WorldWideScience

Sample records for inhibitor c1 inh

  1. Overview of hereditary angioedema caused by C1-inhibitor deficiency: assessment and clinical management.

    Science.gov (United States)

    Bork, K; Davis-Lorton, M

    2013-02-01

    Hereditary angioedema due to C1-inhibitor deficiency (HAE-C1-INH) is a rare, autosomal-dominant disease. HAE-C1-INH is characterized by recurrent attacks of marked, diffuse, nonpitting and nonpruritic skin swellings, painful abdominal attacks, and laryngeal edema. The extremities and the gastrointestinal tract are most commonly affected. Swelling of the upper respiratory mucosa poses the greatest risk because death from asphyxiation can result from laryngealedema. HAE-C1-INH attacks are variable, unpredictable, and may be induced by a variety of stimuli, including stress or physical trauma. Because the clinical presentation of HAE-C1-INH is similar to other types of angioedema, the condition may be a challenge to diagnose. Accurate identification of HAE-C1-INH is critical in order to avoid asphyxiation by laryngeal edema and to improve the burden of disease. Based on an understanding of the underlying pathophysiology of IHAE-C1-INH, drugs targeted specifically to the disease, such as C1-inhibitor therapy, bradykinin B2-receptor antagonists, and kallikrein-inhibitors, have become available for both treatment and prevention of angioedema attacks. This article reviews the clinical features, differential diagnosis, and current approaches to management of HAE-C1-INH.

  2. Safety of C1-Esterase Inhibitor in Acute and Prophylactic Therapy of Hereditary Angioedema

    DEFF Research Database (Denmark)

    Busse, Paula; Bygum, Anette; Edelman, Jonathan

    2014-01-01

    BACKGROUND: The plasma-derived, pasteurized C1-inhibitor (C1-INH) concentrate, Berinert has a 4-decade history of use in hereditary angioedema (HAE), with a substantial literature base that demonstrates safety and efficacy. Thromboembolic events have rarely been reported with C1-INH products......, typically with off-label use or at supratherapeutic doses. OBJECTIVES: Active surveillance of safety and clinical usage patterns of pasteurized C1-inhibitor concentrate and the more recent pasteurized, nanofiltered C1-INH, with a particular interest in thromboembolic events. METHODS: A registry...

  3. Suppression of complement regulatory protein C1 inhibitor in vascular endothelial activation by inhibiting vascular cell adhesion molecule-1 action

    International Nuclear Information System (INIS)

    Zhang, Haimou; Qin, Gangjian; Liang, Gang; Li, Jinan; Chiu, Isaac; Barrington, Robert A.; Liu, Dongxu

    2007-01-01

    Increased expression of adhesion molecules by activated endothelium is a critical feature of vascular inflammation associated with the several diseases such as endotoxin shock and sepsis/septic shock. Our data demonstrated complement regulatory protein C1 inhibitor (C1INH) prevents endothelial cell injury. We hypothesized that C1INH has the ability of an anti-endothelial activation associated with suppression of expression of adhesion molecule(s). C1INH blocked leukocyte adhesion to endothelial cell monolayer in both static assay and flow conditions. In inflammatory condition, C1INH reduced vascular cell adhesion molecule (VCAM-1) expression associated with its cytoplasmic mRNA destabilization and nuclear transcription level. Studies exploring the underlying mechanism of C1INH-mediated suppression in VCAM-1 expression were related to reduction of NF-κB activation and nuclear translocation in an IκBα-dependent manner. The inhibitory effects were associated with reduction of inhibitor IκB kinase activity and stabilization of the NF-κB inhibitor IκB. These findings indicate a novel role for C1INH in inhibition of vascular endothelial activation. These observations could provide the basis for new therapeutic application of C1INH to target inflammatory processes in different pathologic situations

  4. Elucidating the Mechanism of Gain of Toxic Function From Mutant C1 Inhibitor Proteins in Hereditary Angioedema

    Science.gov (United States)

    2017-10-01

    antibodies to 5 specifically blot wild-type C1INH in the pathologic polymers.. A FLAG tag was placed into the wild-type C1INH cDNA located immediately...resulted in decreased secretion of the 3x-FLAG-WT-C1INH when cotransfected with the mutant cDNA . This was an important confirmation of our...C1INH plus mutant C1INH cDNA in the presence or absence of a lactacystin, a proteasome inhibitor. As shown in figure 2, blocking degradation of

  5. Potentiation of C1-esterase inhibitor by heparin and interactions with C1s protease as assessed by surface plasmon resonance.

    Science.gov (United States)

    Rajabi, Mohsen; Struble, Evi; Zhou, Zhaohua; Karnaukhova, Elena

    2012-01-01

    Human C1-esterase inhibitor (C1-INH) is a multifunctional plasma protein with a wide range of inhibitory and non-inhibitory properties, mainly recognized as a key down-regulator of the complement and contact cascades. The potentiation of C1-INH by heparin and other glycosaminoglycans (GAGs) regulates a broad spectrum of C1-INH activities in vivo both in normal and disease states. SCOPE OF RESEARCH: We have studied the potentiation of human C1-INH by heparin using Surface Plasmon Resonance (SPR), circular dichroism (CD) and a functional assay. To advance a SPR for multiple-unit interaction studies of C1-INH we have developed a novel (consecutive double capture) approach exploring different immobilization and layout. Our SPR experiments conducted in three different design versions showed marked acceleration in C1-INH interactions with complement protease C1s as a result of potentiation of C1-INH by heparin (from 5- to 11-fold increase of the association rate). Far-UV CD studies suggested that heparin binding did not alter C1-INH secondary structure. Functional assay using chromogenic substrate confirmed that heparin does not affect the amidolytic activity of C1s, but does accelerate its consumption due to C1-INH potentiation. This is the first report that directly demonstrates a significant acceleration of the C1-INH interactions with C1s due to heparin by using a consecutive double capture SPR approach. The results of this study may be useful for further C-INH therapeutic development, ultimately for the enhancement of current C1-INH replacement therapies. Published by Elsevier B.V.

  6. Functional C1-inhibitor diagnostics in hereditary angioedema: assay evaluation and recommendations

    DEFF Research Database (Denmark)

    Wagenaar-Bos, Ineke G A; Drouet, Christian; Aygören-Pursun, Emel

    2008-01-01

    Hereditary angioedema (HAE) is an autosomal dominant disease characterized by recurrent episodes of potentially life-threatening angioedema. The most widespread underlying genetic deficiency is a heterozygous deficiency of the serine protease inhibitor C1 esterase inhibitor (C1-Inh). In addition ...

  7. International consensus on the diagnosis and management of pediatric patients with hereditary angioedema with C1 inhibitor deficiency.

    Science.gov (United States)

    Farkas, H; Martinez-Saguer, I; Bork, K; Bowen, T; Craig, T; Frank, M; Germenis, A E; Grumach, A S; Luczay, A; Varga, L; Zanichelli, A

    2017-02-01

    The consensus documents published to date on hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) have focused on adult patients. Many of the previous recommendations have not been adapted to pediatric patients. We intended to produce consensus recommendations for the diagnosis and management of pediatric patients with C1-INH-HAE. During an expert panel meeting that took place during the 9th C1 Inhibitor Deficiency Workshop in Budapest, 2015 (www.haenet.hu), pediatric data were presented and discussed and a consensus was developed by voting. The symptoms of C1-INH-HAE often present in childhood. Differential diagnosis can be difficult as abdominal pain is common in pediatric C1-INH-HAE, but also commonly occurs in the general pediatric population. The early onset of symptoms may predict a more severe subsequent course of the disease. Before the age of 1 year, C1-INH levels may be lower than in adults; therefore, it is advisable to confirm the diagnosis after the age of one year. All neonates/infants with an affected C1-INH-HAE family member should be screened for C1-INH deficiency. Pediatric patients should always carry a C1-INH-HAE information card and medicine for emergency use. The regulatory approval status of the drugs for prophylaxis and for acute treatment is different in each country. Plasma-derived C1-INH, recombinant C1-INH, and ecallantide are the only agents licensed for the acute treatment of pediatric patients. Clinical trials are underway with additional drugs. It is recommended to follow up patients in an HAE comprehensive care center. The pediatric-focused international consensus for the diagnosis and management of C1-INH-HAE patients was created. © 2016 The Authors. Allergy Published by John Wiley & Sons Ltd.

  8. Exposure‐Response Model of Subcutaneous C1Inhibitor Concentrate to Estimate the Risk of Attacks in Patients With Hereditary Angioedema

    Science.gov (United States)

    Tortorici, Michael A.; Pawaskar, Dipti; Pragst, Ingo; Machnig, Thomas; Hutmacher, Matthew; Zuraw, Bruce; Cicardi, Marco; Craig, Timothy; Longhurst, Hilary; Sidhu, Jagdev

    2018-01-01

    Subcutaneous C1inhibitor (HAEGARDA, CSL Behring), is a US Food and Drug Administration (FDA)‐approved, highly concentrated formulation of a plasma‐derived C1‐esterase inhibitor (C1INH), which, in the phase III Clinical Studies for Optimal Management in Preventing Angioedema with Low‐Volume Subcutaneous C1inhibitor Replacement Therapy (COMPACT) trial, reduced the incidence of hereditary angioedema (HAE) attacks when given prophylactically. Data from the COMPACT trial were used to develop a repeated time‐to‐event model to characterize the timing and frequency of HAE attacks as a function of C1INH activity, and then develop an exposure–response model to assess the relationship between C1INH functional activity levels (C1INH(f)) and the risk of an attack. The C1INH(f) values of 33.1%, 40.3%, and 63.1% were predicted to correspond with 50%, 70%, and 90% reductions in the HAE attack risk, respectively, relative to no therapy. Based on trough C1INH(f) values for the 40 IU/kg (40.2%) and 60 IU/kg (48.0%) C1INH (SC) doses, the model predicted that 50% and 67% of the population, respectively, would see at least a 70% decrease in the risk of an attack. PMID:29316335

  9. Evaluating the efficacy of subcutaneous C1-esterase inhibitor administration for use in rat models of inflammatory diseases

    NARCIS (Netherlands)

    Emmens, Reindert W.; Naaijkens, Benno A.; Roem, Dorina; Kramer, Klaas; Wouters, Diana; Zeerleder, Sacha; van Ham, Marieke S.; Niessen, Hans W.; Krijnen, Paul A.

    2014-01-01

    Context: C1-esterase inhibitor (C1-inh) therapy is currently administered to patients with C1-inh deficiency through intravenous injections. The possibility of subcutaneous administration is currently being explored since this would alleviate need for hospitalization and increase mobility and

  10. International consensus on the diagnosis and management of pediatric patients with hereditary angioedema with C1 inhibitor deficiency

    OpenAIRE

    Farkas, H.; Martinez?Saguer, I.; Bork, K.; Bowen, T.; Craig, T.; Frank, M.; Germenis, A. E.; Grumach, A. S.; Luczay, A.; Varga, L.; Zanichelli, A.; Aberer, Werner; Andrejevic, Sladjana; Aygoeren?P?rs?n, Emel; Banerji, Alena

    2016-01-01

    BACKGROUND: The consensus documents published to date on hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) have focused on adult patients. Many of the previous recommendations have not been adapted to pediatric patients. We intended to produce consensus recommendations for the diagnosis and management of pediatric patients with C1-INH-HAE.METHODS: During an expert panel meeting that took place during the 9th C1 Inhibitor Deficiency Workshop in Budapest, 2015 (www.haenet.hu), ped...

  11. Functional C1-inhibitor diagnostics in hereditary angioedema: Assay evaluation and recommendations

    NARCIS (Netherlands)

    Wagenaar-Bos, Ineke G. A.; Drouet, Christian; Aygoeren-Pursun, Emel; Bork, Konrad; Bucher, Christoph; Bygum, Anette; Farkas, Henriette; Fust, George; Gregorek, Hanna; Hack, C. Erik; Hickey, Alaco; Joller-Jemelka, Helen I.; Kapusta, Maria; Kreuz, Wolfhart; Longhurst, Hilary; Lopez-Trascasa, Margarita; Madalinski, Kazimierz; Naskalski, Jerzy; Nieuwenhuys, Ed; Ponard, Denise; Truedsson, Lennart; Varga, Lilian; Nielsen, Erik Waage; Wagner, Eric; Zingale, Lorenza; Cicardi, Marco; van Ham, S. Marieke

    2008-01-01

    Hereditary angioedema (HAE) is an autosomal dominant disease characterized by recurrent episodes of potentially life-threatening angioedema. The most widespread underlying genetic deficiency is a heterozygous deficiency of the serine protease inhibitor Cl esterase inhibitor (C1-Inh). In addition to

  12. Health-Related Quality of Life with Subcutaneous C1-Inhibitor for Prevention of Attacks of Hereditary Angioedema.

    Science.gov (United States)

    Lumry, William R; Craig, Timothy; Zuraw, Bruce; Longhurst, Hilary; Baker, James; Li, H Henry; Bernstein, Jonathan A; Anderson, John; Riedl, Marc A; Manning, Michael E; Keith, Paul K; Levy, Donald S; Caballero, Teresa; Banerji, Aleena; Gower, Richard G; Farkas, Henriette; Lawo, John-Philip; Pragst, Ingo; Machnig, Thomas; Watson, Douglas J

    2018-01-31

    Hereditary angioedema with C1-inhibitor deficiency (C1-INH-HAE) impairs health-related quality of life (HRQoL). The objective of this study was to assess HRQoL outcomes in patients self-administering subcutaneous C1-INH (C1-INH[SC]; HAEGARDA) for routine prevention of HAE attacks. Post hoc analysis of data from the placebo-controlled, crossover phase III COMPACT study (Clinical Studies for Optimal Management of Preventing Angioedema with Low-Volume Subcutaneous C1-Inhibitor Replacement Therapy). Ninety patients with C1-INH-HAE were randomized to 1 of 4 treatment sequences: C1-INH(SC) 40 or 60 IU/kg twice weekly for 16 weeks, preceded or followed by 16 weeks of twice weekly placebo injections. All HAE attacks were treated with open-label on-demand treatment as necessary. HRQoL assessments at week 14 (last visit) included the European Quality of Life-5 Dimensions Questionnaire (EQ-5D-3L), the Hospital Anxiety and Depression Scale (HADS), the Work Productivity and Activity Impairment Questionnaire (WPAI), and the Treatment Satisfaction Questionnaire for Medication (TSQM). Compared with placebo (on-demand treatment alone), treatment with twice weekly C1-INH(SC) (both doses combined) was associated with better EQ-5D visual analog scale general health, less HADS anxiety, less WPAI presenteeism, work productivity loss, and activity impairment, and greater TSQM effectiveness and overall treatment satisfaction. More patients self-reported a "good/excellent" response during routine prevention with C1-INH(SC) compared with on-demand only (placebo prophylaxis) management. For each HRQoL measure, a greater proportion of patients had a clinically meaningful improvement during C1-INH(SC) treatment compared with placebo. In patients with frequent HAE attacks, a treatment strategy of routine prevention with self-administered twice weekly C1-INH(SC) had a greater impact on improving multiple HAE-related HRQoL impairments, most notably anxiety and work productivity, compared with on

  13. C1-esterase inhibitor protects against early vein graft remodeling under arterial blood pressure.

    Science.gov (United States)

    Krijnen, Paul A J; Kupreishvili, Koba; de Vries, Margreet R; Schepers, Abbey; Stooker, Wim; Vonk, Alexander B A; Eijsman, Leon; Van Hinsbergh, Victor W M; Zeerleder, Sacha; Wouters, Diana; van Ham, Marieke; Quax, Paul H A; Niessen, Hans W M

    2012-01-01

    Arterial pressure induced vein graft injury can result in endothelial loss, accelerated atherosclerosis and vein graft failure. Inflammation, including complement activation, is assumed to play a pivotal role herein. Here, we analyzed the effects of C1-esterase inhibitor (C1inh) on early vein graft remodeling. Human saphenous vein graft segments (n=8) were perfused in vitro with autologous blood either supplemented or not with purified human C1inh at arterial pressure for 6h. The vein segments and perfusion blood were analyzed for cell damage and complement activation. In addition, the effect of purified C1inh on vein graft remodeling was analyzed in vivo in atherosclerotic C57Bl6/ApoE3 Leiden mice, wherein donor caval veins were interpositioned in the common carotid artery. Application of C1inh in the in vitro perfusion model resulted in significantly higher blood levels and significantly more depositions of C1inh in the vein wall. This coincided with a significant reduction in endothelial loss and deposition of C3d and C4d in the vein wall, especially in the circular layer, compared to vein segments perfused without supplemented C1inh. Administration of purified C1inh significantly inhibited vein graft intimal thickening in vivo in atherosclerotic C57Bl6/ApoE3 Leiden mice, wherein donor caval veins were interpositioned in the common carotid artery. C1inh significantly protects against early vein graft remodeling, including loss of endothelium and intimal thickening. These data suggest that it may be worth considering its use in patients undergoing coronary artery bypass grafting. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  14. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

    Science.gov (United States)

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

    2005-01-01

    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  15. Use of a C1 Inhibitor Concentrate in Adults ≥65 Years of Age with Hereditary Angioedema

    DEFF Research Database (Denmark)

    Bygum, Anette; Martinez-Saguer, Inmaculada; Bas, Murat

    2016-01-01

    BACKGROUND: Treatment of hereditary angioedema (HAE) in 'older adults' (those aged ≥65 years) has not been well studied. The international Berinert Patient Registry collected data on the use of intravenous plasma-derived, pasteurized, nanofiltered C1-inhibitor concentrate (pnfC1-INH; Berinert......(®)/CSL Behring) in patients of any age, including many older adults. METHODS: This observational registry, conducted from 2010 to 2014 at 30 US and seven European sites, gathered prospective (post-enrollment) and retrospective (pre-enrollment) usage and adverse event (AE) data on subjects treated with pnfC1-INH....... RESULTS: The registry documented 1701 pnfC1-INH infusions in 27 older adults. A total of 1511 HAE attacks treated with pnfC1-INH administration were reported among 25 of the 27 (92.6 %) older adults. Among the older adults, mean (standard deviation [SD]) (8.8 [4.1] IU/kg) and median (6.4 IU/kg) pnfC1-INH...

  16. Identification and Functional Characterization of Sugarcane Invertase Inhibitor (ShINH1: A Potential Candidate for Reducing Pre- and Post-harvest Loss of Sucrose in Sugarcane

    Directory of Open Access Journals (Sweden)

    Suresha G. Shivalingamurthy

    2018-05-01

    Full Text Available In sugarcane, invertase enzymes play a key role in sucrose accumulation and are also involved in futile reactions where sucrose is continuously degraded during the pre- and post-harvest period, thereby reducing sugar yield and recovery. Invertase inhibitor (INVINH proteins play a key role in post-translation regulation of plant invertases through which sucrose hydrolysis is controlled. INVINH proteins are small (18 kDa members of the pectin methylesterase inhibitor superfamily and they are moderately conserved across plants. In the present study, we identified two INVINH genes from sugarcane, ShINH1 and ShINH2. In silico characterization of the encoded proteins revealed 43% sequence identity at the amino acid level, confirming the non-allelic nature of the proteins. The presence of putative signal peptide and subcellular targeting sequences revealed that ShINH1 and ShINH2 likely have apoplasmic and vacuolar localization, respectively. Experimental visualization of ShINH1–GFP revealed that ShINHI is indeed exported to the apoplast. Differential tissue-specific and developmental expression of ShINH1 between leaf, stalk, flower and root suggest that it plays a role in controlling source-sink metabolic regulation during sucrose accumulation in sugarcane. ShINH1 is expressed at relatively high levels in leaves and stalk compared to flowers and roots, and expression decreases significantly toward internodal maturity during stalk development. ShINH1 is expressed at variable levels in flowers with no specific association to floral maturity. Production of recombinant ShINH1 enabled experimental validation of protein function under in vitro conditions. Recombinant ShINH1 potently inhibited acid invertase (IC50 22.5 nM, making it a candidate for controlling pre- and post-harvest deterioration of sucrose in sugarcane. Our results indicate that ShINH1 and ShINH2 are likely to play a regulatory role in sucrose accumulation and contribute to the improvement

  17. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology.

    Science.gov (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A

    2016-12-06

    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  18. N- and O-glycosylation Analysis of Human C1-inhibitor Reveals Extensive Mucin-type O-Glycosylation.

    Science.gov (United States)

    Stavenhagen, Kathrin; Kayili, H Mehmet; Holst, Stephanie; Koeleman, Carolien A M; Engel, Ruchira; Wouters, Diana; Zeerleder, Sacha; Salih, Bekir; Wuhrer, Manfred

    2018-06-01

    Human C1-inhibitor (C1-Inh) is a serine protease inhibitor and the major regulator of the contact activation pathway as well as the classical and lectin complement pathways. It is known to be a highly glycosylated plasma glycoprotein. However, both the structural features and biological role of C1-Inh glycosylation are largely unknown. Here, we performed for the first time an in-depth site-specific N - and O -glycosylation analysis of C1-Inh combining various mass spectrometric approaches, including C18-porous graphitized carbon (PGC)-LC-ESI-QTOF-MS/MS applying stepping-energy collision-induced dissociation (CID) and electron-transfer dissociation (ETD). Various proteases were applied, partly in combination with PNGase F and exoglycosidase treatment, in order to analyze the (glyco)peptides. The analysis revealed an extensively O -glycosylated N-terminal region. Five novel and five known O -glycosylation sites were identified, carrying mainly core1-type O -glycans. In addition, we detected a heavily O -glycosylated portion spanning from Thr 82 -Ser 121 with up to 16 O -glycans attached. Likewise, all known six N -glycosylation sites were covered and confirmed by this site-specific glycosylation analysis. The glycoforms were in accordance with results on released N -glycans by MALDI-TOF/TOF-MS/MS. The comprehensive characterization of C1-Inh glycosylation described in this study will form the basis for further functional studies on the role of these glycan modifications. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. ELISA to measure neutralizing capacity of anti-C1-inhibitor antibodies in plasma of angioedema patients

    NARCIS (Netherlands)

    Engel, Ruchira; Rensink, Irma; Roem, Dorina; Brouwer, Mieke; Kalei, Asma; Perry, Dawn; Zeerleder, Sacha; Wouters, Diana; Hamann, Dörte

    2015-01-01

    Neutralizing autoantibodies (NAbs) against plasma serpin C1-inhibitor (C1-inh) are implicated in the rare disorder, acquired angioedema (AAE). There is insufficient understanding of the process of antibody formation and its correlation with disease progression and severity. We have developed an

  20. C1-esterase inhibitor blocks T lymphocyte proliferation and cytotoxic T lymphocyte generation in vitro

    DEFF Research Database (Denmark)

    Nissen, Mogens Holst; Bregenholt, S; Nording, J A

    1998-01-01

    We have previously shown that activated C1s complement and activated T cells cleave beta2-microglobulin (beta2m) in vitro leading to the formation of desLys58 beta2m. This process can specifically be inhibited by C1-esterase inhibitor (C1-inh). Furthermore we showed that exogenously added desLys58...

  1. Safety and Usage of C1-Inhibitor in Hereditary Angioedema

    DEFF Research Database (Denmark)

    Riedl, Marc A; Bygum, Anette; Lumry, William

    2016-01-01

    , international patient registry documented widespread implementation of pnfC1-INH self-administration outside of a health care setting consistent with current HAE guidelines. These real-world data revealed pnfC1-INH usage for a variety of reasons in patients with HAE and showed a high level of safety regardless...... of this study was to describe safety and usage patterns of pnfC1-INH. METHODS: A multicenter, observational, registry was conducted between 2010 and 2014 at 30 United States and 7 European sites to obtain both prospective (occurring after enrollment) and retrospective (occurring before enrollment) safety...... and usage data on subjects receiving pnfC1-INH for any reason. RESULTS: Of 343 enrolled patients, 318 received 1 or more doses of pnfC1-INH for HAE attacks (11,848 infusions) or for prophylaxis (3142 infusions), comprising the safety population. Median dosages per infusion were 10.8 IU/kg (attack treatment...

  2. Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor

    Directory of Open Access Journals (Sweden)

    María Martínez-Hoyos

    2016-06-01

    Full Text Available Despite being one of the first antitubercular agents identified, isoniazid (INH is still the most prescribed drug for prophylaxis and tuberculosis (TB treatment and, together with rifampicin, the pillars of current chemotherapy. A high percentage of isoniazid resistance is linked to mutations in the pro-drug activating enzyme KatG, so the discovery of direct inhibitors (DI of the enoyl-ACP reductase (InhA has been pursued by many groups leading to the identification of different enzyme inhibitors, active against Mycobacterium tuberculosis (Mtb, but with poor physicochemical properties to be considered as preclinical candidates. Here, we present a series of InhA DI active against multidrug (MDR and extensively (XDR drug-resistant clinical isolates as well as in TB murine models when orally dosed that can be a promising foundation for a future treatment.

  3. Gennemgang af en ny type hereditært angioødem med normal komplement C1-inhibitor

    DEFF Research Database (Denmark)

    Okholm-Hansen, Maria Bach; Winther, Anna Hillert; Fagerberg, Christina

    2018-01-01

    Hereditary angio-oedema (HAE) is a rare, potentially fatal disease characterized by recurrent swelling of skin and mucosa. Besides HAE with quantitative (type I) or qualitative (type II) deficiency of complement C1-inhibitor (C1-INH), a new subtype of HAE is now described with normal levels of C1...

  4. C1 Inhibitor in Acute Antibody-Mediated Rejection Nonresponsive to Conventional Therapy in Kidney Transplant Recipients: A Pilot Study.

    Science.gov (United States)

    Viglietti, D; Gosset, C; Loupy, A; Deville, L; Verine, J; Zeevi, A; Glotz, D; Lefaucheur, C

    2016-05-01

    Complement inhibitors have not been thoroughly evaluated in the treatment of acute antibody-mediated rejection (ABMR). We performed a prospective, single-arm pilot study to investigate the potential effects and safety of C1 inhibitor (C1-INH) Berinert added to high-dose intravenous immunoglobulin (IVIG) for the treatment of acute ABMR that is nonresponsive to conventional therapy. Kidney recipients with nonresponsive active ABMR and acute allograft dysfunction were enrolled between April 2013 and July 2014 and received C1-INH and IVIG for 6 months (six patients). The primary end point was the change in eGFR at 6 months after inclusion (M+6). Secondary end points included the changes in histology and DSA characteristics and adverse events as evaluated at M+6. All patients showed an improvement in eGFR between inclusion and M+6: from 38.7 ± 17.9 to 45.2 ± 21.3 mL/min/1.73 m(2) (p = 0.0277). There was no change in histological features, except a decrease in the C4d deposition rate from 5/6 to 1/6 (p = 0.0455). There was a change in DSA C1q status from 6/6 to 1/6 positive (p = 0.0253). One deep venous thrombosis was observed. In a secondary analysis, C1-INH patients were compared with a similar historical control group (21 patients). C1-INH added to IVIG is safe and may improve allograft function in kidney recipients with nonresponsive acute ABMR. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  5. International consensus and practical guidelines on the gynecologic and obstetric management of female patients with hereditary angioedema caused by C1 inhibitor deficiency

    DEFF Research Database (Denmark)

    Caballero, Teresa; Farkas, Henriette; Bouillet, Laurence

    2012-01-01

    devices, and progestins can be used. Pregnancy: Attenuated androgens are contraindicated and should be discontinued before attempting conception. Plasma-derived human C1 inhibitor concentrate (pdhC1INH) is preferred for acute treatment, short-term prophylaxis, or long-term prophylaxis. Tranexamic acid...

  6. Acquisition of C1 inhibitor by Bordetella pertussis virulence associated gene 8 results in C2 and C4 consumption away from the bacterial surface.

    Science.gov (United States)

    Hovingh, Elise S; van den Broek, Bryan; Kuipers, Betsy; Pinelli, Elena; Rooijakkers, Suzan H M; Jongerius, Ilse

    2017-07-01

    Whooping cough, or pertussis, is a contagious disease of the respiratory tract that is re-emerging worldwide despite high vaccination coverage. The causative agent of this disease is the Gram-negative Bordetella pertussis. Knowledge on complement evasion strategies of this pathogen is limited. However, this is of great importance for future vaccine development as it has become apparent that a novel pertussis vaccine is needed. Here, we unravel the effect of Virulence associated gene 8 (Vag8) of B. pertussis on the human complement system at the molecular level. We show that both recombinant and endogenously secreted Vag8 inhibit complement deposition on the bacterial surface at the level of C4b. We reveal that Vag8 binding to human C1-inhibitor (C1-inh) interferes with the binding of C1-inh to C1s, C1r and MASP-2, resulting in the release of active proteases that subsequently cleave C2 and C4 away from the bacterial surface. We demonstrate that the depletion of these complement components in the bacterial surrounding and subsequent decreased deposition on B. pertussis leads to less complement-mediated bacterial killing. Vag8 is the first protein described that specifically prevents C1s, C1r and MASP-2 binding to C1-inh and thereby mediates complement consumption away from the bacterial surface. Unravelling the mechanism of this unique complement evasion strategy of B. pertussis is one of the first steps towards understanding the interactions between the first line of defense complement and B. pertussis.

  7. Acquisition of C1 inhibitor by Bordetella pertussis virulence associated gene 8 results in C2 and C4 consumption away from the bacterial surface

    Science.gov (United States)

    Hovingh, Elise S.; Kuipers, Betsy; Pinelli, Elena; Rooijakkers, Suzan H. M.

    2017-01-01

    Whooping cough, or pertussis, is a contagious disease of the respiratory tract that is re-emerging worldwide despite high vaccination coverage. The causative agent of this disease is the Gram-negative Bordetella pertussis. Knowledge on complement evasion strategies of this pathogen is limited. However, this is of great importance for future vaccine development as it has become apparent that a novel pertussis vaccine is needed. Here, we unravel the effect of Virulence associated gene 8 (Vag8) of B. pertussis on the human complement system at the molecular level. We show that both recombinant and endogenously secreted Vag8 inhibit complement deposition on the bacterial surface at the level of C4b. We reveal that Vag8 binding to human C1-inhibitor (C1-inh) interferes with the binding of C1-inh to C1s, C1r and MASP-2, resulting in the release of active proteases that subsequently cleave C2 and C4 away from the bacterial surface. We demonstrate that the depletion of these complement components in the bacterial surrounding and subsequent decreased deposition on B. pertussis leads to less complement-mediated bacterial killing. Vag8 is the first protein described that specifically prevents C1s, C1r and MASP-2 binding to C1-inh and thereby mediates complement consumption away from the bacterial surface. Unravelling the mechanism of this unique complement evasion strategy of B. pertussis is one of the first steps towards understanding the interactions between the first line of defense complement and B. pertussis. PMID:28742139

  8. Plasma-derived human C1-esterase inhibitor does not prevent mechanical ventilation-induced pulmonary complement activation in a rat model of Streptococcus pneumoniae pneumonia

    NARCIS (Netherlands)

    de Beer, F. M.; Aslami, H.; Hoeksma, J.; van Mierlo, G.; Wouters, D.; Zeerleder, S.; Roelofs, J. J. T. H.; Juffermans, N. P.; Schultz, M. J.; Lagrand, W. K.

    2014-01-01

    Mechanical ventilation has the potential to cause lung injury, and the role of complement activation herein is uncertain. We hypothesized that inhibition of the complement cascade by administration of plasma-derived human C1-esterase inhibitor (C1-INH) prevents ventilation-induced pulmonary

  9. Investigating the CYP2E1 Potential Role in the Mechanisms Behind INH/LPS-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    Hozeifa M. Hassan

    2018-03-01

    Full Text Available Tuberculosis (TB is one of the oldest infectious diseases that affected humankind and remains one of the world’s deadliest communicable diseases that could be considered as global emergency, but the discovery and development of isoniazid (INH in the 1950s paved the way to an effective single and/or combined first-line anti-TB therapy. However, administration of INH induces severe hepatic toxicity in some patients. Previously, we establish a rat model of INH hepatotoxicity utilizing the inflammatory stress theory, in which bacterial lipopolysaccharide (LPS potentially enhanced INH toxicity. These enhancing activities ranged between augmenting the inflammatory stress, oxidative stress, alteration of bile acid homeostasis, and CYP2E1 over-expression. Although pre-treatment with dexamethasone (DEX helped overcome both inflammatory and oxidative stress which ended-up in alleviation of LPS augmenting effects, but still minor toxicities were being detected, alongside with CYP2E1 over expression. This finding positively indicated the corner-stone role played by CYP2E1 in the pathogenesis of INH/LPS-induced liver damage. Therefore, we examined whether INH/LPS co-treatment with CYP2E1 inhibitor diallyl sulfide (DAS and DEX can protect against the INH/LPS-induced hepatotoxicity. Our results showed that pre-administration of both DAS and DEX caused significant reduction in serum TBA, TBil, and gamma-glutamyl transferase levels. Furthermore, the histopathological analysis showed that DAS and DEX could effectively reverse the liver lesions seen following INH/LPS treatment and protect against hepatic steatosis as indicated by absence of lipid accumulation. Pre-treatment with DAS alone could not completely block the CYP2E1 protein expression following INH/LPS treatment, as appeared in the immunoblotting and immunohistochemistry results. This is probably due to the fact that the combined enhancement activities of both INH and LPS on CYP2E1 protein expression

  10. Specific, sensitive, precise, and rapid functional chromogenic assay of activated first complement component (C1) in plasma

    DEFF Research Database (Denmark)

    Munkvad, S; Jespersen, J; Sidelmann, Johannes Jakobsen

    1990-01-01

    We present a new functional assay for the first complement component (C1) in plasma, based on its activation by inhibition of the C1-esterase inhibitor (C1-inh) when monospecific antiserum to C1-inh is added to the plasma. After maximal activation, we can determine the concentration of activated ...

  11. Refractory Abdominal Pain in a Patient with Chronic Lymphocytic Leukemia: Be Wary of Acquired Angioedema due to C1 Esterase Inhibitor Deficiency

    Directory of Open Access Journals (Sweden)

    Abdullateef Abdulkareem

    2018-01-01

    Full Text Available Acquired angioedema due to C1 inhibitor deficiency (C1INH-AAE is a rare and potentially fatal syndrome of bradykinin-mediated angioedema characterized by episodes of angioedema without urticaria. It typically manifests with nonpitting edema of the skin and edema in the gastrointestinal (GI tract mucosa or upper airway. Edema of the upper airway and tongue may lead to life-threatening asphyxiation. C1INH-AAE is typically under-diagnosed because of its rarity and its propensity to mimic more common abdominal conditions and allergic reactions. In this article, we present the case of a 62-year-old male with a history of recently diagnosed chronic lymphocytic leukemia (CLL who presented to our hospital with recurrent abdominal pain, initially suspected to have Clostridium difficile colitis and diverticulitis. He received a final diagnosis of acquired angioedema due to C1 esterase inhibitor deficiency due to concomitant symptoms of lip swelling, cutaneous nonpitting edema of his lower extremities, and complement level deficiencies. He received acute treatment with C1 esterase replacement and icatibant and was maintained on C1 esterase infusions. He also underwent chemotherapy for his underlying CLL and did not experience further recurrence of his angioedema.

  12. Usefulness of C1 Esterase Inhibitor Protein Concentrate in the ...

    African Journals Online (AJOL)

    2018-04-04

    Apr 4, 2018 ... 2018 Nigerian Journal of Clinical Practice | Published by Wolters Kluwer ‑ Medknow ... of this case report is to describe the lifesaving use of a novel C1INH protein ... edema of the upper lip, uvula, and tongue [Figure 1].

  13. Multiple receptor conformers based molecular docking study of fluorine enhanced ethionamide with mycobacterium enoyl ACP reductase (InhA).

    Science.gov (United States)

    Khan, Akib Mahmud; Shawon, Jakaria; Halim, Mohammad A

    2017-10-01

    A major limitation in current molecular docking method is that of failure to account for receptor flexibility. Herein we report multiple receptor conformers based molecular docking as a practical alternative to account for the receptor flexibility. Multiple (forty) conformers of Mycobacterium Enoyl ACP Reductase (InhA) are generated from Molecular Dynamics simulation and twenty crystallographic structures of InhA bound to different inhibitors are obtained from the Protein Data Bank. Fluorine directed modifications are performed to currently available anti-tuberculosis drug ethionamide. The modified drugs are optimized using B3LYP 6-31G (d,p) level of theory. Dipole moment, frontier orbital gap and thermodynamical properties such as electronic energy, enthalpy and Gibbs free energy of these optimized drugs are investigated. These drugs are subsequently docked against the conformers of InhA. Molecular docking against multiple InhA conformations show variation in ligand binding affinity and suggest that Ser94, Gly96, Lys165 and Ile194 amino acids play critical role on strong drug-InhA interaction. Modified drug N1 showed greater binding affinity compared to EN in most conformations. Structure of PDB ID: 2NSD and snapshot conformer at 5.5ns show most favorable binding with N1 compared to other conformers. Fluorine participates in forming fluorine bonds and contributes significantly in increasing binding affinity. Our study reveal that addition of trifluoromethyl group explicitly shows promise in improving thermodynamic properties and in enhancing hydrogen bonding and non-bonded interactions. Molecular dynamics (MD) simulation show that EN and N1 remained in the binding pocket similar to the docked pose of EN-InhA and E1-InhA complexes and also suggested that InhA binds to its inhibitor in inhibitor-induced folding manner. ADMET calculations predict modified drugs to have improved pharmacokinetic properties. Our study concludes that multiple receptor conformers based

  14. Effects of INH, DNP, 2,4-D and CMU on the photosynthetic activity of barley and maize plants

    International Nuclear Information System (INIS)

    Fernandez, J.; Prieto, M. P.

    1979-01-01

    Determinations of the rate of photosynthesis were made in barley and maize leaves treated with INH, DNP, 2,4-D or CMU. 1 ppm of the chemicals in nutritive solutions was absorbed by roots during 24 or 48 hours in both dark and light conditions. After this period, photosynthetic activity, compensation point and 14 C O 2 assimilation were determined. Results show that INH increases the rate of photosynthesis, DNP and 2,4-D do not alter it sensibly and CMU acts as a strong inhibitor of photosynthesis. Some possible applications for ths obtention of labelled compounds by biosynthesis are discussed. (Author) 87 refs

  15. International consensus on the diagnosis and management of pediatric patients with hereditary angioedema with C1 inhibitor deficiency

    DEFF Research Database (Denmark)

    Farkas, H; Martinez-Saguer, I; Bork, K

    2017-01-01

    : The symptoms of C1-INH-HAE often present in childhood. Differential diagnosis can be difficult as abdominal pain is common in pediatric C1-INH-HAE, but also commonly occurs in the general pediatric population. The early onset of symptoms may predict a more severe subsequent course of the disease. Before...

  16. Encoded library technology as a source of hits for the discovery and lead optimization of a potent and selective class of bactericidal direct inhibitors of Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas

    2014-02-27

    Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.

  17. Effects of INH, DNP, 2,4-D and CMU on the photosynthetic activity of barley and maize plants; Efecto de cuatro inhibidores metabolicos (INH, DNP, 2, 4-D y CMU) sobre la actividad fotosintetica de plantular de cebada (Hordeum vulgare L.) y Maiz (Zea mais L.)

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez, J; Prieto, M P

    1979-07-01

    Determinations of the rate of photosynthesis were made in barley and maize leaves treated with INH, DNP, 2,4-D or CMU. 1 ppm of the chemicals in nutritive solutions was absorbed by roots during 24 or 48 hours in both dark and light conditions. After this period, photosynthetic activity, compensation point and 14{sup C}O{sub 2} assimilation were determined. Results show that INH increases the rate of photosynthesis, DNP and 2,4-D do not alter it sensibly and CMU acts as a strong inhibitor of photosynthesis. Some possible applications for ths obtention of labelled compounds by biosynthesis are discussed. (Author) 87 refs.

  18. Screening of a Novel Fragment Library with Functional Complexity against Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C

    2018-04-06

    Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  19. Inhibition of cell proliferation by a selective inhibitor of the Ca{sup 2+}-activated Cl{sup -} channel, Ano1

    Energy Technology Data Exchange (ETDEWEB)

    Mazzone, Amelia; Eisenman, Seth T.; Strege, Peter R. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Yao, Zhen [Laboratory of Molecular Genetics, UCSF, San Francisco, CA (United States); Ordog, Tamas; Gibbons, Simon J. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Farrugia, Gianrico, E-mail: farrugia.gianrico@mayo.edu [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States)

    2012-10-19

    from BALB/c mice following treatment with T16A{sub inh}-A01. Proliferation of the CFPAC-1 human cell-line was also reduced by T16A{sub inh}-A01. In organotypic cultures of smooth muscle strips from mouse jejunum, the proliferation of ICC was reduced but the total number of proliferating cells/confocal stack was not affected, suggesting that the inhibitory effect was specific for ICC. Conclusions: The selective Ano1 inhibitor T16A{sub inh}-A01 inhibited Ca{sup 2+}-activated Cl{sup -} currents, reduced the number of proliferating ICC in culture and inhibited proliferation in the pancreatic cancer cell line CFPAC-1. These data support the notion that chloride channels in general and Ano1 in particular are involved in the regulation of proliferation.

  20. Surface-bound capsular polysaccharide of type Ia group B Streptococcus mediates C1 binding and activation of the classic complement pathway

    International Nuclear Information System (INIS)

    Levy, N.J.; Kasper, D.L.

    1986-01-01

    The role of surface-bound type Ia group B Streptococcus (GBS) capsular polysaccharide in anti-body-independent binding of C1 and activation of the classic component pathway was investigated. In a radiolabeled bacterial-polymorphonuclear leukocyte (PMN) association assay, a measure of bacterial opsonization, preincubation of 3 H-type Ia GBS with purified F(ab') 2 to the organism blocked the association of the bacteria with PMN', and the inhibitory effect was dose dependent. The specificity of F(ab') 2 blocking was shown after adsorption of F(ab') 2 with type Ia polysaccharide-sensitized erythrocytes. Polysaccharide-adsorbed F(ab') 2 had a 70% decrease in ability to block the association of bacteria with PMN. Neuraminidase digestion removed 80% of the terminal sialic acid residues from the native polysaccharide. These neuraminidase-digested organisms had a 72% decrease in binding and transfer of purified C1 compared with non-enzyme-treated organisms. Type Ia capsular polysaccharide bound to sheep erythrocytes promoted classic complement pathway-mediated hemolysis of the cells. The role of C1 inhibitor (INH) in modulation of C1 activation by the organisms was investigated. The possibility existed that the C1 INH could be bound by the bacteria, allowing C1 activation to occur in the fluid phase. The inhibitor was purified from human serum, and its activity was measured before and after incubation with type Ia GBS. The organisms had no effect on C1 INH activity. Thus surface-bound capsular polysacchardie of type Ia GBS mediates C1 binding and classic pathway activation, and this does not involve the C1 INH

  1. [Anaesthesic management of vaginal delivery in a parturient with C1 esterase deficiency].

    Science.gov (United States)

    Libert, N; Schérier, S; Dubost, C; Franck, L; Rouquette, I; Tortosa, J-C; Rousseau, J-M

    2009-04-01

    Hereditary and acquired angioedema (HAE/AAE) are the clinical translation of a qualitative or a quantitative deficit of C1 esterase inhibitor (C1 INH). The frequency and severity of clinical manifestations vary greatly, ranging from a moderate swelling of the extremities to obstruction of upper airway. Anaesthesiologists and intensivists must be prepared to manage acute manifestations of this disease in case of life-threatening laryngeal edema. Surgery, physical trauma and labour are classical triggers of the disease. The anaesthesiologists should be aware of the drugs used as prophylaxis and treatment of acute attacks when considering labour and caesarean section. Androgens are contraindicated during pregnancy. If prophylaxis is required, tranexamic acid may be used with caution. The safest obstetric approach appears to be to administer a predelivery infusion of C1 INH concentrate. It is important to avoid manipulation of the airway as much as possible by relying on regional techniques. We report the case of a patient suffering from an HAE discovered during pregnancy. The management included administration of C1 INH during labor and early epidural analgesia for pain relief. A short review of the pathophysiology and therapeutic options follows.

  2. [Tranexamic acid as first-line emergency treatment for episodes of bradykinin-mediated angioedema induced by ACE inhibitors].

    Science.gov (United States)

    Beauchêne, C; Martins-Héricher, J; Denis, D; Martin, L; Maillard, H

    2018-05-04

    Episodes of acquired bradykinin-mediated angioedema due to angiotensin-converting enzyme (ACE) inhibitors may result in fatal outcomes. There is no consensus regarding emergency pharmacological management of these episodes. Treatment options include icatibant and C1INH concentrate. Tranexamic acid is administered for moderate episodes. Its efficacy in the treatment of ACE inhibitor-induced episodes of angioedema is not established. The aim of this retrospective study is to assess the benefits of emergency tranexamic acid administration in the management of ACE inhibitor-induced episodes of angioedema. Retrospective analysis of the medical files of patients who consulted between 2010 and 2016 in two French tertiary care hospitals for a bradykinic angioedema attributed to an ACE treatment. All of them had received tranexamic acid as a first line treatment. Thirty three patients who had experienced severe episode of angioedema were included. Twenty seven patients showed significant improvement when treated with tranexamic acid alone. The six remaining patients were treated with icatibant (5/33) or C1INH concentrate (1/33), due to partial improvement after tranexamic acid therapy. None of the patients were intubated, no fatalities were recorded and no side effects were reported. Tranexamic acid is an easily accessible and affordable therapy that may provide effective treatment for ACE inhibitor-induced episodes of angioedema. It may help while waiting for a more specific treatment (icatibant and C1INH concentrate) that is at times unavailable in emergency departments. Copyright © 2018 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  3. Correlations of mutations in katG, oxyR-ahpC and inhA genes and in vitro susceptibility in Mycobacterium tuberculosis clinical strains segregated by spoligotype families from tuberculosis prevalent countries in South America

    Directory of Open Access Journals (Sweden)

    Suffys Philip N

    2009-02-01

    Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.

  4. Contribution of katG, ahpC and inhA mutations to the detection of isoniazid-resistant Mycobacterium tuberculosis isolates from Lebanon and Syria

    Directory of Open Access Journals (Sweden)

    F Dabboussi

    2015-01-01

    Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.

  5. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  6. Comparing acquired angioedema with hereditary angioedema (types I/II): findings from the Icatibant Outcome Survey.

    Science.gov (United States)

    Longhurst, H J; Zanichelli, A; Caballero, T; Bouillet, L; Aberer, W; Maurer, M; Fain, O; Fabien, V; Andresen, I

    2017-04-01

    Icatibant is used to treat acute hereditary angioedema with C1 inhibitor deficiency types I/II (C1-INH-HAE types I/II) and has shown promise in angioedema due to acquired C1 inhibitor deficiency (C1-INH-AAE). Data from the Icatibant Outcome Survey (IOS) were analysed to evaluate the effectiveness of icatibant in the treatment of patients with C1-INH-AAE and compare disease characteristics with those with C1-INH-HAE types I/II. Key medical history (including prior occurrence of attacks) was recorded upon IOS enrolment. Thereafter, data were recorded retrospectively at approximately 6-month intervals during patient follow-up visits. In the icatibant-treated population, 16 patients with C1-INH-AAE had 287 attacks and 415 patients with C1-INH-HAE types I/II had 2245 attacks. Patients with C1-INH-AAE versus C1-INH-HAE types I/II were more often male (69 versus 42%; P = 0·035) and had a significantly later mean (95% confidence interval) age of symptom onset [57·9 (51·33-64·53) versus 14·0 (12·70-15·26) years]. Time from symptom onset to diagnosis was significantly shorter in patients with C1-INH-AAE versus C1-INH-HAE types I/II (mean 12·3 months versus 118·1 months; P = 0·006). Patients with C1-INH-AAE showed a trend for higher occurrence of attacks involving the face (35 versus 21% of attacks; P = 0·064). Overall, angioedema attacks were more severe in patients with C1-INH-HAE types I/II versus C1-INH-AAE (61 versus 40% of attacks were classified as severe to very severe; P types I/II, respectively. © 2016 British Society for Immunology.

  7. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability.

    Science.gov (United States)

    Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A

    2017-07-05

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

  8. Fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75 interact with the CREC proteins, calumenin and reticulocalbin

    DEFF Research Database (Denmark)

    Hansen, Gry Aune Westergaard; Ludvigsen, Maja; Jacobsen, Christian

    2015-01-01

    Affinity purification, immunoprecipitation, gel electrophoresis and mass spectrometry were used to identify fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75, grp75, as binding partners of the CREC proteins, calumenin and reticulocalbin. Surface plasmon resonance was used to verify...... the interaction of all three proteins with each of the CREC proteins. Fibulin-1C interacts with calumenin and reticulocalbin with an estimated dissociation constant around 50-60 nM. The interaction, at least for reticulocalbin, was not dependent upon the presence of Ca2+. C1 esterase inhibitor interacted...

  9. Characterization of cucurbita maxima phloem serpin-1 (CmPS-1). A developmentally regulated elastase inhibitor.

    Science.gov (United States)

    Yoo, B C; Aoki, K; Xiang, Y; Campbell, L R; Hull, R J; Xoconostle-Cázares, B; Monzer, J; Lee, J Y; Ullman, D E; Lucas, W J

    2000-11-10

    We report on the molecular, biochemical, and functional characterization of Cucurbita maxima phloem serpin-1 (CmPS-1), a novel 42-kDa serine proteinase inhibitor that is developmentally regulated and has anti-elastase properties. CmPS-1 was purified to near homogeneity from C. maxima (pumpkin) phloem exudate and, based on microsequence analysis, the cDNA encoding CmPS-1 was cloned. The association rate constant (k(a)) of phloem-purified and recombinant His(6)-tagged CmPS-1 for elastase was 3.5 +/- 1.6 x 10(5) and 2.7 +/- 0.4 x 10(5) m(-)(1) s(-)(1), respectively. The fraction of complex-forming CmPS-1, X(inh), was estimated at 79%. CmPS-1 displayed no detectable inhibitory properties against chymotrypsin, trypsin, or thrombin. The elastase cleavage sites within the reactive center loop of CmPS-1 were determined to be Val(347)-Gly(348) and Val(350)-Ser(351) with a 3:2 molar ratio. In vivo feeding assays conducted with the piercing-sucking aphid, Myzus persicae, established a close correlation between the developmentally regulated increase in CmPS-1 within the phloem sap and the reduced ability of these insects to survive and reproduce on C. maxima. However, in vitro feeding experiments, using purified phloem CmPS-1, failed to demonstrate a direct effect on aphid survival. Likely roles of this novel phloem serpin in defense against insects/pathogens are discussed.

  10. In Vitro Fertilization Using Luteinizing Hormone-Releasing Hormone Injections Resulted in Healthy Triplets without Increased Attack Rates in a Hereditary Angioedema Case

    Directory of Open Access Journals (Sweden)

    Ceyda Tunakan Dalgıç

    2018-01-01

    Full Text Available Hereditary angioedema due to C1-inhibitor deficiency (C1-INH-HAE is a rare, autosomal dominant disorder. The management of pregnant patients with C1-INH-HAE is a challenge for the physician. Intravenous plasma-derived nanofiltered C1-INH (pdC1INH is the only recommended option throughout pregnancy, postpartum, and breastfeeding period. In order to increase pregnancy rates, physicians use fertilization therapies increasing endogen levels of estrogens. Therefore, these techniques can provoke an increase in the number and severity of edema attacks in C1-INH-HAE. Our patient is a 32-year-old female, diagnosed with C1-INH-HAE type 1 since 2004. She had been taking danazol 50–200 mg/day for 9 years. Due to her pregnancy plans in 2013, danazol was discontinued. PdC1INH was prescribed regularly for prophylactic purpose. Triplet pregnancy occurred by in vitro fertilization using luteinizing hormone-releasing hormone (LHRH injections. In our patient, LHRH injections were done four times without causing any severe attack during in vitro fertilization. Angioedema did not worsen during pregnancy and delivery due to the prophylactic use of intravenous pdC1INH in our patient. According to the attack frequency and severity, there was no difference between the three pregnancy trimesters. To our knowledge, this is the first published case of C1-INH-HAE receiving in vitro fertilization therapies without any angioedema attacks during pregnancy and delivery and eventually having healthy triplets with the prophylactic use of intravenous pdC1INH.

  11. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent (CNRS-UMR); (Einstein); (TAM)

    2011-08-24

    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.

  12. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis.

    Science.gov (United States)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C; Jacobs, William R; Kremer, Laurent

    2010-12-01

    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA_T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development. © 2010 Blackwell Publishing Ltd.

  13. Effects of new-generation TMEM16A inhibitors on calcium-activated chloride currents in rabbit urethral interstitial cells of Cajal.

    Science.gov (United States)

    Fedigan, Stephen; Bradley, Eamonn; Webb, Timothy; Large, Roddy J; Hollywood, Mark A; Thornbury, Keith D; McHale, Noel G; Sergeant, Gerard P

    2017-11-01

    Interstitial cells of Cajal (ICC) isolated from the rabbit urethra exhibit Ca 2+ -activated Cl - currents (I ClCa ) that are important for the development of urethral tone. Here, we examined if TMEM16A (ANO1) contributed to this activity by examining the effect of "new-generation" TMEM16A inhibitors, CACC inh -A01 and T16A inh -A01, on I ClCa recorded from freshly isolated rabbit urethral ICC (RUICC) and on contractions of intact strips of rabbit urethra smooth muscle. Real-time quantitative PCR experiments demonstrated that TMEM16A was highly expressed in rabbit urethra smooth muscle, in comparison to TMEM16B and TMEM16F. Single-cell RT-PCR experiments revealed that only TMEM16A was expressed in freshly isolated RUICC. Depolarization-evoked I ClCa in isolated RUICC, recorded using voltage clamp, were inhibited by CACC inh -A01 and T16A inh -A01 with IC 50 values of 1.2 and 3.4 μM, respectively. Similarly, spontaneous transient inward currents (STICs) recorded from RUICC voltage clamped at -60 mV and spontaneous transient depolarizations (STDs), recorded in current clamp, were also inhibited by CACC inh -A01 and T16A inh -A01. In contrast, spontaneous Ca 2+ waves in isolated RUICC were only partially reduced by CACC inh -A01 and T16A inh -A01. Finally, neurogenic contractions of strips of rabbit urethra smooth muscle (RUSM), evoked by electric field stimulation (EFS), were also significantly reduced by CACC inh -A01 and T16A inh -A01. These data are consistent with the idea that TMEM16A is involved with CACCs in RUICC and in contraction of rabbit urethral smooth muscle.

  14. The relationship between anxiety and quality of life in children with hereditary angioedema.

    Science.gov (United States)

    Kessel, Aharon; Farkas, Henriette; Kivity, Shmuel; Veszeli, Nóra; Kőhalmi, Kinga V; Engel-Yeger, Batya

    2017-11-01

    The severe life-threatening characteristics of hereditary angioedema (HAE) with C1-inhibitor deficiency (C1-INH-HAE) can affect anxiety levels among pediatric patients. This emotional burden together with the physical restrictions of C1-INH-HAE may decrease children's health-related quality of life (HRQoL). (i) To compare anxiety state and trait between children with C1-INH-HAE and healthy controls; (ii) to examine the relationship between the level of anxiety of children with C1-INH-HAE, their disease activity/affected sites and their HRQoL; and (iii) to predict the HRQoL of children with C1-INH-HAE based on their anxiety level and disease activity/affected sites METHODS: Thirty-three children with C1-INH-HAE (aged 5-18 years) and 52 healthy controls were recruited from Israel and Hungary. All children completed the State-Trait Anxiety Inventory for Children (STAIC), the Pediatric Quality of Life Inventory (Peds-QL) demographic questionnaire and a disease activity and site questionnaire . Disease activity was defined as the number of attacks in last year. Both anxiety state and trait were significantly higher among children with C1-INH-HAE as compared to the controls (44.74±10.56 vs 38.76±10.67, Panxiety state (F 56,2 =4.69, P=.001) and trait (F 56,2 =9.06, Panxiety trait was correlated with the number of angioedema-affected sites (r=.52, P=.003). The presence of HAE attacks and higher anxiety trait predicted a lower HRQoL in children with C1-INH-HAE. C1-INH-HAE children have higher anxiety trait and state, which correlate with reduced HRQoL domains. © 2017 EAACI and John Wiley and Sons A/S. Published by John Wiley and Sons Ltd.

  15. [Acquired angioedema – clinical characteristic of the patients diagnosed in 2012-2016 with acquired C1 inhibitor deficiency].

    Science.gov (United States)

    Stobiecki, Marcin; Czarnobilska, Ewa; Obtułowicz, Krystyna

    Acquired angioedema is a rare disease caused by a deficiency of C1 esterase inhibitor with recurrent swelling symptoms. It may occur in the course of lymphoproliferative disorders or autoimmune diseases. Symptoms resemble hereditary angioedema, and the only differentiating features is negative family history, late onset of symptoms and accompanying lymphoproliferative disorder. The aim of the study was to analyze the cases of acquired angioedema. The retrospective analysis of 341 patients from the registry of patients with C1 inhibitor deficiency. Results: We identified 4 patients among 119 with HAE (3.57%) diagnosed in this same period of time 2012-2016 who fulfilled the criteria of acquired edema. In two cases the primary reason of angioedema was lymphoproliferive disease, in two monoclonal gammapathy of unknown reason. We analyzed also the results of laboratory tests C4, C1 inhibitor, C1q. In all cases the face was dominated localization. After the treatment of primary lymphoproliferive disease, in two cases, we observed total remission of angioedema. Only one patient with gammapathy require treatment with C1 inhibitor during the attacks. In these case we observed both plasma deriver, and recombinant C1 inhibitor were effective.

  16. The Use of Plasma-Derived Complement C1-Esterase Inhibitor Concentrate (Berinert®) in the Treatment of Angiotensin Converting Enzyme-Inhibitor Related Angioedema

    DEFF Research Database (Denmark)

    Hermanrud, Thorbjørn; Duus, Nicolaj; Bygum, Anette

    2016-01-01

    Angioedema of the upper airways is a severe and potentially life-threatening condition. The incidence has been increasing in the past two decades, primarily due to pharmaceuticals influencing the generation or degradation of the vasoactive molecule bradykinin. Plasma-derived C1-esterase inhibitor...... concentrate is a well-established treatment option of hereditary and acquired complement C1-esterase inhibitor deficiency, which are also mediated by an increased level of bradykinin resulting in recurrent angioedema. We here present a case of severe angiotensin converting enzyme-inhibitor related angioedema...

  17. Molecular dissection of the APC/C inhibitor Rca1 shows a novel F-box-dependent function

    OpenAIRE

    Zielke, Norman; Querings, Silvia; Grosskortenhaus, Ruth; Reis, Tânia; Sprenger, Frank

    2006-01-01

    Rca1 (regulator of Cyclin A)/Emi (early mitotic inhibitor) proteins are essential inhibitors of the anaphase-promoting complex/cyclosome (APC/C). In Drosophila, Rca1 is required during G2 to prevent premature cyclin degradation by the Fizzy-related (Fzr)-dependent APC/C activity. Here, we present a structure and function analysis of Rca1 showing that a carboxy-terminal fragment is sufficient for APC/C inhibition. Rca1/Emi proteins contain a conserved F-box and interact with components of the ...

  18. Fibulin-1C, C1 Esterase Inhibitor and Glucose Regulated Protein 75 Interact with the CREC Proteins, Calumenin and Reticulocalbin.

    Directory of Open Access Journals (Sweden)

    Gry Aune Westergaard Hansen

    Full Text Available Affinity purification, immunoprecipitation, gel electrophoresis and mass spectrometry were used to identify fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75, grp75, as binding partners of the CREC proteins, calumenin and reticulocalbin. Surface plasmon resonance was used to verify the interaction of all three proteins with each of the CREC proteins. Fibulin-1C interacts with calumenin and reticulocalbin with an estimated dissociation constant around 50-60 nM. The interaction, at least for reticulocalbin, was not dependent upon the presence of Ca2+. C1 esterase inhibitor interacted with both proteins with an estimated dissociation constant at 1 μM for reticulocalbin and 150 nM for calumenin. The interaction, at least for calumenin, was dependent upon the presence of Ca2+ with strong interaction at 3.5 mM while no detectable interaction could be found at 0.1 mM. Grp75 binds with an affinity of approximately 3-7 nM with reticulocalbin as well as with calumenin. These interactions suggest functional participation of the CREC proteins in chaperone activity, cell proliferation and transformation, cellular aging, haemostasis and thrombosis as well as modulation of the complement system in fighting bacterial infection.

  19. Synthesis and crystal structure of acid indium phosphite In(H3PO3)3

    International Nuclear Information System (INIS)

    Zakharova, B.S.; Chudinova, N.N.; Ilyhkhin, A.B.

    1996-01-01

    A group of isostructural acid phosphites of trivalent metals M(H 2 PO 3 ) 3 , where M 3 =V, Fe, Ga, In, was synthesized. Crystal structure of In(H 2 PO 3 ) 3 was determined. The compound crystallizes in hexagonal syngony, a = 8.414(2), c = 7.069(2) A, V = 433.3(2) A 3 , Z = 2, sp.gr. P6 3 . In (H 2 PO 3 ) 3 structure is of frame type. 9 refs.; 3 tabs

  20. Rational Modulation of the Induced-Fit Conformational Change for Slow-Onset Inhibition in Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Lai, Cheng-Tsung; Li, Huei-Jiun; Yu, Weixuan; Shah, Sonam; Bommineni, Gopal R; Perrone, Victoria; Garcia-Diaz, Miguel; Tonge, Peter J; Simmerling, Carlos

    2015-08-04

    Slow-onset enzyme inhibitors are the subject of considerable interest as an approach to increasing the potency of pharmaceutical compounds by extending the residence time of the inhibitor on the target (the lifetime of the drug-receptor complex). However, rational modulation of residence time presents significant challenges because it requires additional mechanistic insight, such as the nature of the transition state for postbinding isomerization. Our previous work, based on X-ray crystallography, enzyme kinetics, and molecular dynamics simulation, suggested that the slow step in inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA involves a change in the conformation of the substrate binding loop from an open state in the initial enzyme-inhibitor complex to a closed state in the final enzyme-inhibitor complex. Here, we use multidimensional free energy landscapes for loop isomerization to obtain a computational model for the transition state. The results suggest that slow-onset inhibitors crowd key side chains on helices that slide past each other during isomerization, resulting in a steric clash. The landscapes become significantly flatter when residues involved in the steric clash are replaced with alanine. Importantly, this lower barrier can be increased by rational inhibitor redesign to restore the steric clash. Crystallographic studies and enzyme kinetics confirm the predicted effects on loop structure and flexibility, as well as inhibitor residence time. These loss and regain of function studies validate our mechanistic hypothesis for interactions controlling substrate binding loop isomerization, providing a platform for the future design of inhibitors with longer residence times and better in vivo potency. Similar opportunities for slow-onset inhibition via the same mechanism are identified in other pathogens.

  1. Discovery of potent 1H-imidazo[4,5-b]pyridine-based c-Met kinase inhibitors via mechanism-directed structural optimization.

    Science.gov (United States)

    An, Xiao-De; Liu, Hongyan; Xu, Zhong-Liang; Jin, Yi; Peng, Xia; Yao, Ying-Ming; Geng, Meiyu; Long, Ya-Qiu

    2015-02-01

    Starting from our previously identified novel c-Met kinase inhibitors bearing 1H-imidazo[4,5-h][1,6]naphthyridin-2(3H)-one scaffold, a global structural exploration was conducted to furnish an optimal binding motif for further development, directed by the enzyme inhibitory mechanism. First round SAR study picked two imidazonaphthyridinone frameworks with 1,8- and 3,5-disubstitution pattern as class I and class II c-Met kinase inhibitors, respectively. Further structural optimization on type II inhibitors by truncation of the imidazonaphthyridinone core and incorporation of an N-phenyl cyclopropane-1,1-dicarboxamide pharmacophore led to the discovery of novel imidazopyridine-based c-Met kinase inhibitors, displaying nanomolar enzyme inhibitory activity and improved Met kinase selectivity. More significantly, the new chemotype c-Met kinase inhibitors effectively inhibited Met phosphorylation and its downstream signaling as well as the proliferation of Met-dependent EBC-1 human lung cancer cells at submicromolar concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

    Science.gov (United States)

    Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

    2017-10-01

    Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. A case of tongue edema associated with radiation-induced ulcer with low level of C1 inhibitor activity

    International Nuclear Information System (INIS)

    Hata, Tsuyoshi; Hosoda, Masaru

    2003-01-01

    A 66-year-old man became aware of sudden swelling of the tongue with swallowing disturbance. He had a medical history of tongue cancer treated by interstitial radiotherapy and had undergone a cytological examination of an ulcer on the right side of the tongue three weeks earlier because of suspected recurrence. The cytological examination result was class I with no malignant findings. Angioneurotic edema, so-called ''Quincke's edema'', associated with radiation-induced ulcer of the tongue, was diagnosed. Tranexamic acid, d-chlorpheniramine maleate, and epinephrine were administered. After six days, the tongue edema had almost disappeared. Laboratory examination revealed a low level of C1 inhibitor activity with normal levels of CH50, C1, C3, and C4 at the time of swelling. Hereditary angioneurotic edema with absence of hereditary trait was suspected based on the sudden edema attack and low level of C1 inhibitor activity. The C1 inhibitor activity returned to normal after disappearance of the tongue edema. (author)

  4. Interaction proteins of invertase and invertase inhibitor in cold-stored potato tubers suggested a protein complex underlying post-translational regulation of invertase.

    Science.gov (United States)

    Lin, Yuan; Liu, Jun; Liu, Xun; Ou, Yongbin; Li, Meng; Zhang, Huiling; Song, Botao; Xie, Conghua

    2013-12-01

    The activity of vacuolar invertase (VI) is vital to potato cold-induced sweetening (CIS). A post-translational regulation of VI activity has been proposed which involves invertase inhibitor (VIH), but the mechanism for the interaction between VI and VIH has not been fully understood. To identify the potential partners of VI and VIH, two cDNA libraries were respectively constructed from CIS-resistant wild potato species Solanum berthaultii and CIS-sensitive potato cultivar AC035-01 for the yeast two-hybrid analysis. The StvacINV1 (one of the potato VIs) and StInvInh2B (one of the potato VIHs), previously identified to be associated with potato CIS, were used as baits to screen the two libraries. Through positive selection and sequencing, 27 potential target proteins of StvacINV1 and eight of StInvInh2B were clarified. The Kunitz-type protein inhibitors were captured by StvacINV1 in both libraries and the interaction between them was confirmed by bimolecular fluorescence complementation assay in tobacco cells, reinforcing a fundamental interaction between VI and VIH. Notably, a sucrose non-fermenting-1-related protein kinase 1 was captured by both the baits, suggesting that a protein complex could be necessary for fine turning of the invertase activity. The target proteins clarified in present research provide a route to elucidate the mechanism by which the VI activity can be subtly modulated. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  5. AMPLIFIKASI DAN IDENTIFIKASI MUTASI REGIO PROMOTER inhA PADA ISOLAT Mycobacterium tuberculosis MULTIDRUG RESISTANCE DENGAN TEKNIK POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum

    2014-10-01

    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  6. The effect of C1-esterase inhibitor in definite and suspected streptococcal toxic shock syndrome. Report of seven patients.

    Science.gov (United States)

    Fronhoffs, S; Luyken, J; Steuer, K; Hansis, M; Vetter, H; Walger, P

    2000-10-01

    To evaluate the effect of adjunctive C1-esterase inhibitor substitution therapy on clinical characteristics and outcome of patients with streptococcal toxic shock syndrome (TSS). Observational. Medizinische Poliklinik, University of Bonn, Germany. Seven patients with direct or indirect evidence of streptococcal TSS. In addition to conventional and supportive therapy, all patients received 2-3 single doses of C1-esterase inhibitor totaling 6,000-10,000 U within the first 24 h after admission. All patients developed fulminant septic shock, multiorgan failure and/or capillary leak syndrome and necrotizing fasciitis within 10-72 h following the onset of first symptoms. Between 1 and 4 days following administration of C1-esterase inhibitor, a marked shift of fluid from extravascular to intravascular compartments took place in all but one patient, accompanied by a transient intra-alveolar lung edema and rapidly decreasing need for adrenergic agents. Six of seven patients survived. These clinical observations in a small series of patients and the favorable outcome point towards a positive effect of early and high-dose administration of C1-esterase inhibitor as adjunctive therapy in streptococcal TSS. The possible mechanism involved may be the attenuation of capillary leak syndrome (CLS) via early inactivation of complement and contact systems. Controlled studies are needed to establish an improvement of the survival rates of patients with streptococcal TSS following administration of C1-esterase inhibitor.

  7. High-affinity, noninhibitory pathogenic C1 domain antibodies are present in patients with hemophilia A and inhibitors

    Science.gov (United States)

    Batsuli, Glaivy; Deng, Wei; Healey, John F.; Parker, Ernest T.; Baldwin, W. Hunter; Cox, Courtney; Nguyen, Brenda; Kahle, Joerg; Königs, Christoph; Li, Renhao; Lollar, Pete

    2016-01-01

    Inhibitor formation in hemophilia A is the most feared treatment-related complication of factor VIII (fVIII) therapy. Most inhibitor patients with hemophilia A develop antibodies against the fVIII A2 and C2 domains. Recent evidence demonstrates that the C1 domain contributes to the inhibitor response. Inhibitory anti-C1 monoclonal antibodies (mAbs) have been identified that bind to putative phospholipid and von Willebrand factor (VWF) binding epitopes and block endocytosis of fVIII by antigen presenting cells. We now demonstrate by competitive enzyme-linked immunosorbent assay and hydrogen-deuterium exchange mass spectrometry that 7 of 9 anti-human C1 mAbs tested recognize an epitope distinct from the C1 phospholipid binding site. These mAbs, designated group A, display high binding affinities for fVIII, weakly inhibit fVIII procoagulant activity, poorly inhibit fVIII binding to phospholipid, and exhibit heterogeneity with respect to blocking fVIII binding to VWF. Another mAb, designated group B, inhibits fVIII procoagulant activity, fVIII binding to VWF and phospholipid, fVIIIa incorporation into the intrinsic Xase complex, thrombin generation in plasma, and fVIII uptake by dendritic cells. Group A and B epitopes are distinct from the epitope recognized by the canonical, human-derived inhibitory anti-C1 mAb, KM33, whose epitope overlaps both groups A and B. Antibodies recognizing group A and B epitopes are present in inhibitor plasmas from patients with hemophilia A. Additionally, group A and B mAbs increase fVIII clearance and are pathogenic in a hemophilia A mouse tail snip bleeding model. Group A anti-C1 mAbs represent the first identification of pathogenic, weakly inhibitory antibodies that increase fVIII clearance. PMID:27381905

  8. Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

    DEFF Research Database (Denmark)

    Mocroft, A; Horban, A; Clumeck, N

    2006-01-01

    increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

  9. COOH-terminal substitutions in the serpin C1 inhibitor that cause loop overinsertion and subsequent multimerization

    NARCIS (Netherlands)

    Eldering, E.; Verpy, E.; Roem, D.; Meo, T.; Tosi, M.

    1995-01-01

    The region COOH-terminal to the reactive center loop is highly conserved in the serine protease inhibitor (serpin) family. We have studied the structural consequences of three substitutions (Val451-->Met, Phe455-->Ser, and Pro476-->Ser) found in this region of C1 inhibitor in patients suffering from

  10. Subcutaneous self-injections of C1 inhibitor: an effective and safe treatment in a patient with hereditary angio-oedema.

    Science.gov (United States)

    Weller, K; Krüger, R; Maurer, M; Magerl, M

    2016-01-01

    A 25-year-old woman presented to our clinic with a history of recurrent swelling and abdominal symptoms for > 20 years. The patient's father was similarly affected. The patient was diagnosed with hereditary angio-oedema (HAE) due to C1 inhibitor deficiency. This was initially managed with systemic androgens, but the symptoms of hyperandrogenism eventually became intolerable. Treatment with icatibant (an antagonist of bradykinin B2 receptors) was partially successful. We changed the therapy to prophylactic treatment with C1 inhibitor. Although the patient became completely symptom-free under this regimen, she found the repeated intravenous injections unacceptable. Therefore, we changed the route of administration to subcutaneous injections of C1 inhibitor 1000 U in 10 mL twice weekly, using a subcutaneous infusion kit. Since that time (December 2013), she has remained completely free of symptoms under this regimen. To our knowledge, this is the first report documenting the efficacy and safety of subcutaneous injections of C1 inhibitor in a patient with HAE. © 2015 British Association of Dermatologists.

  11. 2010 International consensus algorithm for the diagnosis, therapy and management of hereditary angioedema

    DEFF Research Database (Denmark)

    Bowen, Tom; Cicardi, Marco; Farkas, Henriette

    2010-01-01

    ABSTRACT: BACKGROUND: We published the Canadian 2003 International Consensus Algorithm for the Diagnosis, Therapy, and Management of Hereditary Angioedema (HAE; C1 inhibitor [C1-INH] deficiency) and updated this as Hereditary angioedema: a current state-of-the-art review: Canadian Hungarian 2007 ...

  12. Performance of the Abbott RealTime MTB RIF/INH resistance assay when used to test Mycobacterium tuberculosis specimens from Bangladesh

    Directory of Open Access Journals (Sweden)

    Kostera J

    2018-05-01

    Full Text Available Joshua Kostera, Gregor Leckie, Klara Abravaya, Hong Wang Abbott Molecular, Abbott Laboratories, Des Plaines, IL, USA Introduction: The Abbott RealTime MTB RIF/INH Resistance Assay (RT MTB RIF/INH is an assay for the detection of rifampicin (RIF- and/or isoniazid (INH-resistant Mycobacterium tuberculosis (MTB. The assay can be used to test sputum, bronchial alveolar lavage, and N-Acetyl-L-Cysteine (NALC/NaOH pellets prepared from these samples. The assay can be used in direct testing mode, or in reflex mode following a MTB positive result produced by its companion assay, Abbott RT MTB. Methods: In this study, the direct testing mode was used to test paired sputum and NALC/NaOH pellets prepared from sputum collected from Bangladesh TB patients. One hundred and thirty two paired samples were tested. Results: The RT MTB RIF/INH inhibition rate was 0%. One hundred and twenty-two paired samples had results above the assay limit of detection and were analyzed by comparing with results from phenotypic drug sensitivity testing, GeneXpert MTB/RIF (Xpert, and MTBDR plus (Hain. RT MTB RIF/INH results were in good agreement with those of GeneXpert and Hain. Conclusion: The ability of this assay to detect RIF and INH resistance may contribute to the global control of multidrug resistant tuberculosis. Keywords: tuberculosis, rifampicin, isoniazid, resistance

  13. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

    OpenAIRE

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

    2014-01-01

    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

  14. PPARα induced NOS1 phosphorylation via PI3K/Akt in guinea pig antral mucous cells: NO-enhancement in Ca(2+)-regulated exocytosis.

    Science.gov (United States)

    Tanaka, Saori; Hosogi, Shigekuni; Sawabe, Yukinori; Shimamoto, Chikao; Matsumura, Hitoshi; Inui, Toshio; Marunaka, Yoshinori; Nakahari, Takashi

    2016-01-01

    A PPARα (peroxisome proliferation activation receptor α) agonist (GW7647) activates nitric oxide synthase 1 (NOS1) to produce NO leading to cGMP accumulation in antral mucous cells. In this study, we examined how PPARα activates NOS1. The NO production stimulated by GW7647 was suppressed by inhibitors of PI3K (wortmannin) and Akt (AKT 1/2 Kinase Inhibitor, AKT-inh), although it was also suppressed by the inhibitors of PPARα (GW6471) and NOS1 (N-PLA). GW7647 enhanced the ACh (acetylcholine)-stimulated exocytosis (Ca(2+)-regulated exocytosis) mediated via NO, which was abolished by GW6471, N-PLA, wortmannin, and AKT-inh. The Western blotting revealed that GW7647 phosphorylates NOS1 via phosphorylation of PI3K/Akt in antral mucous cells. The immunofluorescence examinations demonstrated that PPARα existing with NOS1 co-localizes with PI3K and Akt in the cytoplasm of antral mucous cells. ACh alone and AACOCF3, an analogue of arachidonic acid (AA), induced the NOS1 phosphorylation via PI3K/Akt to produce NO, which was inhibited by GW6471. Since AA is a natural ligand for PPARα, ACh stimulates PPARα probably via AA. In conclusion, PPARα activates NOS1 via PI3K/Akt phosphorylation to produce NO in antral mucous cells during ACh stimulation.

  15. Solution Structure of a Novel C2-Symmetrical Bifunctional Bicyclic Inhibitor Based on SFTI-1

    International Nuclear Information System (INIS)

    Jaulent, Agnes M.; Brauer, Arnd B. E.; Matthews, Stephen J.; Leatherbarrow, Robin J.

    2005-01-01

    A novel bifunctional bicyclic inhibitor has been created that combines features both from the Bowman-Birk inhibitor (BBI) proteins, which have two distinct inhibitory sites, and from sunflower trypsin inhibitor-1 (SFTI-1), which has a compact bicyclic structure. The inhibitor was designed by fusing together a pair of reactive loops based on a sequence derived from SFTI-1 to create a backbone-cyclized disulfide-bridged 16-mer peptide. This peptide has two symmetrically spaced trypsin binding sites. Its synthesis and biological activity have been reported in a previous communication [Jaulent and Leatherbarrow, 2004, PEDS 17, 681]. In the present study we have examined the three-dimensional structure of the molecule. We find that the new inhibitor, which has a symmetrical 8-mer half-cystine CTKSIPP'I' motif repeated through a C 2 symmetry axis also shows a complete symmetry in its three-dimensional structure. Each of the two loops adopts the expected canonical conformation common to all BBIs as well as SFTI-1. We also find that the inhibitor displays a strong and unique structural identity, with a notable lack of minor conformational isomers that characterise most reactive site loop mimics examined to date as well as SFTI-1. This suggests that the presence of the additional cyclic loop acts to restrict conformational mobility and that the deliberate introduction of cyclic symmetry may offer a general route to locking the conformation of β-hairpin structures

  16. Breakthrough attacks in patients with hereditary angioedema receiving long-term prophylaxis are responsive to icatibant

    DEFF Research Database (Denmark)

    Aberer, Werner; Maurer, Marcus; Bouillet, Laurence

    2017-01-01

    BACKGROUND: Patients with hereditary angioedema (HAE) due to C1-inhibitor deficiency (C1-INH-HAE) experience recurrent attacks of cutaneous or submucosal edema that may be frequent and severe; prophylactic treatments can be prescribed to prevent attacks. However, despite the use of long-term prop...

  17. Molecular dissection of the APC/C inhibitor Rca1 shows a novel F-box-dependent function.

    Science.gov (United States)

    Zielke, Norman; Querings, Silvia; Grosskortenhaus, Ruth; Reis, Tânia; Sprenger, Frank

    2006-12-01

    Rca1 (regulator of Cyclin A)/Emi (early mitotic inhibitor) proteins are essential inhibitors of the anaphase-promoting complex/cyclosome (APC/C). In Drosophila, Rca1 is required during G2 to prevent premature cyclin degradation by the Fizzy-related (Fzr)-dependent APC/C activity. Here, we present a structure and function analysis of Rca1 showing that a carboxy-terminal fragment is sufficient for APC/C inhibition. Rca1/Emi proteins contain a conserved F-box and interact with components of the Skp-Cullin-F-box (SCF) complex. So far, no function has been ascribed to this domain. We find that the F-box of Rca1 is dispensable for APC/C-Fzr inhibition during G2. Nevertheless, we show that Rca1 has an additional function at the G1-S transition, which requires the F-box. Overexpression of Rca1 accelerates the G1-S transition in an F-box-dependent manner. Conversely, S-phase entry is delayed in cells in which endogenous Rca1 is replaced by a transgene lacking the F-box. We propose that Rca1 acts as an F-box protein in an as yet uncharacterized SCF complex, which promotes S-phase entry.

  18. Epidemiology of Non-hereditary Angioedema

    DEFF Research Database (Denmark)

    Madsen, Flemming; Attermann, Jorn; Linneberg, Allan

    2012-01-01

    The prevalence of non-hereditary angioedema was investigated in a general population sample (n = 7,931) and in a sample of Danish patients (n = 7,433) tested for deficiency of functional complement C1 esterase inhibitor protein (functional C1 INH). The general population sample (44% response rate...

  19. Experimental study of PLLA/INH slow release implant fabricated by three dimensional printing technique and drug release characteristics in vitro.

    Science.gov (United States)

    Wu, Gui; Wu, Weigang; Zheng, Qixin; Li, Jingfeng; Zhou, Jianbo; Hu, Zhilei

    2014-07-19

    Local slow release implant provided long term and stable drug release in the lesion. The objective of this study was to fabricate biodegradable slow release INH/PLLA tablet via 3 dimensional printing technique (3DP) and to compare the drug release characteristics of three different structured tablets in vitro. Three different drug delivery systems (columnar-shaped tablet (CST), doughnut-shaped tablet (DST) and multilayer doughnut-shaped tablet (MDST)) were manufactured by the three dimensional printing machine and isoniazid was loaded into the implant. Dynamic soaking method was used to study the drug release characteristics of the three implants. MTT cytotoxicity test and direct contact test were utilized to study the biocompatibility of the implant. The microstructures of the implants' surfaces were observed with electron microscope. The PLLA powder in the tablet could be excellently combined through 3DP without disintegration. Electron microscope observations showed that INH distributed evenly on the surface of the tablet in a "nest-shaped" way, while the surface of the barrier layer in the multilayer doughnut shaped tablet was compact and did not contain INH. The concentration of INH in all of the three tablets were still higher than the effective bacteriostasis concentration (Isoniazid: 0.025 ~ 0.05 μg/ml) after 30 day's release in vitro. All of the tablets showed initial burst release of the INH in the early period. Drug concentration of MDST became stable and had little fluctuation starting from the 6th day of the release. Drug concentration of DST and CST decreased gradually and the rate of decrease in concentration was faster in DST than CST. MTT cytotoxicity test and direct contact test indicated that the INH-PLLA tablet had low cytotoxicity and favorable biocompatibility. Three dimensional printing technique was a reliable technique to fabricate complicated implants. Drug release pattern in MDST was the most stable among the three implants. It was

  20. Discovery and optimization of antibacterial AccC inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Cliff C.; Shipps, Jr., Gerald W.; Yang, Zhiwei; Sun, Binyuan; Kawahata, Noriyuki; Soucy, Kyle A.; Soriano, Aileen; Orth, Peter; Xiao, Li; Mann, Paul; Black, Todd; (SPRI)

    2010-09-17

    The biotin carboxylase (AccC) is part of the multi-component bacterial acetyl coenzyme-A carboxylase (ACCase) and is essential for pathogen survival. We describe herein the affinity optimization of an initial hit to give 2-(2-chlorobenzylamino)-1-(cyclohexylmethyl)-1H-benzo[d]imidazole-5-carboxamide (1), which was identified using our proprietary Automated Ligand Identification System (ALIS). The X-ray co-crystal structure of 1 was solved and revealed several key interactions and opportunities for further optimization in the ATP site of AccC. Structure Based Drug Design (SBDD) and parallel synthetic approaches resulted in a novel series of AccC inhibitors, exemplified by (R)-2-(2-chlorobenzylamino)-1-(2,3-dihydro-1H-inden-1-yl)-1H-imidazo[4,5-b]pyridine-5-carboxamide (40). This compound is a potent and selective inhibitor of bacterial AccC with an IC{sub 50} of 20 nM and a MIC of 0.8 {micro}g/mL against a sensitized strain of Escherichia coli (HS294 E. coli).

  1. Imprinted CDKN1C is a tumor suppressor in rhabdoid tumor and activated by restoration of SMARCB1 and histone deacetylase inhibitors.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Algar

    Full Text Available SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to loss of SMARCB1, and that this hypothesis if proven could provide a biological rationale for testing epigenetic therapies in this disease. We used an inducible expression system to show that the imprinted cell cycle inhibitor CDKN1C is a downstream target for SMARCB1 and is transcriptionally activated by increased histone H3 and H4 acetylation at the promoter. We also show that CDKN1C expression induces cell cycle arrest, CDKN1C knockdown with siRNA is associated with increased proliferation, and is able to compete against the anti-proliferative effect of restored SMARCB1 expression. The histone deacetylase inhibitor (HDACi, Romidepsin, specifically restored CDKN1C expression in rhabdoid tumor cells through promoter histone H3 and H4 acetylation, recapitulating the effect of SMARCB1 on CDKNIC allelic expression, and induced cell cycle arrest in G401 and STM91-01 rhabdoid tumor cell lines. CDKN1C expression was also shown to be generally absent in clinical specimens of rhabdoid tumor, however CDKN1A and CDKN1B expression persisted. Our observations suggest that maintenance of CDKN1C expression plays a critical role in preventing rhabdoid tumor growth. Significantly, we report for the first time, parallels between the molecular pathways of SMARCB1 restoration and Romidepsin treatment, and demonstrate a biological basis for the further exploration of histone deacetylase inhibitors as relevant therapeutic reagents in the treatment of rhabdoid tumor.

  2. Molecular phylogeny of C1 inhibitor depicts two immunoglobulin-like domains fusion in fishes and ray-finned fishes specific intron insertion after separation from zebrafish

    International Nuclear Information System (INIS)

    Kumar, Abhishek; Bhandari, Anita; Sarde, Sandeep J.; Goswami, Chandan

    2014-01-01

    Highlights: • C1 inhibitors of fishes have two Ig domains fused in the N-terminal end. • Spliceosomal introns gain in two Ig domains of selected ray-finned fishes. • C1 inhibitors gene is maintained from 450 MY on the same locus. • C1 inhibitors gene is missing in frog and lampreys. • C1 inhibitors of tetrapod and fishes differ in the RCL region. - Abstract: C1 inhibitor (C1IN) is a multi-facet serine protease inhibitor in the plasma cascades, inhibiting several proteases, notably, regulates both complement and contact system activation. Despite huge advancements in the understanding of C1IN based on biochemical properties and its roles in the plasma cascades, the phylogenetic history of C1IN remains uncharacterized. To date, there is no comprehensive study illustrating the phylogenetic history of C1IN. Herein, we explored phylogenetic history of C1IN gene in vertebrates. Fishes have C1IN with two immunoglobulin like domains attached in the N-terminal region. The RCL regions of CIIN from fishes and tetrapod genomes have variations at the positions P2 and P1′. Gene structures of C1IN gene from selected ray-finned fishes varied in the Ig domain region with creation of novel intron splitting exon Im2 into Im2a and Im2b. This intron is limited to ray-finned fishes with genome size reduced below 1 Gb. Hence, we suggest that genome compaction and associated double-strand break repairs are behind this intron gain. This study reveals the evolutionary history of C1IN and confirmed that this gene remains the same locus for ∼450 MY in 52 vertebrates analysed, but it is not found in frogs and lampreys

  3. Molecular phylogeny of C1 inhibitor depicts two immunoglobulin-like domains fusion in fishes and ray-finned fishes specific intron insertion after separation from zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Abhishek, E-mail: akumar@bot.uni-kiel.de [Department of Genetics and Molecular Biology in Botany, Institute of Botany, Christian-Albrechts-University at Kiel, Kiel (Germany); Bhandari, Anita [Molecular Physiology, Zoological Institute, Christian-Albrechts-University at Kiel, Kiel (Germany); Sarde, Sandeep J. [Department of Genetics and Molecular Biology in Botany, Institute of Botany, Christian-Albrechts-University at Kiel, Kiel (Germany); Goswami, Chandan [National Institute of Science Education and Research, Bhubaneswar, Orissa (India)

    2014-07-18

    Highlights: • C1 inhibitors of fishes have two Ig domains fused in the N-terminal end. • Spliceosomal introns gain in two Ig domains of selected ray-finned fishes. • C1 inhibitors gene is maintained from 450 MY on the same locus. • C1 inhibitors gene is missing in frog and lampreys. • C1 inhibitors of tetrapod and fishes differ in the RCL region. - Abstract: C1 inhibitor (C1IN) is a multi-facet serine protease inhibitor in the plasma cascades, inhibiting several proteases, notably, regulates both complement and contact system activation. Despite huge advancements in the understanding of C1IN based on biochemical properties and its roles in the plasma cascades, the phylogenetic history of C1IN remains uncharacterized. To date, there is no comprehensive study illustrating the phylogenetic history of C1IN. Herein, we explored phylogenetic history of C1IN gene in vertebrates. Fishes have C1IN with two immunoglobulin like domains attached in the N-terminal region. The RCL regions of CIIN from fishes and tetrapod genomes have variations at the positions P2 and P1′. Gene structures of C1IN gene from selected ray-finned fishes varied in the Ig domain region with creation of novel intron splitting exon Im2 into Im2a and Im2b. This intron is limited to ray-finned fishes with genome size reduced below 1 Gb. Hence, we suggest that genome compaction and associated double-strand break repairs are behind this intron gain. This study reveals the evolutionary history of C1IN and confirmed that this gene remains the same locus for ∼450 MY in 52 vertebrates analysed, but it is not found in frogs and lampreys.

  4. Hereditary angioedema: what the gastroenterologist needs to know

    Directory of Open Access Journals (Sweden)

    Ali MA

    2014-11-01

    Full Text Available M Aamir Ali, Marie L Borum Division of Gastroenterology and Liver Diseases, George Washington University, Washington, DC, USA Abstract: Up to 93% of patients with hereditary angioedema (HAE experience recurrent abdominal pain. Many of these patients, who often present to emergency departments, primary care physicians, general surgeons, or gastroenterologists, are misdiagnosed for years and undergo unnecessary testing and surgical procedures. Making the diagnosis of HAE can be challenging because symptoms and attack locations are often inconsistent from one episode to the next. Abdominal attacks are common and can occur without other attack locations. An early, accurate diagnosis is central to managing HAE. Unexplained abdominal pain, particularly when accompanied by swelling of the face and extremities, suggests the diagnosis of HAE. A family history and radiologic imaging demonstrating edematous bowel also support an HAE diagnosis. Once HAE is suspected, C4 and C1 esterase inhibitor (C1-INH laboratory studies are usually diagnostic. Patients with HAE may benefit from recently approved specific treatments, including plasma-derived C1-INH or recombinant C1-INH, a bradykinin B2-receptor antagonist, or a kallikrein inhibitor as first-line therapy and solvent/detergent-treated or fresh frozen plasma as second-line therapy for acute episodes. Short-term or long-term prophylaxis with nanofiltered C1-INH or attenuated androgens will prevent or reduce the frequency and severity of episodes. Gastroenterologists can play a critical role in identifying and treating patients with HAE, and should have a high index of suspicion when encountering patients with recurrent, unexplained bouts of abdominal pain. Given the high rate of abdominal attacks in HAE, it is important for gastroenterologists to appropriately diagnose and promptly recognize and treat HAE, or refer patients with HAE to an allergist. Keywords: hereditary angioedema, abdominal pain, diagnosis

  5. Epidemiology of Non-hereditary Angioedema

    DEFF Research Database (Denmark)

    Madsen, Flemming; Attermann, Jørn; Linneberg, Allan

    2012-01-01

    The prevalence of non-hereditary angioedema was investigated in a general population sample (n¿=¿7,931) and in a sample of Danish patients (n¿=¿7,433) tested for deficiency of functional complement C1 esterase inhibitor protein (functional C1 INH). The general population sample (44% response rate...

  6. The novel Akt inhibitor API-1 induces c-FLIP degradation and synergizes with TRAIL to augment apoptosis independent of Akt inhibition.

    Science.gov (United States)

    Li, Bo; Ren, Hui; Yue, Ping; Chen, Mingwei; Khuri, Fadlo R; Sun, Shi-Yong

    2012-04-01

    API-1 (pyrido[2,3-d]pyrimidines) is a novel small-molecule inhibitor of Akt, which acts by binding to Akt and preventing its membrane translocation and has promising preclinical antitumor activity. In this study, we reveal a novel function of API-1 in regulation of cellular FLICE-inhibitory protein (c-FLIP) levels and TRAIL-induced apoptosis, independent of Akt inhibition. API-1 effectively induced apoptosis in tested cancer cell lines including activation of caspase-8 and caspase-9. It reduced the levels of c-FLIP without increasing the expression of death receptor 4 (DR4) or DR5. Accordingly, it synergized with TRAIL to induce apoptosis. Enforced expression of ectopic c-FLIP did not attenuate API-1-induced apoptosis but inhibited its ability to enhance TRAIL-induced apoptosis. These data indicate that downregulation of c-FLIP mediates enhancement of TRAIL-induced apoptosis by API-1 but is not sufficient for API-1-induced apoptosis. API-1-induced reduction of c-FLIP could be blocked by the proteasome inhibitor MG132. Moreover, API-1 increased c-FLIP ubiquitination and decreased c-FLIP stability. These data together suggest that API-1 downregulates c-FLIP by facilitating its ubiquitination and proteasome-mediated degradation. Because other Akt inhibitors including API-2 and MK2206 had minimal effects on reducing c-FLIP and enhancement of TRAIL-induced apoptosis, it is likely that API-1 reduces c-FLIP and enhances TRAIL-induced apoptosis independent of its Akt-inhibitory activity. 2012 AACR

  7. Inhibitors of the alpha-ketoglutarate dehydrogenase complex alter [1-13C]glucose and [U-13C]glutamate metabolism in cerebellar granule neurons.

    Science.gov (United States)

    Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula

    2006-02-15

    Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.

  8. Analytical and clinical performance characteristics of the Abbott RealTime MTB RIF/INH Resistance, an assay for the detection of rifampicin and isoniazid resistant Mycobacterium tuberculosis in pulmonary specimens.

    Science.gov (United States)

    Kostera, Joshua; Leckie, Gregor; Tang, Ning; Lampinen, John; Szostak, Magdalena; Abravaya, Klara; Wang, Hong

    2016-12-01

    Clinical management of drug-resistant tuberculosis patients continues to present significant challenges to global health. To tackle these challenges, the Abbott RealTime MTB RIF/INH Resistance assay was developed to accelerate the diagnosis of rifampicin and/or isoniazid resistant tuberculosis to within a day. This article summarizes the performance of the Abbott RealTime MTB RIF/INH Resistance assay; including reliability, analytical sensitivity, and clinical sensitivity/specificity as compared to Cepheid GeneXpert MTB/RIF version 1.0 and Hain MTBDRplus version 2.0. The limit of detection (LOD) of the Abbott RealTime MTB RIF/INH Resistance assay was determined to be 32 colony forming units/milliliter (cfu/mL) using the Mycobacterium tuberculosis (MTB) strain H37Rv cell line. For rifampicin resistance detection, the Abbott RealTime MTB RIF/INH Resistance assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Cepheid GeneXpert MTB/RIF. For isoniazid resistance detection, the assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Hain MTBDRplus. The performance data presented herein demonstrate that the Abbott RealTime MTB RIF/INH Resistance assay is a sensitive, robust, and reliable test for realtime simultaneous detection of first line anti-tuberculosis antibiotics rifampicin and isoniazid in patient specimens. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.

  9. Recent Developments of C-Aryl Glucoside SGLT2 Inhibitors.

    Science.gov (United States)

    Zhang, Yang; Liu, Zhao-Peng

    2016-01-01

    Sodium-glucose cotransporter 2 (SGLT2) is almost exclusively expressed in the proximal renal tubules. It is responsible for about 90% of the glucose reabsorption from tubular fluid. Selective inhibition of SGLT2 is expected to favor in the normalization of plasma glucose levels in T2DM patients through the prevention of renal glucose reabsorption and the promotion of glucose excretion from urine. Selective SGLT2 inhibitors have the merits to minimize the gastrointestinal side effects associated with SGLT1 inhibition, and selective SGLT2 inhibition may have a low risk of hypoglycemia. Since the C-aryl glucosides are metabolically more stable than the O-glucosides, numerous efforts have been made in the development of potent and selective C-aryl glucoside SGLT2 inhibitors, and a number of them are now used as anti-diabetes drugs in clinic or at various stages of clinical developments. Based on their structural features, in this review, these SGLT2 inhibitors are classified as three types: the phenyl/arylmethylphenyl C-glucosides, with an emphasis on the modifications on the proximal and/or the distal phenyl ring, and the spacer; the heteroarylmethylphenyl Cglucosides, with a replacement of the distal phenyl ring by a heterocycle like pyridazine, pyrimidine, thiophene and benzothiophene, thiazole, 1,3,4-thiadiazole, and triazolopyridinone; and the glucose-modified Caryl glucosides, including the glucose C-1 derived O-spiroketals, C-4 gem-difluoro analogues, C-5 and C-6 modified derivatives, dioxa-bicyclo[3.2.1]octane bridged ketals, the thioglucosides, and carbasugars. The structure-activity relationships (SARs) of each type along with their inhibitory potency against human SGLT2 and selectivity over human SGLT1 are discussed.

  10. Binding of the Inhibitor Protein IF1 to Bovine F1-ATPase

    Science.gov (United States)

    Bason, John V.; Runswick, Michael J.; Fearnley, Ian M.; Walker, John E.

    2011-01-01

    In the structure of bovine F1-ATPase inhibited with residues 1–60 of the bovine inhibitor protein IF1, the α-helical inhibitor interacts with five of the nine subunits of F1-ATPase. In order to understand the contributions of individual amino acid residues to this complex binding mode, N-terminal deletions and point mutations have been introduced, and the binding properties of each mutant inhibitor protein have been examined. The N-terminal region of IF1 destabilizes the interaction of the inhibitor with F1-ATPase and may assist in removing the inhibitor from its binding site when F1Fo-ATPase is making ATP. Binding energy is provided by hydrophobic interactions between residues in the long α-helix of IF1 and the C-terminal domains of the βDP-subunit and βTP-subunit and a salt bridge between residue E30 in the inhibitor and residue R408 in the C-terminal domain of the βDP-subunit. Several conserved charged amino acids in the long α-helix of IF1 are also required for establishing inhibitory activity, but in the final inhibited state, they are not in contact with F1-ATPase and occupy aqueous cavities in F1-ATPase. They probably participate in the pathway from the initial interaction of the inhibitor and the enzyme to the final inhibited complex observed in the structure, in which two molecules of ATP are hydrolysed and the rotor of the enzyme turns through two 120° steps. These findings contribute to the fundamental understanding of how the inhibitor functions and to the design of new inhibitors for the systematic analysis of the catalytic cycle of the enzyme. PMID:21192948

  11. Novel tetra-peptide insertion in Gag-p6 ALIX-binding motif in HIV-1 subtype C associated with protease inhibitor failure in Indian patients.

    Science.gov (United States)

    Neogi, Ujjwal; Rao, Shwetha D; Bontell, Irene; Verheyen, Jens; Rao, Vasudev R; Gore, Sagar C; Soni, Neelesh; Shet, Anita; Schülter, Eugen; Ekstrand, Maria L; Wondwossen, Amogne; Kaiser, Rolf; Madhusudhan, Mallur S; Prasad, Vinayaka R; Sonnerborg, Anders

    2014-09-24

    A novel tetra-peptide insertion was identified in Gag-p6 ALIX-binding region, which appeared in protease inhibitor failure Indian HIV-1C sequences (odds ratio=17.1, P < 0.001) but was naturally present in half of untreated Ethiopian HIV-1C sequences. The insertion is predicted to restore ALIX-mediated virus release pathway, which is lacking in HIV-1C. The clinical importance of the insertion needs to be evaluated in HIV-1C dominating regions wherein the use of protease inhibitor drugs are being scaled up.

  12. Lack of integrase inhibitors associated resistance mutations among HIV-1C isolates.

    Science.gov (United States)

    Mulu, Andargachew; Maier, Melanie; Liebert, Uwe Gerd

    2015-12-01

    Although biochemical analysis of HIV-1 integrase enzyme suggested the use of integrase inhibitors (INIs) against HIV-1C, different viral subtypes may favor different mutational pathways potentially leading to varying levels of drug resistance. Thus, the aim of this study was to search for the occurrence and natural evolution of integrase polymorphisms and/or resistance mutations in HIV-1C Ethiopian clinical isolates prior to the introduction of INIs. Plasma samples from chronically infected drug naïve patients (N = 45), of whom the PR and RT sequence was determined previously, were used to generate population based sequences of HIV-1 integrase. HIV-1 subtype was determined using the REGA HIV-1 subtyping tool. Resistance mutations were interpreted according to the Stanford HIV drug resistance database ( http://hivdb.stanford.edu ) and the updated International Antiviral Society (IAS)-USA mutation lists. Moreover, rates of polymorphisms in the current isolates were compared with South African and global HIV-1C isolates. All subjects were infected with HIV-1C concordant to the protease (PR) and reverse transcriptase (RT) regions. Neither major resistance-associated IN mutations (T66I/A/K, E92Q/G, T97A, Y143HCR, S147G, Q148H/R/K, and N155H) nor silent mutations known to change the genetic barrier were observed. Moreover, the DDE-catalytic motif (D64G/D116G/E152 K) and signature HHCC zinc-binding motifs at codon 12, 16, 40 and 43 were found to be highly conserved. However, compared to other South African subtype C isolates, the rate of polymorphism was variable at various positions. Although the sample size is small, the findings suggest that this drug class could be effective in Ethiopia and other southern African countries where HIV-1C is predominantly circulating. The data will contribute to define the importance of integrase polymorphism and to improve resistance interpretation algorithms in HIV-1C isolates.

  13. Design and synthesis of 3,3'-biscoumarin-based c-Met inhibitors.

    Science.gov (United States)

    Xu, Jimin; Ai, Jing; Liu, Sheng; Peng, Xia; Yu, Linqian; Geng, Meiyu; Nan, Fajun

    2014-06-14

    A library of biscoumarin-based c-Met inhibitors was synthesized, based on optimization of 3,3'-biscoumarin hit 3, which was identified as a non-ATP competitive inhibitor of c-Met from a diverse library of coumarin derivatives. Among these compounds, 38 and 40 not only showed potent enzyme activities with IC50 values of 107 nM and 30 nM, respectively, but also inhibited c-Met phosphorylation in BaF3/TPR-Met and EBC-1 cells.

  14. Psychometric Field Study of Hereditary Angioedema Quality of Life Questionnaire for Adults

    DEFF Research Database (Denmark)

    Prior, Nieves; Remor, Eduardo; Pérez-Fernández, Elia

    2016-01-01

    BACKGROUND: Hereditary angioedema due to C1 inhibitor deficiency (C1-INH-HAE) may affect health-related quality of life (HRQoL). A specific HRQoL questionnaire for adult patients with C1-INH-HAE, the HAE-QoL, has recently been developed in Spain. OBJECTIVE: The objective of this study...... was to perform a cross-cultural validation and psychometric study of the HAE-QoL in an international setting. METHODS: Cross-cultural adaptation of the Spanish HAE-QoL draft version and an international rating phase with experts were performed. The resultant version of the HAE-QoL, a clinical questionnaire...... with and without psychiatric and/or psychological care (median: 74 vs 103; P ≤ .001). CONCLUSIONS: The HAE-QoL, currently available in 18 languages, showed good reliability and validity evidence....

  15. Isolated angioedema of the bowel due to C1 esterase inhibitor deficiency: a case report and review of literature

    Directory of Open Access Journals (Sweden)

    Kothari Shivangi T

    2011-02-01

    Full Text Available Abstract Introduction We report a rare, classic case of isolated angioedema of the bowel due to C1-esterase inhibitor deficiency. It is a rare presentation and very few cases have been reported worldwide. Angioedema has been classified into three categories. Case presentation A 66-year-old Caucasian man presented with a ten-month history of episodic severe cramping abdominal pain, associated with loose stools. A colonoscopy performed during an acute attack revealed nonspecific colitis. Computed tomography of the abdomen performed at the same time showed a thickened small bowel and ascending colon with a moderate amount of free fluid in the abdomen. Levels of C4 ( Conclusion In addition to a detailed comprehensive medical history, laboratory data and imaging studies are required to confirm a diagnosis of angioedema due to C1 esterase inhibitor deficiency.

  16. A novel small molecule inhibitor of hepatitis C virus entry.

    Directory of Open Access Journals (Sweden)

    Carl J Baldick

    Full Text Available Small molecule inhibitors of hepatitis C virus (HCV are being developed to complement or replace treatments with pegylated interferons and ribavirin, which have poor response rates and significant side effects. Resistance to these inhibitors emerges rapidly in the clinic, suggesting that successful therapy will involve combination therapy with multiple inhibitors of different targets. The entry process of HCV into hepatocytes represents another series of potential targets for therapeutic intervention, involving viral structural proteins that have not been extensively explored due to experimental limitations. To discover HCV entry inhibitors, we utilized HCV pseudoparticles (HCVpp incorporating E1-E2 envelope proteins from a genotype 1b clinical isolate. Screening of a small molecule library identified a potent HCV-specific triazine inhibitor, EI-1. A series of HCVpp with E1-E2 sequences from various HCV isolates was used to show activity against all genotype 1a and 1b HCVpp tested, with median EC50 values of 0.134 and 0.027 µM, respectively. Time-of-addition experiments demonstrated a block in HCVpp entry, downstream of initial attachment to the cell surface, and prior to or concomitant with bafilomycin inhibition of endosomal acidification. EI-1 was equally active against cell-culture adapted HCV (HCVcc, blocking both cell-free entry and cell-to-cell transmission of virus. HCVcc with high-level resistance to EI-1 was selected by sequential passage in the presence of inhibitor, and resistance was shown to be conferred by changes to residue 719 in the carboxy-terminal transmembrane anchor region of E2, implicating this envelope protein in EI-1 susceptibility. Combinations of EI-1 with interferon, or inhibitors of NS3 or NS5A, resulted in additive to synergistic activity. These results suggest that inhibitors of HCV entry could be added to replication inhibitors and interferons already in development.

  17. Discovery of pyrazolo[1,5-a]pyrimidine-based CHK1 inhibitors: A template-based approach-Part 2

    Energy Technology Data Exchange (ETDEWEB)

    Labroli, Marc; Paruch, Kamil; Dwyer, Michael P.; Alvarez, Carmen; Keertikar, Kartik; Poker, Cory; Rossman, Randall; Duca, Jose S.; Fischmann, Thierry O.; Madison, Vincent; Parry, David; Davis, Nicole; Seghezzi, Wolfgang; Wiswell, Derek; Guzi, Timothy J. [Merck

    2013-11-20

    Previous efforts by our group have established pyrazolo[1,5-a]pyrimidine as a viable core for the development of potent and selective CDK inhibitors. As part of an effort to utilize the pyrazolo[1,5-a]pyrimidine core as a template for the design and synthesis of potent and selective kinase inhibitors, we focused on a key regulator in the cell cycle progression, CHK1. Continued SAR development of the pyrazolo[1,5-a]pyrimidine core at the C5 and C6 positions, in conjunction with previously disclosed SAR at the C3 and C7 positions, led to the discovery of potent and selective CHK1 inhibitors.

  18. Protein C Inhibitor-A Novel Antimicrobial Agent

    NARCIS (Netherlands)

    Malmström, E.; Mörgelin, M.; Malmsten, M.; Johansson, L.; Norrby-Teglund, A.; Shannon, O.; Schmidtchen, A.; Meijers, J.C.M.; Herwald, H.

    2009-01-01

    Protein C inhibitor (PCI) is a heparin-binding serine proteinase inhibitor belonging to the family of serpin proteins. Here we describe that PCI exerts broad antimicrobial activity against bacterial pathogens. This ability is mediated by the interaction of PCI with lipid membranes, which

  19. Multimerized CHR-derived peptides as HIV-1 fusion inhibitors.

    Science.gov (United States)

    Nomura, Wataru; Hashimoto, Chie; Suzuki, Takaharu; Ohashi, Nami; Fujino, Masayuki; Murakami, Tsutomu; Yamamoto, Naoki; Tamamura, Hirokazu

    2013-08-01

    To date, several HIV-1 fusion inhibitors based on the carboxy-terminal leucine/isoleucine heptad repeat (CHR) region of an HIV-1 envelope protein gp41 have been discovered. We have shown that a synthetic peptide mimetic of a trimer form of the CHR-derived peptide C34 has potent inhibitory activity against the HIV-1 fusion mechanism, compared to a monomer C34 peptide. The present study revealed that a dimeric form of C34 is evidently structurally critical for fusion inhibitors, and that the activity of multimerized CHR-derived peptides in fusion inhibition is affected by the properties of the unit peptides C34, SC34EK, and T20. The fluorescence-based study suggested that the N36-interactive sites of the C34 trimer, including hydrophobic residues, are exposed outside the trimer and that trimerization of C34 caused a remarkable increase in fusion inhibitory activity. The present results could be useful in the design of fusion inhibitors against viral infections which proceed via membrane fusion with host cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Dual mTORC1/C2 inhibitors suppress cellular geroconversion (a senescence program).

    Science.gov (United States)

    Leontieva, Olga V; Demidenko, Zoya N; Blagosklonny, Mikhail V

    2015-09-15

    In proliferating cells, mTOR is active and promotes cell growth. When the cell cycle is arrested, then mTOR converts reversible arrest to senescence (geroconversion). Rapamycin and other rapalogs suppress geroconversion, maintaining quiescence instead. Here we showed that ATP-competitive kinase inhibitors (Torin1 and PP242), which inhibit both mTORC1 and TORC2, also suppressed geroconversion. Despite inhibition of proliferation (in proliferating cells), mTOR inhibitors preserved re-proliferative potential (RP) in arrested cells. In p21-arrested cells, Torin 1 and PP242 detectably suppressed geroconversion at concentrations as low as 1-3 nM and 10-30 nM, reaching maximal gerosuppression at 30 nM and 300 nM, respectively. Near-maximal gerosuppression coincided with inhibition of p-S6K(T389) and p-S6(S235/236). Dual mTOR inhibitors prevented senescent morphology and hypertrophy. Our study warrants investigation into whether low doses of dual mTOR inhibitors will prolong animal life span and delay age-related diseases. A new class of potential anti-aging drugs can be envisioned.

  1. The Complex Interaction Between Polycystic Ovary Syndrome and Hereditary Angioedema: Case Reports and Review of the Literature.

    Science.gov (United States)

    Iahn-Aun, Marina; Aun, Marcelo Vivolo; Motta, Antonio Abílio; Kalil, Jorge; Giavina-Bianchi, Pedro; Hayashida, Sylvia Asaka; Baracat, Edmund Chada; Maciel, Gustavo Arantes

    2017-07-01

    Hereditary angioedema (HAE) is a rare but severe disease, with high risk of death, and attacks have been associated to high estrogen levels. Polycystic ovary syndrome (PCOS) is a common hyperandrogenic condition, which is frequently treated with combined oral contraceptives. The aim of this study was to describe 2 clinical cases of young women diagnosed as having PCOS who developed HAE attacks after the introduction of combined estrogen-progestin pills to treat PCOS symptoms. Literature review of sex hormones' role in genesis of HAE attacks and possible mechanisms involved. In the cases reported, after initiation of combined contraceptives, patients presented with facial swelling with airway involvement (laryngeal edema) and abdominal pain. They had a familial history of angioedema and normal C1 inhibitor (C1-INH) levels, leading to the diagnosis of HAE with normal C1-INH (HAEnC1-INH) or HAE type III. After suspension of exogenous estrogen, patients remained asymptomatic from HAE. HAEnC1-INH is an estrogen-dependent form of HAE. It is well established that exogenous estrogen triggers attacks of all types of HAE. However, this is the first description of the association between PCOS and HAE, in which PCOS could be masking HAE symptoms. We propose that PCOS might have a protective role regarding HAE attacks, because of its particular hormonal features, that is, hyperandrogenism and relative stable levels of estradiol. The use of combined estrogen-progestin compounds in women with PCOS and HAE must be avoided, and treatment must be individualized.

  2. Kininogen Cleavage Assay: Diagnostic Assistance for Kinin-Mediated Angioedema Conditions.

    Directory of Open Access Journals (Sweden)

    Rémi Baroso

    Full Text Available Angioedema without wheals (AE is a symptom characterised by localised episodes of oedema presumably caused by kinin release from kininogen cleavage. It can result from a hereditary deficiency in C1 Inhibitor (C1Inh, but it can present with normal level of C1Inh. These forms are typically difficult to diagnose although enhanced kinin production is suspected or demonstrated in some cases.We wanted to investigate bradykinin overproduction in all AE condition with normal C1Inh, excluding cases with enhanced kinin catabolism, and to propose this parameter as a disease biomarker.We retrospectively investigated high molecular weight kininogen (HK cleavage pattern, using gel electrophoresis and immunorevelation. Plasma samples were drawn using the same standardised procedure from blood donors or AE patients with normal C1Inh conditions, normal kinin catabolism, and without prophylaxis.Circulating native HK plasma concentrations were similar in the healthy men (interquartile range: 98-175μg/mL, n = 51 and in healthy women (90-176μg/mL, n = 74, while HK cleavage was lower (p14.4% HK cleavage for men; 33.0% HK cleavage for women, with >98% specificity achieved for all parameters. In plasma from patients undergoing recovery two months after oestrogen/progestin combination withdrawal (n = 13 or two weeks after AE attack (n = 2, HK cleavage was not fully restored, suggesting its use as a post-attack assay.As a diagnostic tool, HK cleavage can offer physicians supportive arguments for kinin production in suspected AE cases and improve patient follow-up in clinical trials or prophylactic management.

  3. [Determination of drug resistance mutations of NS3 inhibitors in chronic hepatitis C patients infected with genotype 1].

    Science.gov (United States)

    Şanlıdağ, Tamer; Sayan, Murat; Akçalı, Sinem; Kasap, Elmas; Buran, Tahir; Arıkan, Ayşe

    2017-04-01

    Direct-acting antiviral agents (DAA) such as NS3 protease inhibitors is the first class of drugs used for chronic hepatitis C (CHC) treatment. NS3 inhibitors (PI) with low genetic barrier have been approved to be used in the CHC genotype 1 infections, and in the treatment of compensated liver disease including cirrhosis together with pegile interferon and ribavirin. Consequently, the development of drug resistance during DAA treatment of CHC is a major problem. NS3 resistant variants can be detected before treatment as they can occurnaturally. The aim of this study was to investigate new and old generation NS3 inhibitors resistance mutations before DAA treatment in hepatitis C virus (HCV) that were isolated from CHC. The present study was conducted in 2015 and included 97 naive DAA patients infected with HCV genotype 1, who were diagnosed in Manisa and Kocaeli cities of Turkey. Magnetic particle based HCV RNA extraction and than RNA detection and quantification were performed using commercial real-time PCR assay QIASypmhony + Rotorgene Q/ArtusHCV QS-RGQ and COBAS Ampliprep/COBAS TaqMan HCV Tests. HCV NS3 viral protease genome region was amplified with PCR and mutation analysis was performed by Sanger dideoxy sequencing technique of NS3 protease codons (codon 32-185). HCV NS3 protease inhibitors; asunaprevir, boceprevir, faldaprevir, grazoprevir, pariteprevir, simeprevir and telaprevir were analysed for resistant mutations by Geno2pheno-HCV resistance tool. HCV was genotyped in all patients and 88 patients (n= 88/97, 91%) had genotype 1. Eight (n= 8/97, 8.2%) and 80 (n= 80/97, 82.4%) HCC patients were subgenotyped as 1a and 1b, respectively. Many aminoacid substitutions and resistance mutations were determined in 39/88 (44%) patients in the study group. Q80L, S122C/N, S138W were defined as potential substitutions (6/88 patients; 7%); R109K, R117C, S122G, I132V, I170V, N174S were described as potential resistance (34/88 patients; 39%); V36L, T54S, V55A, Q80H were

  4. Role of gemfibrozil as an inhibitor of CYP2C8 and membrane transporters.

    Science.gov (United States)

    Tornio, Aleksi; Neuvonen, Pertti J; Niemi, Mikko; Backman, Janne T

    2017-01-01

    Cytochrome P450 (CYP) 2C8 is a drug metabolizing enzyme of major importance. The lipid-lowering drug gemfibrozil has been identified as a strong inhibitor of CYP2C8 in vivo. This effect is due to mechanism-based inhibition of CYP2C8 by gemfibrozil 1-O-β-glucuronide. In vivo, gemfibrozil is a fairly selective CYP2C8 inhibitor, which lacks significant inhibitory effect on other CYP enzymes. Gemfibrozil can, however, have a smaller but clinically meaningful inhibitory effect on membrane transporters, such as organic anion transporting polypeptide 1B1 and organic anion transporter 3. Areas covered: This review describes the inhibitory effects of gemfibrozil on CYP enzymes and membrane transporters. The clinical drug interactions caused by gemfibrozil and the different mechanisms contributing to the interactions are reviewed in detail. Expert opinion: Gemfibrozil is a useful probe inhibitor of CYP2C8 in vivo, but its effect on membrane transporters has to be taken into account in study design and interpretation. Moreover, gemfibrozil could be used to boost the pharmacokinetics of CYP2C8 substrate drugs. Identification of gemfibrozil 1-O-β-glucuronide as a potent mechanism-based inhibitor of CYP2C8 has led to recognition of glucuronide metabolites as perpetrators of drug-drug interactions. Recently, also acyl glucuronide metabolites of clopidogrel and deleobuvir have been shown to strongly inhibit CYP2C8.

  5. Synthesis and structure-activity relationship of α-keto amides as enterovirus 71 3C protease inhibitors.

    Science.gov (United States)

    Zeng, Debin; Ma, Yuying; Zhang, Rui; Nie, Quandeng; Cui, Zhengjie; Wang, Yaxin; Shang, Luqing; Yin, Zheng

    2016-04-01

    α-Keto amide derivatives as enterovirus 71 (EV71) 3C protease (3C(pro)) inhibitors have been synthesized and assayed for their biochemical and antiviral activities. structure-activity relationship (SAR) study indicated that small moieties were primarily tolerated at P1' and the introduction of para-fluoro benzyl at P2 notably improved the potency of inhibitor. Inhibitors 8v, 8w and 8x exhibited satisfactory activity (IC50=1.32±0.26μM, 1.88±0.35μM and 1.52±0.31μM, respectively) and favorable CC50 values (CC50>100μM). α-Keto amide may represent a good choice as a warhead for EV71 3C(pro) inhibitor. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Inhibitors of HIV-1 maturation: Development of structure-activity relationship for C-28 amides based on C-3 benzoic acid-modified triterpenoids.

    Science.gov (United States)

    Swidorski, Jacob J; Liu, Zheng; Sit, Sing-Yuen; Chen, Jie; Chen, Yan; Sin, Ny; Venables, Brian L; Parker, Dawn D; Nowicka-Sans, Beata; Terry, Brian J; Protack, Tricia; Rahematpura, Sandhya; Hanumegowda, Umesh; Jenkins, Susan; Krystal, Mark; Dicker, Ira B; Meanwell, Nicholas A; Regueiro-Ren, Alicia

    2016-04-15

    We have recently reported on the discovery of a C-3 benzoic acid (1) as a suitable replacement for the dimethyl succinate side chain of bevirimat (2), an HIV-1 maturation inhibitor that reached Phase II clinical trials before being discontinued. Recent SAR studies aimed at improving the antiviral properties of 2 have shown that the benzoic acid moiety conferred topographical constraint to the pharmacophore and was associated with a lower shift in potency in the presence of human serum albumin. In this manuscript, we describe efforts to improve the polymorphic coverage of the C-3 benzoic acid chemotype through modifications at the C-28 position of the triterpenoid core. The dimethylaminoethyl amides 17 and 23 delivered improved potency toward bevirimat-resistant viruses while increasing C24 in rat oral PK studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Discovery of amido-benzisoxazoles as potent c-Kit inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Kunz, Roxanne K.; Rumfelt, Shannon; Chen, Ning; Zhang, Dawei; Tasker, Andrew S.; Bürli, Roland; Hungate, Randall; Yu, Violeta; Nguyen, Yen; Whittington, Douglas A.; Meagher, Kristin L.; Plant, Matthew; Tudor, Yanyan; Schrag, Michael; Xu, Yang; Ng, Gordon Y.; Hu, Essa (Amgen)

    2010-01-12

    Deregulation of the receptor tyrosine kinase c-Kit is associated with an increasing number of human diseases, including certain cancers and mast cell diseases. Interference of c-Kit signaling with multi-kinase inhibitors has been shown clinically to successfully treat gastrointestinal stromal tumors and mastocytosis. Targeted therapy of c-Kit activity may provide therapeutic advantages against off-target effects for non-oncology applications. A new structural class of c-Kit inhibitors is described, including in vitro c-Kit potency, kinase selectivity, and the observed binding mode.

  8. Pathophysiological roles of aldo-keto reductases (AKR1C1 and AKR1C3) in development of cisplatin resistance in human colon cancers.

    Science.gov (United States)

    Matsunaga, Toshiyuki; Hojo, Aki; Yamane, Yumi; Endo, Satoshi; El-Kabbani, Ossama; Hara, Akira

    2013-02-25

    Cisplatin (cis-diamminedichloroplatinum, CDDP) is widely used for treatment of patients with solid tumors formed in various organs including the lung, prostate and cervix, but is much less sensitive in colon and breast cancers. One major factor implicated in the ineffectiveness has been suggested to be acquisition of the CDDP resistance. Here, we established the CDDP-resistant phenotypes of human colon HCT15 cells by continuously exposing them to incremental concentrations of the drug, and monitored expressions of aldo-keto reductases (AKRs) 1A1, 1B1, 1B10, 1C1, 1C2 and 1C3. Among the six AKRs, AKR1C1 and AKR1C3 are highly induced with the CDDP resistance. The resistance lowered the sensitivity toward cellular damages evoked by oxidative stress-derived aldehydes, 4-hydroxy-2-nonenal and 4-oxo-2-nonenal that are detoxified by AKR1C1 and AKR1C3. Overexpression of AKR1C1 or AKR1C3 in the parental HCT15 cells mitigated the cytotoxicity of the aldehydes and CDDP. Knockdown of both AKR1C1 and AKR1C3 in the resistant cells or treatment of the cells with specific inhibitors of the AKRs increased the sensitivity to CDDP toxicity. Thus, the two AKRs participate in the mechanism underlying the CDDP resistance probably via detoxification of the aldehydes resulting from enhanced oxidative stress. The resistant cells also showed an enhancement in proteolytic activity of proteasome accompanied by overexpression of its catalytic subunits (PSMβ9 and PSMβ10). Pretreatment of the resistant cells with a potent proteasome inhibitor Z-Leu-Leu-Leu-al augmented the CDDP sensitization elicited by the AKR inhibitors. Additionally, the treatment of the cells with Z-Leu-Leu-Leu-al and the AKR inhibitors induced the expressions of the two AKRs and proteasome subunits. Collectively, these results suggest the involvement of up-regulated AKR1C1, AKR1C3 and proteasome in CDDP resistance of colon cancers and support a chemotherapeutic role for their inhibitors. Copyright © 2012 Elsevier Ireland

  9. Role of Mutations in Dihydrofolate Reductase DfrA (Rv2763c) and Thymidylate Synthase ThyA (Rv2764c) in Mycobacterium tuberculosis Drug Resistance

    KAUST Repository

    Koser, C. U.

    2010-09-17

    We would like to comment on a number of recent reports in this journal (6, 8, 12, 18) concerning Mycobacterium tuberculosis dihydrofolate reductase (DHFR), encoded by dfrA (Rv2763c). Around 36% of phenotypically para-aminosalicylic acid (PAS)-resistant M. tuberculosis strains harbor mutations in thyA (Rv2764c), which encodes a thymidylate synthase (20). In their effort to elucidate the remaining unknown resistance mechanism(s), Mathys et al. extended their sequence analysis to a number of additional genes, including dfrA (12). It was unclear whether the three dfrA mutations they identified in the PAS-resistant strains P-693 and P-3158 could contribute to PAS resistance on their own. Nonetheless, these findings are notable for two reasons. First, isoniazid (INH) has been shown to inhibit M. tuberculosis DHFR in vitro (1). Whether the same holds true for ethionamide, which shares a number of common resistance mechanisms with INH, was not tested (J. Blanchard, personal communication). In any case, the clinical relevance of DHFR-mediated INH resistance remains enigmatic. To date, only Ho et al. have addressed this question, but they did not identify any dfrA mutations in a screen of 127 INH-resistant clinical isolates (8). Consequently, Mathys et al. remain the first to describe mutations in this target (12). However, given that isolates with mutated DHFR are members of a cluster with baseline INH resistance, the importance of these mutations with respect to INH resistance remains unclear. Irrespective of their relevance in INH resistance, these dfrA mutations are noteworthy for a second reason. Contrary to previous wisdom, Forgacs et al. recently showed that M. tuberculosis is sensitive to the drug combination trimethoprim-sulfamethoxazole (TMP-SMX) (6, 18). DHFR is competitively inhibited by TMP, and consequently, mutations therein lead to resistance in a variety of organisms (9, 16, 19). The crystal structures of the wild-type M. tuberculosis DHFR in complex with

  10. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    DEFF Research Database (Denmark)

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.

    2015-01-01

    Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors...... as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult...... zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance...

  11. Efficacy of c-Met inhibitor for advanced prostate cancer

    International Nuclear Information System (INIS)

    Tu, William H; Zhu, Chunfang; Clark, Curtis; Christensen, James G; Sun, Zijie

    2010-01-01

    Aberrant expression of HGF/SF and its receptor, c-Met, often correlates with advanced prostate cancer. Our previous study showed that expression of c-Met in prostate cancer cells was increased after attenuation of androgen receptor (AR) signalling. This suggested that current androgen ablation therapy for prostate cancer activates c-Met expression and may contribute to development of more aggressive, castration resistant prostate cancer (CRPC). Therefore, we directly assessed the efficacy of c-Met inhibition during androgen ablation on the growth and progression of prostate cancer. We tested two c-Met small molecule inhibitors, PHA-665752 and PF-2341066, for anti-proliferative activity by MTS assay and cell proliferation assay on human prostate cancer cell lines with different levels of androgen sensitivity. We also used renal subcapsular and castrated orthotopic xenograft mouse models to assess the effect of the inhibitors on prostate tumor formation and progression. We demonstrated a dose-dependent inhibitory effect of PHA-665752 and PF-2341066 on the proliferation of human prostate cancer cells and the phosphorylation of c-Met. The effect on cell proliferation was stronger in androgen insensitive cells. The c-Met inhibitor, PF-2341066, significantly reduced growth of prostate tumor cells in the renal subcapsular mouse model and the castrated orthotopic mouse model. The effect on cell proliferation was greater following castration. The c-Met inhibitors demonstrated anti-proliferative efficacy when combined with androgen ablation therapy for advanced prostate cancer

  12. Organization of the gene coding for human protein C inhibitor (plasminogen activator inhibitor-3). Assignment of the gene to chromosome 14

    NARCIS (Netherlands)

    Meijers, J. C.; Chung, D. W.

    1991-01-01

    Protein C inhibitor (plasminogen activator inhibitor-3) is a plasma glycoprotein and a member of the serine proteinase inhibitor superfamily. In the present study, the human gene for protein C inhibitor was isolated and characterized from three independent phage that contained overlapping inserts

  13. Novel tetra-peptide insertion in Gag-p6 ALIX-binding motif in HIV-1 subtype C associated with protease inhibitor failure

    Science.gov (United States)

    Neogi, Ujjwal; RAO, Shwetha D; BONTELL, Irene; VERHEYEN, Jens; RAO, Vasudev R; GORE, Sagar C; SONI, Neelesh; SHET, Anita; SCHÜLTER, Eugen; EKSTRAND, Maria L.; WONDWOSSEN, Amogne; KAISER, Rolf; MADHUSUDHAN, Mallur S.; PRASAD, Vinayaka R; SONNERBORG, Anders

    2014-01-01

    A novel tetra-peptide insertion was identified in Gag-p6 ALIX-binding region which is appears in protease inhibitor (PI) failure Indian HIV-1C sequences (Odds Ratio 17.1, p<0.001) but naturally present in half of untreated Ethiopian sequences. The insertion will probably restore the ALIX mediated virus release pathway, which is lacking in HIV-1C. The clinical importance of such insertion need to be evaluated in HIV-1C dominating regions were PI-drugs are being scaled up as second line treatment options. PMID:25102091

  14. Evaluation of B1 inhomogeneity effect on DCE-MRI data analysis of brain tumor patients at 3T.

    Science.gov (United States)

    Sengupta, Anirban; Gupta, Rakesh Kumar; Singh, Anup

    2017-12-02

    Dynamic-contrast-enhanced (DCE) MRI data acquired using gradient echo based sequences is affected by errors in flip angle (FA) due to transmit B 1 inhomogeneity (B 1 inh). The purpose of the study was to evaluate the effect of B 1 inh on quantitative analysis of DCE-MRI data of human brain tumor patients and to evaluate the clinical significance of B 1 inh correction of perfusion parameters (PPs) on tumor grading. An MRI study was conducted on 35 glioma patients at 3T. The patients had histologically confirmed glioma with 23 high-grade (HG) and 12 low-grade (LG). Data for B 1 -mapping, T 1 -mapping and DCE-MRI were acquired. Relative B 1 maps (B 1rel ) were generated using the saturated-double-angle method. T 1 -maps were computed using the variable flip-angle method. Post-processing was performed for conversion of signal-intensity time (S(t)) curve to concentration-time (C(t)) curve followed by tracer kinetic analysis (K trans , Ve, Vp, Kep) and first pass analysis (CBV, CBF) using the general tracer-kinetic model. DCE-MRI data was analyzed without and with B 1 inh correction and errors in PPs were computed. Receiver-operating-characteristic (ROC) analysis was performed on HG and LG patients. Simulations were carried out to understand the effect of B 1 inhomogeneity on DCE-MRI data analysis in a systematic way. S(t) curves mimicking those in tumor tissue, were generated and FA errors were introduced followed by error analysis of PPs. Dependence of FA-based errors on the concentration of contrast agent and on the duration of DCE-MRI data was also studied. Simulations were also done to obtain K trans of glioma patients at different B 1rel values and see whether grading is affected or not. Current study shows that B 1rel value higher than nominal results in an overestimation of C(t) curves as well as derived PPs and vice versa. Moreover, at same B 1rel values, errors were large for larger values of C(t). Simulation results showed that grade of patients can change

  15. Covalent Allosteric Inactivation of Protein Tyrosine Phosphatase 1B (PTP1B) by an Inhibitor-Electrophile Conjugate.

    Science.gov (United States)

    Punthasee, Puminan; Laciak, Adrian R; Cummings, Andrea H; Ruddraraju, Kasi Viswanatharaju; Lewis, Sarah M; Hillebrand, Roman; Singh, Harkewal; Tanner, John J; Gates, Kent S

    2017-04-11

    Protein tyrosine phosphatase 1B (PTP1B) is a validated drug target, but it has proven difficult to develop medicinally useful, reversible inhibitors of this enzyme. Here we explored covalent strategies for the inactivation of PTP1B using a conjugate composed of an active site-directed 5-aryl-1,2,5-thiadiazolidin-3-one 1,1-dioxide inhibitor connected via a short linker to an electrophilic α-bromoacetamide moiety. Inhibitor-electrophile conjugate 5a caused time-dependent loss of PTP1B activity consistent with a covalent inactivation mechanism. The inactivation occurred with a second-order rate constant of (1.7 ± 0.3) × 10 2 M -1 min -1 . Mass spectrometric analysis of the inactivated enzyme indicated that the primary site of modification was C121, a residue distant from the active site. Previous work provided evidence that covalent modification of the allosteric residue C121 can cause inactivation of PTP1B [Hansen, S. K., Cancilla, M. T., Shiau, T. P., Kung, J., Chen, T., and Erlanson, D. A. (2005) Biochemistry 44, 7704-7712]. Overall, our results are consistent with an unusual enzyme inactivation process in which noncovalent binding of the inhibitor-electrophile conjugate to the active site of PTP1B protects the nucleophilic catalytic C215 residue from covalent modification, thus allowing inactivation of the enzyme via selective modification of allosteric residue C121.

  16. Bacterial β-glucuronidase inhibition protects mice against enteropathy induced by indomethacin, ketoprofen or diclofenac: mode of action and pharmacokinetics.

    Science.gov (United States)

    Saitta, Kyle S; Zhang, Carmen; Lee, Kang Kwang; Fujimoto, Kazunori; Redinbo, Matthew R; Boelsterli, Urs A

    2014-01-01

    1.  We have previously demonstrated that a small molecule inhibitor of bacterial β-glucuronidase (Inh-1; [1-((6,8-dimethyl-2-oxo-1,2-dihydroquinolin-3-yl)-3-(4-ethoxyphenyl)-1-(2-hydroxyethyl)thiourea]) protected mice against diclofenac (DCF)-induced enteropathy. Here we report that Inh-1 was equally protective against small intestinal injury induced by other carboxylic acid-containing non-steroidal anti-inflammatory drugs (NSAIDs), indomethacin (10 mg/kg, ip) and ketoprofen (100 mg/kg, ip). 2.  Inh-1 provided complete protection if given prior to DCF (60 mg/kg, ip), and partial protection if administered 3-h post-DCF, suggesting that the temporal window of mucosal protection can be extended for drugs undergoing extensive enterohepatic circulation. 3.  Pharmacokinetic analysis of Inh-1 revealed an absolute bioavailability (F) of 21% and a short t1/2 of <1 h. This low F was shown to be due to hepatic first-pass metabolism, as confirmed with the pan-CYP inhibitor, 1-aminobenzotriazole. 4.  Using the fluorescent probe 5 (and 6)-carboxy-2',7'-dichlorofluorescein, we demonstrated that Inh-1 did not interfere with hepatobiliary export of glucuronides in gall bladder-cannulated mice. 5.  These data are compatible with the hypothesis that pharmacological inhibition of bacterial β-glucuronidase-mediated cleavage of NSAID glucuronides in the small intestinal lumen can protect against NSAID-induced enteropathy caused by locally high concentrations of NSAID aglycones.

  17. Hepatitis C Virus NS3 Inhibitors: Current and Future Perspectives

    Directory of Open Access Journals (Sweden)

    Kazi Abdus Salam

    2013-01-01

    Full Text Available Currently, hepatitis C virus (HCV infection is considered a serious health-care problem all over the world. A good number of direct-acting antivirals (DAAs against HCV infection are in clinical progress including NS3-4A protease inhibitors, RNA-dependent RNA polymerase inhibitors, and NS5A inhibitors as well as host targeted inhibitors. Two NS3-4A protease inhibitors (telaprevir and boceprevir have been recently approved for the treatment of hepatitis C in combination with standard of care (pegylated interferon plus ribavirin. The new therapy has significantly improved sustained virologic response (SVR; however, the adverse effects associated with this therapy are still the main concern. In addition to the emergence of viral resistance, other targets must be continually developed. One such underdeveloped target is the helicase portion of the HCV NS3 protein. This review article summarizes our current understanding of HCV treatment, particularly with those of NS3 inhibitors.

  18. Inhibitors of the bacterial cell wall biosynthesis enzyme MurC.

    Science.gov (United States)

    Reck, F; Marmor, S; Fisher, S; Wuonola, M A

    2001-06-04

    A series of phosphinate transition-state analogues of the L-alanine adding enzyme (MurC) of bacterial peptidoglycan biosynthesis was prepared and tested as inhibitors of the Escherichia coli enzyme. Compound 4 was identified as a potent inhibitor of MurC from Escherichia coli with an IC(50) of 49nM.

  19. Thalassiolins A-C: new marine-derived inhibitors of HIV cDNA integrase.

    Science.gov (United States)

    Rowley, David C; Hansen, Mark S T; Rhodes, Denise; Sotriffer, Christoph A; Ni, Haihong; McCammon, J Andrew; Bushman, Frederic D; Fenical, William

    2002-11-01

    Human immunodeficiency virus (HIV) replication requires integration of viral cDNA into the host genome, a process mediated by the viral enzyme integrase. We describe a new series of HIV integrase inhibitors, thalassiolins A-C (1-3), isolated from the Caribbean sea grass Thalassia testudinum. The thalassiolins are distinguished from other flavones previously studied by the substitution of a sulfated beta-D-glucose at the 7-position, a substituent that imparts increased potency against integrase in biochemical assays. The most active of these molecules, thalassiolin A (1), displays in vitro inhibition of the integrase catalyzed strand transfer reaction (IC50=0.4 microM) and an antiviral IC50 of 30 microM. Molecular modeling studies indicate a favorable binding mode is probable at the catalytic core domain of HIV-1 integrase.

  20. Effects of phosphodiesterase inhibitors on atrial dynamics induced by C-type natriuretic peptide in isolated beating rabbit atria

    International Nuclear Information System (INIS)

    Ding Dazhi; Cui Xun; Jin Xiunan; Lan Ying; Liu Liping; Hong Lan

    2010-01-01

    Objective: To investigate the effects of phosphodiesterase inhibitors (PDEI) on atrial dynamics induced by C-type natriuretic peptide (CNP) and the contents of cyclic nucleotide (cAMP, cGMP) in isolated beating rabbit atria. Methods: After the rabbits had been anesthetized, the hearts were removed rapidly. The left auricles were isolated and fixed on the atrial perfusion system. The atrial stroke volume and the pulse pressure were observed by CNP with or without PDEIs pretreatment. The contents of cAMP and cGMP were measured by radioimmunoassay. Results: (1)Compared with control cycle group, CNP (30.0 nmol · L -1 ) obviously decreased the atrial stroke volume and pulse pressure (P 0.05). (2)Compared with control cycle group, IBMX(1000.0 nmol · L -1 ), a non-selective inhibitor of PDE, significantly increased the atrial stroke volume, pulse pressure, cAMP and cGMP contents (P -1 ) plus CNP (30.0 nmol · L -1 )group and IBMX group (P>0.05). (3)Compared with control cycle group, EHNA(30.0 nmol · L -1 ), an inhibitor of PDE2, obviously decreased the atrial stroke volume and pulse pressure (P 0.05). EHNA(30.0 nmol · L -1 ) plus CNP (30.0 nmol · L -1 ) showed similar roles with EHNA only. (4)Compared with control cycle group, milrinone (1.0 nmol · L -1 ), an inhibitor of PDE3, significantly increased the content of cAMP (P 0.05). CNP (30.0 nmol · L -1 ) obviously decreased the atrial stroke volume and pulse pressure (P 0.05). Conclusion: CNP can inhibit atrial dynamics by increasing the content of cGMP, the different inhibitors of PDEs play different roles in the CNP-induced inhibition of atrial dynamics in isolated beating rabbit atria. (authors)

  1. A nomogram to estimate the HbA1c response to different DPP-4 inhibitors in type 2 diabetes: a systematic review and meta-analysis of 98 trials with 24 163 patients

    Science.gov (United States)

    Esposito, Katherine; Chiodini, Paolo; Maiorino, Maria Ida; Capuano, Annalisa; Cozzolino, Domenico; Petrizzo, Michela; Bellastella, Giuseppe; Giugliano, Dario

    2015-01-01

    Objectives To develop a nomogram for estimating the glycated haemoglobin (HbA1c) response to different dipeptidyl peptidase-4 (DPP-4) inhibitors in type 2 diabetes. Design A systematic review and meta-analysis of randomised controlled trials (RCTs) of DPP-4 inhibitors (vildagliptin, sitagliptin, saxagliptin, linagliptin and alogliptin) on HbA1c were conducted. Electronic searches were carried out up to December 2013. Trials were included if they were carried out on participants with type 2 diabetes, lasted at least 12 weeks, included at least 30 participants and had a final assessment of HbA1c. A random effect model was used to pool data. A nomogram was used to represent results of the metaregression model. Participants Adults with type 2 diabetes. Interventions Any DPP-4 inhibitor (vildagliptin, sitagliptin, saxagliptin, linagliptin or alogliptin). Outcome measures The HbA1c response to each DPP-4 inhibitor within 1 year of therapy. Results We screened 928 citations and reviewed 98 articles reporting 98 RCTs with 100 arms in 24 163 participants. There were 26 arms with vildagliptin, 37 with sitagliptin, 13 with saxagliptin, 13 with linagliptin and 11 with alogliptin. For all 100 arms, the mean baseline HbA1c value was 8.05% (64 mmol/mol); the decrease of HbA1c from baseline was −0.77% (95% CI −0.82 to −0.72%), with high heterogeneity (I2=96%). Multivariable metaregression model that included baseline HbA1c, type of DPP-4 inhibitor and fasting glucose explained 58% of variance between studies, with no significant interaction between them. Other factors, including age, previous diabetes drugs and duration of treatment added low predictive power (HbA1c reduction from baseline using the type of DPP-4 inhibitor, baseline values of HbA1c and fasting glucose. Conclusions Baseline HbA1c level and fasting glucose explain most of the variance in HbA1c change in response to DPP-4 inhibitors: each increase of 1.0% units HbA1c provides a 0.4–0.5% units greater

  2. [5-(1,3-Diphenyl-1H-pyrazol-4-yl-3-phenyl-4,5-dihydropyrazol-1-yl](pyridin-4-ylmethanone

    Directory of Open Access Journals (Sweden)

    Tarawanti Verma

    2011-01-01

    Full Text Available A novel pyrazoline derivative 2 was synthesized by reaction of an α,β-unsaturated ketone 1 with isonicotinic acid hydrazide (INH in glacial acetic acid. The structure of the title compound 2 was established on basis of IR, 1H-NMR, 13C-NMR and mass spectral data.

  3. Differential sensitivity of 5'UTR-NS5A recombinants of hepatitis C virus genotypes 1-6 to protease and NS5A inhibitors

    DEFF Research Database (Denmark)

    Li, Yi-Ping; Ramirez, Santseharay; Humes, Daryl

    2014-01-01

    BACKGROUND & AIMS: Hepatitis C virus (HCV) therapy will benefit from the preclinical evaluation of direct-acting antiviral (DAA) agents in infectious culture systems that test the effects on different virus genotypes. We developed HCV recombinants comprising the 5' untranslated region-NS5A (5-5A...... daclatasvir. The 1a(TN) 5-5A and JFH1-independent full-length viruses had similar levels of sensitivity to the DAA agents, validating the 5-5A recombinants as surrogates for full-length viruses in DAA testing. Compared with the 1a(TN) full-length virus, the 3a(S52) 5-5A recombinant was highly resistant to all...... protease inhibitors, and the 4a(ED43) recombinant was highly resistant to telaprevir and boceprevir, but most sensitive to other protease inhibitors. Compared with other protease inhibitors, MK-5172 had exceptional potency against all HCV genotypes. The NS5A inhibitor daclatasvir had the highest potency...

  4. Design and optimization of a series of 1-sulfonylpyrazolo[4,3-b]pyridines as selective c-Met inhibitors.

    Science.gov (United States)

    Ma, Yuchi; Sun, Guangqiang; Chen, Danqi; Peng, Xia; Chen, Yue-Lei; Su, Yi; Ji, Yinchun; Liang, Jin; Wang, Xin; Chen, Lin; Ding, Jian; Xiong, Bing; Ai, Jing; Geng, Meiyu; Shen, Jingkang

    2015-03-12

    c-Met has emerged as an attractive target for targeted cancer therapy because of its abnormal activation in many cancer cells. To identify high potent and selective c-Met inhibitors, we started with profiling the potency and in vitro metabolic stability of a reported hit 7. By rational design, a novel sulfonylpyrazolo[4,3-b]pyridine 9 with improved DMPK properties was discovered. Further elaboration of π-π stacking interactions and solvent accessible polar moieties led to a series of highly potent and selective type I c-Met inhibitors. On the basis of in vitro and in vivo pharmacological and pharmacokinetics studies, compound 46 was selected as a preclinical candidate for further anticancer drug development.

  5. A novel assay to diagnose hereditary angioedema utilizing inhibition of bradykinin-forming enzymes

    DEFF Research Database (Denmark)

    Joseph, Kusumam; Bains, Sonia; Tholanikunnel, Baby G

    2015-01-01

    . This was evident regardless whether we measured factor XIIa-C1-INH or kallikrein-C1-INH complexes, and the two assays were in close agreement. By contrast, testing the same samples utilizing the commercial method (complex ELISA, Quidel Corp.) revealed levels of C1-INH between 0 and 57% of normal (mean, 38%) and 42...

  6. Phospholipid Binding Protein C Inhibitor (PCI) Is Present on Microparticles Generated In Vitro and In Vivo

    Science.gov (United States)

    Einfinger, Katrin; Badrnya, Sigrun; Furtmüller, Margareta; Handschuh, Daniela; Lindner, Herbert; Geiger, Margarethe

    2015-01-01

    Protein C inhibitor is a secreted, non-specific serine protease inhibitor with broad protease reactivity. It binds glycosaminoglycans and anionic phospholipids, which can modulate its activity. Anionic phospholipids, such as phosphatidylserine are normally localized to the inner leaflet of the plasma membrane, but are exposed on activated and apoptotic cells and on plasma membrane-derived microparticles. In this report we show by flow cytometry that microparticles derived from cultured cells and activated platelets incorporated protein C inhibitor during membrane blebbing. Moreover, protein C inhibitor is present in/on microparticles circulating in normal human plasma as judged from Western blots, ELISAs, flow cytometry, and mass spectrometry. These plasma microparticles are mainly derived from megakaryocytes. They seem to be saturated with protein C inhibitor, since they do not bind added fluorescence-labeled protein C inhibitor. Heparin partially removed microparticle-bound protein C inhibitor, supporting our assumption that protein C inhibitor is bound via phospholipids. To assess the biological role of microparticle-bound protein C inhibitor we performed protease inhibition assays and co-precipitated putative binding partners on microparticles with anti-protein C inhibitor IgG. As judged from amidolytic assays microparticle-bound protein C inhibitor did not inhibit activated protein C or thrombin, nor did microparticles modulate the activity of exogenous protein C inhibitor. Among the proteins co-precipitating with protein C inhibitor, complement factors, especially complement factor 3, were most striking. Taken together, our data do not support a major role of microparticle-associated protein C inhibitor in coagulation, but rather suggest an interaction with proteins of the complement system present on these phospholipid vesicles. PMID:26580551

  7. 1-Nitropyrene (1-NP) induces apoptosis and apparently a non-apoptotic programmed cell death (paraptosis) in Hepa1c1c7 cells

    International Nuclear Information System (INIS)

    Asare, Nana; Landvik, Nina E.; Lagadic-Gossmann, Dominique; Rissel, Mary; Tekpli, Xavier; Ask, Kjetil; Lag, Marit; Holme, Jorn A.

    2008-01-01

    Mechanistic studies of nitro-PAHs (polycyclic aromatic hydrocarbons) of interest might help elucidate which chemical characteristics are most important in eliciting toxic effects. 1-Nitropyrene (1-NP) is the predominant nitrated PAH emitted in diesel exhaust. 1-NP-exposed Hepa1c1c7 cells exhibited marked changes in cellular morphology, decreased proliferation and different forms of cell death. A dramatic increase in cytoplasmic vacuolization was observed already after 6 h of exposure and the cells started to round up at 12 h. The rate of cell proliferation was markedly reduced at 24 h and apoptotic as well as propidium iodide (PI)-positive cells appeared. Electron microscopic examination revealed that the vacuolization was partly due to mitochondria swelling. The caspase inhibitor Z-VAD-FMK inhibited only the apoptotic cell death and Nec-1 (an inhibitor of necroptosis) exhibited no inhibitory effects on either cell death or vacuolization. In contrast, cycloheximide markedly reduced both the number of apoptotic and PI-positive cells as well as the cytoplasmic vacuolization, suggesting that 1-NP induced paraptotic cell death. All the MAPKs; ERK1/2, p38 and JNK, appear to be involved in the death process since marked activation was observed upon 1-NP exposure, and their inhibitors partly reduced the induced cell death. The ERK1/2 inhibitor PD 98057 completely blocked the induced vacuolization, whereas the other MAPKs inhibitors only had minor effects on this process. These findings suggest that 1-NP may cause apoptosis and paraptosis. In contrast, the corresponding amine (1-aminopyrene) elicited only minor apoptotic and necrotic cell death, and cells with characteristics typical of paraptosis were absent

  8. Aldehyde Dehydrogenase 1 and Raf Kinase Inhibitor Protein ...

    African Journals Online (AJOL)

    Aldehyde Dehydrogenase 1 and Raf Kinase Inhibitor Protein Expression Defines the Proliferative Nature of Cervical Cancer Stem Cells. ... of cervical cancer stem cells and also to validate them in initial and advanced stages of cervical cancer. Keywords: Cervical cancer, ALDH1, BALB/c-nu/nu, HeLa cells, RKIP, Sox2 ...

  9. Synthesis of[11C]LY186126, an inhibitor of phosphodiesterase

    International Nuclear Information System (INIS)

    Prenant, C.; Crouzel, C.; Comar, D.; Robertson, D.W.

    1992-01-01

    LY186126 [1,3-dihydro-1,3,3-trimethyl-5-(1,4,5,6-tetrahydro-4-methyl-6-oxo-3-pyriddazinyl)-2H-indol-2-one ], an analogue of the cardiotonic agent indolidan, is a potent, selective and competitive inhibitor of an isozymic form of cyclic AMP phosphodiesterase. LY186126 was labelled with carbon-11 to permit pharmacological studies in the dog myocardium by positron emission tomography. Alkylation with [ 11 C]methyl iodide of N-norLY186126 (LY-197055) allowed the production of 1.7 GBq (50mCi) of [ 11 C]LY-186126 in 40 min. The product, was purified by HPLC. (author)

  10. Discovery of natural mouse serum derived HIV-1 entry inhibitor(s).

    Science.gov (United States)

    Wei, M; Chen, Y; Xi, J; Ru, S; Ji, M; Zhang, D; Fang, Q; Tang, B

    Among rationally designed human immunodeficiency virus 1 (HIV-1) inhibitors, diverse natural factors have showed as potent anti-HIV activity in human blood. We have discovered that the boiled supernatant of healthy mouse serum could suppress HIV-1 entry, and exhibited reduced inhibitory activity after trypsin digestion. Further analysis demonstrated that only the fraction containing 10-25 K proteins could inhibit HIV-1 mediated cell-cell fusion. These results suggest that the 10-25 K protein(s) is novel natural HIV-1 entry inhibitor(s). Our findings provide important information about novel natural HIV entry inhibitors in mouse serum.

  11. The effects of residual platelets in plasma on plasminogen activator inhibitor-1 and plasminogen activator inhibitor-1-related assays.

    Directory of Open Access Journals (Sweden)

    Marlien Pieters

    Full Text Available Due to controversial evidence in the literature pertaining to the activity of plasminogen activator inhibitor-1 in platelets, we examined the effects of residual platelets present in plasma (a potential pre-analytical variable on various plasminogen activator inhibitor-1 and plasminogen activator inhibitor-1-related assays. Blood samples were collected from 151 individuals and centrifuged at 352 and 1500 g to obtain plasma with varying numbers of platelet. In a follow-up study, blood samples were collected from an additional 23 individuals, from whom platelet-poor (2000 g, platelet-containing (352 g and platelet-rich plasma (200 g were prepared and analysed as fresh-frozen and after five defrost-refreeze cycles (to determine the contribution of in vitro platelet degradation. Plasminogen activator inhibitor-1 activity, plasminogen activator inhibitor-1 antigen, tissue plasminogen activator/plasminogen activator inhibitor-1 complex, plasma clot lysis time, β-thromboglobulin and plasma platelet count were analysed. Platelet α-granule release (plasma β-thromboglobulin showed a significant association with plasminogen activator inhibitor-1 antigen levels but weak associations with plasminogen activator inhibitor-1 activity and a functional marker of fibrinolysis, clot lysis time. Upon dividing the study population into quartiles based on β-thromboglobulin levels, plasminogen activator inhibitor-1 antigen increased significantly across the quartiles while plasminogen activator inhibitor-1 activity and clot lysis time tended to increase in the 4th quartile only. In the follow-up study, plasma plasminogen activator inhibitor-1 antigen was also significantly influenced by platelet count in a concentration-dependent manner. Plasma plasminogen activator inhibitor-1 antigen levels increased further after complete platelet degradation. Residual platelets in plasma significantly influence plasma plasminogen activator inhibitor-1 antigen levels mainly

  12. Some aromatic hydrazone derivatives as inhibitors for the corrosion of C-steel in phosphoric acid solution.

    Science.gov (United States)

    Fouda, Abd El-Aziz S; Al-Sarawy, Ahmed A; Radwan, Mohamed S

    2006-01-01

    The effect of furfural benzoylhydrazone and its derivatives (I-VII) as corrosion inhibitors for C-steel in 1M phosphoric acid solution has been studied by weight-loss and galvanostatic polarization techniques. A significant decrease in the corrosion rate of C-steel was observed in the presence of the investigated inhibitors. This study revealed that, the inhibition efficiency increases with increasing the inhibitor concentration, and the addition of iodide ions enhances it to a considerable extent. The effect of temperature on the inhibition efficiency of these compounds was studied using weight-loss method. Activation energy (E(a)*) and other thermodynamic parameters for the corrosion process were calculated and discussed. The galvanostatic polarization data indicated that, the inhibitors were of mixed-type, but the cathode is more polarized than the anode. The adsorption of these compounds on C-steel surface has been found to obey Frumkin's adsorption isotherm. The mechanism of inhibition was discussed in the light of the chemical structure of the undertaken inhibitors.

  13. The proton pump inhibitor, omeprazole, but not lansoprazole or pantoprazole, is a metabolism-dependent inhibitor of CYP2C19: implications for coadministration with clopidogrel.

    Science.gov (United States)

    Ogilvie, Brian W; Yerino, Phyllis; Kazmi, Faraz; Buckley, David B; Rostami-Hodjegan, Amin; Paris, Brandy L; Toren, Paul; Parkinson, Andrew

    2011-11-01

    As a direct-acting inhibitor of CYP2C19 in vitro, lansoprazole is more potent than omeprazole and other proton pump inhibitors (PPIs), but lansoprazole does not cause clinically significant inhibition of CYP2C19 whereas omeprazole does. To investigate this apparent paradox, we evaluated omeprazole, esomeprazole, R-omeprazole, lansoprazole, and pantoprazole for their ability to function as direct-acting and metabolism-dependent inhibitors (MDIs) of CYP2C19 in pooled human liver microsomes (HLM) as well as in cryopreserved hepatocytes and recombinant CYP2C19. In HLM, all PPIs were found to be direct-acting inhibitors of CYP2C19 with IC(50) values varying from 1.2 μM [lansoprazole; maximum plasma concentration (C(max)) = 2.2 μM] to 93 μM (pantoprazole; C(max) = 6.5 μM). In addition, we identified omeprazole, esomeprazole, R-omeprazole, and omeprazole sulfone as MDIs of CYP2C19 (they caused IC(50) shifts after a 30-min preincubation with NADPH-fortified HLM of 4.2-, 10-, 2.5-, and 3.2-fold, respectively), whereas lansoprazole and pantoprazole were not MDIs (IC(50) shifts lansoprazole, or pantoprazole, as irreversible (or quasi-irreversible) MDIs of CYP2C19. These results have important implications for the mechanism of the clinical interaction reported between omeprazole and clopidogrel, as well as other CYP2C19 substrates.

  14. Discovery of novel high potent and cellular active ADC type PTP1B inhibitors with selectivity over TC-PTP via modification interacting with C site.

    Science.gov (United States)

    Du, Yongli; Zhang, Yanhui; Ling, Hao; Li, Qunyi; Shen, Jingkang

    2018-01-20

    PTP1B serving as a key negative regulator of insulin signaling is a novel target for type 2 diabetes and obesity. Modification at ring B of N-{4-[(3-Phenyl-ureido)-methyl]-phenyl}-methane-sulfonamide template to interact with residues Arg47 and Lys41 in the C site of PTP1B by molecular docking aided design resulted in the discovery of a series of novel high potent and selective inhibitors of PTP1B. The structure activity relationship interacting with the C site of PTP1B was well illustrated. Compounds 8 and 18 were shown to be the high potent and most promising PTP1B inhibitors with cellular activity and great selectivity over the highly homologous TCPTP and other PTPs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Rapid emergence of hepatitis C virus protease inhibitor resistance is expected

    Energy Technology Data Exchange (ETDEWEB)

    Rong, Libin [Los Alamos National Laboratory; Perelson, Alan S [Los Alamos National Laboratory; Ribeiro, Ruy M [Los Alamos National Laboratory

    2009-01-01

    Approximately 170 million people worldwide are infected with hepatitis C virus (HCV). Current therapy, consisting of pegylated interferon (PEG-IFN) and ribavirin (RBV), leads to sustained viral elimination in only about 45% of patients treated. Telaprevir (VX-950), a novel HCV NS3-4A serine protease inhibitor, has demonstrated substantial antiviral activity in patients with chronic hepatitis C genotype 1 infection. However, some patients experience viral breakthrough during dosing, with drug resistant variants being 5%-20% of the virus population as early as day 2 after treatment initiation. Why viral variants appear such a short time after the start of dosing is unclear, especially since this has not been seen with monotherapy for either human immunodeficiency virus or hepatitis B virus. Here, using a viral dynamic model, we explain why such rapid emergence of drug resistant variants is expected when potent HCV protease inhibitors are used as monotherapy. Surprisingly, our model also shows that such rapid emergence need not be the case with some potent HCV NS5B polymerase inhibitors. Examining the case of telaprevir therapy in detail, we show the model fits observed dynamics of both wild-type and drug-resistant variants during treatment, and supports combination therapy of direct antiviral drugs with PEG-IFN and/or RBV for hepatitis C.

  16. Subnanomolar Inhibitor of Cytochrome bc1 Complex Designed via Optimizing Interaction with Conformationally Flexible Residues

    Science.gov (United States)

    Zhao, Pei-Liang; Wang, Le; Zhu, Xiao-Lei; Huang, Xiaoqin; Zhan, Chang-Guo; Wu, Jia-Wei; Yang, Guang-Fu

    2009-01-01

    Cytochrome bc1 complex (EC 1.10.2.2, bc1), an essential component of the cellular respiratory chain and the photosynthetic apparatus in photosynthetic bacteria, has been identified as a promising target for new drugs and agricultural fungicides. X-ray diffraction structures of the free bc1 complex and its complexes with various inhibitors revealed that the phenyl group of Phe274 in the binding pocket exhibited significant conformational flexibility upon different inhibitors binding to optimize respective π-π interactions, whereas the side chains of other hydrophobic residues showed conformational stability. Therefore, in the present study, a strategy of optimizing the π-π interaction with conformationally flexible residues was proposed to design and discover new bc1 inhibitors with a higher potency. Eight new compounds were designed and synthesized, among which compound 5c with a Ki value of 570 pM was identified as the most promising drug or fungicide candidate, significantly more potent than the commercially available bc1 inhibitors including azoxystrobin (AZ), kresoxim-methyl (KM), and pyraclostrobin (PY). To our knowledge, this is the first bc1 inhibitor discovered from structure-based design with a potency of subnanomolar Ki value. For all of the compounds synthesized and assayed, the calculated binding free energies correlated reasonably well with the binding free energies derived from the experimental Ki values with a correlation coefficient of r2 = 0.89. The further inhibitory kinetics studies revealed that compound 5c is a non-competitive inhibitor with respect to substrate cytochrome c, but is a competitive inhibitor with respect to substrate ubiquinol. Due to its subnanomolar Ki potency and slow dissociation rate constant (k−0 = 0.00358 s−1), compound 5c could be used as a specific probe for further elucidation of the mechanism of bc1 function and as a new lead compound for future drug discovery. PMID:19928849

  17. The potential of P1 site alterations in peptidomimetic protease inhibitors as suggested by virtual screening and explored by the use of C-C-coupling reagents.

    Science.gov (United States)

    Weik, Steffen; Luksch, Torsten; Evers, Andreas; Böttcher, Jark; Sotriffer, Christoph A; Hasilik, Andrej; Löffler, Hans-Gerhard; Klebe, Gerhard; Rademann, Jörg

    2006-04-01

    A synthetic concept is presented that allows the construction of peptide isostere libraries through polymer-supported C-acylation reactions. A phosphorane linker reagent is used as a carbanion equivalent; by employing MSNT as a coupling reagent, the C-acylation can be conducted without racemization. Diastereoselective reduction was effected with L-selectride. The reagent linker allows the preparation of a norstatine library with full variation of the isosteric positions including the P1 side chain that addresses the protease S1 pocket. Therefore, the concept was employed to investigate the P1 site specificity of peptide isostere inhibitors systematically. The S1 pocket of several aspartic proteases including plasmepsin II and cathepsin D was modeled and docked with approximately 500 amino acid side chains. Inspired by this virtual screen, a P1 site mutation library was designed, synthesized, and screened against three aspartic proteases (plasmepsin II, HIV protease, and cathepsin D). The potency of norstatine inhibitors was found to depend strongly on the P1 substituent. Large, hydrophobic residues such as biphenyl, 4-bromophenyl, and 4-nitrophenyl enhanced the inhibitory activity (IC50) by up to 70-fold against plasmepsin II. In addition, P1 variation introduced significant selectivity, as up to 9-fold greater activity was found against plasmepsin II relative to human cathepsin D. The active P1 site residues did not fit into the crystal structure; however, molecular dynamics simulation suggested a possible alternative binding mode.

  18. Hereditary angioedema.

    Science.gov (United States)

    Bracho, Francisco A

    2005-11-01

    Hereditary angioedema is an autosomal-dominant deficiency of C1 inhibitor--a serpin inhibitor of kallikrein, C1r, C1s, factor XII, and plasmin. Quantitative or qualitative deficiency of C1 inhibitor leads to the generation of vasoactive mediators, most likely bradykinin. The clinical syndrome is repeated bouts of nonpruritic, nonpitting edema of the face, larynx, extermities, and intestinal viscera. Recently, investigators, physicians, and industry have demonstrated a renewed interest in the biology and treatment of hereditary angioedema. Investigators have generated a C1INH-/- mouse model that has demonstrated the importance of the contact activation system for hereditary angioedema-related vascular permeability. An interactive database of mutations is available electronically. Investigators have continued exploration into mRNA/protein levels. The proceedings of a recent workshop have been impressive in the scope and depth. Clinicians have produced consensus documents and expert reviews. The pharmaceutical industry has initiated clinical trails with novel agents. Hereditary angioedema is often misdiagnosed and poorly treated. Diagnosis requires careful medical and family history and the measurement of functional C1 inhibitor and C4 levels. Attenuated androgens, anti-fibrinolytics, and C1 inhibitor concentrates are used for long-term and preprocedure prophylaxis, but have significant drawbacks. C1 inhibitor concentrates and fresh frozen plasma are available for acute intervention. The mainstays of supportive care are airway monitoring, pain relief, hydration, and control of nausea. New agents such as recombinant C1 inhibitor, kallikrein inhibitors, and bradykinin inhibitors may offer safer and more tolerable treatments.

  19. Benzene-1,3-dicarboxylic acid 2,5-dimethylpyrrole derivatives as multiple inhibitors of bacterial Mur ligases (MurC-MurF).

    Science.gov (United States)

    Perdih, Andrej; Hrast, Martina; Barreteau, Hélène; Gobec, Stanislav; Wolber, Gerhard; Solmajer, Tom

    2014-08-01

    Enzymes catalyzing the biosynthesis of bacterial peptidoglycan represent traditionally a collection of highly selective targets for novel antibacterial drug design. Four members of the bacterial Mur ligase family-MurC, MurD, MurE and MurF-are involved in the intracellular steps of peptidoglycan biosynthesis, catalyzing the synthesis of the peptide moiety of the Park's nucleotide. In our previous virtual screening campaign, a chemical class of benzene-1,3-dicarboxylic acid 2,5-dimethylpyrrole derivatives exhibiting dual MurD/MurE inhibition properties was discovered. In the present study we further investigated this class of compounds by performing inhibition assays on all four Mur ligases (MurC-MurF). Furthermore, molecular dynamics (MD) simulation studies of one of the initially discovered compound 1 were performed to explore its geometry as well as its energetic behavior based on the Linear Interaction Energy (LIE) method. Further in silico virtual screening (VS) experiments based on the parent active compound 1 were conducted to optimize the discovered series. Selected hits were assayed against all Escherichia coli MurC-MurF enzymes in biochemical inhibition assays and molecules 10-14 containing benzene-1,3-dicarboxylic acid 2,5-dimethylpyrrole coupled with five member-ring rhodanine moiety were found to be multiple inhibitors of the whole MurC-MurF cascade of bacterial enzymes in the micromolar range. Steady-state kinetics studies suggested this class to act as competitive inhibitors of the MurD enzyme towards d-Glu. These compounds represent novel valuable starting point in the development of novel antibacterial agents. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Hepatitis C virus inhibitor synergism suggests multistep interactions between heat-shock protein 90 and hepatitis C virus replication

    Science.gov (United States)

    Kubota, Naoko; Nomoto, Masataka; Hwang, Gi-Wook; Watanabe, Toshihiko; Kohara, Michinori; Wakita, Takaji; Naganuma, Akira; Kuge, Shusuke

    2016-01-01

    AIM: To address the effect of heat-shock protein 90 (HSP90) inhibitors on the release of the hepatitis C virus (HCV), a cell culture-derived HCV (JFH1/HCVcc) from Huh-7 cells was examined. METHODS: We quantified both the intracellular and extracellular (culture medium) levels of the components (RNA and core) of JFH-1/HCVcc. The intracellular HCV RNA and core levels were determined after the JFH1/HCVcc-infected Huh-7 cells were treated with radicicol for 36 h. The extracellular HCV RNA and core protein levels were determined from the medium of the last 24 h of radicicol treatment. To determine the possible role of the HSP90 inhibitor in HCV release, we examined the effect of a combined application of low doses of the HSP90 inhibitor radicicol and the RNA replication inhibitors cyclosporin A (CsA) or interferon. Finally, we statistically examined the combined effect of radicicol and CsA using the combination index (CI) and graphical representation proposed by Chou and Talalay. RESULTS: We found that the HSP90 inhibitors had greater inhibitory effects on the HCV RNA and core protein levels measured in the medium than inside the cells. This inhibitory effect was observed in the presence of a low level of a known RNA replication inhibitor (CsA or interferon-α). Treating the cells with a combination of radicicol and cyclosporin A for 24 h resulted in significant synergy (CI < 1) that affected the release of both the viral RNA and the core protein. CONCLUSION: In addition to having an inhibitory effect on RNA replication, HSP90 inhibitors may interfere with an HCV replication step that occurs after the synthesis of viral RNA, such as assembly and release. PMID:26925202

  1. Lessons from the Institute for New Heads (INH) Class of 2006: Ten Headships--134 Years of Hard-Earned Experience

    Science.gov (United States)

    Raphel, Annette; Huber, John; Chandler, Carolyn; Vorenberg, Amy; Jones-Wilkins, Andy; Devey, Mark A.; Holford, Josie; Craig, Ian; Elam, Julie

    2016-01-01

    Ten years ago in July 2006, 64 mostly starry-eyed men and women attended the NAIS Institute for New Heads (INH) in order to learn the ropes of headship. These newly minted heads were filled with enthusiasm, commitment, and passion, along with humility and a bit of healthy trepidation. One core group connected under the careful guidance of…

  2. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  3. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

    Science.gov (United States)

    Patick, A K; Boritzki, T J; Bloom, L A

    1997-10-01

    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

  4. Synthesis of 1-benzyl-4-[(5,6-dimethoxy[2-14C]-1-indanon)-2-YL]-methylpiperidine hydrochloride (E2020-14C)

    International Nuclear Information System (INIS)

    Iimura, Youichi; Mishima, Mannen; Sugimoto, Hachiro

    1989-01-01

    1-Benzyl-4-[(5,6-dimethoxy[2- 14 C]-1-indanon)-2-yl]-methylpiperidine hydrochloride (E2020- 14 C), and acetylcholinesterase inhibitor for studying the pharmacokinetic profiles of E2020, was synthesized from 5,6-dimethoxy[2- 14 C]-1-indanone as the labelled starting material. (author)

  5. A serine palmitoyltransferase inhibitor blocks hepatitis C virus replication in human hepatocytes.

    Science.gov (United States)

    Katsume, Asao; Tokunaga, Yuko; Hirata, Yuichi; Munakata, Tsubasa; Saito, Makoto; Hayashi, Hitohisa; Okamoto, Koichi; Ohmori, Yusuke; Kusanagi, Isamu; Fujiwara, Shinya; Tsukuda, Takuo; Aoki, Yuko; Klumpp, Klaus; Tsukiyama-Kohara, Kyoko; El-Gohary, Ahmed; Sudoh, Masayuki; Kohara, Michinori

    2013-10-01

    Host cell lipid rafts form a scaffold required for replication of hepatitis C virus (HCV). Serine palmitoyltransferases (SPTs) produce sphingolipids, which are essential components of the lipid rafts that associate with HCV nonstructural proteins. Prevention of the de novo synthesis of sphingolipids by an SPT inhibitor disrupts the HCV replication complex and thereby inhibits HCV replication. We investigated the ability of the SPT inhibitor NA808 to prevent HCV replication in cells and mice. We tested the ability of NA808 to inhibit SPT's enzymatic activity in FLR3-1 replicon cells. We used a replicon system to select for HCV variants that became resistant to NA808 at concentrations 4- to 6-fold the 50% inhibitory concentration, after 14 rounds of cell passage. We assessed the ability of NA808 or telaprevir to inhibit replication of HCV genotypes 1a, 1b, 2a, 3a, and 4a in mice with humanized livers (transplanted with human hepatocytes). NA808 was injected intravenously, with or without pegylated interferon alfa-2a and HCV polymerase and/or protease inhibitors. NA808 prevented HCV replication via noncompetitive inhibition of SPT; no resistance mutations developed. NA808 prevented replication of all HCV genotypes tested in mice with humanized livers. Intravenous NA808 significantly reduced viral load in the mice and had synergistic effects with pegylated interferon alfa-2a and HCV polymerase and protease inhibitors. The SPT inhibitor NA808 prevents replication of HCV genotypes 1a, 1b, 2a, 3a, and 4a in cultured hepatocytes and in mice with humanized livers. It might be developed for treatment of HCV infection or used in combination with pegylated interferon alfa-2a or HCV polymerase or protease inhibitors. Copyright © 2013 AGA Institute. Published by Elsevier Inc. All rights reserved.

  6. Protein C inhibitor acts as a procoagulant by inhibiting the thrombomodulin-induced activation of protein C in human plasma

    NARCIS (Netherlands)

    Elisen, M. G.; von dem Borne, P. A.; Bouma, B. N.; Meijers, J. C.

    1998-01-01

    Protein C inhibitor (PCI), which was originally identified as an inhibitor of activated protein C, also efficiently inhibits coagulation factors such as factor Xa and thrombin. Recently it was found, using purified proteins, that the anticoagulant thrombin-thrombomodulin complex was also inhibited

  7. Peptide Inhibitor of Complement C1 (PIC1 Rapidly Inhibits Complement Activation after Intravascular Injection in Rats.

    Directory of Open Access Journals (Sweden)

    Julia A Sharp

    Full Text Available The complement system has been increasingly recognized to play a pivotal role in a variety of inflammatory and autoimmune diseases. Consequently, therapeutic modulators of the classical, lectin and alternative pathways of the complement system are currently in pre-clinical and clinical development. Our laboratory has identified a peptide that specifically inhibits the classical and lectin pathways of complement and is referred to as Peptide Inhibitor of Complement C1 (PIC1. In this study, we determined that the lead PIC1 variant demonstrates a salt-dependent binding to C1q, the initiator molecule of the classical pathway. Additionally, this peptide bound to the lectin pathway initiator molecule MBL as well as the ficolins H, M and L, suggesting a common mechanism of PIC1 inhibitory activity occurs via binding to the collagen-like tails of these collectin molecules. We further analyzed the effect of arginine and glutamic acid residue substitution on the complement inhibitory activity of our lead derivative in a hemolytic assay and found that the original sequence demonstrated superior inhibitory activity. To improve upon the solubility of the lead derivative, a pegylated, water soluble variant was developed, structurally characterized and demonstrated to inhibit complement activation in mouse plasma, as well as rat, non-human primate and human serum in vitro. After intravenous injection in rats, the pegylated derivative inhibited complement activation in the blood by 90% after 30 seconds, demonstrating extremely rapid function. Additionally, no adverse toxicological effects were observed in limited testing. Together these results show that PIC1 rapidly inhibits classical complement activation in vitro and in vivo and is functional for a variety of animal species, suggesting its utility in animal models of classical complement-mediated diseases.

  8. Evidence-based recommendations for the therapeutic management of angioedema owing to hereditary C1 inhibitor deficiency: consensus report of an International Working Group

    NARCIS (Netherlands)

    Cicardi, M.; Bork, K.; Caballero, T.; Craig, T.; Li, H. H.; Longhurst, H.; Reshef, A.; Zuraw, B.; Werner, Aberer; Aygören-Pürsün, Emel; Banerji, Aleena; Bjorkander, Janne; Boccon-Gibod, Isabelle; Konrad, Bork; Bouillet, Laurence; Bova, Maria; Bowen, Tom; Branco Ferreira, Manuel; Bygum, Anette; Caballero, Teresa; Cancian, Mauro; Castel-Branco, Maria Graça; Cicardi, Marco; Craig, Timothy; de Carolis, Caterina; Mihály, Enikö; Josè, Fabiani; Farkas, Henriette; Gompels, Mark; Gower, Richard; Groffik, Adriane; Grumach, Anete; Guillarte, Mar; Hernandez Landeros, Maria Esthela; Kaplan, Allen; Leibovich, Iris; Li, Henry; Lock, Bob; Longhurst, Hilary; Lumry, William; Malbran, Alejandro; Martinez-Saguer, Immaculada; Campos, Matta; Maurer, Marcus; Moldovan, Dumitru; Montinaro, Vincenzo; Nieto, Sandra; Nordenfelt, Patrik; Obtulovicz, Krystana; Zeerleder, Sacha

    2012-01-01

    Angioedema owing to hereditary deficiency of C1 inhibitor (HAE) is a rare, life-threatening, disabling disease. In the last 2 years, the results of well-designed and controlled trials with existing and new therapies for this condition have been published, and new treatments reached the market.

  9. Soluble IgM links apoptosis to complement activation in early alcoholic liver disease in mice.

    Science.gov (United States)

    Smathers, Rebecca L; Chiang, Dian J; McMullen, Megan R; Feldstein, Ariel E; Roychowdhury, Sanjoy; Nagy, Laura E

    2016-04-01

    Ethanol feeding in mice activates complement via C1q binding to apoptotic cells in the liver; complement contributes to ethanol-induced inflammation and injury. Despite the critical role of C1q in ethanol-induced injury, the mechanism by which ethanol activates C1q remains poorly understood. Secretory IgM (sIgM), traditionally considered to act as an anti-microbial, also has critical housekeeping functions, facilitating clearance of apoptotic cells, at least in part through activation of C1q. Therefore, we hypothesized that (1) ethanol-induced apoptosis in the liver recruits sIgM, facilitating the activation of C1q and complement and (2) C1INH (C1 esterase inhibitor), which inhibits C1 functional activity, prevents complement activation and decreases ethanol-induced liver injury. Female C57BL/6 wild-type, C1qa(-/-), BID(-/-) and sIgM(-/-) mice were fed ethanol containing liquid diets or pair-fed control diets. C1INH or vehicle was given via tail vein injection to ethanol- or pair-fed wild-type mice at 24 and 48h prior to euthanasia. Ethanol exposure increased apoptosis in the liver, as well as the accumulation of IgM in the liver. In the early stages of ethanol feeding, C1q co-localized with IgM in the peri-sinusoidal space of the liver and accumulation of IgM and C3b was dependent on ethanol-induced BID-dependent apoptosis. sIgM(-/-) mice were protected from both ethanol-induced activation of complement and early ethanol-induced liver injury when compared to wild-type mice. Treatment with C1INH also decreased hepatic C3b deposition and ethanol-induced injury. These data indicate that sIgM contributes to activation of complement and ethanol-induced increases in inflammatory cytokine expression and hepatocyte injury in the early stages of ethanol-induced liver injury. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

    Science.gov (United States)

    Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

    2000-05-18

    To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

  11. Dipeptidyl peptidase-4 (DPP-4) inhibitors are favourable to glucagon-like peptide-1 (GLP-1) agonists

    DEFF Research Database (Denmark)

    Madsbad, Sten

    2012-01-01

    Incretin-based therapies, which include the GLP-1 receptor agonists and DPP-4 inhibitors, use the antidiabetic properties of potentiating the GLP-1 receptor signalling via the regulation of insulin and glucagon secretion, inhibition of gastric emptying and suppression of appetite. Most physicians...... will start antidiabetic treatment with metformin, but adding a GLP-1 receptor agonist as the second drug seems to be optimal since more patients will reach an HbA1c below 7% than with a DPP-4 inhibitor or another oral antidiabetic agents and with minimal risk of hypoglycaemia. The GLP-1 receptor agonists...

  12. Aqueous Molecular Dynamics Simulations of the M. tuberculosis Enoyl-ACP Reductase-NADH System and Its Complex with a Substrate Mimic or Diphenyl Ethers Inhibitors

    Directory of Open Access Journals (Sweden)

    Camilo Henrique da Silva Lima

    2015-10-01

    Full Text Available Molecular dynamics (MD simulations of 12 aqueous systems of the NADH-dependent enoyl-ACP reductase from Mycobacterium tuberculosis (InhA were carried out for up to 20–40 ns using the GROMACS 4.5 package. Simulations of the holoenzyme, holoenzyme-substrate, and 10 holoenzyme-inhibitor complexes were conducted in order to gain more insight about the secondary structure motifs of the InhA substrate-binding pocket. We monitored the lifetime of the main intermolecular interactions: hydrogen bonds and hydrophobic contacts. Our MD simulations demonstrate the importance of evaluating the conformational changes that occur close to the active site of the enzyme-cofactor complex before and after binding of the ligand and the influence of the water molecules. Moreover, the protein-inhibitor total steric (ELJ and electrostatic (EC interaction energies, related to Gly96 and Tyr158, are able to explain 80% of the biological response variance according to the best linear equation, pKi = 7.772 − 0.1885 × Gly96 + 0.0517 × Tyr158 (R2 = 0.80; n = 10, where interactions with Gly96, mainly electrostatic, increase the biological response, while those with Tyr158 decrease. These results will help to understand the structure-activity relationships and to design new and more potent anti-TB drugs.

  13. Recent advances in the discovery of small molecule c-Met Kinase inhibitors.

    Science.gov (United States)

    Parikh, Palak K; Ghate, Manjunath D

    2018-01-01

    c-Met is a prototype member of a subfamily of heterodimeric receptor tyrosine kinases (RTKs) and is the receptor for hepatocyte growth factor (HGF). Binding of HGF to its receptor c-Met, initiates a wide range of cellular signalling, including those involved in proliferation, motility, migration and invasion. Importantly, dysregulated HGF/c-Met signalling is a driving factor for numerous malignancies and promotes tumour growth, invasion, dissemination and/or angiogenesis. Dysregulated HGF/c-Met signalling has also been associated with poor clinical outcomes and resistance acquisition to some approved targeted therapies. Thus, c-Met kinase has emerged as a promising target for cancer drug development. Different therapeutic approaches targeting the HGF/c-Met signalling pathway are under development for targeted cancer therapy, among which small molecule inhibitors of c-Met kinase constitute the largest effort within the pharmaceutical industry. The review is an effort to summarize recent advancements in medicinal chemistry development of small molecule c-Met kinase inhibitors as potential anti-cancer agents which would certainly help future researchers to bring further developments in the discovery of small molecule c-Met kinase inhibitors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Receptor tyrosine kinase (c-Kit inhibitors: a potential therapeutic target in cancer cells

    Directory of Open Access Journals (Sweden)

    Abbaspour Babaei M

    2016-08-01

    Full Text Available Maryam Abbaspour Babaei,1 Behnam Kamalidehghan,2,3 Mohammad Saleem,4–6 Hasniza Zaman Huri,1,7 Fatemeh Ahmadipour1 1Department of Pharmacy, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia; 2Department of Medical Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB, Shahrak-e Pajoohesh, 3Medical Genetics Department, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran; 4Department of Urology, 5Department of Laboratory Medicine and Pathology, Masonic Cancer Center, University of Minnesota, 6Section of Molecular Therapeutics & Cancer Health Disparity, The Hormel Institute, Austin, MN, USA; 7Clinical Investigation Centre, University Malaya Medical Centre, Lembah Pantai, Kuala Lumpur, Malaysia Abstract: c-Kit, a receptor tyrosine kinase, is involved in intracellular signaling, and the mutated form of c-Kit plays a crucial role in occurrence of some cancers. The function of c-Kit has led to the concept that inhibiting c-Kit kinase activity can be a target for cancer therapy. The promising results of inhibition of c-Kit for treatment of cancers have been observed in some cancers such as gastrointestinal stromal tumor, acute myeloid leukemia, melanoma, and other tumors, and these results have encouraged attempts toward improvement of using c-Kit as a capable target for cancer therapy. This paper presents the findings of previous studies regarding c-Kit as a receptor tyrosine kinase and an oncogene, as well as its gene targets and signaling pathways in normal and cancer cells. The c-Kit gene location, protein structure, and the role of c-Kit in normal cell have been discussed. Comprehending the molecular mechanism underlying c-Kit-mediated tumorogenesis is consequently essential and may lead to the identification of future novel drug targets. The potential mechanisms by which c-Kit induces cellular transformation have been described. This study aims to elucidate the function of c

  15. Small molecule inhibitors reveal Niemann-Pick C1 is essential for Ebola virus infection.

    Science.gov (United States)

    Côté, Marceline; Misasi, John; Ren, Tao; Bruchez, Anna; Lee, Kyungae; Filone, Claire Marie; Hensley, Lisa; Li, Qi; Ory, Daniel; Chandran, Kartik; Cunningham, James

    2011-08-24

    Ebola virus (EboV) is a highly pathogenic enveloped virus that causes outbreaks of zoonotic infection in Africa. The clinical symptoms are manifestations of the massive production of pro-inflammatory cytokines in response to infection and in many outbreaks, mortality exceeds 75%. The unpredictable onset, ease of transmission, rapid progression of disease, high mortality and lack of effective vaccine or therapy have created a high level of public concern about EboV. Here we report the identification of a novel benzylpiperazine adamantane diamide-derived compound that inhibits EboV infection. Using mutant cell lines and informative derivatives of the lead compound, we show that the target of the inhibitor is the endosomal membrane protein Niemann-Pick C1 (NPC1). We find that NPC1 is essential for infection, that it binds to the virus glycoprotein (GP), and that antiviral compounds interfere with GP binding to NPC1. Combined with the results of previous studies of GP structure and function, our findings support a model of EboV infection in which cleavage of the GP1 subunit by endosomal cathepsin proteases removes heavily glycosylated domains to expose the amino-terminal domain, which is a ligand for NPC1 and regulates membrane fusion by the GP2 subunit. Thus, NPC1 is essential for EboV entry and a target for antiviral therapy.

  16. Entry inhibitor-based microbicides are active in vitro against HIV-1 isolates from multiple genetic subtypes

    International Nuclear Information System (INIS)

    Ketas, Thomas J.; Schader, Susan M.; Zurita, Juan; Teo, Esther; Polonis, Victoria; Lu Min; Klasse, Per Johan; Moore, John P.

    2007-01-01

    Inhibitors of viral entry are under consideration as topical microbicides to prevent HIV-1 sexual transmission. Small molecules targeting HIV-1 gp120 (BMS-378806) or CCR5 (CMPD167), and a peptide fusion inhibitor (C52L), each blocks vaginal infection of macaques by a SHIV. A microbicide, however, must be active against multiple HIV-1 variants. We therefore tested BMS-C (a BMS-378806 derivative), CMPD167, C52L and the CXCR4 ligand AMD3465, alone and in combination, against 25 primary R5, 12 X4 and 7 R5X4 isolates from subtypes A-G. At high concentrations (0.1-1 μM), the replication of most R5 isolates in human donor lymphocytes was inhibited by > 90%. At lower concentrations, double and triple combinations were more effective than individual inhibitors. Similar results were obtained with X4 viruses when AMD3465 was substituted for CMPD167. The R5X4 viruses were inhibited by combining AMD3465 with CMPD167, or by the coreceptor-independent compounds. Thus, combining entry inhibitors may improve microbicide effectiveness

  17. Synthesis of 14C analogue of 1,2-diaryl-[2-14C]-pyrroles

    International Nuclear Information System (INIS)

    Saemian, N.; Shirvani, G.; Matloubi, H.

    2007-01-01

    Three 1,2-diaryl pyrroles selective COX-2 inhibitors, 2-(4-fluorophenyl)-5-methyl-1-(4-methylsulfonyl-phenyl)-1H pyrrole, 2-(4-fluorophenyl)-1- [4-(methylsulfonyl) phenyl]-1H-pyrrole and 4-[2-(4-fluorophenyl)-1H-pyrrol-1-yl]benzenesulfon-amide, all three labeled with 14 C in the 2-position were prepared from para-fluoro-benzaldehyde-[carbonyl- 14 C]. (author)

  18. Depressed activation of the lectin pathway of complement in hereditary angioedema

    DEFF Research Database (Denmark)

    Varga, L; Széplaki, G; Laki, J

    2008-01-01

    ) in three complement activation pathways. Functional activity of the CP, LP and AP were measured in the sera of 68 adult patients with hereditary angioedema (HAE) and 64 healthy controls. In addition, the level of C1q, MBL, MBL-associated serine protease-2 (MASP-2), C4-, C3- and C1INH was measured...... by standard laboratory methods. MBL-2 genotypes were determined by polymerase chain reaction. Besides the complement alterations (low CP and C1INH activity, low C4-, C1INH concentrations), which characterize HAE, the level of MASP-2 was also lower (P = 0.0001) in patients compared with controls. Depressed LP...

  19. Synthesis and characterisation of 5-acyl-6,7-dihydrothieno[3,2-c]pyridine inhibitors of Hedgehog acyltransferase

    Directory of Open Access Journals (Sweden)

    Thomas Lanyon-Hogg

    2016-06-01

    Full Text Available In this data article we describe synthetic and characterisation data for four members of the 5-acyl-6,7-dihydrothieno[3,2-c]pyridine (termed “RU-SKI” class of inhibitors of Hedgehog acyltransferase, including associated NMR spectra for final compounds. RU-SKI compounds were selected for synthesis based on their published high potencies against the enzyme target. RU-SKI 41 (9a, RU-SKI 43 (9b, RU-SKI 101 (9c, and RU-SKI 201 (9d were profiled for activity in the related article “Click chemistry armed enzyme linked immunosorbent assay to measure palmitoylation by Hedgehog acyltransferase” (Lanyon-Hogg et al., 2015 [1]. 1H NMR spectral data indicate different amide conformational ratios between the RU-SKI inhibitors, as has been observed in other 5-acyl-6,7-dihydrothieno[3,2-c]pyridines. The synthetic and characterisation data supplied in the current article provide validated access to the class of RU-SKI inhibitors.

  20. Discovery of Selective Phosphodiesterase 1 Inhibitors with Memory Enhancing Properties.

    Science.gov (United States)

    Dyck, Brian; Branstetter, Bryan; Gharbaoui, Tawfik; Hudson, Andrew R; Breitenbucher, J Guy; Gomez, Laurent; Botrous, Iriny; Marrone, Tami; Barido, Richard; Allerston, Charles K; Cedervall, E Peder; Xu, Rui; Sridhar, Vandana; Barker, Ryan; Aertgeerts, Kathleen; Schmelzer, Kara; Neul, David; Lee, Dong; Massari, Mark Eben; Andersen, Carsten B; Sebring, Kristen; Zhou, Xianbo; Petroski, Robert; Limberis, James; Augustin, Martin; Chun, Lawrence E; Edwards, Thomas E; Peters, Marco; Tabatabaei, Ali

    2017-04-27

    A series of potent thienotriazolopyrimidinone-based PDE1 inhibitors was discovered. X-ray crystal structures of example compounds from this series in complex with the catalytic domain of PDE1B and PDE10A were determined, allowing optimization of PDE1B potency and PDE selectivity. Reduction of hERG affinity led to greater than a 3000-fold selectivity for PDE1B over hERG. 6-(4-Methoxybenzyl)-9-((tetrahydro-2H-pyran-4-yl)methyl)-8,9,10,11-tetrahydropyrido[4',3':4,5]thieno[3,2-e][1,2,4]triazolo[1,5-c]pyrimidin-5(6H)-one was identified as an orally bioavailable and brain penetrating PDE1B enzyme inhibitor with potent memory-enhancing effects in a rat model of object recognition memory.

  1. In vivo evaluation of carbon-11-labelled non-sarcosine-based glycine transporter 1 inhibitors in mice and conscious monkeys

    International Nuclear Information System (INIS)

    Toyohara, Jun; Ishiwata, Kiichi; Sakata, Muneyuki; Wu, Jin; Nishiyama, Shingo; Tsukada, Hideo; Hashimoto, Kenji

    2011-01-01

    Introduction: Glycine transporter 1 (GlyT-1) is an attractive target in positron emission tomography (PET) studies. Here, we report the in vivo evaluation of three carbon-11-labelled non-sarcosine-type GlyT-1 inhibitors - [ 11 C]SA1, [ 11 C]SA2 and [ 11 C]SA3 - as novel PET tracers for GlyT-1. Methods: The regional brain distributions of the three compounds in mice were studied at baseline and under receptor-blockade conditions with co-injection of carrier loading or pretreatment with an excess of selective GlyT-1 inhibitors (ALX-5407 and SSR504734). Metabolic stability was investigated by radio high-performance liquid chromatography. Dynamic PET scans in conscious monkeys were performed with/without selective GlyT-1 inhibitors. Results: The IC 50 values of SA1, SA2 and SA3 were 9.0, 6400 and 39.7 nM, respectively. The regional brain uptakes of [ 11 C]SA1 and [ 11 C]SA3 in mice were heterogeneous and consistent with the known distribution of GlyT-1. [ 11 C]SA2 showed low and homogeneous uptake in the brain. Most radioactivity in the brain was detected in unchanged form, although peripherally these compounds were degraded. Carrier loading decreased the uptake of [ 11 C]SA1 in GlyT-1-rich regions. However, similar reductions were not observed with [ 11 C]SA3. Pretreatment with ALX-5407 decreased the uptake of [ 11 C]SA1 in GlyT-1-rich regions. In the monkey at baseline, regional brain uptake of [ 11 C]SA1 was heterogeneous and consistent with the known GlyT-1 distribution. Pretreatment with selective GlyT-1 inhibitors significantly decreased the distribution volume ratio of [ 11 C] SA1 in GlyT-1-rich regions. Conclusions: [ 11 C]SA1 has the most suitable profile among the three carbon-11-labelled GlyT-1 inhibitors. Lead optimization of [ 11 C]SA1 structure will be required to achieve in vivo selective GlyT-1 imaging.

  2. Virtual screening for potential inhibitors of bacterial MurC and MurD ligases.

    Science.gov (United States)

    Tomašić, Tihomir; Kovač, Andreja; Klebe, Gerhard; Blanot, Didier; Gobec, Stanislav; Kikelj, Danijel; Mašič, Lucija Peterlin

    2012-03-01

    Mur ligases are bacterial enzymes involved in the cytoplasmic steps of peptidoglycan biosynthesis and are viable targets for antibacterial drug discovery. We have performed virtual screening for potential ATP-competitive inhibitors targeting MurC and MurD ligases, using a protocol of consecutive hierarchical filters. Selected compounds were evaluated for inhibition of MurC and MurD ligases, and weak inhibitors possessing dual inhibitory activity have been identified. These compounds represent new scaffolds for further optimisation towards multiple Mur ligase inhibitors with improved inhibitory potency.

  3. DPP-4 inhibitor treatment: β-cell response but not HbA1c reduction is dependent on the duration of diabetes

    Directory of Open Access Journals (Sweden)

    Kozlovski P

    2017-03-01

    Full Text Available Plamen Kozlovski,1 Vaishali Bhosekar,2 James E Foley3 1Novartis Pharma AG, Basel, Switzerland; 2Novartis Healthcare Private Limited, Hyderabad, India; 3Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA Introduction: Dipeptidyl peptidase-4 (DPP-4 inhibitors reduce hyperglycemia in patients with type 2 diabetes mellitus (T2DM by enhancing insulin and suppressing glucagon secretion. Since T2DM is associated with progressive loss of β-cell function, we hypothesized that the DPP-4 inhibitor action to improve β-cell function would be attenuated with longer duration of T2DM.Methods: Data from six randomized, placebo-controlled trials of 24 weeks duration, where β-cell response to vildagliptin 50 mg twice daily was assessed, were pooled. In each study, the insulin secretory rate relative to glucose (ISR/G 0–2h during glucose load (standard meal or oral glucose tolerance test was assessed at baseline and end of study. The mean placebo-subtracted difference (PSD in the change in ISR/G 0–2h from baseline for each study was evaluated as a function of age, duration of T2DM, baseline ISR/G 0–2h, glycated hemoglobin (HbA1c, fasting plasma glucose, body mass index, and mean PSD in the change in HbA1c from baseline, using univariate model.Results: There was a strong negative association between the PSD in the change from baseline in ISR/G 0–2h and duration of T2DM (r= −0.89, p<0.02. However, there was no association between the PSD in the change from baseline in ISR/G 0–2h and the PSD in the change from baseline in HbA1c (r=0.33, p=0.52. None of the other characteristics were significantly associated with mean PSD change in ISR/G 0–2h.Conclusion: These findings indicate that the response of the β-cell, but not the HbA1c reduction, with vildagliptin is dependent on duration of T2DM. Further, it can be speculated that glucagon suppression may become the predominant mechanism via which glycemic control is improved when treatment with a

  4. Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Nishiura, T; Abe, K

    1999-01-01

    The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

  5. Carbon-11 labelling of an inhibitor of acetylcholinesterase: [11C]physostigmine

    International Nuclear Information System (INIS)

    Bonnot-Lours, S.; Crouzel, C.; Prenant, C.; Hinnen, F.

    1993-01-01

    Physostigmine, an alkaloid from calabar bean is a strong inhibitor of acetylcholinesterase and has been used clinically in the treatment of glaucoma, atropine intoxication, myasthenia gravis and more recently, in experimental trials in Alzheimer's disease. In order to study the AChE activity in the brain by positron emission tomography, we have undertaken the labelling of physostigmine with carbon-11. The synthesis involves the reaction of [ 11 C]methylisocyanate with eseroline. [ 11 C]Methylisocyanate was obtained by heating [ 11 C]acetylchloride with tetrabutylammonium azide in toluene. The synthesis of [ 11 C]CH 3 COC1 involves the carbonation of methylmagnesium bromide in THF with cyclotron produced [ 11 C]carbon dioxide and the addition of phthaloyl dichloride. The [ 11 C]methylisocyanate is distilled into a solution of eseroline in ether with a small piece of sodium. After 10 minutes at 25 o C, the solution is purified by HPLC and the appropriate fraction collected. Starting with 55.5 GBq (1.5 Ci) of [ 11 C]carbon dioxide, 0.92-1.48 GBq (25-40 mCi) of [ 11 C]Physostigmine are obtained 57 minutes after EOB. (author)

  6. Contributions of basic amino acids in the autolysis loop of factor XIa to serpin specificity.

    Science.gov (United States)

    Rezaie, Alireza R; Sun, Mao-fu; Gailani, David

    2006-08-08

    The autolysis loops (amino acids 143-154, chymotrypsinogen numbering) of plasma serine proteases play key roles in determining the specificity of protease inhibition by plasma serpins. We studied the importance of four basic residues (Arg-144, Lys-145, Arg-147, and Lys-149) in the autolysis loop of the coagulation protease factor XIa (fXIa) for inhibition by serpins. Recombinant fXIa mutants, in which these residues were replaced individually or in combination with alanine, were prepared. The proteases were compared to wild-type fXIa (fXIa-WT) with respect to their ability to activate factor IX in a plasma clotting assay, to hydrolyze the chromogenic substrate S2366, and to undergo inhibition by the C1-inhibitor (C1-INH), protein Z dependent protease inhibitor (ZPI), antithrombin (AT), and alpha(1)-protease inhibitor (alpha(1)-PI). All mutants exhibited normal activity in plasma and hydrolyzed S2366 with catalytic efficiencies similar to that of fXIa-WT. Inhibition of mutants by C1-INH was increased to varying degrees relative to that of fXIa-WT, with the mutant containing alanine replacements for all four basic residues (fXIa-144-149A) exhibiting an approximately 15-fold higher rate of inhibition. In contrast, the inhibition by ZPI was impaired 2-3-fold for single amino acid substitutions, and fXIa-144-149A was essentially resistant to inhibition by ZPI. Alanine substitution for Arg-147 impaired inhibition by AT approximately 7-fold; however, other substitutions did not affect it or slightly enhanced inhibition. Arg-147 was also required for inhibition by alpha(1)-PI. Cumulatively, the results demonstrate that basic amino acids in the autolysis loop of fXIa are important determinants of serpin specificity.

  7. Tissue inhibitor of matrix metalloproteinase-1 suppresses apoptosis of mouse bone marrow stromal cell line MBA-1.

    Science.gov (United States)

    Guo, L-J; Luo, X-H; Xie, H; Zhou, H-D; Yuan, L-Q; Wang, M; Liao, E-Y

    2006-05-01

    We investigated the action of tissue inhibitor of metalloproteinase-1 (TIMP-1) on apoptosis and differentiation of mouse bone marrow stromal cell line MBA-1. TIMP-1 did not affect alkaline phosphatase (ALP) activity, suggesting that it is not involved in osteoblastic differentiation in MBA-1 cells. However, TIMP-1 inhibited MBA-1 apoptosis induced by serum deprivation in a dose-dependent manner. Our study also showed increased Bcl-2 protein expression and decreased Bax protein expression with TIMP-1 treatment. TIMP-1 decreased cytochrome c release and caspase-3 activation in MBA-1 cells. TIMP-1 activated phosphatidylinositol 3-kinase (PI3-kinase) and c-Jun N-terminal kinase (JNK), and the PI3-kinase inhibitor LY294002 or the JNK inhibitor SP600125 abolished its antiapoptotic activity. To investigate whether antiapoptotic action of TIMP-1 was mediated through its inhibition on MMP activities, we constructed mutant TIMP-1 by side-directed mutagenesis, which abolished the inhibitory activity of MMPs by deletion of Cys1 to Ala4. Wild-type TIMP-1 and mutant TIMP-1 expression plasmids were transfected in MBA-1 cells, and results showed that mutant TIMP-1 still protected the induced MBA-1 cell against apoptosis. These data suggest that TIMP-1 antiapoptotic actions are mediated via the PI3-kinase and JNK signaling pathways and independent of TIMP-1 inhibition of MMP activities.

  8. Structural insights into the binding mechanism of IDO1 with hydroxylamidine based inhibitor INCB14943

    International Nuclear Information System (INIS)

    Wu, You; Xu, Tingting; Liu, Jinsong; Ding, Ke; Xu, Jinxin

    2017-01-01

    IDO1 (indoleamine 2, 3-dioxygenase 1), a well characterized immunosuppressive enzyme, has attracted growing attention as a potential target for cancer immunotherapy. Hydroxylamidine compounds INCB024360 and INCB14943 (INCB024360 analogue) are highly effective IDO1 inhibitors. INCB024360 is undergoing clinical trials for treatment of various types of human cancer. Here, we determined the co-crystal structure of IDO1 and INCB14943, and elucidate the detailed binding mode. INCB14943 binds to heme iron in IDO1 protein through the oxime nitrogen. Further analysis also reveals that a halogen bonding interaction between the chlorine atom (3-Cl) of INCB14943 and the sulphur atom of C129 significantly improves the inhibition activity against IDO1. Comparing with the other reported inhibitors, the oxime nitrogen and halogen bond interaction are identified as the unique features of INCB14943 among the IDO1 inhibitors. Thus, our study provides novel insights into the interaction between a small molecule inhibitor INCB14943 and IDO1 protein. The structural information will facilitate future IDO1 inhibitor design. - Highlights: • This is the first co-crystal structure of IDO1 with hydroxylamidine compound. • INCB14943 binds to heme iron through oxime nitrogen instead of imidazole nitrogen. • Halogen bond interaction with C129 is another unique feature of INCB14943.

  9. Fluorescence Resonance Energy Transfer Assay for High-Throughput Screening of ADAMTS1 Inhibitors

    Directory of Open Access Journals (Sweden)

    Guanhua Du

    2011-12-01

    Full Text Available A disintegrin and metalloprotease with thrombospondin type I motifs-1 (ADAMTS1 plays a crucial role in inflammatory joint diseases and its inhibitors are potential candidates for anti-arthritis drugs. For the purposes of drug discovery, we reported the development and validation of fluorescence resonance energy transfer (FRET assay for high-throughput screening (HTS of the ADAMTS1 inhibitors. A FRET substrate was designed for a quantitative assay of ADAMTS1 activity and enzyme kinetics studies. The assay was developed into a 50-µL, 384-well assay format for high throughput screening of ADAMTS1 inhibitors with an overall Z’ factor of 0.89. ADAMTS1 inhibitors were screened against a diverse library of 40,960 total compounds with the established HTS system. Four structurally related hits, naturally occurring compounds, kuwanon P, kuwanon X, albafuran C and mulberrofuran J, extracted from the Chinese herb Morus alba L., were identified for further investigation. The results suggest that this FRET assay is an excellent tool, not only for measurement of ADAMTS1 activity but also for discovery of novel ADAMTS1 inhibitors with HTS.

  10. CD38 Structure-Based Inhibitor Design Using the N1-Cyclic Inosine 5'-Diphosphate Ribose Template.

    Directory of Open Access Journals (Sweden)

    Christelle Moreau

    Full Text Available Few inhibitors exist for CD38, a multifunctional enzyme catalyzing the formation and metabolism of the Ca(2+-mobilizing second messenger cyclic adenosine 5'-diphosphoribose (cADPR. Synthetic, non-hydrolyzable ligands can facilitate structure-based inhibitor design. Molecular docking was used to reproduce the crystallographic binding mode of cyclic inosine 5'-diphosphoribose (N1-cIDPR with CD38, revealing an exploitable pocket and predicting the potential to introduce an extra hydrogen bond interaction with Asp-155. The purine C-8 position of N1-cIDPR (IC50 276 µM was extended with an amino or diaminobutane group and the 8-modified compounds were evaluated against CD38-catalyzed cADPR hydrolysis. Crystallography of an 8-amino N1-cIDPR:CD38 complex confirmed the predicted interaction with Asp-155, together with a second H-bond from a realigned Glu-146, rationalizing the improved inhibition (IC50 56 µM. Crystallography of a complex of cyclic ADP-carbocyclic ribose (cADPcR, IC50 129 µM with CD38 illustrated that Glu-146 hydrogen bonds with the ligand N6-amino group. Both 8-amino N1-cIDPR and cADPcR bind deep in the active site reaching the catalytic residue Glu-226, and mimicking the likely location of cADPR during catalysis. Substantial overlap of the N1-cIDPR "northern" ribose monophosphate and the cADPcR carbocyclic ribose monophosphate regions suggests that this area is crucial for inhibitor design, leading to a new compound series of N1-inosine 5'-monophosphates (N1-IMPs. These small fragments inhibit hydrolysis of cADPR more efficiently than the parent cyclic compounds, with the best in the series demonstrating potent inhibition (IC50 = 7.6 µM. The lower molecular weight and relative simplicity of these compounds compared to cADPR make them attractive as a starting point for further inhibitor design.

  11. 14C-labeling of a tetrahydroacridine, a novel CNS-selective cholinesterase inhibitor

    International Nuclear Information System (INIS)

    Nishioka, Kazuhiko; Kamada, Takeshi; Kanamaru, Hiroshi

    1992-01-01

    9-Amino-8-fluoro-2,4-methano-1,2,3,4-tetrahydroacridine citrate (SM-10888), a novel cholinesterase inhibitor, was labeled with carbon-14 at C9 of the tetrahydroacridine ring for use in metabolic studies. Carbonation of 2,6-difluorophenyllithium (3) with [ 14 C]carbon dioxide gave the acid (4). Chlorination of 4 followed by treatment of the resulting acid chloride with ammonia afforded the amide (5). Dehydration of 5 with thionyl chloride and subsequent displacement reaction with ammonia gave the aminobenzonitrile (7). Condensation of 7 with the ketone (8) in the presence of anhydrous zinc chloride yielded the aminoacridine (9), which was treated with citric acid to afford [9- 14 C]SM-10888 (1). The overall yield of 1 was 37% from 2, and the specific activity was 1.35 GBq/mmol. (author)

  12. Before and after, the impact of available on-demand treatment for HAE

    DEFF Research Database (Denmark)

    Christiansen, Sandra C; Bygum, Anette; Banerji, Aleena

    2015-01-01

    of suffocation, worry about their children inheriting HAE, and medication side effects. Data were analyzed using Wilcoxon signed-rank tests or analysis of variance. Responses were obtained from 134 self-identified HAE subjects: 85 type I, 21 type II, and 28 with normal C1 inhibitor (C1INH). Burden of disease......Availability of effective treatment for acute attacks is expected to transform the care of hereditary angioedema (HAE) patients. We felt that it would be of interest to test these assumptions by examining the perceptions of HAE patients regarding the impact that these therapies have had...

  13. Ebselen, a Small-Molecule Capsid Inhibitor of HIV-1 Replication.

    Science.gov (United States)

    Thenin-Houssier, Suzie; de Vera, Ian Mitchelle S; Pedro-Rosa, Laura; Brady, Angela; Richard, Audrey; Konnick, Briana; Opp, Silvana; Buffone, Cindy; Fuhrmann, Jakob; Kota, Smitha; Billack, Blase; Pietka-Ottlik, Magdalena; Tellinghuisen, Timothy; Choe, Hyeryun; Spicer, Timothy; Scampavia, Louis; Diaz-Griffero, Felipe; Kojetin, Douglas J; Valente, Susana T

    2016-04-01

    The human immunodeficiency virus type 1 (HIV-1) capsid plays crucial roles in HIV-1 replication and thus represents an excellent drug target. We developed a high-throughput screening method based on a time-resolved fluorescence resonance energy transfer (HTS-TR-FRET) assay, using the C-terminal domain (CTD) of HIV-1 capsid to identify inhibitors of capsid dimerization. This assay was used to screen a library of pharmacologically active compounds, composed of 1,280in vivo-active drugs, and identified ebselen [2-phenyl-1,2-benzisoselenazol-3(2H)-one], an organoselenium compound, as an inhibitor of HIV-1 capsid CTD dimerization. Nuclear magnetic resonance (NMR) spectroscopic analysis confirmed the direct interaction of ebselen with the HIV-1 capsid CTD and dimer dissociation when ebselen is in 2-fold molar excess. Electrospray ionization mass spectrometry revealed that ebselen covalently binds the HIV-1 capsid CTD, likely via a selenylsulfide linkage with Cys198 and Cys218. This compound presents anti-HIV activity in single and multiple rounds of infection in permissive cell lines as well as in primary peripheral blood mononuclear cells. Ebselen inhibits early viral postentry events of the HIV-1 life cycle by impairing the incoming capsid uncoating process. This compound also blocks infection of other retroviruses, such as Moloney murine leukemia virus and simian immunodeficiency virus, but displays no inhibitory activity against hepatitis C and influenza viruses. This study reports the use of TR-FRET screening to successfully identify a novel capsid inhibitor, ebselen, validating HIV-1 capsid as a promising target for drug development. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  14. Synthesis of 1-benzyl-4-((5,6-dimethoxy(2- sup 14 C)-1-indanon)-2-YL)-methylpiperidine hydrochloride (E2020- sup 14 C)

    Energy Technology Data Exchange (ETDEWEB)

    Iimura, Youichi; Mishima, Mannen; Sugimoto, Hachiro (Eisai Co., Ltd., Ibaraki (Japan). Tsukuba Research Labs.)

    1989-07-01

    1-Benzyl-4-((5,6-dimethoxy(2-{sup 14}C)-1-indanon)-2-yl)-methylpiperidine hydrochloride (E2020-{sup 14}C), and acetylcholinesterase inhibitor for studying the pharmacokinetic profiles of E2020, was synthesized from 5,6-dimethoxy(2-{sup 14}C)-1-indanone as the labelled starting material. (author).

  15. C75, a fatty acid synthase inhibitor, modulates AMP-activated protein kinase to alter neuronal energy metabolism.

    Science.gov (United States)

    Landree, Leslie E; Hanlon, Andrea L; Strong, David W; Rumbaugh, Gavin; Miller, Ian M; Thupari, Jagan N; Connolly, Erin C; Huganir, Richard L; Richardson, Christine; Witters, Lee A; Kuhajda, Francis P; Ronnett, Gabriele V

    2004-01-30

    C75, a synthetic inhibitor of fatty acid synthase (FAS), is hypothesized to alter the metabolism of neurons in the hypothalamus that regulate feeding behavior to contribute to the decreased food intake and profound weight loss seen with C75 treatment. In the present study, we characterize the suitability of primary cultures of cortical neurons for studies designed to investigate the consequences of C75 treatment and the alteration of fatty acid metabolism in neurons. We demonstrate that in primary cortical neurons, C75 inhibits FAS activity and stimulates carnitine palmitoyltransferase-1 (CPT-1), consistent with its effects in peripheral tissues. C75 alters neuronal ATP levels and AMP-activated protein kinase (AMPK) activity. Neuronal ATP levels are affected in a biphasic manner with C75 treatment, decreasing initially, followed by a prolonged increase above control levels. Cerulenin, a FAS inhibitor, causes a similar biphasic change in ATP levels, although levels do not exceed control. C75 and cerulenin modulate AMPK phosphorylation and activity. TOFA, an inhibitor of acetyl-CoA carboxylase, increases ATP levels, but does not affect AMPK activity. Several downstream pathways are affected by C75 treatment, including glucose metabolism and acetyl-CoA carboxylase (ACC) phosphorylation. These data demonstrate that C75 modulates the levels of energy intermediates, thus, affecting the energy sensor AMPK. Similar effects in hypothalamic neurons could form the basis for the effects of C75 on feeding behavior.

  16. Structure-guided evolution of potent and selective CHK1 inhibitors through scaffold morphing.

    Science.gov (United States)

    Reader, John C; Matthews, Thomas P; Klair, Suki; Cheung, Kwai-Ming J; Scanlon, Jane; Proisy, Nicolas; Addison, Glynn; Ellard, John; Piton, Nelly; Taylor, Suzanne; Cherry, Michael; Fisher, Martin; Boxall, Kathy; Burns, Samantha; Walton, Michael I; Westwood, Isaac M; Hayes, Angela; Eve, Paul; Valenti, Melanie; de Haven Brandon, Alexis; Box, Gary; van Montfort, Rob L M; Williams, David H; Aherne, G Wynne; Raynaud, Florence I; Eccles, Suzanne A; Garrett, Michelle D; Collins, Ian

    2011-12-22

    Pyrazolopyridine inhibitors with low micromolar potency for CHK1 and good selectivity against CHK2 were previously identified by fragment-based screening. The optimization of the pyrazolopyridines to a series of potent and CHK1-selective isoquinolines demonstrates how fragment-growing and scaffold morphing strategies arising from a structure-based understanding of CHK1 inhibitor binding can be combined to successfully progress fragment-derived hit matter to compounds with activity in vivo. The challenges of improving CHK1 potency and selectivity, addressing synthetic tractability, and achieving novelty in the crowded kinase inhibitor chemical space were tackled by multiple scaffold morphing steps, which progressed through tricyclic pyrimido[2,3-b]azaindoles to N-(pyrazin-2-yl)pyrimidin-4-amines and ultimately to imidazo[4,5-c]pyridines and isoquinolines. A potent and highly selective isoquinoline CHK1 inhibitor (SAR-020106) was identified, which potentiated the efficacies of irinotecan and gemcitabine in SW620 human colon carcinoma xenografts in nude mice.

  17. Hepatitis C virus protease inhibitor-resistance mutations: our experience and review.

    Science.gov (United States)

    Wu, Shuang; Kanda, Tatsuo; Nakamoto, Shingo; Imazeki, Fumio; Yokosuka, Osamu

    2013-12-21

    Direct-acting antiviral agents (DAAs) for hepatitis C virus (HCV) infection are one of the major advances in its medical treatment. The HCV protease inhibitors boceprevir and telaprevir were the first approved DAAs in the United States, Europe, and Japan. When combined with peginterferon plus ribavirin, these agents increase sustained virologic response rates to 70%-80% in treatment-naïve patients and previous-treatment relapsers with chronic HCV genotype 1 infection. Without peginterferon plus ribavirin, DAA mono-therapies increased DAA-resistance mutations. Several new DAAs for HCV are now in clinical development and are likely to be approved in the near future. However, it has been reported that the use of these drugs also led to the emergence of DAA-resistance mutations in certain cases. Furthermore, these mutations exhibit cross-resistance to multiple drugs. The prevalence of DAA-resistance mutations in HCV-infected patients who were not treated with DAAs is unknown, and it is as yet uncertain whether such variants are sensitive to DAAs. We performed a population sequence analysis to assess the frequency of such variants in the sera of HCV genotype 1-infected patients not treated with HCV protease inhibitors. Here, we reviewed the literature on resistance variants of HCV protease inhibitors in treatment naïve patients with chronic HCV genotype 1, as well as our experience.

  18. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

    2017-01-01

    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  19. Taxane-Platin-Resistant Lung Cancers Co-develop Hypersensitivity to JumonjiC Demethylase Inhibitors

    Directory of Open Access Journals (Sweden)

    Maithili P. Dalvi

    2017-05-01

    Full Text Available Although non-small cell lung cancer (NSCLC patients benefit from standard taxane-platin chemotherapy, many relapse, developing drug resistance. We established preclinical taxane-platin-chemoresistance models and identified a 35-gene resistance signature, which was associated with poor recurrence-free survival in neoadjuvant-treated NSCLC patients and included upregulation of the JumonjiC lysine demethylase KDM3B. In fact, multi-drug-resistant cells progressively increased the expression of many JumonjiC demethylases, had altered histone methylation, and, importantly, showed hypersensitivity to JumonjiC inhibitors in vitro and in vivo. Increasing taxane-platin resistance in progressive cell line series was accompanied by progressive sensitization to JIB-04 and GSK-J4. These JumonjiC inhibitors partly reversed deregulated transcriptional programs, prevented the emergence of drug-tolerant colonies from chemo-naive cells, and synergized with standard chemotherapy in vitro and in vivo. Our findings reveal JumonjiC inhibitors as promising therapies for targeting taxane-platin-chemoresistant NSCLCs.

  20. In vivo evaluation of carbon-11-labelled non-sarcosine-based glycine transporter 1 inhibitors in mice and conscious monkeys

    Energy Technology Data Exchange (ETDEWEB)

    Toyohara, Jun [Division of Clinical Neuroscience, Chiba University Center for Forensic Mental Health, Chiba, Japan 260-8670 (Japan); Positron Medical Center, Tokyo Metropolitan Institute of Gerontology, Tokyo, Japan 173-0022 (Japan); Ishiwata, Kiichi; Sakata, Muneyuki [Positron Medical Center, Tokyo Metropolitan Institute of Gerontology, Tokyo, Japan 173-0022 (Japan); Wu, Jin [Division of Clinical Neuroscience, Chiba University Center for Forensic Mental Health, Chiba, Japan 260-8670 (Japan); Nishiyama, Shingo; Tsukada, Hideo [Central Research Laboratory, Hamamatsu Photonics K.K., Shizuoka, Japan 434-8601 (Japan); Hashimoto, Kenji, E-mail: hashimoto@faculty.chiba-u.j [Division of Clinical Neuroscience, Chiba University Center for Forensic Mental Health, Chiba, Japan 260-8670 (Japan)

    2011-05-15

    Introduction: Glycine transporter 1 (GlyT-1) is an attractive target in positron emission tomography (PET) studies. Here, we report the in vivo evaluation of three carbon-11-labelled non-sarcosine-type GlyT-1 inhibitors - [{sup 11}C]SA1, [{sup 11}C]SA2 and [{sup 11}C]SA3 - as novel PET tracers for GlyT-1. Methods: The regional brain distributions of the three compounds in mice were studied at baseline and under receptor-blockade conditions with co-injection of carrier loading or pretreatment with an excess of selective GlyT-1 inhibitors (ALX-5407 and SSR504734). Metabolic stability was investigated by radio high-performance liquid chromatography. Dynamic PET scans in conscious monkeys were performed with/without selective GlyT-1 inhibitors. Results: The IC{sub 50} values of SA1, SA2 and SA3 were 9.0, 6400 and 39.7 nM, respectively. The regional brain uptakes of [{sup 11}C]SA1 and [{sup 11}C]SA3 in mice were heterogeneous and consistent with the known distribution of GlyT-1. [{sup 11}C]SA2 showed low and homogeneous uptake in the brain. Most radioactivity in the brain was detected in unchanged form, although peripherally these compounds were degraded. Carrier loading decreased the uptake of [{sup 11}C]SA1 in GlyT-1-rich regions. However, similar reductions were not observed with [{sup 11}C]SA3. Pretreatment with ALX-5407 decreased the uptake of [{sup 11}C]SA1 in GlyT-1-rich regions. In the monkey at baseline, regional brain uptake of [{sup 11}C]SA1 was heterogeneous and consistent with the known GlyT-1 distribution. Pretreatment with selective GlyT-1 inhibitors significantly decreased the distribution volume ratio of [{sup 11}C] SA1 in GlyT-1-rich regions. Conclusions: [{sup 11}C]SA1 has the most suitable profile among the three carbon-11-labelled GlyT-1 inhibitors. Lead optimization of [{sup 11}C]SA1 structure will be required to achieve in vivo selective GlyT-1 imaging.

  1. Modulation of the epithelial sodium channel (ENaC by bacterial metalloproteases and protease inhibitors.

    Directory of Open Access Journals (Sweden)

    Michael B Butterworth

    Full Text Available The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC, leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions.

  2. Biochemical characterization of a phosphinate inhibitor of Escherichia coli MurC.

    Science.gov (United States)

    Marmor, S; Petersen, C P; Reck, F; Yang, W; Gao, N; Fisher, S L

    2001-10-09

    The bacterial UDP-N-acetylmuramyl-L-alanine ligase (MurC) from Escherichia coli, an essential, cytoplasmic peptidoglycan biosynthetic enzyme, catalyzes the ATP-dependent ligation of L-alanine (Ala) and UDP-N-acetylmuramic acid (UNAM) to form UDP-N-acetylmuramyl-L-alanine (UNAM-Ala). The phosphinate inhibitor 1 was designed and prepared as a multisubstrate/transition state analogue. The compound exhibits mixed-type inhibition with respect to all three enzyme substrates (ATP, UNAM, Ala), suggesting that this compound forms dead-end complexes with multiple enzyme states. Results from isothermal titration calorimetry (ITC) studies supported these findings as exothermic binding was observed under conditions with free enzyme (K(d) = 1.80-2.79 microM, 95% CI), enzyme saturated with ATP (K(d) = 0.097-0.108 microM, 95% CI), and enzyme saturated with the reaction product ADP (K(d) = 0.371-0.751 microM, 95% CI). Titrations run under conditions of saturating UNAM or the product UNAM-Ala did not show heat effects consistent with competitive compound binding to the active site. The potent binding affinity observed in the presence of ATP is consistent with the inhibitor design and the proposed Ordered Ter-Ter mechanism for this enzyme; however, the additional binding pathways suggest that the inhibitor can also serve as a product analogue.

  3. Design, synthesis and biological evaluation of uncharged catechol derivatives as selective inhibitors of PTP1B.

    Science.gov (United States)

    Li, Xiang-Qian; Xu, Qi; Luo, Jiao; Wang, Li-Jun; Jiang, Bo; Zhang, Ren-Shuai; Shi, Da-Yong

    2017-08-18

    Protein tyrosine phosphatases 1B (PTP1B) is a promising and validated therapeutic target to effectively treat T2DM and obesity. However, the development of charged PTP1B inhibitors was restricted due to their low cell permeability and poor bioavailability. Based on active natural products, two series of uncharged catechol derivatives were identified as PTP1B inhibitors by targeting a secondary aryl phosphate-binding site as well as the catalytic site. The most potent inhibitor 22 showed an IC 50 of 0.487 μM against PTP1B and strong selectivity (27-fold) over TCPTP. Kinetic studies were also performed that 22 act as a competitive PTP1B inhibitor. The treatment of C2C12 myotubes with 22 markedly increased the phosphorylation levels of IRβ, Akt and IRS1 phosphorylation. The similarity of its action profiling with that produced by insulin suggested its potential as a new non-insulin-dependent drug candidate. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. Inhibition of colony-stimulating-factor-1 signaling in vivo with the orally bioavailable cFMS kinase inhibitor GW2580.

    Science.gov (United States)

    Conway, James G; McDonald, Brad; Parham, Janet; Keith, Barry; Rusnak, David W; Shaw, Eva; Jansen, Marilyn; Lin, Peiyuan; Payne, Alan; Crosby, Renae M; Johnson, Jennifer H; Frick, Lloyd; Lin, Min-Hwa Jasmine; Depee, Scott; Tadepalli, Sarva; Votta, Bart; James, Ian; Fuller, Karen; Chambers, Timothy J; Kull, Frederick C; Chamberlain, Stanley D; Hutchins, Jeff T

    2005-11-01

    Colony-stimulating-factor-1 (CSF-1) signaling through cFMS receptor kinase is increased in several diseases. To help investigate the role of cFMS kinase in disease, we identified GW2580, an orally bioavailable inhibitor of cFMS kinase. GW2580 completely inhibited human cFMS kinase in vitro at 0.06 microM and was inactive against 26 other kinases. GW2580 at 1 microM completely inhibited CSF-1-induced growth of mouse M-NFS-60 myeloid cells and human monocytes and completely inhibited bone degradation in cultures of human osteoclasts, rat calvaria, and rat fetal long bone. In contrast, GW2580 did not affect the growth of mouse NS0 lymphoblastoid cells, human endothelial cells, human fibroblasts, or five human tumor cell lines. GW2580 also did not affect lipopolysaccharide (LPS)-induced TNF, IL-6, and prostaglandin E2 production in freshly isolated human monocytes and mouse macrophages. After oral administration, GW2580 blocked the ability of exogenous CSF-1 to increase LPS-induced IL-6 production in mice, inhibited the growth of CSF-1-dependent M-NFS-60 tumor cells in the peritoneal cavity, and diminished the accumulation of macrophages in the peritoneal cavity after thioglycolate injection. Unexpectedly, GW2580 inhibited LPS-induced TNF production in mice, in contrast to effects on monocytes and macrophages in vitro. In conclusion, GW2580's selective inhibition of monocyte growth and bone degradation is consistent with cFMS kinase inhibition. The ability of GW2580 to chronically inhibit CSF-1 signaling through cFMS kinase in normal and tumor cells in vivo makes GW2580 a useful tool in assessing the role of cFMS kinase in normal and disease processes.

  5. Antifungal drugs as corrosion inhibitors for aluminium in 0.1 M HCl

    Energy Technology Data Exchange (ETDEWEB)

    Obot, I.B. [Department of Chemistry, Faculty of Science, University of Uyo, Uyo (Nigeria)], E-mail: proffoime@yahoo.com; Obi-Egbedi, N.O. [Department of Chemistry, University of Ibadan, Ibadan (Nigeria); Umoren, S.A. [Department of Chemistry, Faculty of Science, University of Uyo, Uyo (Nigeria)

    2009-08-15

    The inhibitive capabilities of Clotrimazole (CTM) and Fluconazole (FLC), two antifungal drugs, on the electrochemical corrosion of aluminium in 0.1 M HCl solution has been studied using weight loss measurements at 30 and 50 deg. C. The results indicate that both compound act as inhibitors in the acidic corrodent. At constant acid concentration, the inhibition efficiency (%I) increased with increase in the concentration of the inhibitors. Increase in temperature increased the corrosion rate in the absence and presence of the inhibitors but decreased the inhibition efficiency. CTM and FLC adsorbed on the surface of aluminium according to the Langmuir adsorption isotherm model at all the concentrations and temperatures studied. Phenomenon of physical adsorption is proposed from the activation parameter obtained. Thermodynamic parameters reveal that the adsorption process is spontaneous. The reactivity of these compounds was analyzed through theoretical calculations based on AM1 semi-empirical method to explain the different efficiencies of these compounds as corrosion inhibitors. CTM was found to be a better inhibitor than FLC.

  6. Identification of an inhibitor of the MurC enzyme, which catalyzes an essential step in the peptidoglycan precursor synthesis pathway.

    Science.gov (United States)

    Zawadzke, Laura E; Norcia, Michael; Desbonnet, Charlene R; Wang, Hong; Freeman-Cook, Kevin; Dougherty, Thomas J

    2008-02-01

    The pathway for synthesis of the peptidoglycan precursor UDP-N-acetylmuramyl pentapeptide is essential in Gram-positive and Gram-negative bacteria. This pathway has been exploited in the recent past to identify potential new antibiotics as inhibitors of one or more of the Mur enzymes. In the present study, a high-throughput screen was employed to identify potential inhibitors of the Escherichia coli MurC (UDP-N-acetylmuramic acid:L-alanine ligase), the first of four paralogous amino acid-adding enzymes. Inhibition of ATP consumed during the MurC reaction, using an adaptation of a kinase assay format, identified a number of potential inhibitory chemotypes. After nonspecific inhibition testing and chemical attractiveness were assessed, C-1 emerged as a compound for further characterization. The inhibition of MurC by this compound was confirmed in both a kinetic-coupled enzyme assay and a direct nuclear magnetic resonance product detection assay. C-1 was found to be a low micromolar inhibitor of the E. coli MurC reaction, with preferential inhibition by one of two enantiomeric forms. Experiments indicated that it was a competitive inhibitor of ATP binding to the MurC enzyme. Further work with MurC enzymes from several bacterial sources revealed that while the compound was equally effective at inhibiting MurC from genera (Proteus mirabilis and Klebsiella pneumoniae) closely related to E. coli, MurC enzymes from more distant Gram-negative species such as Haemophilus influenzae, Acinetobacter baylyi, and Pseudomonas aeruginosa were not inhibited.

  7. Normalization of Hepatic Homeostasis in the Npc1nmf164 Mouse Model of Niemann-Pick Type C Disease Treated with the Histone Deacetylase Inhibitor Vorinostat.

    Science.gov (United States)

    Munkacsi, Andrew B; Hammond, Natalie; Schneider, Remy T; Senanayake, Dinindu S; Higaki, Katsumi; Lagutin, Kirill; Bloor, Stephen J; Ory, Daniel S; Maue, Robert A; Chen, Fannie W; Hernandez-Ono, Antonio; Dahlson, Nicole; Repa, Joyce J; Ginsberg, Henry N; Ioannou, Yiannis A; Sturley, Stephen L

    2017-03-17

    Niemann-Pick type C (NP-C) disease is a fatal genetic lipidosis for which there is no Food and Drug Administration (FDA)-approved therapy. Vorinostat, an FDA-approved inhibitor of histone deacetylases, ameliorates lysosomal lipid accumulation in cultured NP-C patient fibroblasts. To assess the therapeutic potential of histone deacetylase inhibition, we pursued these in vitro observations in two murine models of NP-C disease. Npc1 nmf164 mice, which express a missense mutation in the Npc1 gene, were treated intraperitoneally, from weaning, with the maximum tolerated dose of vorinostat (150 mg/kg, 5 days/week). Disease progression was measured via gene expression, liver function and pathology, serum and tissue lipid levels, body weight, and life span. Transcriptome analyses of treated livers indicated multiple changes consistent with reversal of liver dysfunction that typifies NP-C disease. Significant improvements in liver pathology and function were achieved by this treatment regimen; however, NPC1 protein maturation and levels, disease progression, weight loss, and animal morbidity were not detectably altered. Vorinostat concentrations were >200 μm in the plasma compartment of treated animals but were almost 100-fold lower in brain tissue. Apolipoprotein B metabolism and the expression of key components of lipid homeostasis in primary hepatocytes from null ( Npc1 -/- ) and missense ( Npc1 nmf164 ) mutant mice were altered by vorinostat treatment, consistent with a response by these cells independent of the status of the Npc1 locus. These results suggest that HDAC inhibitors have utility to treat visceral NP-C disease. However, it is clear that improved blood-brain barrier penetration will be required to alleviate the neurological symptoms of human NP-C disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Normalization of Hepatic Homeostasis in the Npc1nmf164 Mouse Model of Niemann-Pick Type C Disease Treated with the Histone Deacetylase Inhibitor Vorinostat*

    Science.gov (United States)

    Munkacsi, Andrew B.; Hammond, Natalie; Schneider, Remy T.; Senanayake, Dinindu S.; Higaki, Katsumi; Lagutin, Kirill; Bloor, Stephen J.; Ory, Daniel S.; Maue, Robert A.; Chen, Fannie W.; Hernandez-Ono, Antonio; Dahlson, Nicole; Repa, Joyce J.; Ginsberg, Henry N.; Ioannou, Yiannis A.; Sturley, Stephen L.

    2017-01-01

    Niemann-Pick type C (NP-C) disease is a fatal genetic lipidosis for which there is no Food and Drug Administration (FDA)-approved therapy. Vorinostat, an FDA-approved inhibitor of histone deacetylases, ameliorates lysosomal lipid accumulation in cultured NP-C patient fibroblasts. To assess the therapeutic potential of histone deacetylase inhibition, we pursued these in vitro observations in two murine models of NP-C disease. Npc1nmf164 mice, which express a missense mutation in the Npc1 gene, were treated intraperitoneally, from weaning, with the maximum tolerated dose of vorinostat (150 mg/kg, 5 days/week). Disease progression was measured via gene expression, liver function and pathology, serum and tissue lipid levels, body weight, and life span. Transcriptome analyses of treated livers indicated multiple changes consistent with reversal of liver dysfunction that typifies NP-C disease. Significant improvements in liver pathology and function were achieved by this treatment regimen; however, NPC1 protein maturation and levels, disease progression, weight loss, and animal morbidity were not detectably altered. Vorinostat concentrations were >200 μm in the plasma compartment of treated animals but were almost 100-fold lower in brain tissue. Apolipoprotein B metabolism and the expression of key components of lipid homeostasis in primary hepatocytes from null (Npc1−/−) and missense (Npc1nmf164) mutant mice were altered by vorinostat treatment, consistent with a response by these cells independent of the status of the Npc1 locus. These results suggest that HDAC inhibitors have utility to treat visceral NP-C disease. However, it is clear that improved blood-brain barrier penetration will be required to alleviate the neurological symptoms of human NP-C disease. PMID:28031458

  9. Does plasminogen activator inhibitor-1 drive lymphangiogenesis?

    DEFF Research Database (Denmark)

    Bruyère, Françoise; Melen-Lamalle, Laurence; Blacher, Silvia

    2010-01-01

    The purpose of this study is to explore the function of plasminogen activator inhibitor-1 (PAI-1) during pathological lymphangiogenesis. PAI-1, the main physiological inhibitor of plasminogen activators is involved in pathological angiogenesis at least by controlling extracellular proteolysis and...

  10. Identification of novel inhibitors of Pseudomonas aeruginosa MurC enzyme derived from phage-displayed peptide libraries.

    Science.gov (United States)

    El Zoeiby, Ahmed; Sanschagrin, François; Darveau, André; Brisson, Jean-Robert; Levesque, Roger C

    2003-03-01

    The machinery of peptidoglycan biosynthesis is an ideal site at which to look for novel antimicrobial targets. Phage display was used to develop novel peptide inhibitors for MurC, an essential enzyme involved in the early steps of biosynthesis of peptidoglycan monomer. We cloned and overexpressed the murA, -B and -C genes from Pseudomonas aeruginosa in the pET expression vector, adding a His-tag to their C termini. The three proteins were overproduced in Escherichia coli and purified to homogeneity in milligram quantities. MurA and -B were combinatorially used to synthesize the MurC substrate UDP-N-acetylmuramate, the identity of which was confirmed by mass spectrometry and nuclear magnetic resonance analysis. Two phage-display libraries were screened against MurC in order to identify peptide ligands to the enzyme. Three rounds of biopanning were carried out, successively increasing elution specificity from round 1 to 3. The third round was accomplished with both non-specific elution and competitive elution with each of the three MurC substrates, UDP-N-acetylmuramic acid (UNAM), ATP and L-alanine. The DNA of 10 phage, selected randomly from each group, was extracted and sequenced, and consensus peptide sequences were elucidated. Peptides were synthesized and tested for inhibition of the MurC-catalysed reaction, and two peptides were shown to be inhibitors of MurC activity with IC(50)s of 1.5 and 0.9 mM, respectively. The powerful selection technique of phage display allowed us to identify two peptide inhibitors of the essential bacterial enzyme MurC. The peptide sequences represent the basis for the synthesis of inhibitory peptidomimetic molecules.

  11. Development of a novel non-radioactive cell-based method for the screening of SGLT1 and SGLT2 inhibitors using 1-NBDG.

    Science.gov (United States)

    Chang, Hung-Chi; Yang, Su-Fu; Huang, Ching-Chun; Lin, Tzung-Sheng; Liang, Pi-Hui; Lin, Chun-Jung; Hsu, Lih-Ching

    2013-08-01

    Sodium-coupled glucose co-transporters SGLT1 and SGLT2 play important roles in intestinal absorption and renal reabsorption of glucose, respectively. Blocking SGLT2 is a novel mechanism for lowering the blood glucose level by inhibiting renal glucose reabsorption and selective SGLT2 inhibitors are under development for treatment of type 2 diabetes. Furthermore, it has been reported that perturbation of SGLT1 is associated with cardiomyopathy and cancer. Therefore, both SGLT1 and SGLT2 are potential therapeutic targets. Here we report the development of a non-radioactive cell-based method for the screening of SGLT inhibitors using COS-7 cells transiently expressing human SGLT1 (hSGLT1), CHO-K1 cells stably expressing human SGLT2 (hSGLT2), and a novel fluorescent d-glucose analogue 1-NBDG as a substrate. Our data indicate that 1-NBDG can be a good replacement for the currently used isotope-labeled SGLT substrate, (14)C-AMG. The Michaelis constant of 1-NBDG transport (0.55 mM) is similar to that of d-glucose (0.51 mM) and AMG (0.40 mM) transport through hSGLT1. The IC50 values of a SGLT inhibitor phlorizin for hSGLT1 obtained using 1-NBDG and (14)C-AMG were identical (0.11 μM) in our cell-based system. The IC50 values of dapagliflozin, a well-known selective SGLT2 inhibitor, for hSGLT2 and hSGLT1 determined using 1-NBDG were 1.86 nM and 880 nM, respectively, which are comparable to the published results obtained using (14)C-AMG. Compared to (14)C-AMG, the use of 1-NBDG is cost-effective, convenient and potentially more sensitive. Taken together, a non-radioactive system using 1-NBDG has been validated as a rapid and reliable method for the screening of SGLT1 and SGLT2 inhibitors.

  12. Viral kinetics in patients with chronic hepatitis C treated with the serine protease inhibitor BILN 2061

    NARCIS (Netherlands)

    Herrmann, Eva; Zeuzem, Stefan; Sarrazin, Christoph; Hinrichsen, Holger; Benhamou, Yves; Manns, Michael P.; Reiser, Markus; Reesink, Henk; Calleja, José L.; Forns, Xavier; Steinmann, Gerhard G.; Nehmiz, Gerhard

    2006-01-01

    We analysed viral kinetics from a 2-day treatment with BILN 2061, a serine protease inhibitor of hepatitis C virus, in patients chronically infected with genotype 1 hepatitis C virus. The efficiency (E), describing inhibition of viral production, was above 99.45% in all patients with minor or

  13. Angioedema hereditário: considerações sobre terapia Therapeutic approach of hereditary angioedema

    Directory of Open Access Journals (Sweden)

    Kélem de Nardi Chagas

    2004-09-01

    HAE ser causado pelo mesmo defeito e acometer membros da mesma família, diferentes critérios têm sido estabelecidos para o tratamento desses pacientes. Foram indicados diferentes esquemas terapêuticos para HAE e alguns dos pacientes puderam ser seguidos sem terapia medicamentosa.PURPOSE: Hereditary Angioedema was first described by William Osler in 1888 and it is caused by a hereditary or acquired deficiency of C1 esterase inhibitor (C1-INH. Treatment is indicated for acute attacks or prophylaxis of angioedema which occur in the subcutaneous tissue respiratory or gastrointestinal tracts. Treatment includes attenuated androgens, inhibitors of kininogen or plasminogen, like tranexamic acid or e-aminocaproic acid and the administration of C1-INH concentrate. We describe the peculiarities of the treatment chosen for 10 patients (4 families with HAE and their evolution. METHODS: Ten patients (1-38 years old with HAE were diagnosed by clinical history and laboratory evaluation. The following tests were performed for the complement system: C1-INH, C4 and C3 levels and hemolytic assay (CH50 and APH50 for the classic and alternative pathways. Treatment was initiated considering severity of symptoms, age, gender and therapeutic response of the patient. RESULTS: Clinical evaluation showed: 4/10 patients with recurrent subcutaneous edema; 3/10 with previous laryngeal edema and 3/10 with sporadic symptoms. Different severity of symptoms was verified in the same family. The laboratory evaluation detected: low C1-INH levels (10/10; low serum C4 level (8/10; undetectable CH50 (3/10 and low CH50 levels (6/10; low APH50 levels (2/10. Six out of ten patients did not receive any specific treatment and 2 of them had high risk of asphyxia. One adolescent had been controlled with e-aminocaproic acid, one child had been changed from danazol to tranexamic acid, a 30 year old female patient had received oxandrolone and a 38 year old man had been treated with danazol. CONCLUSIONS: Although

  14. Carbon-11 labelling of an inhibitor of acetylcholinesterase: [[sup 11]C]physostigmine

    Energy Technology Data Exchange (ETDEWEB)

    Bonnot-Lours, S.; Crouzel, C.; Prenant, C.; Hinnen, F. (CEA, 91 - Orsay (France). Service Hospitalier Frederic Joliot)

    1993-01-01

    Physostigmine, an alkaloid from calabar bean is a strong inhibitor of acetylcholinesterase and has been used clinically in the treatment of glaucoma, atropine intoxication, myasthenia gravis and more recently, in experimental trials in Alzheimer's disease. In order to study the AChE activity in the brain by positron emission tomography, we have undertaken the labelling of physostigmine with carbon-11. The synthesis involves the reaction of [[sup 11]C]methylisocyanate with eseroline. [[sup 11]C]Methylisocyanate was obtained by heating [[sup 11]C]acetylchloride with tetrabutylammonium azide in toluene. The synthesis of [[sup 11]C]CH[sub 3]COC1 involves the carbonation of methylmagnesium bromide in THF with cyclotron produced [[sup 11]C]carbon dioxide and the addition of phthaloyl dichloride. The [[sup 11]C]methylisocyanate is distilled into a solution of eseroline in ether with a small piece of sodium. After 10 minutes at 25[sup o]C, the solution is purified by HPLC and the appropriate fraction collected. Starting with 55.5 GBq (1.5 Ci) of [[sup 11]C]carbon dioxide, 0.92-1.48 GBq (25-40 mCi) of [[sup 11]C]Physostigmine are obtained 57 minutes after EOB. (author).

  15. Tofacitinib and analogs as inhibitors of the histone kinase PRK1 (PKN1).

    Science.gov (United States)

    Ostrovskyi, Dmytro; Rumpf, Tobias; Eib, Julia; Lumbroso, Alexandre; Slynko, Inna; Klaeger, Susan; Heinzlmeir, Stephanie; Forster, Michael; Gehringer, Matthias; Pfaffenrot, Ellen; Bauer, Silke Mona; Schmidtkunz, Karin; Wenzler, Sandra; Metzger, Eric; Kuster, Bernhard; Laufer, Stefan; Schüle, Roland; Sippl, Wolfgang; Breit, Bernhard; Jung, Manfred

    2016-09-01

    The histone kinase PRK1 has been identified as a potential target to combat prostate cancer but selective PRK1 inhibitors are lacking. The US FDA -approved JAK1-3 inhibitor tofacitinib also potently inhibits PRK1 in vitro. We show that tofacitinib also inhibits PRK1 in a cellular setting. Using tofacitinib as a starting point for structure-activity relationship studies, we identified a more potent and another more selective PRK1 inhibitor compared with tofacitinib. Furthermore, we found two potential PRK1/JAK3-selectivity hotspots. The identified inhibitors and the selectivity hotspots lay the basis for the development of selective PRK1 inhibitors. The identification of PRK1, but also of other cellular tofacitinib targets, has implications on its clinical use and on future development of tofacitinib-like JAK inhibitors. [Formula: see text].

  16. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

    OpenAIRE

    Patick, A K; Boritzki, T J; Bloom, L A

    1997-01-01

    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritona...

  17. Phosphodiesterase-4 inhibition alters gene expression and improves isoniazid-mediated clearance of Mycobacterium tuberculosis in rabbit lungs.

    Directory of Open Access Journals (Sweden)

    Selvakumar Subbian

    2011-09-01

    Full Text Available Tuberculosis (TB treatment is hampered by the long duration of antibiotic therapy required to achieve cure. This indolent response has been partly attributed to the ability of subpopulations of less metabolically active Mycobacterium tuberculosis (Mtb to withstand killing by current anti-TB drugs. We have used immune modulation with a phosphodiesterase-4 (PDE4 inhibitor, CC-3052, that reduces tumor necrosis factor alpha (TNF-α production by increasing intracellular cAMP in macrophages, to examine the crosstalk between host and pathogen in rabbits with pulmonary TB during treatment with isoniazid (INH. Based on DNA microarray, changes in host gene expression during CC-3052 treatment of Mtb infected rabbits support a link between PDE4 inhibition and specific down-regulation of the innate immune response. The overall pattern of host gene expression in the lungs of infected rabbits treated with CC-3052, compared to untreated rabbits, was similar to that described in vitro in resting Mtb infected macrophages, suggesting suboptimal macrophage activation. These alterations in host immunity were associated with corresponding down-regulation of a number of Mtb genes that have been associated with a metabolic shift towards dormancy. Moreover, treatment with CC-3052 and INH resulted in reduced expression of those genes associated with the bacterial response to INH. Importantly, CC-3052 treatment of infected rabbits was associated with reduced ability of Mtb to withstand INH killing, shown by improved bacillary clearance, from the lungs of co-treated animals compared to rabbits treated with INH alone. The results of our study suggest that changes in Mtb gene expression, in response to changes in the host immune response, can alter the responsiveness of the bacteria to antimicrobial agents. These findings provide a basis for exploring the potential use of adjunctive immune modulation with PDE4 inhibitors to enhance the efficacy of existing anti-TB treatment.

  18. Electrochemical and quantum chemical studies of some indole derivatives as corrosion inhibitors for C38 steel in molar hydrochloric acid

    International Nuclear Information System (INIS)

    Lebrini, M.; Robert, F.; Vezin, H.; Roos, C.

    2010-01-01

    A comparative study of 9H-pyrido[3,4-b]indole (norharmane) and 1-methyl-9H-pyrido[3,4-b]indole (harmane) as inhibitors for C38 steel corrosion in 1 M HCl solution at 25 o C was carried out. Potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) techniques were applied to study the metal corrosion behavior in the absence and presence of different concentrations of these inhibitors. The OCP as a function of time were also established. Cathodic and anodic polarization curves show that norharmane and harmane are a mixed-type inhibitors. Adsorption of indole derivatives on the C38 steel surface, in 1 M HCl solution, follows the Langmuir adsorption isotherm model. The ΔG ads o values were calculated and discussed. The potential of zero charge (PZC) of the C38 steel in inhibited solution was studied by the EIS method, and a mechanism for the adsorption process was proposed. Raman spectroscopy confirmed that indole molecules strongly adsorbed onto the steel surface. The electronic properties of indole derivates, obtained using the AM1 semi-empirical quantum chemical approach, were correlated with their experimental efficiencies using the linear resistance model (LR).

  19. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability

    OpenAIRE

    Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.

    2017-01-01

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...

  20. Inhibitor scaffold for the histone lysine demethylase KDM4C (JMJD2C)

    DEFF Research Database (Denmark)

    Leurs, Ulrike; Clausen, Rasmus P; Kristensen, Jesper L

    2012-01-01

    The human histone demethylases of the KDM4 (JMJD2) family have been associated to diseases such as prostate and breast cancer, as well as X-linked mental retardation. Therefore, these enzymes are considered oncogenes and their selective inhibition might be a possible therapeutic approach to treat...... cancer. Here we describe a heterocyclic ring system library screened against the histone demethylase KDM4C (JMJD2C) in the search for novel inhibitory scaffolds. A 4-hydroxypyrazole scaffold was identified as an inhibitor of KDM4C; this scaffold could be employed in the further development of novel...... therapeutics, as well as for the elucidation of the biological roles of KDM4C on epigenetic regulation....

  1. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo

    2006-11-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  2. The effects of residual platelets in plasma on plasminogen activator inhibitor-1 and plasminogen activator inhibitor-1-related assays

    NARCIS (Netherlands)

    M. Pieters (Marlien); S.A. Barnard (Sunelle A.); D.T. Loots (Du Toit); D.C. Rijken (Dingeman)

    2017-01-01

    textabstractDue to controversial evidence in the literature pertaining to the activity of plasminogen activator inhibitor-1 in platelets, we examined the effects of residual platelets present in plasma (a potential pre-analytical variable) on various plasminogen activator inhibitor-1 and plasminogen

  3. C1q protein binds to the apoptotic nucleolus and causes C1 protease degradation of nucleolar proteins.

    Science.gov (United States)

    Cai, Yitian; Teo, Boon Heng Dennis; Yeo, Joo Guan; Lu, Jinhua

    2015-09-11

    In infection, complement C1q recognizes pathogen-congregated antibodies and elicits complement activation. Among endogenous ligands, C1q binds to DNA and apoptotic cells, but whether C1q binds to nuclear DNA in apoptotic cells remains to be investigated. With UV irradiation-induced apoptosis, C1q initially bound to peripheral cellular regions in early apoptotic cells. By 6 h, binding concentrated in the nuclei to the nucleolus but not the chromatins. When nucleoli were isolated from non-apoptotic cells, C1q also bound to these structures. In vivo, C1q exists as the C1 complex (C1qC1r2C1s2), and C1q binding to ligands activates the C1r/C1s proteases. Incubation of nucleoli with C1 caused degradation of the nucleolar proteins nucleolin and nucleophosmin 1. This was inhibited by the C1 inhibitor. The nucleoli are abundant with autoantigens. C1q binding and C1r/C1s degradation of nucleolar antigens during cell apoptosis potentially reduces autoimmunity. These findings help us to understand why genetic C1q and C1r/C1s deficiencies cause systemic lupus erythematosus. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. [sup 14]C-labeling of a tetrahydroacridine, a novel CNS-selective cholinesterase inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Nishioka, Kazuhiko; Kamada, Takeshi; Kanamaru, Hiroshi (Sumitomo Chemical Co., Ltd., Takatsukasa, Takarazuka (Japan). Environmental Health Science Lab.)

    1992-06-01

    9-Amino-8-fluoro-2,4-methano-1,2,3,4-tetrahydroacridine citrate (SM-10888), a novel cholinesterase inhibitor, was labeled with carbon-14 at C9 of the tetrahydroacridine ring for use in metabolic studies. Carbonation of 2,6-difluorophenyllithium (3) with [[sup 14]C]carbon dioxide gave the acid (4). Chlorination of 4 followed by treatment of the resulting acid chloride with ammonia afforded the amide (5). Dehydration of 5 with thionyl chloride and subsequent displacement reaction with ammonia gave the aminobenzonitrile (7). Condensation of 7 with the ketone (8) in the presence of anhydrous zinc chloride yielded the aminoacridine (9), which was treated with citric acid to afford [9-[sup 14]C]SM-10888 (1). The overall yield of 1 was 37% from 2, and the specific activity was 1.35 GBq/mmol. (author).

  5. N- and C-alkylation of seven-membered iminosugars generates potent glucocerebrosidase inhibitors and F508del-CFTR correctors.

    Science.gov (United States)

    Désiré, J; Mondon, M; Fontelle, N; Nakagawa, S; Hirokami, Y; Adachi, I; Iwaki, R; Fleet, G W J; Alonzi, D S; Twigg, G; Butters, T D; Bertrand, J; Cendret, V; Becq, F; Norez, C; Marrot, J; Kato, A; Blériot, Y

    2014-11-28

    The glycosidase inhibitory properties of synthetic C-alkyl and N-alkyl six-membered iminosugars have been extensively studied leading to therapeutic candidates. The related seven-membered iminocyclitols have been less examined despite the report of promising structures. Using an in house ring enlargement/C-alkylation as well as cross-metathesis methodologies as the key steps, we have undertaken the synthesis and biological evaluation of a library of fourteen 2C- and eight N-alkyl tetrahydroxylated azepanes starting from an easily available glucopyranose-derived azidolactol. Four, six, nine and twelve carbon atom alkyl chains have been introduced. The study of two distinct D-gluco and L-ido stereochemistries for the tetrol pattern as well as R and S configurations for the C-2 carbon bearing the C-alkyl chain is reported. We observed that C-alkylation of the L-ido tetrahydroxylated azepane converts it from an α-L-fucosidase to a β-glucosidase and β-galactosidase inhibitor while N-alkylation of the D-gluco iminosugar significantly improves its inhibition profile leading to potent β-glucosidase, β-galactosidase, α-L-rhamnosidase and β-glucuronidase inhibitors whatever the stereochemistry of the alkyl chain. Interestingly, the N-alkyl chain length usually parallels the azepane inhibitor potency as exemplified by the identification of a potent glucocerebrosidase inhibitor (Ki 1 μM) bearing a twelve carbon atom chain. Additionally, several C-alkyl azepanes demonstrated promising F508del-CFTR correction unlike the parent tetrahydroxyazepanes. None of the C-alkyl and N-alkyl azepanes did inhibit ER α-glucosidases I or II.

  6. Evaluation of the efficacy of valproic acid and suberoylanilide hydroxamic acid (vorinostat in enhancing the effects of first-line tuberculosis drugs against intracellular Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Martin Rao

    2018-04-01

    Full Text Available Background: New tuberculosis (TB drug treatment regimens are urgently needed. This study evaluated the potential of the histone deacetylase inhibitors (HDIs valproic acid (VPA and suberoylanilide hydroxamic acid (SAHA to enhance the effects of first-line anti-TB drugs against intracellular Mycobacterium tuberculosis. Methods: M. tuberculosis H37Rv cultures were exposed to VPA or SAHA over 6 days, in the presence or absence of isoniazid (INH and rifampicin (RIF. The efficacy of VPA and SAHA against intracellular M. tuberculosis with and without INH or RIF was tested by treating infected macrophages. Bactericidal activity was assessed by counting mycobacterial colony-forming units (CFU. Results: VPA treatment exhibited superior bactericidal activity to SAHA (2-log CFU reduction, while both HDIs moderately improved the activity of RIF against extracellular M. tuberculosis. The bactericidal effect of VPA against intracellular M. tuberculosis was greater than that of SAHA (1-log CFU reduction and equalled that of INH (1.5-log CFU reduction. INH/RIF and VPA/SAHA combination treatment inhibited intracellular M. tuberculosis survival in a shorter time span than monotherapy (3 days vs. 6 days. Conclusions: VPA and SAHA have adjunctive potential to World Health Organization-recommended TB treatment regimens. Clinical evaluation of the two drugs with regard to reducing the treatment duration and improving treatment outcomes in TB is warranted. Keywords: Mycobacterium tuberculosis, Adjunct host-directed therapy, Tuberculosis, Histone deacetylase inhibitors, Repurposed drugs

  7. The lectin complement pathway serine proteases (MASPs) represent a possible crossroad between the coagulation and complement systems in thromboinflammation

    DEFF Research Database (Denmark)

    Kozarcanin, H; Lood, C; Fog, Lea Munthe

    2016-01-01

    by AT during clotting without the assistance of heparin. In all other cases the MASPs were, as previously reported, inactivated by C1-INH. In systemic lupus erythematosus patients with thrombotic disease and in polytrauma patients, the levels of activated MASP-1 and MASP-2 in complex with both AT and C1-INH...

  8. Molecular characterization of c-Abl/c-Src kinase inhibitors targeted against murine tumour progenitor cells that express stem cell markers.

    Directory of Open Access Journals (Sweden)

    Thomas Kruewel

    Full Text Available BACKGROUND: The non-receptor tyrosine kinases c-Abl and c-Src are overexpressed in various solid human tumours. Inhibition of their hyperactivity represents a molecular rationale in the combat of cancerous diseases. Here we examined the effects of a new family of pyrazolo [3,4-d] pyrimidines on a panel of 11 different murine lung tumour progenitor cell lines, that express stem cell markers, as well as on the human lung adenocarcinoma cell line A549, the human hepatoma cell line HepG2 and the human colon cancer cell line CaCo2 to obtain insight into the mode of action of these experimental drugs. METHODOLOGY/PRINCIPAL FINDINGS: Treatment with the dual kinase inhibitors blocked c-Abl and c-Src kinase activity efficiently in the nanomolar range, induced apoptosis, reduced cell viability and caused cell cycle arrest predominantly at G0/G1 phase while western blot analysis confirmed repressed protein expression of c-Abl and c-Src as well as the interacting partners p38 mitogen activated protein kinase, heterogenous ribonucleoprotein K, cyclin dependent kinase 1 and further proteins that are crucial for tumour progression. Importantly, a significant repression of the epidermal growth factor receptor was observed while whole genome gene expression analysis evidenced regulation of many cell cycle regulated genes as well integrin and focal adhesion kinase (FAK signalling to impact cytoskeleton dynamics, migration, invasion and metastasis. CONCLUSIONS/SIGNIFICANCE: Our experiments and recently published in vivo engraftment studies with various tumour cell lines revealed the dual kinase inhibitors to be efficient in their antitumour activity.

  9. Leucine Modulates Mitochondrial Biogenesis and SIRT1-AMPK Signaling in C2C12 Myotubes

    Directory of Open Access Journals (Sweden)

    Chunzi Liang

    2014-01-01

    Full Text Available Previous studies from this laboratory demonstrate that dietary leucine protects against high fat diet-induced mitochondrial impairments and stimulates mitochondrial biogenesis and energy partitioning from adipocytes to muscle cells through SIRT1-mediated mechanisms. Moreover, β-hydroxy-β-methyl butyrate (HMB, a metabolite of leucine, has been reported to activate AMPK synergistically with resveratrol in C2C12 myotubes. Therefore, we hypothesize that leucine-induced activation of SIRT1 and AMPK is the central event that links the upregulated mitochondrial biogenesis and fatty acid oxidation in skeletal muscle. Thus, C2C12 myotubes were treated with leucine (0.5 mM, alanine (0.5 mM, valine (0.5 mM, EX527 (SIRT1 inhibitor, 25 μM, and Compound C (AMPK inhibitor, 25 μM alone or in combination to determine the roles of AMPK and SIRT1 in leucine-modulation of energy metabolism. Leucine significantly increased mitochondrial content, mitochondrial biogenesis-related genes expression, fatty acid oxidation, SIRT1 activity and gene expression, and AMPK phosphorylation in C2C12 myotubes compared to the controls, while EX527 and Compound C markedly attenuated these effects. Furthermore, leucine treatment for 24 hours resulted in time-dependent increases in cellular NAD+, SIRT1 activity, and p-AMPK level, with SIRT1 activation preceding that of AMPK, indicating that leucine activation of SIRT1, rather than AMPK, is the primary event.

  10. 1H and 13C NMR Chemical Shift Assignments and Conformational Analysis for the Two Diastereomers of the Vitamin K Epoxide Reductase Inhibitor Brodifacoum

    International Nuclear Information System (INIS)

    Cort, John R.; Cho, Herman M.

    2009-01-01

    Proton and 13C NMR chemical shift assignments and 1H-1H scalar couplings for the two diastereomers of the vitamin K epoxide reductase (VKOR) inhibitor brodifacoum have been determined from acetone solutions containing both diastereomers. Data were obtained from homo- and heteronuclear correlation spectra acquired at 1H frequencies of 750 and 900 MHz over a 268-303 K temperature range. Conformations inferred from scalar coupling and 1-D NOE measurements exhibit large differences between the diastereomers. Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.

  11. PD-1/PD-L1 Inhibitors for Immuno-oncology: From Antibodies to Small Molecules.

    Science.gov (United States)

    Geng, Qiaohong; Jiao, Peifu; Jin, Peng; Su, Gaoxing; Dong, Jinlong; Yan, Bing

    2018-02-12

    The recent regulatory approvals of immune checkpoint protein inhibitors, such as ipilimumab, pembrolizumab, nivolumab, atezolizumab, durvalumab, and avelumab ushered a new era in cancer therapy. These inhibitors do not attack tumor cells directly but instead mobilize the immune system to re-recognize and eradicate tumors, which endows them with unique advantages including durable clinical responses and substantial clinical benefits. PD-1/PD-L1 inhibitors, a pillar of immune checkpoint protein inhibitors, have demonstrated unprecedented clinical efficacy in more than 20 cancer types. Besides monoclonal antibodies, diverse PD- 1/PD-L1 inhibiting candidates, such as peptides, small molecules have formed a powerful collection of weapons to fight cancer. The goal of this review is to summarize and discuss the current PD-1/PD-L1 inhibitors including candidates under clinical development, their molecular interactions with PD-1 or PD-L1, the disclosed structureactivity relationships of peptides and small molecules as inhibitors. Current PD-1/PD-L1 inhibitors under clinical development are exclusively dominated by antibodies. The molecular interactions of therapeutic antibodies with PD-1 or PD-L1 have been gradually elucidated for the design of novel inhibitors. Various peptides and traditional small molecules have been investigated in preclinical model to discover novel PD-1/PD-L1 inhibitors. Peptides and small molecules may play an important role in immuno-oncology because they may bind to multiple immune checkpoint proteins via rational design, opening opportunity for a new generation of novel PD-1/PD-L1 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. Novel selective PDE type 1 inhibitors cause vasodilatation and lower blood pressure in rats

    DEFF Research Database (Denmark)

    Laursen, Morten; Beck, Lilliana; Kehler, Jan

    2017-01-01

    BACKGROUND AND PURPOSE: The PDE enzymes (PDE1-11) hydrolyse and thus inactivate cyclic nucleotides and are important in the regulation of the cardiovascular system. Here,we have investigated the effects on the cardiovascular system, of two novel selective PDE1 inhibitors, Lu AF41228 and Lu AF58027...... and Lu AF58027 inhibited PDE1A, PDE1B and PDE1C enzyme activity, while micromolar concentrations were required to observe inhibitory effects at other PDEs. RT-PCR revealed expression of PDE1A, PDE1B and PDE1C in rat brain, heart and aorta, but only PDE1A and PDE1B in mesenteric arteries. In rat isolated...... and Lu AF58027 dose-dependently lowered mean BP and increased heart rate. In conscious rats with telemetric pressure transducers, repeated dosing with Lu AF41228 lowered mean arterial BP 10-15 mmHg and increased heart rate. CONCLUSIONS AND IMPLICATIONS: These novel PDE1 inhibitors induce vasodilation...

  13. A chiral synthesis of dapoxetine hydrochloride, a serotonin re-uptake inhibitor, and its 14C isotopomer

    International Nuclear Information System (INIS)

    Wheeler, W.J.; O'Bannon, D.D.

    1992-01-01

    The 14 C-isotopmer of dapoxetine-[ 14 C] HCl (S (+) -N,N-dimethyl-α[2-(1-naphthalenyloxy)ethyl-2- 14 C]benzenemeth a-n amine hydrochloride, 1a), a potent serotonin re-uptake inhibitor has been prepared by a chiral synthesis, starting with tert. -butyloxyphenylglycine (3). Borane reduction, followed by activation of the resulting alcohol 4 as its mesylate 5b, provided the chiral starting material. The radiolabel was introduced by reaction of 5b with sodium cyanide-[ 14 C]. The desired product (1) was then elaborated from nitrile 6a,b via a five step synthesis in an overall 19.5% radiochemical yield. (Author)

  14. Different effects of histone deacetylase inhibitors nicotinamide and trichostatin A (TSA) in C17.2 neural stem cells.

    Science.gov (United States)

    Wang, Haifeng; Cheng, Hua; Wang, Kai; Wen, Tieqiao

    2012-11-01

    Histone deacetylase inhibitors are involved in proliferation, apoptosis, cell cycle, mRNA transcription, and protein expression in various cells. However, the molecular mechanism underlying such functions is still not fully clear. In this study, we used C17.2 neural stem cell (NSC) line as a model to evaluate the effects of nicotinamide and trichostatin A (TSA) on cell characteristics. Results show that nicotinamide and TSA greatly inhibit cell growth, lead to cell morphology changes, and effectively induce cell apoptosis in a dose-dependent manner. Western blot analyses confirmed that nicotinamide significantly decreases the expression of bcl-2 and p38. Further insight into the molecular mechanisms shows the suppression of phosphorylation in eukaryotic initiation factor 4E-binding protein 1 (4EBP1) by nicotinamide, whereas, an increased expression of bcl-2 and p38 and phosphorylation of 4EBP1 by TSA. However, both nicotinamide and TSA significantly increase the expression of cytochrome c (cyt c). These results strongly suggest that bcl-2, p38, cyt c, and p-4EBP1 could suppress proliferation and induce apoptosis of C17.2 NSCs mediated by histone deacetylase inhibitors, nicotinamide and TSA, involving different molecular mechanisms.

  15. Opuntia ficus-indica Extract as Green Corrosion Inhibitor for Carbon Steel in 1 M HCl Solution

    Directory of Open Access Journals (Sweden)

    J. P. Flores-De los Ríos

    2015-01-01

    Full Text Available The effect of Opuntia ficus-indica (Nopal as green corrosion inhibitor for carbon steel in 1 M HCl solution has been investigated by using weight loss tests, potentiodynamic polarization curves, and electrochemical impedance spectroscopy measurements. Also, scanning electron microscopy (SEM and Fourier transform infrared spectroscopy (FT-IR analysis were performed. The inhibitor concentrations used ranged from 0 to 300 ppm at 25, 40, and 60°C. Results indicated the inhibition efficiency increases with increasing extract concentration and decreases with the temperature, and the inhibitor acted as a cathodic-type inhibitor which is physically absorbed onto the steel surface. In fact, the adsorption of the inhibitor on the steel surface follows the Langmuir adsorption isotherm, indicating monolayer adsorption. The presence of heteroatoms such as C, N, and O and OH groups were responsible for the corrosion inhibition.

  16. HDAC inhibitors enhance neratinib activity and when combined enhance the actions of an anti-PD-1 immunomodulatory antibody in vivo.

    Science.gov (United States)

    Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

    2017-10-27

    Patients whose NSCLC tumors become afatinib resistant presently have few effective therapeutic options to extend their survival. Afatinib resistant NSCLC cells were sensitive to clinically relevant concentrations of the irreversible pan-HER inhibitor neratinib, but not by the first generation ERBB1/2/4 inhibitor lapatinib. In multiple afatinib resistant NSCLC clones, HDAC inhibitors reduced the expression of ERBB1/3/4, but activated c-SRC, which resulted in higher total levels of ERBB1/3 phosphorylation. Neratinib also rapidly reduced the expression of ERBB1/2/3/4, c-MET and of mutant K-/N-RAS; K-RAS co-localized with phosphorylated ATG13 and with cathepsin B in vesicles. Combined exposure of cells to [neratinib + HDAC inhibitors] caused inactivation of mTORC1 and mTORC2, enhanced autophagosome and subsequently autolysosome formation, and caused an additive to greater than additive induction of cell death. Knock down of Beclin1 or ATG5 prevented HDAC inhibitors or neratinib from reducing ERBB1/3/4 and K-/N-RAS expression and reduced [neratinib + HDAC inhibitor] lethality. Neratinib and HDAC inhibitors reduced the expression of multiple HDAC proteins via autophagy that was causal in the reduced expression of PD-L1, PD-L2 and ornithine decarboxylase, and increased expression of Class I MHCA. In vivo , neratinib and HDAC inhibitors interacted to suppress the growth of 4T1 mammary tumors, an effect that was enhanced by an anti-PD-1 antibody. Our data support the premises that neratinib lethality can be enhanced by HDAC inhibitors, that neratinib may be a useful therapeutic tool in afatinib resistant NSCLC, and that [neratinib + HDAC inhibitor] exposure facilitates anti-tumor immune responses.

  17. Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2010-03-01

    Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

  18. A comparison of effects of DPP-4 inhibitor and SGLT2 inhibitor on lipid profile in patients with type 2 diabetes.

    Science.gov (United States)

    Cha, Seon-Ah; Park, Yong-Moon; Yun, Jae-Seung; Lim, Tae-Seok; Song, Ki-Ho; Yoo, Ki-Dong; Ahn, Yu-Bae; Ko, Seung-Hyun

    2017-04-13

    Previous studies suggest that dipeptidyl peptidase-4 (DPP-4) inhibitors and sodium glucose cotransporter 2 (SGLT2) inhibitors have different effects on the lipid profile in patients with type 2 diabetes. We investigated the effects of DPP-4 inhibitors and SGLT2 inhibitors on the lipid profile in patients with type 2 diabetes. From January 2013 to December 2015, a total of 228 patients with type 2 diabetes who were receiving a DPP-4 inhibitor or SGLT2 inhibitor as add-on therapy to metformin and/or a sulfonylurea were consecutively enrolled. We compared the effects of DPP-4 inhibitors and SGLT2 inhibitors on the lipid profile at baseline and after 24 weeks of treatment. To compare lipid parameters between the two groups, we used the analysis of covariance (ANCOVA). A total of 184 patients completed follow-up (mean age: 53.1 ± 6.9 years, mean duration of diabetes: 7.1 ± 5.7 years). From baseline to 24 weeks, HDL-cholesterol (HDL-C) levels were increased by 0.5 (95% CI, -0.9 to 2.0) mg/dl with a DPP-4 inhibitor and by 5.1 (95% CI, 3.0 to 7.1) mg/dl with an SGLT2 inhibitor (p = 0.001). LDL-cholesterol (LDL-C) levels were reduced by 8.4 (95% CI, -14.0 to -2.8) mg/dl with a DPP-4 inhibitor, but increased by 1.3 (95% CI, -5.1 to 7.6) mg/dl with an SGLT2 inhibitor (p = 0.046). There was no significant difference in the mean hemoglobin A1c (8.3 ± 1.1 vs. 8.0 ± 0.9%, p = 0.110) and in the change of total cholesterol (TC) (p = 0.836), triglyceride (TG) (p = 0.867), apolipoprotein A (p = 0.726), apolipoprotein B (p = 0.660), and lipoprotein (a) (p = 0.991) between the DPP-4 inhibitor and the SGLT2 inhibitor. The SGLT2 inhibitor was associated with a significant increase in HDL-C and LDL-C after 24 weeks of SGLT2 inhibitor treatment in patients with type 2 diabetes compared with those with DPP-4 inhibitor treatment in this study. This study was conducted by retrospective medical record review.

  19. V3-independent competitive resistance of a dual-X4 HIV-1 to the CXCR4 inhibitor AMD3100.

    Directory of Open Access Journals (Sweden)

    Yosuke Maeda

    Full Text Available A CXCR4 inhibitor-resistant HIV-1 was isolated from a dual-X4 HIV-1 in vitro. The resistant variant displayed competitive resistance to the CXCR4 inhibitor AMD3100, indicating that the resistant variant had a higher affinity for CXCR4 than that of the wild-type HIV-1. Amino acid sequence analyses revealed that the resistant variant harbored amino acid substitutions in the V2, C2, and C4 regions, but no remarkable changes in the V3 loop. Site-directed mutagenesis confirmed that the changes in the C2 and C4 regions were principally involved in the reduced sensitivity to AMD3100. Furthermore, the change in the C4 region was associated with increased sensitivity to soluble CD4, and profoundly enhanced the entry efficiency of the virus. Therefore, it is likely that the resistant variant acquired the higher affinity for CD4/CXCR4 by the changes in non-V3 regions. Taken together, a CXCR4 inhibitor-resistant HIV-1 can evolve using a non-V3 pathway.

  20. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  1. Cellular growth kinetics distinguish a cyclophilin inhibitor from an HSP90 inhibitor as a selective inhibitor of hepatitis C virus.

    Directory of Open Access Journals (Sweden)

    Rudolf K F Beran

    Full Text Available During antiviral drug discovery, it is critical to distinguish molecules that selectively interrupt viral replication from those that reduce virus replication by adversely affecting host cell viability. In this report we investigate the selectivity of inhibitors of the host chaperone proteins cyclophilin A (CypA and heat-shock protein 90 (HSP90 which have each been reported to inhibit replication of hepatitis C virus (HCV. By comparing the toxicity of the HSP90 inhibitor, 17-(Allylamino-17-demethoxygeldanamycin (17-AAG to two known cytostatic compounds, colchicine and gemcitabine, we provide evidence that 17-AAG exerts its antiviral effects indirectly through slowing cell growth. In contrast, a cyclophilin inhibitor, cyclosporin A (CsA, exhibited selective antiviral activity without slowing cell proliferation. Furthermore, we observed that 17-AAG had little antiviral effect in a non-dividing cell-culture model of HCV replication, while CsA reduced HCV titer by more than two orders of magnitude in the same model. The assays we describe here are useful for discriminating selective antivirals from compounds that indirectly affect virus replication by reducing host cell viability or slowing cell growth.

  2. c-Abl inhibitors enable insights into the pathophysiology and neuroprotection in Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Dan Lindholm

    2016-10-01

    Full Text Available Parkinson’s disease (PD is a progressive neurodegenerative disorder causing movement disabilities and several non-motor symptoms in afflicted patients. Recent studies in animal models of PD and analyses of brain specimen from PD patients revealed an increase in the level and activity of the non-receptor tyrosine kinase Abelson (c-Abl in dopaminergic neurons with phosphorylation of protein substrates, such as α-synuclein and the E3 ubiquitin ligase, Parkin. Most significantly inhibition of c-Abl kinase activity by small molecular compounds used in the clinic to treat human leukemia have shown promising neuroprotective effects in cell and animal models of PD. This has raised hope that similar beneficial outcome may also be observed in the treatment of PD patients by using c-Abl inhibitors. Here we highlight the background for the current optimism, reviewing c-Abl and its relationship to pathophysiological pathways prevailing in PD, as well as discussing issues related to the pharmacology and safety of current c-Abl inhibitors. Clearly more rigorously controlled and well-designed trials are needed before the c-Abl inhibitors can be used in the neuroclinic to possibly benefit an increasing number of PD patients.

  3. SGLT-2 Inhibitors: Is There a Role in Type 1 Diabetes Mellitus Management?

    Science.gov (United States)

    Ahmed-Sarwar, Nabila; Nagel, Angela K; Leistman, Samantha; Heacock, Kevin

    2017-09-01

    The purpose of this review is to identify and evaluate disease management of patients with type 1 diabetes mellitus (T1DM) who were treated with a sodium-glucose cotransporter 2 (SGLT-2) inhibitor as an adjunct to insulin therapy. A PubMed (1969 to March 2017) and Ovid (1946 to March 2017) search was performed for articles published utilizing the following MESH terms: canagliflozin, empagliflozin, dapagliflozin, type 1 diabetes mellitus, insulin dependent diabetes, insulin, sodium-glucose transporter 2. There were no limitations placed on publication type. All English-language articles were evaluated for association of SGLT-2 inhibitors and type 1 diabetes. Further studies were identified by review of pertinent manuscript bibliographies. All 3 SGLT-2 inhibitors, when combined with insulin, resulted in an overall reduction of hemoglobin A1C (up to 0.49%), lower total daily insulin doses, and a reduction in weight (up to 2.7 kg). The combination therapy of insulin and SGLT-2 inhibitors also resulted in a lower incidence of hypoglycemia. Study duration varied from 2 to 18 weeks. A review of the identified literature indicated that there is a potential role for the combination of SGLT-2 inhibitors with insulin in T1DM for improving glycemic control without increasing the risk of hypoglycemia. The short duration and small sample sizes limit the ability to fully evaluate the incidences of diabetic ketoacidosis and urogenital infections. The risks associated with this combination of medications require further evaluation.

  4. Angiotensin II reduces cardiac AdipoR1 expression through AT1 receptor/ROS/ERK1/2/c-Myc pathway.

    Directory of Open Access Journals (Sweden)

    Li Li

    Full Text Available Adiponectin, an abundant adipose tissue-derived protein, exerts protective effect against cardiovascular disease. Adiponectin receptors (AdipoR1 and AdipoR2 mediate the beneficial effects of adiponectin on the cardiovascular system. However, the alteration of AdipoRs in cardiac remodeling is not fully elucidated. Here, we investigated the effect of angiotensin II (AngII on cardiac AdipoRs expression and explored the possible molecular mechanism. AngII infusion into rats induced cardiac hypertrophy, reduced AdipoR1 but not AdipoR2 expression, and attenuated the phosphorylations of adenosine monophosphate-activated protein kinase and acetyl coenzyme A carboxylase, and those effects were all reversed by losartan, an AngII type 1 (AT1 receptor blocker. AngII reduced expression of AdipoR1 mRNA and protein in cultured neonatal rat cardiomyocytes, which was abolished by losartan, but not by PD123319, an AT2 receptor antagonist. The antioxidants including reactive oxygen species (ROS scavenger NAC, NADPH oxidase inhibitor apocynin, Nox2 inhibitor peptide gp91 ds-tat, and mitochondrial electron transport chain complex I inhibitor rotenone attenuated AngII-induced production of ROS and phosphorylation of extracellular signal-regulated kinase (ERK 1/2. AngII-reduced AdipoR1 expression was reversed by pretreatment with NAC, apocynin, gp91 ds-tat, rotenone, and an ERK1/2 inhibitor PD98059. Chromatin immunoprecipitation assay demonstrated that AngII provoked the recruitment of c-Myc onto the promoter region of AdipoR1, which was attenuated by PD98059. Moreover, AngII-induced DNA binding activity of c-Myc was inhibited by losartan, NAC, apocynin, gp91 ds-tat, rotenone, and PD98059. c-Myc small interfering RNA abolished the inhibitory effect of AngII on AdipoR1 expression. Our results suggest that AngII inhibits cardiac AdipoR1 expression in vivo and in vitro and AT1 receptor/ROS/ERK1/2/c-Myc pathway is required for the downregulation of AdipoR1 induced by AngII.

  5. Targeting Type 2 Diabetes with C-Glucosyl Dihydrochalcones as Selective Sodium Glucose Co-Transporter 2 (SGLT2) Inhibitors: Synthesis and Biological Evaluation.

    Science.gov (United States)

    Jesus, Ana R; Vila-Viçosa, Diogo; Machuqueiro, Miguel; Marques, Ana P; Dore, Timothy M; Rauter, Amélia P

    2017-01-26

    Inhibiting glucose reabsorption by sodium glucose co-transporter proteins (SGLTs) in the kidneys is a relatively new strategy for treating type 2 diabetes. Selective inhibition of SGLT2 over SGLT1 is critical for minimizing adverse side effects associated with SGLT1 inhibition. A library of C-glucosyl dihydrochalcones and their dihydrochalcone and chalcone precursors was synthesized and tested as SGLT1/SGLT2 inhibitors using a cell-based fluorescence assay of glucose uptake. The most potent inhibitors of SGLT2 (IC 50 = 9-23 nM) were considerably weaker inhibitors of SGLT1 (IC 50 = 10-19 μM). They showed no effect on the sodium independent GLUT family of glucose transporters, and the most potent ones were not acutely toxic to cultured cells. The interaction of a C-glucosyl dihydrochalcone with a POPC membrane was modeled computationally, providing evidence that it is not a pan-assay interference compound. These results point toward the discovery of structures that are potent and highly selective inhibitors of SGLT2.

  6. Inhibitors of the mitochondrial cytochrome b-c1 complex inhibit the cyanide-insensitive respiration of Trypanosoma brucei.

    Science.gov (United States)

    Turrens, J F; Bickar, D; Lehninger, A L

    1986-06-01

    The cyanide-insensitive respiration of bloodstream trypomastigote forms of Trypanosoma brucei (75 +/- 8 nmol O2 min-1(mg protein)-1) is completely inhibited by the mitochondrial ubiquinone-like inhibitors 2-hydroxy-3-undecyl-1,4-naphthoquinone (UHNQ) and 5-n-undecyl-6-hydroxy-4,7-dioxobenzothiazole (UHDBT). The Ki values for UHDBT (30 nM) and UHNQ (2 microM) are much lower than the reported Ki for salicylhydroxamic acid (SHAM) (5 microM), a widely used inhibitor of the cyanide-insensitive oxidase. UHNQ also stimulated the glycerol-3-phosphate-dependent reduction of phenazine methosulfate, demonstrating that the site of UHNQ inhibition is on the terminal oxidase of the cyanide-insensitive respiration of T. brucei. These results suggest that a ubiquinone-like compound may act as an electron carrier between the two enzymatic components of the cyanide-insensitive glycerol-3-phosphate oxidase.

  7. Assessment of cerebral P-glycoprotein expression and function with PET by combined [11C]inhibitor and [11C]substrate scans in rats

    International Nuclear Information System (INIS)

    Müllauer, Julia; Karch, Rudolf; Bankstahl, Jens P.; Bankstahl, Marion; Stanek, Johann; Wanek, Thomas; Mairinger, Severin; Müller, Markus; Löscher, Wolfgang; Langer, Oliver; Kuntner, Claudia

    2013-01-01

    Introduction: The adenosine triphosphate-binding cassette (ABC) transporter P-glycoprotein (Pgp) protects the brain from accumulation of lipophilic compounds by active efflux transport across the blood–brain barrier. Changes in Pgp function/expression may occur in neurological disorders, such as epilepsy, Alzheimer’s or Parkinson’s disease. In this work we investigated the suitability of the radiolabeled Pgp inhibitors [ 11 C]elacridar and [ 11 C]tariquidar to visualize Pgp density in rat brain with PET. Methods: Rats underwent a first PET scan with [ 11 C]elacridar (n = 5) or [ 11 C]tariquidar (n = 6) followed by a second scan with the Pgp substrate (R)-[ 11 C]verapamil after administration of unlabeled tariquidar at a dose which half-maximally inhibits cerebral Pgp (3 mg/kg). Compartmental modeling using an arterial input function and Logan graphical analysis were used to estimate rate constants and volumes of distribution (V T ) of radiotracers in different brain regions. Results: Brain PET signals of [ 11 C]elacridar and [ 11 C]tariquidar were very low (∼ 0.5 standardized uptake value, SUV). There was a significant negative correlation between V T and K 1 (i.e. influx rate constant from plasma into brain) values of [ 11 C]elacridar or [ 11 C]tariquidar and V T and K 1 values of (R)-[ 11 C]verapamil in different brain regions which was consistent with binding of [ 11 C]inhibitors to Pgp and efflux of (R)-[ 11 C]verapamil by Pgp. Conclusion: The small Pgp binding signals obtained with [ 11 C]elacridar and [ 11 C]tariquidar limit the applicability of these tracers to measure cerebral Pgp density. PET tracers with higher (i.e. subnanomolar) binding affinities will be needed to visualize the low density of Pgp in brain

  8. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  9. Effectiveness of icatibant for treatment of hereditary angioedema attacks is not affected by body weight: findings from the Icatibant Outcome Survey, a cohort observational study.

    Science.gov (United States)

    Caballero, Teresa; Zanichelli, Andrea; Aberer, Werner; Maurer, Marcus; Longhurst, Hilary J; Bouillet, Laurence; Andresen, Irmgard

    2018-01-01

    Icatibant is a bradykinin B2-receptor antagonist used for the treatment of hereditary angioedema attacks resulting from C1-inhibitor deficiency. Treatment is not adjusted by body weight however the impact of body mass index (BMI) on the effectiveness of icatibant is not documented in the literature. We examined disease characteristics and icatibant treatment effectiveness in patients stratified by BMI in the Icatibant Outcome Survey, an ongoing, international, observational study monitoring the real-world safety and effectiveness of icatibant. Attack and treatment characteristics as well as outcomes following treatment with icatibant were compared among patients with underweight, normal, overweight, and obese BMI. Data from 2697 icatibant-treated attacks in 342 patients (3.5, 44.7, 34.8, and 17.0% patients of underweight, normal, overweight, and obese BMI, respectively) were analyzed. There was no significant difference in the frequency and severity of attacks across BMI groups, although obese patients tended to have more attacks of high severity. There was no impact of BMI on the frequency of laryngeal attacks, but patients with normal BMI had fewer cutaneous attacks and more abdominal attacks. Most attacks (71.9-83.8%) were treated with a single icatibant injection without the need for rescue with plasma-derived C1-inhibitor (pdC1-INH), regardless of BMI. Patients with obese BMI used pdC1-INH as rescue treatment more often (P < 0.0001; P = 0.0232 excluding 2 outliers) and treated attacks earlier than patients with normal BMI (P = 0.007). Furthermore, time to resolution and duration of attack were shorter for patients with high BMI (P < 0.001 for overweight and P < 0.05 for obese versus normal). Overall, icatibant was comparatively effective in treating attacks in patients across all BMI groups. Trial registration NCT01034969.

  10. The irreversible ERBB1/2/4 inhibitor neratinib interacts with the PARP1 inhibitor niraparib to kill ovarian cancer cells.

    Science.gov (United States)

    Booth, Laurence; Roberts, Jane L; Samuel, Peter; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Poklepovic, Andrew; Dent, Paul

    2018-06-03

    The irreversible ERBB1/2/4 inhibitor neratinib has been shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET, PDGFRα and mutant RAS proteins via autophagic degradation. Neratinib interacted in an additive to synergistic fashion with the approved PARP1 inhibitor niraparib to kill ovarian cancer cells. Neratinib and niraparib caused the ATM-dependent activation of AMPK which in turn was required to cause mTOR inactivation, ULK-1 activation and ATG13 phosphorylation. The drug combination initially increased autophagosome levels followed later by autolysosome levels. Preventing autophagosome formation by expressing activated mTOR or knocking down of Beclin1, or knock down of the autolysosome protein cathepsin B, reduced drug combination lethality. The drug combination caused an endoplasmic reticulum stress response as judged by enhanced eIF2α phosphorylation that was responsible for reducing MCL-1 and BCL-XL levels and increasing ATG5 and Beclin1 expression. Knock down of BIM, but not of BAX or BAK, reduced cell killing. Expression of activated MEK1 prevented the drug combination increasing BIM expression and reduced cell killing. Downstream of the mitochondrion, drug lethality was partially reduced by knock down of AIF, but expression of dominant negative caspase 9 was not protective. Our data demonstrate that neratinib and niraparib interact to kill ovarian cancer cells through convergent DNA damage and endoplasmic reticulum stress signaling. Cell killing required the induction of autophagy and was cathepsin B and AIF -dependent, and effector caspase independent.

  11. Design, Synthesis, and Biological Activity of 1,2,3-Triazolobenzodiazepine BET Bromodomain Inhibitors.

    Science.gov (United States)

    Sharp, Phillip P; Garnier, Jean-Marc; Hatfaludi, Tamas; Xu, Zhen; Segal, David; Jarman, Kate E; Jousset, Hélène; Garnham, Alexandra; Feutrill, John T; Cuzzupe, Anthony; Hall, Peter; Taylor, Scott; Walkley, Carl R; Tyler, Dean; Dawson, Mark A; Czabotar, Peter; Wilks, Andrew F; Glaser, Stefan; Huang, David C S; Burns, Christopher J

    2017-12-14

    A number of diazepines are known to inhibit bromo- and extra-terminal domain (BET) proteins. Their BET inhibitory activity derives from the fusion of an acetyl-lysine mimetic heterocycle onto the diazepine framework. Herein we describe a straightforward, modular synthesis of novel 1,2,3-triazolobenzodiazepines and show that the 1,2,3-triazole acts as an effective acetyl-lysine mimetic heterocycle. Structure-based optimization of this series of compounds led to the development of potent BET bromodomain inhibitors with excellent activity against leukemic cells, concomitant with a reduction in c- MYC expression. These novel benzodiazepines therefore represent a promising class of therapeutic BET inhibitors.

  12. Indoleamine 2,3-dioxygenase 1 (IDO1) inhibitors activate the aryl hydrocarbon receptor

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Benjamin J. [Department of Molecular and Systems Biology, Geisel School of Medicine at Dartmouth, Dartmouth Hitchcock Medical Center, One Medical Center Drive, Lebanon, NH 03756 (United States); Rojas, Itzel Y. [Norris Cotton Cancer Center, Geisel School of Medicine at Dartmouth, Dartmouth Hitchcock Medical Center, One Medical Center Drive, Lebanon, NH 03756 (United States); Murray, Iain A. [Center for Molecular Toxicology and Carcinogenesis, The Pennsylvania State University, University Park, PA 16802 (United States); Department of Veterinary and Biomedical Sciences, The Pennsylvania State University, University Park, PA 16802 (United States); Lee, Seokwon; Hazlett, Haley F. [Norris Cotton Cancer Center, Geisel School of Medicine at Dartmouth, Dartmouth Hitchcock Medical Center, One Medical Center Drive, Lebanon, NH 03756 (United States); Perdew, Gary H. [Center for Molecular Toxicology and Carcinogenesis, The Pennsylvania State University, University Park, PA 16802 (United States); Department of Veterinary and Biomedical Sciences, The Pennsylvania State University, University Park, PA 16802 (United States); Tomlinson, Craig R., E-mail: Craig.R.Tomlinson@Dartmouth.edu [Department of Molecular and Systems Biology, Geisel School of Medicine at Dartmouth, Dartmouth Hitchcock Medical Center, One Medical Center Drive, Lebanon, NH 03756 (United States); Norris Cotton Cancer Center, Geisel School of Medicine at Dartmouth, Dartmouth Hitchcock Medical Center, One Medical Center Drive, Lebanon, NH 03756 (United States)

    2017-05-15

    Indoleamine 2,3-dioxygenase 1 (IDO1) plays a key role in the immune system by regulating tryptophan levels and T cell differentiation. Several tumor types overexpress IDO1 to avoid immune surveillance making IDO1 of interest as a target for therapeutic intervention. As a result, several IDO1 inhibitors are currently being tested in clinical trials for cancer treatment as well as several other diseases. Many of the IDO1 inhibitors in clinical trials naturally bear structural similarities to the IDO1 substrate tryptophan, as such, they fulfill many of the structural and functional criteria as potential AHR ligands. Using mouse and human cell-based luciferase gene reporter assays, qPCR confirmation experiments, and CYP1A1 enzyme activity assays, we report that some of the promising clinical IDO1 inhibitors also act as agonists for the aryl hydrocarbon receptor (AHR), best known for its roles in xenobiotic metabolism and as another key regulator of the immune response. The dual role as IDO antagonist and AHR agonist for many of these IDO target drugs should be considered for full interrogation of their biological mechanisms and clinical outcomes. - Highlights: • Indoleamine-2,3-dioxygenase 1 (IDO1) inhibitors are in cancer clinical trials. • Some IDO1 inhibitors also potently activate AHR signaling. • The dual role of the IDO1 inhibitors may explain some past paradoxical findings. • AHR induction studies must be included in assessing clinical suitability.

  13. Indoleamine 2,3-dioxygenase 1 (IDO1) inhibitors activate the aryl hydrocarbon receptor

    International Nuclear Information System (INIS)

    Moyer, Benjamin J.; Rojas, Itzel Y.; Murray, Iain A.; Lee, Seokwon; Hazlett, Haley F.; Perdew, Gary H.; Tomlinson, Craig R.

    2017-01-01

    Indoleamine 2,3-dioxygenase 1 (IDO1) plays a key role in the immune system by regulating tryptophan levels and T cell differentiation. Several tumor types overexpress IDO1 to avoid immune surveillance making IDO1 of interest as a target for therapeutic intervention. As a result, several IDO1 inhibitors are currently being tested in clinical trials for cancer treatment as well as several other diseases. Many of the IDO1 inhibitors in clinical trials naturally bear structural similarities to the IDO1 substrate tryptophan, as such, they fulfill many of the structural and functional criteria as potential AHR ligands. Using mouse and human cell-based luciferase gene reporter assays, qPCR confirmation experiments, and CYP1A1 enzyme activity assays, we report that some of the promising clinical IDO1 inhibitors also act as agonists for the aryl hydrocarbon receptor (AHR), best known for its roles in xenobiotic metabolism and as another key regulator of the immune response. The dual role as IDO antagonist and AHR agonist for many of these IDO target drugs should be considered for full interrogation of their biological mechanisms and clinical outcomes. - Highlights: • Indoleamine-2,3-dioxygenase 1 (IDO1) inhibitors are in cancer clinical trials. • Some IDO1 inhibitors also potently activate AHR signaling. • The dual role of the IDO1 inhibitors may explain some past paradoxical findings. • AHR induction studies must be included in assessing clinical suitability.

  14. Systemic catechol-O-methyl transferase inhibition enables the D1 agonist radiotracer R-[11C]SKF 82957

    International Nuclear Information System (INIS)

    Palner, Mikael; McCormick, Patrick; Parkes, Jun; Knudsen, Gitte M.; Wilson, Alan A.

    2010-01-01

    Introduction: R-[ 11 C]-SKF 82957 is a high-affinity and potent dopamine D 1 receptor agonist radioligand, which gives rise to a brain-penetrant lipophilic metabolite. In this study, we demonstrate that systemic administration of catechol-O-methyl transferase (COMT) inhibitors blocks this metabolic pathway, facilitating the use of R-[ 11 C]-SKF 82957 to image the high-affinity state of the dopamine D 1 receptor with PET. Methods: R-[ 11 C]SKF 82957 was administered to untreated and COMT inhibitor-treated conscious rats, and the radioactive metabolites present in the brain and plasma were quantified by HPLC. Under optimal conditions, cerebral uptake and dopamine D 1 binding of R-[ 11 C]SKF 82957 were measured ex vivo. In addition, pharmacological challenges with the receptor antagonist SCH 23390, amphetamine, the dopamine reuptake inhibitor RTI-32 and the dopamine hydroxylase inhibitor α-methyl-p-tyrosine were performed to study the specificity and sensitivity of R-[ 11 C]-SKF 82957 dopamine D 1 binding in COMT-inhibited animals. Results: Treatment with the COMT inhibitor tolcapone was associated with a dose-dependent (EC 90 5.3±4.3 mg/kg) reduction in the lipophilic metabolite. Tolcapone treatment (20 mg/kg) also resulted in a significant increase in the striatum/cerebellum ratio of R-[ 11 C]SKF 82957, from 15 (controls) to 24. Treatment with the dopamine D 1 antagonist SCH 23390 reduced the striatal binding to the levels of the cerebellum, demonstrating a high specificity and selectivity of R-[ 11 C]SKF 82957 binding. Conclusions: Pre-treatment with the COMT inhibitor tolcapone inhibits formation of an interfering metabolite of R-[ 11 C]SKF 82957. Under such conditions, R-[ 11 C]SKF 82957 demonstrates high potential as the first agonist radiotracer for imaging the dopamine D 1 receptor by PET.

  15. Design and Synthesis of Novel and Selective Glycine Transporter-1 (GlyT1) Inhibitors with Memory Enhancing Properties.

    Science.gov (United States)

    Santora, Vincent J; Almos, Theresa A; Barido, Richard; Basinger, Jillian; Bellows, Chris L; Bookser, Brett Carder; Breitenbucher, J Guy; Broadbent, Nicola J; Cabebe, Clifford; Chai, Chih-Kun; Chen, Mi; Chow, Stephine; Chung, De Michael; Crickard, Lindsay; Danks, Anne M; Freestone, Graeme; Gitnick, Dany; Gupta, Varsha; Hoffmaster, Christine; Hudson, Andrew R; Kaplan, Alan P; Kennedy, Michael R; Lee, Dong; Limberis, James; Ly, Kiev; Mak, Chi Ching; Masatsugu, Brittany; Morse, Andrew C; Na, Jim; Neul, David; Nikpur, John; Peters, Marco; Petroski, Robert E; Renick, Joel; Sebring, Kristen; Sevidal, Samantha; Tabatabaei, Ali; Wen, Jenny; Yan, Yingzhuo; Yoder, Zachary W; Zook, Douglas

    2018-06-11

    We report here the identification and optimization of a novel series of potent GlyT1 inhibitors. A ligand design campaign that utilized known GlyT1 inhibitors as starting points led to the identification of a novel series of pyrrolo[3,4-c]pyrazoles amides (21-50) with good in vitro potency. Subsequent optimization of physicochemical and in vitro ADME properties produced several compounds with promising pharmacokinetic profiles. In vivo inhibition of GlyT1 was demonstrated for select compounds within this series by measuring the elevation of glycine in the cerebrospinal fluid (CSF) of rats after a single oral dosing of 10 mg/kg. Ultimately, an optimized lead, compound 46, demonstrated in vivo efficacy in a rat Novel Object Recognition (NOR) assay after oral dosing at 0.1, 1, and 3 mg/kg.

  16. Dynamic hepatitis C virus genotypic and phenotypic changes in patients treated with the protease inhibitor telaprevir

    NARCIS (Netherlands)

    Sarrazin, Christoph; Kieffer, Tara L.; Bartels, Doug; Hanzelka, Brian; Müh, Ute; Welker, Martin; Wincheringer, Dennis; Zhou, Yi; Chu, Hui-May; Lin, Chao; Weegink, Christine; Reesink, Henk; Zeuzem, Stefan; Kwong, Ann D.

    2007-01-01

    BACKGROUND & AIMS: Telaprevir (VX-950), a hepatitis C virus (HCV) NS3.4A protease inhibitor, has shown strong antiviral activity in phase 1 clinical studies. Because of high levels of HCV replication and the low fidelity of HCV polymerase, selection of resistant isolates during therapy may occur.

  17. Scaffold protein enigma homolog 1 overcomes the repression of myogenesis activation by inhibitor of DNA binding 2

    Energy Technology Data Exchange (ETDEWEB)

    Nakatani, Miyuki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Ito, Jumpei [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Japan Society for the Promotion of Science, Tokyo, 102-0083 (Japan); Koyama, Riko [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Iijima, Masumi; Yoshimoto, Nobuo [The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Niimi, Tomoaki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Kuroda, Shun' ichi [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Maturana, Andrés D., E-mail: maturana@agr.nagoya-u.ac.jp [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan)

    2016-05-27

    Enigma Homolog 1 (ENH1) is a scaffold protein for signaling proteins and transcription factors. Previously, we reported that ENH1 overexpression promotes the differentiation of C2C12 myoblasts. However, the molecular mechanism underlying the role of ENH1 in the C2C12 cells differentiation remains elusive. ENH1 was shown to inhibit the proliferation of neuroblastoma cells by sequestering Inhibitor of DNA binding protein 2 (Id2) in the cytosol. Id2 is a repressor of basic Helix-Loop-Helix transcription factors activity and prevents myogenesis. Here, we found that ENH1 overcome the Id2 repression of C2C12 cells myogenic differentiation and that ENH1 overexpression promotes mice satellite cells activation, the first step toward myogenic differentiation. In addition, we show that ENH1 interacted with Id2 in C2C12 cells and mice satellite cells. Collectively, our results suggest that ENH1 plays an important role in the activation of myogenesis through the repression of Id2 activity. -- Highlights: •Enigma Homolog 1 (ENH1) is a scaffold protein. •ENH1 binds to inhibitor of DNA binding 2 (Id2) in myoblasts. •ENH1 overexpression overcomes the Id2's repression of myogenesis. •The Id2-ENH1 complex play an important role in the activation of myogenesis.

  18. SGLT2 inhibitors as adjunct therapy to insulin in type 1 diabetes: Meta analysis

    Directory of Open Access Journals (Sweden)

    Jiao CHEN

    2017-02-01

    Full Text Available Objective To evaluate the efficacy and safety of sodium glucose co-transporter-2 (SGLT-2 inhibitors as adjunct therapy to insulin in type 1 diabetes (T1DM. Methods The PubMed, The Cochrane Library, EMbase, CENTRRAI, CBM, CNKI, VIP and WangFang database were searched from inception to April 5, 2016 for systematic reviews, references screen was performed manually. The trials of SGLT2 inhibitors versus placebo add to insulin carried out in patients with T1DM were collected, and their bias risk was assessed and meta-analysis was conducted by using RevMan 5.3 software. Results Four randomized control trials (RCTs were yielded for meta-analysis, including 529 patients. Compared with control group, SGLT2 inhibitors as adjunct therapy to insulin significantly reduced fasting plasma glucose (FPG [weighted mean difference (WMD=–0.65mmol/L, 95% confidence interval (CI=–1.30 to –0.08, P<0.05], glycated hemoglobin A1C (HbA1c (WMD=–0.37%, 95%CI=–0.54 to –0.20, P<0.00001, body weight (WMD=–2.54kg, 95%CI=–3.48 to –1.60, P<0.0001 and total daily insulin dose (WMD=–6.23IU, 95% CI=–8.05 to –4.40, P<0.0001, but the total adverse events (AEs, hypoglycemia, genital and urinary infections showed no significant difference. Conclusions Based on current studies, SGLT-2 inhibitors are effective as adjunct therapy to insulin in T1DM, may improve glycemic control, reduce body weight and total daily insulin dose without increase of total AEs, hypoglycemia, and genital and urinary infections. DOI: 10.11855/j.issn.0577-7402.2016.12.15

  19. Asperentin B, a New Inhibitor of the Protein Tyrosine Phosphatase 1B.

    Science.gov (United States)

    Wiese, Jutta; Aldemir, Hülya; Schmaljohann, Rolf; Gulder, Tobias A M; Imhoff, Johannes F

    2017-06-21

    In the frame of studies on secondary metabolites produced by fungi from deep-sea environments we have investigated inhibitors of enzymes playing key roles in signaling cascades of biochemical pathways relevant for the treatment of diseases. Here we report on a new inhibitor of the human protein tyrosine phosphatase 1B (PTP1B), a target in the signaling pathway of insulin. A new asperentin analog is produced by an Aspergillus sydowii strain isolated from the sediment of the deep Mediterranean Sea. Asperentin B ( 1 ) contains an additional phenolic hydroxy function at C-6 and exhibits an IC 50 value against PTP1B of 2 μM in vitro, which is six times stronger than the positive control, suramin. Interestingly, asperentin ( 2 ) did not show any inhibition of this enzymatic activity. Asperentin B ( 1 ) is discussed as possible therapeutic agents for type 2 diabetes and sleeping sickness.

  20. HDAC inhibitors enhance neratinib activity and when combined enhance the actions of an anti-PD-1 immunomodulatory antibody in vivo

    OpenAIRE

    Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Avogadri-Connors, Francesca; Cutler, Richard E.; Lalani, Alshad S.; Dent, Paul

    2017-01-01

    Patients whose NSCLC tumors become afatinib resistant presently have few effective therapeutic options to extend their survival. Afatinib resistant NSCLC cells were sensitive to clinically relevant concentrations of the irreversible pan-HER inhibitor neratinib, but not by the first generation ERBB1/2/4 inhibitor lapatinib. In multiple afatinib resistant NSCLC clones, HDAC inhibitors reduced the expression of ERBB1/3/4, but activated c-SRC, which resulted in higher total levels of ERBB1/3 phos...

  1. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

    International Nuclear Information System (INIS)

    Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

  2. EGFR inhibitor C225 increases the radiosensitivity of human lung squamous cancer cells

    Directory of Open Access Journals (Sweden)

    Yang Ruijie

    2010-10-01

    Full Text Available Abstract Background The purpose of the present study is to investigate the direct biological effects of the epidermal growth factor receptor (EGFR inhibitor C225 on the radiosensitivity of human lung squamous cancer cell-H520. H520 cells were treated with different dosage of 60Co γ ray irradiation (1.953 Gy/min in the presence or absence of C225. The cellular proliferation, colony forming capacity, apoptosis, the cell cycle distribution as well as caspase-3 were analyzed in vitro. Results We found that C225 treatment significantly increased radiosensitivity of H-520 cells to irradiation, and led to cell cycle arrest in G1 phase, whereas 60Co γ ray irradiation mainly caused G2 phase arrest. H-520 cells thus displayed both the G1 and G2 phase arrest upon treatment with C225 in combination with 60Co γ ray irradiation. Moreover, C225 treatment significantly increased the apoptosis percentage of H-520 cells (13.91% ± 1.88% compared with the control group (5.75% ± 0.64%, P Conclusion In this regard, C225 treatment may make H-520 cells more sensitive to irradiation through the enhancement of caspase-3 mediated tumor cell apoptosis and cell cycle arrest.

  3. Phosphorylated hydroxyethylamines as novel inhibitors of the bacterial cell wall biosynthesis enzymes MurC to MurF.

    Science.gov (United States)

    Sova, Matej; Kovac, Andreja; Turk, Samo; Hrast, Martina; Blanot, Didier; Gobec, Stanislav

    2009-12-01

    Enzymes involved in the biosynthesis of bacterial peptidoglycan represent important targets for development of new antibacterial drugs. Among them, Mur ligases (MurC to MurF) catalyze the formation of the final cytoplasmic precursor UDP-N-acetylmuramyl-pentapeptide from UDP-N-acetylmuramic acid. We present the design, synthesis and biological evaluation of a series of phosphorylated hydroxyethylamines as new type of small-molecule inhibitors of Mur ligases. We show that the phosphate group attached to the hydroxyl moiety of the hydroxyethylamine core is essential for good inhibitory activity. The IC(50) values of these inhibitors were in the micromolar range, which makes them a promising starting point for the development of multiple inhibitors of Mur ligases as potential antibacterial agents. In addition, 1-(4-methoxyphenylsulfonamido)-3-morpholinopropan-2-yl dihydrogen phosphate 7a was discovered as one of the best inhibitors of MurE described so far.

  4. Thermodynamic and kinetic characterization of hydroxyethylamine β-secretase-1 inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Mondal, Kalyani; Regnstrom, Karin; Morishige, Winse; Barbour, Robin; Probst, Gary; Xu, Ying-Zi; Artis, Dean R.; Yao, Nanhua; Beroza, Paul; Bova, Michael P., E-mail: mpbova2001@yahoo.com

    2013-11-15

    Highlights: •Kinetic and thermodynamic characterization of 10 hydroxyethylamine BACE-1 inhibitors. •Equilibrium binding of inhibitors was enthalpy driven for BACE-1. •Negative entropy of binding was observed towards BACE-1, but not Cathepsin-D. •Structural analysis demonstrates ligand binding induces a major conformational change. •Structural analysis and SPR analysis corroborate induced fit and negative entropy of binding. -- Abstract: Alzheimer’s disease (AD) is a devastating neurodegenerative disease affecting millions of people. β-Secretase-1 (BACE-1), an enzyme involved in the processing of the amyloid precursor protein (APP) to form Aβ, is a well validated target for AD. Herein, the authors characterize 10 randomly selected hydroxyethylamine (HEA) BACE-1 inhibitors in terms of their association and dissociation rate constants and thermodynamics of binding using surface plasmon resonance (SPR). Rate constants of association (k{sub a}) measured at 25 °C ranged from a low of 2.42 × 10{sup 4} M{sup −1} s{sup −1} to the highest value of 8.3 × 10{sup 5} M{sup −1} s{sup −1}. Rate constants of dissociation (k{sub d}) ranged from 1.09 × 10{sup −4} s{sup −1} (corresponding to a residence time of close to three hours), to the fastest of 0.028 s{sup −1}. Three compounds were selected for further thermodynamic analysis where it was shown that equilibrium binding was enthalpy driven while unfavorable entropy of binding was observed. Structural analysis revealed that upon ligand binding, the BACE-1flap folds down over the bound ligand causing an induced fit. The maximal difference between alpha carbon positions in the open and closed conformations of the flap was over 5 Å. Thus the negative entropy of binding determined using SPR analysis was consistent with an induced fit observed by structural analysis.

  5. Role of p53 in cdk Inhibitor VMY-1-103-Induced Apoptosis in Prostate Cancer

    Science.gov (United States)

    2012-09-01

    References 1. Pestell RG, Albanese C, Reutens AT, Segall JE, Lee RJ, Arnold A. The cyclins and cyclin-dependent kinase inhibitors in hormonal...26; PMID:20524040; DOI:10.1007/s11060-010-0259-9. 11. Pestell RG, Albanese C, Reutens AT, Segall JE, Lee RJ, Arnold A. The cyclins and cyclin

  6. Glycyrrhetinic acid and its derivatives as inhibitors of poly(ADP-ribosepolymerases 1 and 2, apurinic/apyrimidinic endonuclease 1 and DNA polymerase β

    Directory of Open Access Journals (Sweden)

    Salakhutdinov N. F.

    2012-06-01

    Full Text Available Aim. For strengthening the efficiency of monofunctional alkylating antineoplastic drugs it is important to lower the capacity of base excision repair (BER system which corrects the majority of DNA damages caused by these reagents. The objective was to create inhibitors of the key BER enzymes (PARP1, PARP2, DNA polymerase β, and APE1 by the directed modification of glycyrrhetinic acid (GA. Methods. Amides of GA were produced from the GA acetate by formation of the corresponding acyl chloride, amidation with the appropriate amine and subsequent deacylation. Small library of 2-cyano substituted derivatives of GA methyl esters was obtained by the structural modification of GA framework and carboxylic acid group. The inhibitory capacity of the compounds was estimated by comparison of the enzyme activities in specific tests in the presence of compounds versus their absence. Results. None of tested compounds inhibits PARP1 significantly. Unmodified GA and its morpholinic derivative were shown to be weak inhibitors of PARP2. The derivatives of GA containing keto-group in 11 triterpene framework were shown to be moderate inhibitors of pol β. Compound 3, containing 12-oxo-9(11-en moiety in the ring C, was shown to be a single inhibitor of APE1 among all compounds studied. Conclusions. The class of GA derivatives, selective pol β inhibitors, was found out. The selective inhibitor of APE1 and weak selective inhibitor of PARP2 were also revealed.

  7. Computational discovery of picomolar Q(o) site inhibitors of cytochrome bc1 complex.

    Science.gov (United States)

    Hao, Ge-Fei; Wang, Fu; Li, Hui; Zhu, Xiao-Lei; Yang, Wen-Chao; Huang, Li-Shar; Wu, Jia-Wei; Berry, Edward A; Yang, Guang-Fu

    2012-07-11

    A critical challenge to the fragment-based drug discovery (FBDD) is its low-throughput nature due to the necessity of biophysical method-based fragment screening. Herein, a method of pharmacophore-linked fragment virtual screening (PFVS) was successfully developed. Its application yielded the first picomolar-range Q(o) site inhibitors of the cytochrome bc(1) complex, an important membrane protein for drug and fungicide discovery. Compared with the original hit compound 4 (K(i) = 881.80 nM, porcine bc(1)), the most potent compound 4f displayed 20 507-fold improved binding affinity (K(i) = 43.00 pM). Compound 4f was proved to be a noncompetitive inhibitor with respect to the substrate cytochrome c, but a competitive inhibitor with respect to the substrate ubiquinol. Additionally, we determined the crystal structure of compound 4e (K(i) = 83.00 pM) bound to the chicken bc(1) at 2.70 Å resolution, providing a molecular basis for understanding its ultrapotency. To our knowledge, this study is the first application of the FBDD method in the discovery of picomolar inhibitors of a membrane protein. This work demonstrates that the novel PFVS approach is a high-throughput drug discovery method, independent of biophysical screening techniques.

  8. DPP4 inhibitors promote biological functions of human endothelial progenitor cells by targeting the SDF-1/CXCR4 signaling pathway

    Directory of Open Access Journals (Sweden)

    Liu Feng

    2016-01-01

    Full Text Available Dipeptidyl peptidase 4 (DPP4 inhibitors(oral hypoglycemic agentshave beneficial effects during the early stages of diabetes. In this study, we evaluated the role of DPP4inhibitorsonthe biological functions of cultured human endothelial progenitor cells (EPCs. After treating EPCs with the DPP4 inhibitors sitagliptin and vildagliptin, we examined the mRNA expression of DPP4, vascular endothelial growth factor (VEGF,VEGF receptor 2 (VEGFR-2,endothelial nitric oxide synthase (eNOS, caspase-3,stromal cell-derived factor-1 (SDF-1, chemokine (C-X-C motif receptor 4 (CXCR4 were measured by RT-PCR. The protein expression of SDF-1 and CXCR4 was determined by Western blot; cell proliferation was tested by the MTT method, and DPP4 activity was determined by a DPP4 assay. Our results revealed that DPP4 expression and activity were inhibited following the treatment with various doses of DPP4 inhibitors. Cell proliferation and the expression of VEGF, VEGFR-2andeNOS were up regulated, while cell apoptosis was inhibited by DPP4 inhibitors in a dose-dependent manner. DPP4 inhibitors activated the SDF-1/CXCR4 signaling pathway, shown by the elevated expression of SDF-1/CXCR4. This further proved that after the SDF-1/CXCR4 signaling pathway was blocked by its inhibitor ADM3100, the effects of DPP4 inhibitors on the proliferation and apoptosis, and the expression of VEGF, VEGFR-2and eNOS of EPCs were significantly reduced. These findings suggest that DPP4 inhibitors promote the biological functions of human EPCs by up regulating the SDF-1/CXCR4 signaling pathway.

  9. Novel orally bioavailable EZH1/2 dual inhibitors with greater antitumor efficacy than an EZH2 selective inhibitor.

    Science.gov (United States)

    Honma, Daisuke; Kanno, Osamu; Watanabe, Jun; Kinoshita, Junzo; Hirasawa, Makoto; Nosaka, Emi; Shiroishi, Machiko; Takizawa, Takeshi; Yasumatsu, Isao; Horiuchi, Takao; Nakao, Akira; Suzuki, Keisuke; Yamasaki, Tomonori; Nakajima, Katsuyoshi; Hayakawa, Miho; Yamazaki, Takanori; Yadav, Ajay Singh; Adachi, Nobuaki

    2017-10-01

    Polycomb repressive complex 2 (PRC2) methylates histone H3 lysine 27 and represses gene expression to regulate cell proliferation and differentiation. Enhancer of zeste homolog 2 (EZH2) or its close homolog EZH1 functions as a catalytic subunit of PRC2, so there are two PRC2 complexes containing either EZH2 or EZH1. Tumorigenic functions of EZH2 and its synthetic lethality with some subunits of SWItch/Sucrose Non-Fermentable (SWI/SNF) chromatin remodeling complexes have been observed. However, little is known about the function of EZH1 in tumorigenesis. Herein, we developed novel, orally bioavailable EZH1/2 dual inhibitors that strongly and selectively inhibited methyltransferase activity of both EZH2 and EZH1. EZH1/2 dual inhibitors suppressed trimethylation of histone H3 lysine 27 in cells more than EZH2 selective inhibitors. They also showed greater antitumor efficacy than EZH2 selective inhibitor in vitro and in vivo against diffuse large B-cell lymphoma cells harboring gain-of-function mutation in EZH2. A hematological cancer panel assay indicated that EZH1/2 dual inhibitor has efficacy against some lymphomas, multiple myeloma, and leukemia with fusion genes such as MLL-AF9, MLL-AF4, and AML1-ETO. A solid cancer panel assay demonstrated that some cancer cell lines are sensitive to EZH1/2 dual inhibitor in vitro and in vivo. No clear correlation was detected between sensitivity to EZH1/2 dual inhibitor and SWI/SNF mutations, with a few exceptions. Severe toxicity was not seen in rats treated with EZH1/2 dual inhibitor for 14 days at drug levels higher than those used in the antitumor study. Our results indicate the possibility of EZH1/2 dual inhibitors for clinical applications. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  10. C2 Arylated Benzo[b]thiophene Derivatives as Staphylococcus aureus NorA Efflux Pump Inhibitors.

    Science.gov (United States)

    Liger, François; Bouhours, Pascale; Ganem-Elbaz, Carine; Jolivalt, Claude; Pellet-Rostaing, Stéphane; Popowycz, Florence; Paris, Jean-Marc; Lemaire, Marc

    2016-02-04

    An innovative and straightforward synthesis of second-generation 2-arylbenzo[b]thiophenes as structural analogues of INF55 and the first generation of our laboratory-made molecules was developed. The synthesis of C2-arylated benzo[b]thiophene derivatives was achieved through a method involving direct arylation, followed by simple structural modifications. Among the 34 compounds tested, two of them were potent NorA pump inhibitors, which led to a 16-fold decrease in the ciprofloxacin minimum inhibitory concentration (MIC) against the SA-1199B strain at concentrations of 0.25 and 0.5 μg mL(-1) (1 and 1.5 μm, respectively). This is a promising result relative to that obtained for reserpine (MIC=20 μg mL(-1)), a reference compound amongst NorA pump inhibitors. These molecules thus represent promising candidates to be used in combination with ciprofloxacin against fluoroquinolone-resistant strains. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Synthetic Routes to N-9 Alkylated 8-Oxoguanines; Weak Inhibitors of the Human DNA Glycosylase OGG1

    Directory of Open Access Journals (Sweden)

    Tushar R. Mahajan

    2015-09-01

    Full Text Available The human 8-oxoguanine DNA glycosylase OGG1 is involved in base excision repair (BER, one of several DNA repair mechanisms that may counteract the effects of chemo- and radiation therapy for the treatment of cancer. We envisage that potent inhibitors of OGG1 may be found among the 9-alkyl-8-oxoguanines. Thus we explored synthetic routes to 8-oxoguanines and examined these as OGG1 inhibitors. The best reaction sequence started from 6-chloroguanine and involved N-9 alkylation, C-8 bromination, and finally simultaneous hydrolysis of both halides. Bromination before N-alkylation should only be considered when the N-substituent is not compatible with bromination conditions. The 8-oxoguanines were found to be weak inhibitors of OGG1. 6-Chloro-8-oxopurines, byproducts in the hydrolysis of 2,6-halopurines, turned out to be slightly better inhibitors than the corresponding 8-oxoguanines.

  12. Cellular inhibitor of apoptosis protein 2 (cIAP2) controls human colonic epithelial restitution, migration and Rac1 activation

    DEFF Research Database (Denmark)

    Seidelin, JB; Larsen, Sylvester; Linnemann, D

    2015-01-01

    epithelial cells (IECs) was increased at the wound edge after 24 h (P 2 was induced in vitro in regenerating Caco2 IECs after wound infliction (P ...Identification of pathways involved in wound healing is important for understanding the pathogenesis of various intestinal diseases. Cellular inhibitor of apoptosis protein 2 (cIAP2) regulates proliferation and migration in nonepithelial cells and is expressed in human colonocytes. The aim...... of the study was to investigate the role of cIAP2 for wound healing in the normal human colon. Wound tissue was generated by taking rectosigmoidal biopsies across an experimental ulcer in healthy subjects after 5, 24, and 48 h. In experimental ulcers, the expression of cIAP2 in regenerating intestinal...

  13. Detection of inhibitors of Candida albicans Cdr transporters using a diS-C3(3 fluorescence

    Directory of Open Access Journals (Sweden)

    Joanna eSzczepaniak

    2015-03-01

    Full Text Available Candida albicans is a major cause of opportunistic and life-threatening, systemic fungal infections. Hence new antifungal agents, as well as new methods to treat fungal infections, are still needed. The application of inhibitors of drug-efflux pumps may increase the susceptibility of C. albicans to drugs. We developed a new fluorescence method that allows the in vivo activity evaluation of compounds inhibiting of C. albicans transporters. We show that the potentiometric dye 3,3′-dipropylthiacarbocyanine iodide diS-C3(3 is pumped out by both Cdr1 and Cdr2 transporters. The fluorescence labeling with diS-C3(3 enables a real-time observation of the activity of C. albicans Cdr1 and Cdr2 transporters. We demonstrate that enniatin A and beauvericin show different specificities toward these transporters. Enniatin A inhibits diS-C3(3 efflux by Cdr1 while beauvericin inhibits both Cdr1p and Cdr2p.

  14. Statin and rottlerin small-molecule inhibitors restrict colon cancer progression and metastasis via MACC1.

    Science.gov (United States)

    Juneja, Manisha; Kobelt, Dennis; Walther, Wolfgang; Voss, Cynthia; Smith, Janice; Specker, Edgar; Neuenschwander, Martin; Gohlke, Björn-Oliver; Dahlmann, Mathias; Radetzki, Silke; Preissner, Robert; von Kries, Jens Peter; Schlag, Peter Michael; Stein, Ulrike

    2017-06-01

    MACC1 (Metastasis Associated in Colon Cancer 1) is a key driver and prognostic biomarker for cancer progression and metastasis in a large variety of solid tumor types, particularly colorectal cancer (CRC). However, no MACC1 inhibitors have been identified yet. Therefore, we aimed to target MACC1 expression using a luciferase reporter-based high-throughput screening with the ChemBioNet library of more than 30,000 compounds. The small molecules lovastatin and rottlerin emerged as the most potent MACC1 transcriptional inhibitors. They remarkably inhibited MACC1 promoter activity and expression, resulting in reduced cell motility. Lovastatin impaired the binding of the transcription factors c-Jun and Sp1 to the MACC1 promoter, thereby inhibiting MACC1 transcription. Most importantly, in CRC-xenografted mice, lovastatin and rottlerin restricted MACC1 expression and liver metastasis. This is-to the best of our knowledge-the first identification of inhibitors restricting cancer progression and metastasis via the novel target MACC1. This drug repositioning might be of therapeutic value for CRC patients.

  15. Histone deacetylase inhibitors restore IL-10 expression in lipopolysaccharide-induced cell inflammation and reduce IL-1β and IL-6 production in breast silicone implant in C57BL/6J wild-type murine model.

    Science.gov (United States)

    Di Liddo, Rosa; Valente, Sergio; Taurone, Samanta; Zwergel, Clemens; Marrocco, Biagina; Turchetta, Rosaria; Conconi, Maria Teresa; Scarpa, Carlotta; Bertalot, Thomas; Schrenk, Sandra; Mai, Antonello; Artico, Marco

    2016-01-20

    Among epigenetic enzymes, histone deacetylases (HDACs) are responsible for regulating the expression of an extensive array of genes by reversible deacetylation of nuclear histones as well as a large number of non-histone proteins. Initially proposed for cancer therapy, recently the interest for HDAC inhibitors (HDACi) as orally active, safe, and anti-inflammatory agents is rising due to their ability in reducing the severity of inflammatory and autoimmune diseases. In particular, selective HDAC3, HDAC6, and HDAC8 inhibitors have been described to downregulate the expression of pro-inflammatory cytokines (TNF-α, TGF-β, IL-1β, and IL-6). Herein, using KB31, C2C12, and 3T3-J2 cell lines, we demonstrated that, under lipopolysaccharide-induced in vitro inflammation, HDAC3/6/8 inhibitor MC2625 and HDAC6-selective inhibitor MC2780 were effective at a concentration of 30 ng/mL to downregulate mRNA expression of pro-inflammatory cytokines (IL-1β and IL-6) and to promote the transcription of IL-10 gene, without affecting the cell viability. Afterwards, we investigated by immunohistochemistry the activity of MC2625 and MC2780 at a concentration of 60 ng/kg animal weight to regulate silicone-triggered immune response in C57BL/6J female mice. Our findings evidenced the ability of such inhibitors to reduce host inflammation in silicone implants promoting a thickness reduction of peri-implant fibrous capsule, upregulating IL-10 expression, and reducing the production of both IL-1β and IL-6. These results underline the potential application of MC2625 and MC2780 in inflammation-related diseases.

  16. Synthesis and characteristics in tumor-bearing mice of N-[11C]methyl-1-deoxynojirimycin and N-[11C]methyl-1-deoxymannojirimycin

    International Nuclear Information System (INIS)

    Ishiwata, Kiichi; Sasaki, Toru; Ishii, Shin-ichi; Senda, Michio; Seki, Hiroyuki; Kitasato Univ.; Nozaki, Tadashi

    1993-01-01

    N-[ 11 C]Methyl-1-deoxynojirimycin ([ 11 C]MDNM) and N-[ 11 C]methyl-1-deoxymannojirimycin ([ 11 C]MDMM) were prepared by 11 C-methylation of 1-deoxynojirimycin (DNM) and 1-deoxymannojirimycin (DMM), which are specific inhibitors of glucosidase and mannosidase, respectively. In mice bearing Ehrich ascitic tumor, the highest uptake of the [ 11 C]MDNM was observed in the kidney, followed by the liver and small intestine, while the tumour uptake was moderate. By MDNM loading, saturable uptake was observed in these tissues. In homogenates of the kidney and tumor tissues, a considerable amount of radioactivity was detected in a high-molecular weight fraction. These results demonstrate that the [ 11 C]MDNM has a potential for imaging the glucosidase activity by positron emission tomography. On the other hand, [ 11 C]MDMM showed lower uptake than [ 11 C]MDNM in the kidney, liver and small intestine and no effect of carrier DMM, suggesting that the [ 11 C]MDMM would not reflect mannosidase activity. (Author)

  17. Glucocorticoids and Polyamine Inhibitors Synergize to Kill Human Leukemic CEM Cells1

    Science.gov (United States)

    Miller, Aaron L; Johnson, Betty H; Medh, Rheem D; Townsend, Courtney M; Thompson, E Brad

    2002-01-01

    Abstract Glucocorticoids are well-known apoptotic agents in certain classes of lymphoid cell malignancies. Reduction of intracellular polyamine levels by use of inhibitors that block polyamine synthesis slows or inhibits growth of many cells in vitro. Several such inhibitors have shown efficacy in clinical trials, though the toxicity of some compounds has limited their usefulness. We have tested the effects of combinations of the glucocorticoid dexamethasone (Dex) and two polyamine inhibitors, difluoromethylornithine (DFMO) and methyl glyoxal bis guanylhydrazone (MGBG), on the clonal line of human acute lymphoblastic leukemia cells, CEM-C7-14. Dex alone kills these cells, though only after a delay of at least 24 hours. We also evaluated a partially glucocorticoid-resistant c-Myc-expressing CEM-C7-14 clone. We show that Dex downregulates ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine synthesis. Pretreatment with the ODC inhibitor DFMO, followed by addition of Dex, enhances steroid-evoked kill slightly. The combination of pretreatment with sublethal concentrations of both DFMO and the inhibitor of S-adenosylmethionine decarboxylase, MGBG, followed by addition of Dex, results in strong synergistic cell kill. Both the rapidity and extent of cell kill are enhanced compared to the effects of Dex alone. These results suggest that use of such combinations in vivo may result in apoptosis of malignant cells with lower overall toxicity. PMID:11922393

  18. Successful retreatment with grazoprevir and elbasvir for patients infected with hepatitis C virus genotype 1b, who discontinued prior treatment with NS5A inhibitor-including regimens due to adverse events.

    Science.gov (United States)

    Kanda, Tatsuo; Yasui, Shin; Nakamura, Masato; Nakamoto, Shingo; Takahashi, Koji; Wu, Shuang; Sasaki, Reina; Haga, Yuki; Ogasawara, Sadahisa; Saito, Tomoko; Kobayashi, Kazufumi; Kiyono, Soichiro; Ooka, Yoshihiko; Suzuki, Eiichiro; Chiba, Tetsuhiro; Maruyama, Hitoshi; Moriyama, Mitsuhiko; Kato, Naoya

    2018-03-23

    Sustained virologic response (SVR) by interferon and interferon-free treatment can results in the reduction of advanced liver fibrosis and the occurrence of hepatocellular carcinoma in patients infected with hepatitis C virus (HCV). Recent interferon-free treatment for HCV shortens the duration of treatment and leads to higher SVR rates, without any serious adverse events. However, it is important to retreat patients who have had treatment-failure with HCV non-structural protein 5A (NS5A) inhibitor-including regimens. Combination of sofosbuvir and ledipasvir only leads to approximately 100% SVR rates in HCV genotype (GT1b), NS5A inhibitor-naïve patients in Japan. This combination is not an indication for severe renal disease or heart disease, and these patients should be treated or retreated with a different regimen. Retreatment with HCV non-structural protein 3/4A inhibitor, grazoprevir, and HCV NS5A inhibitor, elbasvir, successfully eradicated HCV RNA in three patients with HCV genotype 1b infection who discontinued prior interferon-free treatments including HCV NS5A inhibitors due to adverse events within 2 weeks. Retreatment with the 12-week combination regimen of grazoprevir and elbasvir is effective for HCV GT1b patients who discontinue the HCV NS5A inhibitor-including regimens within 2 weeks. The treatment response may be related to the short duration of initial treatment, which did not produce treatment-emergent RASs.

  19. Enzymatic assays for the diagnosis of bradykinin-dependent angioedema.

    Directory of Open Access Journals (Sweden)

    Federica Defendi

    Full Text Available BACKGROUND: The kinins (primarily bradykinin, BK represent the mediators responsible for local increase of vascular permeability in hereditary angioedema (HAE, HAE I-II associated with alterations of the SERPING1 gene and HAE with normal C1-Inhibitor function (HAE-nC1INH. Besides C1-Inhibitor function and concentration, no biological assay of kinin metabolism is actually available to help physicians for the diagnosis of angioedema (AE. We describe enzymatic tests on the plasma for diagnosis of BK-dependent AE. METHODS: The plasma amidase assays are performed using the Pro-Phe-Arg-p-nitroanilide peptide substrate to evaluate the spontaneous amidase activity and the proenzyme activation. We analyzed data of 872 patients presenting with BK-dependent AE or BK-unrelated diseases, compared to 303 controls. Anti-high MW kininogen (HK immunoblot was achieved to confirm HK cleavage in exemplary samples. Reproducibility, repeatability, limit of blank, limit of detection, precision, linearity and receiver operating characteristics (ROC were used to calculate the diagnostic performance of the assays. RESULTS: Spontaneous amidase activity was significantly increased in all BK-dependent AE, associated with the acute phase of disease in HAE-nC1INH, but preserved in BK-unrelated disorders. The increase of the amidase activity was associated to HK proteolysis, indicating its relevance to identify kininogenase activity. The oestrogens, known for precipitating AE episodes, were found as triggers of enzymatic activity. Calculations from ROC curves gave the optimum diagnostic cut-off for women (9.3 nmol⋅min(-1⋅mL(-1, area under curve [AUC] 92.1%, sensitivity 80.0%, and specificity 90.1% and for men (6.6 nmol·min(-1⋅mL(-1, AUC 91.0%, sensitivity 87.0% and specificity 81.2%. CONCLUSION: The amidase assay represents a diagnostic tool to help physicians in the decision to distinguish between BK-related and -unrelated AE.

  20. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    Science.gov (United States)

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  1. Effect of centrally administered C75, a fatty acid synthase inhibitor, on gastric emptying and gastrointestinal transit in mice.

    Science.gov (United States)

    Li, Lai-Fu; Lu, Yan-Yu; Xiong, Wei; Liu, Juan-Ying; Chen, Qiang

    2008-10-24

    The central or systemic administration of 3-carboxy-4-octyl-2-methylenebutyrolactone (C75), a synthetic inhibitor of fatty acid synthase (FAS), causes anorexia and profound weight loss in rodents. The amount of food intake and gastrointestinal mobility are closely related. In this study, an attempt has been made to investigate the effects and mechanisms of C75 on gastric emptying and gastrointestinal transit after intracerebroventricular (i.c.v.) injection in mice. Our data showed that C75 (1, 5, 10 microg/mouse) dose-dependently delayed gastric emptying and gastrointestinal transit in fasted mice. 10 microg C75 delayed gastric emptying by about 21.4% and reduced gastrointestinal transit by about 31.0% compared with vehicle control group. Administration (i.c.v.) of 5-(tetradecyloxy)-2-furoic acid (TOFA, an acetyl-CoA carboxylase (ACC) inhibitor) or ghrelin attenuated the delayed gastrointestinal mobility effect induced by 10 microg C75. Taken together, C75 is able to decrease gastrointestinal mobility and it seems possible that malonyl-CoA and ghrelin might play an intermediary role in these processes.

  2. Activity of a potent hepatitis C virus polymerase inhibitor in the chimpanzee model.

    Science.gov (United States)

    Chen, Chih-Ming; He, Yupeng; Lu, Liangjun; Lim, Hock Ben; Tripathi, Rakesh L; Middleton, Tim; Hernandez, Lisa E; Beno, David W A; Long, Michelle A; Kati, Warren M; Bosse, Todd D; Larson, Daniel P; Wagner, Rolf; Lanford, Robert E; Kohlbrenner, William E; Kempf, Dale J; Pilot-Matias, Tami J; Molla, Akhteruzzaman

    2007-12-01

    A-837093 is a potent and specific nonnucleoside inhibitor of the hepatitis C virus (HCV) nonstructural protein 5B (NS5B) RNA-dependent RNA polymerase. It possesses nanomolar potencies in both enzymatic and replicon-based cell culture assays. In rats and dogs this compound demonstrated an oral plasma half-life of greater than 7 h, and its bioavailability was >60%. In monkeys it had a half-life of 1.9 h and 15% bioavailability. Its antiviral efficacy was evaluated in two chimpanzees infected with HCV in a proof-of-concept study. The design included oral dosing of 30 mg per kg of body weight twice a day for 14 days, followed by a 14-day posttreatment observation. Maximum viral load reductions of 1.4 and 2.5 log(10) copies RNA/ml for genotype 1a- and 1b-infected chimpanzees, respectively, were observed within 2 days after the initiation of treatment. After this initial drop in the viral load, a rebound of plasma HCV RNA was observed in the genotype 1b-infected chimpanzee, while the genotype 1a-infected chimpanzee experienced a partial rebound that lasted throughout the treatment period. Clonal analysis of NS5B gene sequences derived from the plasma of A-837093-treated chimpanzees revealed the presence of several mutations associated with resistance to A-837093, including Y448H, G554D, and D559G in the genotype 1a-infected chimpanzee and C316Y and G554D in the genotype 1b-infected chimpanzee. The identification of resistance-associated mutations in both chimpanzees is consistent with the findings of in vitro selection studies, in which many of the same mutations were selected. These findings validate the antiviral efficacy and resistance development of benzothiadiazine HCV polymerase inhibitors in vivo.

  3. Efficacy and Safety of SGLT2 Inhibitors in Patients with Type 1 Diabetes: A Meta-analysis of Randomized Controlled Trials.

    Science.gov (United States)

    Yang, Yingying; Pan, Hui; Wang, Bo; Chen, Shi; Zhu, Huijuan

    2017-04-10

    Objective To assess the efficiency and safety of a novel sodium-glucose co-transporter 2 (SGLT2) inhibitor-SGLT2 inhibitors, in combination with insulin for type 1 diabetes mellitus (T1DM). Methods We searched Medline, Embase, and the Cochrane Collaboration Library to identify the eligible studies published between January 2010 and July 2016 without restriction of language. The Food and Drug Administration (FDA) data and ClinicalTrials (http://www.clinicaltrials.gov) were also searched. The included studies met the following criteria: randomized controlled trials; T1DM patients aged between 18 and 65 years old; patients were treated with insulin plus SGLT2 inhibitors for more than 2 weeks; patients' glycosylated hemoglobin (HbA1c) levels were between 7% and 12%. The SGLT2 inhibitors group was treated with SGLT2 inhibitors plus insulin, and the placebo group received placebo plus insulin treatment. The outcomes should include one of the following items: fasting blood glucose, HbA1c, glycosuria, or adverse effects. Data were analyzed by two physicians independently. The risk of bias was evaluated by using the Cochrane Collaboration's Risk of Bias tool and heterogeneity among studies was assessed using Chi-square test. Random effect model was used to analyze the treatment effects with Revman 5.3.Results Three trials including 178 patients were enrolled. As compared to the placebo group, SGLT2 inhibitor absolutely decreased fasting blood glucose [mean differences (MD) -2.47 mmol/L, 95% confidence interval (CI) -3.65 to -1.28, PSGLT2 inhibitors could also increase the excretion of urine glucose (MD 131.09 g/24 h, 95%CI 91.79 to 170.39, PSGLT2 inhibitors combined with insulin might be an efficient and safe treatment modality for T1DM patients.

  4. Interdependence of Inhibitor Recognition in HIV-1 Protease.

    Science.gov (United States)

    Paulsen, Janet L; Leidner, Florian; Ragland, Debra A; Kurt Yilmaz, Nese; Schiffer, Celia A

    2017-05-09

    Molecular recognition is a highly interdependent process. Subsite couplings within the active site of proteases are most often revealed through conditional amino acid preferences in substrate recognition. However, the potential effect of these couplings on inhibition and thus inhibitor design is largely unexplored. The present study examines the interdependency of subsites in HIV-1 protease using a focused library of protease inhibitors, to aid in future inhibitor design. Previously a series of darunavir (DRV) analogs was designed to systematically probe the S1' and S2' subsites. Co-crystal structures of these analogs with HIV-1 protease provide the ideal opportunity to probe subsite interdependency. All-atom molecular dynamics simulations starting from these structures were performed and systematically analyzed in terms of atomic fluctuations, intermolecular interactions, and water structure. These analyses reveal that the S1' subsite highly influences other subsites: the extension of the hydrophobic P1' moiety results in 1) reduced van der Waals contacts in the P2' subsite, 2) more variability in the hydrogen bond frequencies with catalytic residues and the flap water, and 3) changes in the occupancy of conserved water sites both proximal and distal to the active site. In addition, one of the monomers in this homodimeric enzyme has atomic fluctuations more highly correlated with DRV than the other monomer. These relationships intricately link the HIV-1 protease subsites and are critical to understanding molecular recognition and inhibitor binding. More broadly, the interdependency of subsite recognition within an active site requires consideration in the selection of chemical moieties in drug design; this strategy is in contrast to what is traditionally done with independent optimization of chemical moieties of an inhibitor.

  5. Structure-Activity Relationships of Pentacyclic Triterpenoids as Potent and Selective Inhibitors against Human Carboxylesterase 1

    Directory of Open Access Journals (Sweden)

    Li-Wei Zou

    2017-06-01

    Full Text Available Human carboxylesterase 1 (hCE1, one of the most important serine hydrolases distributed in liver and adipocytes, plays key roles in endobiotic homeostasis and xenobiotic metabolism. This study aimed to find potent and selective inhibitors against hCE1 from phytochemicals and their derivatives. To this end, a series of natural triterpenoids were collected and their inhibitory effects against human carboxylesterases (hCEs were assayed using D-Luciferin methyl ester (DME and 6,8-dichloro-9,9-dimethyl-7-oxo-7,9-dihydroacridin-2-yl benzoate (DDAB as specific optical substrate for hCE1, and hCE2, respectively. Following screening of a series of natural triterpenoids, oleanolic acid (OA, and ursolic acid (UA were found with strong inhibitory effects on hCE1 and relative high selectivity over hCE2. In order to get the highly selective and potent inhibitors of hCE1, a series of OA and UA derivatives were synthesized from OA and UA by chemical modifications including oxidation, reduction, esterification, and amidation. The inhibitory effects of these derivatives on hCEs were assayed and the structure-activity relationships of tested triterpenoids as hCE1 inhibitors were carefully investigated. The results demonstrated that the carbonyl group at the C-28 site is essential for hCE1 inhibition, the modifications of OA or UA at this site including esters, amides and alcohols are unbeneficial for hCE1 inhibition. In contrast, the structural modifications on OA and UA at other sites, such as converting the C-3 hydroxy group to 3-O-β-carboxypropionyl (compounds 20 and 22, led to a dramatically increase of the inhibitory effects against hCE1 and very high selectivity over hCE2. 3D-QSAR analysis of all tested triterpenoids including OA and UA derivatives provide new insights into the fine relationships linking between the inhibitory effects on hCE1 and the steric-electrostatic properties of triterpenoids. Furthermore, both inhibition kinetic analyses and docking

  6. Murine hematopoietic stem cell dormancy controlled by induction of a novel short form of PSF1 by histone deacetylase inhibitors

    International Nuclear Information System (INIS)

    Han, Yinglu; Gong, Zhi-Yuan; Takakura, Nobuyuki

    2015-01-01

    Hematopoietic stem cells (HSCs) can survive long-term in a state of dormancy. Little is known about how histone deacetylase inhibitors (HDACi) affect HSC kinetics. Here, we use trichostatin A (TSA), a histone deacetylase inhibitor, to enforce histone acetylation and show that this suppresses cell cycle entry by dormant HSCs. Previously, we found that haploinsufficiency of PSF1, a DNA replication factor, led to attenuation of the bone marrow (BM) HSC pool size and lack of acute proliferation after 5-FU ablation. Because PSF1 protein is present in CD34 + transiently amplifying HSCs but not in CD34 − long-term reconstituting-HSCs which are resting in a dormant state, we analyzed the relationship between dormancy and PSF1 expression, and how a histone deacetylase inhibitor affects this. We found that CD34 + HSCs produce long functional PSF1 (PSF1a) but CD34 − HSCs produce a shorter possibly non-functional PSF1 (PSF1b, c, dominantly PSF1c). Using PSF1a-overexpressing NIH-3T3 cells in which the endogenous PSF1 promoter is suppressed, we found that TSA treatment promotes production of the shorter form of PSF1 possibly by inducing recruitment of E2F family factors upstream of the PSF1 transcription start site. Our data document one mechanism by which histone deacetylase inhibitors affect the dormancy of HSCs by regulating the DNA replication factor PSF1. - Highlights: • Hematopoetic stem cell dormancy is controlled by histone deacetylation inhibitors. • Dormancy of HSCs is associated with a shorter form of non-functional PSF1. • Histone deacetylase inhibitors suppress PSF1 promoter activity

  7. Murine hematopoietic stem cell dormancy controlled by induction of a novel short form of PSF1 by histone deacetylase inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Han, Yinglu; Gong, Zhi-Yuan [Department of Signal Transduction, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Takakura, Nobuyuki, E-mail: ntakaku@biken.osaka-u.ac.jp [Department of Signal Transduction, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Japan Science Technology Agency, CREST, K' s Gobancho, 7, Gobancho, Chiyoda-ku, Tokyo 102-0076 (Japan)

    2015-06-10

    Hematopoietic stem cells (HSCs) can survive long-term in a state of dormancy. Little is known about how histone deacetylase inhibitors (HDACi) affect HSC kinetics. Here, we use trichostatin A (TSA), a histone deacetylase inhibitor, to enforce histone acetylation and show that this suppresses cell cycle entry by dormant HSCs. Previously, we found that haploinsufficiency of PSF1, a DNA replication factor, led to attenuation of the bone marrow (BM) HSC pool size and lack of acute proliferation after 5-FU ablation. Because PSF1 protein is present in CD34{sup +} transiently amplifying HSCs but not in CD34{sup −} long-term reconstituting-HSCs which are resting in a dormant state, we analyzed the relationship between dormancy and PSF1 expression, and how a histone deacetylase inhibitor affects this. We found that CD34{sup +} HSCs produce long functional PSF1 (PSF1a) but CD34{sup −} HSCs produce a shorter possibly non-functional PSF1 (PSF1b, c, dominantly PSF1c). Using PSF1a-overexpressing NIH-3T3 cells in which the endogenous PSF1 promoter is suppressed, we found that TSA treatment promotes production of the shorter form of PSF1 possibly by inducing recruitment of E2F family factors upstream of the PSF1 transcription start site. Our data document one mechanism by which histone deacetylase inhibitors affect the dormancy of HSCs by regulating the DNA replication factor PSF1. - Highlights: • Hematopoetic stem cell dormancy is controlled by histone deacetylation inhibitors. • Dormancy of HSCs is associated with a shorter form of non-functional PSF1. • Histone deacetylase inhibitors suppress PSF1 promoter activity.

  8. cGMP-Dependent Protein Kinase Inhibitors in Health and Disease

    Directory of Open Access Journals (Sweden)

    Jens Schlossmann

    2013-02-01

    Full Text Available cGMP-dependent protein kinases (PKG exhibit diverse physiological functions in the mammalian system e.g., in vascular and gastrointestinal smooth muscles, in platelets, in kidney, in bone growth, nociception and in the central nervous system. Furthermore, PKG were found in insects and in the malaria parasite Plasmodium falciparum. Two different genes of PKG exist: a the PKG-I gene that is expressed as cytosolic PKG-Iα or PKG-Iβ isoform, and b the PKG-II gene, which expresses the membrane associated PKG-II protein. The enzyme kinetics, the localization and the substrates of these PKG enzymes differ utilizing different physiological functions. Various inhibitors of PKG were developed directed against diverse functional regions of the kinase. These inhibitors of PKG have been used to analyse the specific functions of these enzymes. The review article will summarize these different inhibitors regarding their specificity and their present applications in vitro and in vivo. Furthermore, it will be discussed that the distinct inhibition of the PKG enzymes could be used as a valuable pharmacological target e.g., in the treatment of cardiovascular diseases, diarrhea, cancer or malaria.

  9. Resistance analysis and characterization of NITD008 as an adenosine analog inhibitor against hepatitis C virus.

    Science.gov (United States)

    Qing, Jie; Luo, Rui; Wang, Yaxin; Nong, Junxiu; Wu, Ming; Shao, Yan; Tang, Ruoyi; Yu, Xi; Yin, Zheng; Sun, Yuna

    2016-02-01

    Hepatitis disease caused by hepatitis C virus (HCV) is a severe threat to global public health, affecting approximately 3% of the world's population. Sofosbuvir (PSI-7977), a uridine nucleotide analog inhibitor targeting the HCV NS5B polymerase, was approved by FDA at the end of 2013 and represents a key step towards a new era in the management of HCV infection. Previous study identified NITD008, an adenosine nucleoside analog, as the specific inhibitor against dengue virus and showed good antiviral effect on other flaviviruses or enteroviruses. In this report, we systematically analyzed the anti-HCV profile of NITD008, which was discovered to effectively suppress the replication of different strains of HCV in human hepatoma cells with a low nanomolar activity. On genotype 2a virus, or 2a, 1a, and 1b replicon cells, EC50 values were 8.7 nM, 93.3 nM, 60.0 nM and 67.2 nM, and selective index values were >2298.9, >214.4, >333.3, >298.5 respectively. We demonstrated that resistance to NITD008 was conferred by mutation in NS5B (S282T) in the HCV infectious virus genotype 2a (JFH-1). Then, we compared the resistant profiles of NITD008 and PSI-7977, and found that the folds change of EC50 of NITD008 to full replicon cells containing mutation S282T was much bigger than PSI-7977(folds 76.50 vs. 4.52). Analysis of NITD008 cross-resistance against previously reported NS5B drug-selected mutations showed that the resistance pattern of NITD008 was not completely similar to PSI-7977, and meanwhile, S282T resistant mutation to NITD008 emerge more easily in cell culture than PSI-7977. Interestingly, NITD008 displayed significant synergistic effects with the NS5B polymerase inhibitor PSI-7977, however, only additive effects with alpha interferon (IFNα-2b), ribavirin, and an NS3 protease inhibitor. These results verify that NITD008 is an effective analog inhibitor against hepatitis C virus and a good research tool as a supplement to other types of nucleoside analogs. Copyright

  10. Role of the A+ helix in heparin binding to protein C inhibitor

    NARCIS (Netherlands)

    Elisen, M. G.; Maseland, M. H.; Church, F. C.; Bouma, B. N.; Meijers, J. C.

    1996-01-01

    Interactions between proteins and heparin(-like) structures involve electrostatic forces and structural features. Based on charge distributions in the linear sequence of protein C inhibitor (PCI), two positively charged regions of PCI were proposed as possible candidates for this interaction. The

  11. Anomalous inhibition of c-Met by the kinesin inhibitor aurintricarboxylic acid.

    Science.gov (United States)

    Milanovic, Mina; Radtke, Simone; Peel, Nick; Howell, Michael; Carrière, Virginie; Joffre, Carine; Kermorgant, Stéphanie; Parker, Peter J

    2012-03-01

    c-Met [the hepatocyte growth factor (HGF) receptor] is a receptor tyrosine kinase playing a role in various biological events. Overexpression of the receptor has been observed in a number of cancers, correlating with increased metastatic tendency and poor prognosis. Additionally, activating mutations in c-Met kinase domain have been reported in a subset of familial cancers causing resistance to treatment. Receptor trafficking, relying on the integrity of the microtubule network, plays an important role in activation of downstream targets and initiation of signalling events. Aurintricarboxylic acid (ATA) is a triphenylmethane derivative that has been reported to inhibit microtubule motor proteins kinesins. Additional reported properties of this inhibitor include inhibition of protein tyrosine phosphatases, nucleases and members of the Jak family. Here we demonstrate that ATA prevents HGF-induced c-Met phosphorylation, internalisation, subsequent receptor trafficking and degradation. In addition, ATA prevented HGF-induced downstream signalling which also affected cellular function, as assayed by collective cell migration of A549 cells. Surprisingly, the inhibitory effect of ATA on HGF-induced phosphorylation and signalling in vivo was associated with an increase in basal c-Met kinase activity in vitro. It is concluded that the inhibitory effects of ATA on c-Met in vivo is an allosteric effect mediated through the kinase domain of the receptor. As the currently tested adenosine triphosphate competitive tyrosine kinase inhibitors (TKIs) may lead to tumor resistance (McDermott U, et al., Cancer Res 2010;70:1625-34), our findings suggest that novel anti-c-Met therapies could be developed in the future for cancer treatment. Copyright © 2011 UICC.

  12. Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

    Science.gov (United States)

    Gao, Lan; Li, Hao-Ming

    2017-08-01

    Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

  13. Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues

    Science.gov (United States)

    Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang

    2006-05-01

    To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

  14. High-throughput screening assay of hepatitis C virus helicase inhibitors using fluorescence-quenching phenomenon

    International Nuclear Information System (INIS)

    Tani, Hidenori; Akimitsu, Nobuyoshi; Fujita, Osamu; Matsuda, Yasuyoshi; Miyata, Ryo; Tsuneda, Satoshi; Igarashi, Masayuki; Sekiguchi, Yuji; Noda, Naohiro

    2009-01-01

    We have developed a novel high-throughput screening assay of hepatitis C virus (HCV) nonstructural protein 3 (NS3) helicase inhibitors using the fluorescence-quenching phenomenon via photoinduced electron transfer between fluorescent dyes and guanine bases. We prepared double-stranded DNA (dsDNA) with a 5'-fluorescent-dye (BODIPY FL)-labeled strand hybridized with a complementary strand, the 3'-end of which has guanine bases. When dsDNA is unwound by helicase, the dye emits fluorescence owing to its release from the guanine bases. Our results demonstrate that this assay is suitable for quantitative assay of HCV NS3 helicase activity and useful for high-throughput screening for inhibitors. Furthermore, we applied this assay to the screening for NS3 helicase inhibitors from cell extracts of microorganisms, and found several cell extracts containing potential inhibitors.

  15. Boro-norleucine as a P1 residue for the design of selective and potent DPP7 inhibitors.

    Science.gov (United States)

    Shreder, Kevin R; Wong, Melissa S; Corral, Sergio; Yu, Zhizhou; Winn, David T; Wu, Min; Hu, Yi; Nomanbhoy, Tyzoon; Alemayehu, Senaiet; Fuller, Stacy R; Rosenblum, Jonathan S; Kozarich, John W

    2005-10-01

    Dipeptide-based inhibitors with C-substituted (alkyl or aminoalkyl) alpha-amino acids in the P2 position and boro-norleucine (boro-Nle) in the P1 position were synthesized. Relative to boro-proline, boro-Nle as a P1 residue was shown able to significantly dial out DPP4, FAP, DPP8, and DPP9 activity. Dab-boro-Nle (4g) proved to be the most selective and potent DPP7 inhibitor with a DPP7 IC50 value of 480 pM.

  16. The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Hidalgo, Cecilia [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Lavandero, Sergio, E-mail: slavander@uchile.cl [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile)

    2009-10-09

    Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal {alpha}-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.

  17. The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling

    International Nuclear Information System (INIS)

    Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo; Hidalgo, Cecilia; Lavandero, Sergio

    2009-01-01

    Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal α-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.

  18. Naturally occurring hepatitis C virus protease inhibitors resistance-associated mutations among chronic hepatitis C genotype 1b patients with or without HIV co-infection.

    Science.gov (United States)

    Cao, Ying; Zhang, Yu; Bao, Yi; Zhang, Renwen; Zhang, Xiaxia; Xia, Wei; Wu, Hao; Xu, Xiaoyuan

    2016-05-01

    The aim of this study was to measure the frequency of natural mutations in hepatitis C virus (HCV) mono-infected and HIV/HCV co-infected protease inhibitor (PI)-naive patients. Population sequence of the non-structural (NS)3 protease gene was evaluated in 90 HCV mono-infected and 96 HIV/HCV co-infected PI treatment-naive patients. The natural prevalence of PI resistance mutations in both groups was compared. Complete HCV genotype 1b NS3 sequence information was obtained for 152 (81.72%) samples. Seven sequences (8.33%) of the 84 HCV mono-infected patients and 21 sequences (30.88%) of the 68 HIV/HCV co-infected patients showed amino acid substitutions associated with HCV PI resistance. There was a significant difference in the natural prevalence of PI resistance mutations between these two groups (P = 0.000). The mutations T54S, R117H and N174F were observed in 1.19%, 5.95% and 1.19% of HCV mono-infected patients. The mutations F43S, T54S, Q80K/R, R155K, A156G/V, D168A/E/G and V170A were found in 1.47%, 4.41%, 1.47%/1.47%, 2.94%, 23.53%/1.47%, 1.47%/1.47%/1.47% and 1.47% of HIV/HCV co-infected patients, respectively. In addition, the combination mutations in the NS3 region were detected only in HIV/HCV genotype 1b co-infected patients. Naturally occurring HCV PI resistance mutations existed in HCV mono-infected and HIV/HCV co-infected genotype 1b PI-naive patients. HIV co-infection was associated with a greater frequency of PI resistance mutations. The impact of HIV infection on baseline HCV PI resistance mutations and treatment outcome in chronic hepatitis C (CHC) patients should be further analyzed. © 2015 The Japan Society of Hepatology.

  19. Discovery of PF-06928215 as a high affinity inhibitor of cGAS enabled by a novel fluorescence polarization assay.

    Science.gov (United States)

    Hall, Justin; Brault, Amy; Vincent, Fabien; Weng, Shawn; Wang, Hong; Dumlao, Darren; Aulabaugh, Ann; Aivazian, Dikran; Castro, Dana; Chen, Ming; Culp, Jeffrey; Dower, Ken; Gardner, Joseph; Hawrylik, Steven; Golenbock, Douglas; Hepworth, David; Horn, Mark; Jones, Lyn; Jones, Peter; Latz, Eicke; Li, Jing; Lin, Lih-Ling; Lin, Wen; Lin, David; Lovering, Frank; Niljanskul, Nootaree; Nistler, Ryan; Pierce, Betsy; Plotnikova, Olga; Schmitt, Daniel; Shanker, Suman; Smith, James; Snyder, William; Subashi, Timothy; Trujillo, John; Tyminski, Edyta; Wang, Guoxing; Wong, Jimson; Lefker, Bruce; Dakin, Leslie; Leach, Karen

    2017-01-01

    Cyclic GMP-AMP synthase (cGAS) initiates the innate immune system in response to cytosolic dsDNA. After binding and activation from dsDNA, cGAS uses ATP and GTP to synthesize 2', 3' -cGAMP (cGAMP), a cyclic dinucleotide second messenger with mixed 2'-5' and 3'-5' phosphodiester bonds. Inappropriate stimulation of cGAS has been implicated in autoimmune disease such as systemic lupus erythematosus, thus inhibition of cGAS may be of therapeutic benefit in some diseases; however, the size and polarity of the cGAS active site makes it a challenging target for the development of conventional substrate-competitive inhibitors. We report here the development of a high affinity (KD = 200 nM) inhibitor from a low affinity fragment hit with supporting biochemical and structural data showing these molecules bind to the cGAS active site. We also report a new high throughput cGAS fluorescence polarization (FP)-based assay to enable the rapid identification and optimization of cGAS inhibitors. This FP assay uses Cy5-labelled cGAMP in combination with a novel high affinity monoclonal antibody that specifically recognizes cGAMP with no cross reactivity to cAMP, cGMP, ATP, or GTP. Given its role in the innate immune response, cGAS is a promising therapeutic target for autoinflammatory disease. Our results demonstrate its druggability, provide a high affinity tool compound, and establish a high throughput assay for the identification of next generation cGAS inhibitors.

  20. Prevalence of polymorphisms with significant resistance to NS5A inhibitors in treatment-naive patients with hepatitis C virus genotypes 1a and 3a in Sweden.

    Science.gov (United States)

    Lindström, Ida; Kjellin, Midori; Palanisamy, Navaneethan; Bondeson, Kåre; Wesslén, Lars; Lannergard, Anders; Lennerstrand, Johan

    2015-08-01

    The future treatment of hepatitis C virus (HCV) infection will be combinations of direct-acting antivirals (DAAs) that not only target multiple viral targets, but are also effective against different HCV genotypes. Of the many drug targets in HCV, one promising target is the non-structural 5A protein (NS5A), against which inhibitors, namely daclatasvir, ledipasvir and ombitasvir, have shown potent efficacy. However, since HCV is known to have very high sequence diversity, development of resistance is a problem against but not limited to NS5A inhibitors (i.e. resistance also found against NS3-protease and NS5B non-nucleoside inhibitors), when used in suboptimal combinations. Furthermore, it has been shown that natural resistance against DAAs is present in treatment-naïve patients and such baseline resistance will potentially complicate future treatment strategies. A pan-genotypic population-sequencing method with degenerated primers targeting the NS5A region was developed. We have investigated the prevalence of baseline resistant variants in 127 treatment-naïve patients of HCV genotypes 1a, 1b, 2b and 3a. The method could successfully sequence more than 95% of genotype 1a, 1b and 3a samples. Interpretation of fold resistance data against the NS5A inhibitors was done with the help of earlier published phenotypic data. Baseline resistance variants associated with high resistance (1000-50,000-fold) was found in three patients: Q30H or Y93N in genotype 1a patients and further Y93H in a genotype 3a patient. Using this method, baseline resistance can be examined and the data could have a potential role in selecting the optimal and cost-efficient treatment for the patient.

  1. Role of c-Src inhibitor in the regulation of hepatocarcinoma cell ...

    African Journals Online (AJOL)

    SAM

    2014-03-19

    Mar 19, 2014 ... BEL-7402 cell line was used as HCC cell model for investigating the regulation of cell migration upon c-. Src inhibitors (PP2 and .... PDGF-BB were purchased from Enzo Life Sciences International,. USA; SU6656 Sigma (USA). .... Statistical analysis was done with Student's t-test for comparison of two ...

  2. Interaction between amiodarone and hepatitis-C virus nucleotide inhibitors in human induced pluripotent stem cell-derived cardiomyocytes and HEK-293 Cav1.2 over-expressing cells.

    Science.gov (United States)

    Lagrutta, Armando; Zeng, Haoyu; Imredy, John; Balasubramanian, Bharathi; Dech, Spencer; Lis, Edward; Wang, Jixin; Zhai, Jin; DeGeorge, Joseph; Sannajust, Frederick

    2016-10-01

    Several clinical cases of severe bradyarrhythmias have been reported upon co-administration of the Hepatitis-C NS5B Nucleotide Polymerase Inhibitor (HCV-NI) direct-acting antiviral agent, sofosbuvir (SOF), and the Class-III anti-arrhythmic amiodarone (AMIO). We model the cardiac drug-drug interaction (DDI) between AMIO and SOF, and between AMIO and a closely-related SOF analog, MNI-1 (Merck Nucleotide Inhibitor #1), in functional assays of human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), to provide mechanistic insights into recently reported clinical cases. AMIO co-applied with SOF or MNI-1 increased beating rate or field potential (FP) rate and decreased impedance (IMP) and Ca(2+) transient amplitudes in hiPSC-CM syncytia. This action resembled that of Ca(2+) channel blockers (CCBs) in the model, but CCBs did not substitute for AMIO in the DDI. AMIO analog dronedarone (DRON) did not substitute for, but competed with AMIO in the DDI. Ryanodine and thapsigargin, decreasing intracellular Ca(2+) stores, and SEA-0400, a Na(+)/Ca(2+) exchanger-1 (NCX1) inhibitor, partially antagonized or suppressed DDI effects. Other agents affecting FP rate only exerted additive or subtractive effects, commensurate with their individual effects. We also describe an interaction between AMIO and MNI-1 on Cav1.2 ion channels in an over-expressing HEK-293 cell line. MNI-1 enhanced Cav1.2 channel inhibition by AMIO, but did not affect inhibition of Cav1.2 by DRON, verapamil, nifedipine, or diltiazem. Our data in hiPSC-CMs indicate that HCV-NI agents such as SOF and MNI-1 interact with key intracellular Ca(2+)-handling mechanisms. Additional study in a Cav1.2 HEK-293 cell-line suggests that HCV-NIs potentiate the inhibitory action of AMIO on L-type Ca(2+) channels. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Design, synthesis and crystallographic analysis of nitrile-based broad-spectrum peptidomimetic inhibitors for coronavirus 3C-like proteases.

    Science.gov (United States)

    Chuck, Chi-Pang; Chen, Chao; Ke, Zhihai; Wan, David Chi-Cheong; Chow, Hak-Fun; Wong, Kam-Bo

    2013-01-01

    Coronaviral infection is associated with up to 5% of respiratory tract diseases. The 3C-like protease (3CL(pro)) of coronaviruses is required for proteolytic processing of polyproteins and viral replication, and is a promising target for the development of drugs against coronaviral infection. We designed and synthesized four nitrile-based peptidomimetic inhibitors with different N-terminal protective groups and different peptide length, and examined their inhibitory effect on the in-vitro enzymatic activity of 3CL(pro) of severe-acute-respiratory-syndrome-coronavirus. The IC(50) values of the inhibitors were in the range of 4.6-49 μM, demonstrating that the nitrile warhead can effectively inactivate the 3CL(pro) autocleavage process. The best inhibitor, Cbz-AVLQ-CN with an N-terminal carbobenzyloxy group, was ~10x more potent than the other inhibitors tested. Crystal structures of the enzyme-inhibitor complexes showed that the nitrile warhead inhibits 3CL(pro) by forming a covalent bond with the catalytic Cys145 residue, while the AVLQ peptide forms a number of favourable interactions with the S1-S4 substrate-binding pockets. We have further showed that the peptidomimetic inhibitor, Cbz-AVLQ-CN, has broad-spectrum inhibition against 3CL(pro) from human coronavirus strains 229E, NL63, OC43, HKU1, and infectious bronchitis virus, with IC(50) values ranging from 1.3 to 3.7 μM, but no detectable inhibition against caspase-3. In summary, we have shown that the nitrile-based peptidomimetic inhibitors are effective against 3CL(pro), and they inhibit 3CL(pro) from a broad range of coronaviruses. Our results provide further insights into the future design of drugs that could serve as a first line defence against coronaviral infection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  4. Discovery of novel selenium derivatives as Pin1 inhibitors by high-throughput screening

    International Nuclear Information System (INIS)

    Subedi, Amit; Shimizu, Takeshi; Ryo, Akihide; Sanada, Emiko; Watanabe, Nobumoto; Osada, Hiroyuki

    2016-01-01

    Peptidyl prolyl cis/trans isomerization by Pin1 regulates various oncogenic signals during cancer progression, and its inhibition through multiple approaches has established Pin1 as a therapeutic target. However, lack of simplified screening systems has limited the discovery of potent Pin1 inhibitors. We utilized phosphorylation-dependent binding of Pin1 to its specific substrate to develop a screening system for Pin1 inhibitors. Using this system, we screened a chemical library, and identified a novel selenium derivative as Pin1 inhibitor. Based on structure-activity guided chemical synthesis, we developed more potent Pin1 inhibitors that inhibited cancer cell proliferation. -- Highlights: •Novel screening for Pin1 inhibitors based on Pin1 binding is developed. •A novel selenium compound is discovered as Pin1 inhibitor. •Activity guided chemical synthesis of selenium derivatives resulted potent Pin1 inhibitors.

  5. Selective Inhibitors of Kv11.1 Regulate IL-6 Expression by Macrophages in Response to TLR/IL-1R Ligands

    Directory of Open Access Journals (Sweden)

    Cheryl Hunter

    2010-01-01

    Full Text Available The mechanism by which the platelet-endothelial cell adhesion molecule PECAM-1 regulates leukodiapedesis, vascular endothelial integrity, and proinflammatory cytokine expression in vivo is not known. We recently identified PECAM-1 as a negative regulator of Kv11.1, a specific voltage-gated potassium channel that functioned in human macrophages to reset a resting membrane potential following depolarization. We demonstrate here that dofetilide (DOF, a selective inhibitor of the Kv11.1 current, had a profound inhibitory effect on neutrophil recruitment in mice following TLR/IL-1R–elicited peritonitis or intrascrotal injection of IL-1β, but had no effect on responses seen with TNFα. Furthermore, inhibitors of Kv11.1 (DOF, E4031, and astemizole, but not Kv1.3 (margatoxin, suppressed the expression of IL-6 and MCP-1 cytokines by murine resident peritoneal macrophages, while again having no effect on TNFα. In contrast, IL-6 expression by peritoneal mesothelial cells was unaffected. Using murine P388 cells, which lack endogenous C/EBPβexpression and are unresponsive to LPS for the expression of both IL-6 and MCP-1, we observed that DOF inhibited LPS-induced expression of IL-6 mRNA following ectopic expression of wild-type C/EBPβ, but not a serine-64 point mutant. Finally, DOF inhibited the constitutive activation of cdk2 in murine peritoneal macrophages; cdk2 is known to phosphorylate C/EBPβ at serine-64. Taken together, our results implicate a potential role for Kv11.1 in regulating cdk2 and C/EBPβ activity, where robust transactivation of both IL-6 and MCP-1 transcription is known to be dependent on serine-64 of C/EBPβ. Our data might also explain the altered phenotypes displayed by PECAM-1 knockout mice in several disease models.

  6. Identification of the Niemann-Pick C1-like 1 cholesterol absorption receptor as a new hepatitis C virus entry factor

    Science.gov (United States)

    Sainz, Bruno; Barretto, Naina; Martin, Danyelle N.; Hiraga, Nobuhiko; Imamura, Michio; Hussain, Snawar; Marsh, Katherine A.; Yu, Xuemei; Chayama, Kazuaki; Alrefai, Waddah A.; Uprichard, Susan L.

    2011-01-01

    Hepatitis C virus (HCV) is a leading cause of liver disease worldwide. With ~170 million individuals infected and current interferon-based treatment having toxic side-effects and marginal efficacy, more effective antivirals are critically needed1. Although HCV protease inhibitors were just FDA approved, analogous to HIV therapy, optimal HCV therapy likely will require a combination of antivirals targeting multiple aspects of the viral lifecycle. Viral entry represents a promising multi-faceted target for antiviral intervention; however, to date FDA-approved inhibitors of HCV cell entry are unavailable. Here we show that the cellular Niemann-Pick C1-Like 1 (NPC1L1) cholesterol uptake receptor is an HCV entry factor amendable to therapeutic intervention. Specifically, NPC1L1 expression is necessary for HCV infection as silencing or antibody-mediated blocking of NPC1L1 impairs cell-cultured-derived HCV (HCVcc) infection initiation. In addition, the clinically-available FDA-approved NPC1L1 antagonist ezetimibe2,3 potently blocks HCV uptake in vitro via a virion cholesterol-dependent step prior to virion-cell membrane fusion. Importantly, ezetimibe inhibits infection of all major HCV genotypes in vitro, and in vivo delays the establishment of HCV genotype 1b infection in mice with human liver grafts. Thus, we have not only identified NPC1L1 as an HCV cell entry factor, but also discovered a new antiviral target and potential therapeutic agent. PMID:22231557

  7. Health-related quality of life in Danish children with hereditary angioedema

    DEFF Research Database (Denmark)

    Aabom, Anne; Nguyen, Dan; Fisker, Niels

    2017-01-01

    have considerable impact on the health-related quality of life (HRQoL) in adult patients. Half the patients with C1-INH-HAE develop symptoms before the age of 10 years. However, the HRQoL in children with C1-INH-HAE is almost unexplored. Objective: To investigate HRQoL in Danish children with C1...... were the PedsQL (Child Self-Report and Parent Proxy-Report forms); the Children's Dermatology Life Quality Index; a nonvalidated, diseasespecific quality-of-life questionnaire; and two visual analog scales that rated general health. Results: The HRQoL scores in our study were comparable with the normal...... the Parent Proxy-Report form carried the disease. Conclusion: Overall, the children assessed on average had a normal HRQoL and better than those with other common skin disorders. However, according to our findings, health care providers should be especially attentive to HRQoL when children with C1-INH...

  8. Allosteric Mutant IDH1 Inhibitors Reveal Mechanisms for IDH1 Mutant and Isoform Selectivity

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xiaoling; Baird, Daniel; Bowen, Kimberly; Capka, Vladimir; Chen, Jinyun; Chenail, Gregg; Cho, YoungShin; Dooley, Julia; Farsidjani, Ali; Fortin, Pascal; Kohls, Darcy; Kulathila, Raviraj; Lin, Fallon; McKay, Daniel; Rodrigues, Lindsey; Sage, David; Touré, B. Barry; van der Plas, Simon; Wright, Kirk; Xu, Ming; Yin, Hong; Levell, Julian; Pagliarini, Raymond A. (Novartis)

    2017-03-01

    Oncogenic IDH1 and IDH2 mutations contribute to cancer via production of R-2-hydroxyglutarate (2-HG). Here, we characterize two structurally distinct mutant- and isoform-selective IDH1 inhibitors that inhibit 2-HG production. Both bind to an allosteric pocket on IDH1, yet shape it differently, highlighting the plasticity of this site. Oncogenic IDH1R132H mutation destabilizes an IDH1 “regulatory segment,” which otherwise restricts compound access to the allosteric pocket. Regulatory segment destabilization in wild-type IDH1 promotes inhibitor binding, suggesting that destabilization is critical for mutant selectivity. We also report crystal structures of oncogenic IDH2 mutant isoforms, highlighting the fact that the analogous segment of IDH2 is not similarly destabilized. This intrinsic stability of IDH2 may contribute to observed inhibitor IDH1 isoform selectivity. Moreover, discrete residues in the IDH1 allosteric pocket that differ from IDH2 may also guide IDH1 isoform selectivity. These data provide a deeper understanding of how IDH1 inhibitors achieve mutant and isoform selectivity.

  9. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  10. PTP1B inhibitor promotes endothelial cell motility by activating the DOCK180/Rac1 pathway.

    Science.gov (United States)

    Wang, Yuan; Yan, Feng; Ye, Qing; Wu, Xiao; Jiang, Fan

    2016-04-07

    Promoting endothelial cell (EC) migration is important not only for therapeutic angiogenesis, but also for accelerating re-endothelialization after vessel injury. Several recent studies have shown that inhibition of protein tyrosine phosphatase 1B (PTP1B) may promote EC migration and angiogenesis by enhancing the vascular endothelial growth factor receptor-2 (VEGFR2) signalling. In the present study, we demonstrated that PTP1B inhibitor could promote EC adhesion, spreading and migration, which were abolished by the inhibitor of Rac1 but not RhoA GTPase. PTP1B inhibitor significantly increased phosphorylation of p130Cas, and the interactions among p130Cas, Crk and DOCK180; whereas the phosphorylation levels of focal adhesion kinase, Src, paxillin, or Vav2 were unchanged. Gene silencing of DOCK180, but not Vav2, abrogated the effects of PTP1B inhibitor on EC motility. The effects of PTP1B inhibitor on EC motility and p130Cas/DOCK180 activation persisted in the presence of the VEGFR2 antagonist. In conclusion, we suggest that stimulation of the DOCK180 pathway represents an alternative mechanism of PTP1B inhibitor-stimulated EC motility, which does not require concomitant VEGFR2 activation as a prerequisite. Therefore, PTP1B inhibitor may be a useful therapeutic strategy for promoting EC migration in cardiovascular patients in which the VEGF/VEGFR functions are compromised.

  11. Discovery of PF-06928215 as a high affinity inhibitor of cGAS enabled by a novel fluorescence polarization assay

    Energy Technology Data Exchange (ETDEWEB)

    Hall, Justin; Brault, Amy; Vincent, Fabien; Weng, Shawn; Wang, Hong; Dumlao, Darren; Aulabaugh, Ann; Aivazian, Dikran; Castro, Dana; Chen, Ming; Culp, Jeffrey; Dower, Ken; Gardner, Joseph; Hawrylik, Steven; Golenbock, Douglas; Hepworth, David; Horn, Mark; Jones, Lyn; Jones, Peter; Latz, Eicke; Li, Jing; Lin, Lih-Ling; Lin, Wen; Lin, David; Lovering, Frank; Niljanskul, Nootaree; Nistler, Ryan; Pierce, Betsy; Plotnikova, Olga; Schmitt, Daniel; Shanker, Suman; Smith, James; Snyder, William; Subashi, Timothy; Trujillo, John; Tyminski, Edyta; Wang, Guoxing; Wong, Jimson; Lefker, Bruce; Dakin, Leslie; Leach, Karen (UMASS, MED); (Pfizer)

    2017-09-21

    Cyclic GMP-AMP synthase (cGAS) initiates the innate immune system in response to cytosolic dsDNA. After binding and activation from dsDNA, cGAS uses ATP and GTP to synthesize 2', 3' -cGAMP (cGAMP), a cyclic dinucleotide second messenger with mixed 2'-5' and 3'-5' phosphodiester bonds. Inappropriate stimulation of cGAS has been implicated in autoimmune disease such as systemic lupus erythematosus, thus inhibition of cGAS may be of therapeutic benefit in some diseases; however, the size and polarity of the cGAS active site makes it a challenging target for the development of conventional substrate-competitive inhibitors. We report here the development of a high affinity (KD = 200 nM) inhibitor from a low affinity fragment hit with supporting biochemical and structural data showing these molecules bind to the cGAS active site. We also report a new high throughput cGAS fluorescence polarization (FP)-based assay to enable the rapid identification and optimization of cGAS inhibitors. This FP assay uses Cy5-labelled cGAMP in combination with a novel high affinity monoclonal antibody that specifically recognizes cGAMP with no cross reactivity to cAMP, cGMP, ATP, or GTP. Given its role in the innate immune response, cGAS is a promising therapeutic target for autoinflammatory disease. Our results demonstrate its druggability, provide a high affinity tool compound, and establish a high throughput assay for the identification of next generation cGAS inhibitors.

  12. Purification and characterization of bioactive his6-tagged recombinant human tissue inhibitor of metalloproteinases-1 (TIMP-1) protein expressed at high yields in mammalian cells

    DEFF Research Database (Denmark)

    Jensen, Lena Vinther; Lademann, Ulrik Axel; Andersen, Elisabeth Veyhe

    2014-01-01

    Tissue inhibitor of metalloproteinases-1 (TIMP-1) is an endogenous inhibitor of matrix metalloproteinases (MMPs) with reported tumor promoting, as well as inhibitory, effects. These paradoxical properties are presumably mediated by different biological functions, MMP-dependent as well as -indepen...... TIMP-1, which structurally and functionally is similar to endogenous human TIMP-1, while using an expression system that is adaptable to most biochemical and biomedical laboratories including those that do not perform protein purifications routinely.......Tissue inhibitor of metalloproteinases-1 (TIMP-1) is an endogenous inhibitor of matrix metalloproteinases (MMPs) with reported tumor promoting, as well as inhibitory, effects. These paradoxical properties are presumably mediated by different biological functions, MMP-dependent as well...... as -independent, and probably related to TIMP-1 levels of protein expression, post-translational modifications, and cellular localization. TIMP-1 is an N-glycosylated protein that folds into two functional domains, a C- and an N-terminal domain, with six disulfide bonds. Furthermore, TIMP-1 is processed in the N...

  13. The cyclophilin inhibitor Debio-025 shows potent anti-hepatitis C effect in patients coinfected with hepatitis C and human immunodeficiency virus.

    Science.gov (United States)

    Flisiak, Robert; Horban, Andrzej; Gallay, Philippe; Bobardt, Michael; Selvarajah, Suganya; Wiercinska-Drapalo, Alicja; Siwak, Ewa; Cielniak, Iwona; Higersberger, Jozef; Kierkus, Jarek; Aeschlimann, Christian; Grosgurin, Pierre; Nicolas-Métral, Valérie; Dumont, Jean-Maurice; Porchet, Hervé; Crabbé, Raf; Scalfaro, Pietro

    2008-03-01

    Debio-025 is an oral cyclophilin (Cyp) inhibitor with potent anti-hepatitis C virus activity in vitro. Its effect on viral load as well as its influence on intracellular Cyp levels was investigated in a randomized, double-blind, placebo-controlled study. Mean hepatitis C viral load decreased significantly by 3.6 log(10) after a 14-day oral treatment with 1200 mg twice daily (P CypB) levels in peripheral blood mononuclear cells decreased from 67 +/- 6 (standard error) ng/mg protein (baseline) to 5 +/- 1 ng/mg protein at day 15 (P CypB levels, coinciding with the decrease in hepatitis C viral load. These are the first preliminary human data supporting the hypothesis that CypB may play an important role in hepatitis C virus replication and that Cyp inhibition is a valid target for the development of anti-hepatitis C drugs.

  14. Mechanistic Characterization of GS-9190 (Tegobuvir), a Novel Nonnucleoside Inhibitor of Hepatitis C Virus NS5B Polymerase▿

    Science.gov (United States)

    Shih, I-hung; Vliegen, Inge; Peng, Betty; Yang, Huiling; Hebner, Christy; Paeshuyse, Jan; Pürstinger, Gerhard; Fenaux, Martijn; Tian, Yang; Mabery, Eric; Qi, Xiaoping; Bahador, Gina; Paulson, Matthew; Lehman, Laura S.; Bondy, Steven; Tse, Winston; Reiser, Hans; Lee, William A.; Schmitz, Uli; Neyts, Johan; Zhong, Weidong

    2011-01-01

    GS-9190 (Tegobuvir) is a novel imidazopyridine inhibitor of hepatitis C virus (HCV) RNA replication in vitro and has demonstrated potent antiviral activity in patients chronically infected with genotype 1 (GT1) HCV. GS-9190 exhibits reduced activity against GT2a (JFH1) subgenomic replicons and GT2a (J6/JFH1) infectious virus, suggesting that the compound's mechanism of action involves a genotype-specific viral component. To further investigate the GS-9190 mechanism of action, we utilized the susceptibility differences between GT1b and GT2a by constructing a series of replicon chimeras where combinations of 1b and 2a nonstructural proteins were encoded within the same replicon. The antiviral activities of GS-9190 against the chimeric replicons were reduced to levels comparable to that of the wild-type GT2a replicon in chimeras expressing GT2a NS5B. GT1b replicons in which the β-hairpin region (amino acids 435 to 455) was replaced by the corresponding sequence of GT2a were markedly less susceptible to GS-9190, indicating the importance of the thumb subdomain of the polymerase in this effect. Resistance selection in GT1b replicon cells identified several mutations in NS5B (C316Y, Y448H, Y452H, and C445F) that contributed to the drug resistance phenotype. Reintroduction of these mutations into wild-type replicons conferred resistance to GS-9190, with the number of NS5B mutations correlating with the degree of resistance. Analysis of GS-9190 cross-resistance against previously reported NS5B drug-selected mutations showed that the resistance pattern of GS-9190 is different from other nonnucleoside inhibitors. Collectively, these data demonstrate that GS-9190 represents a novel class of nonnucleoside polymerase inhibitors that interact with NS5B likely through involvement of the β-hairpin in the thumb subdomain. PMID:21746939

  15. Discovery of imidazopyridine derivatives as novel c-Met kinase inhibitors: Synthesis, SAR study, and biological activity.

    Science.gov (United States)

    Yang, Yifei; Zhang, Yuan; Yang, LingYun; Zhao, Leilei; Si, Lianghui; Zhang, Huibin; Liu, Qingsong; Zhou, Jinpei

    2017-02-01

    Receptor tyrosine kinase c-Met acts as an alternative angiogenic pathway in the process and contents of cancers. A series of imidazopyridine derivatives were designed and synthesized according to the established docking studies as possible c-Met inhibitors. Most of these imidazopyridine derivatives displayed nanomolar potency against c-Met in both biochemical enzymatic screens and cellular pharmacology studies. Especially, compound 7g exhibited the most inhibitory activity against c-Met with IC 50 of 53.4nM and 253nM in enzymatic and cellular level, respectively. Following that, the compound 7g was docked into the protein of c-Met and the structure-activity relationship was analyzed in detail. These findings indicated that the novel imidazopyridine derivative compound 7g was a potential c-Met inhibitor deserving further investigation for cancer treatment. Copyright © 2016. Published by Elsevier Inc.

  16. Silencing c-Myc translation as a therapeutic strategy through targeting PI3Kδ and CK1ε in hematological malignancies.

    Science.gov (United States)

    Deng, Changchun; Lipstein, Mark R; Scotto, Luigi; Jirau Serrano, Xavier O; Mangone, Michael A; Li, Shirong; Vendome, Jeremie; Hao, Yun; Xu, Xiaoming; Deng, Shi-Xian; Realubit, Ronald B; Tatonetti, Nicholas P; Karan, Charles; Lentzsch, Suzanne; Fruman, David A; Honig, Barry; Landry, Donald W; O'Connor, Owen A

    2017-01-05

    Phosphoinositide 3-kinase (PI3K) and the proteasome pathway are both involved in activating the mechanistic target of rapamycin (mTOR). Because mTOR signaling is required for initiation of messenger RNA translation, we hypothesized that cotargeting the PI3K and proteasome pathways might synergistically inhibit translation of c-Myc. We found that a novel PI3K δ isoform inhibitor TGR-1202, but not the approved PI3Kδ inhibitor idelalisib, was highly synergistic with the proteasome inhibitor carfilzomib in lymphoma, leukemia, and myeloma cell lines and primary lymphoma and leukemia cells. TGR-1202 and carfilzomib (TC) synergistically inhibited phosphorylation of the eukaryotic translation initiation factor 4E (eIF4E)-binding protein 1 (4E-BP1), leading to suppression of c-Myc translation and silencing of c-Myc-dependent transcription. The synergistic cytotoxicity of TC was rescued by overexpression of eIF4E or c-Myc. TGR-1202, but not other PI3Kδ inhibitors, inhibited casein kinase-1 ε (CK1ε). Targeting CK1ε using a selective chemical inhibitor or short hairpin RNA complements the effects of idelalisib, as a single agent or in combination with carfilzomib, in repressing phosphorylation of 4E-BP1 and the protein level of c-Myc. These results suggest that TGR-1202 is a dual PI3Kδ/CK1ε inhibitor, which may in part explain the clinical activity of TGR-1202 in aggressive lymphoma not found with idelalisib. Targeting CK1ε should become an integral part of therapeutic strategies targeting translation of oncogenes such as c-Myc. © 2017 by The American Society of Hematology.

  17. Indanones as high-potency reversible inhibitors of monoamine oxidase.

    Science.gov (United States)

    Mostert, Samantha; Petzer, Anél; Petzer, Jacobus P

    2015-05-01

    Recent reports document that α-tetralone (3,4-dihydro-2H-naphthalen-1-one) is an appropriate scaffold for the design of high-potency monoamine oxidase (MAO) inhibitors. Based on the structural similarity between α-tetralone and 1-indanone, the present study involved synthesis of 34 1-indanone and related indane derivatives as potential inhibitors of recombinant human MAO-A and MAO-B. The results show that C6-substituted indanones are particularly potent and selective MAO-B inhibitors, with IC50 values ranging from 0.001 to 0.030 μM. C5-Substituted indanone and indane derivatives are comparatively weaker MAO-B inhibitors. Although the 1-indanone and indane derivatives are selective inhibitors of the MAO-B isoform, a number of homologues are also potent MAO-A inhibitors, with three homologues possessing IC50 values 1-indanone as a reversible MAO inhibitor with a competitive mode of inhibition. It may be concluded that 1-indanones are promising leads for the design of therapies for neurodegenerative and neuropsychiatric disorders such as Parkinson's disease and depression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Clinical characteristics and treatment outcomes of patients with low- and high-concentration isoniazid-monoresistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Tsai-Yu Wang

    Full Text Available BACKGROUND: Isoniazid (INH resistance is now the most common type of tuberculosis (TB infection resistance worldwide. The aim of this study was to evaluate the clinical characteristics and treatment outcomes of patients with low- and high-concentration INH-monoresistant TB. METHODS: One hundred and thirty-four patients with culture-confirmed INH-monoresistant TB during 2006 January to 2007 December were retrospectively enrolled. INH resistance was classified as either low-concentration or high-concentration resistance according to the critical concentrations of 0.2 µg/mL or 1 µg/mL of INH, respectively. The patients' clinical outcomes, treatment regimens, and treatment duration were analyzed. RESULTS: The treatment success rates between low- and high-concentration INH-resistant TB were similar (81.8% vs. 86.7%. The treatment regimens and treatment duration were similar between both groups. Only a minor percentage of the patients in both groups received 6-month treatment regimens (low vs. high concentration resistance, 9.1% vs. 13.3%; respectively, p = 0.447 The most common reason for treatment duration longer than 6 months was pyrazinamide given for less than 6 months, followed by a delay in clinical response to treatment. Multivariable analysis showed that prior tuberculosis treatment (Odds ratio, 2.82, 95% C.I., 1.02-7.77, p = 0.045 was the only independent risk factor for unsuccessful treatment outcome. CONCLUSION: Different levels of INH resistance did not affect the treatment outcomes of patients with INH-monoresistant tuberculosis. Prolonged Rifampin-containing regimens may achieve those good outcomes in patients with low- and high-concentration INH-monoresistant TB.

  19. The design strategy of selective PTP1B inhibitors over TCPTP.

    Science.gov (United States)

    Li, XiangQian; Wang, LiJun; Shi, DaYong

    2016-08-15

    Protein tyrosine phosphatase 1B (PTP1B) has already been well studied as a highly validated therapeutic target for diabetes and obesity. However, the lack of selectivity limited further studies and clinical applications of PTP1B inhibitors, especially over T-cell protein tyrosine phosphatase (TCPTP). In this review, we enumerate the published specific inhibitors of PTP1B, discuss the structure-activity relationships by analysis of their X-ray structures or docking results, and summarize the characteristic of selectivity related residues and groups. Furthermore, the design strategy of selective PTP1B inhibitors over TCPTP is also proposed. We hope our work could provide an effective way to gain specific PTP1B inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Systemic catechol-O-methyl transferase inhibition enables the D{sub 1} agonist radiotracer R-[{sup 11}C]SKF 82957

    Energy Technology Data Exchange (ETDEWEB)

    Palner, Mikael, E-mail: mikael.palner@nru.d [Neurobiology Research Unit, Rigshospitalet and University of Copenhagen, Copenhagen (Denmark); Center for Integrated Molecular Brain Imaging, Rigshospitalet (Denmark); McCormick, Patrick; Parkes, Jun [PET Center, Center for Addiction and Mental Health, Toronto, Ontario (Canada); Knudsen, Gitte M. [Neurobiology Research Unit, Rigshospitalet and University of Copenhagen, Copenhagen (Denmark); Center for Integrated Molecular Brain Imaging, Rigshospitalet (Denmark); Wilson, Alan A. [PET Center, Center for Addiction and Mental Health, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, Ontario (Canada)

    2010-10-15

    Introduction: R-[{sup 11}C]-SKF 82957 is a high-affinity and potent dopamine D{sub 1} receptor agonist radioligand, which gives rise to a brain-penetrant lipophilic metabolite. In this study, we demonstrate that systemic administration of catechol-O-methyl transferase (COMT) inhibitors blocks this metabolic pathway, facilitating the use of R-[{sup 11}C]-SKF 82957 to image the high-affinity state of the dopamine D{sub 1} receptor with PET. Methods: R-[{sup 11}C]SKF 82957 was administered to untreated and COMT inhibitor-treated conscious rats, and the radioactive metabolites present in the brain and plasma were quantified by HPLC. Under optimal conditions, cerebral uptake and dopamine D{sub 1} binding of R-[{sup 11}C]SKF 82957 were measured ex vivo. In addition, pharmacological challenges with the receptor antagonist SCH 23390, amphetamine, the dopamine reuptake inhibitor RTI-32 and the dopamine hydroxylase inhibitor {alpha}-methyl-p-tyrosine were performed to study the specificity and sensitivity of R-[{sup 11}C]-SKF 82957 dopamine D{sub 1} binding in COMT-inhibited animals. Results: Treatment with the COMT inhibitor tolcapone was associated with a dose-dependent (EC{sub 90} 5.3{+-}4.3 mg/kg) reduction in the lipophilic metabolite. Tolcapone treatment (20 mg/kg) also resulted in a significant increase in the striatum/cerebellum ratio of R-[{sup 11}C]SKF 82957, from 15 (controls) to 24. Treatment with the dopamine D{sub 1} antagonist SCH 23390 reduced the striatal binding to the levels of the cerebellum, demonstrating a high specificity and selectivity of R-[{sup 11}C]SKF 82957 binding. Conclusions: Pre-treatment with the COMT inhibitor tolcapone inhibits formation of an interfering metabolite of R-[{sup 11}C]SKF 82957. Under such conditions, R-[{sup 11}C]SKF 82957 demonstrates high potential as the first agonist radiotracer for imaging the dopamine D{sub 1} receptor by PET.

  1. Classification of Cytochrome P450 1A2 Inhibitors and Non-Inhibitors by Machine Learning Techniques

    DEFF Research Database (Denmark)

    Vasanthanathan, Poongavanam; Taboureau, Olivier; Oostenbrink, Chris

    2009-01-01

    of CYP1A2 inhibitors and non-inhibitors. Training and test sets consisted of about 400 and 7000 compounds, respectively. Various machine learning techniques, like binary QSAR, support vector machine (SVM), random forest, kappa nearest neighbors (kNN), and decision tree methods were used to develop...

  2. Identification of catechols as histone-lysine demethylase inhibitors

    DEFF Research Database (Denmark)

    Nielsen, Anders L; Kristensen, Line H; Stephansen, Karen B

    2012-01-01

    Identification of inhibitors of histone-lysine demethylase (HDM) enzymes is important because of their involvement in the development of cancer. An ELISA-based assay was developed for identification of inhibitors of the HDM KDM4C in a natural products library. Based on one of the hits with affinity...... in the low µM range (1, a catechol), a subset of structurally related compounds was selected and tested against a panel of HDMs. In this subset, two inhibitors (2 and 10) had comparable affinities towards KDM4C and KDM6A but no effect on PHF8. One inhibitor restored H3K9me3 levels in KDM4C transfected U2-OS...

  3. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.

    Science.gov (United States)

    Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald

    2017-09-19

    The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.

  4. Structure-Based Design of Potent and Selective 3-Phosphoinositide-Dependent Kinase-1 (PDK1) Inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Medina, Jesus R.; Becker, Christopher J.; Blackledge, Charles W.; Duquenne, Celine; Feng, Yanhong; Grant, Seth W.; Heerding, Dirk; Li, William H.; Miller, William H.; Romeril, Stuart P.; Scherzer, Daryl; Shu, Arthur; Bobko, Mark A.; Chadderton, Antony R.; Dumble, Melissa; Gardiner, Christine M.; Gilbert, Seth; Liu, Qi; Rabindran, Sridhar K.; Sudakin, Valery; Xiang, Hong; Brady, Pat G.; Campobasso, Nino; Ward, Paris; Axten, Jeffrey M. (GSKPA)

    2014-10-02

    Phosphoinositide-dependent protein kinase-1(PDK1) is a master regulator of the AGC family of kinases and an integral component of the PI3K/AKT/mTOR pathway. As this pathway is among the most commonly deregulated across all cancers, a selective inhibitor of PDK1 might have utility as an anticancer agent. Herein we describe our lead optimization of compound 1 toward highly potent and selective PDK1 inhibitors via a structure-based design strategy. The most potent and selective inhibitors demonstrated submicromolar activity as measured by inhibition of phosphorylation of PDK1 substrates as well as antiproliferative activity against a subset of AML cell lines. In addition, reduction of phosphorylation of PDK1 substrates was demonstrated in vivo in mice bearing OCl-AML2 xenografts. These observations demonstrate the utility of these molecules as tools to further delineate the biology of PDK1 and the potential pharmacological uses of a PDK1 inhibitor.

  5. Does the treatment of type 2 diabetes mellitus with the DPP-4 inhibitor vildagliptin reduce HbA1c to a greater extent in Japanese patients than in Caucasian patients?

    Directory of Open Access Journals (Sweden)

    Foley JE

    2016-01-01

    Full Text Available James E Foley,1 Vaishali Bhosekar,2 Ryuzo Kawamori3 1Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA; 2Novartis Healthcare Pvt Ltd, Hyderabad, Telangana, India; 3Sportology Center, Juntendo University Graduate School of Medicine, Juntendo University, Tokyo, Japan Background: Previous work suggests that Japanese patients with type 2 diabetes mellitus (T2DM may respond more favorably to a DPP-4 (dipeptidyl peptidase-4 inhibitor than Caucasians. We aimed to compare the efficacy of the DPP-4 inhibitor vildagliptin (50 mg twice daily [bid] between Japanese and Caucasian populations. Methods: This analysis pooled data from 19 studies of drug-naïve patients with T2DM who were treated for 12 weeks with vildagliptin 50 mg bid as monotherapy. The pool comprised Japanese patients (n=338 who had been treated in Japan and Caucasian patients (n=1,275 who were treated elsewhere. Change from baseline (Δ in glycated hemoglobin (HbA1c at 12 weeks (in millimoles per mole versus baseline HbA1c (both in percentage National Glycohemoglobin Standardization Program units [NGSP%] and millimoles per mole for each population was reported. Universal HbA1c in millimoles per mole was calculated from either the Japanese Diabetes Society or the NGSP% HbA1c standards. Results: At baseline, mean values for Japanese and Caucasian patients, respectively, were as follows: age, 59 years and 56 years; % male, 69% and 57%. The average HbA1c was reduced from 7.90% to 6.96% (Japanese Diabetes Society and from 8.57% to 7.50% (United States National Glycohemoglobin Standardization Program, while HbA1c was reduced from 63 mmol/mol to 53 mmol/mol and from 70 mmol/mol to 58 mmol/mol in Japanese and Caucasians, respectively. ΔHbA1c increased with increasing baseline in both populations. The slopes were the same (0.41, r2=0.36; and 0.41, r2=0.15, and the intercepts were 15.4 mmol/mol and 17.2 mmol/mol, respectively. In Japanese patients, mean ΔHbA1c was greater by 1.7 mmol

  6. Acid corrosion inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Chen, N G

    1964-04-28

    An acid corrosion inhibitor is prepared by a 2-stage vacuum evaporation of effluents obtained from the ammonia columns of the coking oven plant. The effluent, leaving a scrubber in which the phenols are removed at a temperature of 98$C, passes through a quartz filter and flows into a heated chamber in which it is used for preheating a solution circulating through a vacuum unit, maintaining the temperature of the solution at 55$ to 60$C. The effluent enters a large tank in which it is boiled at 55$ to 60$C under 635 to 640 mm Hg pressure. Double evaporation of this solution yields a very effective acid corrosion inhibitor. Its corrosion-preventing effect is 97.9% compared with 90.1% for thiourea and 88.5% for urotropin under identical conditions.

  7. FoxM1 is a general target for proteasome inhibitors.

    Directory of Open Access Journals (Sweden)

    Uppoor G Bhat

    2009-08-01

    Full Text Available Proteasome inhibitors are currently in the clinic or in clinical trials, but the mechanism of their anticancer activity is not completely understood. The oncogenic transcription factor FoxM1 is one of the most overexpressed genes in human tumors, while its expression is usually halted in normal non-proliferating cells. Previously, we established that thiazole antibiotics Siomycin A and thiostrepton inhibit FoxM1 and induce apoptosis in human cancer cells. Here, we report that Siomycin A and thiostrepton stabilize the expression of a variety of proteins, such as p21, Mcl-1, p53 and hdm-2 and also act as proteasome inhibitors in vitro. More importantly, we also found that well-known proteasome inhibitors such as MG115, MG132 and bortezomib inhibit FoxM1 transcriptional activity and FoxM1 expression. In addition, overexpression of FoxM1 specifically protects against bortezomib-, but not doxorubicin-induced apoptosis. These data suggest that negative regulation of FoxM1 by proteasome inhibitors is a general feature of these drugs and it may contribute to their anticancer properties.

  8. Comparative high-resolution mapping of the wax inhibitors Iw1 and Iw2 in hexaploid wheat.

    Directory of Open Access Journals (Sweden)

    Haibin Wu

    Full Text Available The wax (glaucousness on wheat leaves and stems is mainly controlled by two sets of genes: glaucousness loci (W1 and W2 and non-glaucousness loci (Iw1 and Iw2. The non-glaucousness (Iw loci act as inhibitors of the glaucousness loci (W. High-resolution comparative genetic linkage maps of the wax inhibitors Iw1 originating from Triticum dicoccoides, and Iw2 from Aegilops tauschii were developed by comparative genomics analyses of Brachypodium, sorghum and rice genomic sequences corresponding to the syntenic regions of the Iw loci in wheat. Eleven Iw1 and eight Iw2 linked EST markers were developed and mapped to linkage maps on the distal regions of chromosomes 2BS and 2DS, respectively. The Iw1 locus mapped within a 0.96 cM interval flanked by the BE498358 and CA499581 EST markers that are collinear with 122 kb, 202 kb, and 466 kb genomic regions in the Brachypodium 5S chromosome, the sorghum 6S chromosome and the rice 4S chromosome, respectively. The Iw2 locus was located in a 4.1 to 5.4-cM interval in chromosome 2DS that is flanked by the CJ886319 and CJ519831 EST markers, and this region is collinear with a 2.3 cM region spanning the Iw1 locus on chromosome 2BS. Both Iw1 and Iw2 co-segregated with the BF474014 and CJ876545 EST markers, indicating they are most likely orthologs on 2BS and 2DS. These high-resolution maps can serve as a framework for chromosome landing, physical mapping and map-based cloning of the wax inhibitors in wheat.

  9. Proteomic Analysis of Bacillus thuringiensis Strain 4.0718 at Different Growth Phases

    Directory of Open Access Journals (Sweden)

    Xiaohui Li

    2012-01-01

    Full Text Available The growth process of Bacillus thuringiensis Bt4.0718 strain was studied using proteomic technologies. The proteins of Bt whole cells at three phases—middle vegetative, early sporulation, and late sporulation—were extracted with lysis buffer, followed with separation by 2-DE and identified by MALDI-TOF/TOF MS. Bioactive factors such as insecticidal crystal proteins (ICPs including Cry1Ac(3, Cry2Aa, and BTRX28, immune inhibitor (InhA, and InhA precursor were identified. InhA started to express at the middle vegetative phase, suggesting its contribution to the survival of Bt in the host body. At the early sporulation phase, ICPs started their expression. CotJC, OppA, ORF1, and SpoIVA related to the formation of crystals and spores were identified, the expression characteristics of which ensured the stable formation of crystals and spores. This study provides an important foundation for further exploration of the stable expression of ICPs, the smooth formation of crystals, and the construction of recombinant strains.

  10. Identification of Leishmania donovani Topoisomerase 1 inhibitors via intuitive scaffold hopping and bioisosteric modification of known Top 1 inhibitors

    Science.gov (United States)

    Mamidala, Rajinikanth; Majumdar, Papiya; Jha, Kunal Kumar; Bathula, Chandramohan; Agarwal, Rahul; Chary, M. Thirumala; Mazumdar, H. K.; Munshi, Parthapratim; Sen, Subhabrata

    2016-05-01

    A library of arylidenefuropyridinediones was discovered as potent inhibitors of Leishmania donovani Topoisomerase 1 (LdTop1) where the active molecules displayed considerable inhibition with single digit micromolar EC50 values. This molecular library was designed via intuitive scaffold hopping and bioisosteric modification of known topoisomerase 1 inhibitors such as camptothecin, edotecarin and etc. The design was rationalized by molecular docking analysis of the compound prototype with human topoisomerase 1 (HTop1) and Leishmania donovani topoisomerase 1(LdTop1). The most active compound 4 displayed no cytotoxicity against normal mammalian COS7 cell line (~100 fold less inhibition at the EC50). Similar to camptothecin, 4 interacted with free LdTop1 as observed in the preincubation DNA relaxation inhibition experiment. It also displayed anti-protozoal activity against Leishmania donovani promastigote. Crystal structure investigation of 4 and its molecular modelling with LdTop1 revealed putative binding sites in the enzyme that could be harnessed to generate molecules with better potency.

  11. Radiosynthesis and ex vivo evaluation of [11C-carbonyl]carbamate- and urea-based monoacylglycerol lipase inhibitors

    International Nuclear Information System (INIS)

    Hicks, Justin W.; Parkes, Jun; Tong, Junchao; Houle, Sylvain; Vasdev, Neil; Wilson, Alan A.

    2014-01-01

    Introduction: Monoacylglycerol lipase (MAGL) and fatty acid amide hydrolase (FAAH) are the two primary enzymes that regulate the tone of endocannabinoid signaling. Although new PET radiotracers have been discovered for imaging FAAH in vivo, no such radiotracer exists for imaging MAGL. Here we report the radiosynthesis of five candidate MAGL radiotracers and their ex vivo evaluations in mice and rats. Methods: Candidate carbamate and urea MAGL inhibitors were radiolabeled at the carbonyl position by [ 11 C]CO 2 fixation. Radiotracers were administered (tail-vein injection) to rodents and brain uptake of radioactivity measured at early and late time points ex vivo. Specificity of uptake was explored by pretreatment with unlabeled inhibitors (2 mg/kg, ip) 30 min prior to radiotracer administration. Results: All five candidate MAGL radiotracers were prepared in high specific activity (> 65 GBq/μmol) and radiochemical purity (> 98%). Moderate brain uptake (0.2–0.8 SUV) was observed for each candidate while pretreatment did not reduce uptake for four of the five tested. For two candidates ([ 11 C]12 and [ 11 C]14), high retention of radioactivity was observed in the blood (ca. 10 and 4 SUV at 40 min) which was blocked by pretreatment with unlabeled inhibitors. The most promising candidate, [ 11 C]18, demonstrated moderate brain uptake (ca. 0.8 SUV) which showed circa 50% blockade by pretreatment with unlabeled 18. Conclusion: One putative and four reported potent and selective MAGL inhibitors have been radiolabeled via [ 11 C]CO 2 fixation as radiotracers for this enzyme. Despite the promising in vitro pharmacological profile, none of the five candidate radiotracers exhibited in vivo behavior suitable for PET neuroimaging

  12. Identification of a human protein-derived HIV-1 fusion inhibitor targeting the gp41 fusion core structure.

    Directory of Open Access Journals (Sweden)

    Lijun Chao

    Full Text Available The HIV-1 envelope glycoprotein (Env gp41 plays a crucial role in the viral fusion process. The peptides derived from the C-terminal heptad repeat (CHR of gp41 are potent HIV fusion inhibitors. However, the activity of these anti-HIV-1 peptides in vivo may be attenuated by their induction of anti-gp41 antibodies. Thus, it is essential to identify antiviral peptides or proteins with low, or no, immunogenicity to humans. Here, we found that the C-terminal fragment (aa 462-521 of the human POB1 (the partner of RalBP1, designated C60, is an HIV-1 fusion inhibitor. It bound to N36, the peptide derived from the N-terminal heptad repeat (NHR of gp41, and to the six-helix bundle (6-HB formed by N36 and C34, a CHR-peptide, but it did not bind to C34. Unlike the CHR-peptides, C60 did not block gp41 6-HB formation. Rather, results suggest that C60 inhibits HIV-1 fusion by binding to the 6-HB, in particular, the residues in the gp41 NHR domain that are exposed on the surface of 6-HB. Since 6-HB plays a crucial role in the late stage of fusion between the viral envelope and endosomal membrane during the endocytic process of HIV-1, C60 may serve as a host restriction factor to suppress HIV-1 entry into CD4+ T lymphocytes. Taken together, it can be concluded from these results that C60 can be used as a lead for the development of anti-HIV-1 therapeutics or microbicides for the treatment and prevention of HIV-1 infection, as well as a molecular probe to study the fusogenic mechanism of HIV-1.

  13. Pore Polarity and Charge Determine Differential Block of Kir1.1 and Kir7.1 Potassium Channels by Small-Molecule Inhibitor VU590.

    Science.gov (United States)

    Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S

    2017-09-01

    VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  14. Probing the aglycon binding site of a b-glucosidase: a collection of C-1-modified 2,5-dideoxy-2,5-imino-D-mannitol derivatives and their structure-activity relationships as competitive inhibitors

    DEFF Research Database (Denmark)

    Wrodnigg, Tanja; Diness, Frederik; Gruber, Christoph

    2004-01-01

    A range of new C-1 modified derivatives of the powerful glucosidase inhibitor 2,5-dideoxy-2,5-imino-D-mannitol has been synthesised and their biological activities probed with the b-glucosidase from Agrobacterium sp. Ki values are compared with those of previously prepared close relatives. Findings...

  15. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

    Science.gov (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

    2017-11-08

    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  16. Tailored release drug delivery system for rifampicin and isoniazid for enhanced bioavailability of rifampicin.

    Science.gov (United States)

    Avachat, Amelia M; Bhise, Satish B

    2011-04-01

    The front line antitubercular drugs rifampicin (RMP) and isoniazid (INH), when co-administered, face the problem of reduced bioavailability of RMP. Stabilization of RMP in the presence of INH under acidic environment may improve the bioavailability of RMP. In vitro degradation studies showed around 15-25% degradation of RMP under the aforesaid conditions if the ratio of RMP: INH is above 1:0.5.This degradation is reduced to less than 10% when the ratio of RMP: INH is below 1:0.25. Based on these findings, an innovative drug delivery system was designed with the immediate release of RMP and tailored prolonged release of INH. The bilayer tablets prepared with this concept were subjected to relative bioavailability studies in healthy human volunteers in an open label, balanced, randomized, single-dose, cross-over study under fasted state. A validated LC-MS/MS bioanalytical method was employed for estimation of RMP and INH in plasma. Bioavailability studies revealed that C(max) and AUC for RMP increased by 18 and 20%, respectively, confirming the above innovative concept. Even in the case of INH, AUC increased significantly by around 30% and thus time above minimum inhibitory concentration (MIC) would also increase, which may result in further improved clinical outcome.

  17. Fragment-Based Drug Discovery of Potent Protein Kinase C Iota Inhibitors.

    Science.gov (United States)

    Kwiatkowski, Jacek; Liu, Boping; Tee, Doris Hui Ying; Chen, Guoying; Ahmad, Nur Huda Binte; Wong, Yun Xuan; Poh, Zhi Ying; Ang, Shi Hua; Tan, Eldwin Sum Wai; Ong, Esther Hq; Nurul Dinie; Poulsen, Anders; Pendharkar, Vishal; Sangthongpitag, Kanda; Lee, May Ann; Sepramaniam, Sugunavathi; Ho, Soo Yei; Cherian, Joseph; Hill, Jeffrey; Keller, Thomas H; Hung, Alvin W

    2018-05-24

    Protein kinase C iota (PKC-ι) is an atypical kinase implicated in the promotion of different cancer types. A biochemical screen of a fragment library has identified several hits from which an azaindole-based scaffold was chosen for optimization. Driven by a structure-activity relationship and supported by molecular modeling, a weakly bound fragment was systematically grown into a potent and selective inhibitor against PKC-ι.

  18. Boceprevir: a protease inhibitor for the treatment of hepatitis C.

    Science.gov (United States)

    Chang, Mei H; Gordon, Lori A; Fung, Horatio B

    2012-10-01

    Boceprevir is a protease inhibitor indicated for the treatment of chronic hepatitis C virus (HCV) genotype 1 infection in combination with peginterferon and ribavirin for treatment-naive patients and those who previously failed to improve with interferon and ribavirin treatment. This article provides an overview of the mechanism of action, pharmacologic and pharmacokinetic properties, clinical efficacy, and tolerability of boceprevir. Relevant information was identified through a search of PubMed (1990-July 2012), EMBASE (1990-July 2012), International Pharmaceutical Abstracts (1970-July 2012), and Google Scholar using the key words boceprevir, SCH 503034, non-structural protein 3 (NS3) serine protease inhibitor, and direct-acting antiviral agent (DAA). Additional information was obtained from the US Food and Drug Administration's Web site, review of the reference lists of identified articles, and posters and abstracts from scientific meetings. Clinical efficacy of boceprevir was assessed in 2 Phase III trials, Serine Protease Inhibitor Therapy-2 (SPRINT-2) for treatment-naive patients and Retreatment with HCV Serine Protease Inhibitor Boceprevir and PegIntron/Rebetol 2 (RESPOND-2) for treatment-experienced patients. In SPRINT-2, patients were randomized to receive peginterferon + ribavirin (PR) or peginterferon + ribavirin + boceprevir (PRB); duration of boceprevir therapy varied from 24, 32, to 44 weeks on the basis of HCV RNA results. The primary endpoint was achievement of sustained virologic response (SVR; lower limit of detection, 9.3 IU/mL). The addition of boceprevir was shown to be superior, with overall SVR rates ranging from 63% to 66% compared with 38% with PR (P < 0.001). Results of SVR in SPRINT-2 were also reorganized to monitor SVRs in black and non-black patients. Treatment-experienced patients were assessed in RESPOND-2; however, null responders were excluded. Patients were again randomized to PR or PRB; duration of boceprevir therapy varied from

  19. PD-1 Checkpoint Inhibitor Associated Autoimmune Encephalitis

    Directory of Open Access Journals (Sweden)

    Stephanie Schneider

    2017-05-01

    Full Text Available Objective: To report first-hand narrative experience of autoimmune encephalitis and to briefly review currently available evidence of autoimmune encephalitis in cancer patients treated with immune checkpoint inhibitors. Setting: A case study is presented on the management of a patient who developed autoimmune encephalitis during nivolumab monotherapy occurring after 28 weeks on anti-PD-1 monotherapy (nivolumab 3 mg/kg every 2 weeks for non-small cell lung cancer. Results: No substantial improvement was observed by antiepileptic treatment. After administration of 80 mg methylprednisolone, neurologic symptoms disappeared within 24 h and the patient fully recovered. Conclusions: Immune checkpoint inhibitor treatment can lead to autoimmune encephalitis. Clinical trial data indicate a frequency of autoimmune encephalitis of ≥0.1 to <1% with a higher probability during combined or sequential anti-CTLA-4/anti-PD-1 therapy than during anti-PD-1 or anti-PD-L1 monotherapy. Further collection of evidence and translational research is warranted.

  20. Fragment-Based Discovery of a Potent, Orally Bioavailable Inhibitor That Modulates the Phosphorylation and Catalytic Activity of ERK1/2.

    Science.gov (United States)

    Heightman, Tom D; Berdini, Valerio; Braithwaite, Hannah; Buck, Ildiko M; Cassidy, Megan; Castro, Juan; Courtin, Aurélie; Day, James E H; East, Charlotte; Fazal, Lynsey; Graham, Brent; Griffiths-Jones, Charlotte M; Lyons, John F; Martins, Vanessa; Muench, Sandra; Munck, Joanne M; Norton, David; O'Reilly, Marc; Palmer, Nick; Pathuri, Puja; Reader, Michael; Rees, David C; Rich, Sharna J; Richardson, Caroline; Saini, Harpreet; Thompson, Neil T; Wallis, Nicola G; Walton, Hugh; Wilsher, Nicola E; Woolford, Alison J-A; Cooke, Michael; Cousin, David; Onions, Stuart; Shannon, Jonathan; Watts, John; Murray, Christopher W

    2018-05-31

    Aberrant activation of the MAPK pathway drives cell proliferation in multiple cancers. Inhibitors of BRAF and MEK kinases are approved for the treatment of BRAF mutant melanoma, but resistance frequently emerges, often mediated by increased signaling through ERK1/2. Here, we describe the fragment-based generation of ERK1/2 inhibitors that block catalytic phosphorylation of downstream substrates such as RSK but also modulate phosphorylation of ERK1/2 by MEK without directly inhibiting MEK. X-ray crystallographic and biophysical fragment screening followed by structure-guided optimization and growth from the hinge into a pocket proximal to the C-α helix afforded highly potent ERK1/2 inhibitors with excellent kinome selectivity. In BRAF mutant cells, the lead compound suppresses pRSK and pERK levels and inhibits proliferation at low nanomolar concentrations. The lead exhibits tumor regression upon oral dosing in BRAF mutant xenograft models, providing a promising basis for further optimization toward clinical pERK1/2 modulating ERK1/2 inhibitors.

  1. Identification of the hot spot residues for pyridine derivative inhibitor CCT251455 and ATP substrate binding on monopolar spindle 1 (MPS1) kinase by molecular dynamic simulation.

    Science.gov (United States)

    Chen, Kai; Duan, Wenxiu; Han, Qianqian; Sun, Xuan; Li, Wenqian; Hu, Shuangyun; Wan, Jiajia; Wu, Jiang; Ge, Yushu; Liu, Dan

    2018-03-08

    Protein kinase monopolar spindle 1 plays an important role in spindle assembly checkpoint at the onset of mitosis. Over expression of MPS1 correlated with a wide range of human tumors makes it an attractive target for finding an effective and specific inhibitor. In this work, we performed molecular dynamics simulations of protein MPS1 itself as well as protein bound systems with the inhibitor and natural substrate based on crystal structures. The reported orally bioavailable 1 h-pyrrolo [3,2-c] pyridine inhibitors of MPS1 maintained stable binding in the catalytic site, while natural substrate ATP could not stay. Comparative study of stability and flexibility of three systems reveals position shifting of β-sheet region within the catalytic site, which indicates inhibition mechanism was through stabilizing the β-sheet region. Binding free energies calculated with MM-GB/PBSA method shows different binding affinity for inhibitor and ATP. Finally, interactions between protein and inhibitor during molecular dynamic simulations were measured and counted. Residue Gly605 and Leu654 were suggested as important hot spots for stable binding of inhibitor by molecular dynamic simulation. Our results reveal an important position shifting within catalytic site for non-inhibited proteins. Together with hot spots found by molecular dynamic simulation, the results provide important information of inhibition mechanism and will be referenced for designing novel inhibitors.

  2. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2012-05-01

    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  3. Andrastins A-C, new protein farnesyltransferase inhibitors produced by Penicillium sp. FO-3929. I. Producing strain, fermentation, isolation, and biological activities.

    Science.gov (United States)

    Omura, S; Inokoshi, J; Uchida, R; Shiomi, K; Masuma, R; Kawakubo, T; Tanaka, H; Iwai, Y; Kosemura, S; Yamamura, S

    1996-05-01

    New protein farnesyltransferase inhibitors, andrastins A-C, have been discovered in the cultured broth of Penicillium sp. FO-3929. Andrastins extracted from broth supernatant were purified by silica gel chromatography, ODS chromatography and HPLC. The IC50 of andrastins A, B, and C against protein farnesyltransferase were 24.9, 47.1, and 13.3 microM, respectively.

  4. Interaction of protein C inhibitor with the type II transmembrane serine protease enteropeptidase.

    Directory of Open Access Journals (Sweden)

    Thomas A Prohaska

    Full Text Available The serine protease inhibitor protein C inhibitor (PCI is expressed in many human tissues and exhibits broad protease reactivity. PCI binds glycosaminoglycans and certain phospholipids, which modulate its inhibitory activity. Enteropeptidase (EP is a type II transmembrane serine protease mainly found on the brush border membrane of epithelial cells in the duodenum, where it activates trypsinogen to initiate the digestion of food proteins. Some active EP is also present in duodenal fluid and has been made responsible for causing pancreatitis in case of duodeno-pancreatic reflux. Together with its substrate trypsinogen, EP is furthermore present in the epidermis and in some cancer cells. In this report, we show that PCI inhibited EP with an apparent 2nd order rate constant of 4.48 × 10(4 M(-1 s(-1. Low molecular weight (LMWH and unfractionated heparin (UFH slightly reduced the inhibitory effect of PCI. The SI (stoichiometry of inhibition value for the inhibition of EP by PCI was 10.8 in the absence and 17.9 in the presence of UFH (10 U/ml. By inhibiting trypsin, chymotrypsin, and additionally EP, PCI might play a role in the protection of the pancreas from autodigestion. Furthermore the interaction of PCI with EP may influence the regulation of epithelial differentiation.

  5. Anti-inflammatory effect of a selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor via the stimulation of heme oxygenase-1 in LPS-activated mice and J774.1 murine macrophages

    Directory of Open Access Journals (Sweden)

    Sung Bum Park

    2016-08-01

    Full Text Available 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1 converts inactive cortisone to the active cortisol. 11β-HSD1 may be involved in the resolution of inflammation. In the present study, we investigate the anti-inflammatory effects of 2-(3-benzoyl-4-hydroxy-1,1-dioxo-2H-1,2-benzothiazine-2-yl-1-phenylethanone (KR-66344, a selective 11β-HSD1 inhibitor, in lipopolysaccharide (LPS-activated C57BL/6J mice and macrophages. LPS increased 11β-HSD1 activity and expression in macrophages, which was inhibited by KR-66344. In addition, KR-66344 increased survival rate in LPS treated C57BL/6J mice. HO-1 mRNA expression level was increased by KR-66344, and this effect was reversed by the HO competitive inhibitor, ZnPP, in macrophages. Moreover, ZnPP reversed the suppression of ROS formation and cell death induced by KR-66344. ZnPP also suppressed animal survival rate in LPS plus KR-66344 treated C57BL/6J mice. In the spleen of LPS-treated mice, KR-66344 prevented cell death via suppression of inflammation, followed by inhibition of ROS, iNOS and COX-2 expression. Furthermore, LPS increased NFκB-p65 and MAPK phosphorylation, and these effects were abolished by pretreatment with KR-66344. Taken together, KR-66344 protects against LPS-induced animal death and spleen injury by inhibition of inflammation via induction of HO-1 and inhibition of 11β-HSD1 activity. Thus, we concluded that the selective 11β-HSD1 inhibitor may provide a novel strategy in the prevention/treatment of inflammatory disorders in patients.

  6. Antimalarial activity of HIV-1 protease inhibitor in chromone series.

    Science.gov (United States)

    Lerdsirisuk, Pradith; Maicheen, Chirattikan; Ungwitayatorn, Jiraporn

    2014-12-01

    Increasing parasite resistance to nearly all available antimalarial drugs becomes a serious problem to human health and necessitates the need to continue the search for new effective drugs. Recent studies have shown that clinically utilized HIV-1 protease (HIV-1 PR) inhibitors can inhibit the in vitro and in vivo growth of Plasmodium falciparum. In this study, a series of chromone derivatives possessing HIV-1 PR inhibitory activity has been tested for antimalarial activity against P. falciparum (K1 multi-drug resistant strain). Chromone 15, the potent HIV-1 PR inhibitor (IC50=0.65μM), was found to be the most potent antimalarial compound with IC50=0.95μM while primaquine and tafenoquine showed IC50=2.41 and 1.95μM, respectively. Molecular docking study of chromone compounds against plasmepsin II, an aspartic protease enzyme important in hemoglobin degradation, revealed that chromone 15 exhibited the higher binding affinity (binding energy=-13.24kcal/mol) than the known PM II inhibitors. Thus, HIV-1 PR inhibitor in chromone series has the potential to be a new class of antimalarial agent. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Structure based design of 11β-HSD1 inhibitors.

    Science.gov (United States)

    Singh, Suresh; Tice, Colin

    2010-11-01

    Controlling elevated tissue-specific levels of cortisol may provide a novel therapeutic approach for treating metabolic syndrome. This concept has spurred large scale medicinal chemistry efforts in the pharmaceutical industry for the design of 11β-HSD1 inhibitors. High resolution X-ray crystal structures of inhibitors in complex with the enzyme have facilitated the structure-based design of diverse classes of molecules. A summary of binding modes, trends in structure-activity relationships, and the pharmacodynamic data of inhibitors from each class is presented.

  8. Inhibitors of nuclease and redox activity of apurinic/apyrimidinic endonuclease 1/redox effector factor 1 (APE1/Ref-1).

    Science.gov (United States)

    Laev, Sergey S; Salakhutdinov, Nariman F; Lavrik, Olga I

    2017-05-01

    Human apurinic/apyrimidinic endonuclease 1/redox effector factor 1 (APE1/Ref-1) is a multifunctional protein which is essential in the base excision repair (BER) pathway of DNA lesions caused by oxidation and alkylation. This protein hydrolyzes DNA adjacent to the 5'-end of an apurinic/apyrimidinic (AP) site to produce a nick with a 3'-hydroxyl group and a 5'-deoxyribose phosphate moiety or activates the DNA-binding activity of certain transcription factors through its redox function. Studies have indicated a role for APE1/Ref-1 in the pathogenesis of cancer and in resistance to DNA-interactive drugs. Thus, this protein has potential as a target in cancer treatment. As a result, major efforts have been directed to identify small molecule inhibitors against APE1/Ref-1 activities. These agents have the potential to become anticancer drugs. The aim of this review is to present recent progress in studies of all published small molecule APE1/Ref-1 inhibitors. The structures and activities of APE1/Ref-1 inhibitors, that target both DNA repair and redox activities, are presented and discussed. To date, there is an urgent need for further development of the design and synthesis of APE1/Ref-1 inhibitors due to high importance of this protein target. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. C-Aryl glucoside SGLT2 inhibitors containing a biphenyl motif as potential anti-diabetic agents.

    Science.gov (United States)

    Ding, Yuyang; Mao, Liufeng; Xu, Dengfeng; Xie, Hui; Yang, Ling; Xu, Hongjiang; Geng, Wenjun; Gao, Yong; Xia, Chunguang; Zhang, Xiquan; Meng, Qingyi; Wu, Donghai; Zhao, Junling; Hu, Wenhui

    2015-07-15

    A series of highly active C-aryl glucoside SGLT2 inhibitors containing a biphenyl motif were designed and synthesized for biological evaluation. Among the compounds tested, compound 16l demonstrated high inhibitory activity against SGLT2 (IC50=1.9 nM) with an excellent pharmacokinetic profile. Further study indicated that the in vivo efficacy of compound 16l was comparable to that of dapagliflozin, suggesting that further development would be worthwhile. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Preoperative plasma plasminogen activator inhibitor type-1 and serum C-reactive protein levels in patients with colorectal cancer. The RANX05 Colorectal Cancer Study Group

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen; Christensen, Ib Jarle; Sørensen, Steen

    2000-01-01

    study we analyzed the association between plasma PAI-1 and serum CRP in patients scheduled for elective resection of colorectal cancer. In addition, the prognostic value of PAI-1 and CRP was studied in this patient cohort. METHODS: PAI-1 and CRP were analyzed in citrated plasma and serum, respectively......, excluding patients with Dukes' D disease showed serum CRP to be an independent prognostic variable (P study did not show a strong correlation between plasma PAI-1 and serum CRP in patients with colorectal cancer. Serum CRP was found to be a Dukes......BACKGROUND: Preoperative plasma plasminogen activator inhibitor-1 (PAI-1) is a prognostic variable in patients with colorectal cancer. It has been suggested, however, that plasma PAI-1 is a nonspecific prognostic parameter similar to the acute-phase reactant C-reactive protein (CRP). In the present...

  11. Potent and Selective Covalent Quinazoline Inhibitors of KRAS G12C

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Mei; Lu, Jia; Li, Lianbo; Feru, Frederic; Quan, Chunshan; Gero, Thomas W.; Ficarro, Scott B.; Xiong, Yuan; Ambrogio, Chiara; Paranal, Raymond M.; Catalano, Marco; Shao, Jay; Wong, Kwok-Kin; Marto, Jarrod A.; Fischer, Eric S.; Jänne, Pasi A.; Scott, David A.; Westover, Kenneth D.; Gray, Nathanael S. (DFCI); (UTSMC); (Harvard-Med); (NYUSM)

    2017-08-01

    Targeted covalent small molecules have shown promise for cancers driven by KRAS G12C. Allosteric compounds that access an inducible pocket formed by movement of a dynamic structural element in KRAS, switch II, have been reported, but these compounds require further optimization to enable their advancement into clinical development. We demonstrate that covalent quinazoline-based switch II pocket (SIIP) compounds effectively suppress GTP loading of KRAS G12C, MAPK phosphorylation, and the growth of cancer cells harboring G12C. Notably we find that adding an amide substituent to the quinazoline scaffold allows additional interactions with KRAS G12C, and remarkably increases the labeling efficiency, potency, and selectivity of KRAS G12C inhibitors. Structural studies using X-ray crystallography reveal a new conformation of SIIP and key interactions made by substituents located at the quinazoline 2-, 4-, and 7-positions. Optimized lead compounds in the quinazoline series selectively inhibit KRAS G12C-dependent signaling and cancer cell growth at sub-micromolar concentrations.

  12. Significance of Coexisting Mutations on Determination of the Degree of Isoniazid Resistance in Mycobacterium tuberculosis Strains.

    Science.gov (United States)

    Karunaratne, Galbokka Hewage Roshanthi Eranga; Wijesundera, Sandhya Sulochana; Vidanagama, Dhammika; Adikaram, Chamila Priyangani; Perera, Jennifer

    2018-04-23

    The emergence and spread of drug-resistant tuberculosis (TB) pose a threat to TB control in Sri Lanka. Isoniazid (INH) is a key element of the first-line anti-TB treatment regimen. Resistance to INH is mainly associated with point mutations in katG, inhA, and ahpC genes. The objective of this study was to determine mutations of these three genes in INH-resistant Mycobacterium tuberculosis (MTb) strains in Sri Lanka. Complete nucleotide sequence of the three genes was amplified by polymerase chain reaction and subjected to DNA sequencing. Point mutations in the katG gene were identified in 93% isolates, of which the majority (78.6%) were at codon 315. Mutations at codons 212 and 293 of the katG gene have not been reported previously. Novel mutations were recognized in the promoter region of the inhA gene (C deletion at -34), fabG1 gene (codon 27), and ahpC gene (codon 39). Single S315T mutation in the katG gene led to a high level of resistance, while a low level of resistance with high frequency (41%) was observed when katG codon 315 coexisted with the mutation at codon 463. Since most of the observed mutations of all three genes coexisted with the katG315 mutation, screening of katG315 mutations will be a useful marker for molecular detection of INH resistance of MTb in Sri Lanka.

  13. Developing HIV-1 Protease Inhibitors through Stereospecific Reactions in Protein Crystals.

    Science.gov (United States)

    Olajuyigbe, Folasade M; Demitri, Nicola; De Zorzi, Rita; Geremia, Silvano

    2016-10-31

    Protease inhibitors are key components in the chemotherapy of HIV infection. However, the appearance of viral mutants routinely compromises their clinical efficacy, creating a constant need for new and more potent inhibitors. Recently, a new class of epoxide-based inhibitors of HIV-1 protease was investigated and the configuration of the epoxide carbons was demonstrated to play a crucial role in determining the binding affinity. Here we report the comparison between three crystal structures at near-atomic resolution of HIV-1 protease in complex with the epoxide-based inhibitor, revealing an in-situ epoxide ring opening triggered by a pH change in the mother solution of the crystal. Increased pH in the crystal allows a stereospecific nucleophile attack of an ammonia molecule onto an epoxide carbon, with formation of a new inhibitor containing amino-alcohol functions. The described experiments open a pathway for the development of new stereospecific protease inhibitors from a reactive lead compound.

  14. Developing HIV-1 Protease Inhibitors through Stereospecific Reactions in Protein Crystals

    Directory of Open Access Journals (Sweden)

    Folasade M. Olajuyigbe

    2016-10-01

    Full Text Available Protease inhibitors are key components in the chemotherapy of HIV infection. However, the appearance of viral mutants routinely compromises their clinical efficacy, creating a constant need for new and more potent inhibitors. Recently, a new class of epoxide-based inhibitors of HIV-1 protease was investigated and the configuration of the epoxide carbons was demonstrated to play a crucial role in determining the binding affinity. Here we report the comparison between three crystal structures at near-atomic resolution of HIV-1 protease in complex with the epoxide-based inhibitor, revealing an in-situ epoxide ring opening triggered by a pH change in the mother solution of the crystal. Increased pH in the crystal allows a stereospecific nucleophile attack of an ammonia molecule onto an epoxide carbon, with formation of a new inhibitor containing amino-alcohol functions. The described experiments open a pathway for the development of new stereospecific protease inhibitors from a reactive lead compound.

  15. SCH-C (SCH 351125), an orally bioavailable, small molecule antagonist of the chemokine receptor CCR5, is a potent inhibitor of HIV-1 infection in vitro and in vivo.

    Science.gov (United States)

    Strizki, J M; Xu, S; Wagner, N E; Wojcik, L; Liu, J; Hou, Y; Endres, M; Palani, A; Shapiro, S; Clader, J W; Greenlee, W J; Tagat, J R; McCombie, S; Cox, K; Fawzi, A B; Chou, C C; Pugliese-Sivo, C; Davies, L; Moreno, M E; Ho, D D; Trkola, A; Stoddart, C A; Moore, J P; Reyes, G R; Baroudy, B M

    2001-10-23

    We describe here the identification and properties of SCH-C (SCH 351125), a small molecule inhibitor of HIV-1 entry via the CCR5 coreceptor. SCH-C, an oxime-piperidine compound, is a specific CCR5 antagonist as determined in multiple receptor binding and signal transduction assays. This compound specifically inhibits HIV-1 infection mediated by CCR5 in U-87 astroglioma cells but has no effect on infection of CXCR4-expressing cells. SCH-C has broad and potent antiviral activity in vitro against primary HIV-1 isolates that use CCR5 as their entry coreceptor, with mean 50% inhibitory concentrations ranging between 0.4 and 9 nM. Moreover, SCH-C strongly inhibits the replication of an R5-using HIV-1 isolate in SCID-hu Thy/Liv mice. SCH-C has a favorable pharmacokinetic profile in rodents and primates with an oral bioavailability of 50-60% and a serum half-life of 5-6 h. On the basis of its novel mechanism of action, potent antiviral activity, and in vivo pharmacokinetic profile, SCH-C is a promising new candidate for therapeutic intervention of HIV infection.

  16. Structure of the Enterovirus 71 3C Protease in Complex with NK-1.8k and Indications for the Development of Antienterovirus Protease Inhibitor.

    Science.gov (United States)

    Wang, Yaxin; Cao, Lin; Zhai, Yangyang; Yin, Zheng; Sun, Yuna; Shang, Luqing

    2017-07-01

    Hand-foot-and-mouth disease (HFMD), caused by enterovirus, is a threat to public health worldwide. To date, enterovirus 71 (EV71) has been one of the major causative agents of HFMD in the Pacific-Asia region, and outbreaks with EV71 cause millions of infections. However, no drug is currently available for clinical therapeutics. In our previous works, we developed a set of protease inhibitors (PIs) targeting the EV71 3C protease (3C pro ). Among these are NK-1.8k and NK-1.9k, which have various active groups and high potencies and selectivities. In the study described here, we determined the structures of the PI NK-1.8k in complex with wild-type (WT) and drug-resistant EV71 3C pro Comparison of these structures with the structure of unliganded EV71 3C pro and its complex with AG7088 indicated that the mutation of N69 to a serine residue destabilized the S2 pocket. Thus, the mutation influenced the cleavage activity of EV71 3C pro and the inhibitory activity of NK-1.8k in an in vitro protease assay and highlighted that site 69 is an additional key site for PI design. More information for the optimization of the P1' to P4 groups of PIs was also obtained from these structures. Together with the results of our previous works, these in-depth results elucidate the inhibitory mechanism of PIs and shed light to develop PIs for the clinical treatment of infections caused by EV71 and other enteroviruses. Copyright © 2017 American Society for Microbiology.

  17. Synthesis and structure activity relationships of carbamimidoylcarbamate derivatives as novel vascular adhesion protein-1 inhibitors.

    Science.gov (United States)

    Yamaki, Susumu; Yamada, Hiroyoshi; Nagashima, Akira; Kondo, Mitsuhiro; Shimada, Yoshiaki; Kadono, Keitaro; Yoshihara, Kosei

    2017-11-01

    Vascular adhesion protein-1 (VAP-1) is a promising therapeutic target for the treatment of diabetic nephropathy. Here, we conducted structural optimization of the glycine amide derivative 1, which we previously reported as a novel VAP-1 inhibitor, to improve stability in dog and monkey plasma, and aqueous solubility. By chemical modification of the right part in the glycine amide derivative, we identified the carbamimidoylcarbamate derivative 20c, which showed stability in dog and monkey plasma while maintaining VAP-1 inhibitory activity. We also found that conversion of the pyrimidine ring in 20c into saturated rings was effective for improving aqueous solubility. This led to the identification of 28a and 35 as moderate VAP-1 inhibitors with excellent aqueous solubility. Further optimization led to the identification of 2-fluoro-3-{3-[(6-methylpyridin-3-yl)oxy]azetidin-1-yl}benzyl carbamimidoylcarbamate (40b), which showed similar human VAP-1 inhibitory activity to 1 with improved aqueous solubility. 40b showed more potent ex vivo efficacy than 1, with rat plasma VAP-1 inhibitory activity of 92% at 1h after oral administration at 0.3mg/kg. In our pharmacokinetic study, 40b showed good oral bioavailability in rats, dogs, and monkeys, which may be due to its improved stability in dog and monkey plasma. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Design, Synthesis and Biological Evaluation of Histone Deacetylase (HDAC) Inhibitors: Saha (Vorinostat) Analogs and Biaryl Indolyl Benzamide Inhibitors Display Isoform Selectivity

    Science.gov (United States)

    Negmeldin, Ahmed Thabet

    HDAC proteins have emerged as interesting targets for anti-cancer drugs due to their involvement in cancers, as well as several other diseases. Several HDAC inhibitors have been approved by the FDA as anti-cancer drugs, including SAHA (suberoylanilide hydroxamic acid, Vorinostat). Unfortunately, SAHA inhibits most HDAC isoforms, which limit its use as a pharmacological tool and may lead to side effects in the clinic. In this work we were interested in developing isoform selective HDAC inhibitors, which may decrease or eliminate the side effects associated with non-selective inhibitors treatment. In addition, isoform selective HDAC inhibitors can be used as biological tools to help understand the HDAC-related cancer biology. Our strategy was based on synthesis and screening of several derivatives of the non-selective FDA approved drug SAHA substituted at different positions of the linker region. Several SAHA analogs modified at the C4 and C5 positions of the linker were synthesized. The new C4- and C5-modified SAHA libraries, along with the previously synthesized C2-modified SAHA analogs were screened in vitro and in cellulo for HDAC isoform selectivity. Interestingly, several analogs exhibited dual HDAC6/HDAC8 selectivity. Enantioselective syntheses of the pure enantiomers of some of the interesting analogs were performed and the enantiomers were screened in vitro. Among the most interesting analogs, ( R)-C4-benzyl SAHA displayed 520- to 1300-fold selectivity for HDAC6 and HDAC8 over HDAC1, 2, and 3, with IC50 values of 48 and 27 nM with HDAC6 and 8, respectively. Docking studies were performed to provide structural rationale for the observed selectivity of the new analogs. In addition, rational design, synthesis, and screening of several other biaryl indolyl benzamide HDAC inhibitors is discussed, and some showed modest HDAC1 selectivity. The new biaryl indolyl benzamides can be useful to further develop HDAC1 selective inhibitors. The dual HDAC6/8 selective

  19. Tumor necrosis factor-alpha potentiates the cytotoxicity of amiodarone in Hepa1c1c7 cells: roles of caspase activation and oxidative stress.

    Science.gov (United States)

    Lu, Jingtao; Miyakawa, Kazuhisa; Roth, Robert A; Ganey, Patricia E

    2013-01-01

    Amiodarone (AMD), a class III antiarrhythmic drug, causes idiosyncratic hepatotoxicity in human patients. We demonstrated previously that tumor necrosis factor-alpha (TNF-α) plays an important role in a rat model of AMD-induced hepatotoxicity under inflammatory stress. In this study, we developed a model in vitro to study the roles of caspase activation and oxidative stress in TNF potentiation of AMD cytotoxicity. AMD caused cell death in Hepa1c1c7 cells, and TNF cotreatment potentiated its toxicity. Activation of caspases 9 and 3/7 was observed in AMD/TNF-cotreated cells, and caspase inhibitors provided minor protection from cytotoxicity. Intracellular reactive oxygen species (ROS) generation and lipid peroxidation were observed after treatment with AMD and were further elevated by TNF cotreatment. Adding water-soluble antioxidants (trolox, N-acetylcysteine, glutathione, or ascorbate) produced only minor attenuation of AMD/TNF-induced cytotoxicity and did not influence the effect of AMD alone. On the other hand, α-tocopherol (TOCO), which reduced lipid peroxidation and ROS generation, prevented AMD toxicity and caused pronounced reduction in cytotoxicity from AMD/TNF cotreatment. α-TOCO plus a pancaspase inhibitor completely abolished AMD/TNF-induced cytotoxicity. In summary, activation of caspases and oxidative stress were observed after AMD/TNF cotreatment, and caspase inhibitors and a lipid-soluble free-radical scavenger attenuated AMD/TNF-induced cytotoxicity.

  20. Polymorphisms in STAT4, PTPN2, PSORS1C1 and TRAF3IP2 Genes Are Associated with the Response to TNF Inhibitors in Patients with Rheumatoid Arthritis

    Science.gov (United States)

    Politi, Cristina; Triggianese, Paola; Rufini, Sara; Kroegler, Barbara; Perricone, Carlo; Latini, Andrea; Novelli, Giuseppe; Borgiani, Paola; Perricone, Roberto

    2017-01-01

    Objective Rheumatoid Arthritis (RA) is a progressive autoimmune disease characterized by chronic joint inflammation and structural damage. Remission or at least low disease activity (LDA) represent potentially desirable goals of RA treatment. Single nucleotide polymorphisms (SNPs) in several genes might be useful for prediction of response to therapy. We aimed at exploring 4 SNPs in candidate genes (STAT4, PTPN2, PSORS1C1 and TRAF3IP2) in order to investigate their potential role in the response to therapy with tumor necrosis factor inhibitors (TNF-i) in RA patients. Methods In 171 RA patients we investigated the following SNPs: rs7574865 (STAT4), rs2233945 (PSORS1C1), rs7234029 (PTPN2) and rs33980500 (TRAF3IP2). Remission, LDA, and EULAR response were registered at 6 months and 2 years after initiation of first line TNF-i [Adalimumab (ADA) and Etanercept (ETN)]. Results STAT4 variant allele was associated with the absence of a good/moderate EULAR response at 2 years of treatment in the whole RA group and in ETN treated patients. The PTPN2 SNP was associated with no good/moderate EULAR response at 6 months in ADA treated patients. Patients carrying PSORS1C1 variant allele did not reach LDA at 6 months in both the whole RA group and ETN treated patients. TRAF3IP2 variant allele was associated with the lack of LDA and remission achievement at 6 months in all RA cohort while an association with no EULAR response at 2 years of treatment occurred only in ETN treated patients. Conclusions For the first time, we reported that SNPs in STAT4, PTPN2, PSORS1C1, and TRAF3IP2 are associated with response to TNF-i treatment in RA patients; however, these findings should be validated in a larger population. PMID:28107378

  1. Polymorphisms in STAT4, PTPN2, PSORS1C1 and TRAF3IP2 Genes Are Associated with the Response to TNF Inhibitors in Patients with Rheumatoid Arthritis.

    Science.gov (United States)

    Conigliaro, Paola; Ciccacci, Cinzia; Politi, Cristina; Triggianese, Paola; Rufini, Sara; Kroegler, Barbara; Perricone, Carlo; Latini, Andrea; Novelli, Giuseppe; Borgiani, Paola; Perricone, Roberto

    2017-01-01

    Rheumatoid Arthritis (RA) is a progressive autoimmune disease characterized by chronic joint inflammation and structural damage. Remission or at least low disease activity (LDA) represent potentially desirable goals of RA treatment. Single nucleotide polymorphisms (SNPs) in several genes might be useful for prediction of response to therapy. We aimed at exploring 4 SNPs in candidate genes (STAT4, PTPN2, PSORS1C1 and TRAF3IP2) in order to investigate their potential role in the response to therapy with tumor necrosis factor inhibitors (TNF-i) in RA patients. In 171 RA patients we investigated the following SNPs: rs7574865 (STAT4), rs2233945 (PSORS1C1), rs7234029 (PTPN2) and rs33980500 (TRAF3IP2). Remission, LDA, and EULAR response were registered at 6 months and 2 years after initiation of first line TNF-i [Adalimumab (ADA) and Etanercept (ETN)]. STAT4 variant allele was associated with the absence of a good/moderate EULAR response at 2 years of treatment in the whole RA group and in ETN treated patients. The PTPN2 SNP was associated with no good/moderate EULAR response at 6 months in ADA treated patients. Patients carrying PSORS1C1 variant allele did not reach LDA at 6 months in both the whole RA group and ETN treated patients. TRAF3IP2 variant allele was associated with the lack of LDA and remission achievement at 6 months in all RA cohort while an association with no EULAR response at 2 years of treatment occurred only in ETN treated patients. For the first time, we reported that SNPs in STAT4, PTPN2, PSORS1C1, and TRAF3IP2 are associated with response to TNF-i treatment in RA patients; however, these findings should be validated in a larger population.

  2. Polymorphisms in STAT4, PTPN2, PSORS1C1 and TRAF3IP2 Genes Are Associated with the Response to TNF Inhibitors in Patients with Rheumatoid Arthritis.

    Directory of Open Access Journals (Sweden)

    Paola Conigliaro

    Full Text Available Rheumatoid Arthritis (RA is a progressive autoimmune disease characterized by chronic joint inflammation and structural damage. Remission or at least low disease activity (LDA represent potentially desirable goals of RA treatment. Single nucleotide polymorphisms (SNPs in several genes might be useful for prediction of response to therapy. We aimed at exploring 4 SNPs in candidate genes (STAT4, PTPN2, PSORS1C1 and TRAF3IP2 in order to investigate their potential role in the response to therapy with tumor necrosis factor inhibitors (TNF-i in RA patients.In 171 RA patients we investigated the following SNPs: rs7574865 (STAT4, rs2233945 (PSORS1C1, rs7234029 (PTPN2 and rs33980500 (TRAF3IP2. Remission, LDA, and EULAR response were registered at 6 months and 2 years after initiation of first line TNF-i [Adalimumab (ADA and Etanercept (ETN].STAT4 variant allele was associated with the absence of a good/moderate EULAR response at 2 years of treatment in the whole RA group and in ETN treated patients. The PTPN2 SNP was associated with no good/moderate EULAR response at 6 months in ADA treated patients. Patients carrying PSORS1C1 variant allele did not reach LDA at 6 months in both the whole RA group and ETN treated patients. TRAF3IP2 variant allele was associated with the lack of LDA and remission achievement at 6 months in all RA cohort while an association with no EULAR response at 2 years of treatment occurred only in ETN treated patients.For the first time, we reported that SNPs in STAT4, PTPN2, PSORS1C1, and TRAF3IP2 are associated with response to TNF-i treatment in RA patients; however, these findings should be validated in a larger population.

  3. Evolutionary dynamics of hepatitis C virus NS3 protease domain during and following treatment with narlaprevir, a potent NS3 protease inhibitor

    NARCIS (Netherlands)

    de Bruijne, J.; Thomas, X. V.; Rebers, S. P.; Weegink, C. J.; Treitel, M. A.; Hughes, E.; Bergmann, J. F.; de Knegt, R. J.; Janssen, H. L. A.; Reesink, H. W.; Molenkamp, R.; Schinkel, J.

    2013-01-01

    Narlaprevir, a hepatitis C virus (HCV) NS3/4A serine protease inhibitor, has demonstrated robust antiviral activity in a placebo-controlled phase 1 study. To study evolutionary dynamics of resistant variants, the NS3 protease sequence was clonally analysed in thirty-two HCV genotype 1-infected

  4. The CYP2C8 inhibitor gemfibrozil does not affect the pharmacokinetics of zafirlukast.

    Science.gov (United States)

    Karonen, Tiina; Neuvonen, Pertti J; Backman, Janne T

    2011-02-01

    Gemfibrozil, a strong inhibitor of cytochrome P450 (CYP) 2C8 in vivo, was recently found to markedly increase the plasma concentrations of montelukast in humans. Like montelukast, zafirlukast is a substrate of CYP2C9 and CYP3A4 and a potent inhibitor of CYP2C8 in vitro. To investigate the contribution of CYP2C8 to the metabolism of zafirlukast in vivo, we studied the effect of gemfibrozil on the pharmacokinetics of zafirlukast. Ten healthy subjects in a randomized cross-over study took gemfibrozil 600 mg or placebo twice daily for 5 days, and on day 3, a single oral dose of 20 mg zafirlukast. The plasma concentrations of zafirlukast were measured for 72 h postdose. The mean total area under the plasma concentration-time curve of zafirlukast during the gemfibrozil phase was 102% (geometric mean ratio; 95% confidence interval 89-116%) of that during the placebo phase. Furthermore, there were no statistically significant differences in the peak plasma concentration, time of peak concentration, or elimination half-life of zafirlukast between the phases. Gemfibrozil has no effect on the pharmacokinetics of zafirlukast, indicating that CYP2C8 does not play a significant role in the elimination of zafirlukast.

  5. SGLT2 inhibitors or GLP-1 receptor agonists as second-line therapy in type 2 diabetes: patient selection and perspectives

    Directory of Open Access Journals (Sweden)

    Gurgle HE

    2016-06-01

    Full Text Available Holly E Gurgle, Karen White, Carrie McAdam-Marx Department of Pharmacotherapy, University of Utah College of Pharmacy, Salt Lake City, UT, USA Abstract: Controversy exists regarding the selection of second-line therapy for patients with type 2 diabetes mellitus (T2DM who are unable to achieve glycemic control with metformin therapy alone. Newer pharmacologic treatments for T2DM include glucagon-like peptide-1 receptor agonists and sodium–glucose cotransporter 2 inhibitors. Both the classes of medication are efficacious, exhibit positive effects on weight, and are associated with minimal risk of hypoglycemia. The purpose of this review is to compare the clinical trial and real-world effectiveness data of glucagon-like peptide-1 receptor agonists versus sodium–glucose cotransporter 2 inhibitors related to A1c reduction, weight loss, cost-effectiveness, cardiovascular outcomes, and safety in patients with T2DM. This review summarizes comparative evidence for providers who are determining which of the two classes may be the most appropriate for a specific patient. Keywords: type 2 diabetes mellitus, GLP-1 receptor agonist, SGLT2 inhibitor, A1c, weight loss, adverse effect

  6. Regulation of hemopoiesis: inhibitors and stimulators produced by a murine bone marrow stromal cell line (H-1)

    International Nuclear Information System (INIS)

    Cronkite, E.P.; Miller, M.E.; Garnett, H.; Harigaya, K.

    1982-01-01

    A murine cell line (H-1) probably derived from the adventitial reticular cell has been isolated and preserved. This line produces: (1) CSF; (2) a labile inhibitor of CFU-c proliferation with preferential action on granulopoiesis; (3) PGE; (4) proliferation inhibitors of BFU-E and GEMM; and (5) suppression of entry of CFU-S into DNA synthesis in vitro. It is postulated that the adventitial reticular cell (ARC) may play a major regulatory role in hemopoiesis through intramedullary production of the factors described. The nature of the signals that activate the genes in the ARC which are coded for the factors described is not known

  7. Curcumin derivatives as HIV-1 protease inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R. [Univ. of California, San Francisco, CA (United States)

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  8. Natural inhibitors of tumor-associated proteases

    International Nuclear Information System (INIS)

    Magdolen, U.; Krol, J.; Sato, S.; Schmitt, M.; Magdolen, V.; Krueger, A.; Mueller, M.M.; Sperl, S.

    2002-01-01

    The turnover and remodelling of extracellular matrix (ECM) is an essential part of many normal biological processes including development, morphogenesis, and wound healing. ECM turnover also occurs in severe pathological situations like artherosclerosis, fibrosis, tumor invasion and metastasis. The major proteases involved in this turnover are serine proteases (especially the urokinase-type plasminogen activator/plasmin system), matrix metalloproteases (a family of about 20 zinc-dependent endopeptidases including collagenases, gelatinases, stromelysins, and membrane-type metalloproteases), and cysteine proteases. In vivo, the activity of these proteases is tightly regulated in the extracellular space by zymogen activation and/or controlled inhibition. In the present review, we give an overview on the structure and biochemical properties of important tumor-associated protease inhibitors such as plasminogen activator inhibitor type 1 and type 2 (PAI-1, PAI-2), tissue inhibitors of metalloproteinases (TIMP-1, -2, -3, and -4), and the cysteine protease inhibitor cystatin C. Interestingly, some of these inhibitors of tumor-associated proteases display multiple functions which rather promote than inhibit tumor progression, when the presence of inhibitors in the tumor tissue is not balanced. (author)

  9. Preparation of 14-C-labelled 1,4-Dideoxy-1,4-imino-D-arabinitol: Cyanosilylation of Cyclic Imines using KCN in a One-Pot Synthesis

    DEFF Research Database (Denmark)

    Lundt, Inge; Malle, Birgitte Mølholm; Foged, Christian

    1999-01-01

    A new method for C-C bond formation was developed based on in situ cyanosilylation of cyclic Schiff bases using KCN, TMSCl, KI and ZnI2. This method was used to prepare the potent -glucosidase inhibitor 1,4-dideoxy-1,4-imino-D-arabinitol 14-C labelled at C-5.Keywords: in situ cyanosilylation; 14-C...

  10. Manumycin A Is a Potent Inhibitor of Mammalian Thioredoxin Reductase-1 (TrxR-1).

    Science.gov (United States)

    Tuladhar, Anupama; Rein, Kathleen S

    2018-04-12

    The anticancer effect of manumycin A (Man A) has been attributed to the inhibition of farnesyl transferase (FTase), an enzyme that is responsible for post-translational modification of Ras proteins. However, we have discovered that Man A inhibits mammalian cytosolic thioredoxin reductase 1 (TrxR-1) in a time-dependent manner, with an IC 50 of 272 nM with preincubation and 1586 nM without preincubation. The inhibition of TrxR-1 by Man A is irreversible and is the result of a covalent interaction between Man A and TrxR-1. Evidence presented herein demonstrates that Man A forms a Michael adduct with the selenocysteine residue, which is located in the C-terminal redox center of TrxR-1. Inhibitors of TrxR-1, which act through this mechanism, convert TrxR-1 into a SecTRAP, which utilizes NADPH to reduce oxygen to superoxide radical anion (O 2 -• ).

  11. In Vitro Antiviral Activity and Resistance Profile of the Next-Generation Hepatitis C Virus NS5A Inhibitor Pibrentasvir.

    Science.gov (United States)

    Ng, Teresa I; Krishnan, Preethi; Pilot-Matias, Tami; Kati, Warren; Schnell, Gretja; Beyer, Jill; Reisch, Thomas; Lu, Liangjun; Dekhtyar, Tatyana; Irvin, Michelle; Tripathi, Rakesh; Maring, Clarence; Randolph, John T; Wagner, Rolf; Collins, Christine

    2017-05-01

    Pibrentasvir (ABT-530) is a novel and pan-genotypic hepatitis C virus (HCV) NS5A inhibitor with 50% effective concentration (EC 50 ) values ranging from 1.4 to 5.0 pM against HCV replicons containing NS5A from genotypes 1 to 6. Pibrentasvir demonstrated similar activity against a panel of chimeric replicons containing HCV NS5A of genotypes 1 to 6 from clinical samples. Resistance selection studies were conducted using HCV replicon cells with NS5A from genotype 1a, 1b, 2a, 2b, 3a, 4a, 5a, or 6a at a concentration of pibrentasvir that was 10- or 100-fold over its EC 50 for the respective replicon. With pibrentasvir at 10-fold over the respective EC 50 , only a small number of colonies (0.00015 to 0.0065% of input cells) with resistance-associated amino acid substitutions were selected in replicons containing genotype 1a, 2a, or 3a NS5A, and no viable colonies were selected in replicons containing NS5A from other genotypes. With pibrentasvir at 100-fold over the respective EC 50 , very few colonies (0.0002% of input cells) were selected by pibrentasvir in genotype 1a replicon cells while no colonies were selected in other replicons. Pibrentasvir is active against common resistance-conferring substitutions in HCV genotypes 1 to 6 that were identified for other NS5A inhibitors, including those at key amino acid positions 28, 30, 31, or 93. The combination of pibrentasvir with HCV inhibitors of other classes produced synergistic inhibition of HCV replication. In summary, pibrentasvir is a next-generation HCV NS5A inhibitor with potent and pan-genotypic activity, and it maintains activity against common amino acid substitutions of HCV genotypes 1 to 6 that are known to confer resistance to currently approved NS5A inhibitors. Copyright © 2017 Ng et al.

  12. Interaction of small molecule inhibitors of HIV-1 entry with CCR5

    International Nuclear Information System (INIS)

    Seibert, Christoph; Ying Weiwen; Gavrilov, Svetlana; Tsamis, Fotini; Kuhmann, Shawn E.; Palani, Anandan; Tagat, Jayaram R.; Clader, John W.; McCombie, Stuart W.; Baroudy, Bahige M.; Smith, Steven O.; Dragic, Tatjana; Moore, John P.; Sakmar, Thomas P.

    2006-01-01

    The CC-chemokine receptor 5 (CCR5) is the major coreceptor for macrophage-tropic (R5) HIV-1 strains. Several small molecule inhibitors of CCR5 that block chemokine binding and HIV-1 entry are being evaluated as drug candidates. Here we define how CCR5 antagonists TAK-779, AD101 (SCH-350581) and SCH-C (SCH-351125), which inhibit HIV-1 entry, interact with CCR5. Using a mutagenesis approach in combination with a viral entry assay to provide a direct functional read out, we tested predictions based on a homology model of CCR5 and analyzed the functions of more than 30 amino acid residues. We find that a key set of aromatic and aliphatic residues serves as a hydrophobic core for the ligand binding pocket, while E283 is critical for high affinity interaction, most likely by acting as the counterion for a positively charged nitrogen atom common to all three inhibitors. These results provide a structural basis for understanding how specific antagonists interact with CCR5, and may be useful for the rational design of new, improved CCR5 ligands

  13. Modulation of thyroid hormone receptor transactivation by the early region 1A (E1A-like inhibitor of differentiation 1 (EID1

    Directory of Open Access Journals (Sweden)

    Diana Vargas

    2008-01-01

    Full Text Available Transcriptional activation (TA mediated by the effect of thyroid hormones on target genes requires co-activator proteins such as the early region 1A (E1A associated 300 kDa binding protein (p300 and the cAMP response element binding protein (CREB binding protein (CBP, known as the p300/CBP complex, which acetylate histones 3 and 4 to allow transcriptional machinery access to the target gene promoter. Little is known on the role of p300 in thyroid hormone receptor (TR mediated TA but the E1A-like inhibitor of differentiation 1 (EID1, an inhibitor of p300 histone acetyltransferase (HAT, is a functional homolog of E1A and may inhibit myogenic differentiation factor D (MyoD transcriptional activity and reduces muscle cell differentiation. We evaluated the influence of EID1 on TR-mediated transcriptional activity using transfection and mammalian two-hybrid studies to show that EID1 may partially reduces TA activity of the TR receptor, probably due to p300 blockage since EID1 mutants cannot reduce TR-mediated TA. The EID1 does not affect the function of p160 co-activator proteins (160 kDa proteins of steroid receptor co-activators and is functionally independent of co-repressor proteins or TR binding. Summarizing, EID1 reduces TR-mediated transcriptional activity by blocking p300 and may play an important role in thyroid receptor activity in muscle and other tissues.

  14. Adapted J6/JFH1-based Hepatitis C virus recombinants with genotype-specific NS4A show similar efficacies against lead protease inhibitors, alpha interferon, and a putative NS4A inhibitor

    DEFF Research Database (Denmark)

    Gottwein, Judith M; Jensen, Sanne B; Serre, Stéphanie B N

    2013-01-01

    To facilitate studies of hepatitis C virus (HCV) NS4A, we aimed at developing J6/JFH1-based recombinants with genotype 1- to 7-specific NS4A proteins. We developed efficient culture systems expressing NS4A proteins of genotypes (isolates) 1a (H77 and TN), 1b (J4), 2a (J6), 4a (ED43), 5a (SA13), 6a...... (HK6a), and 7a (QC69), with peak infectivity titers of ∼3.5 to 4.5 log10 focus-forming units per ml. Except for genotype 2a (J6), growth depended on adaptive mutations identified in long-term culture. Genotype 1a, 1b, and 4a recombinants were adapted by amino acid substitutions F772S (p7) and V1663A...... (NS4A), while 5a, 6a, and 7a recombinants required additional substitutions in the NS3 protease and/or NS4A. We demonstrated applicability of the developed recombinants for study of antivirals. Genotype 1 to 7 NS4A recombinants showed similar responses to the protease inhibitors telaprevir (VX-950...

  15. New small molecule inhibitors of UPR activation demonstrate that PERK, but not IRE1α signaling is essential for promoting adaptation and survival to hypoxia

    International Nuclear Information System (INIS)

    Cojocari, Dan; Vellanki, Ravi N.; Sit, Brandon; Uehling, David; Koritzinsky, Marianne; Wouters, Bradly G.

    2013-01-01

    Background and purpose: The unfolded protein response (UPR) is activated in response to hypoxia-induced stress in the endoplasmic reticulum (ER) and consists of three distinct signaling arms. Here we explore the potential of targeting two of these arms with new potent small-molecule inhibitors designed against IRE1α and PERK. Methods: We utilized shRNAs and small-molecule inhibitors of IRE1α (4μ8c) and PERK (GSK-compound 39). XBP1 splicing and DNAJB9 mRNA was measured by qPCR and was used to monitor IRE1α activity. PERK activity was monitored by immunoblotting eIF2α phosphorylation and qPCR of DDIT3 mRNA. Hypoxia tolerance was measured using proliferation and clonogenic cell survival assays of cells exposed to mild or severe hypoxia in the presence of the inhibitors. Results: Using knockdown experiments we show that PERK is essential for survival of KP4 cells while knockdown of IRE1α dramatically decreases the proliferation and survival of HCT116 during hypoxia. Further, we show that in response to both hypoxia and other ER stress-inducing agents both 4μ8c and the PERK inhibitor are selective and potent inhibitors of IRE1α and PERK activation, respectively. However, despite potent inhibition of IRE1α activation, 4μ8c had no effect on cell proliferation or clonogenic survival of cells exposed to hypoxia. This was in contrast to the inactivation of PERK signaling with the PERK inhibitor, which reduced tolerance to hypoxia and other ER stress inducing agents. Conclusions: Our results demonstrate that IRE1α but not its splicing activity is important for hypoxic cell survival. The PERK signaling arm is uniquely important for promoting adaptation and survival during hypoxia-induced ER stress and should be the focus of future therapeutic efforts

  16. Development of antibody-based c-Met inhibitors for targeted cancer therapy

    Directory of Open Access Journals (Sweden)

    Lee D

    2015-02-01

    Full Text Available Dongheon Lee, Eun-Sil Sung, Jin-Hyung Ahn, Sungwon An, Jiwon Huh, Weon-Kyoo You Hanwha Chemical R&D Center, Biologics Business Unit, Daejeon, Republic of Korea Abstract: Signaling pathways mediated by receptor tyrosine kinases (RTKs and their ligands play important roles in the development and progression of human cancers, which makes RTK-mediated signaling pathways promising therapeutic targets in the treatment of cancer. Compared with small-molecule compounds, antibody-based therapeutics can more specifically recognize and bind to ligands and RTKs. Several antibody inhibitors of RTK-mediated signaling pathways, such as human epidermal growth factor receptor 2, vascular endothelial growth factor, epidermal growth factor receptor or vascular endothelial growth factor receptor 2, have been developed and are widely used to treat cancer patients. However, since the therapeutic options are still limited in terms of therapeutic efficacy and types of cancers that can be treated, efforts are being made to identify and evaluate novel RTK-mediated signaling pathways as targets for more efficacious cancer treatment. The hepatocyte growth factor/c-Met signaling pathway has come into the spotlight as a promising target for development of potent cancer therapeutic agents. Multiple antibody-based therapeutics targeting hepatocyte growth factor or c-Met are currently in preclinical or clinical development. This review focuses on the development of inhibitors of the hepatocyte growth factor/c-Met signaling pathway for cancer treatment, including critical issues in clinical development and future perspectives for antibody-based therapeutics. Keywords: hepatocyte growth factor, ligands, receptor tyrosine kinase, signaling pathway, therapeutic agent

  17. The role of cGMP hydrolysing phosphodiesterases 1 and 5 in cerebral artery dilatation

    DEFF Research Database (Denmark)

    Kruuse, Christina; Rybalkin, S D; Khurana, T S

    2001-01-01

    The aim was to investigate the presence and activity of cGMP hydrolysing phosphodiesterases in guinea pig basilar arteries and the effect of selective and non-selective phosphodiesterase inhibitors on cerebral artery dilatation involving the nitric oxide (NO)-guanosine cyclic 3'5-monophosphate (cGMP...... a close relation to the nitric oxide-cGMP pathway. The responses to zaprinast and dipyridamole, however, were not only moderately affected, but also restored by sodium nitroprusside (0.1 microM) pretreatment. At high concentrations, the dilatory effects of zaprinast and dipyridamole were partly caused...... by cGMP-independent mechanisms. Targeting the phosphodiesterases present in cerebral arteries, with selective inhibitors or activators of phosphodiesterase, may be a possible new way of treating cerebrovascular disease....

  18. Detection of potential AcrAB-TolC multidrug efflux pump inhibitor in calyces extract of Hibiscus sabdariffa

    Directory of Open Access Journals (Sweden)

    Nehaya Al-Karablieh

    2017-12-01

    Full Text Available Aim: The aim of this study is to investigate occurrence of potential efflux pump inhibitor (EPI against AcrAB-TolC efflux pump in the methanol extract of H. sabdariffa. Materials and Methods: Calyces of H. sabdariffa were purchased from the local market in April 2014, methanol extract of H. sabdariffa was subjected to agar plate diffusion against Escherichia coli TG1 and its ∆acrB-∆tolC and thin layer chromatography (TLC bioassay. The corresponding EPI fraction was eluted by methanol. The synergistic effect of antimicrobials and EPI fraction was measured by minimum inhibitory concentration (MIC determination for E. coli and Erwinia amylovora strains, and the ability of EPI fraction to enhance EtBr accumulation was conducted. Results: E. coli TG1 was more sensitive to the methanol extracts of H. sabdariffa than E. coli ∆acrB-∆tolC, and inhibition zone corresponding to flavones on TLC bioassay plate has been formed which might be related to the fraction of potential EPI. The MIC values revealed that EPI fraction enhanced the activity of the used antimicrobials by 4 to 8 folds in E. coli TG1 and by 4 to 10 folds in E. amylovora 1189. Addition of EPI fraction in a dose-dependent manner increased the intercellular accumulation of Ethidium Bromide (EtBr in the wild type stains of E. coli TG1 and E. amylovora 1189. Conclusion: EPI fraction behaves like a multidrug efflux pump inhibitor and further investigation should be conducted for determination of the chemical structure of EPI fraction. [J Complement Med Res 2017; 6(4.000: 357-363

  19. Medicinal chemistry insights in the discovery of novel LSD1 inhibitors.

    Science.gov (United States)

    Wang, Xueshun; Huang, Boshi; Suzuki, Takayoshi; Liu, Xinyong; Zhan, Peng

    2015-01-01

    LSD1 is an epigenetic modulator associated with transcriptional regulation of genes involved in a broad spectrum of key cellular processes, and its activity is often altered under pathological conditions. LSD1 inhibitors are considered to be candidates for therapy of cancer, viral diseases and neurodegeneration. Many LSD1 inhibitors with various scaffolds have been disclosed, and a few potent molecules are in different stages of clinical development. In this review, we summarize recent biological findings on the roles of LSD1 and the current understanding of the clinical significance of LSD1, and focus on the medicinal chemistry strategies used in the design and development of LSD1 inhibitors as drug-like epigenetic modulators since 2012, including a brief consideration of structure-activity relationships.

  20. A cGMP kinase mutant with increased sensitivity to the protein kinase inhibitor peptide PKI(5-24).

    Science.gov (United States)

    Ruth, P; Kamm, S; Nau, U; Pfeifer, A; Hofmann, F

    1996-01-01

    Synthetic peptides corresponding to the active domain of the heat-stable inhibitor protein PKI are very potent inhibitors of cAMP-dependent protein kinase, but are extremely weak inhibitors of cGMP-dependent protein kinase. In this study, we tried to confer PKI sensitivity to cGMP kinase by site-directed mutagenesis. The molecular requirements for high affinity inhibition by PKI were deduced from the crystal structure of the cAMP kinase/PKI complex. A prominent site of interaction are residues Tyr235 and Phe239 in the catalytic subunit, which from a sandwich-like structure with Phe10 of the PKI(5-24) peptide. To increase the sensitivity for PKI, the cGMP kinase codons at the corresponding sites, Ser555 and Ser559, were changed to Tyr and Phe. The mutant cGMP kinase was stimulated half maximally by cGMP at 3-fold higher concentrations (240 nM) than the wild type (77 nM). Wild type and mutant cGMP kinase did not differ significantly in their Km and Vmax for three different substrate peptides. The PKI(5-24) peptide inhibited phosphotransferase activity of the mutant cGMP kinase with higher potency than that of wild type, with Ki values of 42 +/- .3 microM and 160 +/- .7 microM, respectively. The increased affinity of the mutant cGMP kinase was specific for the PKI(5-24) peptide. Mutation of the essential Phe10 in the PKI(5-24) sequence to an Ala yielded a peptide that inhibited mutant and wild type cGMP kinase with similar potency, with Ki values of 160 +/- 11 and 169 +/- 27 microM, respectively. These results suggest that the mutations Ser555Tyr and Ser559Phe are required, but not sufficient, for high affinity inhibition of cGMP kinase by PKI.

  1. Variability and resistance mutations in the hepatitis C virus NS3 protease in patients not treated with protease inhibitors

    Directory of Open Access Journals (Sweden)

    Luciana Bonome Zeminian

    2013-02-01

    Full Text Available The goal of treatment of chronic hepatitis C is to achieve a sustained virological response, which is defined as exhibiting undetectable hepatitis C virus (HCV RNA levels in serum following therapy for at least six months. However, the current treatment is only effective in 50% of patients infected with HCV genotype 1, the most prevalent genotype in Brazil. Inhibitors of the serine protease non-structural protein 3 (NS3 have therefore been developed to improve the responses of HCV-infected patients. However, the emergence of drug-resistant variants has been the major obstacle to therapeutic success. The goal of this study was to evaluate the presence of resistance mutations and genetic polymorphisms in the NS3 genomic region of HCV from 37 patients infected with HCV genotype 1 had not been treated with protease inhibitors. Plasma viral RNA was used to amplify and sequence the HCV NS3 gene. The results indicate that the catalytic triad is conserved. A large number of substitutions were observed in codons 153, 40 and 91; the resistant variants T54A, T54S, V55A, R155K and A156T were also detected. This study shows that resistance mutations and genetic polymorphisms are present in the NS3 region of HCV in patients who have not been treated with protease inhibitors, data that are important in determining the efficiency of this new class of drugs in Brazil.

  2. Evidence of impaired sense of smell in hereditary angioedema.

    Science.gov (United States)

    Perricone, C; Agmon-Levin, N; Shoenfeld, N; de Carolis, C; Guarino, M D; Gigliucci, G; Milana, I; Novelli, L; Valesini, G; Perricone, R; Shoenfeld, Y

    2011-01-01

    Hereditary angioedema (HAE) is an autosomal-dominant disorder resulting from C1-inhibitor (C1INH) deficiency. Smell impairments were found in patients affected with systemic lupus erythematosus, that, similarly to HAE, is characterized by the activation of the classical complement pathway with C4 consumption. In this study, we aimed at evaluating the sense of smell in patients with HAE. Thirty patients with HAE and 30 healthy age- and sex-matched controls were evaluated for olfactory functions using the 3-stages Sniffin'-Sticks kit (threshold, discrimination, and identification [TDI]). TDI scores were analyzed according to complement levels (C1INH, C3, C4 and CH50), Beck depression inventory (BDI-II) and danazol treatment. A significant decrease in olfactory function was observed in patients affected with HAE compared with controls in total TDI score (P < 0.001), and in the discrimination (P < 0.001) and identification scores (P = 0.012). Anosmia was present only in patients with HAE (3.3%) who also exhibited more frequently hyposmia (53.3%vs 3.3%, P < 0.0001). Complement levels were reduced in patients with HAE. C4 serum levels showed positive correlation with total TDI score (P < 0.001), and with discrimination (P = 0.002) and identification (P = 0.011) scores. CH50 complement levels showed positive correlation with total TDI score (P < 0.001), and with threshold (P = 0.002) and discrimination (P = 0.011) scores. Sex, age, danazol treatment, BDI-II scores were not different between the patients and controls and did not influence TDI scores significantly. Evidence for an impaired sense of smell was found in patients with HAE. The reduction in olfactory function in these cases seems to correlate with complement C4 and CH50 levels. Immune and genetic mechanisms might play a role in this defect. © 2010 John Wiley & Sons A/S.

  3. PTP1B Inhibitors from the Entomogenous Fungi Isaria fumosorosea

    OpenAIRE

    Jun Zhang; Lin-Lin Meng; Jing-Jing Wei; Peng Fan; Sha-Sha Liu; Wei-Yu Yuan; You-Xing Zhao; Du-Qiang Luo

    2017-01-01

    Protein tyrosine phosphatase 1B (PTP1B) is implicated as a negative regulator of insulin receptor (IR) signaling and a potential drug target for the treatment of type II diabetes and other associated metabolic syndromes. Thus, small molecule inhibitors of PTP1B can be considered as an attractive approach for the design of new therapeutic agents of type II diabetes and cancer diseases. In a continuing search for new PTP1B inhibitors, a new tetramic acid possessing a rare pyrrolidinedione skele...

  4. Progress of PD-1/PD-L1 Inhibitors in Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhansheng JIANG

    2017-02-01

    Full Text Available Pembrolizumab, an inhibitor target programmed death 1 (PD-1, was approved into the first line therapy in advanced non-small cell lung cancer (NSCLC. It was a milestone that immune checkpoints drugs have played an important role in the treatment system of NSCLC. The results of clinical trials revealed the superiority of PD-1/programmed death ligand 1 (PD-L1 inhibitors compared with chemotherapy in first-line, second-line and multidrug resistance phase therapy. Objective response rate (ORR was up to 80% with pembrolizumab plus chemotherapy, and progression-free survival (PFS with single pembrolizumab in first line was nearly 1 year (10.3 months, the hazard ratio for death fell by 40%. Overall survival (OS was more or less 1 year with single drug pembrolizumab, nivolumab and atezolizumab for second line therapy. PD-L1 expression was a predictor of PD-1/PD-L1 inhibitors. The positive rate of PD-L1 (more than 1% in advanced NSCLC was about 60% with little difference between the tissue types. However, there was no gold standard test of PD-L1 expression.

  5. YC-1 potentiates cAMP-induced CREB activation and nitric oxide production in alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Tsong-Long, E-mail: htl@mail.cgu.edu.tw [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Chinese Herbal Medicine Research Team, Healthy Aging Research Center, Chang Gung University, Kweishan, Taoyuan, Taiwan (China); Tang, Ming-Chi [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Kuo, Liang-Mou [Department of General Surgery, Chang Gung Memorial Hospital at Chia-Yi, Taiwan (China); Chang, Wen-De; Chung, Pei-Jen; Chang, Ya-Wen; Fang, Yao-Ching [Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China)

    2012-04-15

    Alveolar macrophages play significant roles in the pathogenesis of several inflammatory lung diseases. Increases in exhaled nitric oxide (NO) are well documented to reflect disease severity in the airway. In this study, we investigated the effect of 3-(5′-hydroxymethyl-2′-furyl)-1-benzyl indazole (YC-1), a known activator of soluble guanylyl cyclase, on prostaglandin (PG)E{sub 1} (a stable PGE{sub 2} analogue) and forskolin (a adenylate cyclase activator) induced NO production and inducible NO synthase (iNOS) expression in rat alveolar macrophages (NR8383). YC-1 did not directly cause NO production or iNOS expression, but drastically potentiated PGE{sub 1}- or forskolin-induced NO production and iNOS expression in NR8383 alveolar macrophages. Combination treatment with YC-1 and PGE{sub 1} significantly increased phosphorylation of the cAMP response element-binding protein (CREB), but not nuclear factor (NF)-κB activation. The combined effect on NO production, iNOS expression, and CREB phosphorylation was reversed by a protein kinase (PK)A inhibitor (H89), suggesting that the potentiating functions were mediated through a cAMP/PKA signaling pathway. Consistent with this, cAMP analogues, but not the cGMP analogue, caused NO release, iNOS expression, and CREB activation. YC-1 treatment induced an increase in PGE{sub 1}-induced cAMP formation, which occurred through the inhibition of cAMP-specific phosphodiesterase (PDE) activity. Furthermore, the combination of rolipram (an inhibitor of PDE4), but not milronone (an inhibitor of PDE3), and PGE{sub 1} also triggered NO production and iNOS expression. In summary, YC-1 potentiates PGE{sub 1}-induced NO production and iNOS expression in alveolar macrophages through inhibition of cAMP PDE activity and activation of the cAMP/PKA/CREB signaling pathway. Highlights: ► YC-1 potentiated PGE1-induced iNOS expression in alveolar macrophages. ► The combination of YC-1 and PGE1 increased CREB but not NFκB activation.

  6. Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase Inhibitors

    Science.gov (United States)

    2015-12-01

    AWARD NUMBER: W81XWH-14-1-0251 TITLE: Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase... Tyrosine Kinase Inhibitors 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-14-1-0251 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Kiran Mahajan 5d...ABSTRACT Central to all cycling cells-including prostate cancer stem cells- is the expression of WEE1 tyrosine kinase. WEE1 monitors duplication of

  7. Discovery and study of novel protein tyrosine phosphatase 1B inhibitors

    Science.gov (United States)

    Zhang, Qian; Chen, Xi; Feng, Changgen

    2017-10-01

    Protein tyrosine phosphatase 1B (PTP1B) is considered to be a target for therapy of type II diabetes and obesity. So it is of great significance to take advantage of a computer aided drug design protocol involving the structured-based virtual screening with docking simulations for fast searching small molecule PTP1B inhibitors. Based on optimized complex structure of PTP1B bound with specific inhibitor of IX1, structured-based virtual screening against a library of natural products containing 35308 molecules, which was constructed based on Traditional Chinese Medicine database@ Taiwan (TCM database@ Taiwan), was conducted to determine the occurrence of PTP1B inhibitors using the Lubbock module and CDOCKER module from Discovery Studio 3.1 software package. The results were further filtered by predictive ADME simulation and predictive toxic simulation. As a result, 2 good drug-like molecules, namely para-benzoquinone compound 1 and Clavepictine analogue 2 were identified ultimately with the dock score of original inhibitor (IX1) and the receptor as a threshold. Binding model analyses revealed that these two candidate compounds have good interactions with PTP1B. The PTP1B inhibitory activity of compound 2 hasn't been reported before. The optimized compound 2 has higher scores and deserves further study.

  8. SCREENING OF PROTEASE INHIBITORS RESISTANCE MUTATIONS IN HEPATITIS C VIRUS ISOLATES INFECTING ROMANIAN PATIENTS UNEXPOSED TO TRIPLE THERAPY.

    Science.gov (United States)

    Dinu, Sorin; Calistru, Petre-Iacob; Ceauşu, Emanoil; Târdeil, Graţiela; Oprişan, Gabriela

    2015-01-01

    Although the European recommendations include the use of new antiviral drugs for the treatment of hepatitis C, in Romania the current treatment remains interferon plus ribavirin. First generation viral protease inhibitors (i.e. boceprevir, telaprevir), which have raised the chances of obtaining viral clearance in up to 70% of infection cases produced by genotype 1 isolates, have not been introduced yet as standard treatment in our country. The success of these new antivirals is limited by the occurrence and selection of resistance mutations during therapy. We set-up a molecular study aiming to detect any resistance mutations to boceprevir and telaprevir harbored by hepatitis C isolates infecting Romanian patients naïve to viral protease inhibitors. Since these new antivirals are efficient and approved for genotype 1 infection, viral samples were genotyped following a protocol previously developed by our research group. We analyzed by both population sequencing and molecular cloning and sequencing the NS3 protease region of hepatitis C virus isolates infecting patients which were not previously exposed to boceprevir and telaprevir. All the analyzed samples were subtype 1b and resembled the samples collected in recent years from Romanian patients. Molecular cloning followed by sequencing showed great intra-host diversity, which is known to represent the source of isolates with different resistance phenotypes. Both population sequencing and molecular cloning followed by clone sequencing revealed two boceprevir resistance mutations (T54S and V55A), respectively, a telaprevir resistance mutation (T54S) in the sequences obtained from a patient with chronic hepatitis C. To our knowledge, this is the first study indicating the existence of pre-treatment resistance mutations to boceprevir and telaprevir in hepatitis C virus isolates infecting Romanian patients.

  9. Combination therapy for hepatitis C virus with heat-shock protein 90 inhibitor 17-AAG and proteasome inhibitor MG132.

    Science.gov (United States)

    Ujino, Saneyuki; Yamaguchi, Saori; Shimotohno, Kunitada; Takaku, Hiroshi

    2010-03-09

    Hepatitis C virus (HCV) infection is a major cause of chronic liver disease. Here, we report a new and effective strategy for inhibiting HCV replication using an inhibitor of heat-shock protein 90, 17-AAG (17-allylamino-17demethoxygeldanamycin), and a proteasome inhibitor, MG132. To explore the virological basis of combination therapy, we analysed the effects of 17-AAG and MG132, singly and in combination on HCV replication in an HCV replicon cell system. In HCV replicon cells, HCV RNA replication was suppressed by 17-AAG in a dose-dependent manner. As shown in the present study, the 50% inhibitory concentration values were 0.82 nM for 17-AAG and 0.21 nM for MG132. Low concentrations of MG132 had strong synergistic inhibitory effects with low toxicity on HCV replicon cells. The results of this study suggest that the different effects and synergistic actions of 17-AAG and MG132 could provide a new therapeutic approach to HCV infection.

  10. Identification of cytochrome P450 2D6 and 2C9 substrates and inhibitors by QSAR analysis

    DEFF Research Database (Denmark)

    Jónsdóttir, Svava Ósk; Ringsted, Tine; Nikolov, Nikolai G.

    2012-01-01

    This paper presents four new QSAR models for CYP2C9 and CYP2D6 substrate recognition and inhibitor identification based on human clinical data. The models were used to screen a large data set of environmental chemicals for CYP activity, and to analyze the frequency of CYP activity among these com......This paper presents four new QSAR models for CYP2C9 and CYP2D6 substrate recognition and inhibitor identification based on human clinical data. The models were used to screen a large data set of environmental chemicals for CYP activity, and to analyze the frequency of CYP activity among...... these compounds. A large fraction of these chemicals were found to be CYP active, and thus potentially capable of affecting human physiology. 20% of the compounds within applicability domain of the models were predicted to be CYP2C9 substrates, and 17% to be inhibitors. The corresponding numbers for CYP2D6 were 9...... of specific CYP activity. An overrepresentation was seen for poly-aromatic hydrocarbons (group of procarcinogens) among CYP2C9 active and mutagenic compounds compared to CYP2C9 inactive and mutagenic compounds. The mutagenicity was predicted with a QSAR model based on Ames in vitro test data....

  11. Chiral gold(I vs chiral silver complexes as catalysts for the enantioselective synthesis of the second generation GSK-hepatitis C virus inhibitor

    Directory of Open Access Journals (Sweden)

    María Martín-Rodríguez

    2011-07-01

    Full Text Available The synthesis of a GSK 2nd generation inhibitor of the hepatitis C virus, by enantioselective 1,3-dipolar cycloaddition between a leucine derived iminoester and tert-butyl acrylate, was studied. The comparison between silver(I and gold(I catalysts in this reaction was established by working with chiral phosphoramidites or with chiral BINAP. The best reaction conditions were used for the total synthesis of the hepatitis C virus inhibitor by a four step procedure affording this product in 99% ee and in 63% overall yield. The origin of the enantioselectivity of the chiral gold(I catalyst was justified according to DFT calculations, the stabilizing coulombic interaction between the nitrogen atom of the thiazole moiety and one of the gold atoms being crucial.

  12. Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase Inhibitors

    Science.gov (United States)

    2015-12-01

    performed the clonogenic survival assay using LAPC4 as a model as these cell form well defined colonies compared to C42B cells. This assay revealed that...cells. Future studies with other PTEN deficient models are important to validate the effectiveness of WEE1 inhibitors to tackle recurrent PC...Amplifications and missense mutations Cixutumumab (IMC-A12), Dalotuzumab (MK-0646; h7C10), Linsitinib ( OSI -906) EPHA5 12% LAC, 10% SCLC, 9% SAC, Lung

  13. The cardiovascular safety trials of DPP-4 inhibitors, GLP-1 agonists, and SGLT2 inhibitors.

    Science.gov (United States)

    Secrest, Matthew H; Udell, Jacob A; Filion, Kristian B

    2017-04-01

    In this paper, we review the results of large, double-blind, placebo-controlled randomized trials mandated by the US Food and Drug Administration to examine the cardiovascular safety of newly-approved antihyperglycemic agents in patients with type 2 diabetes. The cardiovascular effects of dipeptidyl peptidase-4 (DPP-4) inhibitors remain controversial: while these drugs did not reduce or increase the risk of primary, pre-specified composite cardiovascular outcomes, one DPP-4 inhibitor (saxagliptin) increased the risk of hospitalization for heart failure in the overall population; another (alogliptin) demonstrated inconsistent effects on heart failure hospitalization across subgroups of patients, and a third (sitagliptin) demonstrated no effect on heart failure. Evidence for cardiovascular benefits of glucagon-like peptide-1 (GLP-1) agonists has been similarly heterogeneous, with liraglutide and semaglutide reducing the risk of composite cardiovascular outcomes, but lixisenatide having no reduction or increase in cardiovascular risk. The effect of GLP-1 agonists on retinopathy remains a potential concern. In the only completed trial to date to assess a sodium-glucose cotransporter-2 (SGLT2) inhibitor, empagliflozin reduced the risk of composite cardiovascular endpoints, predominantly through its impact on cardiovascular mortality and heart failure hospitalization. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Predictive Factors for Efficacy of Dipeptidyl Peptidase-4 Inhibitors in Patients with Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Shusuke Yagi

    2015-08-01

    Full Text Available BackgroundPredictive factors for the efficacy of dipeptidyl peptidase-4 (DPP-4 inhibitors for lowering glycosylated hemoglobin (HbA1c remain unclear in patients with type 2 diabetes mellitus. The aim of this study is therefore to clarify predictive factors of the efficacy of DPP-4 inhibitors for lowering HbA1c after 12 months of treatment.MethodsA total of 191 consecutive type 2 diabetic patients (male sex 55%, mean age, 68.3±35.8 years, who had been treated with DPP-4 inhibitors for 12 months, were enrolled in this study and evaluated retrospectively.ResultsAfter 12 months of DPP-4 inhibitor treatment, random blood glucose level, and HbA1c level, decreased from 167±63 to 151±49 mg/dL (P<0.01, and from 7.5%±1.3% to 6.9%±0.9% (P<0.01 respectively, without severe side effects. Multiple regression analysis showed that predictors of DPP-4 inhibitor treatment efficacy in lowering HbA1c level after 12 months were a decrease in HbA1c level after 3 months of treatment, a high baseline HbA1c level, a low baseline body mass index, and the absence of coronary artery disease.ConclusionMost suitable candidates for treatment with DPP-4 inhibitors are diabetics who are not obese and do not have coronary artery disease. In addition, long-term efficacy of DPP-4 inhibitors can be predicted by decrement of HbA1c after 3 months of treatment.

  15. Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

    Science.gov (United States)

    Lee, Young Ho; Song, Gwan Gyu

    2014-04-01

    The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. Biochemical Importance of Glycosylation of Plasminogen Activator Inhibitor-1

    DEFF Research Database (Denmark)

    Gils, Ann; Pedersen, Katrine Egelund; Skottrup, Peter

    2003-01-01

    The serpin plasminogen activator inhibitor-1 (PAI-1) is a potential target for anti-thrombotic and anti-cancer therapy. PAI-1 has 3 potential sites for N-linked glycosylation. We demonstrate here that PAI-1 expressed recombinantly or naturally by human cell lines display a heterogeneous glycosyla......The serpin plasminogen activator inhibitor-1 (PAI-1) is a potential target for anti-thrombotic and anti-cancer therapy. PAI-1 has 3 potential sites for N-linked glycosylation. We demonstrate here that PAI-1 expressed recombinantly or naturally by human cell lines display a heterogeneous...... with the glycosylation sites could be excluded as explanation for the differential reactivity. The latency transition of non-glycosylated, but not of glycosylated PAI-1, was strongly accelerated by a non-ionic detergent. The different biochemical properties of glycosylated and non-glycosylated PAI-1 depended...

  17. Andrographolide inhibits hypoxia-induced hypoxia-inducible factor 1α and endothelin 1 expression through the heme oxygenase 1/CO/cGMP/MKP-5 pathways in EA.hy926 cells.

    Science.gov (United States)

    Lin, Hung-Chih; Su, Shih-Li; Lin, Wan-Chun; Lin, Ai-Hsuan; Yang, Ya-Chen; Lii, Chong-Kuei; Chen, Haw-Wen

    2018-03-01

    Andrographolide is a potent anti-inflammatory agent found in Andrographis paniculata. Endothelin 1 (ET-1) is an endothelium-derived vasoconstrictor with pro-inflammatory properties secreted in response to hypoxia. Mitogen-activated protein kinase phosphatase 5 (MKP-5) is a dual-specificity phosphatase that dephosphorylates threonine and tyrosine residues of MAPKs. We showed previously that hypoxia-induced HIF-1α expression and ET-1 secretion are dependent on p38 MAPK in EA.hy926 cells. Here, we investigate what role MKP-5 plays in andrographolide's inhibition of hypoxia-induced expression of HIF-1α and ET-1. Hypoxic conditions were created using the hypoxia-mimetic agent CoCl 2 . Andrographolide enhanced HO-1 and MKP-5 expression and cellular cGMP content in addition to inhibiting hypoxia-induced ROS generation. Concomitantly, the HO-1 byproduct CO and the cGMP analogue 8-bromoguanosine 3',5'-cyclic monophosphate (8-Br-cGMP) increased MKP-5 expression, and pretreatment with CO and 8-Br-cGMP inhibited hypoxia-induced HIF-1α and ET-1 expression. Transfection of HO-1 siRNA or pretreatment with the HO-1 inhibitor ZnPP-9 or 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, a specific inhibitor of soluble guanylate cyclase, reduced andrographolide-induced MKP-5 expression. Moreover, silencing MKP-5 or treatment with the phosphatase inhibitor vanadate abrogated andrographolide's suppressing hypoxia-induced p38 MAPK activation and HIF-1α expression. The inhibition of hypoxia-induced HIF-1α and ET-1 expression by andrographolide is likely associated with HO-1/CO/cGMP/MKP-5 pathways, which is involved in inhibiting hypoxia-induced p38 MAPK activation. © 2017 Wiley Periodicals, Inc.

  18. Broad-Spectrum Inhibitors against 3C-Like Proteases of Feline Coronaviruses and Feline Caliciviruses

    Science.gov (United States)

    Shivanna, Vinay; Narayanan, Sanjeev; Prior, Allan M.; Weerasekara, Sahani; Hua, Duy H.; Kankanamalage, Anushka C. Galasiti; Groutas, William C.; Chang, Kyeong-Ok

    2015-01-01

    ABSTRACT Feline infectious peritonitis and virulent, systemic calicivirus infection are caused by certain types of feline coronaviruses (FCoVs) and feline caliciviruses (FCVs), respectively, and are important infectious diseases with high fatality rates in members of the Felidae family. While FCoV and FCV belong to two distinct virus families, the Coronaviridae and the Caliciviridae, respectively, they share a dependence on viral 3C-like protease (3CLpro) for their replication. Since 3CLpro is functionally and structurally conserved among these viruses and essential for viral replication, 3CLpro is considered a potential target for the design of antiviral drugs with broad-spectrum activities against these distinct and highly important viral infections. However, small-molecule inhibitors against the 3CLpro enzymes of FCoV and FCV have not been previously identified. In this study, derivatives of peptidyl compounds targeting 3CLpro were synthesized and evaluated for their activities against FCoV and FCV. The structures of compounds that showed potent dual antiviral activities with a wide margin of safety were identified and are discussed. Furthermore, the in vivo efficacy of 3CLpro inhibitors was evaluated using a mouse model of coronavirus infection. Intraperitoneal administration of two 3CLpro inhibitors in mice infected with murine hepatitis virus A59, a hepatotropic coronavirus, resulted in significant reductions in virus titers and pathological lesions in the liver compared to the findings for the controls. These results suggest that the series of 3CLpro inhibitors described here may have the potential to be further developed as therapeutic agents against these important viruses in domestic and wild cats. This study provides important insights into the structure and function relationships of 3CLpro for the design of antiviral drugs with broader antiviral activities. IMPORTANCE Feline infectious peritonitis virus (FIPV) is the leading cause of death in young cats

  19. Anti-Inflammatory Effects and Joint Protection in Collagen-Induced Arthritis after Treatment with IQ-1S, a Selective c-Jun N-Terminal Kinase Inhibitor.

    Science.gov (United States)

    Schepetkin, Igor A; Kirpotina, Liliya N; Hammaker, Deepa; Kochetkova, Irina; Khlebnikov, Andrei I; Lyakhov, Sergey A; Firestein, Gary S; Quinn, Mark T

    2015-06-01

    c-Jun N-terminal kinases (JNKs) participate in many physiologic and pathologic processes, including inflammatory diseases. We recently synthesized the sodium salt of IQ-1S (11H-indeno[1,2-b]quinoxalin-11-one oxime) and demonstrated that it is a high-affinity JNK inhibitor and inhibits murine delayed-type hypersensitivity. Here we show that IQ-1S is highly specific for JNK and that its neutral form is the most abundant species at physiologic pH. Molecular docking of the IQ-1S syn isomer into the JNK1 binding site gave the best pose, which corresponded to the position of cocrystallized JNK inhibitor SP600125 (1,9-pyrazoloanthrone). Evaluation of the therapeutic potential of IQ-1S showed that it inhibited matrix metalloproteinase 1 and 3 gene expression induced by interleukin-1β in human fibroblast-like synoviocytes and significantly attenuated development of murine collagen-induced arthritis (CIA). Treatment with IQ-1S either before or after induction of CIA resulted in decreased clinical scores, and joint sections from IQ-1S-treated CIA mice exhibited only mild signs of inflammation and minimal cartilage loss compared with those from control mice. Collagen II-specific antibody responses were also reduced by IQ-1S treatment. By contrast, the inactive ketone derivative 11H-indeno[1,2-b]quinoxalin-11-one had no effect on CIA clinical scores or collagen II-specific antibody titers. IQ-1S treatment also suppressed proinflammatory cytokine and chemokine levels in joints and lymph node cells. Finally, treatment with IQ-1S increased the number of Foxp3(+)CD4(+)CD25(+) regulatory T cells in lymph nodes. Thus, IQ-1S can reduce inflammation and cartilage loss associated with CIA and can serve as a small-molecule modulator for mechanistic studies of JNK function in rheumatoid arthritis. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

  20. Tinidazole

    Science.gov (United States)

    ... suspension (liquid) prepared by the pharmacist and a tablet to take by mouth. It is usually taken ... inhibitors such as indinavir (Crixivan) and ritonavir (Norvir); isoniazid (INH, Nydrazid); lithium (Lithobid); metronidazole (Flagyl); nefazodone (Serzone); ...

  1. Development of a disease-specific quality of life questionnaire for adult patients with hereditary angioedema due to C1 inhibitor deficiency (HAE-QoL): Spanish multi-centre research project.

    Science.gov (United States)

    Prior, Nieves; Remor, Eduardo; Gómez-Traseira, Carmen; López-Serrano, Concepción; Cabañas, Rosario; Contreras, Javier; Campos, Ángel; Cardona, Victoria; Cimbollek, Stefan; González-Quevedo, Teresa; Guilarte, Mar; de Rojas, Dolores Hernández Fernández; Marcos, Carmen; Rubio, María; Tejedor-Alonso, Miguel Ángel; Caballero, Teresa

    2012-07-20

    There is a need for a disease-specific instrument for assessing health-related quality of life in adults with hereditary angioedema due to C1 inhibitor deficiency, a rare, disabling and life-threatening disease. In this paper we report the protocol for the development and validation of a specific questionnaire, with details on the results of the process of item generation, domain selection, and the expert and patient rating phase. Semi-structured interviews were completed by 45 patients with hereditary angioedema and 8 experts from 8 regions in Spain. A qualitative content analysis of the responses was carried out. Issues raised by respondents were grouped into categories. Content analysis identified 240 different responses, which were grouped into 10 conceptual domains. Sixty- four items were generated. A total of 8 experts and 16 patients assessed the items for clarity, relevance to the disease, and correct dimension assignment. The preliminary version of the specific health-related quality of life questionnaire for hereditary angioedema (HAE-QoL v 1.1) contained 44 items grouped into 9 domains. To the best of our knowledge, this is the first multi-centre research project that aims to develop a specific health-related quality of life questionnaire for adult patients with hereditary angioedema due to C1 inhibitor deficiency. A preliminary version of the specific HAE-QoL questionnaire was obtained. The qualitative analysis of interviews together with the expert and patient rating phase helped to ensure content validity. A pilot study will be performed to assess the psychometric properties of the questionnaire and to decide on the final version.

  2. Saururus cernuus lignans-Potent small molecule inhibitors of hypoxia-inducible factor-1

    International Nuclear Information System (INIS)

    Hossain, Chowdhury Faiz; Kim, Yong-Pil; Baerson, Scott R.; Zhang Lei; Bruick, Richard K.; Mohammed, Kaleem A.; Agarwal, Ameeta K.; Nagle, Dale G.; Zhou Yudong

    2005-01-01

    Hypoxia-inducible factor-1 (HIF-1) represents an important tumor-selective therapeutic target for solid tumors. In search of novel small molecule HIF-1 inhibitors, 5400 natural product-rich extracts from plants, marine organisms, and microbes were examined for HIF-1 inhibitory activities using a cell-based reporter assay. Bioassay-guided fractionation and isolation, followed by structure elucidation, yielded three potent natural product-derived HIF-1 inhibitors and two structurally related inactive compounds. In a T47D cell-based reporter assay, manassantin B 1 , manassantin A, and 4-O-methylsaucerneol inhibited hypoxia-induced HIF-1 activation with IC 50 values of 3, 3, and 20 nM, respectively. All three compounds are relatively hypoxia-specific inhibitors of HIF-1 activation, in comparison to other stimuli. The hypoxic induction of HIF-1 target genes CDKN1A, VEGF, and GLUT-1 were also inhibited. These compounds inhibit HIF-1 by blocking hypoxia-induced nuclear HIF-1α protein accumulation without affecting HIF-1α mRNA levels. In addition, preliminary structure-activity studies suggest specific structural requirements for this class of HIF-1 inhibitors

  3. A screen for genetic suppressor elements of hepatitis C virus identifies a supercharged protein inhibitor of viral replication.

    Directory of Open Access Journals (Sweden)

    Rudo L Simeon

    Full Text Available Genetic suppressor elements (GSEs are biomolecules derived from a gene or genome of interest that act as transdominant inhibitors of biological functions presumably by disruption of critical biological interfaces. We exploited a cell death reporter cell line for hepatitis C virus (HCV infection, n4mBid, to develop an iterative selection/enrichment strategy for the identification of anti-HCV GSEs. Using this approach, a library of fragments of an HCV genome was screened for sequences that suppress HCV infection. A 244 amino acid gene fragment, B1, was strongly enriched after 5 rounds of selection. B1 derives from a single-base frameshift of the enhanced green fluorescent protein (eGFP which was used as a filler during fragment cloning. B1 has a very high net positive charge of 43 at neutral pH and a high charge-to-mass (kDa ratio of 1.5. We show that B1 expression specifically inhibits HCV replication. In addition, five highly positively charged B1 fragments produced from progressive truncation at the C-terminus all retain the ability to inhibit HCV, suggesting that a high positive charge, rather than a particular motif in B1, likely accounts for B1's anti-HCV activity. Another supercharged protein, +36GFP, was also found to strongly inhibit HCV replication when added to cells at the time of infection. This study reports a new methodology for HCV inhibitor screening and points to the anti-HCV potential of positively charged proteins/peptides.

  4. Plasma complement biomarkers distinguish multiple sclerosis and neuromyelitis optica spectrum disorder.

    Science.gov (United States)

    Hakobyan, Svetlana; Luppe, Sebastian; Evans, David Rs; Harding, Katharine; Loveless, Samantha; Robertson, Neil P; Morgan, B Paul

    2017-06-01

    Multiple sclerosis (MS) and neuromyelitis optica spectrum disorder (NMOSD) are autoimmune inflammatory demyelinating diseases of the central nervous system. Although distinguished by clinicoradiological and demographic features, early manifestations can be similar complicating management. Antibodies against aquaporin-4 support the diagnosis of NMOSD but are negative in some patients. Therefore, there is unmet need for biomarkers that enable early diagnosis and disease-specific intervention. We investigated whether plasma complement proteins are altered in MS and NMOSD and provide biomarkers that distinguish these diseases. Plasma from 54 NMOSD, 40 MS and 69 control donors was tested in multiplex assays measuring complement activation products and proteins. Using logistic regression, we tested whether combinations of complement analytes distinguished NMOSD from controls and MS. All activation products were elevated in NMOSD compared to either control or MS. Four complement proteins (C1inh, C1s, C5 and FH) were higher in NMOSD compared to MS or controls. A model comprising C1inh and terminal complement complex (TCC) distinguished NMOSD from MS (area under the curve (AUC): 0.98), while C1inh and C5 distinguished NMOSD from controls (AUC: 0.94). NMOSD is distinguished from MS by plasma complement biomarkers. Selected complement analytes enable differential diagnosis. Findings support trials of anti-complement therapies in NMOSD.

  5. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  6. A C-terminal HSP90 inhibitor restores glucocorticoid sensitivity and relieves a mouse allograft model of Cushing disease.

    Science.gov (United States)

    Riebold, Mathias; Kozany, Christian; Freiburger, Lee; Sattler, Michael; Buchfelder, Michael; Hausch, Felix; Stalla, Günter K; Paez-Pereda, Marcelo

    2015-03-01

    One function of the glucocorticoid receptor (GR) in corticotroph cells is to suppress the transcription of the gene encoding proopiomelanocortin (POMC), the precursor of the stress hormone adrenocorticotropin (ACTH). Cushing disease is a neuroendocrine condition caused by partially glucocorticoid-resistant corticotroph adenomas that excessively secrete ACTH, which leads to hypercortisolism. Mutations that impair GR function explain glucocorticoid resistance only in sporadic cases. However, the proper folding of GR depends on direct interactions with the chaperone heat shock protein 90 (HSP90, refs. 7,8). We show here that corticotroph adenomas overexpress HSP90 compared to the normal pituitary. N- and C-terminal HSP90 inhibitors act at different steps of the HSP90 catalytic cycle to regulate corticotroph cell proliferation and GR transcriptional activity. C-terminal inhibitors cause the release of mature GR from HSP90, which promotes its exit from the chaperone cycle and potentiates its transcriptional activity in a corticotroph cell line and in primary cultures of human corticotroph adenomas. In an allograft mouse model, the C-terminal HSP90 inhibitor silibinin showed anti-tumorigenic effects, partially reverted hormonal alterations, and alleviated symptoms of Cushing disease. These results suggest that the pathogenesis of Cushing disease caused by overexpression of heat shock proteins and consequently misregulated GR sensitivity may be overcome pharmacologically with an appropriate HSP90 inhibitor.

  7. Escape from Human Immunodeficiency Virus Type 1 (HIV-1 Entry Inhibitors

    Directory of Open Access Journals (Sweden)

    Carol D. Weiss

    2012-12-01

    Full Text Available The human immunodeficiency virus (HIV enters cells through a series of molecular interactions between the HIV envelope protein and cellular receptors, thus providing many opportunities to block infection. Entry inhibitors are currently being used in the clinic, and many more are under development. Unfortunately, as is the case for other classes of antiretroviral drugs that target later steps in the viral life cycle, HIV can become resistant to entry inhibitors. In contrast to inhibitors that block viral enzymes in intracellular compartments, entry inhibitors interfere with the function of the highly variable envelope glycoprotein as it continuously adapts to changing immune pressure and available target cells in the extracellular environment. Consequently, pathways and mechanisms of resistance for entry inhibitors are varied and often involve mutations across the envelope gene. This review provides a broad overview of entry inhibitor resistance mechanisms that inform our understanding of HIV entry and the design of new inhibitors and vaccines.

  8. Adventures in Scaffold Morphing: Discovery of Fused Ring Heterocyclic Checkpoint Kinase 1 (CHK1) Inhibitors.

    Science.gov (United States)

    Yang, Bin; Vasbinder, Melissa M; Hird, Alexander W; Su, Qibin; Wang, Haixia; Yu, Yan; Toader, Dorin; Lyne, Paul D; Read, Jon A; Breed, Jason; Ioannidis, Stephanos; Deng, Chun; Grondine, Michael; DeGrace, Nancy; Whitston, David; Brassil, Patrick; Janetka, James W

    2018-02-08

    Checkpoint kinase 1 (CHK1) inhibitors are potential cancer therapeutics that can be utilized for enhancing the efficacy of DNA damaging agents. Multiple small molecule CHK1 inhibitors from different chemical scaffolds have been developed and evaluated in clinical trials in combination with chemotherapeutics and radiation treatment. Scaffold morphing of thiophene carboxamide ureas (TCUs), such as AZD7762 (1) and a related series of triazoloquinolines (TZQs), led to the identification of fused-ring bicyclic CHK1 inhibitors, 7-carboxamide thienopyridines (7-CTPs), and 7-carboxamide indoles. X-ray crystal structures reveal a key intramolecular noncovalent sulfur-oxygen interaction in aligning the hinge-binding carboxamide group to the thienopyridine core in a coplanar fashion. An intramolecular hydrogen bond to an indole NH was also effective in locking the carboxamide in the preferred bound conformation to CHK1. Optimization on the 7-CTP series resulted in the identification of lead compound 44, which displayed respectable drug-like properties and good in vitro and in vivo potency.

  9. Seed-Specific Stable Expression of the ?-AI1 Inhibitor in Coffee Grains and the In Vivo Implications for the Development of the Coffee Berry Borer

    OpenAIRE

    Albuquerque, ?rika V. S.; Bezerra, Caroline A.; Romero, Juan V.; Valencia, Jorge W. A.; Valencia-Jim?nez, Arnubio; Pimenta, Lucas M.; Barbosa, Aulus E. A. D.; Silva, Maria C. M.; Meneguim, Ana M.; S?, Maria Eug?nia L.; Engler, Gilbert; de Almeida-Engler, Janice; Fernandez, Diana; Grossi-de-S?, Maria F.

    2015-01-01

    Genetic transformation of coffee (Coffea spp.), the second most traded commodity worldwide, is an alternative approach to introducing features that cannot be introgressed by traditional crossings. The transgenic stability, heritability and quantitative and spatial expression patterns of the seed-specific promoter phytohemagglutinin (PHA-L) from Phaseolus vulgaris were characterized in genetically modified C. arabica expressing the ?-amylase inhibitor-1 (?-AI1) gene. The ?-AI1 inhibitor shows ...

  10. Studies on 2-phenylquinoline Staphylococcus aureus NorA efflux pump inhibitors: New insights on the C-6 position.

    Science.gov (United States)

    Felicetti, Tommaso; Cannalire, Rolando; Nizi, Maria Giulia; Tabarrini, Oriana; Massari, Serena; Barreca, Maria Letizia; Manfroni, Giuseppe; Schindler, Bryan D; Cecchetti, Violetta; Kaatz, Glenn W; Sabatini, Stefano

    2018-06-06

    The alarming and rapid spread of antimicrobial resistance among bacteria represents a high risk for global health. Targeting factors involved in resistance to restore the activity of failing antibiotics is a promising strategy to overcome this urgent medical need. Efflux pump inhibitors are able to increase antibiotic concentrations in bacteria, thus they can be considered true antimicrobial resistance breakers. In this work, continuing our studies on inhibitors of the Staphylococcus aureus NorA pump, we designed, synthesized and biologically evaluated novel 2-phenylquinoline derivatives starting from our hits 1 and 2. Two of the synthesized compounds (6 and 7) bearing a C-6 benzyloxy group showed the best NorA inhibition activity, thereby providing an excellent starting point to direct future chemical optimizations. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  11. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-11-01

    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  12. WNK1 is an unexpected autophagy inhibitor

    Science.gov (United States)

    Gallolu Kankanamalage, Sachith; Lee, A-Young; Wichaidit, Chonlarat; Lorente-Rodriguez, Andres; Shah, Akansha M.; Stippec, Steve; Whitehurst, Angelique W.; Cobb, Melanie H.

    2017-01-01

    ABSTRACT Autophagy is a cellular degradation pathway that is essential to maintain cellular physiology, and deregulation of autophagy leads to multiple diseases in humans. In a recent study, we discovered that the protein kinase WNK1 (WNK lysine deficient protein kinase 1) is an inhibitor of autophagy. The loss of WNK1 increases both basal and starvation-induced autophagy. In addition, the depletion of WNK1 increases the activation of the class III phosphatidylinositol 3-kinase (PtdIns3K) complex, which is required to induce autophagy. Moreover, the loss of WNK1 increases the expression of ULK1 (unc-51 like kinase 1), which is upstream of the PtdIns3K complex. It also increases the pro-autophagic phosphorylation of ULK1 at Ser555 and the activation of AMPK (AMP-activated protein kinase), which is responsible for that phosphorylation. The inhibition of AMPK by compound C decreases the magnitude of autophagy induction following WNK1 loss; however, it does not prevent autophagy induction. We found that the UVRAG (UV radiation resistance associated gene), which is a component of the PtdIns3K, binds to the N-terminal region of WNK1. Moreover, WNK1 partially colocalizes with UVRAG and this colocalization decreases when autophagy is stimulated in cells. The loss of WNK1 also alters the cellular distribution of UVRAG. The depletion of the downstream target of WNK1, OXSR1/OSR1 (oxidative-stress responsive 1) has no effect on autophagy, whereas the depletion of its relative STK39/SPAK (serine/threonine kinase 39) induces autophagy under nutrient-rich and starved conditions. PMID:28282258

  13. Safety and efficacy of an 8-week regimen of grazoprevir plus ruzasvir plus uprifosbuvir compared with grazoprevir plus elbasvir plus uprifosbuvir in participants without cirrhosis infected with hepatitis C virus genotypes 1, 2, or 3 (C-CREST-1 and C-CREST-2, part A)

    DEFF Research Database (Denmark)

    Gane, Edward J; Pianko, Stephen; Roberts, Stuart K

    2017-01-01

    BACKGROUND: New hepatitis C virus (HCV) therapies with pan-genotypic efficacy are needed. The goals of part A of C-CREST-1 and C-CREST-2 were to compare the efficacies of two doses (300 mg or 450 mg once daily) of uprifosbuvir (MK-3682; NS5B inhibitor) in an 8-week regimen combined with grazoprev...

  14. A novel dual NO-donating oxime and c-Jun N-terminal kinase inhibitor protects against cerebral ischemia-reperfusion injury in mice.

    Science.gov (United States)

    Atochin, Dmitriy N; Schepetkin, Igor A; Khlebnikov, Andrei I; Seledtsov, Victor I; Swanson, Helen; Quinn, Mark T; Huang, Paul L

    2016-04-08

    The c-Jun N-terminal kinase (JNK) has been shown to be an important regulator of neuronal cell death. Previously, we synthesized the sodium salt of 11H-indeno[1,2-b]quinoxalin-11-one (IQ-1S) and demonstrated that it was a high-affinity inhibitor of the JNK family. In the present work, we found that IQ-1S could release nitric oxide (NO) during its enzymatic metabolism by liver microsomes. Moreover, serum nitrite/nitrate concentration in mice increased after intraperitoneal injection of IQ-1S. Because of these dual actions as JNK inhibitor and NO-donor, the therapeutic potential of IQ-1S was evaluated in an animal stroke model. We subjected wild-type C57BL6 mice to focal ischemia (30min) with subsequent reperfusion (48h). Mice were treated with IQ-1S (25mg/kg) suspended in 10% solutol or with vehicle alone 30min before and 24h after middle cerebral artery (MCA) occlusion (MCAO). Using laser-Doppler flowmetry, we monitored cerebral blood flow (CBF) above the MCA during 30min of MCAO provoked by a filament and during the first 30min of subsequent reperfusion. In mice treated with IQ-1S, ischemic and reperfusion values of CBF were not different from vehicle-treated mice. However, IQ-1S treated mice demonstrated markedly reduced neurological deficit and infarct volumes as compared with vehicle-treated mice after 48h of reperfusion. Our results indicate that the novel JNK inhibitor releases NO during its oxidoreductive bioconversion and improves stroke outcome in a mouse model of cerebral reperfusion. We conclude that IQ-1S is a promising dual functional agent for the treatment of cerebral ischemia and reperfusion injury. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. A Novel Dual NO-donating Oxime and c-Jun N-terminal Kinase Inhibitor Protects Against Cerebral Ischemia–Reperfusion Injury in Mice

    Science.gov (United States)

    Atochin, Dmitriy N.; Schepetkin, Igor A.; Khlebnikov, Andrei I.; Seledtsov, Victor I.; Swanson, Helen; Quinn, Mark T.; Huang, Paul L.

    2017-01-01

    The c-Jun N-terminal kinase (JNK) has been shown to be an important regulator of neuronal cell death. Previously, we synthesized the sodium salt of 11H-indeno[1,2-b]quinoxalin-11-one (IQ-1S) and demonstrated that it was a high-affinity inhibitor of the JNK family. In the present work, we found that IQ-1S could release nitric oxide (NO) during its enzymatic metabolism by liver microsomes. Moreover, serum nitrite/nitrate concentration in mice increased after intraperitoneal injection of IQ-1S. Because of these dual actions as JNK inhibitor and NO-donor, the therapeutic potential of IQ-1S was evaluated in an animal stroke model. We subjected wild-type C57BL6 mice to focal ischemia (30 minutes) with subsequent reperfusion (48 hours). Mice were treated with IQ-1S (25 mg/kg) suspended in 10% solutol or with vehicle alone 30 minutes before and 24 hours after middle cerebral artery MCA) occlusion (MCAO). Using laser-Doppler flowmetry, we monitored cerebral blood flow (CBF) above the MCA during 30 minutes of MCAO provoked by a filament and during the first 30 minutes of subsequent reperfusion. In mice treated with IQ-1S, ischemic and reperfusion values of CBF were not different from vehicle-treated mice. However, IQ-1S treated mice demonstrated markedly reduced neurological deficit and infarct volumes as compared with vehicle-treated mice after 48 hours of reperfusion. Our results indicate that the novel JNK inhibitor releases NO during its oxidoreductive bioconversion and improves stroke outcome in a mouse model of cerebral reperfusion. We conclude that IQ-1S is a promising dual functional agent for the treatment of cerebral ischemia and reperfusion injury. PMID:26923672

  16. C-Methylated Flavonoids from Cleistocalyx operculatus and Their Inhibitory Effects on Novel Influenza A (H1N1) Neuraminidase

    DEFF Research Database (Denmark)

    Dao, Trong-Tuan; Tung, Bui-Thanh; Nguyen, Phi-Hung

    2010-01-01

    As part of an ongoing study focused on the discovery of anti-influenza agents from plants, four new (1-4) and 10 known (5-14) C-methylated flavonoids were isolated from a methanol extract of Cleistocalyx operculatus buds using an influenza H1N1 neuraminidase inhibition assay. Compounds 4, 7, 8...... mutant) expressed in 293T cells with IC50 values of 8.15 ± 1.05 and 3.31 ± 1.34 μM, respectively. Compounds 4, 7, 8, and 14 behaved as noncompetitive inhibitors in the kinetic studies. These results indicate that C-methylated flavonoids from C. operculatus have the potential to be developed...

  17. PDE1A inhibition elicits cGMP-dependent relaxation of rat mesenteric arteries

    DEFF Research Database (Denmark)

    Khammy, Makhala Michell; Dalsgaard, Thomas; Larsen, Peter Hjorringgaard

    2017-01-01

    (EC50 = 32 nM). Inhibition of NOS with L-NAME, soluble GC with ODQ, or PKG with Rp-8-Br-PET-cGMP all attenuated PDE1 inhibition-induced relaxation, whereas PKA inhibition with H89 had no effect. CONCLUSION AND IMPLICATIONS: Pde1a was the dominant PDE1 isoform present in VSMC and relaxation mediated...... by PDE1A-inhibition was predominantly driven by enhanced cGMP signalling. These results imply that isoform-selective PDE1 inhibitors are powerful investigative tools allowing examination of physiological and pathological roles of PDE1 isoforms....

  18. Natural coagulation inhibitors and active protein c resistance in preeclampsia

    Directory of Open Access Journals (Sweden)

    Cengiz Demir

    2010-01-01

    Full Text Available INTRODUCTION: The etiology of preeclampsia is not fully established. A few studies have shown a relationship between natural coagulation inhibitors and preeclampsia. OBJECTIVES: The purpose of this study was to investigate the status of natural coagulation inhibitors and active protein C resistance (APC-R in preeclampsia. PATIENTS AND METHODS: We studied 70 women with preeclampsia recruited consecutively and 70 healthy pregnant and 70 nonpregnant women as controls. Plasma protein C (PC, free protein S (fPS, antithrombin III (ATIII and APC-R were evaluated. RESULTS: ATIII values were found to be significantly lower in preeclamptic patients than in the control groups (p< 0.001. Nevertheless, there was no significant difference between the healthy pregnant and nonpregnant women groups (p=0.141. The fPS values of the preeclamptic and healthy pregnant groups were lower than that of the nonpregnant group (p< 0.001, and the fPS value of the preeclamptic pregnant women was lower than that of healthy pregnant women (p<0.001. The PC value of the preeclamptic pregnant women was lower than that of the control groups (p< 0.001. The PC value of the healthy pregnant women was lower than that of the nonpregnant women (p< 0.001. The mean APC activity values were lower in the preeclamptic patients than that of the control groups (p< 0.001, p< 0.001. The APC-R positivity rates of the preeclamptic groups were higher than that of the control groups (p<0.001. CONCLUSIONS: This study demonstrated that ATIII, fPS, PC values and APC resistance were lower and APC-R positivity was higher in preeclamptic women than in normal pregnant and nonpregnant women.

  19. DISTRIBUTION AND ELIMINATION OF THE GLYCOSIDASE INHIBITORS 1-DEOXYMANNOJIRIMYCIN AND N-METHYL-1-DEOXYNOJIRIMYCIN IN THE RAT INVIVO

    NARCIS (Netherlands)

    FABER, ED; NEEFJES, JJ; PLOEGH, HL; MEIJER, DKF

    1992-01-01

    We studied the pharmacokinetics of two synthetic derivatives of 1-deoxynojirimycin in the rat after intravenous administration. The mannosidase IA/B inhibitor 1-deoxymannojirimycin and the glucosidase inhibitor N-methyl-1-deoxynojirimycin exhibited minimal plasma protein binding and showed a rapid

  20. Synthesis of deleobuvir, a potent hepatitis C virus polymerase inhibitor, and its major metabolites labeled with carbon-13 and carbon-14.

    Science.gov (United States)

    Latli, Bachir; Hrapchak, Matt; Chevliakov, Maxim; Li, Guisheng; Campbell, Scot; Busacca, Carl A; Senanayake, Chris H

    2015-05-30

    Deleobuvir, (2E)-3-(2-{1-[2-(5-bromopyrimidin-2-yl)-3-cyclopentyl-1-methyl-1H-indole-6-carboxamido]cyclobutyl}-1-methyl-1H-benzimidazol-6-yl)prop-2-enoic acid (1), is a non-nucleoside, potent, and selective inhibitor of hepatitis C virus NS5B polymerase. Herein, we describe the detailed synthesis of this compound labeled with carbon-13 and carbon-14. The synthesis of its three major metabolites, namely, the reduced double bond metabolite (2) and the acyl glucuronide derivatives of (1) and (2), is also reported. Aniline-(13) C6 was the starting material to prepare butyl (E)-3-(3-methylamino-4-nitrophenyl-(13) C6 )acrylate [(13) C6 ]-(11) in six steps. This intermediate was then used to obtain [(13) C6 ]-(1) and [(13) C6 ]-(2) in five and four more steps, respectively. For the radioactive synthesis, potassium cyanide-(14) C was used to prepare 1-cylobutylaminoacid [(14) C]-(23) via Buchrer-Bergs reaction. The carbonyl chloride of this acid was then used to access both [(14) C]-(1) and [(14) C]-(2) in four steps. The acyl glucuronide derivatives [(13) C6 ]-(3), [(13) C6 ]-(4) and [(14) C]-(3) were synthesized in three steps from the acids [(13) C6 ]-(1), [(13) C6 ]-(2) and [(14) C]-(1) using known procedures. Copyright © 2015 John Wiley & Sons, Ltd.

  1. Acidic tumor microenvironment abrogates the efficacy of mTORC1 inhibitors.

    Science.gov (United States)

    Faes, Seraina; Duval, Adrian P; Planche, Anne; Uldry, Emilie; Santoro, Tania; Pythoud, Catherine; Stehle, Jean-Christophe; Horlbeck, Janine; Letovanec, Igor; Riggi, Nicolo; Demartines, Nicolas; Dormond, Olivier

    2016-12-05

    Blocking the mechanistic target of rapamycin complex-1 (mTORC1) with chemical inhibitors such as rapamycin has shown limited clinical efficacy in cancer. The tumor microenvironment is characterized by an acidic pH which interferes with cancer therapies. The consequences of acidity on the anti-cancer efficacy of mTORC1 inhibitors have not been characterized and are thus the focus of our study. Cancer cell lines were treated with rapamycin in acidic or physiological conditions and cell proliferation was investigated. The effect of acidity on mTORC1 activity was determined by Western blot. The anticancer efficacy of rapamycin in combination with sodium bicarbonate to increase the intratumoral pH was tested in two different mouse models and compared to rapamycin treatment alone. Histological analysis was performed on tumor samples to evaluate proliferation, apoptosis and necrosis. Exposing cancer cells to acidic pH in vitro significantly reduced the anti-proliferative effect of rapamycin. At the molecular level, acidity significantly decreased mTORC1 activity, suggesting that cancer cell proliferation is independent of mTORC1 in acidic conditions. In contrast, the activation of mitogen-activated protein kinase (MAPK) or AKT were not affected by acidity, and blocking MAPK or AKT with a chemical inhibitor maintained an anti-proliferative effect at low pH. In tumor mouse models, the use of sodium bicarbonate increased mTORC1 activity in cancer cells and potentiated the anti-cancer efficacy of rapamycin. Combining sodium bicarbonate with rapamycin resulted in increased tumor necrosis, increased cancer cell apoptosis and decreased cancer cell proliferation as compared to single treatment. Taken together, these results emphasize the inefficacy of mTORC1 inhibitors in acidic conditions. They further highlight the potential of combining sodium bicarbonate with mTORC1 inhibitors to improve their anti-tumoral efficacy.

  2. Penostatin Derivatives, a Novel Kind of Protein Phosphatase 1B Inhibitors Isolated from Solid Cultures of the Entomogenous Fungus Isaria tenuipes

    Directory of Open Access Journals (Sweden)

    Yu-Peng Chen

    2014-01-01

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B is implicated as a negative regulator of insulin receptor (IR signaling and a potential drug target for the treatment of type II diabetes and other associated metabolic syndromes. Therefore, small molecular inhibitors of PTP1B can be considered as an attractive approach for the design of new therapeutic agents of type II diabetes diseases. In a continuing search for new protein phosphatase inhibitors from fungi, we have isolated a new compound, named penostatin J (1, together with three known ones, penostatin C (2, penostatin A (3, and penostatin B (4, from cultures of the entomogenous fungus Isaria tenuipes. The structure of penostatin J (1 was elucidated by extensive spectroscopic analysis. We also demonstrate for the first time that penostatin derivatives exhibit the best PTP1B inhibitory action. These findings suggest that penostatin derivatives are a potential novel kind of PTP1B inhibitors.

  3. An APC/C-Cdh1 Biosensor Reveals the Dynamics of Cdh1 Inactivation at the G1/S Transition.

    Science.gov (United States)

    Ondracka, Andrej; Robbins, Jonathan A; Cross, Frederick R

    2016-01-01

    B-type cyclin-dependent kinase activity must be turned off for mitotic exit and G1 stabilization. B-type cyclin degradation is mediated by the anaphase-promoting complex/cyclosome (APC/C); during and after mitotic exit, APC/C is dependent on Cdh1. Cdh1 is in turn phosphorylated and inactivated by cyclin-CDK at the Start transition of the new cell cycle. We developed a biosensor to assess the cell cycle dynamics of APC/C-Cdh1. Nuclear exit of the G1 transcriptional repressor Whi5 is a known marker of Start; APC/C-Cdh1 is inactivated 12 min after Whi5 nuclear exit with little measurable cell-to-cell timing variability. Multiple phosphorylation sites on Cdh1 act in a redundant manner to repress its activity. Reducing the number of phosphorylation sites on Cdh1 can to some extent be tolerated for cell viability, but it increases variability in timing of APC/C-Cdh1 inactivation. Mutants with minimal subsets of phosphorylation sites required for viability exhibit striking stochasticity in multiple responses including budding, nuclear division, and APC/C-Cdh1 activity itself. Multiple cyclin-CDK complexes, as well as the stoichiometric inhibitor Acm1, contribute to APC/C-Cdh1 inactivation; this redundant control is likely to promote rapid and reliable APC/C-Cdh1 inactivation immediately following the Start transition.

  4. Design of novel HIV-1 protease inhibitors incorporating isophthalamide-derived P2-P3 ligands: Synthesis, biological evaluation and X-ray structural studies of inhibitor-HIV-1 protease complex

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Arun K.; Brindisi, Margherita; Nyalapatla, Prasanth R.; Takayama, Jun; Ella-Menye, Jean-Rene; Yashchuk, Sofiya; Agniswamy, Johnson; Wang, Yuan-Fang; Aoki, Manabu; Amano, Masayuki; Weber, Irene T.; Mitsuya, Hiroaki

    2017-10-01

    Based upon molecular insights from the X-ray structures of inhibitor-bound HIV-1 protease complexes, we have designed a series of isophthalamide-derived inhibitors incorporating substituted pyrrolidines, piperidines and thiazolidines as P2-P3 ligands for specific interactions in the S2-S3 extended site. Compound 4b has shown an enzyme Ki of 0.025 nM and antiviral IC50 of 69 nM. An X-ray crystal structure of inhibitor 4b-HIV-1 protease complex was determined at 1.33 Å resolution. We have also determined X-ray structure of 3b-bound HIV-1 protease at 1.27 Å resolution. These structures revealed important molecular insight into the inhibitor–HIV-1 protease interactions in the active site.

  5. Expression of PKA inhibitor (PKI) gene abolishes cAMP-mediated protection to endothelial barrier dysfunction.

    Science.gov (United States)

    Lum, H; Jaffe, H A; Schulz, I T; Masood, A; RayChaudhury, A; Green, R D

    1999-09-01

    We investigated the hypothesis that cAMP-dependent protein kinase (PKA) protects against endothelial barrier dysfunction in response to proinflammatory mediators. An E1-, E3-, replication-deficient adenovirus (Ad) vector was constructed containing the complete sequence of PKA inhibitor (PKI) gene (AdPKI). Infection of human microvascular endothelial cells (HMEC) with AdPKI resulted in overexpression of PKI. Treatment with 0.5 microM thrombin increased transendothelial albumin clearance rate (0.012 +/- 0.003 and 0.035 +/- 0.005 microl/min for control and thrombin, respectively); the increase was prevented with forskolin + 3-isobutyl-1-methylxanthine (F + I) treatment. Overexpression of PKI resulted in abrogation of the F + I-induced inhibition of the permeability increase. However, with HMEC infected with ultraviolet-inactivated AdPKI, the F + I-induced inhibition was present. Also, F + I treatment of HMEC transfected with reporter plasmid containing the cAMP response element-directed transcription of the luciferase gene resulted in an almost threefold increase in luciferase activity. Overexpression of PKI inhibited this induction of luciferase activity. The results show that Ad-mediated overexpression of PKI in endothelial cells abrogated the cAMP-mediated protection against increased endothelial permeability, providing direct evidence that cAMP-dependent protein kinase promotes endothelial barrier function.

  6. Novel indole-based inhibitors of IMPDH: introduction of hydrogen bond acceptors at indole C-3.

    Science.gov (United States)

    Watterson, Scott H; Dhar, T G Murali; Ballentine, Shelley K; Shen, Zhongqi; Barrish, Joel C; Cheney, Daniel; Fleener, Catherine A; Rouleau, Katherine A; Townsend, Robert; Hollenbaugh, Diane L; Iwanowicz, Edwin J

    2003-04-07

    The development of a series of novel indole-based inhibitors of 5'-inosine monophosphate dehydrogenase (IMPDH) is described. Various hydrogen bond acceptors at C-3 of the indole were explored. The synthesis and the structure-activity relationships (SARs) derived from in vitro studies are outlined.

  7. SirT1 confers hypoxia-induced radioresistance via the modulation of c-Myc stabilization on hepatoma cells

    International Nuclear Information System (INIS)

    Xie Yuexia; Zhang Jianghong; Shao Chunlin; Xu Yanwu

    2012-01-01

    Intratumoral hypoxia is an important contributory factor to tumor cell resistance to radiotherapy. SirT1, a nicotinamide adenine dinucleotide (NAD + )-dependent histone/protein deacetylase, has been linked to the decrease of radiation-induced DNA damage and seems to be critical for cancer therapy. The purpose of this study was to investigate the role of SirT1 in hypoxia-induced radiation response on hepatoma cells. It was found that the administration with resveratrol, a putative SirT1 activator, enhanced the resistance of HepG2 cells against radiation-induced DNA damage of MN formation under hypoxia condition; while nicotinamide, a well-known SirT1 inhibitor, sensitized this radiation damage. Nevertheless, pretreatment of cells with 10058-F4, a specific inhibitor of c-Myc, almost eliminated the nicotinamide-induced radiosensitive effect. Further studies revealed that resveratrol inhibited c-Myc protein accumulation via up-regulation of SirT1 expression and deacetylase activity, and this loss of c-Myc protein was abolished by inhibiting its degradation in the presence of MG132, a potent inhibitor of proteasome. In contrast, nicotinamide attenuated c-Myc protein degradation induced by radiation under hypoxia through inhibition of SirT1 deacetylase activity. Our findings suggest that SirT1 could serve as a novel potent target of radiation-induced DNA damage and thus as a potential strategy to advance the efficiency of radiation therapy in hepatoma entities. (author)

  8. Biochemical Importance of Glycosylation of Plasminogen Activator Inhibitor-1

    DEFF Research Database (Denmark)

    Gils, Ann; Pedersen, Katrine Egelund; Skottrup, Peter Durand

    2003-01-01

    The serpin plasminogen activator inhibitor-1 (PAI-1) is a potential target for anti-thrombotic and anti-cancer therapy. PAI-1 has 3 potential sites for N-linked glycosylation. We demonstrate here that PAI-1 expressed recombinantly or naturally by human cell lines display a heterogeneous glycosyla...

  9. Structure-Based Design of Novel HIV-1 Protease Inhibitors to Combat Drug Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh,A.; Sridhar, P.; Leshchenko, S.; Hussain, A.; Li, J.; Kovalevsky, A.; Walters, D.; Wedelind, J.; Grum-Tokars, V.; et al.

    2006-01-01

    Structure-based design and synthesis of novel HIV protease inhibitors are described. The inhibitors are designed specifically to interact with the backbone of HIV protease active site to combat drug resistance. Inhibitor 3 has exhibited exceedingly potent enzyme inhibitory and antiviral potency. Furthermore, this inhibitor maintains impressive potency against a wide spectrum of HIV including a variety of multi-PI-resistant clinical strains. The inhibitors incorporated a stereochemically defined 5-hexahydrocyclopenta[b]furanyl urethane as the P2-ligand into the (R)-(hydroxyethylamino)sulfonamide isostere. Optically active (3aS,5R,6aR)-5-hydroxy-hexahydrocyclopenta[b]furan was prepared by an enzymatic asymmetrization of meso-diacetate with acetyl cholinesterase, radical cyclization, and Lewis acid-catalyzed anomeric reduction as the key steps. A protein-ligand X-ray crystal structure of inhibitor 3-bound HIV-1 protease (1.35 Angstroms resolution) revealed extensive interactions in the HIV protease active site including strong hydrogen bonding interactions with the backbone. This design strategy may lead to novel inhibitors that can combat drug resistance.

  10. An open, randomized, parallel-group study to compare the efficacy and safety profile of inhaled human insulin (exubera) with meformin as adjunctive therapy in patients with type 2 diabetes poorly controlled on a sulfonylurea: response to mikhail and cope

    DEFF Research Database (Denmark)

    Barnett, Anthony H.; Dreyer, Manfred; Lange, Peter

    2006-01-01

    OBJECTIVE: To compare the efficacy and safety profile of adding inhaled human insulin (INH; Exubera) or metformin to sulfonylurea monotherapy in patients with poorly controlled type 2 diabetes. RESEARCH DESIGN AND METHODS: We performed an open-label, parallel, 24-week, multicenter trial. At week -1......: In patients with type 2 diabetes poorly controlled on a sulfonylurea (A1C >9.5%), the addition of premeal INH significantly improves glycemic control compared with adjunctive metformin and is well tolerated....

  11. Inhibitor discovery of full-length New Delhi metallo-β-lactamase-1 (NDM-1.

    Directory of Open Access Journals (Sweden)

    Bingzheng Shen

    Full Text Available New Delhi metallo-β-lactmase-1 (NDM-1 has recently attracted extensive attention for its biological activities to catalyze the hydrolysis of almost all of β-lactam antibiotics. To study the catalytic property of NDM-1, the steady-kinetic parameters of NDM-1 toward several kinds of β-lactam antibiotics have been detected. It could effectively hydrolyze most β-lactams (k cat/K m ratios between 0.03 to 1.28 µmol⁻¹.s⁻¹, except aztreonam. We also found that thiophene-carboxylic acid derivatives could inhibit NDM-1 and have shown synergistic antibacterial activity in combination with meropenem. Flexible docking and quantum mechanics (QM study revealed electrostatic interactions between the sulfur atom of thiophene-carboxylic acid derivatives and the zinc ion of NDM-1, along with hydrogen bond between inhibitor and His189 of NDM-1. The interaction models proposed here can be used in rational design of NDM-1 inhibitors.

  12. Targeting c-Myc: JQ1 as a promising option for c-Myc-amplified esophageal squamous cell carcinoma.

    Science.gov (United States)

    Wang, Jingyuan; Liu, Zhentao; Wang, Ziqi; Wang, Shubin; Chen, Zuhua; Li, Zhongwu; Zhang, Mengqi; Zou, Jianling; Dong, Bin; Gao, Jing; Shen, Lin

    2018-04-10

    c-Myc amplification-induced cell cycle dysregulation is a common cause for esophageal squamous cell carcinoma (ESCC), but no approved targeted drug is available so far. The bromodomain inhibitor JQ1, which targets c-Myc, exerts anti-tumor activity in multiple cancers. However, the role of JQ1 in ESCC remains unknown. In this study, we reported that JQ1 had potent anti-proliferative effects on ESCC cells in both time- and dose-dependent manners by inducing cell cycle arrest at G1 phase, cell apoptosis, and the mesenchymal-epithelial transition. Follow-up studies revealed that both c-Myc/cyclin/Rb and PI3K/AKT signaling pathways were inactivated by JQ1, as indicated by the downregulation of c-Myc, cyclin A/E, and phosphorylated Rb, AKT and S6. Tumor suppression induced by JQ1 in c-Myc amplified or highly expressed xenografts was higher than that in xenografts with low expression, suggesting its potential role in prediction. In conclusion, targeting c-Myc by JQ1 could cause significant tumor suppression in ESCC both in vitro and in vivo. Also, c-Myc amplification or high expression might serve as a potential biomarker and provide a promising therapeutic option for ESCC. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Plasminogen activator inhibitor-1 is an independent prognostic factor of ovarian cancer and IMD-4482, a novel plasminogen activator inhibitor-1 inhibitor, inhibits ovarian cancer peritoneal dissemination.

    Science.gov (United States)

    Nakatsuka, Erika; Sawada, Kenjiro; Nakamura, Koji; Yoshimura, Akihito; Kinose, Yasuto; Kodama, Michiko; Hashimoto, Kae; Mabuchi, Seiji; Makino, Hiroshi; Morii, Eiichi; Yamaguchi, Yoichi; Yanase, Takeshi; Itai, Akiko; Morishige, Ken-Ichirou; Kimura, Tadashi

    2017-10-27

    In the present study, the therapeutic potential of targeting plasminogen activator inhibitor-1 (PAI-1) in ovarian cancer was tested. Tissues samples from 154 cases of ovarian carcinoma were immunostained with anti-PAI-1 antibody, and the prognostic value was analyzed. Among the samples, 67% (104/154) showed strong PAI-1 expression; this was significantly associated with poor prognosis (progression-free survival: 20 vs. 31 months, P = 0.0033). In particular, among patients with stage II-IV serous adenocarcinoma, PAI-1 expression was an independent prognostic factor. The effect of a novel PAI-1 inhibitor, IMD-4482, on ovarian cancer cell lines was assessed and its therapeutic potential was examined using a xenograft mouse model of ovarian cancer. IMD-4482 inhibited in vitro cell adhesion to vitronectin in PAI-1-positive ovarian cancer cells, followed by the inhibition of extracellular signal-regulated kinase and focal adhesion kinase phosphorylation through dissociation of the PAI-urokinase receptor complex from integrin αVβ3. IMD-4482 caused G0/G1 cell arrest and inhibited the proliferation of PAI-1-positive ovarian cancer cells. In the xenograft model, IMD-4482 significantly inhibited peritoneal dissemination with the reduction of PAI-1 expression and the inhibition of focal adhesion kinase phosphorylation. Collectively, the functional inhibition of PAI-1 significantly inhibited ovarian cancer progression, and targeting PAI-1 may be a potential therapeutic strategy in ovarian cancer.

  14. BPN, a marine-derived PTP1B inhibitor, activates insulin signaling and improves insulin resistance in C2C12 myotubes.

    Science.gov (United States)

    Xu, Qi; Luo, Jiao; Wu, Ning; Zhang, Renshuai; Shi, Dayong

    2018-01-01

    Insulin resistance is a key feature of type 2 diabetes mellitus (T2DM) and is characterized by defects in insulin signaling. Protein tyrosine phosphatase 1B (PTP1B) is a major negative regulator of insulin signaling cascade and has attracted intensive investigation in recent T2DM therapy study. BPN, a marine-derived bromophenol compound, was isolated from the red alga Rhodomela confervoides. This study investigated the effects of BPN on the insulin signaling pathway in insulin-resistant C2C12 myotubes by inhibiting PTP1B. Molecular docking study and analysis of small- molecule interaction with PTP1B all showed BPN inhibited PTP1B activity via binding to the catalytic site through hydrogen bonds. We then found that BPN permeated into C2C12 myotubes, on the one hand, activated insulin signaling in an insulin-independent manner in C2C12 cells; on the other hand, ameliorated palmitate-induced insulin resistance through augmenting insulin sensitivity. Moreover, our studies also showed that PTP1B inhibition by BPN increased glucose uptake in normal and insulin-resistant C2C12 myotubes through glucose transporter 4 (GLUT4) translocation. Taken together, BPN activates insulin signaling and alleviates insulin resistance and represents a potential candidate for further development as an antidiabetic agent. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. SAR405, a PIK3C3/Vps34 inhibitor that prevents autophagy and synergizes with MTOR inhibition in tumor cells.

    Science.gov (United States)

    Pasquier, Benoit

    2015-04-03

    Autophagy plays an important role in cancer and it has been suggested that it functions not only as a tumor suppressor pathway to prevent tumor initiation, but also as a prosurvival pathway that helps tumor cells endure metabolic stress and resist death triggered by chemotherapeutic agents. We recently described the discovery of inhibitors of PIK3C3/Vps34 (phosphatidylinositol 3-kinase, catalytic subunit type 3), the lipid kinase component of the class III phosphatidylinositol 3-kinase (PtdIns3K). This PtdIns3K isoform has attracted significant attention in recent years because of its role in autophagy. Following chemical optimization we identified SAR405, a low molecular mass kinase inhibitor of PIK3C3, highly potent and selective with regard to other lipid and protein kinases. We demonstrated that inhibiting the catalytic activity of PIK3C3 disrupts vesicle trafficking from late endosomes to lysosomes. SAR405 treatment also inhibits autophagy induced either by starvation or by MTOR (mechanistic target of rapamycin) inhibition. Finally our results show that combining SAR405 with everolimus, the FDA-approved MTOR inhibitor, results in a significant synergy on the reduction of cell proliferation using renal tumor cells. This result indicates a potential therapeutic application for PIK3C3 inhibitors in cancer.

  16. The CYP2E1 inhibitor DDC up-regulates MMP-1 expression in hepatic stellate cells via an ERK1/2- and Akt-dependent mechanism.

    Science.gov (United States)

    Liu, Tianhui; Wang, Ping; Cong, Min; Xu, Youqing; Jia, Jidong; You, Hong

    2013-06-05

    DDC (diethyldithiocarbamate) could block collagen synthesis in HSC (hepatic stellate cells) through the inhibition of ROS (reactive oxygen species) derived from hepatocyte CYP2E1 (cytochrome P450 2E1). However, the effect of DDC on MMP-1 (matrix metalloproteinase-1), which is the main collagen degrading matrix metalloproteinase, has not been reported. In co-culture experiments, we found that DDC significantly enhanced MMP-1 expression in human HSC (LX-2) that were cultured with hepatocyte C3A cells either expressing or not expressing CYP2E1. The levels of both proenzyme and active MMP-1 enzyme were up-regulated in LX-2 cells, accompanied by elevated enzyme activity of MMP-1 and decreased collagen I, in both LX-2 cells and the culture medium. H2O2 treatment abrogated DDC-induced MMP-1 up-regulation and collagen I decrease, while catalase treatment slightly up-regulated MMP-1 expression. These data suggested that the decrease in ROS by DDC was partially responsible for the MMP-1 up-regulation. ERK1/2 (extracellular signal-regulated kinase 1/2), Akt (protein kinase B) and p38 were significantly activated by DDC. The ERK1/2 inhibitor (U0126) and Akt inhibitor (T3830) abrogated the DDC-induced MMP-1 up-regulation. In addition, a p38 inhibitor (SB203580) improved MMP-1 up-regulation through the stimulation of ERK1/2. Our data indicate that DDC significantly up-regulates the expression of MMP-1 in LX-2 cells which results in greater MMP-1 enzyme activity and decreased collagen I. The enhancement of MMP-1 expression by DDC was associated with H2O2 inhibition and coordinated regulation by the ERK1/2 and Akt pathways. These data provide some new insights into treatment strategies for hepatic fibrosis.

  17. PDE1C deficiency antagonizes pathological cardiac remodeling and dysfunction

    Science.gov (United States)

    Knight, Walter E.; Chen, Si; Zhang, Yishuai; Oikawa, Masayoshi; Wu, Meiping; Zhou, Qian; Miller, Clint L.; Cai, Yujun; Mickelsen, Deanne M.; Moravec, Christine; Small, Eric M.; Abe, Junichi; Yan, Chen

    2016-01-01

    Cyclic nucleotide phosphodiesterase 1C (PDE1C) represents a major phosphodiesterase activity in human myocardium, but its function in the heart remains unknown. Using genetic and pharmacological approaches, we studied the expression, regulation, function, and underlying mechanisms of PDE1C in the pathogenesis of cardiac remodeling and dysfunction. PDE1C expression is up-regulated in mouse and human failing hearts and is highly expressed in cardiac myocytes but not in fibroblasts. In adult mouse cardiac myocytes, PDE1C deficiency or inhibition attenuated myocyte death and apoptosis, which was largely dependent on cyclic AMP/PKA and PI3K/AKT signaling. PDE1C deficiency also attenuated cardiac myocyte hypertrophy in a PKA-dependent manner. Conditioned medium taken from PDE1C-deficient cardiac myocytes attenuated TGF-β–stimulated cardiac fibroblast activation through a mechanism involving the crosstalk between cardiac myocytes and fibroblasts. In vivo, cardiac remodeling and dysfunction induced by transverse aortic constriction, including myocardial hypertrophy, apoptosis, cardiac fibrosis, and loss of contractile function, were significantly attenuated in PDE1C-knockout mice relative to wild-type mice. These results indicate that PDE1C activation plays a causative role in pathological cardiac remodeling and dysfunction. Given the continued development of highly specific PDE1 inhibitors and the high expression level of PDE1C in the human heart, our findings could have considerable therapeutic significance. PMID:27791092

  18. Genetics Home Reference: complete plasminogen activator inhibitor 1 deficiency

    Science.gov (United States)

    ... well studied in a large family belonging to the Old Order Amish population of eastern and southern Indiana. Additional cases in North ... Human plasminogen activator inhibitor-1 (PAI-1) deficiency: characterization of a large kindred with a null mutation in the PAI-1 gene. Blood. 1997 Jul 1;90( ...

  19. Effect of diethyldithiocarbamate (DDC) and ticlopidine on CYP1A2 activity and caffeine metabolism: an in vitro comparative study with human cDNA-expressed CYP1A2 and liver microsomes.

    Science.gov (United States)

    Kot, Marta; Daniel, Władysława A

    2009-01-01

    The aim of the present study was to test the effect of diethyldithiocarbamate (DDC), which is regarded as a cytochrome P450 (CYP) CYP2A6 and CYP2E1 inhibitor, and ticlopidine, an efficient CYP2B6, CYP2C19 and CYP2D6 inhibitor, on the activity of human CYP1A2 and the metabolism of caffeine (1-N-, 3-N- and 7-N-demethylation, and C-8-hydroxylation). The experiment was carried out in vitro using human cDNA-expressed CYP1A2 (Supersomes) and human pooled liver microsomes. The effects of DDC and ticlopidine were compared to those of furafylline (a strong CYP1A2 inhibitor). A comparative in vitro study provides clear evidence that ticlopidine and DDC, applied at concentrations that inhibit the above-mentioned CYP isoforms, potently (as compared to furafylline) inhibit human CYP1A2 and caffeine metabolism, in particular 1-N- and 3-N-demethylation.

  20. Socioeconomic status and impact of the economic crisis on dietary habits in Italy: results from the INHES study.

    Science.gov (United States)

    Bonaccio, Marialaura; Di Castelnuovo, Augusto; Bonanni, Americo; Costanzo, Simona; Persichillo, Mariarosaria; Cerletti, Chiara; Donati, Maria Benedetta; de Gaetano, Giovanni; Iacoviello, Licia

    2017-11-08

    There is lack of evidence about the likely impact of the economic crisis on dietary habits in Western societies. We aimed to assess dietary modifications that possibly occurred during the recession and to investigate major socioeconomic factors associated with such modifications. Cross-sectional analysis on 1829 subjects from the general population recruited in the larger INHES study (n = 9319) a telephone-based survey on nutrition and health conducted in Italy from 2010 to 2013. Association of socioeconomic (education, household income, occupation) with self-reported impact of the economic crisis on dietary habits was tested by multivariable logistic regression analysis. Low-educated subjects (OR = 2.30; 95% CI: 1.39-3.80), those with poor income (OR = 5.71; 95% CI: 3.68-8.85), and unemployed (OR = 3.93; 95% CI: 1.62-9.56) had higher odds of reporting undesirable dietary changes due to recession. Adherence to the Mediterranean diet was lower in subjects reporting a negative impact of the crisis on diet as compared to those declaring no effect, whereas the quality of grocery items was higher in the latter. Undesirable dietary changes due to the economic crisis were mainly reported by lower socioeconomic groups. Subjects perceiving a negative impact of the recession on their diet also showed a lower adherence to Mediterranean diet and reduced quality of grocery products. © The Author 2017. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  1. In Vitro Antiviral Activity and Resistance Profile Characterization of the Hepatitis C Virus NS5A Inhibitor Ledipasvir.

    Science.gov (United States)

    Cheng, Guofeng; Tian, Yang; Doehle, Brian; Peng, Betty; Corsa, Amoreena; Lee, Yu-Jen; Gong, Ruoyu; Yu, Mei; Han, Bin; Xu, Simin; Dvory-Sobol, Hadas; Perron, Michel; Xu, Yili; Mo, Hongmei; Pagratis, Nikos; Link, John O; Delaney, William

    2016-01-11

    Ledipasvir (LDV; GS-5885), a component of Harvoni (a fixed-dose combination of LDV with sofosbuvir [SOF]), is approved to treat chronic hepatitis C virus (HCV) infection. Here, we report key preclinical antiviral properties of LDV, including in vitro potency, in vitro resistance profile, and activity in combination with other anti-HCV agents. LDV has picomolar antiviral activity against genotype 1a and genotype 1b replicons with 50% effective concentration (EC50) values of 0.031 nM and 0.004 nM, respectively. LDV is also active against HCV genotypes 4a, 4d, 5a, and 6a with EC50 values of 0.11 to 1.1 nM. LDV has relatively less in vitro antiviral activity against genotypes 2a, 2b, 3a, and 6e, with EC50 values of 16 to 530 nM. In vitro resistance selection with LDV identified the single Y93H and Q30E resistance-associated variants (RAVs) in the NS5A gene; these RAVs were also observed in patients after a 3-day monotherapy treatment. In vitro antiviral combination studies indicate that LDV has additive to moderately synergistic antiviral activity when combined with other classes of HCV direct-acting antiviral (DAA) agents, including NS3/4A protease inhibitors and the nucleotide NS5B polymerase inhibitor SOF. Furthermore, LDV is active against known NS3 protease and NS5B polymerase inhibitor RAVs with EC50 values equivalent to those for the wild type. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. Covalent docking of selected boron-based serine beta-lactamase inhibitors

    Science.gov (United States)

    Sgrignani, Jacopo; Novati, Beatrice; Colombo, Giorgio; Grazioso, Giovanni

    2015-05-01

    AmpC β-lactamase is a hydrolytic enzyme conferring resistance to β-lactam antibiotics in multiple Gram-negative bacteria. Therefore, identification of non-β-lactam compounds able to inhibit the enzyme is crucial for the development of novel antibacterial therapies. In general, AmpC inhibitors have to engage the highly solvent-exposed catalytic site of the enzyme. Therefore, understanding the implications of ligand-protein induced-fit and water-mediated interactions behind the inhibitor-enzyme recognition process is fundamental for undertaking structure-based drug design process. Here, we focus on boronic acids, a promising class of beta-lactamase covalent inhibitors. First, we optimized a docking protocol able to reproduce the experimentally determined binding mode of AmpC inhibitors bearing a boronic group. This goal was pursued (1) performing rigid and flexible docking calculations aiming to establish the role of the side chain conformations; and (2) investigating the role of specific water molecules in shaping the enzyme active site and mediating ligand protein interactions. Our calculations showed that some water molecules, conserved in the majority of the considered X-ray structures, are needed to correctly predict the binding pose of known covalent AmpC inhibitors. On this basis, we formalized our findings in a docking and scoring protocol that could be useful for the structure-based design of new boronic acid AmpC inhibitors.

  3. PDGF-induced migration of synthetic vascular smooth muscle cells through c-Src-activated L-type Ca2+ channels with full-length CaV1.2 C-terminus.

    Science.gov (United States)

    Guo, Xiaoguang; Kashihara, Toshihide; Nakada, Tsutomu; Aoyama, Toshifumi; Yamada, Mitsuhiko

    2018-06-01

    In atherosclerosis, vascular smooth muscle cells (VSMC) migrate from the media toward the intima of the arteries in response to cytokines, such as platelet-derived growth factor (PDGF). However, molecular mechanism underlying the PDGF-induced migration of VSMCs remains unclear. The migration of rat aorta-derived synthetic VSMCs, A7r5, in response to PDGF was potently inhibited by a Ca V 1.2 channel inhibitor, nifedipine, and a Src family tyrosine kinase (SFK)/Abl inhibitor, bosutinib, in a less-than-additive manner. PDGF significantly increased Ca V 1.2 channel currents without altering Ca V 1.2 protein expression levels in A7r5 cells. This reaction was inhibited by C-terminal Src kinase, a selective inhibitor of SFKs. In contractile VSMCs, the C-terminus of Ca V 1.2 is proteolytically cleaved into proximal and distal C-termini (PCT and DCT, respectively). Clipped DCT is noncovalently reassociated with PCT to autoinhibit the channel activity. Conversely, in synthetic A7r5 cells, full-length Ca V 1.2 (Ca V 1.2FL) is expressed much more abundantly than truncated Ca V 1.2. In a heterologous expression system, c-Src activated Ca V 1.2 channels composed of Ca V 1.2FL but not truncated Ca V 1.2 (Ca V 1.2Δ1763) or Ca V 1.2Δ1763 plus clipped DCT. Further, c-Src enhanced the coupling efficiency between the voltage-sensing domain and activation gate of Ca V 1.2FL channels by phosphorylating Tyr1709 and Tyr1758 in PCT. Compared with Ca V 1.2Δ1763, c-Src could more efficiently bind to and phosphorylate Ca V 1.2FL irrespective of the presence or absence of clipped DCT. Therefore, in atherosclerotic lesions, phenotypic switching of VSMCs may facilitate pro-migratory effects of PDGF on VSMCs by suppressing posttranslational Ca V 1.2 modifications.

  4. [Mechanisms and efficacy of SGLT2 inhibitors].

    Science.gov (United States)

    Shiba, Teruo

    2015-03-01

    SGLT2 is a low affinity, high capacity glucose co-transporter, almost exclusively expressed in the kidney cortex. Inhibition of SGLT2 has been shown to increase the daily 50g or more urinary glucose excretion, as compared to placebo, leading to a reduction in blood glucose levels and indicated only for the treatment of type 2 diabetes. In Japan 6 species of SGLT2 inhibitors have already been sold and reported to results in a decrease of FPG by 14.4 to 45.8 (mg/dL), in a reduction of HbA1c by 0.35 to 1.24% and in loss of body weight by 1.29 to 2.50(kg). There is less effect of the SGLT2 inhibitor in diabetic subjects with renal impairment and the reduction in HbA1c and FPG will be approximately half of the average in those with 30 ≤ eGFR ≤ 59. The position of SGLT2 inhibitors would be considered as the drug administered in combination or add-on therapy when the young obese type 2 diabetics without renal impairment has not yet reached to the glycemic target with other drugs although in AACE consensus statement of 2013, it has been shelved for inexperienced use with respect to the positioning of the SGLT2 inhibitors.

  5. Changes in glucose-induced plasma active glucagon-like peptide-1 levels by co-administration of sodium–glucose cotransporter inhibitors with dipeptidyl peptidase-4 inhibitors in rodents

    Directory of Open Access Journals (Sweden)

    Takahiro Oguma

    2016-12-01

    Full Text Available We investigated whether structurally different sodium–glucose cotransporter (SGLT 2 inhibitors, when co-administered with dipeptidyl peptidase-4 (DPP4 inhibitors, could enhance glucagon-like peptide-1 (GLP-1 secretion during oral glucose tolerance tests (OGTTs in rodents. Three different SGLT inhibitors—1-(β-d-Glucopyranosyl-4-chloro-3-[5-(6-fluoro-2-pyridyl-2-thienylmethyl]benzene (GTB, TA-1887, and canagliflozin—were examined to assess the effect of chemical structure. Oral treatment with GTB plus a DPP4 inhibitor enhanced glucose-induced plasma active GLP-1 (aGLP-1 elevation and suppressed glucose excursions in both normal and diabetic rodents. In DPP4-deficient rats, GTB enhanced glucose-induced aGLP-1 elevation without affecting the basal level, whereas metformin, previously reported to enhance GLP-1 secretion, increased both the basal level and glucose-induced elevation. Oral treatment with canagliflozin and TA-1887 also enhanced glucose-induced aGLP-1 elevation when co-administered with either teneligliptin or sitagliptin. These data suggest that structurally different SGLT2 inhibitors enhance plasma aGLP-1 elevation and suppress glucose excursions during OGTT when co-administered with DPP4 inhibitors, regardless of the difference in chemical structure. Combination treatment with DPP4 inhibitors and SGLT2 inhibitors having moderate SGLT1 inhibitory activity may be a promising therapeutic option for improving glycemic control in patients with type 2 diabetes mellitus.

  6. Imidazopyridine- and purine-thioacetamide derivatives: potent inhibitors of nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1).

    Science.gov (United States)

    Chang, Lei; Lee, Sang-Yong; Leonczak, Piotr; Rozenski, Jef; De Jonghe, Steven; Hanck, Theodor; Müller, Christa E; Herdewijn, Piet

    2014-12-11

    Nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1) belongs to the family of ecto-nucleotidases, which control extracellular nucleotide, nucleoside, and (di)phosphate levels. To study the (patho)physiological roles of NPP1 potent and selective inhibitors with drug-like properties are required. Therefore, a compound library was screened for NPP1 inhibitors using a colorimetric assay with p-nitrophenyl 5'-thymidine monophosphate (p-Nph-5'-TMP) as an artificial substrate. This led to the discovery of 2-(3H-imidazo[4,5-b]pyridin-2-ylthio)-N-(3,4-dimethoxyphenyl)acetamide (5a) as a hit compound with a Ki value of 217 nM. Subsequent structure-activity relationship studies led to the development of purine and imidazo[4,5-b]pyridine analogues with high inhibitory potency (Ki values of 5.00 nM and 29.6 nM, respectively) when assayed with p-Nph-5'-TMP as a substrate. Surprisingly, the compounds were significantly less potent when tested versus ATP as a substrate, with Ki values in the low micromolar range. A prototypic inhibitor was investigated for its mechanism of inhibition and found to be competitive versus both substrates.

  7. Disposition and metabolism of [(14)C] Sacubitril/Valsartan (formerly LCZ696) an angiotensin receptor neprilysin inhibitor, in healthy subjects.

    Science.gov (United States)

    Flarakos, Jimmy; Du, Yancy; Bedman, Timothy; Al-Share, Qusai; Jordaan, Pierre; Chandra, Priya; Albrecht, Diego; Wang, Lai; Gu, Helen; Einolf, Heidi J; Huskey, Su-Er; Mangold, James B

    2016-11-01

    1. Sacubitril/valsartan (LCZ696) is an angiotensin receptor neprilysin inhibitor (ARNI) providing simultaneous inhibition of neprilysin (neutral endopeptidase 24.11; NEP) and blockade of the angiotensin II type-1 (AT1) receptor. 2. Following oral administration, [(14)C]LCZ696 delivers systemic exposure to valsartan and AHU377 (sacubitril), which is rapidly metabolized to LBQ657 (M1), the biologically active neprilysin inhibitor. Peak sacubitril plasma concentrations were reached within 0.5-1 h. The mean terminal half-lives of sacubitril, LBQ657 and valsartan were ∼1.3, ∼12 and ∼21 h, respectively. 3. Renal excretion was the dominant route of elimination of radioactivity in human. Urine accounted for 51.7-67.8% and feces for 36.9 to 48.3 % of the total radioactivity. The majority of the drug was excreted as the active metabolite LBQ657 in urine and feces, total accounting for ∼85.5% of the total dose. 4. Based upon in vitro studies, the potential for LCZ696 to inhibit or induce cytochrome P450 (CYP) enzymes and cause CYP-mediated drug interactions clinically was found to be low.

  8. Preparation and biological evaluation of conformationally constrained BACE1 inhibitors.

    Science.gov (United States)

    Winneroski, Leonard L; Schiffler, Matthew A; Erickson, Jon A; May, Patrick C; Monk, Scott A; Timm, David E; Audia, James E; Beck, James P; Boggs, Leonard N; Borders, Anthony R; Boyer, Robert D; Brier, Richard A; Hudziak, Kevin J; Klimkowski, Valentine J; Garcia Losada, Pablo; Mathes, Brian M; Stout, Stephanie L; Watson, Brian M; Mergott, Dustin J

    2015-07-01

    The BACE1 enzyme is a key target for Alzheimer's disease. During our BACE1 research efforts, fragment screening revealed that bicyclic thiazine 3 had low millimolar activity against BACE1. Analysis of the co-crystal structure of 3 suggested that potency could be increased through extension toward the S3 pocket and through conformational constraint of the thiazine core. Pursuit of S3-binding groups produced low micromolar inhibitor 6, which informed the S3-design for constrained analogs 7 and 8, themselves prepared via independent, multi-step synthetic routes. Biological characterization of BACE inhibitors 6-8 is described. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-07-01

    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  10. Synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid vinyl-ACCA) derivatives: key intermediates for the preparation of inhibitors of the hepatitis C virus NS3 protease.

    Science.gov (United States)

    Beaulieu, Pierre L; Gillard, James; Bailey, Murray D; Boucher, Colette; Duceppe, Jean-Simon; Simoneau, Bruno; Wang, Xiao-Jun; Zhang, Li; Grozinger, Karl; Houpis, Ioannis; Farina, Vittorio; Heimroth, Heidi; Krueger, Thomas; Schnaubelt, Jürgen

    2005-07-22

    (1R,2S)-1-Amino-2-vinylcyclopropanecarboxylic acid (vinyl-ACCA) is a key building block in the synthesis of potent inhibitors of the hepatitis C virus NS3 protease such as BILN 2061, which was recently shown to dramatically reduce viral load after administration to patients infected with HCV genotype 1. We have developed a scalable process that delivers derivatives of this unusual amino acid in >99% ee. The strategy was based on the dialkylation of a glycine Schiff base using trans-1,4-dibromo-2-butene as an electrophile to produce racemic vinyl-ACCA, which was subsequently resolved using a readily available, inexpensive esterase enzyme (Alcalase 2.4L). Factors that affect diastereoselection in the initial dialkylation steps were examined and the conditions optimized to deliver the desired diastereomer selectively. Product inhibition, which was encountered during the enzymatic resolution step, initially resulted in prolonged cycle times. Enrichment of racemic vinyl-ACCA through a chemical resolution via diastereomeric salt formation or the use of forcing conditions in the enzymatic reaction both led to improvements in throughput and the development of a viable process. The chemistry described herein was scaled up to produce multikilogram quantities of this building block.

  11. Effects and Mechanisms of Checkpoint Inhibitors (CTLA-4, PD-1 and PD-L1 Inhibitors as New Immunotherapeutic Agents for Bladder Cancer

    Directory of Open Access Journals (Sweden)

    Serdar Çelik

    2018-04-01

    Full Text Available Since intravesical Bacillus Calmette-Guerin (BCG began to be used for bladder cancer, our understanding of the importance of immune mechanisms in bladder cancer has steadily grown. With developments in immunotherapy in recent years, the use of new immunotherapeutic agents for bladder cancer, especially chemotherapy-resistant invasive and metastatic cancers, has opened the way for research in this area. Of these new therapeutic agents, this article reviews studies published on PubMed or listed on the ClinicalTrials.gov website as of December 2017 regarding the effects and mechanisms of action of checkpoint inhibitors [cytotoxic t-lymphocyte associated protein-4, programmed cell death 1 receptor (PD-1 and PD-1 ligand inhibitors] on bladder cancer. Because checkpoint inhibitors were first used for chemotherapy-resistant bladder cancer after identification of positive expression in tumor cells and especially in tumor-infiltrating mononuclear cells, significant objective response rates and survival advantages have been reported. Research continues regarding the use of these agents as first- and second-line treatment for metastatic disease in combination with chemotherapy; their efficacy in neoadjuvant, adjuvant, and bladder-preserving approaches to muscle-invasive bladder cancer (MIBC disease, and their use in non-muscle-invasize bladder cancer (NMIBC, especially BCG-refractory disease. Depending on the results of these ongoing studies, immunotherapy may direct the treatment of bladder cancer in the future.

  12. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib

    OpenAIRE

    Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler Jr, Richard E.; Lalani, Alshad S.; Dent, Paul

    2017-01-01

    ABSTRACT The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-de