more. The aim of the present study was to explore possible underlying mechanisms by assessing possible associations with (1) ability to experience the typical post-stress reduction of hunger and (2) inhibitory control. We studied these effects in 54 female students who were preselected on the basis of extremely high or low scores on an emotional eating questionnaire. Using a within subject design we measured the difference of actual food or snack intake after a control or a stress task (Trier Social Stress Test). As expected, the moderator effect of emotional eating on distress-induced food intake was found to be only present in females with a failure to report the typical reduction of hunger immediately after a stress task (an a-typical hunger stress response). Contrary to our expectations, this moderator effect of emotional eating was also found to be only present in females with high ability to stop motor impulses (high inhibitory control). These findings suggest that an a-typical hunger stress response but not poor inhibitory control may underlie the moderator effect of emotional eating on distress-induced food intake. However, inhibitory control may play a role whether or not there is a moderator effect of self-reported emotional eating on distress-induced food intake. Copyright © 2014 Elsevier Ltd. All rights reserved.
Antitumor effects of radioiodinated antisense oligonucleotide mediated by VIP receptor
International Nuclear Information System (INIS)
Ou Xiaohong; Tan Tianzhi; Li Yunchun; Kuang Anren
2004-01-01
Purpose: we had constructed a targeting delivery system based on intestinal peptide (VIP) for antisense oligonucleotide (ASON) transfer into VIP receptor-positive cells in previous study. The aims of present studies are to observe the antitumor effect of VIP-131I-ASON in HT29 human colon adenocarcinoma xenografts. Methods: A 15-met phosphorothioate ASON, which was complementary to the translation start region of the C-myc oncogene mRNA, was labeled with 131I and the labelled compound was linked to the VIP bound covalently 'to a polylysine chain so as to deliver oligonucleotide into tumor cells. Distribution experiments for evaluating the radiolabeled antisense complexe uptake in tumor tissue were performed in BALB/c nude mice bearing with HT29 tumor xenografts. Nude mice beating HT29 tumor xenografts were adminstered VIP-131I-ASON (3.7,7.4 MBq) or 131I-ASON (3.7 MBq), 131I labeled control sense and nosense DNA (3.7 MBq), or saline. Antitumor effects were assessed using endpoints of tumor growth delay. C-myc-encoded protein expression of tumor was measured by immunocytohistochemical staining. Results: Distribution experiment performed with athymic mice bearing human colon tumor xenografts revealed maximal accumulation of conjugated ASON in the tumor tissue 2 h after administration and significantly higher than that in nude mice injected unconjngated ASON [(5.89±1.03)%ID/g and(1.56±0.31)%ID/g, respectively; t=7.7954 P<0.001]. The radioratio of tumor to muscle was peaked 4h after administration. VIP-131I-ASON exhibited strong antitumor effects against HT29 xenografts, decreasing their growth rate 7-fold compare with that in saline-treated mice(tumor growth delay, 25.4±0.89 day). The antitumor effects of unconjugated 131I-ASON were much less profound than VIP-131I-ASON (tumor growth delay, 3.2±1.3 and 25.4±0.89 day, respectively; q=51.4126 P<0.01). Sense, nosense control ON with VIP carder caused no therapeutic effect. There was no progressive weight loss or
A virtual screening method for inhibitory peptides of Angiotensin I-converting enzyme.
Wu, Hongxi; Liu, Yalan; Guo, Mingrong; Xie, Jingli; Jiang, XiaMin
2014-09-01
Natural small peptides from foods have been proven to be efficient inhibitors of Angiotensin I-converting enzyme (ACE) for the regulation of blood pressure. The traditional ACE inhibitory peptides screening method is both time consuming and money costing, to the contrary, virtual screening method by computation can break these limitations. We establish a virtual screening method to obtain ACE inhibitory peptides with the help of Libdock module of Discovery Studio 3.5 software. A significant relationship between Libdock score and experimental IC(50) was found, Libdock score = 10.063 log(1/IC(50)) + 68.08 (R(2) = 0.62). The credibility of the relationship was confirmed by testing the coincidence of the estimated log(1/IC(50)) and measured log(1/IC(50)) (IC(50) is 50% inhibitory concentration toward ACE, in μmol/L) of 5 synthetic ACE inhibitory peptides, which was virtual hydrolyzed and screened from a kind of seafood, Phascolosoma esculenta. Accordingly, Libdock method is a valid IC(50) estimation tool and virtual screening method for small ACE inhibitory peptides. © 2014 Institute of Food Technologists®
Yang, Fei-Fei; Zhou, Jing; Hu, Xiao; Cong, Zhao-Qing; Liu, Chun-Yu; Pan, Rui-Le; Chang, Qi; Liu, Xin-Min; Liao, Yong-Hong
2018-03-01
Self-microemulsifying (SME) drug delivery system has been developed to increase oral bioavailabilities, and inhibitory excipients are capable of improving oral bioavailability by inhibiting enzyme mediated intestinal metabolism. However, the potential of enzyme inhibitory excipients containing SME in boosting resveratrol bioavailability remains largely uninvestigated. In this study, we set out to prepare SME-1 with UGT inhibitory excipients (excipients without inhibitory activities named SME-2 as control) to increase the bioavailability of RES by inhibiting intestinal metabolism. Results demonstrated that similar physicochemical properties such as size, polydistribution index and in vitro release, cellular uptake and permeability in Caco-2 cells as well as in vivo lymphatic distribution between inhibitory SME-1 and non-inhibitory SME-2 were observed. In vivo study demonstrated that the molar ratios of RES-G/RES were 7.25±0.48 and 5.06±2.42 for free drug and SME-2, respectively, and the molar ratio decreased to 0.36±0.10 in SME-1 group. Pharmacokinetic study confirmed that the inhibitory excipients containing SME demonstrated potential in increasing bioavailability of RES from 6.5% for the free RES and 12.9% for SME-2 to 76.1% in SME-1 through modulating the glucuronidation by UGT inhibitory excipients. Copyright © 2018 Elsevier B.V. All rights reserved.
Optimization of inhibitory decision rules relative to length and coverage
Alsolami, Fawaz
2012-01-01
The paper is devoted to the study of algorithms for optimization of inhibitory rules relative to the length and coverage. In contrast with usual rules that have on the right-hand side a relation "attribute ≠ value", inhibitory rules have a relation "attribute = value" on the right-hand side. The considered algorithms are based on extensions of dynamic programming. © 2012 Springer-Verlag.
Inhibitory Synaptic Plasticity - Spike timing dependence and putative network function.
Directory of Open Access Journals (Sweden)
Tim P Vogels
2013-07-01
Full Text Available While the plasticity of excitatory synaptic connections in the brain has been widely studied, the plasticity of inhibitory connections is much less understood. Here, we present recent experimental and theoretical □ndings concerning the rules of spike timing-dependent inhibitory plasticity and their putative network function. This is a summary of a workshop at the COSYNE conference 2012.
Modifying yeast tolerance to inhibitory conditions of ethanol production processes
Directory of Open Access Journals (Sweden)
Luis eCaspeta
2015-11-01
Full Text Available Saccharomyces cerevisiae strains having a broad range of substrate utilization, rapid substrate consumption and conversion to ethanol, as well as good tolerance to inhibitory conditions are ideal for cost-competitive ethanol production from lignocellulose. A major drawback to directly design S. cerevisiae tolerance to inhibitory conditions of lignocellulosic ethanol production processes is the lack of knowledge about basic aspects of its cellular signaling network in response to stress. Here we highlight the inhibitory conditions found in ethanol production processes, the targeted cellular functions, the key contributions of integrated –omics analysis to reveal cellular stress responses according to these inhibitors, and current status on design-based engineering of tolerant and efficient S. cerevisiae strains for ethanol production from lignocellulose.
Inhibitory serum factor of lymphoproliferative response to allogeneic cells in pregnancy
Directory of Open Access Journals (Sweden)
Silvia Daher
Full Text Available INTRODUCTION: An inhibitory serum factor of mixed lymphocyte culture (MLC has been associated with successful pregnancy after lymphocyte transfusion in women with unexplained recurrent spontaneous abortions (RSA. OBJECTIVE: Investigate whether the inhibitory serum factor of MLC is essential for a successful pregnancy. METHOD: Sera from 33 healthy pregnant women and from 40 women with RSA were assessed by a one-way MLC in which the woman's lymphocytes were stimulated with her partner's lymphocytes or with third party lymphocytes. RESULTS: An inhibitory serum effect (inhibition > 50% as compared to normal serum was detected in 45% of the pregnant women who had at least 1 previous parity, in 8% of the primigravidea, in 29% of those with one abortion and in 58% of those with more than one abortion. CONCLUSION: MLC inhibitory serum factor does not seem to be an essential factor for pregnancy development. Therefore, it should not be considered as a parameter for the assessment of RSA patients.
Schwiertz, Andreas; Le Blay, Gwenaelle; Blaut, Michael
2000-01-01
Species-specific 16S rRNA-targeted, Cy3 (indocarbocyanine)-labeled oligonucleotide probes were designed and validated to quantify different Eubacterium species in human fecal samples. Probes were directed at Eubacterium barkeri, E. biforme, E. contortum, E. cylindroides (two probes), E. dolichum, E. hadrum, E. lentum, E. limosum, E. moniliforme, and E. ventriosum. The specificity of the probes was tested with the type strains and a range of common intestinal bacteria. With one exception, none...
CpG oligodeoxynucleotides are potent enhancers of radio- and chemoresponses of murine tumors
International Nuclear Information System (INIS)
Mason, Kathryn A.; Neal, Robert; Hunter, Nancy; Ariga, Hisanori; Ang, Kian; Milas, Luka
2006-01-01
Background and purpose: Synthetic oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs bind to Toll-like receptor 9 (TLR9) and stimulate both innate and adaptive immune reactions and possess anti-tumor activity. We recently reported that CpG ODN 1826 strongly enhances radioresponse of both immunogenic [Milas L, Mason K, Ariga H, et al. CpG oligodeoxynucleotide enhances tumor response to radiation. Cancer Res 2004;64:5074-7] and non-immunogenic [Mason KA, Ariga H, Neal R, et al. Targeting toll-like receptor-9 with CpG oligodeoxynucleotides enhances tumor response to fractionated radiotherapy. Clin Cancer Res 2005;11:361-9] murine tumors. Using two immunogenic murine tumors, a fibrosarcoma (FSa) and a mammary carcinoma (MCa-K), the present study explored whether CpG ODN 1826 also improves the response of murine tumors to the chemotherapeutic agent docetaxel (DOC). Materials and methods: CpG ODN 1826 (100 μg) was given sc three times: when leg tumors were 6 mm, when they grew to 8 mm and again 1 week later. DOC (33 mg/kg iv) and local tumor radiation (10 Gy) were given when tumors were 8 mm. Effects of the treatments were assayed by tumor growth delay, defined as days for tumors to grow from 8 to 12 mm in diameter. Results: Treatment with CpG ODN 1826 resulted in strongly enhanced response of FSa tumors to radiation and MCa-K tumors to the chemotherapeutic agent DOC. Enhancement of tumor treatment response was demonstrated by a strong prolongation in the primary tumor treatment endpoint, tumor growth delay. Coincidentally, this treatment also resulted in a higher rate of tumor cure than that observed after tumor radiotherapy or chemotherapy alone. When all three agents were combined the effect was comparable to that of the combination of CpG ODN 1826 with radiation in the case of FSa or of the combination of CpG ODN 1826 with DOC in the case of MCa-K. Conclusion: Overall results show that CpG ODN 1826 can markedly improve tumor response
Inhibitory effects of crude extracts from several plants on postharvest pathogens of citrus
Gong, Mingfu; Guan, Qinlan; Xu, Shanshan
2018-04-01
China is one of the most important origin of citrus. Enormous economic losses was caused by fungal diseases in citrus harvest storage every year. The effective antimicrobial substances of garlic, ginger, celery and pepper were extracted by ethanol extraction and water extraction respectively. The inhibitory effects of the crude extract on Penicillium sp. caused fungal diseases in citrus harvest storage were also determined. The results showed that the extracts of garlic, ginger and celery had inhibitory effect on P. sp., but the extracts of pepper had no inhibitory effect on P. sp.. The garlic ethanol extracts had the best inhibitory effect on P. citrinum.
Synthesis and Structural Characterization of 2'-Fluoro-α-L-RNA-Modified Oligonucleotides
DEFF Research Database (Denmark)
Bundgaard Jensen, Troels; Pasternak, Anna; Stahl Madsen, Andreas
2011-01-01
with the smallest destabilization towards RNA. Thermodynamic data show that the duplex formation with 2'-fluoro-α-L-RNA nucleotides is enthalpically disfavored but entropically favored. 2'-Fluoro-α-L-RNA nucleotides exhibit very good base pairing specificity following Watson-Crick rules. The 2'-fluoro......-α-L-RNA monomer was designed as a monocyclic mimic of the bicyclic α-L-LNA, and molecular modeling showed that this indeed is the case as the 2'-fluoro monomer adopts a C3'-endo/C2'-exo sugar pucker. Molecular modeling of modified duplexes show that the 2'-fluoro-α-L-RNA nucleotides partake in Watson-Crick base......We describe the synthesis and binding properties of oligonucleotides that contain one or more 2'-fluoro-α-L-RNA thymine monomer(s). Incorporation of 2'-fluoro-α-L-RNA thymine into oligodeoxynucleotides decreased thermal binding stability slightly upon hybridization with complementary DNA and RNA...
NK cell activation: distinct stimulatory pathways counterbalancing inhibitory signals.
Bakker, A B; Wu, J; Phillips, J H; Lanier, L L
2000-01-01
A delicate balance between positive and negative signals regulates NK cell effector function. Activation of NK cells may be initiated by the triggering of multiple adhesion or costimulatory molecules, and can be counterbalanced by inhibitory signals induced by receptors for MHC class I. A common pathway of inhibitory signaling is provided by immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in the cytoplasmic domains of these receptors which mediate the recruitment of SH2 domain-bearing tyrosine phosphate-1 (SHP-1). In contrast to the extensive progress that has been made regarding the negative regulation of NK cell function, our knowledge of the signals that activate NK cells is still poor. Recent studies of the activating receptor complexes have shed new light on the induction of NK cell effector function. Several NK receptors using novel adaptors with immunoreceptor tyrosine-based activation motifs (ITAMs) and with PI 3-kinase recruiting motifs have been implicated in NK cell stimulation.
Elimination Voltammetry with Linear Scan as a New Detection Method for DNA Sensors
Directory of Open Access Journals (Sweden)
Rene Kizek
2005-11-01
Full Text Available The paper describes successful coupling of adsorptive transfer stripping (AdTS andelimination voltammetry with linear scan (EVLS for the resolution of reduction signals of cytosine (Cand adenine (A residues in hetero-oligodeoxynucleotides (ODNs. Short ODNs (9-mers and 20-merswere adsorbed from a small volume on a hanging mercury drop electrode (HMDE. After washing ofthe ODN-modified electrode by water and its transferring to an electrochemical cell, voltammetric curves were measured. The AdTS EVLS was able to determine of C/A ratio of ODNs through theelimination function conserving the diffusion current component and eliminating kinetic and chargingcurrent components. This function, which provides the elimination signal in a peak-counterpeak form,increased the current sensitivity for A and C resolution, and for the recognition of bases sequences inODN chains. Optimal conditions of elimination experiments such as pH, time of adsorption, and scanrate were found. The combination of EVLS with AdTS procedure can be considered as a newdetection method in a DNA sensor.
On minimal inhibitory rules for almost all k-valued information systems
Moshkov, Mikhail
2009-07-30
The minimal inhibitory rules for information systems can be used for construction of classifiers. We show that almost all information systems from a certain large class of information systems have relatively short minimal inhibitory rules. However, the number of such rules is not polynomial in the number of attributes and the number of objects. This class consists of all k-valued information systems, k ≥ 2, with the number of objects polynomial in the number of attributes. Hence, for efficient construction of classifiers some filtration techniques in rule generation are necessary. Another way is to work with lazy classification algorithms based on inhibitory rules.
Cai, Weidong; Chen, Tianwen; Ide, Jaime S; Li, Chiang-Shan R; Menon, Vinod
2017-08-01
The ability to anticipate and detect behaviorally salient stimuli is important for virtually all adaptive behaviors, including inhibitory control that requires the withholding of prepotent responses when instructed by external cues. Although right fronto-operculum-insula (FOI), encompassing the anterior insular cortex (rAI) and inferior frontal cortex (rIFC), involvement in inhibitory control is well established, little is known about signaling mechanisms underlying their differential roles in detection and anticipation of salient inhibitory cues. Here we use 2 independent functional magnetic resonance imaging data sets to investigate dynamic causal interactions of the rAI and rIFC, with sensory cortex during detection and anticipation of inhibitory cues. Across 2 different experiments involving auditory and visual inhibitory cues, we demonstrate that primary sensory cortex has a stronger causal influence on rAI than on rIFC, suggesting a greater role for the rAI in detection of salient inhibitory cues. Crucially, a Bayesian prediction model of subjective trial-by-trial changes in inhibitory cue anticipation revealed that the strength of causal influences from rIFC to rAI increased significantly on trials in which participants had higher anticipation of inhibitory cues. Together, these results demonstrate the dissociable bottom-up and top-down roles of distinct FOI regions in detection and anticipation of behaviorally salient cues across multiple sensory modalities. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Aguirre von Wobeser, E.; Huisman, J.; Ibelings, B.; Matthijs, H.C.P.; Matthijs, H.C.P.
2005-01-01
A newly designed 45 to 60 mer oligonucleotide Agilent platform microarray for global gene expression studies of Synechocystis PCC6803: example salt stress experiment Eneas Aguirre-von-Wobeser 1, Jef Huisman1, Bas Ibelings2 and Hans C.P. Matthijs1 1 Universiteit van Amsterdam, Amsterdam, The
Fungal growth inhibitory properties of new phytosphingolipid analogues.
Mormeneo, D; Manresa, A; Casas, J; Llebaria, A; Delgado, A
2008-04-01
To study the growth inhibitory properties of a series of phytosphingosine (PHS) and phytoceramide (PHC) analogues. A panel of two yeast (Candida albicans and Saccharomyces cerevisiae) and six moulds (Aspergillus repens, Aspergillus niger, Penicillium chrysogenum, Cladosporium cladosporioides, Arthroderma uncinatum and Penicillium funiculosum) has been used in this study. A series of new PHS and PHC analogues differing at the sphingoid backbone and the functional group at C1 position were synthesized. Among PHS analogues, 1-azido derivative 1c, bearing the natural D-ribo stereochemistry, showed a promising growth inhibitory profile. Among PHC analogues, compound 12, with a bulky N-pivaloyl group and a Z double bond at C3 position of the sphingoid chain, was the most active growth inhibitor. Minimal inhibitory concentration values were in the range of 23-48 micromol l(-1) for 1c and 44-87 micromol l(-1) for 12. Only scattered data on the antifungal activity of phytosphingolipids have been reported in the literature. This is the first time that a series of analogues of this kind are tested and compared to discern their structural requirements for antifungal activity.
Plasma Exosome Profiling of Cancer Patients by a Next Generation Systems Biology Approach.
Domenyuk, Valeriy; Zhong, Zhenyu; Stark, Adam; Xiao, Nianqing; O'Neill, Heather A; Wei, Xixi; Wang, Jie; Tinder, Teresa T; Tonapi, Sonal; Duncan, Janet; Hornung, Tassilo; Hunter, Andrew; Miglarese, Mark R; Schorr, Joachim; Halbert, David D; Quackenbush, John; Poste, George; Berry, Donald A; Mayer, Günter; Famulok, Michael; Spetzler, David
2017-02-20
Technologies capable of characterizing the full breadth of cellular systems need to be able to measure millions of proteins, isoforms, and complexes simultaneously. We describe an approach that fulfils this criterion: Adaptive Dynamic Artificial Poly-ligand Targeting (ADAPT). ADAPT employs an enriched library of single-stranded oligodeoxynucleotides (ssODNs) to profile complex biological samples, thus achieving an unprecedented coverage of system-wide, native biomolecules. We used ADAPT as a highly specific profiling tool that distinguishes women with or without breast cancer based on circulating exosomes in their blood. To develop ADAPT, we enriched a library of ~10 11 ssODNs for those associating with exosomes from breast cancer patients or controls. The resulting 10 6 enriched ssODNs were then profiled against plasma from independent groups of healthy and breast cancer-positive women. ssODN-mediated affinity purification and mass spectrometry identified low-abundance exosome-associated proteins and protein complexes, some with known significance in both normal homeostasis and disease. Sequencing of the recovered ssODNs provided quantitative measures that were used to build highly accurate multi-analyte signatures for patient classification. Probing plasma from 500 subjects with a smaller subset of 2000 resynthesized ssODNs stratified healthy, breast biopsy-negative, and -positive women. An AUC of 0.73 was obtained when comparing healthy donors with biopsy-positive patients.
Directory of Open Access Journals (Sweden)
I-Ju Hsieh
Full Text Available Aggressive behavior can be defined as any behavior intended to hurt another person, and it is associated with many individual and social factors. This study examined the relationship between emotional regulation and inhibitory control in predicting aggressive behavior. Seventy-eight participants (40 males completed self-report measures (Negative Mood Regulation Scale and Buss-Perry Aggression Questionnaire, a stop signal task, and engaged in a modified version of Taylor Aggression Paradigm (TAP exercise, in which the outcome was used as a measure of direct physical aggression. We used a hierarchical, mixed-model multiple regression analysis test to examine the effects of emotion regulation and inhibitory control on physical reactive aggression. Results indicated an interaction between emotion regulation and inhibitory control on aggression. For participants with low inhibitory control only, there was a significant difference between high and low emotion regulation on aggression, such that low emotion regulation participants registered higher aggression than high emotion regulation participants. This difference was not found among participants with high inhibitory control. These results have implications for refining and targeting training and rehabilitation programs aimed at reducing aggressive behavior.
Increased beta rhythm as an indicator of inhibitory mechanisms in tourette syndrome
DEFF Research Database (Denmark)
Niccolai, Valentina; van Dijk, Hanneke; Franzkowiak, Stephanie
2016-01-01
BACKGROUND: Inhibitory oscillatory mechanisms subserving tic compensation have been put forward in Tourette syndrome. Modulation of the beta rhythm (15-25 Hz) as the well-established oscillatory movement execution-inhibition indicator was tested during a cognitive-motor task in patients with Tour......BACKGROUND: Inhibitory oscillatory mechanisms subserving tic compensation have been put forward in Tourette syndrome. Modulation of the beta rhythm (15-25 Hz) as the well-established oscillatory movement execution-inhibition indicator was tested during a cognitive-motor task in patients...... in parieto-occipital brain regions contralaterally to the response hand. Average beta power and power gain correlated negatively with tic severity. CONCLUSIONS: Increased motor inhibitory as well as visuomotor attentional processes are likely to subserve tic compensation. Correlational results suggest...... that stronger inhibitory compensation accompanies less tic severity. © 2016 International Parkinson and Movement Disorder Society....
Growth inhibition of Listeria spp. on Camembert cheese by bacteria producing inhibitory substances.
Sulzer, G; Busse, M
1991-12-01
Bacterial strains exhibiting antimicrobial activity towards other bacteria are quite common in nature. During the past few years several genera have been shown to exert inhibitory action against Listeria. spp. In the present work strains of Enterococcus, Lactobacillus and Lactococcus were tested for their influence on the development of Listeria spp. on Camembert cheese. Partial or complete inhibition of growth of Listeria spp. was observed using various inhibitory bacteria. Complete inhibition occurred when the inhibitory strain was used as a starter culture and there was a low level of contamination with Listeria spp. during the first stage of ripening. Very little inhibition occurred if the inhibitory strain was added together with the starter culture.
Yasoshima, Yasunobu; Sako, Noritaka; Senba, Emiko; Yamamoto, Takashi
2006-05-02
Several lines of evidence have indicated that the establishment of long-term memory requires protein synthesis, including the synthesis of immediate-early gene products. Although the anatomical expression patterns of the c-fos gene, a transcription factor-encoding immediate-early gene, in conditioned taste aversion (CTA) are well documented, the functional roles of c-fos gene expression and Fos-mediated transcription remain to be clarified. Using the antisense oligodeoxynucleotide (AS-ODN) method in rats and gene-targeting knockout techniques in mice (c-fos(-/-) mice), we examined the roles of c-fos gene expression in the acquisition, retrieval, and retention of CTA. Preconditioning microinfusion of AS-ODN directed against c-fos mRNA (c-fos AS-ODN) into the parabrachial nucleus (PBN) impaired the acquisition, whereas infusion of control ODNs consisting of a randomized or inverted base order had no effect. Microinfusion of c-fos AS-ODN into either the amygdala or insular cortex did not impair the acquisition, whereas it attenuated the retention. Retrieval and subsequent retention of an acquired CTA were not disrupted by c-fos AS-ODN infusion into the PBN or amygdala. Microinfusion of another AS-ODN directed against zif268 (egr-1, krox-24, NGFI-A) mRNA into the PBN or amygdala did not affect the acquisition and retention. The genetic deficiency in c-fos(-/-) mice caused normal acquisition and retention. The present results suggest that the Fos-mediated gene transcription in the PBN, amygdala, or insular cortex plays critical roles in the acquisition and/or consolidation, but not the retrieval, of long-term taste memory; nevertheless, some other factors could compensate CTA mechanism when Fos-mediated transcription is not available.
Recent advances in antisense oligonucleotide therapy in genetic neuromuscular diseases
Directory of Open Access Journals (Sweden)
Ashok Verma
2018-01-01
Full Text Available Genetic neuromuscular diseases are caused by defective expression of nuclear or mitochondrial genes. Mutant genes may reduce expression of wild-type proteins, and strategies to activate expression of the wild-type proteins might provide therapeutic benefits. Also, a toxic mutant protein may cause cell death, and strategies that reduce mutant gene expression may provide therapeutic benefit. Synthetic antisense oligonucleotide (ASO can recognize cellular RNA and control gene expression. In recent years, advances in ASO chemistry, creation of designer ASO molecules to enhance their safety and target delivery, and scientific controlled clinical trials to ascertain their therapeutic safety and efficacy have led to an era of plausible application of ASO technology to treat currently incurable neuromuscular diseases. Over the past 1 year, for the first time, the United States Food and Drug Administration has approved two ASO therapies in genetic neuromuscular diseases. This overview summarizes the recent advances in ASO technology, evolution and use of synthetic ASOs as a therapeutic platform, and the mechanism of ASO action by exon-skipping in Duchenne muscular dystrophy and exon-inclusion in spinal muscular atrophy, with comments on their advantages and limitations.
Rau, Jan Erik
2011-01-01
In the present study the inhibitory substances of P. aurantia NCIMB 2052T and P. citrea NCIMB 1889T were investigated with respect to their substantial and functional nature, their inhibitory potential, their stability against various treatments as well as the growth phases and incubation conditions when the substances are produced. In addition, an inhibitory substance produced by strain Flo1 was examined regarding its structure, function, and inhibitory potential. Furthermore, its taxonomic ...
Sleep: The hebbian reinforcement of the local inhibitory synapses.
Touzet, Claude
2015-09-01
Sleep is ubiquitous among the animal realm, and represents about 30% of our lives. Despite numerous efforts, the reason behind our need for sleep is still unknown. The Theory of neuronal Cognition (TnC) proposes that sleep is the period of time during which the local inhibitory synapses (in particular the cortical ones) are replenished. Indeed, as long as the active brain stays awake, hebbian learning guarantees that efficient inhibitory synapses lose their efficiency – just because they are efficient at avoiding the activation of the targeted neurons. Since hebbian learning is the only known mechanism of synapse modification, it follows that to replenish the inhibitory synapses' efficiency, source and targeted neurons must be activated together. This is achieved by a local depolarization that may travel (wave). The period of time during which such slow waves are experienced has been named the "slow-wave sleep" (SWS). It is cut into several pieces by shorter periods of paradoxical sleep (REM) which activity resembles that of the awake state. Indeed, SWS – because it only allows local neural activation – decreases the excitatory long distance connections strength. To avoid losing the associations built during the awake state, these long distance activations are played again during the REM sleep. REM and SWS sleeps act together to guarantee that when the subject awakes again, his inhibitory synaptic efficiency is restored and his (excitatory) long distance associations are still there. Copyright © 2015 Elsevier Ltd. All rights reserved.
Sex Differences in How Erotic and Painful Stimuli Impair Inhibitory Control
Yu, Jiaxin; Hung, Daisy L.; Tseng, Philip; Tzeng, Ovid J. L.; Muggleton, Neil G.; Juan, Chi-Hung
2012-01-01
Witnessing emotional events such as arousal or pain may impair ongoing cognitive processes such as inhibitory control. We found that this may be true only half of the time. Erotic images and painful video clips were shown to men and women shortly before a stop signal task, which measures cognitive inhibitory control. These stimuli impaired…
Inhibitory coherence in a heterogeneous population of subthreshold and suprathreshold type-I neurons
International Nuclear Information System (INIS)
Kim, Sang-Yoon; Hong, Duk-Geun; Kim, Jean; Lim, Woochang
2012-01-01
We study inhibitory coherence (i.e. collective coherence by synaptic inhibition) in a population of globally coupled type-I neurons, which can fire at arbitrarily low frequency. No inhibitory coherence is observed in a homogeneous population composed of only subthreshold neurons, which exhibit noise-induced firings. In addition to subthreshold neurons, there exist spontaneously firing suprathreshold neurons in a noisy environment of a real brain. To take into consideration the effect of suprathreshold neurons on inhibitory coherence, we consider a heterogeneous population of subthreshold and suprathreshold neurons and investigate the inhibitory coherence by increasing the fraction of suprathreshold neurons P supra . As P supra passes a threshold P* supra , suprathreshold neurons begin to synchronize and play the role of coherent inhibitors for the emergence of inhibitory coherence. Thus, regularly oscillating population-averaged global potential appears for P supra > P* supra . For this coherent case, suprathreshold neurons exhibit sparse spike synchronization (i.e. individual potentials of suprathreshold neurons consist of coherent sparse spikings and coherent subthreshold small-amplitude hoppings). By virtue of their coherent inhibition, sparsely synchronized suprathreshold neurons suppress the noisy activity of subthreshold neurons. Thus, subthreshold neurons exhibit hopping synchronization (i.e. only coherent subthreshold hopping oscillations without spikings appear in the individual potentials of subthreshold neurons). We also characterize the inhibitory coherence in terms of the ‘statistical-mechanical’ spike-based and correlation-based measures, which quantify the average contributions of the microscopic individual spikes and individual potentials to the macroscopic global potential. Finally, the effect of sparse randomness of synaptic connectivity on the inhibitory coherence is briefly discussed. (paper)
Fedigan, Stephen; Bradley, Eamonn; Webb, Timothy; Large, Roddy J; Hollywood, Mark A; Thornbury, Keith D; McHale, Noel G; Sergeant, Gerard P
2017-11-01
Interstitial cells of Cajal (ICC) isolated from the rabbit urethra exhibit Ca 2+ -activated Cl - currents (I ClCa ) that are important for the development of urethral tone. Here, we examined if TMEM16A (ANO1) contributed to this activity by examining the effect of "new-generation" TMEM16A inhibitors, CACC inh -A01 and T16A inh -A01, on I ClCa recorded from freshly isolated rabbit urethral ICC (RUICC) and on contractions of intact strips of rabbit urethra smooth muscle. Real-time quantitative PCR experiments demonstrated that TMEM16A was highly expressed in rabbit urethra smooth muscle, in comparison to TMEM16B and TMEM16F. Single-cell RT-PCR experiments revealed that only TMEM16A was expressed in freshly isolated RUICC. Depolarization-evoked I ClCa in isolated RUICC, recorded using voltage clamp, were inhibited by CACC inh -A01 and T16A inh -A01 with IC 50 values of 1.2 and 3.4 μM, respectively. Similarly, spontaneous transient inward currents (STICs) recorded from RUICC voltage clamped at -60 mV and spontaneous transient depolarizations (STDs), recorded in current clamp, were also inhibited by CACC inh -A01 and T16A inh -A01. In contrast, spontaneous Ca 2+ waves in isolated RUICC were only partially reduced by CACC inh -A01 and T16A inh -A01. Finally, neurogenic contractions of strips of rabbit urethra smooth muscle (RUSM), evoked by electric field stimulation (EFS), were also significantly reduced by CACC inh -A01 and T16A inh -A01. These data are consistent with the idea that TMEM16A is involved with CACCs in RUICC and in contraction of rabbit urethral smooth muscle.
Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.
Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo
2013-11-15
We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.
Characterization of a translation inhibitory protein from Luffa aegyptiaca.
Ramakrishnan, S; Enghlid, J J; Bryant, H L; Xu, F J
1989-04-28
A protein with a molecular weight of about 30,000 was purified from the seeds of Luffa aegyptiaca. This protein inhibited cell free translation at pM concentrations. In spite of functional similarity to other ribosomal inhibitory proteins, the NH2-terminal analysis did not show any significant homology. Competitive inhibition studies indicate no immunological crossreactivity between the inhibitory protein from Luffa aegyptiaca, pokeweed antiviral protein (PAP) and recombinant ricin A chain. Chemical linkage of the protein to a monoclonal antibody reactive to transferrin receptor resulted in a highly cytotoxic conjugate.
de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk
2018-04-06
Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.
Directory of Open Access Journals (Sweden)
Tsai-Yu Wang
Full Text Available BACKGROUND: Isoniazid (INH resistance is now the most common type of tuberculosis (TB infection resistance worldwide. The aim of this study was to evaluate the clinical characteristics and treatment outcomes of patients with low- and high-concentration INH-monoresistant TB. METHODS: One hundred and thirty-four patients with culture-confirmed INH-monoresistant TB during 2006 January to 2007 December were retrospectively enrolled. INH resistance was classified as either low-concentration or high-concentration resistance according to the critical concentrations of 0.2 µg/mL or 1 µg/mL of INH, respectively. The patients' clinical outcomes, treatment regimens, and treatment duration were analyzed. RESULTS: The treatment success rates between low- and high-concentration INH-resistant TB were similar (81.8% vs. 86.7%. The treatment regimens and treatment duration were similar between both groups. Only a minor percentage of the patients in both groups received 6-month treatment regimens (low vs. high concentration resistance, 9.1% vs. 13.3%; respectively, p = 0.447 The most common reason for treatment duration longer than 6 months was pyrazinamide given for less than 6 months, followed by a delay in clinical response to treatment. Multivariable analysis showed that prior tuberculosis treatment (Odds ratio, 2.82, 95% C.I., 1.02-7.77, p = 0.045 was the only independent risk factor for unsuccessful treatment outcome. CONCLUSION: Different levels of INH resistance did not affect the treatment outcomes of patients with INH-monoresistant tuberculosis. Prolonged Rifampin-containing regimens may achieve those good outcomes in patients with low- and high-concentration INH-monoresistant TB.
Directory of Open Access Journals (Sweden)
Patama Suttha
2016-07-01
Full Text Available Background: Treatment of latent tuberculosis infection (LTBI is one of the essential measures for tuberculosis (TB control. The tuberculin skin test (TST is an important tool for the detection of LTBI and the identification of healthcare workers (HCWs who require chemoprophylaxis. Also, the rate of active TB should be evaluated among HCWs with and without isoniazid (INH prophylactic treatment for LTBI. Objective: To evaluate the rate of active TB disease among HCWs with or without INH prophylaxis for LTBI. Methods: We retrospectively studied the clinical records of HCWs with LTBI at the employee TB screening clinic in Bamrasnaradura Infectious Diseases Institute from January 2008 to December 2010. Voluntary INH prophylaxis was recommended by physicians and nurses at the TB clinic in case of recent positive 2-step TST. The rate of active TB disease in HCWs with and without INH prophylaxis for LTBI was evaluated and followed during a period of 5 years. As well, the compliance and adverse effects of INH prophylaxis were identified by history taking. Results: There were 29 from 113 HCWS (25.7% receiving INH prophylaxis for 6 months (23 HCWs and 9 months (6 HCWs. 2 HCWs in each 6- and 9-month group did not complete INH prophylaxis for LTBI. After 5 years of TST, no case of active TB disease was found in HCWS with or without INH prophylaxis. Moreover, no adverse drug reactions were reported. Conclusion: No active tuberculosis disease was noted between the INH treatment and the control groups.
Bannister, K; Lockwood, S; Goncalves, L; Patel, R; Dickenson, A H
2017-04-01
Following neuropathy α2-adrenoceptor-mediated diffuse noxious inhibitory controls (DNIC), whereby a noxious conditioning stimulus inhibits the activity of spinal wide dynamic range (WDR) neurons, are abolished, and spinal 5-HT7 receptor densities are increased. Here, we manipulate spinal 5-HT content in spinal nerve ligated (SNL) animals and investigate which 5-HT receptor mediated actions predominate. Using in vivo electrophysiology we recorded WDR neuronal responses to von frey filaments applied to the hind paw before, and concurrent to, a noxious ear pinch (the conditioning stimulus) in isoflurane-anaesthetised rats. The expression of DNIC was quantified as a reduction in WDR neuronal firing in the presence of conditioning stimulus and was investigated in SNL rats following spinal application of (1) selective serotonin reuptake inhibitors (SSRIs) citalopram or fluoxetine, or dual application of (2) SSRI plus 5-HT7 receptor antagonist SB269970, or (3) SSRI plus α2 adrenoceptor antagonist atipamezole. DNIC were revealed in SNL animals following spinal application of SSRI, but this effect was abolished upon joint application of SSRI plus SB269970 or atipamezole. We propose that in SNL animals the inhibitory actions (quantified as the presence of DNIC) of excess spinal 5-HT (presumed present following application of SSRI) were mediated via 5-HT7 receptors. The anti-nociception depends upon an underlying tonic noradrenergic inhibitory tone via the α2-adrenoceptor. Following neuropathy enhanced spinal serotonin availability switches the predominant spinal 5-HT receptor-mediated actions but also alters noradrenergic signalling. We highlight the therapeutic complexity of SSRIs and monoamine modulators for the treatment of neuropathic pain. © 2016 European Pain Federation - EFIC®.
Nano and Microtechnologies for the Delivery of Oligonucleotides with Gene Silencing Properties
Directory of Open Access Journals (Sweden)
Giuseppe De Rosa
2009-07-01
Full Text Available Oligonucleotides (ONs are synthetic fragments of nucleic acid designed to modulate the expression of target proteins. DNA-based ONs (antisense, antigene, aptamer or decoy and more recently a new class of RNA-based ONs, the small interfering RNAs (siRNAs, have gained great attention for the treatment of different disease states, such as viral infections, inflammation, diabetes, and cancer. However, the development of therapeutic strategies based on ONs is hampered by their low bioavailability, poor intracellular uptake and rapid degradation in biological fluids. The use of a non-viral carrier can be a powerful tool to overcome these drawbacks. Lipid or polymer-based nanotechnologies can improve biological stability and cellular uptake of ONs, with possibility of tissue and/or cellular targeting. The use of polymeric devices can also produce a prolonged release of the ON, thus reducing the need of frequent administrations. This review summarizes advantages and issues related to the main non-viral vectors used for ON delivery.
Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.
Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas
2016-06-17
Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.
Gbaj, A; Bichenkova, Ev; Walsh, L; Savage, He; Sardarian, Ar; Etchells, Ll; Gulati, A; Hawisa, S; Douglas, Kt
2009-12-01
The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5'-bispyrene and 3'-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5'-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.
Negin Saffarzadeh; Seyed Mehdi Kalantar; Ali Jebali; Seyed Hossein Hekmatimoghaddam; Mohammad Hassan Sheikhha; Ehsan Farashahi
2014-01-01
Objective(s): Although several chemical and physical methods for gene delivery have been introduced, their cytotoxicity, non-specific immune responses and the lack of biodegradability remain the main issues. In this study, hydroxyapatite nanoparticles (NPs) and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE)-modified hydroxyapatite NPs was coated with antisense oligonucleotide of E6 mRNA, and their uptakes into the cervical cancer cell line were evaluated. Materials and Methods: Calcium...