Chemical synthesis and characterization of magnesium substituted amorphous calcium phosphate (MG-ACP)

Energy Technology Data Exchange (ETDEWEB)

Lee, Donghyun [Department of Biomedical Engineering, Chung-Ang University, 221 Heukseok-Dong, Dongjak-Gu, Seoul 156-756 (Korea, Republic of); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Mechanical Engineering and Materials Sceince, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Chemical and Petroleum Engineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States)

2010-10-12

Amorphous calcium phosphate (ACP) was synthesized by a simple aqueous precipitation using CaCl{sub 2} and Na{sub 3}PO{sub 4} in the presence of MgCl{sub 2} to ensure the formation of the ACP phase at room temperature. Magnesium substituted ACP phases corresponding to two different compositions representing the two most prominent calcium phosphate phases (hydroxyapatite: Ca + Mg/P = 1.67 and tricalcium phosphate: Ca + Mg/P = 1.5) were synthesized by this simple approach. Both compositions of ACP phases resulted in their transformation into {beta}-tricalcium phosphate upon heat treatment in air at 600 deg. C. X-ray diffraction (XRD), heat treatment, scanning electron microscopy (SEM), Fourier transform infrared (FT-IR) and Brunauer-Emmett-Teller (BET) analyses were used to characterize the phase, thermal stability, surface area, and morphology of the synthesized ACP powders corresponding to the two different nominal Ca/P compositions. Although it is known that {alpha}-TCP is the phase that appears upon heat treatment at 600 deg. C unsubstituted ACP, substitution of magnesium ion in ACP (both TCP and HA composition) stabilized the structure of {beta}-TCMP phase at 600 deg. C. Moreover, FT-IR analysis revealed that the ACP phase regardless of the composition, exhibited characteristic bands corresponding to that of HA, with the exception of the ACP corresponding to HA composition which exhibited a prominent OH vibrational mode.

Safety features and licensing of CNNC-ACP100

Energy Technology Data Exchange (ETDEWEB)

Zhong, F., E-mail: Zhongfj2000@163.com [Nuclear Power Inst. of China, National Key Lab. of Science and Technology on Reactor System Design Technology (China)

2014-07-01

ACP100 is an innovatory modular pressurized water reactor, the engineering safety systems fully adopt passive safety design technology. Its inherent safety and passive features/systems are verified via testing facilities and are highlighted at certain levels of defence in depth. The licensing of ACP 100 is within current LWR framework and meets up-to-date codes and requirements in nuclear safety. (author)

Only Acyl Carrier Protein 1 (AcpP1 Functions in Pseudomonas aeruginosa Fatty Acid Synthesis

Directory of Open Access Journals (Sweden)

Jin-Cheng Ma

2017-11-01

Full Text Available The genome of Pseudomonas aeruginosa contains three open reading frames, PA2966, PA1869, and PA3334, which encode putative acyl carrier proteins, AcpP1, AcpP2, and AcpP3, respectively. In this study, we found that, although these apo-ACPs were successfully phosphopantetheinylated by P. aeruginosa phosphopantetheinyl transferase (PcpS and all holo-forms of these proteins could be acylated by Vibrio harveyi acyl-ACP synthetase (AasS, only AcpP1 could be used as a substrate for the synthesis of fatty acids, catalyzed by P. aeruginosa cell free extracts in vitro, and only acpP1 gene could restore growth in the Escherichia coliacpP mutant strain CY1877. And P. aeruginosaacpP1 could not be deleted, while disruption of acpP2 or acpP3 in the P. aeruginosa genome allowed mutant strains to grow as well as the wild type strain. These findings confirmed that only P. aeruginosa AcpP1 functions in fatty acid biosynthesis, and that acpP2 and acpP3 do not play roles in the fatty acid synthetic pathway. Moreover, disruption of acpP2 and acpP3 did not affect the ability of P. aeruginosa to produce N-acylhomoserine lactones (AHL, but replacement of P. aeruginosaacpP1 with E. coliacpP caused P. aeruginosa to reduce the production of AHL molecules, which indicated that neither P. aeruginosa AcpP2 nor AcpP3 can act as a substrate for synthesis of AHL molecules in vivo. Furthermore, replacement of acpP1 with E. coliacpP reduced the ability of P. aeruginosa to produce some exo-products and abolished swarming motility in P. aeruginosa.

Design Report for ACP Hot Cell Rear Door

Energy Technology Data Exchange (ETDEWEB)

Ku, J. H.; Kwon, K. C.; Choung, W. M.; Cho, I. J.; Kook, D. H.; Lee, W. K.; You, G. S.; Lee, E. P.; Park, S. W

2005-12-15

A hot-cell facility was constructed at the IMEF building for the demonstrate ACP process. ACP hot-cell consists of process cell and maintenance cell, and each cell has rear door. Since this facility was constructed at basement floor, all process materials, equipment and radioactive materials are take in and out through the rear door. Also, this door can be an access route of workers for the maintenance works. Therefore ACP hot-cell rear doors must maintain the radiation shielding, sealing, mechanical and structural safety. This report presents design criteria, design contents of each part and driving part. It was confirmed that the rear doors sufficiently maintain the safety through the structural analysis and shielding analysis. Also, it was confirmed that the rear doors were constructed as designed by the gamma scanning test after the installation.

Design Report for ACP Hot Cell Rear Door

International Nuclear Information System (INIS)

Ku, J. H.; Kwon, K. C.; Choung, W. M.; Cho, I. J.; Kook, D. H.; Lee, W. K.; You, G. S.; Lee, E. P.; Park, S. W.

2005-12-01

A hot-cell facility was constructed at the IMEF building for the demonstrate ACP process. ACP hot-cell consists of process cell and maintenance cell, and each cell has rear door. Since this facility was constructed at basement floor, all process materials, equipment and radioactive materials are take in and out through the rear door. Also, this door can be an access route of workers for the maintenance works. Therefore ACP hot-cell rear doors must maintain the radiation shielding, sealing, mechanical and structural safety. This report presents design criteria, design contents of each part and driving part. It was confirmed that the rear doors sufficiently maintain the safety through the structural analysis and shielding analysis. Also, it was confirmed that the rear doors were constructed as designed by the gamma scanning test after the installation

Design-reliability assurance program application to ACP600

International Nuclear Information System (INIS)

Zhichao, Huang; Bo, Zhao

2012-01-01

ACP600 is a newly nuclear power plant technology made by CNNC in China and it is based on the Generation III NPPs design experience and general safety goals. The ACP600 Design Reliability Assurance Program (D-RAP) is implemented as an integral part of the ACP600 design process. A RAP is a formal management system which assures the collection of important characteristic information about plant performance throughout each phase of its life and directs the use of this information in the implementation of analytical and management process which are specifically designed to meet two specific objects: confirm the plant goals and cost effective improvements. In general, typical reliability assurance program have 4 broad functional elements: 1) Goals and performance criteria; 2) Management system and implementing procedures; 3) Analytical tools and investigative methods; and 4) Information management. In this paper we will use the D-RAP technical and Risk-Informed requirements, and establish the RAM and PSA model to optimize the ACP600 design. Compared with previous design process, the D-RAP is more competent for the higher design targets and requirements, enjoying more creativity through an easier implementation of technical breakthroughs. By using D-RAP, the plants goals, system goals, performance criteria and safety criteria can be easier to realize, and the design can be optimized and more rational

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

Miopatia por deficiência de succinato-citocromo-C-redutase: possível defeito no complexo II da cadeia respiratória

Directory of Open Access Journals (Sweden)

Lineu Cesar Werneck

1989-12-01

Full Text Available Relato do caso de mulher de 24 anos de idade que apresentava astenia desde a puberdade, com agravamento nos últimos anos, cuja biópsia muscular revelou grande acúmulo de mitocôndrias. As dosagens dos enzimas mitocondriais mostrou importante redução da succinato-citocromo-C-redutase, sugerindo defeito na cadeia respiratória a nível do complexo II. Medicada com altas doses de vitamina C e K, melhorou da força muscular. São feitas considerações a respeito das principais síndromes com miopatias mitocondriais, bem como a respeito dos métodos de investigação em defeitos da cadeia respiratória.

LHCb : Measuring $CP$ violation with $\\Delta A_{CP}$ at LHCb

CERN Multimedia

Pearce, A

2014-01-01

Measurements are presented of direct $CP$ violation in $D^{0}$ meson decays in LHCb, using the $\\Delta A_{CP}$ technique, and a proposal is outlined to make similar measurements in the decays of the charmed baryon $\\Lambda_{c}^{+}$. The motivations for use of the $\\Delta A_{CP}$ method are discussed, along with the current results and future prospects.

Inhibition of AcpA phosphatase activity with ascorbate attenuates Francisella tularensis intramacrophage survival.

Science.gov (United States)

McRae, Steven; Pagliai, Fernando A; Mohapatra, Nrusingh P; Gener, Alejandro; Mahmou, Asma Sayed Abdelgeliel; Gunn, John S; Lorca, Graciela L; Gonzalez, Claudio F

2010-02-19

Acid phosphatase activity in the highly infectious intracellular pathogen Francisella tularensis is directly related with the ability of these bacteria to survive inside host cells. Pharmacological inactivation of acid phosphatases could potentially help in the treatment of tularemia or even be utilized to neutralize the infection. In the present work, we report inhibitory compounds for three of the four major acid phosphatases produced by F. tularensis SCHU4: AcpA, AcpB, and AcpC. The inhibitors were identified using a catalytic screen from a library of chemicals approved for use in humans. The best results were obtained against AcpA. The two compounds identified, ascorbate (K(i) = 380 +/- 160 microM) and 2-phosphoascorbate (K(i) = 3.2 +/- 0.85 microM) inhibit AcpA in a noncompetitive, nonreversible fashion. A potential ascorbylation site in the proximity of the catalytic pocket of AcpA was identified using site-directed mutagenesis. The effects of the inhibitors identified in vitro were evaluated using bioassays determining the ability of F. tularensis to survive inside infected cells. The presence of ascorbate or 2-phosphoascorbate impaired the intramacrophage survival of F. tularensis in an AcpA-dependent manner as it was probed using knockout strains. The evidence presented herein indicated that ascorbate could be a good alternative to be used clinically to improve treatments against tularemia.

In situ effect of CPP-ACP chewing gum upon erosive enamel loss

Directory of Open Access Journals (Sweden)

Catarina Ribeiro Barros de ALENCAR

Full Text Available Abstract Casein phosphopeptide-amorphous calcium phosphate (CPP-ACP is able to increase salivary calcium and phosphate levels at an acidic pH. Previous studies demonstrated that a CPP-ACP chewing gum was able to enhance the re-hardening of erosion lesions, but could not diminish enamel hardness loss. Therefore, there is no consensus regarding the effectiveness of CPP-ACP on dental erosion. Objective This in situ study investigated the ability of a CPP-ACP chewing gum in preventing erosive enamel loss. Material and Methods: During three experimental crossover phases (one phase per group of seven days each, eight volunteers wore palatal devices with human enamel blocks. The groups were: GI – Sugar free chewing gum with CPP-ACP; GII – Conventional sugar free chewing gum; and GIII – No chewing gum (control. Erosive challenge was extraorally performed by immersion of the enamel blocks in cola drink (5 min, 4x/day. After each challenge, in groups CPP and No CPP, volunteers chewed one unit of the corresponding chewing gum for 30 minutes. Quantitative analysis of enamel loss was performed by profilometry (µm. Data were analyzed by Repeated-Measures ANOVA and Tukey’s test (p0.05. Conclusion The CPP-ACP chewing gum was not able to enhance the anti-erosive effect of conventional chewing gum against enamel loss.

Virtual analysis of the remote operation of the ACP

International Nuclear Information System (INIS)

Yoon, Ji Sup; Kim, Sung Hyun; Song, Tai Gil; Lim, Kwang Mook

2005-01-01

The remote operation of the Advanced Spent Fuel Conditioning Process (ACP) is analyzed by using the 3D graphic simulation tools. The ACP equipment operates in intense radiation fields as well as in a high temperature. Thus, the equipment should be designed in consideration of the remote handling and maintenance. As well as suitable remote handling and maintenance method needs to be provided. To provide such remote operation technology, we developed the graphic simulator which provides the capability of verifying the remote operability of the ACP without fabrication of the process equipment. In other words, by applying virtual reality to the remote maintenance operation, a remote operation task can be simulated in a computer, not in a real environment. In this way the graphic simulator and substantially reduce the design cost of the remote operation process and the equipment. Also it can provide new operation concept that is more reliable, easier to implement, and easier to understand

The physical properties and ion release of CPP-ACP-modified calcium silicate-based cements.

Science.gov (United States)

Dawood, A E; Manton, D J; Parashos, P; Wong, Rhk; Palamara, Jea; Stanton, D P; Reynolds, E C

2015-12-01

This study investigated the physical properties and ion release of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP)-modified calcium silicate-based cements (CSCs) and compared the properties of a trial mineral trioxide aggregate (MTA) with two commercially available CSCs, Biodentine(™) and Angelus(®) MTA. The setting time, solubility, compressive strength and Vickers surface microhardness of the three CSCs incorporated with 0%, 0.5%, 1.0%, 2.0% and 3.0% (w/w) CPP-ACP were investigated. Release of calcium (Ca(2+) ), phosphate ions (Pi ) and pH of the test cements were measured after 24, 72, 168 and 336 h of storage. The addition of up to 1.0% CPP-ACP into Biodentine(™) and 0.5% into the other cements did not adversely affect their physical properties except for the setting time. The addition of 0.5% CPP-ACP increased Ca(2+) released from Biodentine(™) (after 168 and 336 h), Angelus(®) MTA (after 168 h) and the trial MTA (after 72 h). The addition of 1.0-3.0% CPP-ACP increased Ca(2+) and Pi released from all the cements. Biodentine(™) released more Ca(2+) particularly in the early stages and showed shorter setting time and higher mechanical properties than the other cements. The mechanical properties of Angelus(®) MTA and the trial MTA were similar. All the cements produced highly alkaline storage solutions. Up to 1.0% CPP-ACP in Biodentine(™) improves Ca(2+) and Pi release and 0.5% CPP-ACP in Angelus(®) MTA and the trial MTA improves Ca(2+) release without altering the mechanical properties and solubility. The addition of CPP-ACP into CSCs prolonged the setting time. © 2015 Australian Dental Association.

Acalabrutinib (ACP-196: a selective second-generation BTK inhibitor

Directory of Open Access Journals (Sweden)

Jingjing Wu

2016-03-01

Full Text Available Abstract More and more targeted agents become available for B cell malignancies with increasing precision and potency. The first-in-class Bruton’s tyrosine kinase (BTK inhibitor, ibrutinib, has been in clinical use for the treatment of chronic lymphocytic leukemia, mantle cell lymphoma, and Waldenstrom’s macroglobulinemia. More selective BTK inhibitors (ACP-196, ONO/GS-4059, BGB-3111, CC-292 are being explored. Acalabrutinib (ACP-196 is a novel irreversible second-generation BTK inhibitor that was shown to be more potent and selective than ibrutinib. This review summarized the preclinical research and clinical data of acalabrutinib.

Radiation dose assessment of ACP hot cell in accident

International Nuclear Information System (INIS)

Kook, D. H.; Jeong, W. M.; Koo, J. H.; Jeo, I. J.; Lee, E. P.; Ryu, K. S.

2003-01-01

The Advanced spent fuel Condition in Process(ACP) is under development for the effective management of spent fuel which had been generated in nuclear plants. The ACP needs a hot cell where most operations will be performed. To give priority to the environments safety, radiation doses evaluations for the radioactive nuclides in accident cases were preliminarily performed with the meteorological data around facility site. Fire accident prevails over several accidnets. Internal Dose and External Dose evaluation according to short dispersion data for that case show a safe margin for regulation limits and SAR limit of IMEF where this facility will be constructed

Methylenetetrahydrofolate reductase gene polymorphism is not related to the risk of ischemic cerebrovascular disease in a Brazilian population Polimorfismo no gene de metilenetetrahidrofolato redutase não está relacionado com o risco de doença cerebrovascular isquêmica em uma população brasileira

Directory of Open Access Journals (Sweden)

Samuel Katsuyuki Shinjo

2007-01-01

Full Text Available PURPOSE: Data are conflicting concerning the risk for ischemic stroke associated with a common polymorphism in the gene encoding 5,10-methylenetetrahydrofolate reductase C677T, which predisposes carriers to hyperhomocysteinemia. A meta-analysis study suggested that the 5,10-methylenetetrahydrofolate reductase 677TT genotype might have a small influence in determining susceptibility to ischemic stroke. METHODS: We analyzed the 5,10-methylenetetrahydrofolate reductase 677TT genotype polymorphism in Brazilian subjects with ischemic stroke, using a case-control design. RESULTS: We compared 5,10-methylenetetrahydrofolate reductase genotypes in groups of subjects presenting ischemic stroke (n = 127 and normal control (n = 126 and found an odds ratio of 1.97 (95% CI, 0.84-4.64 in a multivariate analysis in which results were adjusted to baseline clinical characteristics of study participants. CONCLUSION: We found that the homozygous 5,10-methylenetetrahydrofolate reductase C677T genotype was not a risk factor for ischemic stroke in these Brazilian subjects.OBJETIVO: Os dados são conflitantes em relação a risco de acidente cerebrovascular associado a polimorfismo do gene 5,10-metilenetetrahidrofolato redutase C677T, o qual predispõe a hiperhomocisteinemia. Um estudo de meta-análise sugere que o genotipo 5,10-metilenetetrahidrofolato redutase 677TT poderia ter uma pequena influência em determinar susceptibilidade a acidente cerebrovascular. MÉTODOS: Analisamos este polimorfismo em indivíduos brasileiros com acidente cerebrovascular isquêmico, baseando-se em um estudo de caso-controle. RESULTADOS: Comparamos os genótipos 5,10-metilenetetrahidrofolato redutase em grupos de indivíduos com acidente cerebrovascular isquêmico (n=127 e controle normal (n=126, e encontramos Odds Ratio de 1,97 (IC 95% 0,84 - 4,64 em uma análise multivariada, na qual os resultados foram ajustados a características clínicas basais dos indivíduos estudados. DISCUSS�

Effect of CPP/ACP on Initial Bioadhesion to Enamel and Dentin In Situ

Directory of Open Access Journals (Sweden)

Susann Grychtol

2014-01-01

Full Text Available The present in situ study investigated the influence of a preparation containing CPP/ACP (caseinphosphopeptide-amorphous calcium phosphate (GC Tooth mousse on initial bacterial colonization of enamel and dentin. Therefore, pellicle formation was performed in situ on bovine enamel and dentin specimens fixed to individual upper jaw splints worn by 8 subjects. After 1 min of pellicle formation GC Tooth mousse was used according to manufacturer’s recommendations. Rinses with chlorhexidine served as positive controls. Specimens carried without any rinse served as negative controls. After 8 h overnight exposure of the splints, bacterial colonization was quantified by fluorescence microscopy (DAPI and BacLight live/dead staining. Additionally, the colony forming units (CFU were determined after desorption. Furthermore, the effects on Streptococcus mutans bacteria were tested in vitro (BacLight. There was no significant impact of CPP/ACP on initial bacterial colonization proved with DAPI and BacLight. Determination of CFU showed statistical significance for CPP/ACP to reduce bacterial adherence on enamel. The in vitro investigation indicated no antimicrobial effects for CPP/ACP on Streptococcus mutans suspension. Under the chosen conditions, CPP/ACP (GC Tooth mousse had no significant impact on initial biofilm formation on dental hard tissues. The tested preparation cannot be recommended for biofilm management.

Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability

OpenAIRE

Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.

2017-01-01

Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...

Preliminary calibration of the ACP safeguards neutron counter

Science.gov (United States)

Lee, T. H.; Kim, H. D.; Yoon, J. S.; Lee, S. Y.; Swinhoe, M.; Menlove, H. O.

2007-10-01

The Advanced Spent Fuel Conditioning Process (ACP), a kind of pyroprocess, has been developed at the Korea Atomic Energy Research Institute (KAERI). Since there is no IAEA safeguards criteria for this process, KAERI has developed a neutron coincidence counter to make it possible to perform a material control and accounting (MC&A) for its ACP materials for the purpose of a transparency in the peaceful uses of nuclear materials at KAERI. The test results of the ACP Safeguards Neutron Counter (ASNC) show a satisfactory performance for the Doubles count measurement with a low measurement error for its cylindrical sample cavity. The neutron detection efficiency is about 21% with an error of ±1.32% along the axial direction of the cavity. Using two 252Cf neutron sources, we obtained various parameters for the Singles and Doubles rates for the ASNC. The Singles, Doubles, and Triples rates for a 252Cf point source were obtained by using the MCNPX code and the results for the ft8 cap multiplicity tally option with the values of ɛ, fd, and ft measured with a strong source most closely match the measurement results to within a 1% error. A preliminary calibration curve for the ASNC was generated by using the point model equation relationship between 244Cm and 252Cf and the calibration coefficient for the non-multiplying sample is 2.78×10 5 (Doubles counts/s/g 244Cm). The preliminary calibration curves for the ACP samples were also obtained by using an MCNPX simulation. A neutron multiplication influence on an increase of the Doubles rate for a metal ingot and UO2 powder is clearly observed. These calibration curves will be modified and complemented, when hot calibration samples become available. To verify the validity of this calibration curve, a measurement of spent fuel standards for a known 244Cm mass will be performed in the near future.

The effect of CPP-ACP containing fluoride on Streptococcus mutans adhesion and enamel roughness

Directory of Open Access Journals (Sweden)

Yulita Kristanti

2013-12-01

Full Text Available Background: Direct contact between the bleaching agent and the enamel surface results in demineralization, alteration in surface roughness and bacterial adhesion. Many studies try to minimize this side effect through different way. Purpose: The aim of this study was to determined the effect of Calcium Phospho Peptide-Amorphous Calcium Phosphate (CPP-ACP containing fluoride application before and after bleaching procedure on the adhesion of S. Mutans and enamel roughness. Methods: The samples were 6 teeth which were divided into 4 groups, and each tooth was cut into four pieces. Group A and C were treated with CPP-ACP after bleaching, while group B and D were treated with CPP-ACP before and after bleaching. CPP-ACP used in group C and D was the one that contain fluoride. After treatment, all samples were sterilized, immersed in steril human saliva for one hour, then immersed into S. mutans suspension of 108 CFU. Samples were incubated overnight. On the next day the samples were put into steril BHI and vortexed for one minute to detach the bacteria. Fifteen ml BHI containing bacteria was poured into TYS agar then incubated 37°Cfor 48 hours. Bacterial colony was counted with colony counter. The SEM examination was done on all samples. Results: Application of desensitizing agent reduced the S.mutans adhesion significantly among groups (p<0.05 except between group A and C. SEM evaluation revealed significant differences among groups. Conclusion: The application of CPP-ACP containing fluoride before and after bleaching was effective to reduce the accumulation of S.mutans colony and enamel roughness.Latar belakang: Kontak langsung antara bahan bleaching dan permukaan enamel menyebabkan demineralisasi, perubahan kekasaran permukaan dan berpengaruh terhadap banyaknya bakteri Streptococcus mutans (S. mutans yang melekat. Banyak peneliti mencoba meminimalkan efek samping ini dengan cara yang beragam. Tujuan: Penelitian ini bertujuan untuk meneliti efek

Dimethylformamide as a cryoprotectant for canine semen diluted and frozen in ACP-106C.

Science.gov (United States)

Mota Filho, A C; Teles, C H A; Jucá, R P; Cardoso, J F S; Uchoa, D C; Campello, C C; Silva, A R; Silva, L D M

2011-10-15

The objective was to assess the effect of adding various concentrations of dimethylformamide on characteristics of canine semen diluted in powdered coconut water (ACP-106C; ACP Biotecnologia, Fortaleza, CE, Brazil) and frozen at -196°C. Fifteen ejaculates were collected by manual stimulation from five adult Boxer dogs. The sperm-rich fraction was diluted in ACP-106C (ACP Biotecnologia) containing 10% egg yolk and divided into four aliquots. The cryoprotectants used for each aliquot were 6% glycerol (control group; CG) or 2%, 4%, or 6% dimethylformamide (DF2, DF4, and DF6, respectively). After thawing, total motility (mean ± SEM) for CG (58.4 ± 24.6) was higher (P Biotecnologia) and 10% egg yolk as a diluent, yielded unsatisfactory in vitro results for freezing canine semen. Copyright © 2011 Elsevier Inc. All rights reserved.

Acyl carrier proteins from sunflower (Helianthus annuus L.) seeds and their influence on FatA and FatB acyl-ACP thioesterase activities.

Science.gov (United States)

Aznar-Moreno, Jose A; Venegas-Calerón, Mónica; Martínez-Force, Enrique; Garcés, Rafael; Salas, Joaquín J

2016-08-01

The kinetics of acyl-ACP thioesterases from sunflower importantly changed when endogenous ACPs were used. Sunflower FatB was much more specific towards saturated acyl-ACPs when assayed with them. Acyl carrier proteins (ACPs) are small (~9 kDa), soluble, acidic proteins involved in fatty acid synthesis in plants and bacteria. ACPs bind to fatty acids through a thioester bond, generating the acyl-ACP lipoproteins that are substrates for fatty acid synthase (FAS) complexes, and that are required for fatty acid chain elongation, acting as important intermediates in de novo fatty acid synthesis in plants. Plants, usually express several ACP isoforms with distinct functionalities. We report here the cloning of three ACPs from developing sunflower seeds: HaACP1, HaACP2, and HaACP3. These proteins were plastidial ACPs expressed strongly in seeds, and as such they are probably involved in the synthesis of sunflower oil. The recombinant sunflower ACPs were expressed in bacteria but they were lethal to the prokaryote host. Thus, they were finally produced using the GST gene fusion system, which allowed the apo-enzyme to be produced and later activated to the holo form. Radiolabelled acyl-ACPs from the newly cloned holo-ACP forms were also synthesized and used to characterize the activity of recombinant sunflower FatA and FatB thioesterases, important enzymes in plant fatty acids synthesis. The activity of these enzymes changed significantly when the endogenous ACPs were used. Thus, FatA importantly increased its activity levels, whereas FatB displayed a different specificity profile, with much high activity levels towards saturated acyl-CoA derivatives. All these data pointed to an important influence of the ACP moieties on the activity of enzymes involved in lipid synthesis.

Correlations of mutations in katG, oxyR-ahpC and inhA genes and in vitro susceptibility in Mycobacterium tuberculosis clinical strains segregated by spoligotype families from tuberculosis prevalent countries in South America

Directory of Open Access Journals (Sweden)

Suffys Philip N

2009-02-01

Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.

Mutações no gene da metilenotetrahidrofolato redutase e síndrome de Down

Directory of Open Access Journals (Sweden)

Laura Brunelli das Neves Grillo

2002-12-01

Full Text Available Sindrome de Down (SD é uma alteração genética e metabólica complexa atribuída à presença de três cópias do cromossomo 21. O cromossomo extra em 93% dos casos é de origem materna e é resultante de uma segregação anormal durante a meiose (não-disjunção. Com exceção da idade materna avançada, fatores de risco para a não-disjunção meiótica não estão bem estabelecidos. Um estudo preliminar sugeriu que o metabolismo anormal do folato e a mutação 677 (C->T no gene da metilenotetrahidrofolato redutase (MTHFR podem ser fatores de risco maternos para a SD. A freqüência das mutações MTHFR 677 (C->T e 1.298 (A->C foram avaliadas em 36 mães de crianças com SD e em 200 indivíduos-controle. Os resultados demonstraram que as mutações 677 (C->T e 1.298 (A->C são mais prevalentes entre mães de crianças com SD do que nos controles. A heterozigose das duas mutações foi a combinação mais freqüente. O resultado desse estudo inicial sugere que mutações no gene da MTHFR seriam um fator de risco para a SD.

Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii

NARCIS (Netherlands)

Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.

2017-01-01

In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.

Measuring $CP$ violation with $\\Delta A_{CP}$ at LHCb

CERN Document Server

Pearce, Alex

2014-01-01

The control of systematic uncertainties is a key component of many analyses performed at the Large Hadron Collider, and will only become more important as more data are taken during Run II. Many of the CP measurements performed using the LHCb detector have statistical precisions below the per cent level, and so particular care must be taken in this area. One technique for dealing with the various production and detection asymmetries which can mask the physics asymmetry of interest, and increase the measurement’s systematic uncertainty, is $\\Delta A_{CP}$ . The application of $\\Delta A_{CP}$ in three separate LHCb analyses of $D^{0}$ and $\\Lambda_{b}^{0}$ decays will be discussed, along with prospects for applying the technique to $\\Lambda_{c}^{+}$ decays.

Recovery and cryopreservation of epididymal sperm from agouti (Dasiprocta aguti) using powdered coconut water (ACP-109c) and Tris extenders.

Science.gov (United States)

Silva, M A; Peixoto, G C X; Santos, E A A; Castelo, T S; Oliveira, M F; Silva, A R

2011-10-01

The objective was to compare the use of powdered coconut water (ACP-109c; ACP Biotecnologia, Fortaleza, CE, Brazil) and Tris extenders for recovery and cryopreservation of epididymal sperm from agouti. The caudae epididymus and proximal ductus deferens from 10 sexually mature agoutis were subjected to retrograde washing using ACP-109c (ACP Biotecnologia) or Tris. Epididymal sperm were evaluated for motility, vigor, sperm viability, membrane integrity, and morphology. Samples were centrifuged, and extended in the same diluents plus egg yolk (20%) and glycerol (6%), frozen in liquid nitrogen, and subsequently thawed at 37°C for 1 min, followed by re-evaluation of sperm characteristics. The two extenders were similarly efficient for epididymal recovery, with regard to the number and quality of sperm recovered. However, for both extenders, sperm quality decreased (P Biotecnologia) group, which was significantly better than 9.7 ± 2.6% motile sperm with 1.2 ± 0.3 vigor in Tris. In conclusion, agouti epididymal sperm were successfully recovered using either ACP-109c (ACP Biotecnologia) or Tris extenders; however, ACP-109c (ACP Biotecnologia) was a significantly better extender for processing and cryopreserving these sperm. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of genes required for secretion of the Francisella oxidative burst-inhibiting acid phosphatase AcpA

Directory of Open Access Journals (Sweden)

John S Gunn

2016-04-01

Full Text Available Francisella tularensis is a Tier 1 bioterror threat and the intracellular pathogen responsible for tularemia in humans and animals. Upon entry into the host, Francisella uses multiple mechanisms to evade killing. Our previous studies have shown that after entering its primary cellular host, the macrophage, Francisella immediately suppresses the oxidative burst by secreting a series of acid phosphatases including AcpA-B-C and HapA, thereby evading the innate immune response of the macrophage and enhancing survival and further infection. However, the mechanism of acid phosphatase secretion by Francisella is still unknown. In this study, we screened for genes required for AcpA secretion in Francisella. We initially demonstrated that the known secretion systems, the putative Francisella-pathogenicity island (FPI-encoded Type VI secretion system and the Type IV pili, do not secrete AcpA. Using random transposon mutagenesis in conjunction with ELISA, Western blotting and acid phosphatase enzymatic assays, a transposon library of 5450 mutants was screened for strains with a minimum 1.5-fold decrease in secreted (culture supernatant AcpA, but no defect in cytosolic AcpA. Three mutants with decreased supernatant AcpA were identified. The transposon insertion sites of these mutants were revealed by direct genomic sequencing or inverse-PCR and sequencing. One of these mutants has a severe defect in AcpA secretion (at least 85% decrease and is a predicted hypothetical inner membrane protein. Interestingly, this mutant also affected the secretion of the FPI-encoded protein, VgrG. Thus, this screen identified novel protein secretion factors involved in the subversion of host defenses.

Effects of the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) on mechanical properties of luting and lining glass ionomer cement

Science.gov (United States)

Heravi, Farzin; Bagheri, Hossein; Rangrazi, Abdolrasoul; Mojtaba Zebarjad, Seyed

2016-07-01

Recently, the addition of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) into glass ionomer cements (GICs) has attracted interest due to its remineralization of teeth and its antibacterial effects. However, it should be investigated to ensure that the incorporation of CPP-ACP does not have significant adverse effects on its mechanical properties. The purpose of this study was to evaluate the effects of the addition of CPP-ACP on the mechanical properties of luting and lining GIC. The first step was to synthesize the CPP-ACP. Then the CPP-ACP at concentrations of 1%, 1.56% and 2% of CPP-ACP was added into a luting and lining GIC. GIC without CPP-ACP was used as a control group. The results revealed that the incorporation of CPP-ACP up to 1.56%(w/w) increased the flexural strength (29%), diametral tensile strength (36%) and microhardness (18%), followed by a reduction in these mechanical properties at 2%(w/w) CPP-ACP. The wear rate was significantly decreased (23%) in 1.56%(w/w) concentration of CPP-ACP and it was increased in 2%(w/w). Accordingly, the addition of 1.56%(w/w) CPP-ACP into luting and lining GIC had no adverse effect on the mechanical properties of luting and lining GIC and could be used in clinical practice.

Contribution of katG, ahpC and inhA mutations to the detection of isoniazid-resistant Mycobacterium tuberculosis isolates from Lebanon and Syria

Directory of Open Access Journals (Sweden)

F Dabboussi

2015-01-01

Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.

Association of ACP1 gene polymorphisms and coronary artery ...

Indian Academy of Sciences (India)

tients who underwent regular physical examinations who came for regular health .... ACP1 activity reveal a low risk in CAD among Chinese northeast people. ... to account for the gender difference in type I diabetes and allergy of Th2 class ...

Recovery of sperm after epididymal refrigeration from domestic cats using ACP-117c and Tris extenders

Directory of Open Access Journals (Sweden)

D.B.C. Lima

2016-08-01

Full Text Available ABSTRACT We aimed to compare fresh sperm and sperm cooled to 4ºC that had been recovered from the epididymides of cats using powdered coconut water (ACP-117c and Tris extenders. Sixty epididymides were divided into 6 groups: 10 fresh epididymides were recovered using Tris (T0h; 10 were kept at 4°C/2h and recovered using Tris (T2h; 10 were kept at 4°C/4h and recovered using Tris (T4h; 10 fresh were recovered using ACP-117c (A0h; 10 were kept at 4°C/2h and recovered using ACP-117c (A2h, and 10 were kept at 4°C/4h and recovered using ACP-117c (A4h. The testis-epididymis complexes (TEC control were not cooled. The others were cooled at 4°C for 2 or 4h. The epididymis was separated and the sperm was recovered by the modified flotation method. Sperm kinetic parameters were evaluated by a computer-system analysis, and vigor, viability, concentration, membrane function and morphology of the sperm were assessed under a light microscope. The progressive motility with ACP-117c declined after 2h of cooling, but did not differ between fresh and 4h. The vigor and membrane function were higher in A4h than A0h. The vigor at T2h and T4h were decreased compared to T0h. T0h was higher than A0h for vigor and sperm membrane function. However, after 4h of cooling, ACP-117c maintained a higher percentage of living cells. Feline epididymal sperm quality can be maintained to the degree necessary for artificial breeding programs following cooling and ACP-117c may be successfully used to recover cat sperm that have been cooled for up to 4h.

Economic Partnership between the ACP countries and the EU

NARCIS (Netherlands)

Van Hoestenberghe, K.; Roelfsema, H.J.

2006-01-01

In this paper we explore the nature and effects of the Economic Partnership Agreements (EPAs) between the EU and groups of African, Caribbean and Pacific (ACP) countries. We argue that the direct economic effects from reciprocal trade liberalization - both positive and negative – may be rather

Intravaginal artificial insemination in bitches using frozen/thawed semen after dilution in powdered coconut water (ACP-106c).

Science.gov (United States)

Uchoa, D C; Silva, T F P; Mota Filho, A C; Silva, L D M

2012-12-01

The aim of this study was to evaluate powdered coconut water extender (ACP-106c; ACP Serviços Tecnológicos Ltda, ACP Biotecnologia, Fortaleza, Ceará, Brazil) as a diluent for freezing dog semen and the fertility after vaginal insemination of semen frozen therein. Ten ejaculates were collected from five dogs, evaluated fresh, diluted in ACP-106c, 10% egg yolk and 6% glycerol, cooled and frozen. In the first phase of the study, straws with frozen semen were thawed and immediately subjected to the same analysis as the fresh semen and, in addition, to Computer-Assisted Semen Analysis (CASA). In phase 2, 10 bitches that had been subjected to natural breeding during a preceding oestrous cycle were vaginally inseminated with thawed semen that had been re-diluted in ACP-106c. After thawing, a mean of 77% sperm motility was obtained through subjective analysis and 77.3% through CASA. Following artificial insemination, a 60% pregnancy rate was observed, resulting in a 50% parturition rate and a mean litter size of 3.4 (SEM 0.6), with 47.1% males and 52.9% females. ACP-106c can be successfully used for freezing canine semen, and vaginal deposition of such semen yields similar pregnancy rates to those reported in other studies. © 2012 Blackwell Verlag GmbH.

Application of a Dielectric Barrier Discharge Atmospheric Cold Plasma (Dbd-Acp) for Eshcerichia Coli Inactivation in Apple Juice.

Science.gov (United States)

Liao, Xinyu; Li, Jiao; Muhammad, Aliyu Idris; Suo, Yuanjie; Chen, Shiguo; Ye, Xingqian; Liu, Donghong; Ding, Tian

2018-02-01

Atmospheric cold plasma (ACP) is a promising non-thermal technology in food industry. In this study, a dielectric barrier discharge (DBD)-ACP exhibited strong bactericidal effect on Escherichia coli in apple juice. Under a 30 to 50 W input power, less than 40 s treatment time was required for DBD-ACP to result in 3.98 to 4.34 log CFU/mL reduction of E. coli in apple juice. The inactivation behavior of ACP on E. coli was well described by the Weibull model. During the treatment, the cell membrane of E. coli was damaged severely by active species produced by plasma, such as hydrogen peroxide, ozone and nitrate. In addition, the ACP exposure had slight effect on the °Brix, pH, titratable acidity (TA), color values, total phenolic content, and antioxidant capacity of apple juice. However, higher level of DBD-ACP treatment, 50 W for more than 10 s in this case, resulted in significant change of the pH, TA, color and total phenolic content of apple juice. The results in this study have provided insight in potential use of DBD-ACP as an alternative to thermal processing for fruit juices in food industry. Escherichia coli O157:H7 in apple juice is a potential risk for public health. This study demonstrated that 30 s cold plasma treatment resulted in more than 4 log CFU/mL reduction under 50 W, while the quality attributes of apple juice were not significantly affected. Therefore, cold plasma technology is a promising alternative substitute of traditional thermal processing for juice pasteurization. © 2018 Institute of Food Technologists®.

ACP/R3000 processors in data acquisition systems

International Nuclear Information System (INIS)

Deppe, J.; Areti, H.; Atac, R.

1989-02-01

We describe ACP/R3000 processor based data acquisition systems for high energy physics. This VME bus compatible processor board, with a computational power equivalent to 15 VAX 11/780s or better, contains 8 Mb of memory for event buffering and has a high speed secondary bus that allows data gathering from front end electronics. 2 refs., 3 figs

Genetic and bibliographic information: Acp1 [GenLibi

Lifescience Database Archive (English)

Full Text Available Acp1 acid phosphatase 1, soluble rat Myoclonic Epilepsy, Juvenile (MeSH) Nervous Sy...stem Diseases (C10) > Central Nervous System Diseases (C10.228) > Brain Diseases (C10.228.140) > Epilepsy (C...10.228.140.490) > Epilepsies, Myoclonic (C10.228.140.490.250) > Myoclonic Epilepsy, Juvenile (C10.228.140.490.250.670) 05A0446636 ...

Acyl-ACP thioesterases from castor (Ricinus communis L.): an enzymatic system appropriate for high rates of oil synthesis and accumulation.

Science.gov (United States)

Sánchez-García, Alicia; Moreno-Pérez, Antonio J; Muro-Pastor, Alicia M; Salas, Joaquín J; Garcés, Rafael; Martínez-Force, Enrique

2010-06-01

Acyl-acyl carrier protein (ACP) thioesterases are enzymes that terminate the intraplastidial fatty acid synthesis in plants by hydrolyzing the acyl-ACP intermediates and releasing free fatty acids to be incorporated into glycerolipids. These enzymes are classified in two families, FatA and FatB, which differ in amino acid sequence and substrate specificity. In the present work, both FatA and FatB thioesterases were cloned, sequenced and characterized from castor (Ricinus communis) seeds, a crop of high interest in oleochemistry. Single copies of FatA and FatB were found in castor resulting to be closely related with those of Jatropha curcas. The corresponding mature proteins were heterologously expressed in Escherichia coli for biochemical characterization after purification, resulting in high catalytic efficiency of RcFatA on oleoyl-ACP and palmitoleoyl-ACP and high efficiencies of RcFatB for oleoyl-ACP and palmitoyl-ACP. The expression profile of these genes displayed the highest levels in expanding tissues that typically are very active in lipid biosynthesis such as developing seed endosperm and young expanding leaves. The contribution of these two enzymes to the synthesis of castor oil is discussed. Copyright 2010 Elsevier Ltd. All rights reserved.

Effect of CPP-ACP on the remineralization of acid-eroded human tooth enamel: nanomechanical properties and microtribological behaviour study

International Nuclear Information System (INIS)

Zheng, L; Zheng, J; Zhang, Y F; Qian, L M; Zhou, Z R

2013-01-01

Casein phosphopeptide-stabilized amorphous calcium phosphate (CPP-ACP) has been used to enhance tooth remineralization in the dental clinic. But the contribution of CPP-ACP to the remineralization of acid-eroded human tooth enamel is of widespread controversy. To confirm the application potential of CPP-ACP in the remineralization repair of tooth erosion caused by acid-attack, the effect of remineralization in vitro in 2% w/v CPP-ACP solution on the acid-eroded human tooth enamel was investigated in this study. The repair of surface morphology and the improvement of nanomechanical and microtribological properties were characterized with laser confocal scanning microscope, scanning electron microscope, nanoindentation tester and nanoscratch tester. Results showed that a layer of uneven mineral deposits, which were mainly amorphous calcium phosphate (ACP) in all probability, was observed on the acid-eroded enamel surface after remineralization. Compared with the acid-eroded enamel surface, the nanoindentation hardness and Young's modulus of the remineralized enamel surface obviously increased. Both the friction coefficient and wear volume of the acid-eroded enamel surface decreased after remineralization. However, both the nanomechanical and the anti-wear properties of the remineralized enamel surface were still inferior to those of original enamel surface. In summary, tooth damage caused by acid erosion could be repaired by remineralization in CPP-ACP solution, but the repair effect, especially on the nanomechanical and anti-wear properties of the acid-eroded enamel, was limited. These results would contribute to a further exploration of the remineralization potential of CPP-ACP and a better understanding of the remineralization repair mechanism for acid-eroded human tooth enamel. (paper)

Effect of CPP-ACP on the remineralization of acid-eroded human tooth enamel: nanomechanical properties and microtribological behaviour study

Science.gov (United States)

Zheng, L.; Zheng, J.; Zhang, Y. F.; Qian, L. M.; Zhou, Z. R.

2013-10-01

Casein phosphopeptide-stabilized amorphous calcium phosphate (CPP-ACP) has been used to enhance tooth remineralization in the dental clinic. But the contribution of CPP-ACP to the remineralization of acid-eroded human tooth enamel is of widespread controversy. To confirm the application potential of CPP-ACP in the remineralization repair of tooth erosion caused by acid-attack, the effect of remineralization in vitro in 2% w/v CPP-ACP solution on the acid-eroded human tooth enamel was investigated in this study. The repair of surface morphology and the improvement of nanomechanical and microtribological properties were characterized with laser confocal scanning microscope, scanning electron microscope, nanoindentation tester and nanoscratch tester. Results showed that a layer of uneven mineral deposits, which were mainly amorphous calcium phosphate (ACP) in all probability, was observed on the acid-eroded enamel surface after remineralization. Compared with the acid-eroded enamel surface, the nanoindentation hardness and Young's modulus of the remineralized enamel surface obviously increased. Both the friction coefficient and wear volume of the acid-eroded enamel surface decreased after remineralization. However, both the nanomechanical and the anti-wear properties of the remineralized enamel surface were still inferior to those of original enamel surface. In summary, tooth damage caused by acid erosion could be repaired by remineralization in CPP-ACP solution, but the repair effect, especially on the nanomechanical and anti-wear properties of the acid-eroded enamel, was limited. These results would contribute to a further exploration of the remineralization potential of CPP-ACP and a better understanding of the remineralization repair mechanism for acid-eroded human tooth enamel.

Solution Structure of 4′-Phosphopantetheine - GmACP3 from Geobacter metallireducens: A Specialized Acyl Carrier Protein with Atypical Structural Features and a Putative Role in Lipopolysaccharide Biosynthesis†

Science.gov (United States)

Ramelot, Theresa A.; Smola, Matthew J.; Lee, Hsiau-Wei; Ciccosanti, Colleen; Hamilton, Keith; Acton, Thomas B.; Xiao, Rong; Everett, John K.; Prestegard, James H.; Montelione, Gaetano T.; Kennedy, Michael A.

2011-01-01

GmACP3 from Geobacter metallireducens is a specialized acyl carrier protein (ACP) whose gene, gmet_2339, is located near genes encoding many proteins involved in lipopolysaccharide (LPS) biosynthesis, indicating a likely function for GmACP3 in LPS production. By overexpression in Escherichia coli, about 50% holo-GmACP3 and 50% apo-GmACP3 were obtained. Apo-GmACP3 exhibited slow precipitation and non-monomeric behavior by 15N NMR relaxation measurements. Addition of 4′-phosphopantetheine (4′-PP) via enzymatic conversion by E. coli holo-ACP synthase, resulted in stable >95% holo-GmACP3 that was characterized as monomeric by 15N relaxation measurements and had no indication of conformational exchange. We have determined a high-resolution solution structure of holo-GmACP3 by standard NMR methods, including refinement with two sets of NH residual dipolar couplings, allowing for a detailed structural analysis of the interactions between 4′-PP and GmACP3. Whereas the overall four helix bundle topology is similar to previously solved ACP structures, this structure has unique characteristics, including an ordered 4′-PP conformation that places the thiol at the entrance to a central hydrophobic cavity near a conserved hydrogen-bonded Trp-His pair. These residues are part of a conserved WDSLxH/N motif found in GmACP3 and it’s orthologs. The helix locations and the large hydrophobic cavity are more similar to medium- and long-chain acyl-ACPs than to other apo- and holo-ACP structures. Taken together, structural characterization along with bioinformatic analysis of nearby genes suggest that GmACP3 is involved in lipid A acylation, possibly by atypical long-chain hydroxy fatty acids, and potentially involved in synthesis of secondary metabolites. PMID:21235239

[Effect of casein phosphopeptide-amorphouscalcium phosphate (CPP-ACP) treatment on the shear bond strength of orthodontic brackets after tooth bleaching].

Science.gov (United States)

Lu, Jing; Ding, Xiao-jun; Yu, Xiao-ping; Gong, Yi-ming

2015-10-01

To evaluate the effect of casein phosphopeptide-amorphouscalcium phosphate (CPP-ACP) treatment on the shear bond strength of orthodontic brackets after tooth bleaching. One hundred extracted human premolars were randomly divided and treated according to 5 groups (n=20) : (1) no treatment; (2) 10% carbamide peroxide bleaching; (3) 38% hydrogen peroxide bleaching; (4)10% carbamide peroxide bleaching and CPP-ACP paste; (5)38% hydrogen peroxide bleaching and CPP-ACP paste. In all groups, the brackets were bonded using a conventional acid-etch and bond system (Transbond XT, 3M Unitek, Monrovia, Calif). The shear bond strength adhesive remnant index (ARI) of the brackets were determined and the data was analyzed by ANOVA and Bonferroni test using SPSS13.0 software package. The use of 10% carbamide peroxide and 38% hydrogen peroxide bleaching significantly decreased the shear bond strength of orthodontic brackets when compared with untreated group (P0.05). The ARI did not show any significant difference before and after CPP-ACP treatment. After tooth bleaching, CPP-ACP treatment have little influence on the shear bond strength of orthodontic brackets.

The effect of CPP-ACP-propolis chewing gum on calcium and phosphate ion release on caries-active subjects’ saliva and the formation of Streptococcus mutans biofilm

Science.gov (United States)

Hasnamudhia, F.; Bachtiar, E. W.; Sahlan, M.; Soekanto, S. A.

2017-08-01

The aim of this study was to analyze the effect of CPP-APP and propolis wax if they are combined in a chewing gum formulation, observed from the calcium and phosphate ion level released by CPP-ACP and the emphasis of Streptococcus mutans mass in the biofilm by propolis wax on caries-active subjects’ saliva. Chewing gum simulation was done in vitro on 25 caries-active subjects’ saliva using five concentrations of chewing gum (0% propolis + 0% CPP-ACP, 0% propolis + CPP-ACP, 2% propolis + CPP-ACP, 4% propolis + CPP-ACP, and 6% propolis + CPP-ACP) and was then tested using an atomic absorption spectrophotometer to analyze calcium ion levels, an ultraviolet-visible spectrophotometer to analyze phosphate ion levels, and a biofilm assay using crystal violet to analyze the decline in biofilm mass. After the chewing simulation, calcium ion levels on saliva+gum eluent increased significantly compared to the saliva control, with the highest calcium level released by CPP-ACP + 2% propolis chewing gum. There was an insignificant phosphate level change between the saliva control and saliva+gum eluent. There was also a significant decline of S. mutans biofilm mass in the saliva+gum eluent, mostly by the CPP-ACP chewing gum and CPP-ACP + 6% propolis. The CPP-ACP-propolis chewing gum simulation generated the largest increase in calcium and phosphate ion level and the largest decline in S. mutans biofilm mass.

EU Aid Conditionality in ACP Countries: Explaining Inconsistency in EU Sanctions Practice

Directory of Open Access Journals (Sweden)

Karen Del Biondo

2011-09-01

Full Text Available The EU is often criticised for using negative conditionality only in poor, strategically less important countries in the ACP region. However, whether and why there is inconsistency within the group of ACP countries has not been properly investigated. Therefore, this article investigates the reasons for the EU’s non-application of Article 96 of the Cotonou Agreement in five countries that can be considered typical cases where negative conditionality is generally imposed, namely countries that experienced flawed elections over the last ten years: Ethiopia, Rwanda, Nigeria, Kenya and Chad. On the one hand, the study confirms previous findings that security interests tend to trump the EU’s efforts to promote democratisation. On the other hand, the article adds that democratisation might not only conflict with the EU’s interests, but also with its objective to promote development and poverty reduction.

ACCUMULATION OF NITROGEN COMPOUNDS AND NITRATE REDUCTASE ACTIVITY IN LETTUCE CULTIVATED IN DIFFERENT CROP SYSTEMS ACÚMULO DE COMPOSTOS NITROGENADOS E ATIVIDADE DA REDUTASE DO NITRATO EM ALFACE PRODUZIDA EM DIFERENTES SISTEMAS DE CULTIVO

Directory of Open Access Journals (Sweden)

Fernanda Nunes Ibrahim

2008-09-01

limits recommended by literature.

KEY-WORDS: Vegetables; quality; nitrite; metabolism of nitrogen.

O teor de nitrato é um importante índice da qualidade dos alimentos, pois quando ingerido nitrato é reduzido a nitrito, o qual pode gerar compostos prejudiciais ao organismo humano. Diante disso, o presente trabalho teve como objetivo estudar o transporte e acúmulo de compostos nitrogenados e a atividade da enzima redutase do nitrato em alface cultivar 'Vera' produzida em Registro (SP em diferentes sistemas de cultivo. Foram coletadas amostras da seiva do xilema, da parte aérea e da raiz das plantas para quantificação de compostos nitrogenados e atividade da redutase do nitrato in vivo. A concentração de nitrato na seiva xilema, os teores de nitrato e aminoácidos, bem como a atividade da redutase do nitrato, demonstraram transporte, acumulação e assimilação mais intensos em plantas cultivadas em hidroponia, seguido do sistema convencional e por último, do orgânico. O caule da planta nos três sistemas de cultivo apresentou capacidade elevada de acumulação e assimilação de compostos nitrogenados. A atividade da redutase do nitrato nas folhas foi superior a da raiz. O teor de nitrato, independente do sistema de cultivo, variou de 24,32 a 800,06 mg Kg^-1 de MF nas diferentes partes da planta. Contudo, não excedeu os limites máximos recomendados pela literatura.

[Study on application of CPP-ACP on tooth mineralization during orthodontic treatment with fixed appliance].

Science.gov (United States)

He, Wen-dan; Liu, Ying-zhi; Xu, Yuan-yuan; Chen, Dong

2010-04-01

To determine the value of clinical application of CPP-ACP during orthodontic treatment with fixed appliance. Seventy-five subjects were divided randomly into three groups, the control group, experimental group A and experimental group B. The control group were emphasized on daily oral hygiene. Experimental group A used fluor protector every three months under the dentist's guidance. Experimental group B used Casein phosphopeptide amorphous calcium phosphate(CCP-ACP) once a day. After finishing the orthodontic treatment, photos were taken under the same condition ,then the degree of the enamel's demineralization was examined and the enamel decalcification index(EDI) was calculated. SPSS11.0 software package was used for statistical analysis. (1)The incidence of three groups' enamel decalcification declined in sequence as the control group(60%),experimental group A (36%), experimental group B (32%).(2)The incidence of the teeth's enamel calcification of three groups declined in sequence as the control group(14.7%),experimental group A (8.46%), experimental group B (7.72%), the difference between the control group and two experimental groups was significant, while no significant difference was found between the two experimental groups.(3(EDI of the control group was 0.155+/-0.023, EDI of the experimental group A was 0.082+/-0.009,while EDI of the experimental group B was 0.078+/-0.006. The difference between the control group and two experimental groups was statistically significant, while was not statistically significant between the two experimental groups. The application of fluor protector and CPP-ACP can improve the mineralization of the teeth during orthodontic treatment with fixed appliance. CPP-ACP is more convenient for the patients to use. Supported by Research Fund of Bureau of Science and Technology of Futian District Shenzhen City(Grant No.FTWS056).

Expression of Vibrio harveyi acyl-ACP synthetase allows efficient entry of exogenous fatty acids into the Escherichia coli fatty acid and lipid A synthetic pathways.

Science.gov (United States)

Jiang, Yanfang; Morgan-Kiss, Rachael M; Campbell, John W; Chan, Chi Ho; Cronan, John E

2010-02-02

Although the Escherichia coli fatty acid synthesis (FAS) pathway is the best studied type II fatty acid synthesis system, a major experimental limitation has been the inability to feed intermediates into the pathway in vivo because exogenously supplied free fatty acids are not efficiently converted to the acyl-acyl carrier protein (ACP) thioesters required by the pathway. We report that expression of Vibrio harveyi acyl-ACP synthetase (AasS), a soluble cytosolic enzyme that ligates free fatty acids to ACP to form acyl-ACPs, allows exogenous fatty acids to enter the E. coli fatty acid synthesis pathway. The free fatty acids are incorporated intact and can be elongated or directly incorporated into complex lipids by acyltransferases specific for acyl-ACPs. Moreover, expression of AasS strains and supplementation with the appropriate fatty acid restored growth to E. coli mutant strains that lack essential fatty acid synthesis enzymes. Thus, this strategy provides a new tool for circumventing the loss of enzymes essential for FAS function.

Isolation of a kernel oleoyl-ACP thioesterase gene from the oil palm ...

African Journals Online (AJOL)

We have isolated a cDNA clone from the developing kernel of the oil palm Elaeis guineensis which encodes a thioesterase enzyme. Its highest homology was to the Brassica napus oleoyl-ACP thioesterase with which it had 72% homology at the nucleotide level, over the coding region examined, and 83% identity (90% ...

Results of Absolute Cavity Pyrgeometer (ACP), InfraRed Integrating Sphere (IRIS), and Atmospheric Emitted Radiance Interferometer (AERI) Comparisons and CIMO Recommendations

Energy Technology Data Exchange (ETDEWEB)

Reda, Ibrahim M [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Dooraghi, Michael R [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Sengupta, Manajit [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Grobner, Julian [Physikalisch-Meteorologisches Observatorium Davos (PMOD); Wacker, Stefan [Deutscher Wetterdienst (DWD); Thomann, Christian [Physikalisch-Meteorologisches Observatorium Davos (PMOD); Long, Chuck [National Oceanic and Atmospheric Administration (NOAA); McComiskey, Allison [National Oceanic and Atmospheric Administration (NOAA); Ruedi, Isabelle [Physikalisch-Meteorologisches Observatorium Davos (PMOD); Forgan, Bruce [Bureau of Meteorology, Melbourne; Turner, Dave [National Oceanic and Atmospheric Administration (NOAA)

2018-03-05

Presenting results of five comparisons between ACPs and IRISs and the difference between the longwave irradiance measured by the ACPs and IRISs versus the average irradiance measured by the WISG. The process of CIMO recommendation to establish the world reference for measuring the atmospheric longwave irradiance with traceability to the International System of Units (SI) is also presented.

Protective effect of calcium nanophosphate and CPP-ACP agents on enamel erosion

International Nuclear Information System (INIS)

Carvalho, Fabiola Galbiatti de; Santos, Rogerio Lacerda dos; Silva Filho, Tiago Joao da; Carlo, Hugo Lemes; Lima, Bruno Alessandro Silva Guedes de

2013-01-01

The aim of this study was to assess the effect of different remineralizing agents on enamel microhardness (KHN) and surface topography after an erosive challenge. Forty-eight human enamel specimens (4 X 4 mm) were randomly assigned to 4 groups: control (no treatment), fluoride varnish, calcium nanophosphate paste and casein phosphopeptide-amorphous calcium phosphate paste (CPP-ACP). Both pastes were applied for 5 minutes, and fluoride varnish, for 24 h. Four daily erosive cycles of 5 minutes of immersion in a cola drink and 2 h in artificial saliva were conducted for 5 days. KHN readings were performed at baseline and after 5 days. The percentage of enamel hardness change (%KHN) was obtained after erosion. The surface topography was evaluated by atomic force microscopy (AFM). The data were tested using ANOVA, Tukey's and paired-T tests (p < 0.05). After an erosive challenge, there was no statistically significant difference between the control (96.8 ± 11.4 KHN / 72.4 ± 3.0 %KHN) and the varnish (91.7 ± 14.1 KHN / 73.4 ± 5.5 %KHN) groups. The nanophosphate group showed lower enamel hardness loss (187.2 ± 27.9 /49.0 ± 7.9 %KHN), compared with the CPP-ACP group (141.8 ± 16.5 /60.6 ± 4.0 %KHN), and both were statistically different from the varnish and the control groups. AFM images showed a rough surface for the control and the varnish groups, a non-homogeneous layer with globular irregularities for CPP-ACP, and a thick homogeneous layer for the nanophosphate group. None of the agents provided protection against the development of erosion; however, nanophosphate paste was able to reduce enamel surface softening after the erosive challenge. (author)

Protective effect of calcium nanophosphate and CPP-ACP agents on enamel erosion

Energy Technology Data Exchange (ETDEWEB)

Carvalho, Fabiola Galbiatti de; Santos, Rogerio Lacerda dos, E-mail: fabigalbi@yahoo.com.br [Universidade Federal de Campina Grande (UFCG), Patos, PB (Brazil). Dept. de Ciencias Biologicas. Div. de Odontologia; Silva Filho, Tiago Joao da; Carlo, Hugo Lemes [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Centro de Ciencias da Saude. Dept. de Odontologia Restauradora; Lima, Bruno Alessandro Silva Guedes de [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Dept. de Tecnologia Mecanica. Lab. de Solidificacao Rapida

2013-11-15

The aim of this study was to assess the effect of different remineralizing agents on enamel microhardness (KHN) and surface topography after an erosive challenge. Forty-eight human enamel specimens (4 X 4 mm) were randomly assigned to 4 groups: control (no treatment), fluoride varnish, calcium nanophosphate paste and casein phosphopeptide-amorphous calcium phosphate paste (CPP-ACP). Both pastes were applied for 5 minutes, and fluoride varnish, for 24 h. Four daily erosive cycles of 5 minutes of immersion in a cola drink and 2 h in artificial saliva were conducted for 5 days. KHN readings were performed at baseline and after 5 days. The percentage of enamel hardness change (%KHN) was obtained after erosion. The surface topography was evaluated by atomic force microscopy (AFM). The data were tested using ANOVA, Tukey's and paired-T tests (p < 0.05). After an erosive challenge, there was no statistically significant difference between the control (96.8 ± 11.4 KHN / 72.4 ± 3.0 %KHN) and the varnish (91.7 ± 14.1 KHN / 73.4 ± 5.5 %KHN) groups. The nanophosphate group showed lower enamel hardness loss (187.2 ± 27.9 /49.0 ± 7.9 %KHN), compared with the CPP-ACP group (141.8 ± 16.5 /60.6 ± 4.0 %KHN), and both were statistically different from the varnish and the control groups. AFM images showed a rough surface for the control and the varnish groups, a non-homogeneous layer with globular irregularities for CPP-ACP, and a thick homogeneous layer for the nanophosphate group. None of the agents provided protection against the development of erosion; however, nanophosphate paste was able to reduce enamel surface softening after the erosive challenge. (author)

Oriented and Ordered Biomimetic Remineralization of the Surface of Demineralized Dental Enamel Using HAP@ACP Nanoparticles Guided by Glycine

Science.gov (United States)

Wang, Haorong; Xiao, Zuohui; Yang, Jie; Lu, Danyang; Kishen, Anil; Li, Yanqiu; Chen, Zhen; Que, Kehua; Zhang, Qian; Deng, Xuliang; Yang, Xiaoping; Cai, Qing; Chen, Ning; Cong, Changhong; Guan, Binbin; Li, Ting; Zhang, Xu

2017-01-01

Achieving oriented and ordered remineralization on the surface of demineralized dental enamel, thereby restoring the satisfactory mechanical properties approaching those of sound enamel, is still a challenge for dentists. To mimic the natural biomineralization approach for enamel remineralization, the biological process of enamel development proteins, such as amelogenin, was simulated in this study. In this work, carboxymethyl chitosan (CMC) conjugated with alendronate (ALN) was applied to stabilize amorphous calcium phosphate (ACP) to form CMC/ACP nanoparticles. Sodium hypochlorite (NaClO) functioned as the protease which decompose amelogenin in vivo to degrade the CMC-ALN matrix and generate HAP@ACP core-shell nanoparticles. Finally, when guided by 10 mM glycine (Gly), HAP@ACP nanoparticles can arrange orderly and subsequently transform from an amorphous phase to well-ordered rod-like apatite crystals to achieve oriented and ordered biomimetic remineralization on acid-etched enamel surfaces. This biomimetic remineralization process is achieved through the oriented attachment (OA) of nanoparticles based on non-classical crystallization theory. These results indicate that finding and developing analogues of natural proteins such as amelogenin involved in the biomineralization by natural macromolecular polymers and imitating the process of biomineralization would be an effective strategy for enamel remineralization. Furthermore, this method represents a promising method for the management of early caries in minimal invasive dentistry (MID).

The ACP [Advanced Computer Program] multiprocessor system at Fermilab

International Nuclear Information System (INIS)

Nash, T.; Areti, H.; Atac, R.

1986-09-01

The Advanced Computer Program at Fermilab has developed a multiprocessor system which is easy to use and uniquely cost effective for many high energy physics problems. The system is based on single board computers which cost under $2000 each to build including 2 Mbytes of on board memory. These standard VME modules each run experiment reconstruction code in Fortran at speeds approaching that of a VAX 11/780. Two versions have been developed: one uses Motorola's 68020 32 bit microprocessor, the other runs with AT and T's 32100. both include the corresponding floating point coprocessor chip. The first system, when fully configured, uses 70 each of the two types of processors. A 53 processor system has been operated for several months with essentially no down time by computer operators in the Fermilab Computer Center, performing at nearly the capacity of 6 CDC Cyber 175 mainframe computers. The VME crates in which the processing ''nodes'' sit are connected via a high speed ''Branch Bus'' to one or more MicroVAX computers which act as hosts handling system resource management and all I/O in offline applications. An interface from Fastbus to the Branch Bus has been developed for online use which has been tested error free at 20 Mbytes/sec for 48 hours. ACP hardware modules are now available commercially. A major package of software, including a simulator that runs on any VAX, has been developed. It allows easy migration of existing programs to this multiprocessor environment. This paper describes the ACP Multiprocessor System and early experience with it at Fermilab and elsewhere

Spondyloenchondrodysplasia Due to Mutations in ACP5: A Comprehensive Survey.

Science.gov (United States)

Briggs, Tracy A; Rice, Gillian I; Adib, Navid; Ades, Lesley; Barete, Stephane; Baskar, Kannan; Baudouin, Veronique; Cebeci, Ayse N; Clapuyt, Philippe; Coman, David; De Somer, Lien; Finezilber, Yael; Frydman, Moshe; Guven, Ayla; Heritier, Sébastien; Karall, Daniela; Kulkarni, Muralidhar L; Lebon, Pierre; Levitt, David; Le Merrer, Martine; Linglart, Agnes; Livingston, John H; Navarro, Vincent; Okenfuss, Ericka; Puel, Anne; Revencu, Nicole; Scholl-Bürgi, Sabine; Vivarelli, Marina; Wouters, Carine; Bader-Meunier, Brigitte; Crow, Yanick J

2016-04-01

Spondyloenchondrodysplasia is a rare immuno-osseous dysplasia caused by biallelic mutations in ACP5. We aimed to provide a survey of the skeletal, neurological and immune manifestations of this disease in a cohort of molecularly confirmed cases. We compiled clinical, genetic and serological data from a total of 26 patients from 18 pedigrees, all with biallelic ACP5 mutations. We observed a variability in skeletal, neurological and immune phenotypes, which was sometimes marked even between affected siblings. In total, 22 of 26 patients manifested autoimmune disease, most frequently autoimmune thrombocytopenia and systemic lupus erythematosus. Four patients were considered to demonstrate no clinical autoimmune disease, although two were positive for autoantibodies. In the majority of patients tested we detected upregulated expression of interferon-stimulated genes (ISGs), in keeping with the autoimmune phenotype and the likely immune-regulatory function of the deficient protein tartrate resistant acid phosphatase (TRAP). Two mutation positive patients did not demonstrate an upregulation of ISGs, including one patient with significant autoimmune disease controlled by immunosuppressive therapy. Our data expand the known phenotype of SPENCD. We propose that the OMIM differentiation between spondyloenchondrodysplasia and spondyloenchondrodysplasia with immune dysregulation is no longer appropriate, since the molecular evidence that we provide suggests that these phenotypes represent a continuum of the same disorder. In addition, the absence of an interferon signature following immunomodulatory treatments in a patient with significant autoimmune disease may indicate a therapeutic response important for the immune manifestations of spondyloenchondrodysplasia.

The Effect of Laser Irradiation on Shear Bond Strength of GI to Dentin After CPP-ACP Treatment

Directory of Open Access Journals (Sweden)

Moezizadeh

2016-02-01

Full Text Available Background Dentin sensitivity is one of the most important problems in dentistry. Enamel loss due to root exposure is serious issue and common exposure is one of the reasons for dentin hypersensitivity. There are different methods for solving this problem. One of the most conservative and least expensive methods is use of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP paste. Objectives The aim of this study was to evaluate shear bond strength of GIC to dentin, with or without laser, CPP-ACP paste and polyacrylic acid treatments. Materials and Methods Fifty sound human third molars were bisected in a mesiodistal direction using a diamond disk. Using 400, 600 and 800 grit silicon carbide paper, dentin surfaces were exposed. The teeth were divided into five groups. In groups A, B, D and H, CPP-ACP (GC tooth mousse Itabashi-Ku, Tokyo, Japan was applied for one hour the first day and repeated at the same time of day for a total of five days. In groups B, C, D and E, the specimens were subjected to laser for 10 seconds using Er, Cr: YSGG laser. In groups B, C, H and G, specimens were treated with 10% polyacrylic acid for 20 seconds. A plastic tube containing GI was positioned over the tooth. Samples were loaded in shear bond using a Universal Testing Machine (Zwick/Roell, Germany, at a 0.5 mm/minute crosshead speed. Results Despite the failing of groups A and D, group analysis showed that there were no significant differences between the groups. The predominant type of fracture in all groups was adhesive. Conclusions Application of CPP-ACP, without preconditioning with polyacrylic acid, can decrease shear bond strength. Laser irradiation has no effect on shear bond strength of GIC to dentin in this condition.

The ACP (Advanced Computer Program) multiprocessor system at Fermilab

Energy Technology Data Exchange (ETDEWEB)

Nash, T.; Areti, H.; Atac, R.; Biel, J.; Case, G.; Cook, A.; Fischler, M.; Gaines, I.; Hance, R.; Husby, D.

1986-09-01

The Advanced Computer Program at Fermilab has developed a multiprocessor system which is easy to use and uniquely cost effective for many high energy physics problems. The system is based on single board computers which cost under $2000 each to build including 2 Mbytes of on board memory. These standard VME modules each run experiment reconstruction code in Fortran at speeds approaching that of a VAX 11/780. Two versions have been developed: one uses Motorola's 68020 32 bit microprocessor, the other runs with AT and T's 32100. both include the corresponding floating point coprocessor chip. The first system, when fully configured, uses 70 each of the two types of processors. A 53 processor system has been operated for several months with essentially no down time by computer operators in the Fermilab Computer Center, performing at nearly the capacity of 6 CDC Cyber 175 mainframe computers. The VME crates in which the processing ''nodes'' sit are connected via a high speed ''Branch Bus'' to one or more MicroVAX computers which act as hosts handling system resource management and all I/O in offline applications. An interface from Fastbus to the Branch Bus has been developed for online use which has been tested error free at 20 Mbytes/sec for 48 hours. ACP hardware modules are now available commercially. A major package of software, including a simulator that runs on any VAX, has been developed. It allows easy migration of existing programs to this multiprocessor environment. This paper describes the ACP Multiprocessor System and early experience with it at Fermilab and elsewhere.

Conventional cytogenetic characterization of a new cell line, ACP01, established from a primary human gastric tumor

Directory of Open Access Journals (Sweden)

E.M. Lima

2004-12-01

Full Text Available Gastric cancer is the second most frequent type of neoplasia and also the second most important cause of death in the world. Virtually all the established cell lines of gastric neoplasia were developed in Asian countries, and western countries have contributed very little to this area. In the present study we describe the establishment of the cell line ACP01 and characterize it cytogenetically by means of in vitro immortalization. Cells were transformed from an intestinal-type gastric adenocarcinoma (T4N2M0 originating from a 48-year-old male patient. This is the first gastric adenocarcinoma cell line established in Brazil. The most powerful application of the cell line ACP01 is in the assessment of cytotoxicity. Solid tumor cell lines from different origins have been treated with several conventional and investigational anticancer drugs. The ACP01 cell line is triploid, grows as a single, non-organized layer, similar to fibroblasts, with focus formation, heterogeneous division, and a cell cycle of approximately 40 h. Chromosome 8 trisomy, present in 60% of the cells, was the most frequent cytogenetic alteration. These data lead us to propose a multifactorial triggering of gastric cancer which evolves over multiple stages involving progressive genetic changes and clonal expansion.

Shear bond strength of self-etching adhesive systems with different pH values to bleached and/or CPP-ACP-treated enamel.

Science.gov (United States)

Oskoee, Siavash Savadi; Bahari, Mahmoud; Kimyai, Soodabeh; Navimipour, Elmira Jafari; Firouzmandi, Maryam

2012-08-01

To compare shear bond strengths of three different self-etching adhesive systems of different pH values to enamel bleached with carbamide peroxide, treated with casein phosphopeptide-amorphous calcium phosphate (CPP-ACP), or treated with CPP-ACP subsequent to bleaching with carbamide peroxide. Thirty-six human third molars were cut into 4 sections and randomly assigned to 4 groups (n = 36): group I: no treatment; group II: bleaching; group III: CPP-ACP; group IV: bleaching and CPP-ACP. After surface treatments, the samples of each group were further divided into three subgroups (n = 12) based on the adhesive used. The adhesives Clearfil SE Bond (CSE), AdhesE (ADE), and Adper SE Plus (ADP) were applied, and resin composite cylinders with a diameter of 2 mm and a height of 4 mm were bonded to the enamel. Then the specimens were subjected to shear bond strength testing. Two-way ANOVA and a post-hoc Tukey's test were used for statistical analysis (α = 0.05). There were significant differences between the adhesive systems (p system showed the highest bond strength, and the bleaching procedure reduced bond strengths (p = 0.001). Furthermore, there were no significant differences in shear bond strength values between the control and CPP groups. However, the differences between other groups were statistically significant (p material dependent.

Changes in the Concentration of Ions in Saliva and Dental Plaque after Application of CPP-ACP with and without Fluoride among 6-9 Year Old Children.

Science.gov (United States)

Poureslami, H; Hoseinifar, Ra; Khazaeli, P; Hoseinifar, Re; Sharifi, H; Poureslami, P

2017-03-01

The casein phospho peptide-amorphous calcium phosphate with or without fluoride (CPP-ACPF and CPP-ACP respectively) are of considerably new materials which are highly recommended for prevention of dental caries. However, there is a shortage in literature on how they affect the ion concentration of saliva or dental plaque. The aim of this study was to evaluate the concentration of calcium, phosphate and fluoride in the plaque and saliva of children with Early Childhood Caries (ECC) after applying the CPP-ACP paste in comparison with the use of CPP-ACPF paste. One ml of un-stimulated saliva of 25 preschool children was collected and then 1 mg of the plaque sample was collected from the buccal surfaces of the two first primary molars on the upper jaw. CPP-ACP as well as CPP-ACPF pastes were applied on the tooth surfaces in two separate steps. In steps, plaque and saliva sampling was performed after 60 minutes. The amount of calcium ions was measured by Atomic Absorption Device and the amount of phosphate and fluoride ions was measured by Ion Chromatography instrument. Data were analyzed using Repeated Measurements ANOVA at a p Application of both CPP-ACPF and CPP-ACP significantly increased the concentration of calcium, phosphate, and fluoride in both saliva and dental plaque. Moreover, significantly higher salivary fluoride concentration was seen after application of CPP-ACPF compared to CPP-ACP. No other significant difference was observed between these two materials. CPP-ACPF can be more useful than CPP-ACP in protecting the primary teeth against caries process, especially when there is poor hygiene.

Changes in the Concentration of Ions in Saliva and Dental Plaque after Application of CPP-ACP with and without Fluoride among 6-9 Year Old Children

Directory of Open Access Journals (Sweden)

Poureslami H

2017-03-01

Full Text Available Statement of Problem: The casein phospho peptide-amorphous calcium phosphate with or without fluoride (CPP-ACPF and CPP-ACP respectively are of considerably new materials which are highly recommended for prevention of dental caries. However, there is a shortage in literature on how they affect the ion concentration of saliva or dental plaque. Objectives: The aim of this study was to evaluate the concentration of calcium, phosphate and fluoride in the plaque and saliva of children with Early Childhood Caries (ECC after applying the CPP-ACP paste in comparison with the use of CPP- ACPF paste. Materials and Methods: One ml of un-stimulated saliva of 25 preschool children was collected and then 1 mg of the plaque sample was collected from the buccal surfaces of the two first primary molars on the upper jaw. CPP-ACP as well as CPP- ACPF pastes were applied on the tooth surfaces in two separate steps. In steps, plaque and saliva sampling was performed after 60 minutes. The amount of calcium ions was measured by Atomic Absorption Device and the amount of phosphate and fluoride ions was measured by Ion Chromatography instrument. Data were analyzed using Repeated Measurements ANOVA at a p < 0.05 level of significance. Results: Application of both CPP-ACPF and CPP-ACP significantly increased the concentration of calcium, phosphate, and fluoride in both saliva and dental plaque. Moreover, significantly higher salivary fluoride concentration was seen after application of CPP-ACPF compared to CPP-ACP. No other significant difference was observed between these two materials. Conclusions: CPP-ACPF can be more useful than CPP-ACP in protecting the primary teeth against caries process, especially when there is poor hygiene.

DIFFERENT CONCENTRATIONS OF POWDERED EGG YOLK ADDED TO THE ACP-103® EXTENDER IN SWINE SEMEN CONSERVATION

Directory of Open Access Journals (Sweden)

Ricardo Toniolli

2016-04-01

Full Text Available Many attempts have been made to improve the conservation of boar semen. Egg yolk is known to have cryoprotectant properties. This study aimed to test different concentrations of egg yolk added to the coconut milk powder extender (ACP-103®, and verify which one is better to maintain sperm viability. The ejaculated (36 were diluted in ACP-103® supplemented with different concentrations of egg yolk (0%, 1%, 3%, 5% and 7%. The conservation occurred at 17 °C, and vigor and motility analysis were carried out daily. On days 1 (D0, 3 (D2 and 5 (D4 the semen was evaluated for vitality, morphology and osmotic resistance. For statistical nonparametric analysis Kruskal-Wallis and Dunn’s tests were performed, and for parametric data ANOVA and Tukey test were used. A decrease in vigor and motility was observed in all treatments. Treatments T2, T3 and T4 better maintained spermatic on D0 (2.4±0.8, 2.5±1.1, and 2.8±0.9, respectively, with no signi cant differences among them. The same was observed for motility (77±15%, 74±23%, and 81±16% on D0. Analyses of vitality, morphology and osmotic resistance did not show statistical difference among treatments. In conclusion, the concentration of egg yolk (7% added to the ACP-103® can be e ectively used as extender to maintain sperm viability.

Measurement of the direct $CP$-violating parameter $A_{CP}$ in the decay $D^+ \\to K^-\\pi^+\\pi^+$

CERN Document Server

Abazov, Victor Mukhamedovich; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Agnew, James P; Alexeev, Guennadi D; Alkhazov, Georgiy D; Alton, Andrew K; Askew, Andrew Warren; Atkins, Scott; Augsten, Kamil; Avila, Carlos A; Badaud, Frederique; Bagby, Linda F; Baldin, Boris; Bandurin, Dmitry V; Banerjee, Sunanda; Barberis, Emanuela; Baringer, Philip S; Bartlett, JFrederick; Bassler, Ursula Rita; Bazterra, Victor; Bean, Alice L; Begalli, Marcia; Bellantoni, Leo; Beri, Suman B; Bernardi, Gregorio; Bernhard, Ralf Patrick; Bertram, Iain A; Besancon, Marc; Beuselinck, Raymond; Bhat, Pushpalatha C; Bhatia, Sudeep; Bhatnagar, Vipin; Blazey, Gerald Charles; Blessing, Susan K; Bloom, Kenneth A; Boehnlein, Amber S; Boline, Daniel Dooley; Boos, Edward E; Borissov, Guennadi; Borysova, Maryna; Brandt, Andrew; Brandt, Oleg; Brock, Raymond L; Bross, Alan D; Brown, Duncan Paul; Bu, Xue-Bing; Buehler, Marc; Buescher, Volker; Bunichev, Viacheslav Yevgenyevich; Burdin, Sergey; Buszello, Claus Peter; Camacho-Perez, Enrique; Casey, Brendan Cameron Kieran; Castilla-Valdez, Heriberto; Caughron, Seth Aaron; Chakrabarti, Subhendu; Chan, Kwok Ming Leo; Chandra, Avdhesh; Chapon, Emilien; Chen, Guo; Cho, Sung-Woong; Choi, Suyong; Choudhary, Brajesh C; Cihangir, Selcuk; Claes, Daniel R; Clutter, Justace Randall; Cooke, Michael P; Cooper, William Edward; Corcoran, Marjorie D; Couderc, Fabrice; Cousinou, Marie-Claude; Cutts, David; Das, Amitabha; Davies, Gavin John; de Jong, Sijbrand Jan; De La Cruz-Burelo, Eduard; Deliot, Frederic; Demina, Regina; Denisov, Dmitri S; Denisov, Sergei P; Desai, Satish Vijay; Deterre, Cecile; DeVaughan, Kayle Otis; Diehl, HThomas; Diesburg, Michael; Ding, Pengfei; Dominguez, DAaron M; Dubey, Abhinav Kumar; Dudko, Lev V; Duperrin, Arnaud; Dutt, Suneel; Eads, Michael T; Edmunds, Daniel L; Ellison, John A; Elvira, VDaniel; Enari, Yuji; Evans, Harold G; Evdokimov, Valeri N; Faure, Alexandre; Feng, Lei; Ferbel, Thomas; Fiedler, Frank; Filthaut, Frank; Fisher, Wade Cameron; Fisk, HEugene; Fortner, Michael R; Fox, Harald; Fuess, Stuart C; Garbincius, Peter H; Garcia-Bellido, Aran; Garcia-Gonzalez, Jose Andres; Gavrilov, Vladimir B; Geng, Weigang; Gerber, Cecilia Elena; Gershtein, Yuri S; Ginther, George E; Gogota, Olga; Golovanov, Georgy Anatolievich; Grannis, Paul D; Greder, Sebastien; Greenlee, Herbert B; Grenier, Gerald Jean; Gris, Phillipe Luc; Grivaz, Jean-Francois; Grohsjean, Alexander; Gruenendahl, Stefan; Gruenewald, Martin Werner; Guillemin, Thibault; Gutierrez, Gaston R; Gutierrez, Phillip; Haley, Joseph Glenn Biddle; Han, Liang; Harder, Kristian; Harel, Amnon; Hauptman, John Michael; Hays, Jonathan M; Head, Tim; Hebbeker, Thomas; Hedin, David R; Hegab, Hatim; Heinson, Ann; Heintz, Ulrich; Hensel, Carsten; Heredia-De La Cruz, Ivan; Herner, Kenneth Richard; Hesketh, Gavin G; Hildreth, Michael D; Hirosky, Robert James; Hoang, Trang; Hobbs, John D; Hoeneisen, Bruce; Hogan, Julie; Hohlfeld, Mark; Holzbauer, Jenny Lyn; Howley, Ian James; Hubacek, Zdenek; Hynek, Vlastislav; Iashvili, Ia; Ilchenko, Yuriy; Illingworth, Robert A; Ito, Albert S; Jabeen, Shabnam; Jaffre, Michel J; Jayasinghe, Ayesh; Jeong, Min-Soo; Jesik, Richard L; Jiang, Peng; Johns, Kenneth Arthur; Johnson, Emily; Johnson, Marvin E; Jonckheere, Alan M; Jonsson, Per Martin; Joshi, Jyoti; Jung, Andreas Werner; Juste, Aurelio; Kajfasz, Eric; Karmanov, Dmitriy Y; Katsanos, Ioannis; Kaur, Manbir; Kehoe, Robert Leo Patrick; Kermiche, Smain; Khalatyan, Norayr; Khanov, Alexander; Kharchilava, Avto; Kharzheev, Yuri N; Kiselevich, Ivan Lvovich; Kohli, Jatinder M; Kozelov, Alexander V; Kraus, James Alexander; Kumar, Ashish; Kupco, Alexander; Kurca, Tibor; Kuzmin, Valentin Alexandrovich; Lammers, Sabine Wedam; Lebrun, Patrice; Lee, Hyeon-Seung; Lee, Seh-Wook; Lee, William M; Lei, Xiaowen; Lellouch, Jeremie; Li, Dikai; Li, Hengne; Li, Liang; Li, Qi-Zhong; Lim, Jeong Ku; Lincoln, Donald W; Linnemann, James Thomas; Lipaev, Vladimir V; Lipton, Ronald J; Liu, Huanzhao; Liu, Yanwen; Lobodenko, Alexandre; Lokajicek, Milos; Lopes de Sa, Rafael; Luna-Garcia, Rene; Lyon, Adam Leonard; Maciel, Arthur KA; Madar, Romain; Magana-Villalba, Ricardo; Malik, Sudhir; Malyshev, Vladimir L; Mansour, Jason; Martinez-Ortega, Jorge; McCarthy, Robert L; Mcgivern, Carrie Lynne; Meijer, Melvin M; Melnitchouk, Alexander S; Menezes, Diego D; Mercadante, Pedro Galli; Merkin, Mikhail M; Meyer, Arnd; Meyer, Jorg Manfred; Miconi, Florian; Mondal, Naba K; Mulhearn, Michael James; Nagy, Elemer; Narain, Meenakshi; Nayyar, Ruchika; Neal, Homer A; Negret, Juan Pablo; Neustroev, Petr V; Nguyen, Huong Thi; Nunnemann, Thomas P; Hernandez Orduna, Jose de Jesus; Osman, Nicolas Ahmed; Osta, Jyotsna; Pal, Arnab; Parashar, Neeti; Parihar, Vivek; Park, Sung Keun; Partridge, Richard A; Parua, Nirmalya; Patwa, Abid; Penning, Bjoern; Perfilov, Maxim Anatolyevich; Peters, Reinhild Yvonne Fatima; Petridis, Konstantinos; Petrillo, Gianluca; Petroff, Pierre; Pleier, Marc-Andre; Podstavkov, Vladimir M; Popov, Alexey V; Prewitt, Michelle; Price, Darren; Prokopenko, Nikolay N; Qian, Jianming; Quadt, Arnulf; Quinn, Breese; Ratoff, Peter N; Razumov, Ivan A; Ripp-Baudot, Isabelle; Rizatdinova, Flera; Rominsky, Mandy Kathleen; Ross, Anthony; Royon, Christophe; Rubinov, Paul Michael; Ruchti, Randal C; Sajot, Gerard; Sanchez-Hernandez, Alberto; Sanders, Michiel P; Santos, Angelo Souza; Savage, David G; Savitskyi, Mykola; Sawyer, HLee; Scanlon, Timothy P; Schamberger, RDean; Scheglov, Yury A; Schellman, Heidi M; Schwanenberger, Christian; Schwienhorst, Reinhard H; Sekaric, Jadranka; Severini, Horst; Shabalina, Elizaveta K; Shary, Viacheslav V; Shaw, Savanna; Shchukin, Andrey A; Simak, Vladislav J; Skubic, Patrick Louis; Slattery, Paul F; Smirnov, Dmitri V; Snow, Gregory R; Snow, Joel Mark; Snyder, Scott Stuart; Soldner-Rembold, Stefan; Sonnenschein, Lars; Soustruznik, Karel; Stark, Jan; Stoyanova, Dina A; Strauss, Michael G; Suter, Louise; Svoisky, Peter V; Titov, Maxim; Tokmenin, Valeriy V; Tsai, Yun-Tse; Tsybychev, Dmitri; Tuchming, Boris; Tully, Christopher George T; Uvarov, Lev; Uvarov, Sergey L; Uzunyan, Sergey A; Van Kooten, Richard J; van Leeuwen, Willem M; Varelas, Nikos; Varnes, Erich W; Vasilyev, Igor A; Verkheev, Alexander Yurievich; Vertogradov, Leonid S; Verzocchi, Marco; Vesterinen, Mika; Vilanova, Didier; Vokac, Petr; Wahl, Horst D; Wang, Michael HLS; Warchol, Jadwiga; Watts, Gordon Thomas; Wayne, Mitchell R; Weichert, Jonas; Welty-Rieger, Leah Christine; Williams, Mark Richard James; Wilson, Graham Wallace; Wobisch, Markus; Wood, Darien Robert; Wyatt, Terence R; Xie, Yunhe; Yamada, Ryuji; Yang, Siqi; Yasuda, Takahiro; Yatsunenko, Yuriy A; Ye, Wanyu; Ye, Zhenyu; Yin, Hang; Yip, Kin; Youn, Sungwoo; Yu, Jiaming; Zennamo, Joseph; Zhao, Tianqi Gilbert; Zhou, Bing; Zhu, Junjie; Zielinski, Marek; Zieminska, Daria; Zivkovic, Lidija

2014-12-11

We measure the direct CP-violating parameter A_CP for the decay of the charged charm meson, D+ -> K-pi+pi+ (and charge conjugate), using the full 10.4 fb-1 sample of ppbar collisions at sqrt(s) = 1.96 TeV collected by the D0 detector at the Fermilab Tevatron collider. We extract the raw reconstructed charge asymmetry by fitting the invariant mass distributions for the sum and difference of charge-specific samples. This quantity is then corrected for detector-related asymmetries using data-driven methods and for possible physics asymmetries (from B -> D processes) using input from Monte Carlo simulation. We measure A_CP = [-0.16 +- 0.15 (stat.) +- 0.09 (syst.)]%, which is consistent with zero, as expected from the standard model prediction of CP conservation, and is the most precise measurement of this quantity to date

Implementace protokolu ACP do operačního systému L4

OpenAIRE

Kolarík, Tomáš

2012-01-01

Práce se zabývá implementací protokolu ACP, který slouží k řízení přístupu pro operační systém založený na mikrojádře L4. Teoretická část práce se zabývá možnostmi řízení přístupu v počítačových sítích. Pozornost je se přitom soustřeďuje na AAA systémy, které řízení přístupu umožňují. Následně je podrobně popsán protokol ACP, typy jeho zpráv a reakce na ně. Druhá část teoretické přípravy je věnována operačním systémům kde se podrobněji zabývá jejich architekturou a službami. Následně je blíže...

Synthesis and Characterization of New Amino Acid-Schiff Bases and Studies their Effects on the Activity of ACP, PAP and NPA Enzymes (In Vitro

Directory of Open Access Journals (Sweden)

Zahraa Salim M. Al-Garawi

2012-01-01

Full Text Available In this study, two new Schiff base compounds derived from the condensation reaction of L-glycine and L-tryptophan with 4-methylbenzal-dehyde have been synthesized. The Schiff base compounds were characterized by FT-IR, UV and 1H NMR spectroscopy. Their effects on the activity of total (ACP, prostatic (PAP and non prostatic (NPA acid phosphatase enzymes were studied. The Schiff base derived from L-glycine (A demonstrated inhibition effect on the ACP and NPA activities and activation effect on PAP activity. The Schiff base derived from L-tryptophan (B demonstrated semi fixed inhibition effects on the ACP and NPA activities at high concentrations (5.5×10-2, 5.5×10-3 and 5.5×10-4 M and activator effect at low concentration (5.5×10-5 M while it was exhibits as activator on PAP activity.

The CPP-ACP relieved enamel erosion from a carbonated soft beverage: an in vitro AFM and XRD study.

Science.gov (United States)

Wang, C P; Huang, S B; Liu, Y; Li, J Y; Yu, H Y

2014-03-01

To investigate the CPP-ACP's effect on enamel against carbonated beverage erosion and explore the potential mechanism. A total of 30 enamel samples were prepared from sound bovine incisors, divided into 3 groups. Samples in the control group were kept in artificial saliva. Specimens' surfaces were smeared with a CPP-ACP agent (Tooth Mousse, TM) for 3 min, rinsed with distilled water for 10s, merged into cola (Coca Cola, CC) for 4 intervals of 2 min, rinsed again for the TM+CC group. In the CC group, specimens were treated solely with cola for 4 intervals (2 min each). The cycles were applied at 0, 12, 24, 36, 48 and 60 h. The surface microhardness (SMH) alterations were measured using a microhardness tester, the surface profiles were analyzed using the atomic force microscope, and the surface crystalline amount (I%) and crystallinity (FWHM) were analyzed using X-ray diffractometer. The SMH were significantly decreased in CC group, showing the largest SMH alteration; the reduction of SMH in TM+CC group was lower than that in CC group, still larger than control. After cycles, the TM+CC group showed rougher surfaces than control, while the CC group had the roughest surfaces. The TM+CC had an I% higher than the CC, and lower than the control. The TM+CC group had a FWHM lower than CC, higher than control. CPP-ACP was able to relieve the erosion on enamel from carbonated beverage. Copyright © 2013 Elsevier Ltd. All rights reserved.

A conservative region of the mercuric reductase gene (merA as a molecular marker of bacterial mercury resistance Região conservada do gene da mercúrio redutase (merA como marcador molecular da resistência bacteriana ao mercúrio

Directory of Open Access Journals (Sweden)

Adriana Sotero-Martins

2008-06-01

Full Text Available The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II to Hg0, which is dependent of the mercuric reductase enzyme (MerA activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains.O mecanismo de resistência bacteriana ao mercúrio mais comum é baseada na redução do Hg(II a Hg0, através da atividade da enzima mercúrio redutase (MerA. O uso do fragmento de 431 pb amplificado de uma região conservada do gene merA, que codifica a enzima MerA,foi utilizado como marcador molecular deste mecanismo, permitindo a identificação de bactérias resistentes ao mercúrio.

Evolution of the AKH/corazonin/ACP/GnRH receptor superfamily and their ligands in the Protostomia

DEFF Research Database (Denmark)

Hauser, Frank; Grimmelikhuijzen, Cornelis

2014-01-01

In this review we trace the evolutionary connections between GnRH receptors from vertebrates and the receptors for adipokinetic hormone (AKH), AKH/corazonin-related peptide (ACP), and corazonin from arthropods. We conclude that these G protein-coupled receptors (GPCRs) are closely related and hav......QLTFSSDWSGamide), and the penis worm Priapulus caudatus (pQIFFSKGWRGamide). This is the first report, showing that AKH signaling is widespread in molluscs....

A project management approach to an ACPE accreditation self-study.

Science.gov (United States)

Dominelli, Angela; Iwanowicz, Susan L; Bailie, George R; Clarke, David W; McGraw, Patrick S

2007-04-15

In preparation for an on-site evaluation and accreditation by the American Council on Pharmaceutical Education (ACPE), the Albany College of Pharmacy employed project management techniques to complete a comprehensive self-study. A project lifecycle approach, including planning, production, and turnover phases, was used by the project's Self-Study Steering Committee. This approach, with minimal disruption to college operations, resulted in the completion of the self-study process on schedule. Throughout the project, the Steering Committee maintained a log of functions that either were executed successfully or in hindsight, could have been improved. To assess the effectiveness of the project management approach to the the self-study process, feedback was obtained from the College community through a poststudy survey. This feedback, coupled with the Steering Committee's data on possible improvements, form the basis for the lessons learned during this self-study process.

Evaluation of the remineralization capacity of CPP-ACP containing fluoride varnish by different quantitative methods

Directory of Open Access Journals (Sweden)

Selcuk SAVAS

Full Text Available ABSTRACT Objective The aim of this study was to evaluate the efficacy of CPP-ACP containing fluoride varnish for remineralizing white spot lesions (WSLs with four different quantitative methods. Material and Methods Four windows (3x3 mm were created on the enamel surfaces of bovine incisor teeth. A control window was covered with nail varnish, and WSLs were created on the other windows (after demineralization, first week and fourth week in acidified gel system. The test material (MI Varnish was applied on the demineralized areas, and the treated enamel samples were stored in artificial saliva. At the fourth week, the enamel surfaces were tested by surface microhardness (SMH, quantitative light-induced fluorescence-digital (QLF-D, energy-dispersive spectroscopy (EDS and laser fluorescence (LF pen. The data were statistically analyzed (α=0.05. Results While the LF pen measurements showed significant differences at baseline, after demineralization, and after the one-week remineralization period (p0.05. With regards to the SMH and QLF-D analyses, statistically significant differences were found among all the phases (p<0.05. After the 1- and 4-week treatment periods, the calcium (Ca and phosphate (P concentrations and Ca/P ratio were higher compared to those of the demineralization surfaces (p<0.05. Conclusion CPP-ACP containing fluoride varnish provides remineralization of WSLs after a single application and seems suitable for clinical use.

Pediatric advance care planning (pACP) for teens with cancer and their families: Design of a dyadic, longitudinal RCCT.

Science.gov (United States)

Curtin, Katherine B; Watson, Anne E; Wang, Jichuan; Okonkwo, Obianuju C; Lyon, Maureen E

2017-11-01

Cancer is the leading cause of disease-related death for adolescents and young adults (AYAs) in the United States. Parents of AYAs with life-threatening illnesses have expressed the desire to talk to their children about end of life (EOL) care, yet, like caregivers of adult patients, struggle to initiate this conversation. Building Evidence for Effective Palliative/End of Life Care for Teens with Cancer is a longitudinal, randomized, controlled, single-blinded clinical trial aimed at evaluating the efficacy of FAmily CEntered disease-specific advance care planning (ACP) for teens with cancer (FACE-TC). A total of 130 dyads (260 subjects) composed of AYAs 14-20years old with cancer and their family decision maker (≥18years old) will be recruited from pediatric oncology programs at Akron Children's Hospital and St. Jude Children's Research Hospital. Dyads will be randomized to either the FACE-TC intervention or Treatment as Usual (TAU) control. FACE-TC intervention dyads will complete three 60-minute ACP sessions held at weekly intervals. Follow-up data will be collected at 3, 6, 12, and 18months post-intervention by a blinded research assistant (RA). The effects of FACE-TC on patient-family congruence in treatment preferences, quality of life (QOL), and advance directive completion will be analyzed. FACE-TC is an evidenced-based and patient-centered intervention that considers QOL and EOL care according to the AYA's representation of illness. The family is involved in the ACP process to facilitate shared decision making, increase understanding of the AYA's preferences, and make a commitment to honor the AYA's wishes. Copyright © 2017 Elsevier Inc. All rights reserved.

Is IQG-607 a Potential Metallodrug or Metallopro-Drug With a Defined Molecular Target in Mycobacterium tuberculosis?

Directory of Open Access Journals (Sweden)

Bruno L. Abbadi

2018-05-01

Full Text Available The emergence of strains of Mycobacterium tuberculosis resistant to isoniazid (INH has underscored the need for the development of new anti-tuberculosis agents. INH is activated by the mycobacterial katG-encoded catalase-peroxidase, forming an acylpyridine fragment that is covalently attached to the C4 of NADH. This isonicotinyl-NAD adduct inhibits the activity of 2-trans-enoyl-ACP(CoA reductase (InhA, which plays a role in mycolic acid biosynthesis. A metal-based INH analog, Na3[FeII(CN5(INH]·4H2O, IQG-607, was designed to have an electronic redistribution on INH moiety that would lead to an intramolecular electron transfer to bypass KatG activation. HPLC and EPR studies showed that the INH moiety can be oxidized by superoxide or peroxide yielding similar metabolites and isonicotinoyl radical only when associated to IQG-607, thereby supporting redox-mediated drug activation as a possible mechanism of action. However, IQG-607 was shown to inhibit the in vitro activity of both wild-type and INH-resistant mutant InhA enzymes in the absence of KatG activation. IQG-607 given by the oral route to M. tuberculosis-infected mice reduced lung lesions. Experiments using early and late controls of infection revealed a bactericidal activity for IQG-607. HPLC and voltammetric methods were developed to quantify IQG-607. Pharmacokinetic studies showed short half-life, high clearance, moderate volume of distribution, and low oral bioavailability, which was not altered by feeding. Safety and toxic effects of IQG-607 after acute and 90-day repeated oral administrations in both rats and minipigs showed occurrence of mild to moderate toxic events. Eight multidrug-resistant strains (MDR-TB were resistant to IQG-607, suggesting an association between katG mutation and increasing MIC values. Whole genome sequencing of three spontaneous IQG-607-resistant strains harbored katG gene mutations. MIC measurements and macrophage infection experiments with a laboratorial

An Effective Approach for Clustering InhA Molecular Dynamics Trajectory Using Substrate-Binding Cavity Features.

Directory of Open Access Journals (Sweden)

Renata De Paris

Full Text Available Protein receptor conformations, obtained from molecular dynamics (MD simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to

Screening for the genes involved in bombykol biosynthesis: Identification and functional characterization of Bombyx mori acyl carrier protein (BmACP

Directory of Open Access Journals (Sweden)

Atsushi eOhnishi

2011-12-01

Full Text Available Species-specific sex pheromones released by female moths to attract conspecific male moths are synthesized de novo in the pheromone gland (PG via fatty acid synthesis (FAS. Biosynthesis of moth sex pheromones is usually regulated by a neurohormone termed pheromone biosynthesis activating neuropeptide (PBAN, a 33-aa peptide that originates in the subesophageal ganglion. In the silkmoth, Bombyx mori, cytoplasmic lipid droplets (LDs, which store the sex pheromone (bombykol precursor fatty acid, accumulate in PG cells prior to eclosion. PBAN activation of the PBAN receptor stimulates lipolysis of the stored LD triacylglycerols (TAGs resulting in release of the bombykol precursor for final modification. While we have previously characterized a number of molecules involved in bombykol biosynthesis, little is known about the mechanisms of PBAN signaling that regulate the TAG lipolysis in PG cells. In the current study, we sought to further identify genes involved in bombykol biosynthesis as well as PBAN signaling, by using a subset of 312 expressed sequence tag (EST clones that are in either our B. mori PG cDNA library or the public B. mori EST databases, SilkBase and CYBERGATE, and which are preferentially expressed in the PG. Using RT-PCR expression analysis and an RNAi screening approach, we have identified another 8 EST clones involved in bombykol biosynthesis. Furthermore, we have determined the functional role of a clone designated BmACP that encodes B. mori acyl carrier protein (ACP. Our results indicate that BmACP plays an essential role in the biosynthesis of the bombykol precursor fatty acid via the canonical FAS pathway during pheromonogenesis.

Assessment of sperm quality, oxidative stress injury as well as ACP, AC and PDE expression in patients with oligoasthenozoospermia before and after qilin pill treatment

Directory of Open Access Journals (Sweden)

Shi-Jun Zhang

2016-09-01

Full Text Available Objective: To analyze the sperm quality, oxidative stress injury as well as ACP, AC and PDE expression in patients with oligoasthenozoospermia before and after qilin pill treatment. Methods: A total of 60 patients with oligoasthenozoospermia were randomly divided into observation group and control group, control group received routine western medicine treatment, observation group received qilin pill + conventional western medicine treatment, and then differences in sperm quality, oxidative stress injury, ACP, AC and PDE expression, etc. were compared between two groups after treatment. Results: Semen volume and sperm density in semen samples of observation group after qilin pill treatment were higher than those of control group; serum FSH and LH levels were lower than those of control group, and the T level was higher than that of control group; ROS and MDA levels in seminal plasma were lower than those of control group, and SOD level was higher than that of control group; ACP, AC, α-Glu and Fru levels in seminal plasma were higher than those of control group, and PDE level was lower than that of control group. Conclusion: Qilin pill can improve sperm quality and optimize testicular internal environment in patients with oligoasthenozoospermia, and it has positive clinical significance.

Effect of CPP-ACP paste with and without CO2 laser irradiation on demineralized enamel microhardness and bracket shear bond strength

Directory of Open Access Journals (Sweden)

Nasrin Farhadian

Full Text Available ABSTRACT Introduction: Many patients seeking orthodontic treatment already have incipient enamel lesions and should be placed under preventive treatments. The aim of this in vitro study was to evaluate the effect of CPP-ACP paste and CO2 laser irradiation on demineralized enamel microhardness and shear bond strength of orthodontic brackets. Methods: Eighty caries-free human premolars were subjected to a demineralization challenge using Streptococcus mutans. After demineralization, the samples were randomly divided into five equal experimental groups: Group 1 (control, the brackets were bonded without any surface treatment; Group 2, the enamel surfaces were treated with CPP-ACP paste for 4 minutes before bonding; Group 3, the teeth were irradiated with CO2 laser beams at a wavelength of 10.6 µm for 20 seconds. The samples in Groups 4 and 5 were treated with CO2 laser either before or through CPP-ACP application. SEM photomicrographs of a tooth from each group were taken to observe the enamel surface. The brackets were bonded to the buccal enamel using a conventional method. Shear bond strength of brackets and ARI scores were measured. Vickers microhardness was measured on the non-bonded enamel surface. Data were analyzed with ANOVA and Tukey test at the p< 0.05 level. Results: The mean shear bond strength and microhardness of the laser group were higher than those in the control group and this difference was statistically significant (p< 0.05. All groups showed a higher percentage of ARI score 4. Conclusion: CO2 laser at a wavelength of 10.6 µm significantly increased demineralized enamel microhardness and enhanced bonding to demineralized enamel.

EFEITO DE DIFERENTES PROTOCOLOS DE DESCONGELAÇÃO SOBRE O SÊMEN CANINO CRIOPRESERVADO EM DILUIDOR À BASE ÁGUA DE COCO EM PÓ (ACP-106®

Directory of Open Access Journals (Sweden)

Victor Leão Hitzschky Madeira

2010-12-01

Full Text Available It is known that temperature and thawing velocity can affect sperm quality during freeze-thawing procedures. Thus, the aim of this research was to compare different thawing protocols for canine semen extended in ACP-106® extender and cryopreserved. Ten ejaculates were collected from eight dogs and sperm rich fraction was evaluated regarding volume, concentration, motility, vigor, pH, morphology, acrosomal integrity and hyposmotic swelling test. Then, semen was extended in ACP-106® with 20% egg yolk and 6% glycerol, and frozen in 0.25 mL straws. After one week, one straw was thawed at 37°C/60s, another one at 55°C/5s and a third one at 75°C/8s, and the seminal characteristics were reevaluated. Similar results were observed for all the groups, except for sperm motility which was better preserved at 55°C/5s for up 30min than at 37°C/60s or 75°C/8s. From these results, it is concluded that canine semen extended in ACP -106® is better thawed at 55°C/5s.

Design Report for Hotcell Crane of ACP Facility

Energy Technology Data Exchange (ETDEWEB)

Ku, J. H.; You, G. S.; Choung, W. M.; Kwon, K. C.; Cho, I. J.; Kook, D. H.; Lee, W. K.; Lee, E. P.; Park, S. W

2005-12-15

For the handling of the process material, equipment, and radioactive material transport cask, hot-cell crane, crane gate and jib crane are designed and constructed in the advanced spent fuel conditioning process (ACP) demonstration facility. The in-cell crane and the crane gate were installed in the hot-cell, and the jib crane was installed in isolation room. The in-cell crane mainly consists of hoist, driving unit for travelling motion, operation and control equipment and other mechanical equipment. The in-cell crane is specially design to maximize its access area since the inside hot-cell is not accessed by workers. And the manual lifting and travelling devices are attached in the in-cell crane for the electric power failure accident as a fail safe design. The crane gate, which is used for closing the open space above the inter-cell wall, was designed to sufficiently guarantee radiation shielding safety. To investigate the structural safety of the in-cell crane and the crane gate, seismic analysis, structural analysis, modal analysis and stress analysis were performed. The results showed that a structural safety is sufficiently assured under various loading conditions. After installation was completed, the in-cell crane and the jib crane were inspected and tested by Korea Occupational Safety and Health Agency (KOSHA), and received the approval certificates of these cranes from KOSHA.

Crystallization and preliminary X-ray crystallographic analysis of enoyl-ACP reductase III (FabL) from Bacillus subtilis

International Nuclear Information System (INIS)

Kim, Kook-Han; Park, Joon Kyu; Ha, Byung Hak; Moon, Jin Ho; Kim, Eunice EunKyeong

2007-01-01

Enoyl-ACP reductase III (FabL) from B. subtilis has been overexpressed, purified and crystallized. The crystal belongs to space group P622, with unit-cell parameters a = b = 139.56, c = 62.75 Å, α = β = 90, γ = 120°, and data were collected to 2.5 Å resolution using synchrotron radiation. Enoyl-[acyl-carrier protein] reductase (enoyl-ACP reductase; ENR) is a key enzyme in type II fatty-acid synthase that catalyzes the last step in each elongation cycle. It has been considered as an antibiotic target since it is an essential enzyme in bacteria. However, recent studies indicate that some pathogens have more than one ENR. Bacillus subtilis is reported to have two ENRs, namely BsFabI and BsFabL. While BsFabI is similar to other FabIs, BsFabL shows very little sequence similarity and is NADPH-dependent instead of NADH-dependent as in the case of FabI. In order to understand these differences on a structural basis, BsFabL has been cloned, expressed and and crystallized. The crystal belongs to space group P622, with unit-cell parameters a = b = 139.56, c = 62.75 Å, α = β = 90, γ = 120° and one molecule of FabL in the asymmetric unit. Data were collected using synchrotron radiation (beamline 4A at the Pohang Light Source, Korea). The crystal diffracted to 2.5 Å resolution

THE EUROPEAN UNION AND PARTNERSHIPS WITH DEVELOPING COUNTRIES – THE CASE OF ACP REGION

Directory of Open Access Journals (Sweden)

Viera Dobošová

2007-04-01

Full Text Available The EU has developed a wide cooperation network with developing countries based on trade, cooperation, aid and other aspects. These bilateral and regional agreements serve various and specific interests of the EU and the concerned countries and cover not only trade, but also other broad issues. However, above those remain the main goals of the EU in the area of the common commercial policy, development policy and external relations policy. The trend of regional integration and regional trade agreements proliferation has influenced these relations as well. The article will examine this trend in the network of EU trade agreements with developing countries, specifically with the African, Caribbean and Pacific region. Some critical issues of the EU – ACP cooperation will be identified.

Farmacocinética, metabolismo e excreção renal da doxorrubicina em pacientes com câncer de mama

OpenAIRE

Leandro Francisco Pippa

2016-01-01

O presente estudo visa descrever a farmacocinética, o metabolismo e a excreção renal da doxorrubicina, uma antraciclina utilizada no tratamento do câncer de mama. A doxorrubicina é biotransformada a doxorrubicinol pelas enzimas carbonil redutase 1 e 3 e aldo-ceto redutase. Foram investigadas 12 pacientes portadoras de câncer de mama no primeiro ciclo de tratamento adjuvante ou neoadjuvante com doxorrubicina (60 mg/m2) administrada por infusão intravenosa durante 30 min. As amostras seriadas d...

Imidacloprid soil movement under micro-sprinkler irrigation and soil-drench applications to control Asian citrus psyllid (ACP) and citrus leafminer (CLM).

Science.gov (United States)

Fletcher, Evelyn; Morgan, Kelly T; Qureshi, Jawwad A; Leiva, Jorge A; Nkedi-Kizza, Peter

2018-01-01

Imidacloprid (IM) is used to control the Asian Citrus Psyllid (ACP) and citrus leafminer (CLM), which are related to the spread of huanglongbing (HLB or citrus greening) and citrus canker diseases, respectively. In Florida citrus, imidacloprid is mainly soil-drenched around the trees for proper root uptake and translocation into plant canopy to impact ACP and CLM. The objective of this study was to determine the effect of imidacloprid rate, and irrigate amount on concentration of imidacloprid in the soil following drench application to citrus trees in three age classes. The plots were established at the Southwest Florida Research and Education Center, Immokalee, using a randomized complete-block design for three age classes of trees: one-year-old trees (B1), three to five-year-old trees (B2), and eight-year-old trees (B3). The treatments were a combination of two rates each of imidacloprid (1D, 2D) and micro-sprinkling irrigation (1I, 2I). Imidacloprid and bromide (Br-) used as tracer were applied simultaneously. Soil moisture and concentrations of imidacloprid and Br were monitored using soil cores from hand held augers. Soil moisture content (θV) did not differ under two irrigation rates at any given observation day or depth, except following heavy rainfall events. Br- was lost from the observation depths (0-45 cm) about two weeks after soil-drench. Contrarily, imidacloprid persisted for a much longer time (4-8 weeks) at all soil depths, regardless of treatment combinations. The higher retardation of imidacloprid was related to the predominantly unsaturated conditions of the soil (which in turn reduced soil hydraulic conductivities by orders of magnitude), the imidacloprid sorption on soil organic matter, and the citrus root uptake. Findings of this study are important for citrus growers coping with the citrus greening and citrus canker diseases because they suggest that imidacloprid soil drenches can still be an effective control measure of ACP and CLM, and the

Equilibrium calculation for the electrolytic reduction process of the ACP

International Nuclear Information System (INIS)

Park, Byung Heung; Seo, Chung Seok; Yoon, Ji Sup

2006-01-01

The electrolytic reduction process is the most critical process of the advanced spent fuel conditioning process (ACP) since most of the chemical reactions take place during this reduction process in a molten salt bath. However, it is very difficult to observe the behavior of all the spent fuel elements by experiments. Therefore, a perspective calculation is required to predict how much the chemicals are distributed between the phases and which forms are stable in each phase. Chemical equilibria take place during the electrolytic reduction process. The reduction process uses a porous magnesia filter and the materials to be reduced are loaded into the filter, which means the filter, the cathode of the electrolytic reduction cell, acts as a packed-bed reactor. Lithium metal is produced by an electrolytic reaction in a molten Li 2 O-LiCl cell and the reaction is denoted as Eq. In this work, attention has been paid to the chemical reactions of Eq. since an electrochemical reaction is controlled easily by the supplied current and the extents of the chemical reactions are determined by considering many candidates species. Uranium oxides, for example, can be reduced to U 4 O 9 , UO 2 , and/or U when U 3 O 8 is fed to the electrolytic reduction process

Assessment of White Spot Lesions and In-Vivo Evaluation of the Effect of CPP-ACP on White Spot Lesions in Permanent Molars of Children.

Science.gov (United States)

Munjal, Deepti; Garg, Shalini; Dhindsa, Abhishek; Sidhu, Gagandeep Kaur; Sethi, Harsimran Singh

2016-05-01

As hindrance of remineralisation process occurs during orthodontic therapy resulting in decalcification of enamel because number of plaque retention sites increases due to banding and bonding of appliances to teeth. The present analytic study was undertaken to assess the occurrence of white spot lesions in permanent molars of children with and without orthodontic therapy and to evaluate the effect of Casein PhosphoPeptide-Amorphous Calcium Phosphate (CPP-ACP) on white spot lesions in post-orthodontic patients in a given period of time. The study comprised of examination of 679 first permanent molars which were examined to assess the occurrence of smooth surface white spot lesions in children of 8 to 16 years age group. Group I comprised subjects without any orthodontic treatment and Group II comprised of subjects who had undergone orthodontic therapy. The sample size was calculated using the epi-info6 computer package. Treatment group included 20 post-orthodontic patients examined with at least one white spot lesion within the enamel who received remineralizing cream (GC Tooth Mousse, Recaldent, GC Corporation.) i.e., CPP-ACP cream two times a day for 12 consecutive weeks. Computerized image analysis method was taken to evaluate white spot lesions. These frequency and percentages were compared with chi-square test. For comparison of numeric data, paired t-test was used. Of the total 278 (49.6%) first permanent molars showed occurrence of smooth surface white spot lesions out of 560 in Group I and 107 (89.9%) first permanent molars showed presence of white spot lesions out of 119 debanded first permanent molars of children examined in Group II. CPP-ACP therapy group showed reduction in severity of codes which was found to be highly significant after 12 weeks and eight weeks on gingival-third, p-value (spot lesions on teeth undergoing fixed orthodontic therapy according to the present study.

Comparative evaluation of the effects of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) and xylitol-containing chewing gum on salivary flow rate, pH and buffering capacity in children: An in vivo study.

Science.gov (United States)

Hegde, Rahul J; Thakkar, Janhavi B

2017-01-01

This study aimed to compare and evaluate the changes in the salivary flow rate, pH, and buffering capacity before and after chewing casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) and xylitol-containing chewing gums in children. Sixty children aged between 8 and 12 years were selected for the study. They were randomly divided into Group 1 (CPP-ACP chewing gum) and Group 2 (xylitol-containing chewing gum) comprising thirty children each. Unstimulated and stimulated saliva samples at 15 and 30 min interval were collected from all children. All the saliva samples were estimated for salivary flow rate, pH, and buffering capacity. Significant increase in salivary flow rate, pH, and buffering capacity from baseline to immediately after spitting the chewing gum was found in both the study groups. No significant difference was found between the two study groups with respect to salivary flow rate and pH. Intergroup comparison indicated a significant increase in salivary buffer capacity in Group 1 when compared to Group 2. Chewing gums containing CPP-ACP and xylitol can significantly increase the physiochemical properties of saliva. These physiochemical properties of saliva have a definite relation with caries activity in children.

Banana splits and policy challenges: The ACP Caribbean and the fragmentation of interest coalitions

Directory of Open Access Journals (Sweden)

Peter Clegg

2005-10-01

Full Text Available The article considers the changes that have taken  place within the political economy of international  trade over the last decade. The work begins by  assessing briefly the dynamics of the last successful trade negotiations undertaken by the ACP Caribbean – the agreement on a single European  banana market in 1993. Since then, however, the  international political and economic climate has  dramatically changed. The article evaluates recent  developments, which have highlighted attention  on the political acceptability of trade discrimination, particularly within the context of the General  Agreement on Tariffs and Trade and the World Trade Organisation. In addition, there is an analysis of the reform process undertaken by the European Union, both in terms of its membership and  policy agenda, which has seriously impacted on  Caribbean economic interests. The article establishes that the actors representing the Caribbean  were extremely successful in constructing strategic coalitions to defend their trading interests in  the early 1990s, but the region must now appreciate that the international environment has changed  so dramatically that former negotiating strategies  are no longer appropriate. An awareness of the  changed negotiating environment on the part of  the Caribbean is vitally important if ongoing  international trade negotiations are to be completed to the region’s satisfaction. Resumen: Batallas bananeras y desafíos políticos:  El grupo ACP del Caribe y la fragmentación de las coaliciones de interésEste trabajo considera los cambios ocurridos en la  economía política del comercio internacional  durante la última década. El artículo comienza  con una breve evaluación de la dinámica de las  últimas negociaciones comerciales satisfactorias  del grupo ACP del Caribe: el acuerdo sobre un  mercado único bananero europeo en 1993. Desde  entonces, sin embargo, el clima político y �

Structural Safety Analysis of Openable Working Table in ACP Hot Cell for Spent Fuel Treatment

International Nuclear Information System (INIS)

Kwon, Ki Chan; Ku, Jeong Hoe; Lee, Eun Pyo; Choung, Won Myung; You, Gil Sung; Lee, Won Kyung; Cho, IL Je; Kuk, Dong Hak

2006-01-01

A demonstration facility for advanced spent fuel conditioning process (ACP) is under construction in KAERI. In this hot cell facility, all process equipment and materials are taken in and out only through the rear door. The working table in front of the process rear door is specially designed to be openable for the efficient use of the space. This paper presents the structural safety analysis of the openable working table, for the normal operational load condition and accidental drop condition of heavy object. Both cases are investigated through static and dynamic finite element analyses. The analysis results show that structural safety of the working table is sufficiently assured and the working table is not collapsed even when an object of 500 kg is dropped from the height of 50 cm.

Effects of conditioners on microshear bond strength to enamel after carbamide peroxide bleaching and/or casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) treatment.

Science.gov (United States)

Adebayo, O A; Burrow, M F; Tyas, M J

2007-11-01

To evaluate (a) the enamel microshear bond strength (MSBS) of a universal adhesive and (b) the effects of conditioning with a self-etching primer adhesive with/without prior bleaching and/or casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) application. Thirty-five molars were cut into four sections, assigned randomly to four groups (no treatment; 16% carbamide peroxide bleaching; CPP-ACP-containing paste (Tooth Mousse, TM); bleaching and TM) and treated accordingly. Specimens were divided into two for bonding with either a self-etching primer (Clearfil SE Bond, CSE) or a total-etch adhesive (Single Bond, SB). Specimens for CSE bonding were subdivided for one of four preconditioning treatments (no conditioning; 30-40% phosphoric acid (PA); 15% EDTA; 20% polyacrylic acid conditioner (Cavity conditioner, CC) and treated. The adhesives were applied and resin composite bonded to the enamel using microtubes (internal diameter 0.75mm). Bonds were stressed in shear until failure, mean MSBS calculated and data analysed using ANOVA with Tukey's HSD test (alpha=0.05). The modes of bond failure were assessed and classified. Two-way ANOVA revealed significant differences between treatments (Padhesive system on treated enamel may significantly improve bond strengths.

Comparative evaluation of the effects of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP and xylitol-containing chewing gum on salivary flow rate, pH and buffering capacity in children: An in vivo study

Directory of Open Access Journals (Sweden)

Rahul J Hegde

2017-01-01

Full Text Available Aim: This study aimed to compare and evaluate the changes in the salivary flow rate, pH, and buffering capacity before and after chewing casein phosphopeptide-amorphous calcium phosphate (CPP-ACP and xylitol-containing chewing gums in children. Materials and Methods: Sixty children aged between 8 and 12 years were selected for the study. They were randomly divided into Group 1 (CPP-ACP chewing gum and Group 2 (xylitol-containing chewing gum comprising thirty children each. Unstimulated and stimulated saliva samples at 15 and 30 min interval were collected from all children. All the saliva samples were estimated for salivary flow rate, pH, and buffering capacity. Results: Significant increase in salivary flow rate, pH, and buffering capacity from baseline to immediately after spitting the chewing gum was found in both the study groups. No significant difference was found between the two study groups with respect to salivary flow rate and pH. Intergroup comparison indicated a significant increase in salivary buffer capacity in Group 1 when compared to Group 2. Conclusion: Chewing gums containing CPP-ACP and xylitol can significantly increase the physiochemical properties of saliva. These physiochemical properties of saliva have a definite relation with caries activity in children.

Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

DEFF Research Database (Denmark)

Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

2007-01-01

Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

Action mechanism of inhibin α-subunit on the development of Sertoli cells and first wave of spermatogenesis in mice.

Directory of Open Access Journals (Sweden)

Kailai Cai

Full Text Available Inhibin is an important marker of Sertoli cell (SC activity in animals with impaired spermatogenesis. However, the precise relationship between inhibin and SC activity is unknown. To investigate this relationship, we partially silenced both the transcription and translation of the gene for the α-subunit of inhibin, Inha, using recombinant pshRNA vectors developed with RNAi-Ready pSIREN-RetroQ-ZsGreen Vector (Clontech Laboratories, Mountain View, Calif. We found that Inha silencing suppresses the cell-cycle regulators Cyclin D1 and Cyclin E and up-regulates the cell-cycle inhibitor P21 (as detected by Western blot analysis, thereby increasing the number of SCs in the G1 phase of the cell cycle and decreasing the amount in the S-phase of the cell cycle (as detected by flow cytometry. Inha silencing also suppressed Pdgfa, Igf1, and Kitl mRNA levels and up-regulated Tgfbrs, Inhba, Inhbb, Cyp11a1, Dhh, and Tjp1 mRNA levels (as indicated by real-time polymerase chain reaction [PCR] analysis. These findings indicate that Inha has the potential to influence the availability of the ligand inhibin and its antagonist activin in the SC in an autocrine manner and inhibit the progression of SC from G1 to S. It may also participate in the development of the blood-testis barrier, Leydig cells, and spermatogenesis through its effect on Dhh, Tjp1, Kitl, and Pdgfa. Real-time PCR and Western blot analyses of Inha, Inhba, and Inhbb mRNA and Inha levels over time show that Inha plays an important role in the formation of round spermatid during the first wave of spermatogenesis in mice.

Uso do diluente água de coco em pó (ACP-103® na conservação prolongada do sêmen do varrão: avaliação in vitro e in vivo Use of powder coconut water as extender (ACP-103® for boar semen longer preservation: in vitro and in vivo evaluations

Directory of Open Access Journals (Sweden)

R. Toniolli

2010-10-01

Full Text Available O sêmen de oito reprodutores foi coletado e de cada ejaculado separou-se um total de 1,75x10(9sptz, com concentração de 35x10(6sptz/mL. Usou-se o Beltsville Thawing Solution (BTS como controle para testar o diluente água de coco em pó (ACP. O dia de coleta foi o dia zero (D0, sendo o sêmen conservado durante cinco dias, com análises diárias no D0 e nos quatro dias seguintes (D1, D2, D3 e D4. A avaliação da qualidade espermática baseou-se nos resultados do vigor espermático, da porcentagem de células móveis, da morfologia espermática, da integridade da membrana plasmática e dos resultados de fertilidade. As avaliações do vigor espermático (4,1 e da porcentagem de espermatozoides móveis (91% ficaram acima dos parâmetros mínimos exigidos (3,0 e 70% para sua utilização em programas de inseminação artificial, pois não houve influência sobre as variáveis analisadas pelo protocolo experimental. O resultado médio da resistência osmótica foi de 71,3% de espermatozoides com cauda enrolada. Não houve diferenças entre os dois diluentes testados para a característica células com acrossoma intacto (BTS = 67,1%; ACP = 71,2%. O sêmen diluído em ACP apresentou maior número de células vivas (77,7 % com membrana plasmática íntegra (74,2% após a conservação. A escolha do diluente ACP é aconselhável para uso de rotina em laboratórios que trabalhem com conservação de sêmen suíno. Apesar dos bons resultados in vitro obtidos com o diluente ACP, o BTS apresentou os melhores resultados de fertilidade, 86,7% e 96,7%, respectivamente.The semen of eight boars was collected and a total of 1.75x10(9 spermatozoa were separated from each ejaculate, obtaining a concentration of 35x10(6sptz/mL. The Beltsville Thawing Solution (BTS was used as control, being tested the powder coconut water as extender (PCW. The day of collection was considered day zero (D0, and the semen was conserved for five days, with analyses on D0 and on

Inhibition of cell proliferation by a selective inhibitor of the Ca{sup 2+}-activated Cl{sup -} channel, Ano1

Energy Technology Data Exchange (ETDEWEB)

Mazzone, Amelia; Eisenman, Seth T.; Strege, Peter R. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Yao, Zhen [Laboratory of Molecular Genetics, UCSF, San Francisco, CA (United States); Ordog, Tamas; Gibbons, Simon J. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Farrugia, Gianrico, E-mail: farrugia.gianrico@mayo.edu [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States)

2012-10-19

Highlights: Black-Right-Pointing-Pointer T16A{sub inh}-A01 blocked Ano1 currents in HEK cells expressing Ano1. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation in ICC primary cultures and CFPAC-1 cell line. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation of ICC in intact smooth muscle strips. -- Abstract: Background: Ion channels play important roles in regulation of cellular proliferation. Ano1 (TMEM16A) is a Ca{sup 2+}-activated Cl{sup -} channel expressed in several tumors and cell types. In the muscle layers of the gastrointestinal tract Ano1 is selectively expressed in interstitial cells of Cajal (ICC) and appears to be required for normal gastrointestinal slow wave electrical activity. However, Ano1 is expressed in all classes of ICC, including those that do not generate slow waves suggesting that Ano1 may have other functions. Indeed, a role for Ano1 in regulating proliferation of tumors and ICC has been recently suggested. Recently, a high-throughput screen identified a small molecule, T16A{sub inh}-A01 as a specific inhibitor of Ano1. Aim: To investigate the effect of the T16A{sub inh}-A01 inhibitor on proliferation in ICC and in the Ano1-expressing human pancreatic cancer cell line CFPAC-1. Methods: Inhibition of Ano1 was demonstrated by whole cell voltage clamp recordings of currents in cells transfected with full-length human Ano1. The effect of T16A{sub inh}-A01 on ICC proliferation was examined in situ in organotypic cultures of intact mouse small intestinal smooth muscle strips and in primary cell cultures prepared from these tissues. ICC were identified by Kit immunoreactivity. Proliferating ICC and CFPAC-1 cells were identified by immunoreactivity for the nuclear antigen Ki67 or EdU incorporation, respectively. Results: T16A{sub inh}-A01 inhibited Ca{sup 2+}-activated Cl{sup -} currents by 60% at 10 {mu}M in a voltage-independent fashion. Proliferation of ICC was significantly reduced in primary cultures

CRIOPRESERVAÇÃO DE SÊMEN CANINO COM UM DILUIDOR À BASE DE ÁGUA DE COCO NA FORMA DE PÓ (ACP-106®: EFEITO DA TEMPERATURA DE ADIÇÃO DO GLICEROL (27 E 4°C CRYOPRESERVATION CANINE SEMEN USING A POWDERED COCONUT WATER EXTENDER (APC-106: EFFECT OF GLYCEROL TEMPERATURE ADDITION (27OC AND 4OC

Directory of Open Access Journals (Sweden)

Daniel Couto Uchoa

2009-12-01

Full Text Available

SOS2 and ACP1 Loci Identified through Large-Scale Exome Chip Analysis Regulate Kidney Development and Function

DEFF Research Database (Denmark)

Li, Man; Li, Yong; Weeks, Olivia

2017-01-01

Genome-wide association studies have identified >50 common variants associated with kidney function, but these variants do not fully explain the variation in eGFR. We performed a two-stage meta-analysis of associations between genotypes from the Illumina exome array and eGFR on the basis of serum...... creatinine (eGFRcrea) among participants of European ancestry from the CKDGen Consortium (nStage1: 111,666; nStage2: 48,343). In single-variant analyses, we identified single nucleotide polymorphisms at seven new loci associated with eGFRcrea (PPM1J, EDEM3, ACP1, SPEG, EYA4, CYP1A1, and ATXN2L; PStage1......associations of functional rare variants in three genes with eGFRcrea, including a novel association with the SOS Ras/Rho guanine nucleotide exchange factor 2 gene, SOS2 (P=5.4×10(-8) by sequence kernel...

Pre-treating dentin with chlorhexadine and CPP-ACP: self-etching and universal adhesive systems.

Science.gov (United States)

Dos Santos, Ricardo Alves; de Lima, Eliane Alves; Montes, Marcos Antônio Japiassu Resende; Braz, Rodivan

2016-12-01

Objective: The aim of the present study was to compare the effect of pre-treating dentin with chlorhexidine, at concentrations of 0.2% and 2%, and remineralizing paste containing CPP-ACP (MI Paste - GC) on the bond strength of adhesive systems. Material and methods: In total, 80 slides of dentin were used. These slides were 2 mm thick and were obtained from bovine incisors. Standard cavities were created using diamond bur number 3131. In the control groups, a Scotchbond Universal Adhesive (SUA) self-etching adhesive system of 3M ESPE and a Clearfil SE Bond (CSE) adhesive system of Kuraray were applied, following the manufacturer's instructions. In the other groups, dentin was pretreated with chlorhexidine (0.2% and 2%) for 1 min and with MI Paste for 3 min. The cavities were restored with Z350 XT resin (3M ESPE). After 24 h of storage, the push-out test was applied at a speed of 0.5 mm/min. Results: The different dentin pretreatment techniques did not affect the intra-adhesive bond strength. There was a difference between treatment with MI Paste and chlorhexidine 0.2% in favor of the SUA, with values of 15.22 and 20.25 Mpa, respectively. Conclusions: The different pretreatment methods did not alter the immediate bond strength to dentin. Differences were only recorded when comparing the adhesives.

Interaction of the SPG21 protein ACP33/maspardin with the aldehyde dehydrogenase ALDH16A1

Science.gov (United States)

2017-01-01

Mast syndrome (SPG21) is an autosomal-recessive complicated form of hereditary spastic paraplegia characterized by dementia, thin corpus callosum, white matter abnormalities, and cerebellar and extrapyramidal signs in addition to spastic paraparesis. A nucleotide insertion resulting in premature truncation of the SPG21 gene product acidic cluster protein 33 (ACP33)/maspardin underlies this disorder, likely causing loss of protein function. However, little is known about the function of maspardin. Here, we report that maspardin localizes prominently to cytoplasm as well as to membranes, possibly at trans-Golgi network/late endosomal compartments. Immunoprecipitation of maspardin with identification of coprecipitating proteins by mass spectrometry revealed the aldehyde dehydrogenase ALDH16A1 as an interacting protein. This interaction was confirmed using overexpressed proteins as well as by fusion protein pull down experiments, and these proteins colocalized in cells. Further studies of the function of ALDH16A1 and the role of the maspardin–ALDH16A1 interaction in neuronal cells may clarify the cellular pathogenesis of Mast syndrome. PMID:19184135

A user-friendly web portal for analyzing conformational changes in structures of Mycobacterium tuberculosis.

Science.gov (United States)

Hassan, Sameer; Thangam, Manonanthini; Vasudevan, Praveen; Kumar, G Ramesh; Unni, Rahul; Devi, P K Gayathri; Hanna, Luke Elizabeth

2015-10-01

Initiation of the Tuberculosis Structural Consortium has resulted in the expansion of the Mycobacterium tuberculosis (MTB) protein structural database. Currently, 969 experimentally solved structures are available for 354 MTB proteins. This includes multiple crystal structures for a given protein under different functional conditions, such as the presence of different ligands or mutations. In depth analysis of the multiple structures reveal that subtle differences exist in conformations of a given protein under varied conditions. Therefore, it is immensely important to understand the conformational differences between the multiple structures of a given protein in order to select the most suitable structure for molecular docking and structure-based drug designing. Here, we introduce a web portal ( http://bmi.icmr.org.in/mtbsd/torsion.php ) that we developed to provide comparative data on the ensemble of available structures of MTB proteins, such as Cα root means square deviation (RMSD), sequence identity, presence of mutations and torsion angles. Additionally, torsion angles were used to perform principal component analysis (PCA) to identify the conformational differences between the structures. Additionally, we present a few case studies to demonstrate this database. Graphical Abstract Conformational changes seen in the structures of the enoyl-ACP reductase protein encoded by the Mycobacterial gene inhA.

Redução de nitrato em plantas jovens de café cultivadas em diferentes níveis de luz e de nitrogênio Nitrate reduction in young coffee trees grown under different levels of light and nitrogen

Directory of Open Access Journals (Sweden)

Maria Luiza Carvalho Carelli

1990-01-01

Full Text Available Foi estudado o efeito de níveis de luz e de nitrogênio na atividade da enzima redutase de nitrato e nos teores de nitrato e de açúcares nas folhas de plantas jovens de café (Coffea arabica L, assim como as possíveis relações entre a disponibilidade desses compostos e a atividade enzimática. Foram utilizadas plantas de dez meses de idade cultivadas em vasos contendo uma mistura de terra mais composto, e mantidas em condições ambientais em pleno sol e em 50% da luz solar. Metade das plantas de cada tratamento de luz foi suplementada semanalmente com nitrogênio. Os resultados mostraram que a atividade da redutase de nitrato, nos dois tratamentos de luz, foi maior nas plantas suplementadas com nitrogênio. Para um mesmo nível de nitrogênio, as plantas cultivadas em pleno sol apresentaram menor atividade da redutase de nitrato, maiores teores de nitrato e de açúcares e maiores taxas de transpiração, do que as cultivadas na sombra. Tais resultados indicam que a menor atividade da redutase de nitrato nas plantas cultivadas em pleno sol aparentemente não foi devida a limitações na disponibilidade de nitrato e de açúcares para fornecer a energia necessária para a redução de nitrato.The effect of levels of light and nitrogen on the activity of the enzyme nitrate reductase and its relationship with the availability of sugars and nitrate was studied in leaves of coffee plants (Coffea arabica L. cv. Catual. Ten month old plants were grown on pots containing a mixture of soil and compost, and were kept at full or 50% sunlight. Half of the plants of each light treatment received nitrogen supply. The results showed that the activity of nitrate reductase was higher on plants supplied with nitrogen at both light treatments. For the same nitrogen level, plants grown under full sunlight presented lower nitrate reductase activity, higher nitrate and sugars concentrations, and higher transpiration rates than plants kept at 50% sunlight

Transmission Characteristics on Wire-Driven Links of a Bridge Transported Servo Manipulator for the ACP Equipment Maintenance

International Nuclear Information System (INIS)

Park, Byung Suk; Jin, Jae Hyun; Song, Tae Gil; Kim, Sung Hyun; Yoon, Ji Sup

2004-01-01

A bridge transported servo manipulator (BTSM) system for the advanced spent fuel conditioning process (ACP) has been developed to overcome the limitation of access, which is a drawback of mechanical master-slave manipulators (MSM) for the equipment maintenance. The servo manipulator is composed of a slave manipulator attached to the telescoping tube sets equipped with the overhead bridge installed at a hot cell and a master manipulator installed at an out-of-hot cell. Each manipulator has 7 degrees-of-freedom (DOF): a body rotation, an upper-arm tilt, a lower-arm tilt, a lower-arm rotation, a wrist pan and tilt, and a grasp motion. A wire-driven mechanism for a lower-arm rotation, a wrist pan and tilt, and a grasp motion of the manipulator has been adopted to increase the handling capacity compared to the manipulator weight and decrease the friction. The main disadvantage of the wire-driven mechanism is that if one link is in motion, other links can be affected. In this paper, the transmission characteristics among the wire-driven links have been formulated to overcome this drawback. The unexpected behaviors are confirmed by analyses of transmission characteristics as well as experiments. Also, the experimental results show that the unexpected behaviors are greatly decreased by the proposed compensation equations

THE EUROPEAN UNION’S TRADE NEGOTIATIONS WITH THE ACP:ENTRAPPED BY ITS OWN RHETORICAL STRATEGY?

Directory of Open Access Journals (Sweden)

Lotte Drieghe

2008-12-01

Full Text Available This paper deals with the Economic Partnership Agreements (EPAs between the European Union (EU and the group of African, Caribbean and Pacific (ACP countries. It addresses the question why the EU firmly insisted on upholding the negotiating deadline for these new trade agreements, despite the very damaging consequences; these hastily initialed trade deals entailed. Regional integration in the South was hampered; the development of the friendly image of the EU got a serious blow; the EU did not manage to include the WTO plus issues, and the prospect of full EPAs at later stage is not guaranteed. We first qualify the Union’s argument to the expiry of a waiver by the World Trade Organization (WTO, which legitimized the former trade regime, and placed an external and insurmountable pressure on the negotiations. There is no rational explanation for Europe’s harsh attitude on the EPA deadline, since neither legal, nor economic interests would have been harmed, if the deadline had been postponed. The main argument advanced in this article addresses whether the EU had to push through these trade deals, because it had entrapped itself through its own ‘rhetorical action’. In its negotiation discourse, the European Commission (EC had so often emphasized the deadline together with the fact that there were no alternatives to EPAs, that it could not change its mind overnight, when at the end of the 2007 negotiations they were still going nowhere. The Union was forced to keep up with the deadline it had imposed upon itself with the risk of losing all its credibility.

Anti-Müllerian Hormone and Inhibin-A, but not Inhibin-B or Insulin-Like Peptide-3, may be Used as Surrogates in the Diagnosis of Polycystic Ovary Syndrome in Adolescents: Preliminary Results.

Science.gov (United States)

Yetim, Aylin; Yetim, Çağcıl; Baş, Firdevs; Erol, Oğuz Bülent; Çığ, Gülnaz; Uçar, Ahmet; Darendeliler, Feyza

2016-09-01

Polycystic ovary syndrome (PCOS) is a common endocrine problem in adolescents with an increasing prevalence of 30%. Pursuing new biomarkers with high specificity and sensitivity in the diagnosis of PCOS in adolescents is currently an active area of research. We aimed to investigate the diagnostic value of anti-Müllerian hormone (AMH), insulin-like peptide-3 (INSL3), inhibin-A (INH-A), and inhibin-B (INH-B) in adolescents with PCOS and also to determine the association, if any, between these hormones and clinical/laboratory findings related with hyperandrogenism. The study group comprised 53 adolescent girls aged between 14.5 and 20 years who were admitted to our outpatient clinic with symptoms of hirsutism and/or irregular menses and diagnosed as having PCOS in accordance with the Rotterdam criteria. Twenty-six healthy peers, eumenorrheic for at least two years and body mass index-matched, constituted the controls. Fasting blood samples for hormones [luteinizing hormone (LH), follicle-stimulating hormone (FSH), dehydroepiandrosterone-sulfate (DHEAS), androstenedione (D4-A), total/free testosterone (T/fT), sex hormone binding globulin (SHBG), AMH, INSL3, INH-A, INH-B] were drawn after an overnight fast. In the PCOS group, 83% of the subjects were oligomenorrheic/amenorrheic and 87% had hirsutism. The LH, LH/FSH ratio, total T, fT, free androgen-index (FAI), DHEAS levels were significantly higher (p=0.005, p=0.042, p=0.047, pPCOS patients as compared to the controls. Although the INSL-3 and INH-B levels showed no difference between the groups (p>0.05), AMH and INH-A levels were found to be significantly higher in the PCOS group compared to the controls (pPCOS. When AMH and INH-A were used in combination, the sensitivity (96.2%) increased. INSL3 and INH-B were not found to have diagnostic value in adolescents with PCOS. On the other hand, it was shown that INH-A could be used as a new diagnostic biomarker in addition to AMH.

Proteomic Analysis of Bacillus thuringiensis Strain 4.0718 at Different Growth Phases

Directory of Open Access Journals (Sweden)

Xiaohui Li

2012-01-01

Full Text Available The growth process of Bacillus thuringiensis Bt4.0718 strain was studied using proteomic technologies. The proteins of Bt whole cells at three phases—middle vegetative, early sporulation, and late sporulation—were extracted with lysis buffer, followed with separation by 2-DE and identified by MALDI-TOF/TOF MS. Bioactive factors such as insecticidal crystal proteins (ICPs including Cry1Ac(3, Cry2Aa, and BTRX28, immune inhibitor (InhA, and InhA precursor were identified. InhA started to express at the middle vegetative phase, suggesting its contribution to the survival of Bt in the host body. At the early sporulation phase, ICPs started their expression. CotJC, OppA, ORF1, and SpoIVA related to the formation of crystals and spores were identified, the expression characteristics of which ensured the stable formation of crystals and spores. This study provides an important foundation for further exploration of the stable expression of ICPs, the smooth formation of crystals, and the construction of recombinant strains.

"Technical note. Harmonization of the multi-scale multi-model activities HTAP, AQMEII and MICS-Asia: simulations, emission inventories, boundary conditions and output formats." For submission to ACP Special Issue on "Global and regional assessment of intercontinental transport of air pollution: results from HTAP, AQMEII and MICS"

Science.gov (United States)

The ACP Special Issue is being organized to draw together analysis of a set of cooperative modeling experiments (referred to as HTAP2). The purpose of this technical note is to provide a common description of the experimental design and set up for HTAP2 that can be referred to b...

Mutaciones asociadas con resistencia a rifampicina o isoniazida en aislamientos clínicos de M. tuberculosis de Sonora, México DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico

Directory of Open Access Journals (Sweden)

Enrique Bolado-Martínez

2012-04-01

Full Text Available OBJETIVO: Realizar el análisis de regiones específicas de genes asociados con resistencia a isoniazida o rifampicina. MATERIAL Y MÉTODOS: Se estudiaron 22 cepas de M. tuberculosis, aisladas en Sonora, México. Se utilizaron iniciadores para regiones específicas de los genes rpoB, katG e inhA y la región ahpC-oxyR. Los productos de PCR se secuenciaron y analizaron. RESULTADOS: Se identificaron mutaciones en la región promotora del gen inhA, región ahpC-oxyR, codón 315 del gen katG y codones 451 ó 456 del gen rpoB. CONCLUSIONES: La identificación de mutaciones no descritas previamente obliga a continuar el análisis genotípico de cepas aisladas en Sonora.OBJECTIVE: To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. MATERIALS AND METHODS: Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. RESULTS: Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. CONCLUSIONS: Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

Utilização da técnica por componentes principais (acp e fator de iluminação, no mapeamento da cultura do café em relevo montanhoso Coffee crop mapping using principal component analysis and illumination factor for complex relief

Directory of Open Access Journals (Sweden)

Rubens A. C. Lamparelli

2011-06-01

Full Text Available O objetivo deste trabalho foi avaliar as informações obtidas das imagens do satélite Landsat/TM5, utilizando técnicas de Análise por Componentes Principais (ACP e Fator de Iluminação oriundo de um Modelo de Elevação do Terreno, calculado a partir de imagens ASTER, no mapeamento de áreas de café em terreno montanhoso. As imagens utilizadas (três foram corrigidas para o efeito da atmosfera e cobriram, temporalmente, o ciclo da cultura. Foram calculadas as componentes principais e escolhidas as duas primeiras, as quais possuíam 94% das informações, para a definição das amostras. As amostras resultantes da ACP foram utilizadas na classificação supervisionada cujo resultado foi comparado com uma classificação convencional e uma classificação multitemporal convencional. A acurácia das classificações foi realizada por meio do cálculo da Exatidão Global e do Coeficiente Kappa, tendo como base uma máscara da área cafeeira da região. Os resultados mostraram que a técnica de ACP foi efetiva no estabelecimento de classes de iluminação, assim como na escolha das amostras, apesar de estas não terem representado a área efetivamente classificada. Em função disto, as classificações foram mais acuradas, principalmente aquela que considerou todos os pixels de cada imagem classificada individualmente pelo método da ACP, confirmando a importância do aspecto multitemporabilidade .The main goal of this study was to evaluate the information produced from Landsat/TM5 images using Principal Component Analysis (PCA and Illumination Factor built from Digital Elevation Model from ASTER images for coffee areas mapping in complex relief. Three Landsat images were used to monitor the crop cycle. The Principal Component Analysis was applied to the Landsat images and the two first components were chosen, responsible for 94% of the initial information, and used as a sample set for the supervised classification of those images. That

Study on the mass transfer of oxygen in an electrolytic reduction process of ACP

International Nuclear Information System (INIS)

Park, Byung Heung; Park, Sung Bin; Seo, Chung Seok; Park, Seong Won

2005-01-01

The Advanced Spent Fuel Conditioning Process (ACP) is a molten-salt-based back-end fuel cycle technology developed at KAERI. The target fuel type for the process is the oxide fuel unloaded from PWRs which are the main prototype reactor commercially operating in Korea. The volume and the radiotoxicity of the spent fuel decrease to quarters of the initial volume and radiotoxicity after being reduced to metal forms and removing some elements into a molten salt. The reduction of the two properties improves the convenience in managing the spent fuels and makes it possible for disposal sites to be made the best use of. Metallization of the spent oxide fuels is accomplished in an electrolytic reduction cell where a molten LiCl is adopted as an electric medium and Li 2 O is added to increase the activity of the oxygen ion in the system. A porous magnesia filter, a SUS solid conductor, and the metal oxides to be reduced constitute a cathode and anodes are made of platinum. The only cation in the liquid phase is lithium at the first stage and the ion diffuses through the pores of the magnesia filter and then receives electrons to become a metal. The reduced lithium metal snatches oxygen from the metal oxides in the filter and transforms into lithium oxide which diffuses back to the molten salt phase leaving the reduced metal at the inside of the filter. The lithium oxide is dissociated to lithium and oxygen ions once it dissolves in the molten salt if the concentration is within the solubility limit. Hence the actual diffusing element is oxygen in an ionic state rather than the lithium oxide since there is no concentration gradient for the lithium ion to move on - the lithium ion is the main cation in the system though some alkali and alkaline-earth metals dissolve in the molten salt phase to be cations. The analysis of the mass transfer of oxygen in the electrolytic reduction process is, thus, of importance for the metallization process to be completely interpreted

Characterization of mutations causing rifampicin and isoniazid resistance of Mycobacterium tuberculosis in Syria.

Science.gov (United States)

Madania, Ammar; Habous, Maya; Zarzour, Hana; Ghoury, Ifad; Hebbo, Barea

2012-01-01

In order to characterize mutations causing rifampicin and isoniazid resistance of M. tuberculosis in Syria, 69 rifampicin resistant (Rif(r)) and 72 isoniazid resistant (Inh(r)) isolates were screened for point mutations in hot spots of the rpoB, katG and inhA genes by DNA sequencing and real time PCR. Of 69 Rif(r) isolates, 62 (90%) had mutations in the rifampin resistance determining region (RRDR) of the rpoB gene, with codons 531 (61%), 526 (13%), and 516 (8.7%) being the most commonly mutated. We found two new mutations (Asp516Thr and Ser531Gly) described for the first time in the rpoB-RRDR in association with rifampicin resistance. Only one mutation (Ile572Phe) was found outside the rpoB-RRDR. Of 72 Inh(r) strains, 30 (41.6%) had a mutation in katGcodon315 (with Ser315Thr being the predominant alteration), and 23 (32%) harbored the inhA(-15C-->T) mutation. While the general pattern of rpoB-RRDR and katG mutations reflected those found worldwide, the prevalence of the inhA(-15C-->T mutation was above the value found in most other countries, emphasizing the great importance of testing the inhA(-15C-->T) mutation for prediction of isoniazid resistance in Syria. Sensitivity of a rapid test using real time PCR and 3'-Minor groove binder (MGB) probes in detecting Rif(r) and Inh(r) isolates was 90% and 69.4%, respectively. This demonstrates that a small set of MGB-probes can be used in real time PCR in order to detect most mutations causing resistance to rifampicin and isoniazid.

[DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico].

Science.gov (United States)

Bolado-Martínez, Enrique; Pérez-Mendoza, Ansix; Alegría-Morquecho, Francisco Monserrat; Candia-Plata, María del Carmen; Aguayo-Verdugo, María del Rosario; Alvarez-Hernández, Gerardo

2012-01-01

To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

Isoniazid acetylating phenotype in patients with paracoccidioidomycosis and its relationship with serum sulfadoxin levels, glucose-6-phosphate dehydrogenase and glutathione reductase activities

Directory of Open Access Journals (Sweden)

Benedito Barraviera

1991-06-01

Full Text Available The authors evaluated the isoniazid acetylating phenotype and measured hematocrit, hemoglobin, glucose-6-phosphate dehydrogenase and glutathione reductase activities plus serum sulfadoxin levels in 39 patients with paracoccidioidomycosis (33 males and 6 females aged 17 to 58 years. Twenty one (53.84% of the patients presented a slow acetylatingphenotype and 18(46.16% a fast acetylating phenotype. Glucose-6-phosphate- dehydrogenase (G6PD acti vity was decreased in 5(23.80% slow acetylators and in 4(22.22% fast acetylators. Glutathione reductase activity was decreased in 14 (66.66% slow acetylators and in 12 (66.66% fast acetylators. Serum levels of free and total sulfadoxin Were higher in slow acetylator (p Os autores avaliaram o fenótipo acetilador da isoniazida, hematócrito, hemoglobina, atividade da glicose-6- fosfato desidrogenase, glutationa redutase e os níveis séricos de sulfadoxina de 39 doentes com paracoccidíoidomicose, senão 33 do sexo masculino e 6 do feminino, com idades compreendidas entre 17 e 58 anos. Vinte e um (53,84% doentes apresentaram fenótipo acetilador lento e 18 (46,16% rápido. A atividade da glicose-6-fosfato desidrogenase (G6PD esteve diminuída em 5 (23,80% acetiladores lentos e 4 (22,22% rápidos. A atividade da glutationa redutase esteve diminuída em 14 (66,66% acetiladores lentos e 12 (66,66% rápidos. Os níveis séricos de sulfadoxina livre e total foram maiores nos acetiladores lentos (p < 0,02. A análise dos resultados permite concluir que os níveis séricos de sulfadoxina relaciona-se com o fenótipo acetilador. Além disso, os níveis estiveram sempre acima de 50 µg/ml, níveis estes considerados terapêuticos. Por outro lado, a deficiência de glutationa redutase pode estar relacionada com a má absorção intestinal de nutrientes, entre eles riboflavina, vitamina precursora de FAD.

Structural characterization and comparison of three acyl-carrier-protein synthases from pathogenic bacteria

International Nuclear Information System (INIS)

Halavaty, Andrei S.; Kim, Youngchang; Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James; Zhou, Min; Onopriyenko, Olena; Skarina, Tatiana; Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N.; Joachimiak, Andrzej; Savchenko, Alexei; Anderson, Wayne F.

2012-01-01

The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS SA ), Vibrio cholerae (AcpS VC ) and Bacillus anthracis (AcpS BA ) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS BA is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS BA may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP

Isoforms of acyl carrier protein involved in seed-specific fatty acid synthesis.

Science.gov (United States)

Suh, M C; Schultz, D J; Ohlrogge, J B

1999-03-01

Seeds of coriandrum sativum (coriander) and Thunbergia alata (black-eyed Susan vine) produce unusual monoenoic fatty acids which constitute over 80% of the total fatty acids of the seed oil. The initial step in the formation of these fatty acids is the desaturation of palmitoyl-ACP (acyl carrier protein) at the delta(4) or delta(6) positions to produce delta(4)-hexadecenoic acid (16:1(delta(4)) or delta(6)-hexadecenoic acid (16:1(delta(6)), respectively. The involvement of specific forms of ACP in the production of these novel monoenoic fatty acids was studied. ACPs were partially purified from endosperm of coriander and T. alata and used to generate 3H- and 14C-labelled palmitoyl-ACP substrates. In competition assays with labelled palmitoyl-ACP prepared from spinach (Spinacia oleracea), delta(4)-acyl-ACP desaturase activity was two- to threefold higher with coriander ACP than with spinach ACP. Similarly, the T. alata delta(6) desaturase favoured T. alata ACP over spinach ACP. A cDNA clone, Cs-ACP-1, encoding ACP was isolated from a coriander endosperm cDNA library. Cs-ACP-1 mRNA was predominantly expressed in endosperm rather than leaves. The Cs-ACP-1 mature protein was expressed in E. coli and comigrated on SDS-PAGE with the most abundant ACP expressed in endosperm tissues. In in vitro delta(4)-palmitoyl-ACP desaturase assays, the Cs-ACP-1 expressed from E. coli was four- and 10-fold more active than spinach ACP or E. coli ACP, respectively, in the synthesis of delta(4)-hexadecenoic acid from palmitoyl-ACP. In contrast, delta(9)-stearoyl-ACP desaturase activity from coriander endosperm did not discriminate strongly between different ACP species. These results indicate that individual ACP isoforms are specifically involved in the biosynthesis of unusual seed fatty acids and further suggest that expression of multiple ACP isoforms may participate in determining the products of fatty acid biosynthesis.

Structural characterization and comparison of three acyl-carrier-protein synthases from pathogenic bacteria

Energy Technology Data Exchange (ETDEWEB)

Halavaty, Andrei S. [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Kim, Youngchang [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Zhou, Min [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Onopriyenko, Olena; Skarina, Tatiana [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N. [Center for Structural Genomics of Infectious Diseases, (United States); J. Craig Venter Institute, Rockville, MD 20850 (United States); Joachimiak, Andrzej [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Savchenko, Alexei [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Anderson, Wayne F., E-mail: wf-anderson@northwestern.edu [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States)

2012-10-01

The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.

Templated in-situ synthesis of gold nanoclusters conjugated to drug target bacterial enoyl-ACP reductase, and their application to the detection of mercury ions using a test stripe

International Nuclear Information System (INIS)

Ding, Han; Li, Hongwei; Liu, Pengchang; Wu, Yuqing; Shen, Jiacong; Hiltunen, J. Kalervo; Chen, Zhijun

2014-01-01

Fluorescent gold nanoclusters (AuNCs) were synthesized using a drug target bacterial enoyl-ACP reductase (FabI) as a template. The physical and chemical properties of the AuNCs were studied by UV-vis absorption, fluorescence, X-ray photoelectron spectroscopy and TEM. The AuNCs-FabI conjugate was prepared by in situ reduction of tetrachloroaurate in the presence of FabI. The conjugated particles were loaded onto nylon membranes by taking advantage of the electrostatic interaction between the negatively charged AuNCs-FabI and the nylon film which is positively charged at pH 7.4. This results in the formation of a test stripe with sensor spots that can be used to detect Hg(II) ion in the 1 nM to 10 μM concentration range. The test stripes are simple, convenient, selective, sensitive, and can be quickly read out with bare eyes after illumination with a UV lamp. (author)

Analyses of Mitogenome Sequences Revealed that Asian Citrus Psyllids (Diaphorina citri) from California Were Related to Those from Florida.

Science.gov (United States)

Wu, Fengnian; Kumagai, Luci; Cen, Yijing; Chen, Jianchi; Wallis, Christopher M; Polek, MaryLou; Jiang, Hongyan; Zheng, Zheng; Liang, Guangwen; Deng, Xiaoling

2017-08-31

Asian citrus psyllid (ACP, Diaphorina citri Kuwayama) transmits "Candidatus Liberibacter asiaticus" (CLas), an unculturable alpha-proteobacterium associated with citrus Huanglongbing (HLB). CLas has recently been found in California. Understanding ACP population diversity is necessary for HLB regulatory practices aimed at reducing CLas spread. In this study, two circular ACP mitogenome sequences from California (mt-CApsy, ~15,027 bp) and Florida (mt-FLpsy, ~15,012 bp), USA, were acquired. Each mitogenome contained 13 protein coding genes, 2 ribosomal RNA and 22 transfer RNA genes, and a control region varying in sizes. The Californian mt-CApsy was identical to the Floridian mt-FLpsy, but different from the mitogenome (mt-GDpsy) of Guangdong, China, in 50 single nucleotide polymorphisms (SNPs). Further analyses were performed on sequences in cox1 and trnAsn regions with 100 ACPs, SNPs in nad1-nad4-nad5 locus through PCR with 252 ACP samples. All results showed the presence of a Chinese ACP cluster (CAC) and an American ACP cluster (AAC). We proposed that ACP in California was likely not introduced from China based on our current ACP collection but somewhere in America. However, more studies with ACP samples from around the world are needed. ACP mitogenome sequence analyses will facilitate ACP population research.

Effects of Candidatus Liberibacter asiaticus on the fitness of the vector Diaphorina citri.

Science.gov (United States)

Ren, S-L; Li, Y-H; Zhou, Y-T; Xu, W-M; Cuthbertson, A G S; Guo, Y-J; Qiu, B-L

2016-12-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama transmits the bacterium 'Candidatus Liberibacter asiaticus' (Las), which causes citrus huanglongbing (HLB) disease. Although many studies have been conducted on the biology of ACP on different host plants, few have taken the plant, Las bacteria and the vector insect within one context to evaluate the effects of Las on the fitness of ACP under field conditions. Understanding the relationship between Las and ACP is critical for both ACP and HLB disease management. We estimated the development and survival of ACP immatures, the longevity and fecundity of ACP female adults in four treatments (Las-positive or -negative ACP on Las-infected and -free citrus plants). Las-positive ACP immatures developed significantly faster on Las-infected citrus than those on Las-free plants. The fecundity and longevity of Las-positive female adults were also greater, or longer on Las-infected citrus shoots, whereas the survival of Las-positive immatures was significantly lower on Las-infected citrus shoots, compared to those that developed on Las-free plants. Similarly, the intrinsic rate of population increase (r m ) was highest (0·1404) when Las-positive ACP fed on Las-infected citrus shoots and the lowest (0·1328) when the Las-negative ACP fed on Las-free citrus shoots. Both the Las infection in ACP and citrus plants had obvious effects on the biology of ACP. When compared to the Las infection in ACP insects, the Las infection in citrus shoots had a more significant effect on the fitness of ACP. To efficiently prevent the occurrence and spread of HLB disease, it is critical to understand the ecological basis of vector outbreaks and disease incidence, especially under field conditions. Thus, this study has increased our understanding of the epidemiology of HLB transmitted by psyllids in nature. © 2016 The Society for Applied Microbiology.

DIvERTICULE DE ZENKER

African Journals Online (AJOL)

origine de complications respiratoires aigues (détresse respiratoire aigue, pneumopathie d'inha- lation) ou chronique (bronchite chronique, asthme) qui surviennent dans 20 % des cas [8]. L'examen clinique est souvent normal. Cependant une.

Outcomes of cancer surgery after inhalational and intravenous anesthesia

DEFF Research Database (Denmark)

Soltanizadeh, Sinor; Degett, Thea H; Gögenur, Ismail

2017-01-01

Perioperative factors are probably essential for different oncological outcomes. This systematic review investigates the literature concerning overall mortality and postoperative complications after cancer surgery with inhalational (INHA) and intravenous anesthesia (TIVA). A search was conducted...

Advance Care Planning: Understanding Clinical Routines and Experiences of Interprofessional Team Members in Diverse Health Care Settings.

Science.gov (United States)

Arnett, Kelly; Sudore, Rebecca L; Nowels, David; Feng, Cindy X; Levy, Cari R; Lum, Hillary D

2017-12-01

Interprofessional health care team members consider advance care planning (ACP) to be important, yet gaps remain in systematic clinical routines to support ACP. A clearer understanding of the interprofessional team members' perspectives on ACP clinical routines in diverse settings is needed. One hundred eighteen health care team members from community-based clinics, long-term care facilities, academic clinics, federally qualified health centers, and hospitals participated in a 35-question, cross-sectional online survey to assess clinical routines, workflow processes, and policies relating to ACP. Respondents were 53% physicians, 18% advanced practice nurses, 11% nurses, and 18% other interprofessional team members including administrators, chaplains, social workers, and others. Regarding clinical routines, respondents reported that several interprofessional team members play a role in facilitating ACP (ie, physician, social worker, nurse, others). Most (62%) settings did not have, or did not know of, policies related to ACP documentation. Only 14% of settings had a patient education program. Two-thirds of the respondents said that addressing ACP is a high priority and 85% felt that nonphysicians could have ACP conversations with appropriate training. The clinical resources needed to improve clinical routines included training for providers and staff, dedicated staff to facilitate ACP, and availability of patient/family educational materials. Although interprofessional health care team members consider ACP a priority and several team members may be involved, clinical settings lack systematic clinical routines to support ACP. Patient educational materials, interprofessional team training, and policies to support ACP clinical workflows that do not rely solely on physicians could improve ACP across diverse clinical settings.

Advance care planning, culture and religion: an environmental scan of Australian-based online resources.

Science.gov (United States)

Pereira-Salgado, Amanda; Mader, Patrick; Boyd, Leanne M

2017-04-20

Objectives Culture and religion are important in advance care planning (ACP), yet it is not well understood how this is represented in ACP online resources. The aim of the present study was to identify the availability of Australian-based ACP websites and online informational booklets containing cultural and religious information. Methods An environmental scanning framework was used with a Google search conducted from 30 June 2015 to 5 July 2015. Eligible Australian-based ACP websites and online informational booklets were reviewed by two analysts (APS & PM) for information pertaining to at least one culture or religion. Common characteristics were agreed upon and tabulated with narrative description. Results Seven Australian-based ACP websites were identified with varying degrees of cultural and religious information. Seven Australian-based ACP informational booklets were identified addressing culture or religion, namely of Aboriginal and Torres Strait Islander (n=5), Sikh (n=1) and Italian (n=1) communities. Twenty-one other online resources with cultural and religious information were identified, developed within the context of health and palliative care. Conclusions There is no comprehensive Australian-based ACP website or informational booklet supporting ACP across several cultural and religious contexts. Considering Australia's multicultural and multifaith population, such a resource may be beneficial in increasing awareness and uptake of ACP. What is known about the topic? Health professionals and consumers frequently use the Internet to find information. Non-regulation has resulted in the proliferation of ACP online resources (i.e. ACP websites and online informational booklets). Although this has contributed to raising awareness of ACP, the availability of Australian-based ACP online resources with cultural and religious information is not well known. What does this paper add? This paper is the first to use an environmental scanning methodology to identify

Characterization of a structurally and functionally diverged acyl-acyl carrier protein desaturase from milkweed seed.

Science.gov (United States)

Cahoon, E B; Coughlan, S J; Shanklin, J

1997-04-01

A cDNA for a structurally variant acyl-acyl carrier protein (ACP) desaturase was isolated from milkweed (Asclepias syriaca) seed, a tissue enriched in palmitoleic (16:1delta9)* and cis-vaccenic (18:1delta11) acids. Extracts of Escherichia coli that express the milkweed cDNA catalyzed delta9 desaturation of acyl-ACP substrates, and the recombinant enzyme exhibited seven- to ten-fold greater specificity for palmitoyl (16:0)-ACP and 30-fold greater specificity for myristoyl (14:0)-ACP than did known delta9-stearoyl (18:0)-ACP desaturases. Like other variant acyl-ACP desaturases reported to date, the milkweed enzyme contains fewer amino acids near its N-terminus compared to previously characterized delta9-18:0-ACP desaturases. Based on the activity of an N-terminal deletion mutant of a delta9-18:0-ACP desaturase, this structural feature likely does not account for differences in substrate specificities.

Social Work Involvement in Advance Care Planning: Findings from a Large Survey of Social Workers in Hospice and Palliative Care Settings.

Science.gov (United States)

Stein, Gary L; Cagle, John G; Christ, Grace H

2017-03-01

Few data are available describing the involvement and activities of social workers in advance care planning (ACP). We sought to provide data about (1) social worker involvement and leadership in ACP conversations with patients and families; and (2) the extent of functions and activities when these discussions occur. We conducted a large web-based survey of social workers employed in hospice, palliative care, and related settings to explore their role, participation, and self-rated competency in facilitating ACP discussions. Respondents were recruited through the Social Work Hospice and Palliative Care Network and the National Hospice and Palliative Care Organization. Descriptive analyses were conducted on the full sample of respondents (N = 641) and a subsample of clinical social workers (N = 456). Responses were analyzed to explore differences in ACP involvement by practice setting. Most clinical social workers (96%) reported that social workers in their department are conducting ACP discussions with patients/families. Majorities also participate in, and lead, ACP discussions (69% and 60%, respectively). Most respondents report that social workers are responsible for educating patients/families about ACP options (80%) and are the team members responsible for documenting ACP (68%). Compared with other settings, oncology and inpatient palliative care social workers were less likely to be responsible for ensuring that patients/families are informed of ACP options and documenting ACP preferences. Social workers are prominently involved in facilitating, leading, and documenting ACP discussions. Policy-makers, administrators, and providers should incorporate the vital contributions of social work professionals in policies and programs supporting ACP.

Stearoyl-Acyl Carrier Protein and Unusual Acyl-Acyl Carrier Protein Desaturase Activities Are Differentially Influenced by Ferredoxin1

Science.gov (United States)

Schultz, David J.; Suh, Mi Chung; Ohlrogge, John B.

2000-01-01

Acyl-acyl carrier protein (ACP) desaturases function to position a single double bond into an acyl-ACP substrate and are best represented by the ubiquitous Δ9 18:0-ACP desaturase. Several variant acyl-ACP desaturases have also been identified from species that produce unusual monoenoic fatty acids. All known acyl-ACP desaturase enzymes use ferredoxin as the electron-donating cofactor, and in almost all previous studies the photosynthetic form of ferredoxin rather than the non-photosynthetic form has been used to assess activity. We have examined the influence of different forms of ferredoxin on acyl-ACP desaturases. Using combinations of in vitro acyl-ACP desaturase assays and [14C]malonyl-coenzyme A labeling studies, we have determined that heterotrophic ferredoxin isoforms support up to 20-fold higher unusual acyl-ACP desaturase activity in coriander (Coriandrum sativum), Thunbergia alata, and garden geranium (Pelargonium × hortorum) when compared with photosynthetic ferredoxin isoforms. Heterotrophic ferredoxin also increases activity of the ubiquitous Δ9 18:0-ACP desaturase 1.5- to 3.0-fold in both seed and leaf extracts. These results suggest that ferredoxin isoforms may specifically interact with acyl-ACP desaturases to achieve optimal enzyme activity and that heterotrophic isoforms of ferredoxin may be the in vivo electron donor for this reaction. PMID:11027717

Stearoyl-acyl carrier protein and unusual acyl-acyl carrier protein desaturase activities are differentially influenced by ferredoxin.

Science.gov (United States)

Schultz, D J; Suh, M C; Ohlrogge, J B

2000-10-01

Acyl-acyl carrier protein (ACP) desaturases function to position a single double bond into an acyl-ACP substrate and are best represented by the ubiquitous Delta9 18:0-ACP desaturase. Several variant acyl-ACP desaturases have also been identified from species that produce unusual monoenoic fatty acids. All known acyl-ACP desaturase enzymes use ferredoxin as the electron-donating cofactor, and in almost all previous studies the photosynthetic form of ferredoxin rather than the non-photosynthetic form has been used to assess activity. We have examined the influence of different forms of ferredoxin on acyl-ACP desaturases. Using combinations of in vitro acyl-ACP desaturase assays and [(14)C]malonyl-coenzyme A labeling studies, we have determined that heterotrophic ferredoxin isoforms support up to 20-fold higher unusual acyl-ACP desaturase activity in coriander (Coriandrum sativum), Thunbergia alata, and garden geranium (Pelargonium x hortorum) when compared with photosynthetic ferredoxin isoforms. Heterotrophic ferredoxin also increases activity of the ubiquitous Delta9 18:0-ACP desaturase 1.5- to 3.0-fold in both seed and leaf extracts. These results suggest that ferredoxin isoforms may specifically interact with acyl-ACP desaturases to achieve optimal enzyme activity and that heterotrophic isoforms of ferredoxin may be the in vivo electron donor for this reaction.

Prospective comparative effectiveness cohort study comparing two models of advance care planning provision for Australian community aged care clients.

Science.gov (United States)

Detering, Karen Margaret; Carter, Rachel Zoe; Sellars, Marcus William; Lewis, Virginia; Sutton, Elizabeth Anne

2017-12-01

Conduct a prospective comparative effectiveness cohort study comparing two models of advance care planning (ACP) provision in community aged care: ACP conducted by the client's case manager (CM) ('Facilitator') and ACP conducted by an external ACP service ('Referral') over a 6-month period. This Australian study involved CMs and their clients. Eligible CM were English speaking, ≥18 years, had expected availability for the trial and worked ≥3 days per week. CMs were recruited via their organisations, sequentially allocated to a group and received education based on the group allocation. They were expected to initiate ACP with all clients and to facilitate ACP or refer for ACP. Outcomes were quantity of new ACP conversations and quantity and quality of new advance care directives (ACDs). 30 CMs (16 Facilitator, 14 Referral) completed the study; all 784 client's files (427 Facilitator, 357 Referral) were audited. ACP was initiated with 508 (65%) clients (293 Facilitator, 215 Referral; p<0.05); 89 (18%) of these (53 Facilitator, 36 Referral) and 41 (46%) (13 Facilitator, 28 Referral; p<0.005) completed ACDs. Most ACDs (71%) were of poor quality/not valid. A further 167 clients (facilitator 124; referral 43; p<0.005) reported ACP was in progress at study completion. While there were some differences, overall, models achieved similar outcomes. ACP was initiated with 65% of clients. However, fewer clients completed ACP, there was low numbers of ACDs and document quality was generally poor. The findings raise questions for future implementation and research into community ACP provision. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Effect of vanadium compounds on acid phosphatase activity

OpenAIRE

Vescina, Cecilia M.; Sálice, Viviana C.; Cortizo, Ana María; Etcheverry, Susana B.

1996-01-01

The direct effect of different vanadium compounds on acid phosphatase (ACP) activity was investigated. Vanadate and vanadyl but not pervanadate inhibited the wheat germ ACP activity. These vanadium derivatives did not alter the fibroblast Swiss 3T3 soluble fraction ACP activity. Using inhibitors of tyrosine phosphatases (PTPases), the wheat germ ACP was partially characterized as a PTPase. This study suggests that the inhibitory ability of different vanadium derivatives to modulate ACP activi...

The R117A variant of the Escherichia coli transacylase FabD synthesizes novel acyl-(acyl carrier proteins).

Science.gov (United States)

Marcella, Aaron M; Barb, Adam W

2017-12-01

The commercial impact of fermentation systems producing novel and biorenewable chemicals will flourish with the expansion of enzymes engineered to synthesize new molecules. Though a small degree of natural variability exists in fatty acid biosynthesis, the molecular space accessible through enzyme engineering is fundamentally limitless. Prokaryotic fatty acid biosynthesis enzymes build carbon chains on a functionalized acyl carrier protein (ACP) that provides solubility, stability, and a scaffold for interactions with the synthetic enzymes. Here, we identify the malonyl-coenzyme A (CoA)/holo-ACP transacylase (FabD) from Escherichia coli as a platform enzyme for engineering to diversify microbial fatty acid biosynthesis. The FabD R117A variant produced novel ACP-based primer and extender units for fatty acid biosynthesis. Unlike the wild-type enzyme that is highly specific for malonyl-CoA to produce malonyl-ACP, the R117A variant synthesized acetyl-ACP, succinyl-ACP, isobutyryl-ACP, 2-butenoyl-ACP, and β-hydroxybutyryl-ACP among others from holo-ACP and the corresponding acyl-CoAs with specific activities from 3.7 to 120 nmol min -1  mg -1 . FabD R117A maintained K M values for holo-ACP (~ 40 μM) and displayed small changes in K M for acetoacetyl-CoA (110 ± 30 μM) and acetyl-CoA (200 ± 70 μM) when compared to malonyl-CoA (80 ± 30 μM). FabD R117A represents a novel catalyst that synthesizes a broad range of acyl-acyl-ACPs.

Characterization of the murine orthotopic adamantinomatous craniopharyngioma PDX model by MRI in correlation with histology.

Science.gov (United States)

Hölsken, Annett; Schwarz, Marc; Gillmann, Clarissa; Pfister, Christina; Uder, Michael; Doerfler, Arnd; Buchfelder, Michael; Schlaffer, Sven; Fahlbusch, Rudolf; Buslei, Rolf; Bäuerle, Tobias

2018-01-01

Adamantinomatous craniopharyngiomas (ACP) as benign sellar brain tumors are challenging to treat. In order to develop robust in vivo drug testing methodology, the murine orthotopic craniopharyngioma model (PDX) was characterized by magnetic resonance imaging (MRI) and histology in xenografts from three patients (ACP1-3). In ACP PDX, multiparametric MRI was conducted to assess morphologic characteristics such as contrast-enhancing tumor volume (CETV) as well as functional parameters from dynamic contrast-enhanced MRI (DCE-MRI) and diffusion-weighted imaging (DWI) including area-under-the-curve (AUC), peak enhancement (PE), time-to-peak (TTP) and apparent diffusion coefficient (ADC). These MRI parameters evaluated in 27 ACP PDX were correlated to histological features and percentage of vital tumor cell content. Qualitative analysis of MRI and histology from PDX revealed a similar phenotype as seen in patients, although the MRI appearance in mice resulted in a more solid tumor growth than in humans. CETV were significantly higher in ACP2 xenografts relative to ACP1 and ACP3 which correspond to respective average vitality of 41%, <10% and 26% determined histologically. Importantly, CETV prove tumor growth of ACP2 PDX as it significantly increases in longitudinal follow-up of 110 days. Furthermore, xenografts from ACP2 revealed a significantly higher AUC, PE and TTP in comparison to ACP3, and significantly increased ADC relative to ACP1 and ACP3 respectively. Overall, DCE-MRI and DWI can be used to distinguish vital from non-vital grafts, when using a cut off value of 15% for vital tumor cell content. MRI enables the assessment of craniopharyngioma PDX vitality in vivo as validated histologically.

Cloning and sequence analysis of putative type II fatty acid synthase ...

Indian Academy of Sciences (India)

Prakash

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

The group B streptococcal alpha C protein binds alpha1beta1-integrin through a novel KTD motif that promotes internalization of GBS within human epithelial cells.

Science.gov (United States)

Bolduc, Gilles R; Madoff, Lawrence C

2007-12-01

Group B Streptococcus (GBS) is the leading cause of bacterial pneumonia, sepsis and meningitis among neonates and a cause of morbidity among pregnant women and immunocompromised adults. GBS epithelial cell invasion is associated with expression of alpha C protein (ACP). Loss of ACP expression results in a decrease in GBS internalization and translocation across human cervical epithelial cells (ME180). Soluble ACP and its 170 amino acid N-terminal region (NtACP), but not the repeat protein RR', bind to ME180 cells and reduce internalization of wild-type GBS to levels obtained with an ACP-deficient isogenic mutant. In the current study, ACP colocalized with alpha(1)beta(1)-integrin, resulting in integrin clustering as determined by laser scanning confocal microscopy. NtACP contains two structural domains, D1 and D2. D1 is structurally similar to fibronectin's integrin-binding region (FnIII10). D1's (KT)D146 motif is structurally similar to the FnIII10 (RG)D1495 integrin-binding motif, suggesting that ACP binds alpha(1)beta(1)-integrin via the D1 domain. The (KT)D146A mutation within soluble NtACP reduced its ability to bind alpha(1)beta(1)-integrin and inhibit GBS internalization within ME180 cells. Thus ACP binding to human epithelial cell integrins appears to contribute to GBS internalization within epithelial cells.

Use of Video Decision Aids to Promote Advance Care Planning in Hilo, Hawai'i.

Science.gov (United States)

Volandes, Angelo E; Paasche-Orlow, Michael K; Davis, Aretha Delight; Eubanks, Robert; El-Jawahri, Areej; Seitz, Rae

2016-09-01

Advance care planning (ACP) seeks to promote care delivery that is concordant with patients' informed wishes. Scalability and cost may be barriers to widespread ACP, and video decision aids may help address such barriers. Our primary hypothesis was that ACP documentation would increase in Hilo after ACP video implementation. Secondary hypotheses included increased use of hospice, fewer deaths in the hospital, and decreased costs in the last month of life. The city of Hilo in Hawai'i (population 43,263), which is served by one 276-bed hospital (Hilo Medical Center), one hospice (the Hospice of Hilo), and 30 primary care physicians. The intervention consisted of a single, 1- to 4-h training and access to a suite of ACP video decision aids. Prior to implementation, the rate of ACP documentation for hospitalized patients with late-stage disease was 3.2 % (11/346). After the intervention, ACP documentation was 39.9 % (1,107/2,773) (P Hilo patients was $3,458 (95 % CI $3,051 to 3,865) lower per patient after the intervention when compared to the control region. Implementing ACP video decision aids was associated with improved ACP documentation, greater use of hospice, and decreased costs. Decision aids that promote ACP offer a scalable and cost-efficient medium to place patients at the center of their care.

Teaching Medical Students About "The Conversation": An Interactive Value-Based Advance Care Planning Session.

Science.gov (United States)

Lum, Hillary D; Dukes, Joanna; Church, Skotti; Abbott, Jean; Youngwerth, Jean M

2018-02-01

Advance care planning (ACP) promotes care consistent with patient wishes. Medical education should teach how to initiate value-based ACP conversations. To develop and evaluate an ACP educational session to teach medical students a value-based ACP process and to encourage students to take personal ACP action steps. Groups of third-year medical students participated in a 75-minute session using personal reflection and discussion framed by The Conversation Starter Kit. The Conversation Project is a free resource designed to help individuals and families express their wishes for end-of-life care. One hundred twenty-seven US third-year medical students participated in the session. Student evaluations immediately after the session and 1 month later via electronic survey. More than 90% of students positively evaluated the educational value of the session, including rating highly the opportunities to reflect on their own ACP and to use The Conversation Starter Kit. Many students (65%) reported prior ACP conversations. After the session, 73% reported plans to discuss ACP, 91% had thought about preferences for future medical care, and 39% had chosen a medical decision maker. Only a minority had completed an advance directive (14%) or talked with their health-care provider (1%). One month later, there was no evidence that the session increased students' actions regarding these same ACP action steps. A value-based ACP educational session using The Conversation Starter Kit successfully engaged medical students in learning about ACP conversations, both professionally and personally. This session may help students initiate conversations for themselves and their patients.

Beliefs in advance care planning among Chinese Americans: Similarities and differences between the younger and older generations

Directory of Open Access Journals (Sweden)

Mei Ching Lee

2017-10-01

Full Text Available The purpose of this research is to explore behavioral, normative, and control beliefs in the discussion of advance care planning (ACP among older and younger Chinese Americans. Ethnic minority groups have been identified as less engaged in ACP and this represents an ethnic and cultural gap. Older Chinese American adults often have different beliefs and values compared to the younger generation who are more acculturated to American mainstream culture. These differences may hinder the discussion of ACP with Chinese older adults. A qualitative design was used. The Theory of Planned Behavior guided the development of the interview guide. We recruited 60 Chinese Americans. Prior experience was identified as a theme that influenced attitudes about ACP. We found that older and younger Chinese participants had different beliefs in the norm and control related to ACP discussions, but not in the belief of attitudes about ACP discussions. Both younger and older Chinese American participants believed that ACP was important and necessary. Participants in both clusters expressed that they were ready and willing to engage in ACP discussions with their family members but hesitant to initiate these discussions. The reluctance in discussing ACP with Chinese older adults may be related to the expectations and obligations of Xiao (filial piety in Chinese culture. This study describes the similarities and differences of beliefs in ACP between older and younger Chinese Americans. We identified barriers and facilitators in behavioral, normative, and control beliefs that can be used to promote ACP for Chinese Americans.

Clinical Impact of Education Provision on Determining Advance Care Planning Decisions among End Stage Renal Disease Patients Receiving Regular Hemodialysis in University Malaya Medical Centre.

Science.gov (United States)

Hing Wong, Albert; Chin, Loh Ee; Ping, Tan Li; Peng, Ng Kok; Kun, Lim Soo

2016-01-01

Advance care planning (ACP) is a process of shared decision-making about future health-care plans between patients, health care providers, and family members, should patients becomes incapable of participating in medical treatment decisions. ACP discussions enhance patient's autonomy, focus on patient's values and treatment preferences, and promote patient-centered care. ACP is integrated as part of clinical practice in Singapore and the United States. To assess the clinical impact of education provision on determining ACP decisions among end-stage renal disease patients on regular hemodialysis at University Malaya Medical Centre (UMMC). To study the knowledge and attitude of patients toward ACP and end-of-life issues. Fifty-six patients were recruited from UMMC. About 43 questions pretest survey adapted from Lyon's ACP survey and Moss's cardiopulmonary resuscitation (CPR) attitude survey was given to patients to answer. An educational brochure is then introduced to these patients, and a posttest survey carried out after that. The results were analyzed using SPSS version 22.0. Opinion on ACP, including CPR decisions, showed an upward trend on the importance percentage after the educational brochure exposure, but this was statistically not significant. Seventy-five percent of participants had never heard of ACP before, and only 3.6% had actually prepared a written advanced directive. The ACP educational brochure clinically impacts patients' preferences and decisions toward end-of-life care; however, this is statistically not significant. Majority of patients have poor knowledge on ACP. This study lays the foundation for execution of future larger scale clinical trials, and ultimately, the incorporation of ACP into clinical practice in Malaysia.

The advance care planning experiences of people with dementia, family caregivers and professionals: a synthesis of the qualitative literature.

Science.gov (United States)

Ryan, Tony; Amen, Karwan M; McKeown, Jane

2017-10-01

There exists compelling evidence that advance care planning (ACP) remains a key factor in the delivery of appropriate end of life care and facilitates the timely transition to palliative care for people with dementia. Take up of ACP within the dementia population is low, especially when compared with other conditions. Quantitative research has helped in identifying some of the key factors in enabling or inhibiting the use of ACP within the dementia population. Qualitative research can, however, shed further light upon the experiences of all. We carried out a search of the qualitative literature addressing the ACP experiences of people with dementia, family caregivers and professionals. An approach to qualitative synthesis involving coding of original text, developing descriptive themes and generating analytical themes was utilized. We identified five papers and subsequently five analytical themes: breadth and scope of future planning; challenges to ACP; postponing ACP; confidence in systems and making ACP happen for people with dementia. The synthesized findings shed light on the ongoing challenges of the use and further development of ACP in the population of people with dementia. In particular attention is drawn to the difficulties in the timing of ACP and the preference for informal approaches to planning within the families of people affected by dementia. The ACP capacity of the workforce is also addressed. The paper reveals considerable complexity in undertaking ACP in a context of dementia. It is suggested that the preference for informal approaches and the timing of initial conversations be considered and that the skills of those involved in initiating discussions should be given primacy.

Health System Advance Care Planning Culture Change for High-Risk Patients: The Promise and Challenges of Engaging Providers, Patients, and Families in Systematic Advance Care Planning.

Science.gov (United States)

Reidy, Jennifer; Halvorson, Jennifer; Makowski, Suzana; Katz, Delila; Weinstein, Barbara; McCluskey, Christine; Doering, Alex; DeCarli, Kathryn; Tjia, Jennifer

2017-04-01

The success of a facilitator-based model for advance care planning (ACP) in LaCrosse, Wisconsin, has inspired health systems to aim for widespread documentation of advance directives, but limited resources impair efforts to replicate this model. One promising strategy is the development of interactive, Internet-based tools that might increase access to individualized ACP at minimal cost. However, widespread adoption and implementation of Internet-based ACP efforts has yet to be described. We describe our early experiences in building a systematic, population-based ACP initiative focused on health system-wide deployment of an Internet-based tool as an adjunct to a facilitator-based model. With the sponsorship of our healthcare system's population health leadership, we engaged a diverse group of clinical stakeholders as champions to design an Internet-based ACP tool and facilitate local practice change. We describe how we simultaneously began to train clinicians in ACP conversations, engage patients and health system employees in thinking about ACP, redesign clinic workflows to accommodate ACP discussions, and integrate the Internet-based tool into the electronic medical record (EMR). Over 18 months, our project engaged two subspecialty clinics in a systematic ACP process and began work with a large primary care practice with a large Medicare Accountable Care Organization at-risk population. Overall, 807 people registered at the Internet site and 85% completed ACPs. We learned that changing culture and systems to promote ACP requires a comprehensive vision with simultaneous, interconnected strategies targeting patient education, clinician training, EMR documentation, and community awareness.

Synthesis, growth, structural and optical studies of a new organic three dimensional framework: 4-(aminocarbonyl)pyridine 4-(aminocarbonyl)pyridinium hydrogen L-malate

Energy Technology Data Exchange (ETDEWEB)

Vijayalakshmi, A. [Department of Chemistry, RMK. Engineering College, Kavaraipettai 601206 (India); Vidyavathy, B., E-mail: vidyavathybalraj@gmail.com [Department of Chemistry,Velammal Engineering College, Chennai 600066 (India); Peramaiyan, G. [Institute of Physics, Academia Sinica, Taipei 11529, Taiwan (China); Vinitha, G. [Department of Physics, VIT University, Chennai 600127 (India)

2017-02-15

4-(aminocarbonyl)pyridine 4-(aminocarbonyl)pyridinium hydrogen L-malate [(4ACP)(4ACP).(LM)] a new organic nonlinear optical (NLO) crystal was grown by the slow evaporation method. Single crystal X-ray diffraction analysis revealed that the [(4ACP)(4ACP).(LM)] crystal belongs to monoclinic crystal system, space group P2{sub 1}/n, with a three dimensional network. Thermogravimetry (TG) and differential thermal (DT) analyses showed that [(4ACP)(4ACP).(LM)] is thermally stable up to 165 °C. The optical transmittance window and the lower cut-off wavelength of [(4ACP)(4ACP).(LM)] were found out by UV–vis–NIR spectral study. The molecular structure of [(4ACP)(4ACP).(LM)] was further confirmed by FTIR spectral studies. The relative dielectric permittivity and dielectric loss were determined as function of frequency and temperature. The third order nonlinear optical property of [(4ACP)(4ACP).(LM)] was studied by the Z-scan technique using a 532 nm diode pumped CW Nd:YAG laser. Nonlinear refractive index, nonlinear absorption coefficient and third order nonlinear susceptibility of the grown crystal were found to be 7.38×10{sup −8} cm{sup 2}/W, 0.08×10{sup −4} cm/W and 5.36×10{sup −6} esu, respectively. The laser damage threshold value is found to be 1.75 GW/cm{sup 2} - Graphical abstract: In the crystal structure of the title complex, the asymmetric unit contains one hydrogen L-malate anion, 4-(aminocarbonyl)pyridinium cation and a neutral isonicotinamide molecule. It is stabilized by intermolecular N-H…O, C-H…O and O-H…O hydrogen bonds which generate a three dimensional network.

Financial Incentives to Increase Advance Care Planning Among Medicaid Beneficiaries: Lessons Learned From Two Pragmatic Randomized Trials.

Science.gov (United States)

Barnato, Amber E; Moore, Robert; Moore, Charity G; Kohatsu, Neal D; Sudore, Rebecca L

2017-07-01

Medicaid populations have low rates of advance care planning (ACP). Potential policy interventions include financial incentives. To test the effectiveness of patient plus provider financial incentive compared with provider financial incentive alone for increasing ACP discussions among Medicaid patients. Between April 2014 and July 2015, we conducted two sequential assessor-blinded pragmatic randomized trials in a health plan that pays primary care providers (PCPs) $100 to discuss ACP: 1) a parallel cluster trial (provider-delivered patient incentive) and 2) an individual-level trial (mail-delivered patient incentive). Control and intervention arms included encouragement to complete ACP, instructions for using an online ACP tool, and (in the intervention arm) $50 for completing the online ACP tool and a small probability of $1000 (i.e., lottery) for discussing ACP with their PCP. The primary outcome was provider-reported ACP discussion within three months. In the provider-delivered patient incentive study, 38 PCPs were randomized to the intervention (n = 18) or control (n = 20) and given 10 patient packets each to distribute. Using an intention-to-treat analysis, there were 27 of 180 ACP discussions (15%) in the intervention group and 5 of 200 (2.5%) in the control group (P = .0391). In the mail-delivered patient incentive study, there were 5 of 187 ACP discussions (2.7%) in the intervention group and 5 of 189 (2.6%) in the control group (P = .99). ACP rates were low despite an existing provider financial incentive. Adding a provider-delivered patient financial incentive, but not a mail-delivered patient incentive, modestly increased ACP discussions. PCP encouragement combined with a patient incentive may be more powerful than either encouragement or incentive alone. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

Europium-doped amorphous calcium phosphate porous nanospheres: preparation and application as luminescent drug carriers

Directory of Open Access Journals (Sweden)

Zhang Kui-Hua

2011-01-01

Full Text Available Abstract Calcium phosphate is the most important inorganic constituent of biological tissues, and synthetic calcium phosphate has been widely used as biomaterials. In this study, a facile method has been developed for the fabrication of amorphous calcium phosphate (ACP/polylactide-block-monomethoxy(polyethyleneglycol hybrid nanoparticles and ACP porous nanospheres. Europium-doping is performed to enable photoluminescence (PL function of ACP porous nanospheres. A high specific surface area of the europium-doped ACP (Eu3+:ACP porous nanospheres is achieved (126.7 m2/g. PL properties of Eu3+:ACP porous nanospheres are investigated, and the most intense peak at 612 nm is observed at 5 mol% Eu3+ doping. In vitro cytotoxicity experiments indicate that the as-prepared Eu3+:ACP porous nanospheres are biocompatible. In vitro drug release experiments indicate that the ibuprofen-loaded Eu3+:ACP porous nanospheres show a slow and sustained drug release in simulated body fluid. We have found that the cumulative amount of released drug has a linear relationship with the natural logarithm of release time (ln(t. The Eu3+:ACP porous nanospheres are bioactive, and can transform to hydroxyapatite during drug release. The PL properties of drug-loaded nanocarriers before and after drug release are also investigated.

Casein Phosphopeptide-Amorphous Calcium Phosphate Reduces Streptococcus mutans Biofilm Development on Glass Ionomer Cement and Disrupts Established Biofilms.

Science.gov (United States)

Dashper, Stuart G; Catmull, Deanne V; Liu, Sze-Wei; Myroforidis, Helen; Zalizniak, Ilya; Palamara, Joseph E A; Huq, N Laila; Reynolds, Eric C

2016-01-01

Glass ionomer cements (GIC) are dental restorative materials that are suitable for modification to help prevent dental plaque (biofilm) formation. The aim of this study was to determine the effects of incorporating casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) into a GIC on the colonisation and establishment of Streptococcus mutans biofilms and the effects of aqueous CPP-ACP on established S mutans biofilms. S. mutans biofilms were either established in flow cells before a single ten min exposure to 1% w/v CPP-ACP treatment or cultured in static wells or flow cells with either GIC or GIC containing 3% w/w CPP-ACP as the substratum. The biofilms were then visualised using confocal laser scanning microscopy after BacLight LIVE/DEAD staining. A significant decrease in biovolume and average thickness of S. mutans biofilms was observed in both static and flow cell assays when 3% CPP-ACP was incorporated into the GIC substratum. A single ten min treatment with aqueous 1% CPP-ACP resulted in a 58% decrease in biofilm biomass and thickness of established S. mutans biofilms grown in a flow cell. The treatment also significantly altered the structure of these biofilms compared with controls. The incorporation of 3% CPP-ACP into GIC significantly reduced S. mutans biofilm development indicating another potential anticariogenic mechanism of this material. Additionally aqueous CPP-ACP disrupted established S. mutans biofilms. The use of CPP-ACP containing GIC combined with regular CPP-ACP treatment may lower S. mutans challenge.

A Trial Study of Moxibustion with a Warming Needle on Edema

Directory of Open Access Journals (Sweden)

Wen-Ping Zhang

2017-02-01

Full Text Available Edema is an accumulation of an excessive amount of watery fluid in cells or intercellular tissues. In order to examine the effects of acupuncture and moxibustion on edema, seven subjects were randomly divided into three groups, that was a Control group, an Acupuncture group (Acp, and an acupuncture and moxibustion group (Acp-Mox. After sitting for 60 minutes keeping their bodies still, the Acp and Acp-Mox subjects were administered acupuncture or acupuncture/moxibustion on the points of Zusanli (ST-36 and Sanyinjiao (SP-6, separately as against the Control group who only lied on the bed after modelization. After modelization at 60 minutes, the skin temperature and blood flow of all the groups were significantly lower in blood flow when compared with premodelization. But shortly after the procedure at 80 minutes, skin temperature in the Acp and Acp-Mox groups were significantly increased when compared with premodelization (vs. 60 minutes, p < 0.05. Moreover, the skin temperature and blood flow of the Acp-Mox group were significantly increased as compared to both the Control and the Acp group at the 80-minute time point. These results indicate that Acp and Mox-Acp could relieve edematous conditions significantly, especially the procedure of moxibustion with warming needle, was effective in improving edema which is often accompanied with cold intolerance and would be a recommended and superior therapy for edema.

Factors associated with advance care planning discussions by area agency on aging care managers.

Science.gov (United States)

Hazelett, Susan; Baughman, Kristin R; Palmisano, Barbara R; Sanders, Margaret; Ludwick, Ruth E

2013-12-01

Initiating advance care planning (ACP) discussions in the home may prevent avoidable hospitalizations by elucidating goals of care. Area agencies on aging care managers (AAACMs) work in the home with high-risk consumers. To determine which AAACM characteristics contribute to an increased frequency of ACP discussions. Cross-sectional investigator-generated surveys administered to AAACMs at 3 AAAs in Ohio. Of 289 AAACMs, 182 (63%) responded. The more experience and comfort AAACMs felt with ACP discussions, the more likely they were to initiate ACP discussions. It may be necessary to build interactive educational experiences where, for example, AAACMs are asked to fill out their own advance directives and/or facilitate others in ACP discussions to improve experience and comfort with ACP discussions.

A novel approach for over-expression, characterization, and isotopic enrichment of a homogeneous species of acyl carrier protein from Plasmodium falciparum

International Nuclear Information System (INIS)

Sharma, Shailendra Kumar; Modak, Rahul; Sharma, Shilpi; Sharma, Alok Kumar; Sarma, Siddhartha P.; Surolia, Avadhesha; Surolia, Namita

2005-01-01

Acyl carrier protein (ACP) plays a central role in fatty acid biosynthesis by transferring the acyl groups from one enzyme to another for the completion of the fatty acid synthesis cycle. Holo-ACP is the obligatory substrate for the synthesis of acyl-ACPs which act as the carrier and donor for various metabolic reactions. Despite its interactions with numerous proteins in the cell, its mode of interaction is poorly understood. Here, we report the over-expression of PfACP in minimal medium solely in its holo form and in high yield. Expression in minimal media provides a means to isotopically label PfACP for high resolution multi-nuclear and multi-dimensional NMR studies. Indeed, the proton-nitrogen correlated NMR spectrum exhibits very high chemical shift dispersion and resolution. We also show that holo-PfACP thus expressed is amenable to acylation reactions using Escherichia coli acyl-ACP synthetase as well as by standard chemical methods

Recognizing Multi-user Activities using Wearable Sensors in a Smart Home

DEFF Research Database (Denmark)

Wang, Liang; Gu, Tao; Tao, Xianping

2010-01-01

The advances of wearable sensors and wireless networks oer many opportunities to recognize human activities from sensor readings in pervasive computing. Existing work so far focuses mainly on recognizing activities of a single user in a home environment. However, there are typically multiple inha...

[2- (2, 4-dimethylphenylthio) phenyl] aniline and it

Indian Academy of Sciences (India)

Sambhaji

MgSO4, 0.5 g aspargine and 2 ml glycerol in distilled water (100 ml) followed by pH ..... aniline and its derivatives with the crystal structure of. Page 13. 13. Mycobacterium tuberculosis enoyl-acyl carrier protein reductase (InhA) (PDB ID: 4TZK).

Enhanced removal of humic acid from aqueous solution by novel stabilized nano-amorphous calcium phosphate: Behaviors and mechanisms

Science.gov (United States)

Jiang, Ling; Li, Yiming; Shao, Yi; Zhang, Yong; Han, Ruiming; Li, Shiyin; Wei, Wei

2018-01-01

Stabilized nano-amorphous calcium phosphate (nACP) was prepared using polyethylene glycol as stabilizer to obtain a nanosized amorphous adsorbent. The produced nACP was evaluated by using XRD, FTIR, SEM and X-ray photoelectron spectroscopy (XPS). The sedimentation test demonstrated that nACP exhibited better stability than crystallized hydroxyapatite. The adsorption efficiency of the nACP material for aqueous humic acid (HA) was evaluated from the point of view of medium pH, adsorption time, temperature, and ionic strength, as well as the presences of metal ions. The results of the study showed very good adsorption performance towards aqueous HA. The Sips modeling results revealed that the stabilized nACP adsorbent had a considerably high adsorption capacity (248.3 mg/g) for HA at 298 K. The adsorption data fitted well into pseudo-second order and Elovich kinetic models. XPS analyses indicated that HA retention on nACP material might be due to the surface complexation reaction between oxygen-containing group and calcium of HA and nACP, respectively. Moreover, the HA adsorption capacity of nACP could still keep more than 86% after four adsorption-desorption cycles. By taking into account all results it was concluded that the nACP adsorbent leveraged its stability in combination with its high uptake capacity to offer a great promise for HA adsorption from water.

Barriers to and Facilitators of South Asian Indian-Americans' Engagement in Advanced Care Planning Behaviors.

Science.gov (United States)

Radhakrishnan, Kavita; Saxena, Shubhada; Jillapalli, Regina; Jang, Yuri; Kim, Miyong

2017-05-01

To identify barriers to and facilitators of older South Asian Indian-Americans' (SAIAs') engagement in behaviors associated with advance care planning (ACP). Using a descriptive qualitative design guided by the transcultural nursing assessment model, data were collected in focus groups of community-dwelling older SAIA participants, SAIA family caregivers, and SAIA physicians. A directed approach using predetermined coding categories derived from the Transcultural Nursing Assessment model and aided by NVivo 10 software (Melbourne, Australia) facilitated the qualitative data analysis. Eleven focus groups with 36 older SAIAs (61% female, 83% 70+ years old), 10 SAIA family caregivers, and 4 SAIA physicians indicated prior lack of awareness of ACP, good health status, lack of access to linguistically and health literacy-tailored materials, healthcare provider hesitation to initiate discussions on ACP, trust in healthcare providers' or oldest sons' decision making, busy family caregiver work routines, and cultural assumptions about filial piety and after-death rituals as major barriers to engaging in ACP. Introducing ACP using personal anecdotes in a neutral, group-based community setting and incentivizing ACP discussions by including long-term care planning were suggested as facilitators to engage in ACP. The study's findings will guide development of culturally sensitive interventions to raise awareness about ACP among SAIAs and encourage SAIA older adults to engage in ACP. © 2017 Sigma Theta Tau International.

Barriers to and Facilitators of South Asian Indian-Americans’ Engagement in Advanced Care Planning Behaviors

Science.gov (United States)

Radhakrishnan, Kavita; Saxena, Shubhada; Jillapalli, Regina; Jang, Yuri; Kim, Miyong

2018-01-01

Purpose To identify barriers to and facilitators of older South Asian Indian-Americans’ (SAIAs’) engagement in behaviors associated with advance care planning (ACP). Methods Using a descriptive qualitative design guided by the transcultural nursing assessment model, data were collected in focus groups of community-dwelling older SAIA participants, SAIA family caregivers, and SAIA physicians. A directed approach using predetermined coding categories derived from the Transcultural Nursing Assessment model and aided by NVivo 10 software (Melbourne, Australia) facilitated the qualitative data analysis. Results Eleven focus groups with 36 older SAIAs (61% female, 83% 70+ years old), 10 SAIA family caregivers, and 4 SAIA physicians indicated prior lack of awareness of ACP, good health status, lack of access to linguistically and health literacy–tailored materials, healthcare provider hesitation to initiate discussions on ACP, trust in healthcare providers’ or oldest sons’ decision making, busy family caregiver work routines, and cultural assumptions about filial piety and after-death rituals as major barriers to engaging in ACP. Introducing ACP using personal anecdotes in a neutral, group-based community setting and incentivizing ACP discussions by including long-term care planning were suggested as facilitators to engage in ACP. Clinical Relevance The study’s findings will guide development of culturally sensitive interventions to raise awareness about ACP among SAIAs and encourage SAIA older adults to engage in ACP. PMID:28388828

Structural changes in precipitates and cell model for the conversion of amorphous calcium phosphate to hydroxyapatite during the initial stage of precipitation

Science.gov (United States)

Zyman, Z.; Rokhmistrov, D.; Glushko, V.

2012-08-01

A new insight on the conversion of an amorphous calcium phosphate, ACP, to hydroxyapatite, HA, has been proposed. The ACP has been precipitated under appropriate conditions of the nitrous method (low concentrations of reactants, pH>10, 25 °С, fast mixing). The ACP to HA conversion has been found to commence immediately after the ACP precipitation. The conversion reveals itself in the first detected shift of the diffuse maximum from 29.5° 2θ (ACP) to about 32° 2θ (the position of principal peaks of HA) in the XRD patterns for the precipitates of 2 min-6 h lifetimes. The precipitates are biphasic mixtures of ACP and nanocrystalline HA, nHA, with increasing nHA/ACP ratio for longer lifetimes. Characteristics of the simulated XRD profiles calculated proceeding on such a picture are excellently confirmed by experimental results. At the end of the conversion, HA nanocrystals start growing. This follows from the appearance of broadened diffraction maxima, which gradually sharpen, along with the appearance and gradual increase of splitting of the initially featureless υ3 and υ4PO43- bands in the IR spectra of precipitates with their aging (after 6 h of the precipitation). Based on the detected structural and compositional peculiarities of ACP in the early stage of precipitation, a cell model for the HA crystallization has been proposed. Proceeding on the model, the principal data in this and earlier studies, considering the ACP to HA conversion as an internal rearrangement process in the ACP particles, has been reasonably explained.

Casein Phosphopeptide-Amorphous Calcium Phosphate Reduces Streptococcus mutans Biofilm Development on Glass Ionomer Cement and Disrupts Established Biofilms.

Directory of Open Access Journals (Sweden)

Stuart G Dashper

Full Text Available Glass ionomer cements (GIC are dental restorative materials that are suitable for modification to help prevent dental plaque (biofilm formation. The aim of this study was to determine the effects of incorporating casein phosphopeptide-amorphous calcium phosphate (CPP-ACP into a GIC on the colonisation and establishment of Streptococcus mutans biofilms and the effects of aqueous CPP-ACP on established S mutans biofilms. S. mutans biofilms were either established in flow cells before a single ten min exposure to 1% w/v CPP-ACP treatment or cultured in static wells or flow cells with either GIC or GIC containing 3% w/w CPP-ACP as the substratum. The biofilms were then visualised using confocal laser scanning microscopy after BacLight LIVE/DEAD staining. A significant decrease in biovolume and average thickness of S. mutans biofilms was observed in both static and flow cell assays when 3% CPP-ACP was incorporated into the GIC substratum. A single ten min treatment with aqueous 1% CPP-ACP resulted in a 58% decrease in biofilm biomass and thickness of established S. mutans biofilms grown in a flow cell. The treatment also significantly altered the structure of these biofilms compared with controls. The incorporation of 3% CPP-ACP into GIC significantly reduced S. mutans biofilm development indicating another potential anticariogenic mechanism of this material. Additionally aqueous CPP-ACP disrupted established S. mutans biofilms. The use of CPP-ACP containing GIC combined with regular CPP-ACP treatment may lower S. mutans challenge.

Current advance care planning practice in the Australian community: an online survey of home care package case managers and service managers.

Science.gov (United States)

Sellars, Marcus; Detering, Karen M; Silvester, William

2015-04-23

Advance care planning (ACP) is the process of planning for future healthcare that is facilitated by a trained healthcare professional, whereby a person's values, beliefs and treatment preferences are made known to guide clinical decision-making at a future time when they cannot communicate their decisions. Despite the potential benefits of ACP for community aged care clients the availability of ACP is unknown, but likely to be low. In Australia many of these clients receive services through Home Care Package (HCP) programs. This study aimed to explore current attitudes, knowledge and practice of advance care planning among HCP service managers and case managers. An invitation to take part in a cross-sectional online survey was distributed by email to all HCP services across Australia in November 2012. Descriptive analyses were used to examine overall patterns of responses to each survey item in the full sample. 120 (response rate 25%) service managers and 178 (response rate 18%) case managers completed the survey. Only 34% of services had written ACP policies and procedures in place and 48% of case managers had previously completed any ACP training. In addition, although most case managers (70%) had initiated an ACP discussion in the past 12 months and viewed ACP as part of their role, the majority of the conversations (80%) did not result in documentation of the client's wishes and most (85%) of the case managers who responded did not believe ACP was done well within their service. This survey shows low organisational ACP systems and support for case managers and a lack of a normative approach to ACP across Australian HCP services. As HCPs become more prevalent it is essential that a model of ACP is developed and evaluated in this setting, so that clients have the opportunity to discuss and document their future healthcare wishes if they choose to.

delta 6 Hexadecenoic acid is synthesized by the activity of a soluble delta 6 palmitoyl-acyl carrier protein desaturase in Thunbergia alata endosperm.

Science.gov (United States)

Cahoon, E B; Cranmer, A M; Shanklin, J; Ohlrogge, J B

1994-11-04

delta 6 Hexadecenoic acid (16:1 delta 6) composes more than 80% of the seed oil of Thunbergia alata. Studies were conducted to determine the biosynthetic origin of the double bond of this unusual fatty acid. Assays of fractions of developing T. alata seed endosperm with [1-14C]palmitoyl (16:0)-acyl carrier protein (ACP) revealed the presence of a soluble delta 6 desaturase activity. This activity was greatest when 16:0-ACP was provided as a substrate, whereas no desaturation of the coenzyme A ester of this fatty acid was detected. In addition, delta 6 16:0-ACP desaturase activity in T. alata endosperm extracts was dependent on the presence of ferredoxin and molecular oxygen and was stimulated by catalase. To further characterize this enzyme, a cDNA encoding a diverged acyl-ACP desaturase was isolated from a T. alata endosperm cDNA library using polymerase chain reaction with degenerate oligonucleotides corresponding to conserved amino acid sequences in delta 9 stearoyl (18:0)- and delta 4 16:0-ACP desaturases. The primary structure of the mature peptide encoded by this cDNA shares 66% identity with the mature castor delta 9 18:0-ACP desaturase and 57% identity with the mature coriander delta 4 16:0-ACP desaturase. Extracts of Escherichia coli that express the T. alata cDNA catalyzed the delta 6 desaturation of 16:0-ACP. These results demonstrate that 16:1 delta 6 in T. alata endosperm is formed by the activity of a soluble delta 6 16:0-ACP desaturase that is structurally related to the delta 9 18:0- and delta 4 16:0-ACP desaturases. Implications of this work to an understanding of active site structures of acyl-ACP desaturases are discussed.

An In Vitro Study on the Effect of Amorphous Calcium Phosphate and Fluoride Solutions on Color Improvement of White Spot Lesions

Directory of Open Access Journals (Sweden)

Fahimeh Farzanegan

2018-06-01

Full Text Available The ability of remineralizing agents to improve the color of white spot lesions (WSL is an important aspect that should be investigated. The aim of this study was to evaluate the effects of 0.05% amorphous calcium phosphate (ACP, 0.5% ACP, and 0.05% fluoride solutions, as well as artificial saliva on the color improvement of white spot lesions (WSLs. In this in vitro study, 50 human premolar teeth were randomly classified into five groups. At baseline, all the samples were assessed by using a colorimeter (E0. Then, white spot lesions were induced on the surface of the teeth by means of a pH-cycling model, and the colorimeter was used again (E1. Afterwards, samples of the 1st and 2nd groups were kept in 0.05% ACP and 0.5% ACP solutions for 1 min/day, respectively. The 3rd group specimens were placed in 0.05% fluoride solution for 1 min/day. The other two groups were kept in artificial saliva and distilled in water separately. All the samples were assessed by the colorimeter for a third time (E2. We found no significant difference between the groups in ∆E1. There was also no significant difference among 0.05% ACP solution, 0.5% ACP solution, 0.05% fluoride solution, and artificial saliva considering ∆E2. However, a significant difference was noted between the above-mentioned solutions and distilled water in ∆E2. With respect to ∆E3, there were considerable differences between ACP solution and artificial saliva. The same results were obtained for the difference between fluoride solution and artificial saliva. However, no significant difference was found among 0.05% ACP, 0.5% ACP, and 0.05% fluoride solutions in terms of ∆E3. In Conclusion, ACP is as effective as fluoride in the color improvement of WSLs and the recommended treatment for this purpose is daily use of 0.05% ACP, 0.5% ACP or 0.05% fluoride solutions.

Casein phosphopeptide-amorphous calcium phosphate and shear bond strength of adhesives to primary teeth enamel.

Science.gov (United States)

Farokh Gisovar, Elham; Hedayati, Nassim; Shadman, Niloofar; Shafiee, Leila

2015-02-01

CPP-ACP (Phosphopeptide-Amorphous Calcium Phosphate) has an important role in caries prevention in pediatric patients. This study was done, because of the great use of CPP-ACP and the need for restoration for teeth treated with CPP-ACP as well as the importance of shear bond strength of adhesives in the success of restorations. This study aimed to evaluate the effect of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) on shear bond strength of dental adhesives to enamel of primary teeth molars. This in vitro study was conducted on 180 extracted primary molars. They were randomly divided into 6 groups and each group was divided into 2 subgroups (treated with CPP-ACP and untreated). In subgroups with CPP-ACP, enamel was treated with CPP-ACP paste 1 h/d for 5 days. Types of adhesives that were evaluated in this study were Tetric N-Bond, AdheSE, AdheSE One F, single Bond 2, SE Bond, and Adper Prompt L-Pop. Shear bond strength was tested with a universal testing machine and mode of failure was evaluated under stereomicroscope. Data were analyzed by T test, 2-way analysis of variance (ANOVA), Tukey and Fisher exact test using SPSS18. P adhesive systems to enamel of primary teeth treated and untreated with CPP-ACP showed no significant difference (P > 0.05). Mode of failure in all groups regardless of CPP-ACP administration was mainly adhesive type. Our results indicated that CPP-ACP did not affect shear bond strength of studied adhesives to primary teeth enamel. To have a successful and durable composite restoration, having a high strength bonding is essential. Considering the wide use of CPP-ACP in preventing tooth decay and the role of adhesive shear bond strength (SBS) in success of composite restoration, we conducted the present study to evaluate the effect of CPP-ACP on the SBS of adhesives to primary teeth enamel.

Conceptual structure design of experimental facility for advanced spent fuel conditioning process

International Nuclear Information System (INIS)

Joo, J. S.; Koo, J. H.; Jung, W. M.; Jo, I. J.; Kook, D. H.; Yoo, K. S.

2003-01-01

A study on the advanced spent fuel conditioning process (ACP) is carring out for the effective management of spent fuels of domestic nuclear power plants. This study presents basic shielding design, modification of IMEF's reserve hot cell facility which reserved for future usage, conceptual and structural architecture design of ACP hot cell and its contents, etc. considering the characteristics of ACP. The results of this study will be used for the basic and detail design of ACP demonstration facility, and utilized as basic data for the safety evaluation as essential data for the licensing of the ACP facility

Drug priming enhances radiosensitivity of adamantinomatous craniopharyngioma via downregulation of survivin.

Science.gov (United States)

Stache, Christina; Bils, Christiane; Fahlbusch, Rudolf; Flitsch, Jörg; Buchfelder, Michael; Stefanits, Harald; Czech, Thomas; Gaipl, Udo; Frey, Benjamin; Buslei, Rolf; Hölsken, Annett

2016-12-01

OBJECTIVE In this study, the authors investigated the underlying mechanisms responsible for high tumor recurrence rates of adamantinomatous craniopharyngioma (ACP) after radiotherapy and developed new targeted treatment protocols to minimize recurrence. ACPs are characterized by the activation of the receptor tyrosine kinase epidermal growth factor receptor (EGFR), known to mediate radioresistance in various tumor entities. The impact of tyrosine kinase inhibitors (TKIs) gefitinib or CUDC-101 on radiation-induced cell death and associated regulation of survivin gene expression was evaluated. METHODS The hypothesis that activated EGFR promotes radioresistance in ACP was investigated in vitro using human primary cell cultures of ACP (n = 10). The effects of radiation (12 Gy) and combined radiochemotherapy on radiosensitivity were assessed via cell death analysis using flow cytometry. Changes in target gene expression were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). Survivin, identified in qRT-PCR to be involved in radioresistance of ACP, was manipulated by small interfering RNA (siRNA), followed by proliferation and vitality assays to further clarify its role in ACP biology. Immunohistochemically, survivin expression was assessed in patient tumors used for primary cell cultures. RESULTS In primary human ACP cultures, activation of EGFR resulted in significantly reduced cell death levels after radiotherapy. Treatment with TKIs alone and in combination with radiotherapy increased cell death response remarkably, assessed by flow cytometry. CUDC-101 was significantly more effective than gefitinib. The authors identified regulation of survivin expression after therapeutic intervention as the underlying molecular mechanism of radioresistance in ACP. EGFR activation promoting ACP cell survival and proliferation in vitro is consistent with enhanced survivin gene expression shown by qRT-PCR. TKI treatment, as well as the combination with

Incorporation of casein phosphopeptide-amorphous calcium phosphate into a glass-ionomer cement.

Science.gov (United States)

Mazzaoui, S A; Burrow, M F; Tyas, M J; Dashper, S G; Eakins, D; Reynolds, E C

2003-11-01

Casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) nanocomplexes have been shown to prevent demineralization and promote remineralization of enamel subsurface lesions in animal and in situ caries models. The aim of this study was to determine the effect of incorporating CPP-ACP into a self-cured glass-ionomer cement (GIC). Incorporation of 1.56% w/w CPP-ACP into the GIC significantly increased microtensile bond strength (33%) and compressive strength (23%) and significantly enhanced the release of calcium, phosphate, and fluoride ions at neutral and acidic pH. MALDI mass spectrometry also showed casein phosphopeptides from the CPP-ACP nanocomplexes to be released. The release of CPP-ACP and fluoride from the CPP-ACP-containing GIC was associated with enhanced protection of the adjacent dentin during acid challenge in vitro.

Seleção de variáveis para clusterização de bateladas produtivas através de ACP e remapeamento kernel

Directory of Open Access Journals (Sweden)

Victor Leonardo Cervo

2015-12-01

Full Text Available Técnicas de clusterização visam à formação de grupos de observações homogêneas dentro de um mesmo grupo e significativamente distintas das observações inseridas em outros grupos. Em processos industriais cuja produção é apoiada em bateladas, a definição de famílias (grupos de bateladas com perfis semelhantes auxilia na definição de estratégias de controle e monitoramento desses processos. Este artigo propõe um método para seleção das variáveis de clusterização mais relevantes para formação de famílias de bateladas. Para tanto, integra funções kernel a um novo índice de importância de variáveis gerado a partir dos parâmetros oriundos da Análise de Componentes Principais (ACP. A qualidade dos agrupamentos formados é avaliada através do Silhouette Index (SI. Quando aplicada em três processos produtivos, a sistemática proposta reteve em média 5,16% das variáveis iniciais e elevou o SI médio em 235,4% frente à utilização de todas as variáveis. Um estudo de simulação também é realizado para avaliar a robustez do método.

Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

Science.gov (United States)

Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong

2014-10-01

Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

Understanding advance care planning within the South Asian community.

Science.gov (United States)

Biondo, Patricia D; Kalia, Rashika; Khan, Rooh-Afza; Asghar, Nadia; Banerjee, Cyrene; Boulton, Debbie; Marlett, Nancy; Shklarov, Svetlana; Simon, Jessica E

2017-10-01

Advance care planning (ACP) is a process of reflection on and communication of a person's future health-care preferences. Evidence suggests visible minorities engage less in ACP. The South Asian ethnic group is the largest visible minority group in Canada, and information is needed to understand how ACP is perceived and how best to approach ACP within this diverse community. To explore perspectives of South Asian community members towards ACP. Peer-to-peer inquiry. South Asian community members who graduated from the Patient and Community Engagement Research programme (PaCER) at the University of Calgary utilized the PaCER method (SET, COLLECT and REFLECT) to conduct a focus group, family interviews and a community forum. Fifty-seven community-dwelling men and women (22-86 years) who self-identified with the South Asian community in Calgary, Alberta, Canada. The concept of ACP was mostly foreign to this community and was often associated with other end-of-life issues such as organ donation and estate planning. Cultural aspects (e.g. trust in shared family decision making and taboos related to discussing death), religious beliefs (e.g. fatalism) and immigration challenges (e.g. essential priorities) emerged as barriers to participation in ACP. However, participants were eager to learn about ACP and recommended several engagement strategies (e.g. disseminate information through religious institutions and community centres, include families in ACP discussions, encourage family physicians to initiate discussions and translate materials). Use of a patient engagement research model proved highly successful in understanding South Asian community members' participation in ACP. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

Does Volunteering Experience Influence Advance Care Planning in Old Age?

Science.gov (United States)

Shen, Huei-Wern; Khosla, Nidhi

2016-07-01

Advance care planning (ACP) increases the likelihood patients will receive end-of-life care that is congruent with their preferences and lowers stress among both patients and caregivers. Previous efforts to increase ACP have mainly focused on information provision in the very late stage of life. This study examines whether a relationship exists between volunteering and ACP, and whether this relationship is associated with social support. The sample comprises 877 individuals who were aged 55+ in 2008, and were deceased before 2010. The sample is derived from seven waves (1998-2010) of data from the Health and Retirement Study. Logistic regression results showed that overall ACP and durable power of attorney for health care (DPAHC) were both higher (OR = 1.61 and 1.71, respectively) for older adults with volunteering experience in the past 10 years than those without such experience. Available social support (relatives and friends living nearby) was not associated with the relationship between volunteering and ACP. Other factors related to ACP included poorer health, death being expected, death due to cancer, older age, and being a racial minority. Involving older people in volunteer work may help to increase ACP. Future research is encouraged to identify reasons for the association between volunteering and ACP.

FRIENDS WITH BENEFITS IN PUERTO RICAN COLLEGE STUDENTS

Directory of Open Access Journals (Sweden)

Randy Quiñones

2017-01-01

Full Text Available Una relación de amigo o amiga con privilegio (ACP tiene tres componentes; la presencia de una amistad, la actividad sexual y la ausencia de un compromiso establecido. El objetivo principal de esta investigación cuantitativa no experimental fue explorar como correlacionan distintos niveles de religiosidad y búsqueda de sensaciones en estudiantes puertorriqueños que reportan tener ACP. Se administraron tres cuestionarios en español a estudiantes de distintas universidades del área metropolita na de Puerto Rico. El 61.8% de la muestra reportó experiencias con ACP alguna vez en sus vidas y el 17.9% estaban en una relación de ACP al momento del estudio. De éstos, el 40% reportó tener más de un ACP. Consistente con las hipótesis planteadas, altos n iveles de búsqueda de sensaciones estuvo asociado a un mayor número de relaciones de ACP ( p< . 05. Los resultados ayudan a informarnos sobre las motivaciones y expectativas de estudiantes universitarios que tienen ACP.

Advance Care Planning Documentation in Electronic Health Records: Current Challenges and Recommendations for Change.

Science.gov (United States)

Lamas, Daniela; Panariello, Natalie; Henrich, Natalie; Hammes, Bernard; Hanson, Laura C; Meier, Diane E; Guinn, Nancy; Corrigan, Janet; Hubber, Sean; Luetke-Stahlman, Hannah; Block, Susan

2018-04-01

To develop a set of clinically relevant recommendations to improve the state of advance care planning (ACP) documentation in the electronic health record (EHR). Advance care planning (ACP) is a key process that supports goal-concordant care. For preferences to be honored, clinicians must be able to reliably record, find, and use ACP documentation. However, there are no standards to guide ACP documentation in the electronic health record (EHR). We interviewed 21 key informants to understand the strengths and weaknesses of EHR documentation systems for ACP and identify best practices. We analyzed these interviews using a qualitative content analysis approach and subsequently developed a preliminary set of recommendations. These recommendations were vetted and refined in a second round of input from a national panel of content experts. Informants identified six themes regarding current inadequacies in documentation and accessibility of ACP information and opportunities for improvement. We offer a set of concise, clinically relevant recommendations, informed by expert opinion, to improve the state of ACP documentation in the EHR.

Structural analysis of advanced spent fuel conditioning process

International Nuclear Information System (INIS)

Gu, J. H.; Jung, W. M.; Jo, I. J.; Gug, D. H.; Yoo, K. S.

2003-01-01

An advanced spent fuel conditioning process (ACP) is developing for the safe and effective management of spent fuels which arising from the domestic nuclear power plants. And its demonstration facility is under design. This facility will be prepared by modifying IMEF's reserve hot cell facility which reserved for future usage by considering the characteristics of ACP. This study presents a basic structural architecture design and analysis results of ACP hot cell including modification of the IMEF. The results of this study will be used for the detail design of ACP demonstration facility, and utilized as basic data for the licensing of the ACP facility

Effect of vanadium compounds on acid phosphatase activity.

Science.gov (United States)

Vescina, C M; Sálice, V C; Cortizo, A M; Etcheverry, S B

1996-01-01

The direct effect of different vanadium compounds on acid phosphatase (ACP) activity was investigated. Vanadate and vanadyl but not pervanadate inhibited the wheat germ ACP activity. These vanadium derivatives did not alter the fibroblast Swiss 3T3 soluble fraction ACP activity. Using inhibitors of tyrosine phosphatases (PTPases), the wheat germ ACP was partially characterized as a PTPase. This study suggests that the inhibitory ability of different vanadium derivatives to modulate ACP activity seems to depend on the geometry around the vanadium atom more than on the oxidation state. Our results indicate a correlation between the PTPase activity and the sensitivity to vanadate and vanadyl cation.

Improving advance care planning for English-speaking and Spanish-speaking older adults: study protocol for the PREPARE randomised controlled trial

OpenAIRE

Sudore, RL; Barnes, DE; Le, GM; Ramos, R; Osua, SJ; Richardson, SA; Boscardin, J; Schillinger, D

2016-01-01

Introduction Advance care planning (ACP) is a process that allows patients to identify their goals for medical care. Traditionally, ACP has focused on completing advance directives; however, we have expanded the ACP paradigm to also prepare patients to communicate their wishes and make informed decisions. To this end, we created an ACP website called PREPARE (http://www.prepareforyourcare.org) to prepare diverse English-speaking and Spanish-speaking older adults for medical decision-making. H...

Effect of revaccination with BCG in early childhood on mortality: randomised trial in Guinea-Bissau

DEFF Research Database (Denmark)

Roth, A.E.; Benn, Christine Stabell; Ravn, H.

2010-01-01

Objective To determine whether BCG revaccination at 19 months of age reduces overall child mortality. Design Randomised trial, with follow-up to age 5. Setting A health project in Bissau, Guinea-Bissau, which maintains a health and demographic surveillance system in an urban area with 90 000 inha...

Syntheses of copper complexes of nicotinohydroxamic and ...

African Journals Online (AJOL)

Nicotinohydroxamic acid (NHA) and isonicotinohydroxamic acid (INHA) were synthesized, characterized by electronic and spectral studies,magnetic measurements and their pKa determined spectrophotometrically as 8.68 ± 0.02 in aqueous medium of 0.1mol dm-3 I=ionic strength. The composition of the complexes was ...

Autologous Conditioned Plasma Versus Placebo Injection Therapy in Lateral Epicondylitis of the Elbow: A Double Blind, Randomized Study.

Science.gov (United States)

Schöffl, Volker; Willauschus, Wolfgang; Sauer, Felix; Küpper, Thomas; Schöffl, Isabelle; Lutter, Christoph; Gelse, Kolja; Dickschas, Jörg

2017-01-01

Introduction  There are various therapeutic approaches to the treatment of lateral epicondylitis, a highly prevalent musculoskeletal disorder. Recently, injection therapy with autologous conditioned plasma (ACP) has shown promise as a new approach. Methods  Set up as a prospective, double-blind, randomized controlled clinical trial, this study involved 50 patients with lateral epicondylitis. Following external randomization, 25 patients received one round of injection therapy with ACP (platelet rich plasma, PRP), while the remaining 25 patients received a placebo of 0.9 % NaCl. All patients were re-evaluated with respect to lateral epicondylitis of the elbow at four-weeks and six-months post-injection. Results  Out of 50 patients, 36 qualified for reevaluation, 18 patients from the ACP therapy group and 18 from the placebo group. The initial Disability of the Arm, Shoulder and Hand (DASH) score for all reevaluated patients was 36.4 in the ACP group, and 41.0 in the placebo group; both groups exhibited decreased DASH scores at the four-week and six-month post-injection follow-up (6 months: ACP 30.1, placebo 25.8). The decrease of the DASH score after 4 weeks was greater and qualified as statistically significant in the placebo group (p = 0.041), compared to the DASH score decrease in the ACP treatment group, which was statistically non-significant. Additionally, the difference between the DASH scores of the treatment and placebo groups was statistically non-significant four weeks and six months after treatment. Discussion  The results of this study suggest a therapeutic effect in both the ACP and placebo groups, with no evidence for a therapeutically significant difference between ACP and placebo treatments. It is hypothesized that, in accordance with the study protocols, injection with a local anaesthetic prior to ACP therapy may have an influence on the therapeutic effect of ACP. Future studies have to confirm recent findings that demonstrated a

How to achieve the desired outcomes of advance care planning in nursing homes: a theory of change.

Science.gov (United States)

Gilissen, J; Pivodic, L; Gastmans, C; Vander Stichele, R; Deliens, L; Breuer, E; Van den Block, L

2018-02-14

Advance care planning (ACP) has been identified as particularly relevant for nursing home residents, but it remains unclear how or under what circumstances ACP works and can best be implemented in such settings. We aimed to develop a theory that outlines the hypothetical causal pathway of ACP in nursing homes, i.e. what changes are expected, by means of which processes and under what circumstances. The Theory of Change approach is a participatory method of programme design and evaluation whose underlying intention is to improve understanding of how and why a programme works. It results in a Theory of Change map that visually represents how, why and under what circumstances ACP is expected to work in nursing home settings in Belgium. Using this approach, we integrated the results of two workshops with stakeholders (n = 27) with the results of a contextual analysis and a systematic literature review. We identified two long-term outcomes that ACP can achieve: to improve the correspondence between residents’ wishes and the care/treatment they receive and to make sure residents and their family feel involved in planning their future care and are confident their care will be according to their wishes. Besides willingness on the part of nursing home management to implement ACP and act accordingly, other necessary preconditions are identified and put in chronological order. These preconditions serve as precursors to, or requirements for, accomplishing successful ACP. Nine original key intervention components with specific rationales are identified at several levels (resident/family, staff or nursing home) to target the preconditions: selection of a trainer, ensuring engagement by management, training ACP reference persons, in-service education for healthcare staff, information for staff, general practitioners, residents and their family, ACP conversations and documentation, regular reflection sessions, multidisciplinary meetings, and formal monitoring. The Theory of

Tumour compartment transcriptomics demonstrates the activation of inflammatory and odontogenic programmes in human adamantinomatous craniopharyngioma and identifies the MAPK/ERK pathway as a novel therapeutic target.

Science.gov (United States)

Apps, John R; Carreno, Gabriela; Gonzalez-Meljem, Jose Mario; Haston, Scott; Guiho, Romain; Cooper, Julie E; Manshaei, Saba; Jani, Nital; Hölsken, Annett; Pettorini, Benedetta; Beynon, Robert J; Simpson, Deborah M; Fraser, Helen C; Hong, Ying; Hallang, Shirleen; Stone, Thomas J; Virasami, Alex; Donson, Andrew M; Jones, David; Aquilina, Kristian; Spoudeas, Helen; Joshi, Abhijit R; Grundy, Richard; Storer, Lisa C D; Korbonits, Márta; Hilton, David A; Tossell, Kyoko; Thavaraj, Selvam; Ungless, Mark A; Gil, Jesus; Buslei, Rolf; Hankinson, Todd; Hargrave, Darren; Goding, Colin; Andoniadou, Cynthia L; Brogan, Paul; Jacques, Thomas S; Williams, Hywel J; Martinez-Barbera, Juan Pedro

2018-05-01

Adamantinomatous craniopharyngiomas (ACPs) are clinically challenging tumours, the majority of which have activating mutations in CTNNB1. They are histologically complex, showing cystic and solid components, the latter comprised of different morphological cell types (e.g. β-catenin-accumulating cluster cells and palisading epithelium), surrounded by a florid glial reaction with immune cells. Here, we have carried out RNA sequencing on 18 ACP samples and integrated these data with an existing ACP transcriptomic dataset. No studies so far have examined the patterns of gene expression within the different cellular compartments of the tumour. To achieve this goal, we have combined laser capture microdissection with computational analyses to reveal groups of genes that are associated with either epithelial tumour cells (clusters and palisading epithelium), glial tissue or immune infiltrate. We use these human ACP molecular signatures and RNA-Seq data from two ACP mouse models to reveal that cell clusters are molecularly analogous to the enamel knot, a critical signalling centre controlling normal tooth morphogenesis. Supporting this finding, we show that human cluster cells express high levels of several members of the FGF, TGFB and BMP families of secreted factors, which signal to neighbouring cells as evidenced by immunostaining against the phosphorylated proteins pERK1/2, pSMAD3 and pSMAD1/5/9 in both human and mouse ACP. We reveal that inhibiting the MAPK/ERK pathway with trametinib, a clinically approved MEK inhibitor, results in reduced proliferation and increased apoptosis in explant cultures of human and mouse ACP. Finally, we analyse a prominent molecular signature in the glial reactive tissue to characterise the inflammatory microenvironment and uncover the activation of inflammasomes in human ACP. We validate these results by immunostaining against immune cell markers, cytokine ELISA and proteome analysis in both solid tumour and cystic fluid from ACP

Use of Video Decision Aids to Promote Advance Care Planning in Hilo, Hawai?i

OpenAIRE

Volandes, Angelo E.; Paasche-Orlow, Michael K.; Davis, Aretha Delight; Eubanks, Robert; El-Jawahri, Areej; Seitz, Rae

2016-01-01

Introduction: Advance care planning (ACP) seeks to promote care delivery that is concordant with patients’ informed wishes. Scalability and cost may be barriers to widespread ACP, and video decision aids may help address such barriers. Aim Our primary hypothesis was that ACP documentation would increase in Hilo after ACP video implementation. Secondary hypotheses included increased use of hospice, fewer deaths in the hospital, and decreased costs in the last month of life. Setting: The city o...

AcEST: BP921787 [AcEST

Lifescience Database Archive (English)

Full Text Available ... 37 0.49 tr|O04793|O04793_9ROSI Acyl-ACP thioesterase OS=Garcinia mangost... ...cyl-ACP thioesterase OS=Garcinia mangost... 36 0.84 tr|B8BDB0|B8BDB0_ORYSI Putative uncharacterized protein ...LRFAGAGDEINRGRTVWR 285 >tr|O04793|O04793_9ROSI Acyl-ACP thioesterase OS=Garcinia mango... LR A EINRGRTVW+ Sbjct: 248 QRQFLHCLRFAGNGNEINRGRTVWR 272 >tr|O04792|O04792_9ROSI Acyl-ACP thioesterase OS=Garcinia mango

GOTHIC Simulation of APR1400 Auxiliary Charging Pump room heat up

Energy Technology Data Exchange (ETDEWEB)

Ha, Hui-Un; Heo, Sun [KHNP, Daejeon (Korea, Republic of)

2014-10-15

As a part of the Advanced Power Reactor 1400 (APR1400) U. S. Nuclear Regulatory Commission Design Certification (NRC DC) project, we have been investigating Auxiliary Charging Pump (ACP) room heat up. With reference to the design specification of the ACP room, we determined input information and developed a GOTHIC model of the APR1400 ACP room. This calculation model is described herein, and representative results from the calculation are presented as well. The results of the present paper are used to determine the integrity of ACP operating in the accident. APR 1400 GOTHIC model was developed for ACP room heat up calculation. Calculation results confirm that door opening is cooling the room properly. It is found that the difference due to the surface option of heat conductors is insignificant. Based on this result, further studies should be performed to confirm integrity of ACP.

TREM-1 expression in craniopharyngioma and Rathke's cleft cyst: its possible implication for controversial pathology.

Science.gov (United States)

Liu, Yi; Wang, Chao-Hu; Li, Dan-Ling; Zhang, Shi-Chao; Peng, Yu-Ping; Peng, Jun-Xiang; Song, Ye; Qi, Song-Tao; Pan, Jun

2016-08-02

Whether a mixed type of craniopharyngioma (CP) exists and whether papillary craniopharyngioma (pCP) is on a histopathological continuum with Rathke's cleft cyst (RCC) remain controversial. Herein, we examined the expression and localization of β-catenin, BRAF p.V600E (V600E), and triggering receptor expressed on myeloid cells-1 (TREM-1) in 58 samples including 20 pCPs, 26 adamantinomatous craniopharyngiomas (aCP), and 12 RCCs. Five aCPs were diagnosed with mixed type CPs and the remaining 21 cases were pure aCPs. Four of the 12 RCCs presented with significant squamous epithelium (SE). V600E immunoreactivity was observed in all pCPs in the cytoplasm, but not in the nuclei. aCPs and RCCs, including mixed type CP, did not express V600E. Nuclear β-catenin translocation was detected exclusively in aCPs. TREM-1 was expressed in pCPs. Additionally, TREM-1 expression was detected in the SE of 5 "mixed type" CPs, while it was absent in pure aCPs. TREM-1 was expressed in 4 RCCs with SE, but not in the remaining 8 RCCs. TREM-1 mRNA levels were compared in cultured pCP and aCP cells. TREM-1 mRNA level was significantly (p < 0.001; up to 4.045 fold) higher in pCPs than in aCPs. Western blotting revealed a significantly (p < 0.001; up to 7.19 fold) lower level of TREM-1 expression in aCP cells compared to that in pCP cells. Our findings further supported that RCC and pCP may represent two ends of a morphological spectrum. A variant showing overlapping histological features of aCP and pCP should not be considered as a mixed type.

Multiplexed Immunofluorescence Reveals Potential PD-1/PD-L1 Pathway Vulnerabilities in Craniopharyngioma.

Science.gov (United States)

Coy, Shannon; Rashid, Rumana; Lin, Jia-Ren; Du, Ziming; Donson, Andrew M; Hankinson, Todd C; Foreman, Nicholas K; Manley, Peter E; Kieran, Mark W; Reardon, David A; Sorger, Peter K; Santagata, Sandro

2018-03-02

Craniopharyngiomas are neoplasms of the sellar/parasellar region that are classified into adamantinomatous (ACP) and papillary (PCP) subtypes. Surgical resection of craniopharyngiomas is challenging, and recurrence is common, frequently leading to profound morbidity. BRAF V600E mutations render PCP susceptible to BRAF/MEK inhibitors, but effective targeted therapies are needed for ACP. We explored the feasibility of targeting the PD-1/PD-L1 immune checkpoint pathway in ACP and PCP. We mapped and quantified PD-L1 and PD-1 expression in ACP and PCP resections using immunohistochemistry, immunofluorescence, and RNA in situ hybridization. We used tissue-based cyclic immunofluorescence (t-CyCIF) to map the spatial distribution of immune cells and characterize cell cycle and signaling pathways in ACP tumor cells which intrinsically express PD-1. All ACP (15±14% of cells, n=23, average±S.D.) and PCP (35±22% of cells, n=18) resections expressed PD-L1. In ACP, PD-L1 was predominantly expressed by tumor cells comprising the cyst-lining. In PCP, PD-L1 was highly-expressed by tumor cells surrounding the stromal fibrovascular cores. ACP also exhibited tumor cell-intrinsic PD-1 expression in whorled epithelial cells with nuclear-localized beta-catenin. These cells exhibited evidence of elevated mTOR and MAPK signaling. Profiling of immune populations in ACP and PCP showed a modest density of CD8+ T-cells. ACP exhibit PD-L1 expression in the tumor cyst-lining and intrinsic PD-1 expression in cells proposed to comprise an oncogenic stem-like population. In PCP, proliferative tumor cells express PD-L1 in a continuous band at the stromal-epithelial interface. Targeting PD-L1 and/or PD-1 in both subtypes of craniopharyngioma might therefore be an effective therapeutic strategy.

Structure, High Affinity, and Negative Cooperativity of the Escherichia coli Holo-(Acyl Carrier Protein):Holo-(Acyl Carrier Protein) Synthase Complex

Energy Technology Data Exchange (ETDEWEB)

Marcella, Aaron M.; Culbertson, Sannie J.; Shogren-Knaak, Michael A.; Barb, Adam W.

2017-11-01

The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05 and 4.10 Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a KD = 62 ± 13 nM, followed by the binding of two more equivalents of holo-ACPP with KD = 1.2 ± 0.2 μM. Cooperativity was not observed for apo-ACPP which bound with KD = 2.4 ± 0.1 μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis.

Advance Care Planning Does Not Adversely Affect Hope or Anxiety Among Patients With Advanced Cancer.

Science.gov (United States)

Green, Michael J; Schubart, Jane R; Whitehead, Megan M; Farace, Elana; Lehman, Erik; Levi, Benjamin H

2015-06-01

Many physicians avoid advance care planning (ACP) discussions because they worry such conversations will lead to psychological distress. To investigate whether engaging in ACP using online planning tools adversely affects hope, hopelessness, or anxiety among patients with advanced cancer. Patients with advanced cancer and an estimated survival of two years or less (Intervention group) and a Control group were recruited at a tertiary care academic medical center (2007-2012) to engage in ACP using an online decision aid ("Making Your Wishes Known"). Pre/post and between-group comparisons were made, including hope (Herth Hope Index), hopelessness (Beck Hopelessness Scale), and anxiety (State Trait Anxiety Inventory). Secondary outcomes included ACP knowledge, self-determination, and satisfaction. A total of 200 individuals completed the study. After engaging in ACP, there was no decline in hope or increase in hopelessness in either the Control or Intervention group. Anxiety was likewise unchanged in the Control group but decreased slightly in the Intervention group. Knowledge of ACP (% correct answers) increased in both the groups, but more so in the Intervention group (13% increase vs. 4%; P<0.01). Self-determination increased slightly in both groups, and satisfaction with the ACP process was greater (P<0.01) in the Intervention than Control group. Engaging in ACP with online planning tools increases knowledge without diminishing hope, increasing hopelessness, or inducing anxiety in patients with advanced cancer. Physicians need not avoid ACP out of concern for adversely affecting patients' psychological well-being. Copyright © 2015 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

Lay Patient Navigators' Perspectives of Barriers, Facilitators and Training Needs in Initiating Advance Care Planning Conversations With Older Patients With Cancer.

Science.gov (United States)

Niranjan, Soumya J; Huang, Chao-Hui S; Dionne-Odom, J Nicholas; Halilova, Karina I; Pisu, Maria; Drentea, Patricia; Kvale, Elizabeth A; Bevis, Kerri S; Butler, Thomas W; Partridge, Edward E; Rocque, Gabrielle B

2018-04-01

Respecting Choices is an evidence-based model of facilitating advance care planning (ACP) conversations between health-care professionals and patients. However, the effectiveness of whether lay patient navigators can successfully initiate Respecting Choices ACP conversations is unknown. As part of a large demonstration project (Patient Care Connect [PCC]), a cohort of lay patient navigators underwent Respecting Choices training and were tasked to initiate ACP conversations with Medicare beneficiaries diagnosed with cancer. This article explores PCC lay navigators' perceived barriers and facilitators in initiating Respecting Choices ACP conversations with older patients with cancer in order to inform implementation enhancements to lay navigator-facilitated ACP. Twenty-six lay navigators from 11 PCC cancer centers in 4 states (Alabama, George, Tennessee, and Florida) completed in-depth, one-on-one semistructured interviews between June 2015 and August 2015. Data were analyzed using a thematic analysis approach. This evaluation identifies 3 levels-patient, lay navigator, and organizational factors in addition to training needs that influence ACP implementation. Key facilitators included physician buy-in, patient readiness, and navigators' prior experience with end-of-life decision-making. Lay navigators' perceived challenges to initiating ACP conversations included timing of the conversation and social and personal taboos about discussing dying. Our results suggest that further training and health system support are needed for lay navigators playing a vital role in improving the implementation of ACP among older patients with cancer. The lived expertise of lay navigators along with flexible longitudinal relationships with patients and caregivers may uniquely position this workforce to promote ACP.

The frequency of β-globin gene haplotypes, α-thalassemia and genetic polymorphisms of methylenetetrahydrofolate reductase, factor V Leiden and prothrombin genes in children with sickle cell disease in Rio de Janeiro, Brazil Frequência dos haplótipos da globina beta, da talassemia alfa e dos polimorfismos genéticos dos genes da metilenotetrahidrofolato redutase, do fator V Leiden e da protrombina em crianças com doença falciforme no Rio de Janeiro, Brasil

Directory of Open Access Journals (Sweden)

Isaac L. Silva Filho

2010-02-01

Full Text Available A freqüência dos haplótipos beta S e beta C do gene da globina e a prevalência de talassemia alfa e de mutações nos genes da metilenotetrahidrofolato redutase (MTHFR-C677T, do fator V de Leiden e da protrombina (G20210A foi estudada em crianças com doença falciforme do Rio de Janeiro. O haplótipo Bantu foi o mais freqüente (65,9%, 21,2% das crianças (18% heterozigotas e 3% homozigotas apresentam talassemia com mutação alfa 3.7kb, ao contrário da mutação alfa 4.2kb que não foi encontrada. Os alelos 677CT e 677TT da MTHFR foram observados em 20,2% e 4,8%, respectivamente. Os haplótipos Camarões, Árabe-Indiano e Senegal não foram detectados na amostra estudada, bem como mutações no gene do fator V de Leiden e da protrombina. Somente o haplótipo beta C CI foi observado. Esse é o primeiro estudo realizado em uma amostra proveniente do Programa de Triagem Neonatal para Hemoglobinopatias do estado do Rio de Janeiro. Apesar do Rio de Janeiro ser a segunda maior cidade brasileira e seus habitantes expressarem o elevado grau de miscigenação ocorrida no país, nossos resultados ainda coincidem com os registros históricos dos fluxos migratórios do gene beta S para o Brasil, bem como refletem a forte influência de indivíduos de origem africana na população do Rio de Janeiro.

Bioactive Polymeric Materials for Tissue Repair

Directory of Open Access Journals (Sweden)

Diane R. Bienek

2017-01-01

Full Text Available Bioactive polymeric materials based on calcium phosphates have tremendous appeal for hard tissue repair because of their well-documented biocompatibility. Amorphous calcium phosphate (ACP-based ones additionally protect against unwanted demineralization and actively support regeneration of hard tissue minerals. Our group has been investigating the structure/composition/property relationships of ACP polymeric composites for the last two decades. Here, we present ACP’s dispersion in a polymer matrix and the fine-tuning of the resin affects the physicochemical, mechanical, and biological properties of ACP polymeric composites. These studies illustrate how the filler/resin interface and monomer/polymer molecular structure affect the material’s critical properties, such as ion release and mechanical strength. We also present evidence of the remineralization efficacy of ACP composites when exposed to accelerated acidic challenges representative of oral environment conditions. The utility of ACP has recently been extended to include airbrushing as a platform technology for fabrication of nanofiber scaffolds. These studies, focused on assessing the feasibility of incorporating ACP into various polymer fibers, also included the release kinetics of bioactive calcium and phosphate ions from nanofibers and evaluate the biorelevance of the polymeric ACP fiber networks. We also discuss the potential for future integration of the existing ACP scaffolds into therapeutic delivery systems used in the precision medicine field.

Ultrasonic degradation of acetaminophen in water: effect of sonochemical parameters and water matrix.

Science.gov (United States)

Villaroel, Erica; Silva-Agredo, Javier; Petrier, Christian; Taborda, Gonzalo; Torres-Palma, Ricardo A

2014-09-01

This paper deals about the sonochemical water treatment of acetaminophen (ACP, N-acetyl-p-aminophenol or paracetamol), one of the most popular pharmaceutical compounds found in natural and drinking waters. Effect of ultrasonic power (20-60 W), initial ACP concentration (33-1323 μmol L(-1)) and pH (3-12) were evaluated. High ultrasonic powers and, low and natural acidic pH values favored the efficiency of the treatment. Effect of initial substrate concentration showed that the Langmuir-type kinetic model fit well the ACP sonochemical degradation. The influence of organic compounds in the water matrix, at concentrations 10-fold higher than ACP, was also evaluated. The results indicated that only organic compounds having a higher value of the Henry's law constant than the substrate decrease the efficiency of the treatment. On the other hand, ACP degradation in mineral natural water showed to be strongly dependent of the initial substrate concentration. A positive matrix effect was observed at low ACP concentrations (1.65 μmol L(-1)), which was attributed to the presence of bicarbonate ion in solution. However, at relative high ACP concentrations a detrimental effect of matrix components was noticed. Finally, the results indicated that ultrasonic action is able to transform ACP in aliphatic organic compounds that could be subsequently eliminated in a biological system. Copyright © 2014 Elsevier B.V. All rights reserved.

Amorphous calcium phosphate and its application in dentistry

Directory of Open Access Journals (Sweden)

Sun Wei-bin

2011-07-01

Full Text Available Abstract Amorphous Calcium Phosphate (ACP is an essential mineral phase formed in mineralized tissues and the first commercial product as artificial hydroxyapatite. ACP is unique among all forms of calcium phosphates in that it lacks long-range, periodic atomic scale order of crystalline calcium phosphates. The X-ray diffraction pattern is broad and diffuse with a maximum at 25 degree 2 theta, and no other different features compared with well-crystallized hydroxyapatite. Under electron microscopy, its morphological form is shown as small spheroidal particles in the scale of tenths nanometer. In aqueous media, ACP is easily transformed into crystalline phases such as octacalcium phosphate and apatite due to the growing of microcrystalline. It has been demonstrated that ACP has better osteoconductivity and biodegradability than tricalcium phosphate and hydroxyapatite in vivo. Moreover, it can increase alkaline phosphatase activities of mesoblasts, enhance cell proliferation and promote cell adhesion. The unique role of ACP during the formation of mineralized tissues makes it a promising candidate material for tissue repair and regeneration. ACP may also be a potential remineralizing agent in dental applications. Recently developed ACP-filled bioactive composites are believed to be effective anti-demineralizing/remineralizing agents for the preservation and repair of tooth structures. This review provides an overview of the development, structure, chemical composition, morphological characterization, phase transformation and biomedical application of ACP in dentistry.

Molecular Analyses Reveal Inflammatory Mediators in the Solid Component and Cyst Fluid of Human Adamantinomatous Craniopharyngioma.

Science.gov (United States)

Donson, Andrew M; Apps, John; Griesinger, Andrea M; Amani, Vladimir; Witt, Davis A; Anderson, Richard C E; Niazi, Toba N; Grant, Gerald; Souweidane, Mark; Johnston, James M; Jackson, Eric M; Kleinschmidt-DeMasters, Bette K; Handler, Michael H; Tan, Aik-Choon; Gore, Lia; Virasami, Alex; Gonzalez-Meljem, Jose Mario; Jacques, Thomas S; Martinez-Barbera, Juan Pedro; Foreman, Nicholas K; Hankinson, Todd C

2017-09-01

Pediatric adamantinomatous craniopharyngioma (ACP) is a highly solid and cystic tumor, often causing substantial damage to critical neuroendocrine structures such as the hypothalamus, pituitary gland, and optic apparatus. Paracrine signaling mechanisms driving tumor behavior have been hypothesized, with IL-6R overexpression identified as a potential therapeutic target. To identify potential novel therapies, we characterized inflammatory and immunomodulatory factors in ACP cyst fluid and solid tumor components. Cytometric bead analysis revealed a highly pro-inflammatory cytokine pattern in fluid from ACP compared to fluids from another cystic pediatric brain tumor, pilocytic astrocytoma. Cytokines and chemokines with particularly elevated concentrations in ACPs were IL-6, CXCL1 (GRO), CXCL8 (IL-8) and the immunosuppressive cytokine IL-10. These data were concordant with solid tumor compartment transcriptomic data from a larger cohort of ACPs, other pediatric brain tumors and normal brain. The majority of receptors for these cytokines and chemokines were also over-expressed in ACPs. In addition to IL-10, the established immunosuppressive factor IDO-1 was overexpressed by ACPs at the mRNA and protein levels. These data indicate that ACP cyst fluids and solid tumor components are characterized by an inflammatory cytokine and chemokine expression pattern. Further study regarding selective cytokine blockade may inform novel therapeutic interventions. © 2017 American Association of Neuropathologists, Inc. All rights reserved.

Discussing dying in the diaspora: attitudes towards advance care planning among first generation Dutch and Italian migrants in rural Australia.

Science.gov (United States)

Sinclair, Craig; Smith, Jessica; Toussaint, Yann; Auret, Kirsten

2014-01-01

Western cultural practices and values have largely shaped advance care planning (ACP) policies across the world. Low uptake of ACP among ethnic minority groups in Western countries has been interpreted with reference to cultural differences. This paper adopts a life-history approach to explore attitudes towards ACP among older, first-generation Dutch-Australian and Italian-Australian migrants. Thirty people participated in extended ethnographic interviews (N = 17) and group discussions (N = 13) during 2012. Transcripts were thematically analyzed and interpreted using a Foucauldian perspective on knowledge and power. Migration experiences, ongoing contact with the native country and participation in migrant community support networks influenced attitudes towards ACP. Dutch participants framed ACP discussions with reference to euthanasia, and adopted a more individualist approach to medical decision-making. Italian participants often spoke of familial roles and emphasized a family-based decision making style. The importance of migrant identity has been neglected in previous discussions of cultural factors influencing ACP uptake among ethnic minority groups. The unique migration experience should be considered alongside culturally appropriate approaches to decision-making, in order to ensure equitable access to ACP among migrant groups. Copyright © 2013 Elsevier Ltd. All rights reserved.

'Not yet' and 'Just ask': barriers and facilitators to advance care planning--a qualitative descriptive study of the perspectives of seriously ill, older patients and their families.

Science.gov (United States)

Simon, Jessica; Porterfield, Pat; Bouchal, Shelley Raffin; Heyland, Daren

2015-03-01

To explore seriously ill, older hospitalised patients' and their family members' perspectives on the barriers and facilitators of advance care planning (ACP). We used qualitative descriptive study methodology to analyse data from an interviewer administered, questionnaire-based, Canadian multicentre, prospective study of this population. Three main categories described these barriers and facilitators: (1) person (beliefs, attitudes, experiences, health status), (2) access (to doctors and healthcare providers, information, tools and infrastructure to communicate ACP preferences) and (3) the interaction with the doctor (who and how initiated, location, timing, quality of communication, relationship with doctor). Based on the findings, we suggest strategies for both healthcare systems and individual healthcare providers to improve the quality and quantity of ACP with this population. These include assessing readiness for participation in ACP and personalising relevance of ACP to each individual, routinely offering scheduled family meetings for exploring a person's own goals and sharing information, ensuring systems and policies are in place to access previous ACP documentation and ensuring doctors' education includes ACP communication skills. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Vibrational duetting mimics to trap and disrupt mating of the devastating Asian citrus psyllid insect pest

Science.gov (United States)

The Asian citrus psyllid (ACP) is the primary vector of a bacterium that produces a devastating disease of citrus, huanglongbing. Efficient surveillance of ACP at low population densities is essential for timely pest management programs. ACP males search for mates on tree branches by producing vibra...

Preparation and Sustained-Release Property of Triblock Copolymer/Calcium Phosphate Nanocomposite as Nanocarrier for Hydrophobic Drug

Directory of Open Access Journals (Sweden)

Cao Shao-Wen

2010-01-01

Full Text Available Abstract The P123/ACP nanocomposite with sizes less than 100 nm consisting of triblock copolymer P123 and amorphous calcium phosphate (ACP has been prepared by using an aqueous solution containing CaCl2, (NH43PO4, and P123 at room temperature. The P123/ACP nanocomposite is used as the nanocarrier for hydrophobic drug ibuprofen, based on the combined advantages of both amphiphilic block copolymer and calcium phosphate delivery system. The P123/ACP nanocomposite has a much higher ibuprofen loading capacity (148 mg/g than the single-phase calcium phosphate nanostructures. The drug release percentage of the P123/ACP nanocomposite in simulated body fluid reaches about 100% in a period of 156 h, which is much slower than that of single-phase calcium phosphate nanostructures. It is expected that the P123/ACP nanocomposite is promising for the application in the controlled delivery of hydrophobic drugs.

Preparation of reusable conductive activated charcoal plate as a new electrode for industrial wastewater treatment

Energy Technology Data Exchange (ETDEWEB)

Ayoubi-Feiz, Baharak; Aber, Soheil [University of Tabriz, Tabriz (Iran, Islamic Republic of)

2015-10-15

A conductive activated charcoal plate (ACP) was prepared from a low-cost, abundant, and non-conductive charcoal. The prepared ACP was characterized using N{sub 2} adsorption/desorption isotherms, scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). Brunauer-Emmett-Teller (BET) surface area of the charcoal and the ACP was 0.58m{sup 2} g{sup -1} and 461.67m{sup 2} g{sup -1}, respectively. The ACP was employed in textile wastewater treatment using electrosorption process. Response surface methodology (RSM) was applied to design the experiments. The decolorization efficiency of 76% at optimum conditions of voltage=450mV, pH=4, and contact time=120 min indicated that the ACP has promising potential to decolorize textile wastewater. Moreover, the results of the kinetic analyses demonstrated that wastewater treatment followed pseudo-first order kinetic model. The ACP electrode could be regenerated and reused effectively at five successive cycles of electrosorption/electrodesorption.

Advance care planning kan bruges til at planlægge pleje og behandling i forvejen

DEFF Research Database (Denmark)

Skorstengaard, Marianne Hjorth; Grønvold, Mogens; Jensen, Anders Bonde

2017-01-01

Advance care planning (ACP) is a discussion between an incurably ill patient, a healthcare professional and if possible, a relative about preferences for end-of-life care, and ACP may improve the communication in this situation. However, in the Danish healthcare system there is no formalized...... and systematically used standard procedure for discussions with patients about their knowledge of their treatment options, values and preferences. In this article we review the concept of ACP, including definition, experiences from abroad and the status of ACP in Denmark....

Advance Care Planning kan bruges til at planlægge pleje og behandling i forvejen

DEFF Research Database (Denmark)

Skorstengaard, Marianne Hjorth; Groenvold, Mogens; Jensen, Anders Bonde

2017-01-01

Advance care planning (ACP) is a discussion between an incurably ill patient, a healthcare professional and if possible, a relative about preferences for end-of-life care, and ACP may improve the communication in this situation. However, in the Danish healthcare system there is no formalized...... and systematically used standard procedure for discussions with patients about their knowledge of their treatment options, values and preferences. In this article we review the concept of ACP, including definition, experiences from abroad and the status of ACP in Denmark....

Differences in Stylet Sheath Occurrence and the Fibrous Ring (Sclerenchyma) between xCitroncirus Plants Relatively Resistant or Susceptible to Adults of the Asian Citrus Psyllid Diaphorina citri (Hemiptera: Liviidae)

Science.gov (United States)

Ammar, El-Desouky; Richardson, Matthew L.; Abdo, Zaid; Hall, David G.; Shatters, Robert G.

2014-01-01

The Asian citrus psyllid (ACP, Diaphorina citri, Hemiptera: Liviidae), is the principal vector of the phloem-limited bacteria strongly associated with huanglongbing (HLB), the world’s most serious disease of citrus. Host plant resistance may provide an environmentally safe and sustainable method of controlling ACP and/or HLB. Two xCitroncirus accessions (hybrids of Poncirus trifoliata and Citrus spp.), that are relatively resistant (UN-3881) or relatively susceptible (Troyer-1459) to ACP adults with regard to adult longevity, were compared in relation to ACP feeding behavior and some structural features of the leaf midrib. The settling (putative feeding/probing) sites of ACP adults on various parts of the leaf were not influenced primarily by plant accession. However, fewer ACP stylet sheaths were found in the midrib and fewer stylet sheath termini reached the vascular bundle (phloem and/or xylem) in UN-3881 compared to Troyer-1459 plants. Furthermore, in midribs of UN-3881 leaves the fibrous ring (sclerenchyma) around the phloem was significantly wider (thicker) compared to that in midribs of Troyer-1459 leaves. Our data indicate that feeding and/or probing by ACP adults into the vascular bundle is less frequent in the more resistant (UN-3881) than in the more susceptible (Troyer-1459) accessions. Our results also suggest that the thickness of the fibrous ring may be a barrier to stylet penetration into the vascular bundle, which is important for successful ACP feeding on the phloem and for transmitting HLB-associated bacteria. These results may help in the development of citrus plants resistant to ACP, which in turn could halt or slow the spread of the HLB-associated bacteria by this vector. PMID:25343712

Structure, High Affinity, and Negative Cooperativity of the Escherichia coli Holo-(Acyl Carrier Protein):Holo-(Acyl Carrier Protein) Synthase Complex.

Science.gov (United States)

Marcella, Aaron M; Culbertson, Sannie J; Shogren-Knaak, Michael A; Barb, Adam W

2017-11-24

The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05and 4.10Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a K D =62±13nM, followed by the binding of two more equivalents of holo-ACPP with K D =1.2±0.2μM. Cooperativity was not observed for apo-ACPP which bound with K D =2.4±0.1μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Differences in stylet sheath occurrence and the fibrous ring (sclerenchyma between xCitroncirus plants relatively resistant or susceptible to adults of the Asian citrus psyllid Diaphorina citri (Hemiptera: Liviidae.

Directory of Open Access Journals (Sweden)

El-Desouky Ammar

Full Text Available The Asian citrus psyllid (ACP, Diaphorina citri, Hemiptera: Liviidae, is the principal vector of the phloem-limited bacteria strongly associated with huanglongbing (HLB, the world's most serious disease of citrus. Host plant resistance may provide an environmentally safe and sustainable method of controlling ACP and/or HLB. Two xCitroncirus accessions (hybrids of Poncirus trifoliata and Citrus spp., that are relatively resistant (UN-3881 or relatively susceptible (Troyer-1459 to ACP adults with regard to adult longevity, were compared in relation to ACP feeding behavior and some structural features of the leaf midrib. The settling (putative feeding/probing sites of ACP adults on various parts of the leaf were not influenced primarily by plant accession. However, fewer ACP stylet sheaths were found in the midrib and fewer stylet sheath termini reached the vascular bundle (phloem and/or xylem in UN-3881 compared to Troyer-1459 plants. Furthermore, in midribs of UN-3881 leaves the fibrous ring (sclerenchyma around the phloem was significantly wider (thicker compared to that in midribs of Troyer-1459 leaves. Our data indicate that feeding and/or probing by ACP adults into the vascular bundle is less frequent in the more resistant (UN-3881 than in the more susceptible (Troyer-1459 accessions. Our results also suggest that the thickness of the fibrous ring may be a barrier to stylet penetration into the vascular bundle, which is important for successful ACP feeding on the phloem and for transmitting HLB-associated bacteria. These results may help in the development of citrus plants resistant to ACP, which in turn could halt or slow the spread of the HLB-associated bacteria by this vector.

Metil coenzima M redutase (MCR e o fator 430 (F430

Directory of Open Access Journals (Sweden)

Nakagaki Shirley

2006-01-01

Full Text Available This review presents studies on methyl coenzyme M reductase, the biological system Factor 430 (F430 and the use of nickel(II complexes as structural and functional models. The ability of F430 and nickel(II macrocycle complexes to mediate the reductive dehalogenation of cyclohexyl halogens and the CH3-S bond cleavage of methyl CoM (by sodium borohydride and some intermediate species proposed for the catalytic cycle of the biological system F430 was reviewed. The importance of the structure of the nickel complexes and the condition of the catalytic reduction reaction are also discussed.

Metil coenzima M redutase (MCR e o fator 430 (F430

Directory of Open Access Journals (Sweden)

Shirley Nakagaki

2006-10-01

Full Text Available This review presents studies on methyl coenzyme M reductase, the biological system Factor 430 (F430 and the use of nickel(II complexes as structural and functional models. The ability of F430 and nickel(II macrocycle complexes to mediate the reductive dehalogenation of cyclohexyl halogens and the CH3-S bond cleavage of methyl CoM (by sodium borohydride and some intermediate species proposed for the catalytic cycle of the biological system F430 was reviewed. The importance of the structure of the nickel complexes and the condition of the catalytic reduction reaction are also discussed.

Evaluation of potential antioxidant and anti-inflammatory effects of Antrodia cinnamomea powder and the underlying molecular mechanisms via Nrf2- and NF-κB-dominated pathways in broiler chickens.

Science.gov (United States)

Lee, M T; Lin, W C; Wang, S Y; Lin, L J; Yu, B; Lee, T T

2018-04-17

Antrodia cinnamomea, a precious and unique medical fungus existing exclusively in Taiwan, exhibits antioxidant and immunomodulatory properties. This study was conducted to evaluate the beneficial effects of A. cinnamomea powder (ACP) and to further illuminate its underlying antioxidant and immunomodulation molecular mechanisms in broilers. The functional compounds of ACP-crude triterpenoids, crude polysaccharides, and total phenolic content-were assayed, respectively. Two-hundred-forty one-day-old broilers (Ross 308) were assigned to 4 treatment groups receiving dietary supplementation with ACP at 0, 0.1, 0.2, and 0.4% for 35 days. Each group had 4 replicate pens, with 15 birds per pen. During 1 to 21- and 22 to 35-day periods, chickens on ACP-supplemented diet demonstrated increased body weight gain, compared to those on the control diet, resulting in increased weight gain throughout the entire experimental period with an increased tendency in feed consumption yet no significant difference in FCR. Blood antioxidant potentiality, superoxide dismutase (SOD), increased in birds fed the supplemented diet at both 21 and 35 d, accompanied by higher catalase (CAT) activity at 21 days. In vivo peripheral blood mononuclear cells (PBMC) exposed to lipopolysaccharide (LPS) and 2,2΄-Azobis(2-amidinopropane) dihydrochloride (AAPH) capability showed that the diminished cell viability caused by both challenge factors was improved in ACP-supplemented groups. Antioxidant genes dominated by Nrf2 genes, such as HO-1 and GCLC, were up-regulated in 35-day-old birds. Inflammatory-related genes, such as IL-1β and IL-6, ruled mainly by NF-κB, were rather down-regulated by 0.2% ACP addition at 21 and 35 days. Protein expression of Nrf2 and NF-κB in the liver supported the mRNA results, demonstrating that all ACP-supplemented groups showed significantly higher Nrf2 expression, whereas the NF-κB was inhibited. In conclusion, preferable microbial balance may putatively indicate the

Het doel van 'advance care planning'

NARCIS (Netherlands)

Van Delden, Johannes J.M.

2017-01-01

This commentary reflects on a study to determine the efficacy of an advance care planning (ACP) website in increasing planning documentation. It is interesting to see that ACP is considered to be a regular intervention. ACP thus ceases to be something to believe in or not and becomes a normal

Phase analysis in gated blood pool tomography

International Nuclear Information System (INIS)

Nakajima, Kenichi; Bunko, Hisashi; Tada, Akira; Taki, Junichi; Nanbu, Ichiro

1984-01-01

Phase analysis of gated blood pool study has been applied to detect the site of accessory conduction pathway (ACP) in the Wolff-Parkinson-White (WPW) syndrome; however, there was a limitation to detect the precise location of ACP by phase analysis alone. In this study, we applied phase analysis to gated blood pool tomography using seven pin hole tomography (7PT) and gated emission computed tomography (GECT) in 21 patients with WPW syndrome and 3 normal subjects. In 17 patients, the sites of ACPs were confirmed by epicardial mapping and the result of the surgical division of ACP. In 7PT, the site of ACP grossly agreed to the abnormal initial phase in phase image in 5 out of 6 patients with left cardiac type. In GECT, phase images were generated in short axial, vertical and horizontal long axial sections. In 8 out of 9 patients, the site of ACP was correctly identified by phase images, and in a patient who had two ACPs, initial phase corresponded to one of the two locations. Phase analysis of gated blood pool tomography has advantages for avoiding overlap of blood pools and for estimating three-dimensional propagation of the contraction, and can be a good adjunctive method in patients with WPW syndrome. (author)

Phase analysis in gated blood pool tomography. Detection of accessory conduction pathway

Energy Technology Data Exchange (ETDEWEB)

Nakajima, Kenichi; Bunko, Hisashi; Tada, Akira; Taki, Junichi; Nanbu, Ichiro (Kanazawa Univ. (Japan). School of Medicine)

1984-02-01

Phase analysis of gated blood pool study has been applied to detect the site of accessory conduction pathway (ACP) in the Wolff-Parkinson-White (WPW) syndrome; however, there was a limitation to detect the precise location of ACP by phase analysis alone. In this study, we applied phase analysis to gated blood pool tomography using seven pin hole tomography (7PT) and gated emission computed tomography (GECT) in 21 patients with WPW syndrome and 3 normal subjects. In 17 patients, the sites of ACPs were confirmed by epicardial mapping and the result of the surgical division of ACP. In 7PT, the site of ACP grossly agreed to the abnormal initial phase in phase image in 5 out of 6 patients with left cardiac type. In GECT, phase images were generated in short axial, vertical and horizontal long axial sections. In 8 out of 9 patients, the site of ACP was correctly identified by phase images, and in a patient who had two ACPs, initial phase corresponded to one of the two locations. Phase analysis of gated blood pool tomography has advantages for avoiding overlap of blood pools and for estimating three-dimensional propagation of the contraction, and can be a good adjunctive method in patients with WPW syndrome.

Legionella phosphatase hydrolyzes phosphatidylinositol 4,5-bisphosphate and inosital triphosphate in human neutrophils

International Nuclear Information System (INIS)

Dowling, J.N.; Saha, A.K.; Glew, R.H.

1987-01-01

Legionella are facultative intracellular bacterial pathogens which multiply in host phagocytes. L. micdadei cells contain an acid phosphatase (ACP) that blocks superoxide anion production by human neutrophils stimulated with the formylated peptide, fMLP. The possibility that ACP acts by interefering with polyphosphoinositide metabolism and the production of the intracellular second messenger, inositol triphosphate (IP 3 ) was explored. When neutrophil phosphoinositides were labeled with 32 P, incubation of the cells with ACP caused an 85% loss of the labeled phosphatidylinositol-4,5-bisphosphate (PIP 2 ) over 2 h. Treatment of [ 3 H]inositol-labeled neutrophils with ACP for 30 min resulted in a 20% decrease of labeled PIP 2 . Following fMLP stimulation, the fractional reduction in PIP 2 and the fractional increase in IP 3 was the same in ACP-treated and untreated neutrophils, but the total quantity of IP 3 was reduced by ACP pre-treatment. The reduction in IP 3 generated following fMLP stimulation seems to be due primarily to the decreased amount of PIP 2 available for hydrolysis. However, some loss of IP 3 due to direct hydrolysis by ACP cannot be ruled out. The Legionella phosphatase may compromise neutrophil response to the bacteria by hydrolyzing PIP 2 , the prognitor of IP 3 , and by hydrolyzing IP 3 itself

Host plant affects morphometric variation of Diaphorina citri (Hemiptera: Liviidae

Directory of Open Access Journals (Sweden)

Thomson M. Paris

2016-11-01

Full Text Available The Asian citrus psyllid (ACP, Diaphorina citri Kuwayama, is one of the most serious citrus pests worldwide due to its role as vector of huanglongbing or citrus greening disease. While some optimal plant species for ACP oviposition and development have been identified, little is known of the influence of host plants on ACP size and shape. Our goal was to determine how size and shape of ACP wing and body size varies when development occurs on different host plants in a controlled rearing environment. ACP were reared on six different rutaceous species; Bergera koenigii, Citrus aurantifolia, Citrus macrophylla, Citrus maxima, Citrus taiwanica and Murraya paniculata. Adults were examined for morphometric variation using traditional and geometric analysis based on 12 traits or landmarks. ACP reared on C. taiwanica were consistently smaller than those reared on the other plant species. Wing aspect ratio also differed between C. maxima and C. taiwanica. Significant differences in shape were detected with those reared on M. paniculata having narrower wings than those reared on C. macrophylla. This study provides evidence of wing size and shape differences of ACP based on host plant species which potentially may impact dispersal. Further study is needed to determine if behavioral and physiological differences are associated with the observed phenotypic differences.

Host plant affects morphometric variation of Diaphorina citri (Hemiptera: Liviidae).

Science.gov (United States)

Paris, Thomson M; Allan, Sandra A; Hall, David G; Hentz, Matthew G; Hetesy, Gabriella; Stansly, Philip A

2016-01-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, is one of the most serious citrus pests worldwide due to its role as vector of huanglongbing or citrus greening disease. While some optimal plant species for ACP oviposition and development have been identified, little is known of the influence of host plants on ACP size and shape. Our goal was to determine how size and shape of ACP wing and body size varies when development occurs on different host plants in a controlled rearing environment. ACP were reared on six different rutaceous species; Bergera koenigii , Citrus aurantifolia , Citrus macrophylla , Citrus maxima , Citrus taiwanica and Murraya paniculata . Adults were examined for morphometric variation using traditional and geometric analysis based on 12 traits or landmarks. ACP reared on C. taiwanica were consistently smaller than those reared on the other plant species. Wing aspect ratio also differed between C. maxima and C. taiwanica . Significant differences in shape were detected with those reared on M. paniculata having narrower wings than those reared on C. macrophylla . This study provides evidence of wing size and shape differences of ACP based on host plant species which potentially may impact dispersal. Further study is needed to determine if behavioral and physiological differences are associated with the observed phenotypic differences.

Gene expression profiles reveal key genes for early diagnosis and treatment of adamantinomatous craniopharyngioma.

Science.gov (United States)

Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing

2018-04-23

Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis

Religious leaders' perceptions of advance care planning: a secondary analysis of interviews with Buddhist, Christian, Hindu, Islamic, Jewish, Sikh and Bahá'í leaders.

Science.gov (United States)

Pereira-Salgado, Amanda; Mader, Patrick; O'Callaghan, Clare; Boyd, Leanne; Staples, Margaret

2017-12-28

International guidance for advance care planning (ACP) supports the integration of spiritual and religious aspects of care within the planning process. Religious leaders' perspectives could improve how ACP programs respect patients' faith backgrounds. This study aimed to examine: (i) how religious leaders understand and consider ACP and its implications, including (ii) how religion affects followers' approaches to end-of-life care and ACP, and (iii) their implications for healthcare. Interview transcripts from a primary qualitative study conducted with religious leaders to inform an ACP website, ACPTalk, were used as data in this study. ACPTalk aims to assist health professionals conduct sensitive conversations with people from different religious backgrounds. A qualitative secondary analysis conducted on the interview transcripts focussed on religious leaders' statements related to this study's aims. Interview transcripts were thematically analysed using an inductive, comparative, and cyclical procedure informed by grounded theory. Thirty-five religious leaders (26 male; mean 58.6-years-old), from eight Christian and six non-Christian (Jewish, Buddhist, Islamic, Hindu, Sikh, Bahá'í) backgrounds were included. Three themes emerged which focussed on: religious leaders' ACP understanding and experiences; explanations for religious followers' approaches towards end-of-life care; and health professionals' need to enquire about how religion matters. Most leaders had some understanding of ACP and, once fully comprehended, most held ACP in positive regard. Religious followers' preferences for end-of-life care reflected family and geographical origins, cultural traditions, personal attitudes, and religiosity and faith interpretations. Implications for healthcare included the importance of avoiding generalisations and openness to individualised and/ or standardised religious expressions of one's religion. Knowledge of religious beliefs and values around death and dying

Effect of Human Serum and 2 Different Types of Platelet Concentrates on Human Meniscus Cell Migration, Proliferation, and Matrix Formation.

Science.gov (United States)

Freymann, Undine; Metzlaff, Sebastian; Krüger, Jan-Philipp; Hirsh, Glen; Endres, Michaela; Petersen, Wolf; Kaps, Christian

2016-06-01

To evaluate the effect of 10% human serum (HS), 5% platelet-rich plasma (PRP), and 5% autologous conditioned plasma (ACP) on migration, proliferation, and extracellular matrix (ECM) synthesis of human meniscus cells. Cell migration and proliferation on stimulation with HS, PRP, and ACP were assessed by chemotaxis assays and measurement of genomic DNA content. Meniscus cells were cultivated in pellets stimulated with 10% HS, 5% PRP, or 5% ACP. Meniscal ECM formation was evaluated by histochemical staining of collagen type I, type II, and proteoglycans and by analysis of fibrochondrocyte marker gene expression. Human meniscus cells were significantly attracted by all 3 blood-derived products (10% HS and 5% ACP: P = .0001, 5% PRP: P = .0002). Cell proliferation at day 9 was significantly increased on stimulation with 10% HS (P = .0001) and 5% PRP (P = .0002) compared with 5% ACP and controls. Meniscus cell pellet cultures showed the formation of a well-structured meniscal ECM with deposition of collagen type I, type II, and proteoglycans on stimulation with 10% HS, whereas 5% PRP or 5% ACP resulted in the formation of an inhomogeneous and more fibrous ECM. Stimulation with 10% HS and 5% ACP showed a significant induction of fibrochondrocyte marker genes such as aggrecan (HS: P = .0002, ACP: P = .0147), cartilage oligomeric matrix protein (HS: P = .0002, ACP: P = .0005), and biglycan (HS: P = .0002, ACP: P = .0003), whereas PRP showed no inducing effect. Among all tested blood-derived products, only stimulation with HS showed the formation of a meniscal ECM as well as positive cell proliferating and migrating effects in vitro. Regarding a potential biological repair of nonvascular meniscus lesions, our results may point toward the use of HS as a beneficial augment in regenerative meniscus repair approaches. Our findings may suggest that HS might be a beneficial augment for meniscus repair. Copyright © 2016 Arthroscopy Association of North America. Published

Protocol for a national prevalence study of advance care planning documentation and self-reported uptake in Australia.

Science.gov (United States)

Ruseckaite, Rasa; Detering, Karen M; Evans, Sue M; Perera, Veronica; Walker, Lynne; Sinclair, Craig; Clayton, Josephine M; Nolte, Linda

2017-11-03

Advance care planning (ACP) is a process between a person, their family/carer(s) and healthcare providers that supports adults at any age or stage of health in understanding and sharing their personal values, life goals and preferences regarding future medical care. The Australian government funds a number of national initiatives aimed at increasing ACP uptake; however, there is currently no standardised Australian data on formal ACP documentation or self-reported uptake. This makes it difficult to evaluate the impact of ACP initiatives. This study aims to determine the Australian national prevalence of ACP and completion of Advance Care Directives (ACDs) in hospitals, aged care facilities and general practices. It will also explore people's self-reported use of ACP and views about the process. Researchers will conduct a national multicentre cross-sectional prevalence study, consisting of a record audit and surveys of people aged 65 years or more in three sectors. From 49 participating Australian organisations, 50 records will be audited (total of 2450 records). People whose records were audited, who speak English and have a decision-making capacity will also be invited to complete a survey. The primary outcome measure will be the number of people who have formal or informal ACP documentation that can be located in records within 15 min. Other outcomes will include demographics, measure of illness and functional capacity, details of ACP documentation (including type of document), location of documentation in the person's records and whether current clinical care plans are consistent with ACP documentation. People will be surveyed, to measure self-reported interest, uptake and use of ACP/ACDs, and self-reported quality of life. This protocol has been approved by the Austin Health Human Research Ethics Committee (reference HREC/17/Austin/83). Results will be submitted to international peer-reviewed journals and presented at international conferences. ACTRN

Influence of acepromazine on the cardiovascular actions of dobutamine in isoflurane-anesthetized horses Influência da acepromazina sobre os efeitos cardiovasculares da dobutamina em cavalos anestesiados com isofluorano

Directory of Open Access Journals (Sweden)

Eduardo Raposo Monteiro

2011-03-01

Full Text Available The influence of acepromazine (ACP on the effectiveness of dobutamine (DBT in increasing blood pressure during isoflurane (ISO anesthesia was evaluated in six horses. On separate occasions, the horses were randomly assigned to receive NaCl 0.9% (Control, ACP 0.025mg kg-1 and ACP 0.05mg kg-1. The experimental treatment was administered prior to induction of anesthesia. Maintenance of anesthesia was performed under conditions of normocapnia with ISO in oxygen. Dobutamine was administered at progressively increasing infusion rates until mean arterial pressure (MAP reached 70mmHg or until a maximum infusion rate of 5.0µg kg-1 min-1. Compared with baseline, DBT increased heart rate, systolic, diastolic and mean blood pressures in all treatments. However, these variables did not differ among treatments. The target MAP (70mmHg was not reached in 2/6, 2/5 and 0/6 horses in the Control, ACP0.025 and ACP0.05 treatments, respectively. The mean dose of DBT to achieve target MAP was 3.5±1.8, 3.7±1.6 and 2.7±1.4µg kg-1 min-1 in the Control, ACP0.025 and ACP0.05 treatments, respectively (P>0.05. Under the conditions of this study, premedication with ACP does not interfere with the effectiveness of DBT in increasing blood pressure in horses anesthetized with ISO.A influência da acepromazina (ACP sobre a capacidade da dobutamina (DBT em elevar a pressão arterial durante a anestesia com isofluorano (ISO foi avaliada em seis equinos. Em ocasiões diferentes, os animais receberam aleatoriamente NaCl 0,9% (Controle, ACP 0,025mg kg-1 e ACP 0,05mg kg-1. O tratamento experimental foi administrado previamente à indução da anestesia. A manutenção da anestesia foi realizada em condições de normocapnia com ISO em oxigênio. A administração de DBT foi iniciada em doses progressivamente crescentes até que o valor de pressão arterial média (PAM atingisse 70mmHg ou até a dose máxima de 5,0µg kg-1 min-1. Comparado ao basal, a administração da DBT

Evolution of the magnesium incorporated amorphous calcium phosphate to nano-crystallized hydroxyapatite in alkaline solution

Science.gov (United States)

Zhang, Xiao-Juan; Lin, Dong-Yang; Yan, Xiao-Hui; Wang, Xiao-Xiang

2011-12-01

A homogeneous amorphous calcium phosphate (ACP) coating containing magnesium was achieved on titanium substrates by electrochemical deposition (ECD). Its amorphous structure is confirmed by transmission electron microscope (TEM) together with grazing reflection absorption infrared spectroscopy (IR) spectrometer. In the images of high-resolution transmission electron microscope (HRTEM), the ACP spheres are assembled by nano-particles with the diameter of 5-10 nm. In the alkaline environment, nucleation of hydroxyapatite (HAP) occurs on the surfaces of ACP spheres. By consuming the Ca and PO 4 ions inside the ACP spheres, the HAP nuclei grow outward. Confirmed by TEM, the ACP spheres converse to hollow HAP spheres composed of HAP nano-needles. The coating is finally constructed by the HAP nano-needles, which are themselves aggregated by numerous nano-particles.

Concentrations of long-chain acyl-acyl carrier proteins during fatty acid synthesis by chloroplasts isolated from pea (Pisum sativum), safflower (Carthamus tinctoris), and amaranthus (Amaranthus lividus) leaves

International Nuclear Information System (INIS)

Roughan, G.; Nishida, I.

1990-01-01

Fatty acid synthesis from [1-14C]acetate by chloroplasts isolated from peas and amaranthus was linear for at least 15 min, whereas incorporation of the tracer into long-chain acyl-acyl carrier protein (ACP) did not increase after 2-3 min. When reactions were transferred to the dark after 3-5 min, long-chain acyl-ACPs lost about 90% of their radioactivity and total fatty acids retained all of theirs. Half-lives of the long-chain acyl-ACPs were estimated to be 10-15 s. Concentrations of palmitoyl-, stearoyl-, and oleoyl-ACP as indicated by equilibrium labeling during steady-state fatty acid synthesis, ranged from 0.6-1.1, 0.2-0.7, and 0.4-1.6 microM, respectively, for peas and from 1.6-1.9, 1.3-2.6, and 0.6-1.4 microM, respectively, for amaranthus. These values are based on a chloroplast volume of 47 microliters/mg chlorophyll and varied according to the mode of the incubation. A slow increase in activity of the fatty acid synthetase in safflower chloroplasts resulted in long-chain acyl-ACPs continuing to incorporate labeled acetate for 10 min. Upon re-illumination following a dark break, however, both fatty acid synthetase activity and acyl-ACP concentrations increased very rapidly. Palmitoyl-ACP was present at concentrations up to 2.5 microM in safflower chloroplasts, whereas those of stearoyl- and oleoyl-ACPs were in the lower ranges measured for peas. Acyl-ACPs were routinely separated from extracts of chloroplasts that had been synthesising long-chain fatty acids from labeled acetate by a minor modification of the method of Mancha et al. The results compared favorably with those obtained using alternative analytical methods such as adsorption to filter paper and partition chromatography on silicic acid columns

Crystal Structure of the N-terminal Domain of the Group B Streptococcus Alpha C Protein

Energy Technology Data Exchange (ETDEWEB)

Auperin,T.; Bolduc, G.; Baron, M.; Heroux, A.; Filman, D.; Madoff, L.; Hogle, J.

2005-01-01

Group B Streptococcus (GBS) is the leading cause of bacterial pneumonia, sepsis, and meningitis among neonates and an important cause of morbidity among pregnant women and immunocompromised adults. Invasive diseases due to GBS are attributed to the ability of the pathogen to translocate across human epithelial surfaces. The alpha C protein (ACP) has been identified as an invasin that plays a role in internalization and translocation of GBS across epithelial cells. The soluble N-terminal domain of ACP (NtACP) blocks the internalization of GBS. We determined the 1.86-{angstrom} resolution crystal structure of NtACP comprising residues Ser{sup 52} through Leu{sup 225} of the full-length ACP. NtACP has two domains, an N-terminal {beta}-sandwich and a C-terminal three-helix bundle. Structural and topological alignments reveal that the {beta}-sandwich shares structural elements with the type III fibronectin fold (FnIII), but includes structural elaborations that make it unique. We have identified a potential integrin-binding motif consisting of Lys-Thr-Asp{sup 146}, Arg{sup 110}, and Asp{sup 118}. A similar arrangement of charged residues has been described in other invasins. ACP shows a heparin binding activity that requires NtACP. We propose a possible heparin-binding site, including one surface of the three-helix bundle, and nearby portions of the sandwich and repeat domains. We have validated this prediction using assays of the heparin binding and cell-adhesion properties of engineered fragments of ACP. This is the first crystal structure of a member of the highly conserved Gram-positive surface alpha-like protein family, and it will enable the internalization mechanism of GBS to be dissected at the atomic level.

Interleukin‑6 induces an epithelial‑mesenchymal transition phenotype in human adamantinomatous craniopharyngioma cells and promotes tumor cell migration.

Science.gov (United States)

Zhou, Jie; Zhang, Chao; Pan, Jun; Chen, Ligang; Qi, Song-Tao

2017-06-01

Total resection of adamantinomatous craniopharyngioma (ACP) is complex and often leads to postoperative recurrence. This is due to the tendency of the tumor to invade the surrounding brain tissue and the generation of a local inflammatory state between the tumor cells and parenchyma. While there is evidence to suggest that interleukin‑6 (IL‑6) induces craniopharyngioma (CP)‑associated inflammation, particularly in ACP, the role of IL‑6 in the progression of ACP remains unclear. The results of the present study demonstrated that CP inflammation was associated with pathological classification, extent of surgery, degree of calcification and postoperative hypothalamic status scale. Cytokine antibody arrays were conducted to measure the expression of IL‑6 and other inflammatory factors in tumor tissues in response to various levels of inflammatory exposure. IL‑6, IL‑6 receptor (IL‑6R) and glycoprotein 130 expression was detected by immunohistochemistry. In addition, an ELISA was performed to quantify the levels of soluble IL‑6R (sIL‑6R) in the cystic fluid and supernatants of ACP cells and tumor‑associated fibroblasts. These measurements demonstrated that ACP cells produce IL‑6 and its associated proteins. In addition, the results revealed that while the viability of ACP cells was not affected, the migration of ACP cells was promoted by IL‑6 treatment in a concentration‑dependent manner. Conversely, treatment with an IL‑6‑blocking monoclonal antibody significantly decreased the migration of ACP cells. In addition, IL‑6 treatment increased the expression of vimentin and decreased the expression of E‑cadherin in a dose‑dependent manner. The findings of the present study demonstrate that IL‑6 may promote migration in vitro via the classic‑ and trans‑signaling pathways by inducing epithelial‑mesenchymal transition in ACP cell cultures.

Interleukin-6 induces an epithelial-mesenchymal transition phenotype in human adamantinomatous craniopharyngioma cells and promotes tumor cell migration

Science.gov (United States)

Zhou, Jie; Zhang, Chao; Pan, Jun; Chen, Ligang; Qi, Song-Tao

2017-01-01

Total resection of adamantinomatous craniopharyngioma (ACP) is complex and often leads to postoperative recurrence. This is due to the tendency of the tumor to invade the surrounding brain tissue and the generation of a local inflammatory state between the tumor cells and parenchyma. While there is evidence to suggest that interleukin-6 (IL-6) induces craniopharyngioma (CP)-associated inflammation, particularly in ACP, the role of IL-6 in the progression of ACP remains unclear. The results of the present study demonstrated that CP inflammation was associated with pathological classification, extent of surgery, degree of calcification and postoperative hypothalamic status scale. Cytokine antibody arrays were conducted to measure the expression of IL-6 and other inflammatory factors in tumor tissues in response to various levels of inflammatory exposure. IL-6, IL-6 receptor (IL-6R) and glycoprotein 130 expression was detected by immunohistochemistry. In addition, an ELISA was performed to quantify the levels of soluble IL-6R (sIL-6R) in the cystic fluid and supernatants of ACP cells and tumor-associated fibroblasts. These measurements demonstrated that ACP cells produce IL-6 and its associated proteins. In addition, the results revealed that while the viability of ACP cells was not affected, the migration of ACP cells was promoted by IL-6 treatment in a concentration-dependent manner. Conversely, treatment with an IL-6-blocking monoclonal antibody significantly decreased the migration of ACP cells. In addition, IL-6 treatment increased the expression of vimentin and decreased the expression of E-cadherin in a dose-dependent manner. The findings of the present study demonstrate that IL-6 may promote migration in vitro via the classic- and trans-signaling pathways by inducing epithelial-mesenchymal transition in ACP cell cultures. PMID:28487953

Community-based game intervention to improve South Asian Indian Americans' engagement with advanced care planning.

Science.gov (United States)

Radhakrishnan, Kavita; Van Scoy, Lauren Jodi; Jillapalli, Regina; Saxena, Shubhada; Kim, Miyong T

2017-07-27

Advance care planning (ACP) allows individuals to express their preferences for medical treatment in the event that they become incapable of making their own decisions. This study assessed the efficacy of a conversation game intervention for increasing South Asian Indian Americans' (SAIAs') engagement in ACP behaviors as well as the game's acceptability and cultural appropriateness among SAIAs. Eligible community-dwelling SAIAs were recruited at SAIA cultural events held in central Texas during the summer of 2016. Pregame questionnaires included demographics and the 55-item ACP Engagement Survey. Played in groups of 3-5, the game consists of 17 open-ended questions that prompt discussions of end-of-life issues. After each game session, focus groups and questionnaires were used to examine the game's cultural appropriateness and self-rated conversation quality. Postintervention responses on the ACP Engagement Survey and rates of participation in ACP behaviors were collected after 3 months through phone interviews or online surveys. Data were analyzed using descriptive statistics, frequencies, and paired t-tests comparing pre/post averages at a .05 significance level. Of the 47 participants, 64% were female, 62% had graduate degrees, 92% had lived in the U.S. for >10 years, 87% were first-generation immigrants, and 74% had no advance directive prior to the game. At the 3-month follow-up, 58% of participants had completed at least one ACP behavior, 42% had discussed end-of-life issues with loved ones, 15% did so with their healthcare providers, and 18% had created an advanced directive. ACP Engagement Survey scores increased significantly on all four of the process subscales by 3 months postgame. SAIA individuals who played a conversation game had a relatively high rate of performing ACP behaviors 3 months after the intervention. These findings suggest that conversation games may be useful tools for motivating people from minority communities to engage in ACP behaviors.

What limits production of unusual monoenoic fatty acids in transgenic plants?

Science.gov (United States)

Suh, Mi Chung; Schultz, David J; Ohlrogge, John B

2002-08-01

Unusual monounsaturated fatty acids are major constituents (greater than 80%) in seeds of Coriandrum sativum L. (coriander) and Thunbergia alata Bojer, as well as in glandular trichomes (greater than 80% derived products) of Pelargonium x hortorum (geranium). These diverged fatty acid structures are produced via distinct plastidial acyl-acyl carrier protein (ACP) desaturases. When expressed in Arabidopsis thaliana (L.) Heynh. under strong seed-specific promoters the unusual acyl-ACP desaturases resulted in accumulation of unusual monoene fatty acids at 1-15% of seed fatty acid mass. In this study, we have examined several factors that potentially limit higher production of unusual monoenes in transgenic oilseeds. (i) Immunoblots indicated that the introduced desaturases were expressed at levels equivalent to or higher than the endogenous delta9 18:0-ACP desaturase. However, the level of unusual fatty acid produced in transgenic plants was not correlated with the level of desaturase expression. (ii) The unusual desaturases were expressed in several backgrounds, including antisense 18:0-ACP desaturase plants, in fab1 mutants, and co-expressed with specialized ACP or ferredoxin isoforms. None of these experiments led to high production of expected products. (iii) No evidence was found for degradation of the unusual fatty acids during seed development. (iv) Petroselinic acid added to developing seeds was incorporated into triacylglycerol as readily as oleic acid, suggesting no major barriers to its metabolism by enzymes of glycerolipid assembly. (v) In vitro and in situ assay of acyl-ACP desaturases revealed a large discrepancy of activity when comparing unusual acyl-ACP desaturases with the endogenous delta9 18:0-ACP desaturase. The combined results, coupled with the sensitivity of acyl-ACP desaturase activity to centrifugation and low salt or detergent suggests low production of unusual monoenes in transgenic plants may be due to the lack of, or incorrect assemble of

Periostin activates pathways involved in epithelial-mesenchymal transition in adamantinomatous craniopharyngioma.

Science.gov (United States)

Chen, Ming; Zheng, Shi-hao; Liu, Yi; Shi, Jin; Qi, Song-tao

2016-01-15

Periostin (POSTN) is an extracellular matrix protein (ECM) critical for epithelial-mesenchymal transitions (EMT) in several kinds of tumor cells. Previous studies have indicated that EMT exists in craniopharyngioma (CP), and expression of POSTN is a significant factor in the prognosis of CP. However, it has never been explored whether POSTN exists in CP, or how it activates CP's EMT. The expression of POSTN was examined in adamantinomatous craniopharyngioma (ACP) primary cells and tissues by immunohistochemistry, PCR and Western blot, respectively. The effects and mechanisms of POSTN on ACP cells' EMT were also analyzed. It was found that POSTN expression increased in ACP-associated fibroblasts. Overexpressed POSTN significantly elevated the EMT of ACP cells by regulating the expression of associated genes. More importantly, our further study revealed that the upregulated POSTN activated Akt signaling pathway to regulate the EMT. This study showed that POSTN is responsible for the EMT of ACP cells, and POSTN might be a potential molecular therapeutic target for ACP treatment in future. Copyright © 2015 Elsevier B.V. All rights reserved.

Hydrolytic conversion of amorphous calcium phosphate into apatite accompanied by sustained calcium and orthophosphate ions release

Energy Technology Data Exchange (ETDEWEB)

Niu, Xufeng, E-mail: nxf@buaa.edu.cn [Key Laboratory for Biomechanics and Mechanobiology of Ministry of Education, School of Biological Science and Medical Engineering, Beihang University, Beijing 100191 (China); BUAA Research Institute, Guangzhou 510530 (China); Research Institute of Beihang University in Shenzhen, Shenzhen 518057 (China); Chen, Siqian; Tian, Feng; Wang, Lizhen [Key Laboratory for Biomechanics and Mechanobiology of Ministry of Education, School of Biological Science and Medical Engineering, Beihang University, Beijing 100191 (China); Feng, Qingling [State Key Laboratory of New Ceramic and Fine Processing, Tsinghua University, Beijing 100084 (China); Fan, Yubo, E-mail: yubofan@buaa.edu.cn [Key Laboratory for Biomechanics and Mechanobiology of Ministry of Education, School of Biological Science and Medical Engineering, Beihang University, Beijing 100191 (China)

2017-01-01

The aim of this study is to investigate the calcium and orthophosphate ions release during the transformation of amorphous calcium phosphate (ACP) to hydroxyapatite (HA) in aqueous solution. The ACP is prepared by a wet chemical method and further immersed in the distilled water for various time points till 14 d. The release of calcium and orthophosphate ions is measured with calcium and phosphate colorimetric assay kits, respectively. The transition of ACP towards HA is detected by x-ray diffraction (XRD), transmission electron microscopy (TEM), and fourier transform infrared spectroscopy (FTIR). The results indicate that the morphological conversion of ACP to HA occurs within the first 9 h, whereas the calcium and orthophosphate ions releases last for over 7 d. Such sustained calcium and orthophosphate ions release is very useful for ACP as a candidate material for hard tissue regeneration. - Highlights: • ACP is prepared using a wet chemical method. • The conversion of crystal morphology and structure occurs mainly within the initial 9 h. • The calcium and orthophosphate ions release sustains over 14 d.

Biomass accumulation, photochemical efficiency of photosystem II, nutrient contents and nitrate reductase activity in young rosewood plants (Aniba rosaeodora Ducke submitted to different NO3-:NH4+ ratios Acúmulo de biomassa, eficiência fotoquímica do fotossistema II, conteúdo de nutrientes e atividade da redutase do nitrato em plantas jovens de pau-rosa (Aniba rosaeodora Ducke submetidas a diferentes relações NO3-:NH4+

Directory of Open Access Journals (Sweden)

Denize Caranhas de Sousa Barreto

2007-01-01

Full Text Available The rosewood (Aniba rosaeodora Ducke is a native tree species of Amazon rainforest growing naturally in acidic forest soils with reduced redox potential. However, this species can also been found growing in forest gaps containing oxide soils. Variations in the forms of mineral nitrogen (NO3- or NH4+ may be predicted in these different edaphic conditions. Considering that possibility, an experiment was carried out to analyze the effects of different NO3-:NH4+ ratios on the growth performance, mineral composition, chloroplastid pigment contents, photochemical efficiency photosystem II (PSII, and nitrate redutase activity (RN, E.C.1.6.6.1 on A. rosaeodora seedlings. Nine-month-old seedlings were grown in pots with a washed sand capacity of 7.5 kg and submitted to different NO3-:NH4+ ratios (T1 = 0:100%, T2 = 25:75%, T3 = 50:50%, T4 = 75:25%, and T5 = 100:0%. The lowest relative growth rate was observed when the NO3-:NH4+ ratio was equal to 0:100%. In general, high concentrations of NO3- rather than NH4+ favored a greater nutrient accumulation in different parts of the plant. For the chloroplastid pigment, the highest Chl a, Chl b, Chl tot, Chl a/b and Chl tot/Cx+c contents were found in the treatment with 75:25% of NO3-:NH4+, and for Chl b and Cx+c it was observed no difference. In addition, there was a higher photochemical efficiency of PSII (Fv/Fm when high NO3- concentrations were used. A linear and positive response for the nitrate reductase activity was recorded when the nitrate content increased on the culture substrate. Our results suggest that A. rosaeodora seedlings have a better growth performance when the NO3- concentrations in the culture substrate were higher than the NH4+ concentrations.O pau-rosa (Aniba rosaeodora Ducke habita, naturalmente, solos florestais ácidos com potencial redox reduzido. No entanto, estas espécies têm sido encontradas também em clareiras que, teoricamente, apresentam solos mais oxidados. Nestas diferentes

Barriers to advance care planning at the end of life: an explanatory systematic review of implementation studies.

Directory of Open Access Journals (Sweden)

Susi Lund

Full Text Available Advance Care Plans (ACPs enable patients to discuss and negotiate their preferences for the future including treatment options at the end of life. Their implementation poses significant challenges.To investigate barriers and facilitators to the implementation of ACPs, focusing on their workability and integration in clinical practice.An explanatory systematic review of qualitative implementation studies.Empirical studies that reported interventions designed to support ACP in healthcare. Web of Knowledge, Ovid MEDLINE, CINAHL, PsycINFO, British Nursing Index and PubMed databases were searched.Direct content analysis, using Normalization Process Theory, to identify and characterise relevant components of implementation processes.13 papers identified from 166 abstracts were included in the review. Key factors facilitating implementation were: specially prepared staff utilizing a structured approach to interactions around ACPs. Barriers to implementation were competing demands of other work, the emotional and interactional nature of patient-professional interactions around ACPs, problems in sharing decisions and preferences within and between healthcare organizations.This review demonstrates that doing more of the things that facilitate delivery of ACPs will not reduce the effects of those things that undermine them. Structured tools are only likely to be partially effective and the creation of a specialist cadre of ACP facilitators is unlikely to be a sustainable solution. The findings underscore both the challenge and need to find ways to routinely incorporate ACPs in clinical settings where multiple and competing demands impact on practice. Interventions most likely to meet with success are those that make elements of Advance Care Planning workable within complex and time pressured clinical workflows.

Feasibility of hospital-initiated non-facilitator assisted advance care planning documentation for patients with palliative care needs.

Science.gov (United States)

Kok, Maaike; van der Werff, Gertruud F M; Geerling, Jenske I; Ruivenkamp, Jaap; Groothoff, Wies; van der Velden, Annette W G; Thoma, Monique; Talsma, Jaap; Costongs, Louk G P; Gans, Reinold O B; de Graeff, Pauline; Reyners, Anna K L

2018-05-24

Advance Care Planning (ACP) and its documentation, accessible to healthcare professionals regardless of where patients are staying, can improve palliative care. ACP is usually performed by trained facilitators. However, ACP conversations would be more tailored to a patient's specific situation if held by a patient's clinical healthcare team. This study assesses the feasibility of ACP by a patient's clinical healthcare team, and analyses the documented information including current and future problems within the palliative care domains. This multicentre study was conducted at the three Groningen Palliative Care Network hospitals in the Netherlands. Patients discharged from hospital with a terminal care indication received an ACP document from clinical staff (non-palliative care trained staff at hospitals I and II; specialist palliative care nurses at hospital III) after they had held ACP conversations. An anonymised copy of this ACP document was analysed. Documentation rates of patient and contact details were investigated, and documentation of current and future problems were analysed both quantitatively and qualitatively. One hundred sixty ACP documents were received between April 2013 and December 2014, with numbers increasing for each consecutive 3-month time period. Advance directives were frequently documented (82%). Documentation rates of current problems in the social (24%), psychological (27%) and spiritual (16%) domains were low compared to physical problems (85%) at hospital I and II, but consistently high (> 85%) at hospital III. Of 545 documented anticipated problems, 92% were physical or care related in nature, 2% social, 5% psychological, and will improve identification and documentation of non-physical problems remains to be investigated.

Advance Care Planning in Glioblastoma Patients

Directory of Open Access Journals (Sweden)

Lara Fritz

2016-11-01

Full Text Available Despite multimodal treatment with surgery, radiotherapy and chemotherapy, glioblastoma is an incurable disease with a poor prognosis. During the disease course, glioblastoma patients may experience progressive neurological deficits, symptoms of increased intracranial pressure such as drowsiness and headache, incontinence, seizures and progressive cognitive dysfunction. These patients not only have cancer, but also a progressive brain disease. This may seriously interfere with their ability to make their own decisions regarding treatment. It is therefore warranted to involve glioblastoma patients early in the disease trajectory in treatment decision-making on their future care, including the end of life (EOL care, which can be achieved with Advance Care Planning (ACP. Although ACP, by definition, aims at timely involvement of patients and proxies in decision-making on future care, the optimal moment to initiate ACP discussions in the disease trajectory of glioblastoma patients remains controversial. Moreover, the disease-specific content of these ACP discussions needs to be established. In this article, we will first describe the history of patient participation in treatment decision-making, including the shift towards ACP. Secondly, we will describe the possible role of ACP for glioblastoma patients, with the specific aim of treatment of disease-specific symptoms such as somnolence and dysphagia, epileptic seizures, headache, and personality changes, agitation and delirium in the EOL phase, and the importance of timing of ACP discussions in this patient population.

Expression of SRY-related HMG Box Transcription Factors (Sox) 2 and 9 in Craniopharyngioma Subtypes and Surrounding Brain Tissue.

Science.gov (United States)

Thimsen, Vivian; John, Nora; Buchfelder, Michael; Flitsch, Jörg; Fahlbusch, Rudolf; Stefanits, Harald; Knosp, Engelbert; Losa, Marco; Buslei, Rolf; Hölsken, Annett

2017-11-20

Stem cells have been discovered as key players in the genesis of different neoplasms including craniopharyngioma (CP), a rare tumour entity in the sellar region. Sox2 and Sox9 are well-known stem cell markers involved in pituitary development. In this study we analysed the expression of both transcription factors using immunohistochemistry in a large cohort of 64 adamantinomatous (aCP) and 9 papillary CP (pCP) and quantitative PCR in 26 aCP and 7 pCP. Whereas immunohistochemically Sox2+ cells were verifiable in only five aCP (7.8%) and in 39.1% of the respective surrounding cerebral tissue, pCP specimens appeared always negative. In contrast, Sox9 was detectable in all tumours with a significantly higher expression in aCP compared to pCP (protein, p < 0.0001; mRNA p = 0.0484) This was also true for the respective tumour adjacent CNS where 63 aCP (98.4%) and six pCP (66.7%) showed Sox9+ cells. We further confirmed absence of Sox9 expression in nuclear β-catenin accumulating cells of aCP. Our results point to the conclusion that Sox2 and Sox9, seem to play essential roles not only in the specific formation of aCP, but also in processes involving the cerebral tumour environment, which needs to be illuminated in the future.

Population diversity of Diaphorina citri (Hemiptera: Liviidae) in China based on whole mitochondrial genome sequences.

Science.gov (United States)

Wu, Fengnian; Jiang, Hongyan; Beattie, G Andrew C; Holford, Paul; Chen, Jianchi; Wallis, Christopher M; Zheng, Zheng; Deng, Xiaoling; Cen, Yijing

2018-04-24

Diaphorina citri (Asian citrus psyllid; ACP) transmits 'Candidatus Liberibacter asiaticus' associated with citrus Huanglongbing (HLB). ACP has been reported in 11 provinces/regions in China, yet its population diversity remains unclear. In this study, we evaluated ACP population diversity in China using representative whole mitochondrial genome (mitogenome) sequences. Additional mitogenome sequences outside China were also acquired and evaluated. The sizes of the 27 ACP mitogenome sequences ranged from 14 986 to 15 030 bp. Along with three previously published mitogenome sequences, the 30 sequences formed three major mitochondrial groups (MGs): MG1, present in southwestern China and occurring at elevations above 1000 m; MG2, present in southeastern China and Southeast Asia (Cambodia, Indonesia, Malaysia, and Vietnam) and occurring at elevations below 180 m; and MG3, present in the USA and Pakistan. Single nucleotide polymorphisms in five genes (cox2, atp8, nad3, nad1 and rrnL) contributed mostly in the ACP diversity. Among these genes, rrnL had the most variation. Mitogenome sequences analyses revealed two major phylogenetic groups of ACP present in China as well as a possible unique group present currently in Pakistan and the USA. The information could have significant implications for current ACP control and HLB management. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Investigation of isoniazid and ethionamide cross-resistance by whole genome sequencing and association with poor treatment outcomes of multidrug-resistant tuberculosis patients in South Africa

Directory of Open Access Journals (Sweden)

L Malinga

2016-01-01

Conclusion: Baseline ETH molecular resistance before second-line treatment is a concern. Unfavorable treatment outcomes of patients with ethA, ethR, and inhA mutations highlight the importance of genotypic testing before initiation of treatment containing ETH. The clinical significance of whole genome analysis for early detection of mutations predictive of treatment failure needs further investigation.

The logic of ACP

NARCIS (Netherlands)

A. Ponse (Alban); M.B. van der Zwaag

2002-01-01

textabstractWe distinguish two interpretations for the truth value `undefined' in Kleene's three-valued logic. Combining these two interpretations leads to a four-valued propositional logic that characterizes two particular ingredients of process algebra: ``choice' and ``inaction'. We study two

Knowledge About and Perceptions of Advance Care Planning and Communication of Chinese-American Older Adults.

Science.gov (United States)

Yonashiro-Cho, Jeanine; Cote, Sarah; Enguidanos, Susan

2016-09-01

Although advance care planning (ACP) is associated with better care at the end of life, better quality of death, and less psychological distress in survivors, ethnic disparities in ACP completion rates have been documented and may be attributable to lack of knowledge about ACP or differences in cultural values and preferences. Despite rapid increases in the size of the Asian-American population, little is known about ACP preferences of Chinese Americans. The purpose of this study is to explore the knowledge, attitudes, and preferences of older Chinese Americans toward ACP. Focus groups with Chinese older adults (n = 34) were conducted in Mandarin, Cantonese, and English, and transcripts were analyzed using a grounded theory approach. Identified themes included knowledge and experience with ACP and end-of-life care options, health as a factor in timing of ACP and communication, and communication of end-of-life care preferences. Knowledge of and experience with ACP and end-of-life decision-making varied according to focus group, although few participants had an advance directive. Findings suggest that Chinese older adults prefer to use indirect communication strategies, such as commenting on the circumstances of others rather than directly stating their wishes, and informal contexts, such as during a family dinner rather than formal meeting, to convey their care preferences to loved ones and may employ similar tactics when communicating with clinicians. This is particularly important given the recent decision by the Centers for Medicare and Medicaid Services to provide reimbursement to physicians for engaging in advance care planning conversations. © 2016, Copyright the Authors Journal compilation © 2016, The American Geriatrics Society.

Acetyl Phosphate as a Primordial Energy Currency at the Origin of Life

Science.gov (United States)

Whicher, Alexandra; Camprubi, Eloi; Pinna, Silvana; Herschy, Barry; Lane, Nick

2018-03-01

Metabolism is primed through the formation of thioesters via acetyl CoA and the phosphorylation of substrates by ATP. Prebiotic equivalents such as methyl thioacetate and acetyl phosphate have been proposed to catalyse analogous reactions at the origin of life, but their propensity to hydrolyse challenges this view. Here we show that acetyl phosphate (AcP) can be synthesised in water within minutes from thioacetate (but not methyl thioacetate) under ambient conditions. AcP is stable over hours, depending on temperature, pH and cation content, giving it an ideal poise between stability and reactivity. We show that AcP can phosphorylate nucleotide precursors such as ribose to ribose-5-phosphate and adenosine to adenosine monophosphate, at modest ( 2%) yield in water, and at a range of pH. AcP can also phosphorylate ADP to ATP in water over several hours at 50 °C. But AcP did not promote polymerization of either glycine or AMP. The amino group of glycine was preferentially acetylated by AcP, especially at alkaline pH, hindering the formation of polypeptides. AMP formed small stacks of up to 7 monomers, but these did not polymerise in the presence of AcP in aqueous solution. We conclude that AcP can phosphorylate biologically meaningful substrates in a manner analogous to ATP, promoting the origins of metabolism, but is unlikely to have driven polymerization of macromolecules such as polypeptides or RNA in free solution. This is consistent with the idea that a period of monomer (cofactor) catalysis preceded the emergence of polymeric enzymes or ribozymes at the origin of life.

Establishment and conventional cytogenetic characterization of three gastric cancer cell lines.

Science.gov (United States)

Leal, Mariana Ferreira; Martins do Nascimento, José Luiz; da Silva, Carla Elvira Araújo; Vita Lamarão, Maria Fernanda; Calcagno, Danielle Queiroz; Khayat, André Salim; Assumpção, Paulo Pimentel; Cabral, Isabel Rosa; de Arruda Cardoso Smith, Marília; Burbano, Rommel Rodríguez

2009-11-01

Gastric cancer is the fourth most frequent type of cancer and the second most frequent cause of cancer mortality worldwide. Only a modest number of gastric carcinoma cell lines have been isolated thus far. Here we describe the establishment and cytogenetic characterization of three new gastric cancer cell lines obtained from primary gastric adenocarcinoma (ACP02 and ACP03) and cancerous ascitic fluid (AGP01) of individuals from northern Brazil. ACP02, ACP03, and AGP01 cell lines are presently in the 60th passage. The cell lines grew in a disorganized single layer with some agglomerations and heterogeneous divisions (bipolar and multipolar). All cell lines exhibited a composite karyotype with several clonal chromosome alterations. Trisomy 8 was the most frequent alteration. Chromosome 8 aneusomy was confirmed by fluorescence in situ hybridization. All cell lines also exhibited trisomy 7 and deletion of chromosome arm 17p. These results suggest that, although frequent chromosome alterations are commonly observed due to culture process, the ACP02, ACP03, and AGP01 cell lines and primary gastric cancer from individuals of northern Brazil share genetic alterations, supporting use of these cell lines as a model of gastric carcinogenesis in this population.

Barriers and strategies to an iterative model of advance care planning communication.

Science.gov (United States)

Ahluwalia, Sangeeta C; Bekelman, David B; Huynh, Alexis K; Prendergast, Thomas J; Shreve, Scott; Lorenz, Karl A

2015-12-01

Early and repeated patient-provider conversations about advance care planning (ACP) are now widely recommended. We sought to characterize barriers and strategies for realizing an iterative model of ACP patient-provider communication. A total of 2 multidisciplinary focus groups and 3 semistructured interviews with 20 providers at a large Veterans Affairs medical center. Thematic analysis was employed to identify salient themes. Barriers included variation among providers in approaches to ACP, lack of useful information about patient values to guide decision making, and ineffective communication between providers across settings. Strategies included eliciting patient values rather than specific treatment choices and an increased role for primary care in the ACP process. Greater attention to connecting providers across the continuum, maximizing the potential of the electronic health record, and linking patient experiences to their values may help to connect ACP communication across the continuum. © The Author(s) 2014.

LVAD patients' and surrogates' perspectives on SPIRIT-HF: An advance care planning discussion.

Science.gov (United States)

Metzger, Maureen; Song, Mi-Kyung; Devane-Johnson, Stephanie

2016-01-01

To describe LVAD patients' and surrogates' experiences with, and perspectives on SPIRIT-HF, an advance care planning (ACP) intervention. ACP is important for patients with LVAD, yet little is known about their experiences or those of their surrogates who have participated in ACP discussions. We used qualitative content analysis techniques to conduct a secondary analysis of 28 interviews with patients with LVAD (n = 14) and their surrogates (n = 14) who had participated in an RCT pilot study of SPIRIT-HF. Main themes from the data include: 1) sharing their HF stories was very beneficial; 2) participating in SPIRIT-HF led to greater peace of mind for patients and surrogates; 3) "one size does not fit all" when it comes to timing of ACP discussions. An understanding patient and surrogate perspectives may inform clinicians' approach to ACP discussions. Copyright © 2016 Elsevier Inc. All rights reserved.

Comparative immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary craniopharyngiomas

Directory of Open Access Journals (Sweden)

Ghada E. Esheba

2015-09-01

Conclusion: Nuclear accumulation of β-catenin is a diagnostic hallmark of the ACP and is very helpful in the differential diagnosis between both ACP and PCP in the setting of small biopsies. Moreover, the restricted nuclear β-catenin accumulation in the cohesive cell clusters within the whorl-like areas supports that aberrant β-catenin expression may play a role in the morphogenesis of ACP.

Electrospinning of calcium phosphate-poly(D,L-lactic acid nanofibers for sustained release of water-soluble drug and fast mineralization

Directory of Open Access Journals (Sweden)

Fu QW

2016-10-01

Full Text Available Qi-Wei Fu,1,* Yun-Peng Zi,1,* Wei Xu,1 Rong Zhou,1 Zhu-Yun Cai,1 Wei-Jie Zheng,1 Feng Chen,2 Qi-Rong Qian1 1Department of Orthopedics, Changzheng Hospital, Second Military Medical University, 2State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Calcium phosphate-based biomaterials have been well studied in biomedical fields due to their outstanding chemical and biological properties which are similar to the inorganic constituents in bone tissue. In this study, amorphous calcium phosphate (ACP nanoparticles were prepared by a precipitation method, and used for preparation of ACP-poly(D,L-lactic acid (ACP-PLA nanofibers and water-soluble drug-containing ACP-PLA nanofibers by electrospinning. Promoting the encapsulation efficiency of water-soluble drugs in electrospun hydrophobic polymer nanofibers is a common problem due to the incompatibility between the water-soluble drug molecules and hydrophobic polymers solution. Herein, we used a native biomolecule of lecithin as a biocompatible surfactant to overcome this problem, and successfully prepared water-soluble drug-containing ACP-PLA nanofibers. The lecithin and ACP nanoparticles played important roles in stabilizing water-soluble drug in the electrospinning composite solution. The electrospun drug-containing ACP-PLA nanofibers exhibited fast mineralization in simulated body fluid. The ACP nanoparticles played the key role of seeds in the process of mineralization. Furthermore, the drug-containing ACP-PLA nanofibers exhibited sustained drug release which simultaneously occurred with the in situ mineralization in simulated body fluid. The osteoblast-like (MG63 cells with spreading filopodia were well observed on the as-prepared nanofibrous mats after culturing for 24 hours, indicating a high cytocompatibility. Due

Improving advance care planning for English-speaking and Spanish-speaking older adults: study protocol for the PREPARE randomised controlled trial

Science.gov (United States)

Sudore, Rebecca L; Barnes, Deborah E; Le, Gem M; Ramos, Roberto; Osua, Stacy J; Richardson, Sarah A; Boscardin, John; Schillinger, Dean

2016-01-01

Introduction Advance care planning (ACP) is a process that allows patients to identify their goals for medical care. Traditionally, ACP has focused on completing advance directives; however, we have expanded the ACP paradigm to also prepare patients to communicate their wishes and make informed decisions. To this end, we created an ACP website called PREPARE (http://www.prepareforyourcare.org) to prepare diverse English-speaking and Spanish-speaking older adults for medical decision-making. Here, we describe the study protocol for a randomised controlled efficacy trial of PREPARE in a safety-net setting. The goal is to determine the efficacy of PREPARE to engage diverse English-speaking and Spanish-speaking older adults in a full spectrum of ACP behaviours. Methods and analysis We include English-speaking and Spanish-speaking adults from an urban public hospital who are ≥55 years old, have ≥2 chronic medical conditions and have seen a primary care physician ≥2 times in the last year. Participants are randomised to the PREPARE intervention (review PREPARE and an easy-to-read advance directive) or the control arm (only the easy-to-read advance directive). The primary outcome is documentation of an advance directive and/or ACP discussion. Secondary outcomes include ACP behaviour change processes measured with validated surveys (eg, self-efficacy, readiness) and a broad range of ACP actions (eg, choosing a surrogate, identifying goals for care, discussing ACP with clinicians and/or surrogates). Using blinded outcome ascertainment, outcomes will be measured at 1 week and at 3, 6 and 12 months, and compared between study arms using mixed-effects logistic regression and mixed-effects linear, Poisson or negative binomial regression. Ethics and dissemination This study has been approved by the appropriate Institutional Review Boards and is guided by input from patient and clinical advisory boards and a data safety monitoring board. The results of this study will

Non-invasive ventilation: comparison of effectiveness, safety, and management in acute heart failure syndromes and acute exacerbations of chronic obstructive pulmonary disease.

Science.gov (United States)

Pladeck, T; Hader, C; Von Orde, A; Rasche, K; Wiechmann, H W

2007-11-01

Continuous positive airway pressure ventilation (CPAP) and non-invasive positive pressure ventilation (NPPV) are accepted treatments in acute cardiogenic pulmonary edema (ACPE) and acute exacerbation of chronic obstructive pulmonary disease (AECOPD). The aim of the study was a comparison of effectiveness, safety, and management of NPPV in ACPE and AECOPD trying to find an approach for standard management in intensive care. Thirty patients with acute respiratory failure (14 due to ACPE, 16 due to AECOPD) were prospectively included into the study. If clinical stability could not be achieved by standard therapy (pharmacological therapy and oxygen) patients were treated by non-invasive ventilation (NPPV) using a BiPAP-Vision device in S/T-mode. During the first 90 min after the onset of NPPV respiratory and vital parameters were documented every 30 min. Additional relevant outcome parameters (need for intubation, duration of ICU stay, complications and mortality) were monitored. We found that 85.7% of the ACPE patients and 50.0% of the AECOPD patients were treated successfully with NPPV. Intubation rate was 31.2% in the AECOPD group and 14.3% in the ACPE group. 78.6% of the ACPE patients and 43.8% of the AECOPD patients were regularly discharged from hospital in a good condition. In the first 90 min of NIV, there was a significant amelioration of respiratory and other vital parameters. In ACPE patients there was a significant increase in PaO2 from 58.9 mmHg to 80.6 mmHg and of oxygen saturation (SaO2) from 85.1% to 93.1% without changing the inspiratory O2 concentration. This effect was comparable in the AECOPD group, but only could be achieved by increasing the inspiratory ventilation pressure. In the ACPE group inspiratory ventilation pressure could be reduced. In conclusion, in acute respiratory failure, ACPE patients comparably profit from NPPV as do patients with AECOPD, but the algorithm of titration for non-invasive ventilation pressure is different.

Chronic Pain, Patient-Physician Engagement, and Family Communication Associated With Drug-Using HIV Patients' Discussing Advanced Care Planning With Their Physicians.

Science.gov (United States)

Hansen, Eric D; Mitchell, Mary M; Smith, Tom; Hutton, Nancy; Keruly, Jeanne; Knowlton, Amy R

2017-10-01

In the era of effective antiretroviral therapy, persons living with HIV/AIDS (PLWHA) are living longer, transforming HIV into a serious chronic illness, warranting patient-provider discussion about advanced care planning (ACP). Evidence is needed to inform physicians on how to approach ACP for these patients. Chronic pain is common in PLWHA, particularly in those who have substance use disorders; although it is known that this population is at risk for poorer patient-physician engagement, the effects on ACP are unknown. To further characterize factors associated with successful ACP in PLWHA, we examined associations between patient-physician relationship, chronic pain, family communication and problem-solving skills, and rates of patients discussing ACP with their physicians. Data were from the Affirm Care study (N = 325), which examined social and environmental factors associated with health outcomes among PLWHA and their informal caregivers. In multivariate analysis, higher odds of patient reports of discussing ACP with their physicians were associated with their higher rating of their relationship with their physician (adjusted odds ratio [AOR] 1.73; P family arguments about end-of-life medical decisions (AOR 2.43; P family members about problems (AOR 1.33; P family communication and family problem-solving skills. The findings also suggest that PLWHA with chronic pain and prior family discord over end-of-life medical decisions may be primed for ACP. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

First Isolation and Molecular Characterization of Bacteriophages Infecting Acidovorax citrulli, the Causal Agent of Bacterial Fruit Blotch

Directory of Open Access Journals (Sweden)

Aryan Rahimi-Midani

2018-02-01

Full Text Available Bacteriophages of Acidovorax citrulli, the causal agent of bacterial fruit blotch, were isolated from 39 watermelon, pumpkin, and cucumber leaf samples collected from various regions of Korea and tested against 18 A. citrulli strains. Among the six phages isolated, ACP17 forms the largest plaque, and exhibits the morphology of phages in the Myoviridae family with a head diameter of 100 ± 5 nm and tail length of 150 ± 5 nm. ACP17 has eclipse and latent periods of 25 ± 5 min and 50 ± 5 min, respectively, and a burst size of 120. The genome of ACP17 is 156,281 base pairs with a G + C content of 58.7%, 263 open reading frames, and 4 transfer RNA genes. Blast search and phylogenetic analysis of the major capsid protein showed that ACP17 has limited homology to two Stentrophomonas phages, suggesting that ACP17 is a new type of Myoviridae isolated from A. citrulli.

Intra-articular Autologous Conditioned Plasma Injections Provide Safe and Efficacious Treatment for Knee Osteoarthritis: An FDA-Sanctioned, Randomized, Double-blind, Placebo-controlled Clinical Trial.

Science.gov (United States)

Smith, Patrick A

2016-04-01

Platelet-rich plasma (PRP) injections have become an intriguing treatment option for osteoarthritis (OA), particularly OA of the knee. Despite the plethora of PRP-related citations, there is a paucity of high-level evidence that is comparable, cohort specific, dose controlled, injection protocol controlled, and double-blinded. To determine the safety and efficacy of leukocyte-poor PRP autologous conditioned plasma (ACP) for knee OA treatment through a feasibility trial regulated by the US Food and Drug Administration (FDA). Randomized controlled trial; Level of evidence, 1. In accordance with FDA protocol, patient selection was based on strict inclusion/exclusion criteria; 114 patients were screened, and 30 were ultimately included in the study. These patients were randomized to receive either ACP (n = 15) or saline placebo (n = 15) for a series of 3 weekly injections. Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) scores served as the primary efficacy outcome measure. Patients were followed for 1 year. No adverse events were reported for ACP administration. Furthermore, the results demonstrated no statistically significant difference in baseline WOMAC scores between the 2 groups. However, in the ACP group, WOMAC scores at 1 week were significantly decreased compared with baseline scores, and the scores for this group remained significantly lower throughout the study duration. At the study conclusion (12 months), subjects in the ACP group had improved their overall WOMAC scores by 78% from their baseline score, compared with 7% for the placebo group. ACP is safe and provides quantifiable benefits for pain relief and functional improvement with regard to knee OA. No adverse events were reported for ACP administration. After 1 year, WOMAC scores for the ACP subjects had improved by 78% from their baseline score, whereas scores for the placebo control group had improved by only 7%. Other joints affected with OA may also benefit from this

Health behavior change in advance care planning: an agent-based model

Directory of Open Access Journals (Sweden)

Natalie C. Ernecoff

2016-02-01

Full Text Available Abstract Background A practical and ethical challenge in advance care planning research is controlling and intervening on human behavior. Additionally, observing dynamic changes in advance care planning (ACP behavior proves difficult, though tracking changes over time is important for intervention development. Agent-based modeling (ABM allows researchers to integrate complex behavioral data about advance care planning behaviors and thought processes into a controlled environment that is more easily alterable and observable. Literature to date has not addressed how best to motivate individuals, increase facilitators and reduce barriers associated with ACP. We aimed to build an ABM that applies the Transtheoretical Model of behavior change to ACP as a health behavior and accurately reflects: 1 the rates at which individuals complete the process, 2 how individuals respond to barriers, facilitators, and behavioral variables, and 3 the interactions between these variables. Methods We developed a dynamic ABM of the ACP decision making process based on the stages of change posited by the Transtheoretical Model. We integrated barriers, facilitators, and other behavioral variables that agents encounter as they move through the process. Results We successfully incorporated ACP barriers, facilitators, and other behavioral variables into our ABM, forming a plausible representation of ACP behavior and decision-making. The resulting distributions across the stages of change replicated those found in the literature, with approximately half of participants in the action-maintenance stage in both the model and the literature. Conclusions Our ABM is a useful method for representing dynamic social and experiential influences on the ACP decision making process. This model suggests structural interventions, e.g. increasing access to ACP materials in primary care clinics, in addition to improved methods of data collection for behavioral studies, e.g. incorporating

Health behavior change in advance care planning: an agent-based model.

Science.gov (United States)

Ernecoff, Natalie C; Keane, Christopher R; Albert, Steven M

2016-02-29

A practical and ethical challenge in advance care planning research is controlling and intervening on human behavior. Additionally, observing dynamic changes in advance care planning (ACP) behavior proves difficult, though tracking changes over time is important for intervention development. Agent-based modeling (ABM) allows researchers to integrate complex behavioral data about advance care planning behaviors and thought processes into a controlled environment that is more easily alterable and observable. Literature to date has not addressed how best to motivate individuals, increase facilitators and reduce barriers associated with ACP. We aimed to build an ABM that applies the Transtheoretical Model of behavior change to ACP as a health behavior and accurately reflects: 1) the rates at which individuals complete the process, 2) how individuals respond to barriers, facilitators, and behavioral variables, and 3) the interactions between these variables. We developed a dynamic ABM of the ACP decision making process based on the stages of change posited by the Transtheoretical Model. We integrated barriers, facilitators, and other behavioral variables that agents encounter as they move through the process. We successfully incorporated ACP barriers, facilitators, and other behavioral variables into our ABM, forming a plausible representation of ACP behavior and decision-making. The resulting distributions across the stages of change replicated those found in the literature, with approximately half of participants in the action-maintenance stage in both the model and the literature. Our ABM is a useful method for representing dynamic social and experiential influences on the ACP decision making process. This model suggests structural interventions, e.g. increasing access to ACP materials in primary care clinics, in addition to improved methods of data collection for behavioral studies, e.g. incorporating longitudinal data to capture behavioral dynamics.

Modeling linear and cyclic PKS intermediates through atom replacement.

Science.gov (United States)

Shakya, Gaurav; Rivera, Heriberto; Lee, D John; Jaremko, Matt J; La Clair, James J; Fox, Daniel T; Haushalter, Robert W; Schaub, Andrew J; Bruegger, Joel; Barajas, Jesus F; White, Alexander R; Kaur, Parminder; Gwozdziowski, Emily R; Wong, Fiona; Tsai, Shiou-Chuan; Burkart, Michael D

2014-12-03

The mechanistic details of many polyketide synthases (PKSs) remain elusive due to the instability of transient intermediates that are not accessible via conventional methods. Here we report an atom replacement strategy that enables the rapid preparation of polyketone surrogates by selective atom replacement, thereby providing key substrate mimetics for detailed mechanistic evaluations. Polyketone mimetics are positioned on the actinorhodin acyl carrier protein (actACP) to probe the underpinnings of substrate association upon nascent chain elongation and processivity. Protein NMR is used to visualize substrate interaction with the actACP, where a tetraketide substrate is shown not to bind within the protein, while heptaketide and octaketide substrates show strong association between helix II and IV. To examine the later cyclization stages, we extended this strategy to prepare stabilized cyclic intermediates and evaluate their binding by the actACP. Elongated monocyclic mimics show much longer residence time within actACP than shortened analogs. Taken together, these observations suggest ACP-substrate association occurs both before and after ketoreductase action upon the fully elongated polyketone, indicating a key role played by the ACP within PKS timing and processivity. These atom replacement mimetics offer new tools to study protein and substrate interactions and are applicable to a wide variety of PKSs.

Incidence Proportion of Acute Cor Pulmonale in Patients with Acute Respiratory Distress Syndrome Subjected to Lung Protective Ventilation: A Systematic Review and Meta-analysis.

Science.gov (United States)

Das, Saurabh Kumar; Choupoo, Nang Sujali; Saikia, Priyam; Lahkar, Amitabh

2017-06-01

Reported incidence of acute cor pulmonale (ACP) in patients with acute respiratory distress syndrome (ARDS) varies from 10% to 84%, despite being subjected to lung protective ventilation according to the current guidelines. The objective of this review is to find pooled cumulative incidence of ACP in patients with ARDS undergoing lung protective ventilation. We searched MEDLINE, EMBASE, Cochrane Library, KoreaMed, LILACS, and WHO Clinical Trial Registry. Cross-sectional or cohort studies were included if they reported or provided data that could be used to calculate the incidence proportion of ACP. Inverse variance heterogeneity (IVhet) and random effect model were used for the main outcome and measures. We included 16 studies encompassing 1661 patients. The cumulative incidence of ACP using IVhet analysis was 23% (95% confidence interval [CI] = 18%-28%) over 3 days of lung protective ventilation. Random effect analysis of 7 studies (1250 patients) revealed pooled odd ratio of mortality of 1.16 (95% CI = 0.80-1.67, P = 0.44) due to ACP. Patients with ARDS have a 23% risk of developing ACP with lung protective ventilation. Findings of this review indicate the need of updating existing guidelines for ventilating ARDS patients to incorporate right ventricle protective strategy.

Preoperative Prediction of the Necessity for Anterior Clinoidectomy During Microsurgical Clipping of Ruptured Posterior Communicating Artery Aneurysms.

Science.gov (United States)

Kamide, Tomoya; Burkhardt, Jan-Karl; Tabani, Halima; Safaee, Michael M; Lawton, Michael T

2018-01-01

Although most posterior communicating artery (PCoA) aneurysms can be clipped easily with excellent results, some require anterior clinoidectomy for safe and complete clipping. To review our microsurgical series of ruptured PCoA aneurysms and identify the preoperative predictors for anterior clinoidectomy during microsurgical clipping for PCoA aneurysms. Results from microsurgical clipping of 104 patients with ruptured PCoA aneurysms were reviewed retrospectively. Distances and angles were obtained from computed tomographic angiography and compared between the anterior and nonanterior clinoidectomy groups. Anterior clinoidectomy was required in 19 of the 104 cases (18%). None developed surgical complications due to anterior clinoid process (ACP) resection, including postoperative visual deficit. Univariate and multivariate analyses revealed that the distances from the ACP tip to the aneurysmal proximal neck and from the ACP line to the aneurysmal proximal neck were statistically significant predictive factors for the need of anterior clinoidectomy. Based on a receiver operating characteristic analysis, the distances from the ACP tip to the aneurysmal proximal neck PCoA aneurysm surgery, the distances from the ACP tip to the aneurysmal proximal neck and from the ACP line to the aneurysmal proximal neck were both found to be useful predictors of whether anterior clinoidectomy was required. Copyright © 2017 Elsevier Inc. All rights reserved.

The decreased of Streptococcus Mutans growth after topical application of phosphopeptide amorphous calcium phosphate paste

Directory of Open Access Journals (Sweden)

Tika Faradina Araf

2011-07-01

Full Text Available Casein Phosphopeptide-Amorphous Calcium Phosphate (CPP-ACP paste is a topical application substance that consisted of a series of milk derivative peptide as a result of phosphorylation and has an antibacterial activity. The objective of this research was to find out the difference of Streptococcus mutans growth before and after CPP-ACP paste given topically to child's teeth. The method of the research was a quasi-experiment. Research samples were 10 students of MI Al Falah Islamic Boarding School, Jatinangor, West Jawa Indonesia and collected with purposive sampling technique. This research used dental plaque from child's teeth before and after applicated by CPP-ACP paste. The plaque was cultivated in selective media Tryptone Yeast Cysteine Sucrose Bacitracin (TYCSB with repeated twice. Streptococcus mutans colony in TYCSB were counted by Stuart colony counter and statistically analyzed based on paired t-test. The results showed the average of Streptococcus mutans growth before applicated CPP-ACP paste was 57.05, whereas after applicated CPP-ACP paste for 1 days was 9.4; for 3 days was 2.85, and for 14 days was 1.7 colony. The research concluded that there was a decrease of Streptococcus mutans growth in isolate plaque after CPP-ACP paste topically given to child's teeth.

Amorphous Calcium Phosphate Formation and Aggregation Process Revealed by Light Scattering Techniques

Directory of Open Access Journals (Sweden)

Vida Čadež

2018-06-01

Full Text Available Amorphous calcium phosphate (ACP attracts attention as a precursor of crystalline calcium phosphates (CaPs formation in vitro and in vivo as well as due to its excellent biological properties. Its formation can be considered to be an aggregation process. Although aggregation of ACP is of interest for both gaining a fundamental understanding of biominerals formation and in the synthesis of novel materials, it has still not been investigated in detail. In this work, the ACP aggregation was followed by two widely applied techniques suitable for following nanoparticles aggregation in general: dynamic light scattering (DLS and laser diffraction (LD. In addition, the ACP formation was followed by potentiometric measurements and formed precipitates were characterized by Fourier transform infrared spectroscopy (FTIR, powder X-ray diffraction (PXRD, transmission electron microscopy (TEM, and atomic force microscopy (AFM. The results showed that aggregation of ACP particles is a process which from the earliest stages simultaneously takes place at wide length scales, from nanometers to micrometers, leading to a highly polydisperse precipitation system, with polydispersity and vol. % of larger aggregates increasing with concentration. Obtained results provide insight into developing a way of regulating ACP and consequently CaP formation by controlling aggregation on the scale of interest.

Manipulating fatty acid biosynthesis in microalgae for biofuel through protein-protein interactions.

Directory of Open Access Journals (Sweden)

Jillian L Blatti

Full Text Available Microalgae are a promising feedstock for renewable fuels, and algal metabolic engineering can lead to crop improvement, thus accelerating the development of commercially viable biodiesel production from algae biomass. We demonstrate that protein-protein interactions between the fatty acid acyl carrier protein (ACP and thioesterase (TE govern fatty acid hydrolysis within the algal chloroplast. Using green microalga Chlamydomonas reinhardtii (Cr as a model, a structural simulation of docking CrACP to CrTE identifies a protein-protein recognition surface between the two domains. A virtual screen reveals plant TEs with similar in silico binding to CrACP. Employing an activity-based crosslinking probe designed to selectively trap transient protein-protein interactions between the TE and ACP, we demonstrate in vitro that CrTE must functionally interact with CrACP to release fatty acids, while TEs of vascular plants show no mechanistic crosslinking to CrACP. This is recapitulated in vivo, where overproduction of the endogenous CrTE increased levels of short-chain fatty acids and engineering plant TEs into the C. reinhardtii chloroplast did not alter the fatty acid profile. These findings highlight the critical role of protein-protein interactions in manipulating fatty acid biosynthesis for algae biofuel engineering as illuminated by activity-based probes.

Measurement of $CP$ asymmetries in $\\Lambda_{b}^{0} \\to pK^{-}$ and $\\Lambda_{b}^{0} \\to p\\pi^-$ decays at LHCb

CERN Document Server

Ferrari, F

2016-01-01

The LHCb experiment has been designed to perform precision measurements in the flavour physics sector at the Large Hadron Collider (LHC). The measurement of the CP-violating observable defined as ΔACP = ACP (Λ0b → pK − ) − ACP (Λ0b → pπ − ), where ACP (Λ0b → pK − ) and ACP (Λ0b → pπ − ) are the direct CP asymmetries in Λ0b → pK − and Λ0b → pπ − decays, is presented for the first time using LHCb data. Using the full 2011 and 2012 data sets of pp collisions collected with the LHCb detector, corresponding to an integrated luminosity of about 3 fb −1, the value ΔACP = (0.8 ± 2.1 ± 0.2)% is obtained. The first uncertainty is statistical and the second corresponds to one of the dominant systematic effects. As the result is compatible with zero, no evidence of CP violation is found. This is the most precise measurement of CP violation in the decays of baryons containing the b quark to date. Once the analysis will be completed with an exhaustive study of systematic uncertainti...

Oral delivery of double-stranded RNAs induces mortality in nymphs and adults of the Asian citrus psyllid, Diaphorina citri.

Science.gov (United States)

Galdeano, Diogo Manzano; Breton, Michèle Claire; Lopes, João Roberto Spotti; Falk, Bryce W; Machado, Marcos Antonio

2017-01-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, is one of the most important citrus pests. ACP is the vector of the phloem-limited bacteria Candidatus Liberibacter americanus and Candidatus Liberibacter asiaticus, the causal agents of the devastating citrus disease huanglongbing (HLB). The management of HLB is based on the use of healthy young plants, eradication of infected plants and chemical control of the vector. RNA interference (RNAi) has proven to be a promising tool to control pests and explore gene functions. Recently, studies have reported that target mRNA knockdown in many insects can be induced through feeding with double-stranded RNA (dsRNA). In the current study, we targeted the cathepsin D, chitin synthase and inhibitor of apoptosis genes of adult and nymph ACP by feeding artificial diets mixed with dsRNAs and Murraya paniculata leaves placed in dsRNAs solutions, respectively. Adult ACP mortality was positively correlated with the amount of dsRNA used. Both nymphs and adult ACP fed dsRNAs exhibited significantly increased mortality over time compared with that of the controls. Moreover, qRT-PCR analysis confirmed the dsRNA-mediated RNAi effects on target mRNAs. These results showed that RNAi can be a powerful tool for gene function studies in ACP and perhaps for HLB control.

Initial Experience with "Honoring Choices Wisconsin": Implementation of an Advance Care Planning Pilot in a Tertiary Care Setting.

Science.gov (United States)

Peltier, Wendy L; Gani, Faiz; Blissitt, Jennifer; Walczak, Katherine; Opper, Kristi; Derse, Arthur R; Johnston, Fabian M

2017-09-01

Although previous research on advance care planning (ACP) has associated ACP with improved quality of care at the end of life, the appropriate use of ACP remains limited. To evaluate the impact of a pilot program using the "Honoring Choices Wisconsin" (HCW) model for ACP in a tertiary care setting, and to understand barriers to system-wide implementation. Retrospective review of prospectively collected data. Patients who received medical or surgical oncology care at Froedtert and the Medical College of Wisconsin. Patient demographics, disease characteristics, patient satisfaction, and clinical outcomes. Data from 69 patients who died following the implementation of the HCW program were reviewed; 24 patients were enrolled in the HCW program while 45 were not. Patients enrolled in HCW were proportionally less likely to be admitted to the ICU (12.5% vs. 17.8%) and were more likely to be "do not resuscitate" (87.5% vs. 80.0%), as well as have a completed ACP (83.3% vs. 79.1%). Furthermore, admission to a hospice was also higher among patients who were enrolled in the HCW program (79.2% vs. 25.6%), with patients enrolled in HCW more likely to die in hospice (70.8% vs. 53.3%). The HCW program was favorably viewed by patients, patient caregivers, and healthcare providers. Implementation of a facilitator-based ACP care model was associated with fewer ICU admissions, and a higher use of hospice care. System-level changes are required to overcome barriers to ACP that limit patients from receiving end-of-life care in accordance with their preferences.

Tomographic phase analysis to detect the site of accessory conduction pathway in Wolff-Parkinson-White syndrome

International Nuclear Information System (INIS)

Nakajima, K.; Bunko, H.; Tada, A.; Tonami, N.; Taki, J.; Nanbu, I.; Hisada, K.; Misaki, T.; Iwa, T.

1984-01-01

Phase analysis has been applied to Wolff-Parkinson-White syndrome (WPW) to detect the site of accessory conduction pathway (ACP); however, there was a limitation to estimate the precise location of ACP by planar phase analysis. In this study, the authors applied phase analysis to gated blood pool tomography. Twelve patients with WPW who underwent epicardial mapping and surgical division of ACP were studied by both of gated emission computed tomography (GECT) and routine gated blood pool study (GBPS). The GBPS was performed with Tc-99m red blood cells in multiple projections; modified left anterior oblique, right anterior oblique and/or left lateral views. In GECT, short axial, horizontal and vertical long axial blood pool images were reconstructed. Phase analysis was performed using fundamental frequency of the Fourier transform in both GECT and GBPS images, and abnormal initial contractions on both the planar and tomographic phase analysis were compared with the location of surgically confirmed ACPs. In planar phase analysis, abnormal initial phase was identified in 7 out of 12 (58%) patients, while in tomographic phase analysis, the localization of ACP was predicted in 11 out of 12 (92%) patients. Tomographic phase analysis is superior to planar phase images in 8 out of 12 patients to estimate the location of ACP. Phase analysis by GECT can avoid overlap of blood pool in cardiac chambers and has advantage to identify the propagation of phase three-dimensionally. Tomographic phase analysis is a good adjunctive method for patients with WPW to estimate the site of ACP

Tomographic phase analysis to detect the site of accessory conduction pathway in Wolff-Parkinson-White syndrome

Energy Technology Data Exchange (ETDEWEB)

Nakajima, K.; Bunko, H.; Tada, A.; Tonami, N.; Taki, J.; Nanbu, I.; Hisada, K.; Misaki, T.; Iwa, T.

1984-01-01

Phase analysis has been applied to Wolff-Parkinson-White syndrome (WPW) to detect the site of accessory conduction pathway (ACP); however, there was a limitation to estimate the precise location of ACP by planar phase analysis. In this study, the authors applied phase analysis to gated blood pool tomography. Twelve patients with WPW who underwent epicardial mapping and surgical division of ACP were studied by both of gated emission computed tomography (GECT) and routine gated blood pool study (GBPS). The GBPS was performed with Tc-99m red blood cells in multiple projections; modified left anterior oblique, right anterior oblique and/or left lateral views. In GECT, short axial, horizontal and vertical long axial blood pool images were reconstructed. Phase analysis was performed using fundamental frequency of the Fourier transform in both GECT and GBPS images, and abnormal initial contractions on both the planar and tomographic phase analysis were compared with the location of surgically confirmed ACPs. In planar phase analysis, abnormal initial phase was identified in 7 out of 12 (58%) patients, while in tomographic phase analysis, the localization of ACP was predicted in 11 out of 12 (92%) patients. Tomographic phase analysis is superior to planar phase images in 8 out of 12 patients to estimate the location of ACP. Phase analysis by GECT can avoid overlap of blood pool in cardiac chambers and has advantage to identify the propagation of phase three-dimensionally. Tomographic phase analysis is a good adjunctive method for patients with WPW to estimate the site of ACP.

Practice and Perceived Importance of Advance Care Planning and Difficulties in Providing Palliative Care in Geriatric Health Service Facilities in Japan: A Nationwide Survey.

Science.gov (United States)

Yokoya, Shoji; Kizawa, Yoshiyuki; Maeno, Takami

2018-03-01

The provision of end-of-life (EOL) care by geriatric health service facilities (GHSFs) in Japan is increasing. Advance care planning (ACP) is one of the most important issues to provide quality EOL care. This study aimed to clarify the practice and perceived importance of ACP and the difficulties in providing palliative care in GHSFs. A self-report questionnaire was mailed to head nurses at 3437 GHSFs nationwide. We asked participants about their practices regarding ACP, their recognition of its importance, and their difficulties in providing palliative care. We also analyzed the relationship between these factors and EOL care education. Among 844 respondents (24.5% response rate), approximately 69% to 81% of head nurses confirmed that GHSF residents and their families understood disease conditions and goals of care. There was a large discrepancy between the actual practice of ACP components and the recognition of their importance (eg, asking residents about existing advance directive [AD; 27.5% practiced it, while 79.6% considered it important]; recommending completion of an AD [18.1% vs 68.4%], and asking for designation of a health-care proxy [30.4% vs 76.8%]). The EOL care education was provided at 517 facilities (61.3%). Head nurses working at EOL care education-providing GHSFs practiced ACP significantly more frequently and had significantly fewer difficulties in providing palliative care. A large discrepancy was found between GHSF nurses' practice of ACP and their recognition of its importance. Providing EOL care education in GHSFs may increase ACP practices and enhance respect for resident's preferences concerning EOL care.

A soluble fatty acyl-acyl carrier protein synthetase from the bioluminescent bacterium Vibrio harveyi.

Science.gov (United States)

Byers, D M; Holmes, C G

1990-01-01

An enzyme catalyzing the ligation of long chain fatty acids to bacterial acyl carrier protein (ACP) has been detected and partially characterized in cell extracts of the bioluminescent bacterium Vibrio harveyi. Acyl-ACP synthetase activity (optimal pH 7.5-8.0) required millimolar concentrations of ATP and Mg2+ and was slightly activated by Ca2+, but was inhibited at high ionic strength and by Triton X-100. ACP from either Escherichia coli (apparent Km = 20 microM) or V. harveyi was used as a substrate. Of the [14C]fatty acids tested as substrates (8-18 carbons), a preference for fatty acids less than or equal to 14 carbons in length was observed. Vibrio harveyi acyl-ACP synthetase appears to be a soluble hydrophilic enzyme on the basis of subcellular fractionation and Triton X-114 phase partition assay. The enzyme was not coinduced with luciferase activity or light emission in vivo during the late exponential growth phase in liquid culture. Acyl-ACP synthetase activity was also detected in extracts from the luminescent bacterium Vibrio fischeri, but not Photobacterium phosphoreum. The cytosolic nature and enzymatic properties of V. harveyi acyl-ACP synthetase indicate that it may have a different physiological role than the membrane-bound activity of E. coli, which has been implicated in phosphatidylethanolamine turnover. Acyl-ACP synthetase activity in V. harveyi could be involved in the intracellular activation and elongation of exogenous fatty acids that occurs in this species or in the reactivation of free myristic acid generated by luciferase.

Comparative immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary craniopharyngiomas

International Nuclear Information System (INIS)

Eshebaa, Gh.E.; Hassan, A.A.

2015-01-01

Craniopharyngiomas (CPs) are rare epithelial tumors located mainly in the sellar/parasellar region. CPs have been classified into histopathologically, genetically, clinically and prognostically two distinctive subtypes: adamantinomatous and papillary variants. Aim To determine the immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary CPs. Materials and methods β-Catenin, EGFR, ErbB2, and p63 immunostaining was performed on paraffin embedded tissue sections of 25 CPs including 18 adamantinomatous craniopharyngioma (ACP) and 7 cases of papillary craniopharyngiomas (PCPs). Results 17 cases (94%) of ACP exhibited strong nuclear/cytoplasmic expression of β-catenin. On the contrary, all cases of PCP showed exclusively membranous expression (ρ value <0.0001). Regarding EGFR, 15 (83%) and 5 cases (71%) of APC and PCP respectively were positive. On the other hand, only 3 cases (17%) of APC and none of PCP exhibited positivity for ErbB2. p63 over-expression was observed in 16 cases of ACP (89%) and 6 cases of PCP (86%). However, the distribution of p63 staining was diffuse in ACP, while in PCP; the staining was mainly restricted to the basal cell layer. Conclusion Nuclear accumulation of β-catenin is a diagnostic hallmark of the ACP and is very helpful in the differential diagnosis between both ACP and PCP in the setting of small biopsies. Moreover, the restricted nuclear β-catenin accumulation in the cohesive cell clusters within the whorl-like areas supports that aberrant β-catenin expression may play a role in the morphogenesis of ACP.

Synthesis of amorphous calcium phosphate using various types of cyclodextrins

International Nuclear Information System (INIS)

Li Yanbao; Wiliana, Tjandra; Tam, Kam C.

2007-01-01

Amorphous calcium phosphate (ACP) was synthesised in aqueous solution at room temperature using cyclodextrins. Fourier transform infrared (FTIR) spectroscopy, X-ray diffraction (XRD), transmission electron microscopy (TEM), energy dispersive X-ray spectroscopy (EDX) and thermal analysis (DTA/TGA) were performed on the calcium phosphate precipitates obtained from solutions. We observed that only β-CD could stabilise the amorphous phase in the mother solution because of the lower solubility of β-CD in water and the ACP remained stable in aqueous solution for more than 24 h at room temperature. The ACP particle has an initial particle size of less than 40 nm, Ca/P molar ratio of 1.67 and β-CD absorbed on its surface. The mechanism for the stabilisation of ACP is proposed

Efficacy of various topical agents to prevent enamel demineralization

Directory of Open Access Journals (Sweden)

Priska Lestari Hendrawan

2011-09-01

Full Text Available Background: Enamel demineralization is a common and undesirable side effect of fixed appliance orthodontic treatment. Many sudies showed that the prevalence varied between 2–96%. There are many ways to prevent demineralization and increased remineralization such as oral hygiene instruction and by topical application such as acidulated phosphate fluor (APF casein phospo peptide-amorphous calcium phosphate (CPP-ACP, casein phospo peptide-amorphous calcium phosphate plus (CPP-ACPF. Purpose: The purpose of this in-vitro study was to evaluate the efficacy of various topical agents to prevent enamel demineralization. Methods: Fourty extracted human premolars were allocated to 1 of 4 groups: 1.23% APF gel; 10% CPP-ACP paste; 10% CPP-ACPF paste; and untreated control. All samples were subjected to pH cycling treatment for 12 days through a daily procedure of demineralization solution with pH 4 for 6 hours and remineralization solution with pH 7 for 18 hours. Microhardness testing were done before and after pH cycling and the delta hardness values were determined. Results: APF, CPP-ACP and CPP-ACPF application significantly prevent lowering of enamel microhardness value compared with untreated control group. Kruskal-Wallis, ANOVA, Mann-Whitney U, Tukey and Bonferroni Post-Hoc multiple comparison test showed significant difference between mean delta microhardness value of CPP-ACPF and CPP-ACP group with APF group, but there is no significant difference between mean delta microhardness value of CPP-ACPF and CPP-ACP group. Conclusion: APF, CPP-ACP and CPP-ACPF prevent enamel demineralization. CPP-ACP and CPP-ACPF prevent demineralization more than APF.Latar belakang: Demineralisasi email merupakan efek samping negatif yang sering dijumpai pada perawatan ortodontik cekat. Beberapa penelitian menyatakan bahwa prevalensinya bervariasi 2–96 persen. Ada beberapa cara untuk mencegah demineralisasi dan meningkatkan remineralisasi, misalnya dengan instruksi

Preliminary results of endorectal surface coil magnetic resonance imaging for local staging of prostate cancer

International Nuclear Information System (INIS)

Jager, G.H.; Barentsz, J.O.; Rosette, J.J.M.C.H. de la; Rosenbusch, G.

1994-01-01

Objective: To evaluate the effectiveness of endorectal surface coil (ERC) magnetic resonance imaging (MRI) in the local staging of adenocarcinoma of the prostate (ACP). Materials and methods: A total of 23 patients who were considered candidates for radical prostatectomy because of clinically localized ACP were examined by ERC-MRI. All patients underwent laparoscopic or open lymph-node dissection prior to surgery. Four patients had positive lymph nodes at operation. A total of 19 underwant radical prostatectomy, allowing comparison of the MRI data with the surgical pathologic findings. Results: Twelve patients had extraglandular spread of ACP (T3) and 7 had locally confined ACP (T2). ERC-MRI predicted correctly a T3 tumor in 10 of 12 cases and a T2 tumor in 4 of 7 cases. ERC-MRI was 74% accurate in differentiating T2 from T3 tumor. Three cases of overestimation were in studies with poor image quality because of bowel movement motion artifacts. Conclusion: ERC-MRI was found to be a sensitive modality in staging clinically localized ACP. (orig.) [de

Biosynthesis of t-Butyl in Apratoxin A: Functional Analysis and Architecture of a PKS Loading Module.

Science.gov (United States)

Skiba, Meredith A; Sikkema, Andrew P; Moss, Nathan A; Lowell, Andrew N; Su, Min; Sturgis, Rebecca M; Gerwick, Lena; Gerwick, William H; Sherman, David H; Smith, Janet L

2018-04-27

The unusual feature of a t-butyl group is found in several marine-derived natural products including apratoxin A, a Sec61 inhibitor produced by the cyanobacterium Moorea bouillonii PNG 5-198. Here we determine that the apratoxin A t-butyl group is formed as pivaloyl acyl carrier protein (ACP) by AprA, the polyketide synthase (PKS) loading module of the apratoxin A biosynthetic pathway. AprA contains an inactive "pseudo" GCN5-related N-acetyltransferase domain (ΨGNAT) flanked by two methyltransferase domains (MT1 and MT2) that differ distinctly in sequence. Structural, biochemical, and precursor incorporation studies reveal that MT2 catalyzes unusually coupled decarboxylation and methylation reactions to transform dimethylmalonyl-ACP, the product of MT1, to pivaloyl-ACP. Further, pivaloyl-ACP synthesis is primed by the fatty acid synthase malonyl acyltransferase (FabD), which compensates for the ΨGNAT and provides the initial acyl-transfer step to form AprA malonyl-ACP. Additionally, images of AprA from negative stain electron microscopy reveal multiple conformations that may facilitate the individual catalytic steps of the multienzyme module.

Models of human adamantinomatous craniopharyngioma tissue: Steps toward an effective adjuvant treatment.

Science.gov (United States)

Hölsken, Annett; Buslei, Rolf

2017-05-01

Even though ACP is a benign tumor, treatment is challenging because of the tumor's eloquent location. Today, with the exception of surgical intervention and irradiation, further treatment options are limited. However, ongoing molecular research in this field provides insights into the pathways involved in ACP pathogenesis and reveal a plethora of druggable targets. In the next step, appropriate models are essential to identify the most suitable and effective substances for clinical practice. Primary cell cultures in low passages provide a proper and rapid tool for initial drug potency testing. The patient-derived xenograft (PDX) model accommodates ACP complexity in that it shows respect to the preserved architecture and similar histological appearance to human tumors and therefore provides the most appropriate means for analyzing pharmacological efficacy. Nevertheless, further research is needed to understand in more detail the biological background of ACP pathogenesis, which provides the identification of the best targets in the hierarchy of signaling cascades. ACP models are also important for the continuous testing of new targeting drugs, to establish precision medicine. © 2017 International Society of Neuropathology.

The effects of atmospheric pressure cold plasma treatment on microbiological, physical-chemical and sensory characteristics of vacuum packaged beef loin.

Science.gov (United States)

Bauer, A; Ni, Y; Bauer, S; Paulsen, P; Modic, M; Walsh, J L; Smulders, F J M

2017-06-01

Effects on vacuum packaged and non-packaged beef longissimus samples exposed to atmospheric cold plasma (ACP) generated at different powers were studied over a 10day period of vacuum-, and a subsequent 3day period of aerobic storage. Exposure of non-covered beef samples under high power ACP conditions resulted in increased a*, b*, Chroma and Hue values, but ACP treatment of packaged loins did not impact colour (L*, a*, b*, Chroma, Hue), lipid peroxidation, sarcoplasmic protein denaturation, nitrate/nitrite uptake, or myoglobin isoform distribution. Colour values measured after 3days of aerobic storage following unpackaging (i.e. 20days post-mortem) were similar and all compliant with consumer acceptability standards. Exposure to ACP of the polyamide-polyethylene packaging film inoculated with Staphylococcus aureus, Listeria monocytogenes and two Escherichia coli strains resulted in >2 log reduction without affecting the integrity of the packaging matrix. Results indicate that ACP can reduce microbial numbers on surfaces of beef packages without affecting characteristics of the packaged beef. Copyright © 2017 Elsevier Ltd. All rights reserved.

Diagnostic moléculaire du complexe Mycobacterium tuberculosis résistant à l'isoniazide et à la rifampicine au Burkina Faso

Science.gov (United States)

Désire, Ilboudo; Cyrille, Bisseye; Florencia, Djigma; Souba, Diande; Albert, Yonli; Valerie, Bazie Jean Telesphore; Rebecca, Compaore; Charlemagne, Gnoula; Tamboura, Djibril; Rémy, Moret; Virginio, Pietra; Simplice, Karou Damintoti; Martial, Ouedraogo; Jacques, Simpore

2015-01-01

Introduction Cette étude a eu pour objectifs de diagnostiquer la tuberculose pulmonaire par l'examen microscopique et par la PCR des crachats et de déterminer les bases moléculaires de la résistance à la rifampicine et à l'isoniazide. Méthodes Le diagnostic du Complexe Mycobacterium Tuberculosis (CMTB) a été effectué par microscopie après coloration au Ziehl Nielsen et par PCR en temps réel en utilisant le kit d'identification du complexe MTB (Sacace Biotechnologie, Italie). Les résistances à la Rifampicine et à l'Isoniazide ont été étudiées par la technique de la PCR en utilisant le kit MTB résistance 8 (Sacace, Biotechnologie). Résultats Sur les 59 patients diagnostiqués pour la tuberculose pulmonaire, 59,3% étaient positifs en microscopie optique et 44,1% étaient positifs par PCR en Temps réel. Les résistances à la rifampicine (rpoB) et à l'isoniazide (katG et inhA) ont été observées chez 9 patients. La résistance à la rifampicine était due aux mutations (Asp516Val, Ser531Trp, Leu533Pro) et celle à l'isoniazide par les substitutions Ser315Thr du gène katG et C209T du gène inhA. Les multi résistances à la rifampicine et à l'isoniazide ont été observées dans 55,5% des échantillons et concernaient les associations: ropBAsp513Val + inhAC209T et rpoBLeu533Pro + katGSer315Thr. Conclusion La PCR en temps réel qui permet l'identification des allèles mutants rpoB, katG et inhA de M. tuberculosis est un outil de diagnostic épidémiologique de grande importance car elle permet de déterminer le niveau de résistance à la rifampicine et à l'isoniazide. PMID:26491516

Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

Directory of Open Access Journals (Sweden)

Raj N Yadav

Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

Phase analysis in the Wolff-Parkinson-White syndrome with surgically proven accessory conduction pathways: concise communication

International Nuclear Information System (INIS)

Nakajima, K.; Bunko, H.; Tada, A.; Taki, J.; Tonami, N.; Hisada, K.; Misaki, T.; Iwa, T.

1984-01-01

Twenty-one patients with the Wolff-Parkinson-White (WPW) syndrome who underwent surgical division of the accessory conduction pathway (ACP) were studied by gated blood-pool scintigraphy. In each case, a functional image of the phase was generated, based on the fundamental frequency of the Fourier transform. The location of the ACP was confirmed by electrophysiologic study, epicardial mapping, and surgery. Phase analysis identified the side of preexcitation correctly in 16 out of 20 patients with WPW syndrome with a delta wave. All patients with right-cardiac type (N=9) had initial contraction in the right ventricle (RV). In patients with left-cardiac type (N=10), six had initial movement in the left ventricle (LV); but in the other four the ACPs in the anterior or lateral wall of the left ventricle (LV) could not be detected. In patients with multiple ACPs (N=2), one right-cardiac type had initial contraction in the RV, while in the other (with an intermittent WPW syndrome) the ACP was not detected. These observations indicate that abnormal wall motion is associated with the conduction anomalies of the WPW syndrome. We conclude that phase analysis can correctly identify the side of initial contraction in the WPW syndrome before and after surgery. However, as a method of preoperative study, it seems difficult to determine the precise site of the ACP by phase analysis alone

Phase analysis in the Wolff-Parkinson-White syndrome with surgically proven accessory conduction pathways: concise communication

Energy Technology Data Exchange (ETDEWEB)

Nakajima, K.; Bunko, H.; Tada, A.; Taki, J.; Tonami, N.; Hisada, K.; Misaki, T.; Iwa, T.

1984-01-01

Twenty-one patients with the Wolff-Parkinson-White (WPW) syndrome who underwent surgical division of the accessory conduction pathway (ACP) were studied by gated blood-pool scintigraphy. In each case, a functional image of the phase was generated, based on the fundamental frequency of the Fourier transform. The location of the ACP was confirmed by electrophysiologic study, epicardial mapping, and surgery. Phase analysis identified the side of preexcitation correctly in 16 out of 20 patients with WPW syndrome with a delta wave. All patients with right-cardiac type (N=9) had initial contraction in the right ventricle (RV). In patients with left-cardiac type (N=10), six had initial movement in the left ventricle (LV); but in the other four the ACPs in the anterior or lateral wall of the left ventricle (LV) could not be detected. In patients with multiple ACPs (N=2), one right-cardiac type had initial contraction in the RV, while in the other (with an intermittent WPW syndrome) the ACP was not detected. These observations indicate that abnormal wall motion is associated with the conduction anomalies of the WPW syndrome. We conclude that phase analysis can correctly identify the side of initial contraction in the WPW syndrome before and after surgery. However, as a method of preoperative study, it seems difficult to determine the precise site of the ACP by phase analysis alone.

Oral delivery of double-stranded RNAs induces mortality in nymphs and adults of the Asian citrus psyllid, Diaphorina citri.

Directory of Open Access Journals (Sweden)

Diogo Manzano Galdeano

Full Text Available The Asian citrus psyllid (ACP, Diaphorina citri Kuwayama, is one of the most important citrus pests. ACP is the vector of the phloem-limited bacteria Candidatus Liberibacter americanus and Candidatus Liberibacter asiaticus, the causal agents of the devastating citrus disease huanglongbing (HLB. The management of HLB is based on the use of healthy young plants, eradication of infected plants and chemical control of the vector. RNA interference (RNAi has proven to be a promising tool to control pests and explore gene functions. Recently, studies have reported that target mRNA knockdown in many insects can be induced through feeding with double-stranded RNA (dsRNA. In the current study, we targeted the cathepsin D, chitin synthase and inhibitor of apoptosis genes of adult and nymph ACP by feeding artificial diets mixed with dsRNAs and Murraya paniculata leaves placed in dsRNAs solutions, respectively. Adult ACP mortality was positively correlated with the amount of dsRNA used. Both nymphs and adult ACP fed dsRNAs exhibited significantly increased mortality over time compared with that of the controls. Moreover, qRT-PCR analysis confirmed the dsRNA-mediated RNAi effects on target mRNAs. These results showed that RNAi can be a powerful tool for gene function studies in ACP and perhaps for HLB control.

40 CFR 300.185 - Nongovernmental participation.

Science.gov (United States)

2010-07-01

... capable of providing leadership. ACPs also should identify specific areas in which volunteers can be used.... Specific commitments should be listed in the RCP and ACP. Those entities required to develop tank vessel...

A Dyadic Perspective on Engagement in Advance Care Planning.

Science.gov (United States)

Fried, Terri; Zenoni, Maria; Iannone, Lynne

2017-01-01

To understand the perspectives of both patients and the person who would make medical decisions for them if they were unable (surrogates) on their participation in advance care planning (ACP). Qualitative cross-sectional study. Community. Thirty-one veterans age 55 years and older and their surrogates. In interviews conducted with both the veteran and surrogate, they were asked to discuss their participation in four ACP activities: communication about life-sustaining treatment, communication about views on quality of life, completion of a living will, and appointment of a healthcare proxy. They were asked about barriers to and facilitators of ACP engagement. When they did not agree about engagement, they each provided their perspective on what they believed had or had not occurred. Many of the same barriers to and facilitators of engagement were discussed by both patients and surrogates. These included difficulty thinking about dying, differences in values, and experiences with others that demonstrated the ability of ACP to decrease burden or avoid conflict. Reasons for disagreements in perceptions about whether communication had occurred included surrogates' need for more detailed information, surrogates' lack of readiness to hear what the patient was saying, and surrogates' reliance on what they know about the patient. For some dyads, participation in the study prompted additional communication, resulting in a better shared understanding of ACP engagement. Surrogates can both impede and facilitate engagement in ACP, and they can hold different perceptions from patients regarding this engagement. Efforts to promote ACP may be most successful if they assess and address both patients' and surrogates' attitudes and help to facilitate clear communication between them. © 2016, Copyright the Authors Journal compilation © 2016, The American Geriatrics Society.

Soil properties influence kinetics of soil acid phosphatase in response to arsenic toxicity.

Science.gov (United States)

Wang, Ziquan; Tan, Xiangping; Lu, Guannan; Liu, Yanju; Naidu, Ravi; He, Wenxiang

2018-01-01

Soil phosphatase, which plays an important role in phosphorus cycling, is strongly inhibited by Arsenic (As). However, the inhibition mechanism in kinetics is not adequately investigated. In this study, we investigated the kinetic characteristics of soil acid phosphatase (ACP) in 14 soils with varied properties, and also explored how kinetic properties of soil ACP changed with different spiked As concentrations. The results showed that the Michaelis constant (K m ) and maximum reaction velocity (V max ) values of soil ACP ranged from 1.18 to 3.77mM and 0.025-0.133mMh -1 in uncontaminated soils. The kinetic parameters of soil ACP in different soils changed differently with As contamination. The K m remained unchanged and V max decreased with increase of As concentration in most acid and neutral soils, indicating a noncompetitive inhibition mechanism. However, in alkaline soils, the K m increased linearly and V max decreased with increase of As concentration, indicating a mixed inhibition mechanism that include competitive and noncompetitive. The competitive inhibition constant (K ic ) and noncompetitive inhibition constant (K iu ) varied among soils and ranged from 0.38 to 3.65mM and 0.84-7.43mM respectively. The inhibitory effect of As on soil ACP was mostly affected by soil organic matter and cation exchange capacity. Those factors influenced the combination of As with enzyme, which resulted in a difference of As toxicity to soil ACP. Catalytic efficiency (V max /K m ) of soil ACP was a sensitive kinetic parameter to assess the ecological risks of soil As contamination. Copyright © 2017 Elsevier Inc. All rights reserved.

AcEST: BP915195 [AcEST

Lifescience Database Archive (English)

Full Text Available -25 tr|O04792|O04792_9ROSI Acyl-ACP thioesterase OS=Garcinia mangost... 119 1e-25 tr|B8BDB0|B8BDB0_ORYSI Put...04793_9ROSI Acyl-ACP thioesterase OS=Garcinia mangost... 117 3e-25 tr|B8LS31|B8LS31_PICSI Putative uncharact...tr|O04792|O04792_9ROSI Acyl-ACP thioesterase OS=Garcinia mangostana GN=FatA1 PE=2 SV=1 Length = 352 Score =

Advance care planning in stroke: influence of time on engagement in the process

Directory of Open Access Journals (Sweden)

Green T

2014-01-01

Full Text Available Theresa Green1, Shreyas Gandhi2, Tessa Kleissen1, Jessica Simon1,3, Shelley Raffin-Bouchal1, Karla Ryckborst41Faculty of Nursing, University of Calgary, Calgary, AB, Canada; 2Health Sciences, McMaster University, Hamilton, ON, Canada; 3Department of Medicine, University of Calgary, Calgary, AB, Canada; 4Calgary Stroke Program, Alberta Health Services, Calgary, AB, CanadaPurpose: Individuals who experience stroke have a higher likelihood of subsequent stroke events, making it imperative to plan for future medical care. In the event of a further serious health event, engaging in the process of advanced care planning (ACP can help family members and health care professionals (HCPs make medical decisions for individuals who have lost the capacity to do so. Few studies have explored the views and experiences of patients with stroke about discussing their wishes and preferences for future medical events, and the extent to which stroke HCPs engage in conversations around planning for such events. In this study, we sought to understand how the process of ACP unfolded between HCPs and patients post-stroke.Patients and methods: Using grounded theory (GT methodology, we engaged in direct observation of HCP and patient interactions on an acute stroke unit and two stroke rehabilitation units. Using semi-structured interviews, 14 patients and four HCPs were interviewed directly about the ACP process.Results: We found that open and continual ACP conversations were not taking place, patients experienced an apparent lack of urgency to engage in ACP, and HCPs were uncomfortable initiating ACP conversations due to the sensitive nature of the topic.Conclusion: In this study, we identified lack of engagement in ACP post-stroke, attributable to patient and HCP factors. This encourages us to look further into the process of ACP in order to develop open communication between the patient with stroke, their families, and stroke HCPs.Keywords: qualitative, engagement

Patient preferences for future care - how can Advance Care Planning become embedded into dementia care: a study protocol

Science.gov (United States)

2010-01-01

Background People living with a long term condition may wish to be able to plan ahead, so that if in future they cannot make decisions, their wishes about their care will be known; this process is termed Advance Care Planning (ACP). In dementia, guidance stipulates that ACP discussions should take place whilst the person still has capacity to make decisions. However there is a lack of evidence on the effectiveness of ACP in influencing patient choice and resource use. The aims of this study are to determine the effectiveness of ACP in dementia care, identify the factors which facilitate the process in practice and provide a better understanding of the views and experiences of key stakeholders in order to inform clinical practice. Methods/Design The four phase project comprises a systematic review (Phase 1) and a series of qualitative studies (Phases 2 and 3), with data collection via focus groups and individual interviews with relevant stakeholders including people with dementia and their carers, health and social care professionals and representatives from voluntary organisations and the legal profession. The conduct of the systematic review will follow current best practice guidance. In phases 2 and 3, focus groups will be employed to seek the perspectives of the professionals; individual interviews will be carried out with people with dementia and their carers. Data from Phases 1, 2 and 3 will be synthesised in a series of team workshops to develop draft guidance and educational tools for implementing ACP in practice (Phase 4). Discussion In the UK, there is little published research on the effectiveness of ACP, despite its introduction into policy. This study was designed to explore in greater depth how ACP can best be carried out in routine practice. It affords the opportunity to develop both a theoretical and practical understanding of an area which both patients and professionals may find emotionally challenging. Importantly the study will also develop

Patient preferences for future care - how can Advance Care Planning become embedded into dementia care: a study protocol

Directory of Open Access Journals (Sweden)

Exley Catherine

2010-01-01

Full Text Available Abstract Background People living with a long term condition may wish to be able to plan ahead, so that if in future they cannot make decisions, their wishes about their care will be known; this process is termed Advance Care Planning (ACP. In dementia, guidance stipulates that ACP discussions should take place whilst the person still has capacity to make decisions. However there is a lack of evidence on the effectiveness of ACP in influencing patient choice and resource use. The aims of this study are to determine the effectiveness of ACP in dementia care, identify the factors which facilitate the process in practice and provide a better understanding of the views and experiences of key stakeholders in order to inform clinical practice. Methods/Design The four phase project comprises a systematic review (Phase 1 and a series of qualitative studies (Phases 2 and 3, with data collection via focus groups and individual interviews with relevant stakeholders including people with dementia and their carers, health and social care professionals and representatives from voluntary organisations and the legal profession. The conduct of the systematic review will follow current best practice guidance. In phases 2 and 3, focus groups will be employed to seek the perspectives of the professionals; individual interviews will be carried out with people with dementia and their carers. Data from Phases 1, 2 and 3 will be synthesised in a series of team workshops to develop draft guidance and educational tools for implementing ACP in practice (Phase 4. Discussion In the UK, there is little published research on the effectiveness of ACP, despite its introduction into policy. This study was designed to explore in greater depth how ACP can best be carried out in routine practice. It affords the opportunity to develop both a theoretical and practical understanding of an area which both patients and professionals may find emotionally challenging. Importantly the

Patient preferences for future care--how can Advance Care Planning become embedded into dementia care: a study protocol.

Science.gov (United States)

Robinson, Louise; Bamford, Claire; Beyer, Fiona; Clark, Alexa; Dickinson, Claire; Emmet, Charlotte; Exley, Catherine; Hughes, Julian; Robson, Lesley; Rousseau, Nikki

2010-01-12

People living with a long term condition may wish to be able to plan ahead, so that if in future they cannot make decisions, their wishes about their care will be known; this process is termed Advance Care Planning (ACP). In dementia, guidance stipulates that ACP discussions should take place whilst the person still has capacity to make decisions. However there is a lack of evidence on the effectiveness of ACP in influencing patient choice and resource use. The aims of this study are to determine the effectiveness of ACP in dementia care, identify the factors which facilitate the process in practice and provide a better understanding of the views and experiences of key stakeholders in order to inform clinical practice. The four phase project comprises a systematic review (Phase 1) and a series of qualitative studies (Phases 2 and 3), with data collection via focus groups and individual interviews with relevant stakeholders including people with dementia and their carers, health and social care professionals and representatives from voluntary organisations and the legal profession. The conduct of the systematic review will follow current best practice guidance. In phases 2 and 3, focus groups will be employed to seek the perspectives of the professionals; individual interviews will be carried out with people with dementia and their carers. Data from Phases 1, 2 and 3 will be synthesised in a series of team workshops to develop draft guidance and educational tools for implementing ACP in practice (Phase 4). In the UK, there is little published research on the effectiveness of ACP, despite its introduction into policy. This study was designed to explore in greater depth how ACP can best be carried out in routine practice. It affords the opportunity to develop both a theoretical and practical understanding of an area which both patients and professionals may find emotionally challenging. Importantly the study will also develop practical tools, which are grounded in

Proton Environments in Biomimetic Calcium Phosphates Formed from Mesoporous Bioactive CaO-SiO2-P2O5 Glasses in Vitro: Insights from Solid-State NMR.

Science.gov (United States)

Mathew, Renny; Turdean-Ionescu, Claudia; Yu, Yang; Stevensson, Baltzar; Izquierdo-Barba, Isabel; García, Ana; Arcos, Daniel; Vallet-Regí, María; Edén, Mattias

2017-06-22

When exposed to body fluids, mesoporous bioactive glasses (MBGs) of the CaO-SiO 2 -P 2 O 5 system develop a bone-bonding surface layer that initially consists of amorphous calcium phosphate (ACP), which transforms into hydroxy-carbonate apatite (HCA) with a very similar composition as bone/dentin mineral. Information from various 1 H-based solid-state nuclear magnetic resonance (NMR) experiments was combined to elucidate the evolution of the proton speciations both at the MBG surface and within each ACP/HCA constituent of the biomimetic phosphate layer formed when each of three MBGs with distinct Ca, Si, and P contents was immersed in a simulated body fluid (SBF) for variable periods between 15 min and 30 days. Directly excited magic-angle-spinning (MAS) 1 H NMR spectra mainly reflect the MBG component, whose surface is rich in water and silanol (SiOH) moieties. Double-quantum-single-quantum correlation 1 H NMR experimentation at fast MAS revealed their interatomic proximities. The comparatively minor H species of each ACP and HCA component were probed selectively by heteronuclear 1 H- 31 P NMR experimentation. The initially prevailing ACP phase comprises H 2 O and "nonapatitic" HPO 4 2- /PO 4 3- groups, whereas for prolonged MBG soaking over days, a well-progressed ACP → HCA transformation was evidenced by a dominating O 1 H resonance from HCA. We show that 1 H-detected 1 H → 31 P cross-polarization NMR is markedly more sensitive than utilizing powder X-ray diffraction or 31 P NMR for detecting the onset of HCA formation, notably so for P-bearing (M)BGs. In relation to the long-standing controversy as to whether bone mineral comprises ACP and/or forms via an ACP precursor, we discuss a recently accepted structural core-shell picture of both synthetic and biological HCA, highlighting the close relationship between the disordered surface layer and ACP.

Comparative Evaluation of the Efficacy of Tricalcium Phosphate ...

African Journals Online (AJOL)

2018-01-24

Jan 24, 2018 ... effects of various remineralizing agents that can be beneficial to children. .... varnish, CPP‑ACP, and CPP‑ACP plus fluoride protect .... by milk casein derivatives. .... intensively investigated as a possible bone substitute.

Atmospheric sciences transfer between research advances and energy-policy assessments (ASTRAEA). Final report, 1 April 1996--31 December 1997

Energy Technology Data Exchange (ETDEWEB)

Slinn, W.G.N.

1997-12-10

Consistent with the prime goal of the ASTRAEA project, as given in its peer-reviewed proposal, this final report is an informal report to DOE managers about a perceived DOE management problem, specifically, lack of vision in DOE`s Atmospheric Chemistry Program (ACP). After presenting a review of relevant, current literature, the author suggests a framework for conceiving new visions for ACP, namely, multidisciplinary research for energy policy, tackling tough (e.g., nonlinear) problems as a team, ahead of political curves. Two example visions for ACP are then described, called herein the CITIES Project (the Comprehensive Inventory of Trace Inhalants from Energy Sources Project) and the OCEAN Project (the Ocean-Circulation Energy-Aerosol Nonlinearities Project). Finally, the author suggests methods for DOE to provide ACP with needed vision.

Rescuing the Rescuer: On the Protein Complex between the Human Mitochondrial Acyl Carrier Protein and ISD11.

Science.gov (United States)

Herrera, María Georgina; Pignataro, María Florencia; Noguera, Martín Ezequiel; Cruz, Karen Magalí; Santos, Javier

2018-05-16

Iron-sulfur clusters are essential cofactors in many biochemical processes. ISD11, one of the subunits of the protein complex that carries out the cluster assembly in mitochondria, is necessary for cysteine desulfurase NFS1 stability and function. Several authors have recently provided evidence showing that ISD11 interacts with the acyl carrier protein (ACP). We carried out the coexpression of human mitochondrial ACP and ISD11 in E. coli. This work shows that ACP and ISD11 form a soluble, structured, and stable complex able to bind to the human NFS1 subunit modulating its activity. Results suggest that ACP plays a key-role in ISD11 folding and stability in vitro. These findings offer the opportunity to study the mechanism of interaction between ISD11 and NFS1.

Talking about sensitive topics during the advance care planning discussion: A peek into the black box

DEFF Research Database (Denmark)

Andreassen, Pernille; Neergaard, Mette Asbjørn; Brogaard, Trine

2015-01-01

-of-life decisions are addressed in concrete ACP discussions, with special focus on doctor-patient interactions. METHOD: Following a discourse-analysis approach, the study uses the concept of doctor and patient "voices" to analyze 10 directly observed and audiotaped ACP discussions among patients, relatives...... discussions about sensitive end-of-life issues the healthcare professional will be able to pose and explore sensitive ACP questions in a straightforward manner, if the voices that express empathy and seek to empower the patient in different ways are emphasized....

Patient preferences for future care - how can Advance Care Planning become embedded into dementia care: a study protocol

OpenAIRE

Robinson, Louise; Bamford, Claire; Beyer, Fiona; Clark, Alexa; Dickinson, Claire; Emmet, Charlotte; Exley, Catherine; Hughes, Julian; Robson, Lesley; Rousseau, Nikki

2010-01-01

Abstract Background People living with a long term condition may wish to be able to plan ahead, so that if in future they cannot make decisions, their wishes about their care will be known; this process is termed Advance Care Planning (ACP). In dementia, guidance stipulates that ACP discussions should take place whilst the person still has capacity to make decisions. However there is a lack of evidence on the effectiveness of ACP in influencing patient choice and resource use. The aims of thi...

Matrix metalloproteinase content and activity in low-platelet, low-leukocyte and high-platelet, high-leukocyte platelet rich plasma (PRP) and the biologic response to PRP by human ligament fibroblasts.

Science.gov (United States)

Pifer, Matthew A; Maerz, Tristan; Baker, Kevin C; Anderson, Kyle

2014-05-01

Recent work has shown the presence of catabolic cytokines in platelet-rich plasma (PRP), but little is known about endogenous catabolic proteases such as matrix metalloproteinases (MMPs). Hypothesis/ To quantify MMP content in 2 commercially available PRP preparation systems: Arthrex Double Syringe System autologous conditioned plasma (ACP) and Biomet GPS (GPS). The hypothesis was that MMPs are actively secreted from PRP immediately after preparation. Controlled laboratory study. PRP was prepared using either ACP (low platelet, low leukocyte) or GPS (high platelet, high leukocyte). MMP-2, MMP-3, and MMP-9 concentrations were measured using multiplex enzyme-linked immunosorbent assays for up to 6 days in 2 donors, and MMP activity was measured in 3 donors using kinetic activity kits able to detect the enzymatic cleavage of a fluorogenic peptide. Human ligament fibroblasts were cultured and exposed to both ACP and GPS from 1 donor each. MMP-2, -3, and -9 concentrations were assayed in culture media at 24 and 48 hours after exposure. GPS exhibited higher total MMP-2, -3, and -9 concentrations for up to 144 hours of release, while ACP had higher platelet-normalized MMP-2 and MMP-3 concentrations. GPS had significantly higher total and endogenous MMP-2 activity (P = .004 and .014, respectively), MMP-3 activity (P = .020 and .015, respectively), and MMP-9 activity (P = .004 and .002, respectively) compared with ACP. Once normalized to platelet count, differences in MMP activity were not significant between ACP and GPS. Compared with controls, cells stimulated with interleukin-1 beta (IL-1β) and treated with ACP showed significantly higher fold changes of MMP-2 (P = .001) and MMP-3 (P = .003) concentrations at 24 hours than did cells treated with GPS. Total MMP-9 content was higher in the media of GPS-treated, IL-1β-stimulated cells compared with ACP-treated cells (P = .001). At 48 hours, IL-1β-stimulated cells treated with GPS exhibited higher fold changes of MMP-2

Assessment of Canine Autologous Conditioned PlasmaTM Cellular and Transforming Growth Factor-β1 Content

Directory of Open Access Journals (Sweden)

Samuel P. Franklin

2018-06-01

Full Text Available To evaluate (1 the cellular composition of canine ACP™ including using two different preparation protocols with variations on centrifugation time, (2 the effect of different activation protocols on the transforming growth factor (TGF-β1 content in the ACP, and (3 patient factors that might influence platelet concentration of the ACP.ACP was made with blood from 15 dogs using a manufacturer-recommended protocol[1]. Each ACP sample was divided into three aliquots that were activated with calcium chloride (CaCl2, human γ-thrombin (HGT, or not activated. TGF-β1 was quantified in each aliquot using an ELISA and comparisons among activation protocols were performed using a Skillings-Mack test. Correlations between platelet and TGF-β1 concentration were assessed with a Pearson correlation coefficient. ACP was subsequently prepared from an additional 17 dogs using a slightly modified centrifugation protocol and cellular composition was assessed. Effects of dog age, body weight, and hematocrit were assessed for their potential impact on ACP platelet concentration using a multiple linear regression analysis.The mean increase in platelet concentration in the ACP above that in the whole blood was 1.2× (±std 0.62 and leukocyte concentration was a mean of 26% (0.37 that in the whole blood using the standard protocol. There was a significant (p < 0.01 effect of activation on TGF-β1 concentrations with mean concentrations of 4,538 (2,317, 14,948 (13,784, and 14,096 (15,210 pg/ml in aliquots that were not activated or were activated with thrombin or CaCl2 respectively. There were significant correlations between the platelet concentration and TGF-β1 concentration in aliquots that were activated with either thrombin (r = 0.66; p < 0.01 or CaCl2 (r = 0.86, p < 0.0001. The mean increase in platelet concentration was 1.4× (0.62 and the leukocyte concentration was 0.28× (0.13 that in whole blood using the modified ACP preparation protocol. Dog age

Polymorphisms in Isoniazid and Prothionamide Resistance Genes of the Mycobacterium tuberculosis Complex

KAUST Repository

Projahn, M.; Koser, C. U.; Homolka, S.; Summers, D. K.; Archer, John A.C.; Niemann, S.

2011-01-01

Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.

Polymorphisms in Isoniazid and Prothionamide Resistance Genes of the Mycobacterium tuberculosis Complex

KAUST Repository

Projahn, M.

2011-06-27

Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.

Perspectives of family members on planning end-of-life care for terminally ill and frail older people.

Science.gov (United States)

van Eechoud, Ineke J; Piers, Ruth D; Van Camp, Sigrid; Grypdonck, Mieke; Van Den Noortgate, Nele J; Deveugele, Myriam; Verbeke, Natacha C; Verhaeghe, Sofie

2014-05-01

Advance care planning (ACP) is the process by which patients, together with their physician and loved ones, establish preferences for future care. Because previous research has shown that relatives play a considerable role in end-of-life care decisions, it is important to understand how family members are involved in this process. To gain understanding of the involvement of family members in ACP for older people near the end of life by exploring their views and experiences concerning this process. This was a qualitative research study, done with semistructured interviews. Twenty-one family members were recruited from three geriatric settings in Flanders, Belgium. The data were analyzed using the constant comparative method as proposed by the grounded theory. Family members took different positions in the ACP process depending on how much responsibility the family member wanted to take and to what extent the family member felt the patient expected him/her to play a part. The position of family members on these two dimensions was influenced by several factors, namely acknowledgment of the imminent death, experiences with death and dying, opinion about the benefits of ACP, burden of initiating conversations about death and dying, and trust in health care providers. Furthermore, the role of family members in ACP was embedded in the existing relationship patterns. This study provides insight into the different positions of family members in the end-of-life care planning of older patients with a short life expectancy. It is important for health care providers to understand the position of a family member in the ACP of the patient, take into account that family members may experience an active role in ACP as burdensome, and consider existing relationship patterns. Copyright © 2014 U.S. Cancer Pain Relief Committee. Published by Elsevier Inc. All rights reserved.

Solution Structure of the Tandem Acyl Carrier Protein Domains from a Polyunsaturated Fatty Acid Synthase Reveals Beads-on-a-String Configuration

KAUST Repository

Trujillo, Uldaeliz

2013-02-28

The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP

Behaviors in Advance Care Planning and ACtions Survey (BACPACS): development and validation part 1.

Science.gov (United States)

Kassam, Aliya; Douglas, Maureen L; Simon, Jessica; Cunningham, Shannon; Fassbender, Konrad; Shaw, Marta; Davison, Sara N

2017-11-22

Although advance care planning (ACP) is fairly well understood, significant barriers to patient participation remain. As a result, tools to assess patient behaviour are required. The objective of this study was to improve the measurement of patient engagement in ACP by detecting existing survey design issues and establishing content and response process validity for a new survey entitled Behaviours in Advance Care Planning and ACtions Survey (BACPACS). We based our new tool on that of an existing ACP engagement survey. Initial item reduction was carried out using behavior change theories by content and design experts to help reduce response burden and clarify questions. Thirty-two patients with chronic diseases (cancer, heart failure or renal failure) were recruited for the think aloud cognitive interviewing with the new, shortened survey evaluating patient engagement with ACP. Of these, n = 27 had data eligible for analysis (n = 8 in round 1 and n = 19 in rounds 2 and 3). Interviews were audio-recorded and analyzed using the constant comparison method. Three reviewers independently listened to the interviews, summarized findings and discussed discrepancies until consensus was achieved. Item reduction from key content expert review and conversation analysis helped decrease number of items from 116 in the original ACP Engagement Survey to 24-38 in the new BACPACS depending on branching of responses. For the think aloud study, three rounds of interviews were needed until saturation for patient clarity was achieved. The understanding of ACP as a construct, survey response options, instructions and terminology pertaining to patient engagement in ACP warranted further clarification. Conversation analysis, content expert review and think aloud cognitive interviewing were useful in refining the new survey instrument entitled BACPACS. We found evidence for both content and response process validity for this new tool.

Solution structure of the tandem acyl carrier protein domains from a polyunsaturated fatty acid synthase reveals beads-on-a-string configuration.

Directory of Open Access Journals (Sweden)

Uldaeliz Trujillo

Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of

Solution Structure of the Tandem Acyl Carrier Protein Domains from a Polyunsaturated Fatty Acid Synthase Reveals Beads-on-a-String Configuration

KAUST Repository

Trujillo, Uldaeliz; Vá zquez-Rosa, Edwin; Oyola-Robles, Delise; Stagg, Loren J.; Vassallo, David A.; Vega, Irving E.; Arold, Stefan T.; Baerga-Ortiz, Abel

2013-01-01

The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP

Structure-Composition-Property Relationships in Polymeric Amorphous Calcium Phosphate-Based Dental Composites

Directory of Open Access Journals (Sweden)

Drago Skrtic

2009-11-01

Full Text Available Our studies of amorphous calcium phosphate (ACP-based materials over the last decade have yielded bioactive polymeric composites capable of protecting teeth from demineralization or even regenerating lost tooth mineral. The anti-cariogenic/remineralizing potential of these ACP composites originates from their propensity, when exposed to the oral environment, to release in a sustained manner sufficient levels of mineral-forming calcium and phosphate ions to promote formation of stable apatitic tooth mineral. However, the less than optimal ACP filler/resin matrix cohesion, excessive polymerization shrinkage and water sorption of these experimental materials can adversely affect their physicochemical and mechanical properties, and, ultimately, limit their lifespan. This study demonstrates the effects of chemical structure and composition of the methacrylate monomers used to form the matrix phase of composites on degree of vinyl conversion (DVC and water sorption of both copolymers and composites and the release of mineral ions from the composites. Modification of ACP surface via introducing cations and/or polymers ab initio during filler synthesis failed to yield mechanically improved composites. However, moderate improvement in composite’s mechanical stability without compromising its remineralization potential was achieved by silanization and/or milling of ACP filler. Using ethoxylated bisphenol A dimethacrylate or urethane dimethacrylate as base monomers and adding moderate amounts of hydrophilic 2-hydroxyethyl methacrylate or its isomer ethyl-α-hydroxymethacrylate appears to be a promising route to maximize the remineralizing ability of the filler while maintaining high DVC. Exploration of the structure/composition/property relationships of ACP fillers and polymer matrices is complex but essential for achieving a better understanding of the fundamental mechanisms that govern dissolution/re-precipitation of bioactive ACP fillers, and

Clinical evaluation of remineralization potential of casein phosphopeptide amorphous calcium phosphate nanocomplexes for enamel decalcification in orthodontics.

Science.gov (United States)

Wang, Jun-xiang; Yan, Yan; Wang, Xiu-jing

2012-11-01

Enamel decalcification in orthodontics is a concern for dentists and methods to remineralize these lesions are the focus of intense research. The aim of this study was to evaluate the remineralizing effect of casein phosphopeptide amorphous calcium phosphate (CPP-ACP) nanocomplexes on enamel decalcification in orthodontics. Twenty orthodontic patients with decalcified enamel lesions during fixed orthodontic therapy were recruited to this study as test group and twenty orthodontic patients with the similar condition as control group. GC Tooth Mousse, the main component of which is CPP-ACP, was used by each patient of test group every night after tooth-brushing for six months. For control group, each patient was asked to brush teeth with toothpaste containing 1100 parts per million (ppm) of fluoride twice a day. Standardized intraoral images were taken for all patients and the extent of enamel decalcification was evaluated before and after treatment over this study period. Measurements were statistically compared by t test. After using CPP-ACP for six months, the enamel decalcification index (EDI) of all patients had decreased; the mean EDI before using CPP-ACP was 0.191 ± 0.025 and that after using CPP-ACP was 0.183 ± 0.023, the difference was significant (t = 5.169, P 0.05). CPP-ACP can effectively improve the demineralized enamel lesions during orthodontic treatment, so it has some remineralization potential for enamel decalcification in orthodontics.

Non-opioid anesthetic drug abuse among anesthesia care providers: a narrative review.

Science.gov (United States)

Zuleta-Alarcón, Alix; Coffman, John C; Soghomonyan, Suren; Papadimos, Thomas J; Bergese, Sergio D; Moran, Kenneth R

2017-02-01

The objective of this narrative review is to provide an overview of the problem of non-opioid anesthetic drug abuse among anesthesia care providers (ACPs) and to describe current approaches to screening, therapy, and rehabilitation of ACPs suffering from non-opioid anesthetic drug abuse. We first performed a search of all literature available on PubMed prior to April 11, 2016. The search was limited to articles published in Spanish and English, and the following key words were used: anesthesiology, anesthesia personnel, AND substance-related disorders. We also searched Ovid MEDLINE ® databases from 1946-April 11, 2016 using the following search terms: anesthesiology OR anesthesia, OR nurse anesthetist OR anesthesia care provider OR perioperative nursing AND substance-related disorders. Despite an increased awareness of drug abuse among ACPs and improvements in preventive measures, the problem of non-opioid anesthetic drug abuse remains significant. While opioids are the most commonly abused anesthesia medications among ACPs, the abuse of non-opioid anesthetics is a significant cause of morbidity, mortality, and professional demise. Early detection, effective therapy, and long-term follow-up help ACPs cope more effectively with the problem and, when possible, resume their professional activities. There is insufficient evidence to determine the ability of ACPs to return safely to anesthesia practice after rehabilitation, though awareness of the issue and ongoing treatment are necessary to minimize patient risk from potentially related clinical errors.

In vivo immunomodulatory effects of Antrodia camphorata polysaccharides in a T1/T2 doubly transgenic mouse model for inhibiting infection of Schistosoma mansoni

International Nuclear Information System (INIS)

Cheng, P.-C.; Hsu, C.-Y.; Chen, C.-C.; Lee, K.-M.

2008-01-01

Antrodia camphorata (A. camphorata) is a fungus commonly used for treatment of viral hepatitis and cancer in Chinese folk medicine. Extract of A. camphorate is reported to possess anti-inflammatory, antihepatitis B virus and anticancer activities. In this study, we tested the in vivo effects of polysaccharides derived from A. camphorata (AC-PS) on immune function by detection of cytokine expression and evaluation of the immune phenotype in a T1/T2 doubly transgenic mouse model. The protective effect of AC-PS in mice was tested by infection with Schistosoma mansoni. The induction of large amounts of IFN-γ, IL-2 and TNF-a mRNA were detected after 2 and 4 weeks of oral AC-PS administration in BALB/c and C57BL/6 mice. In transgenic mice, 3 to 6 weeks of oral AC-PS administration increased the proportion of CD4 + T cells and B cells within the spleen. More specifically, there was an increase of Th1 CD4 + T cells and Be1 cells among spleen cells as observed by detection the of Type1/Type2 marker molecules. By using a disease model of parasitic infection, we found that AC-PS treatment inhibited infection with S. mansoni in BALB/C and C57BL/6 mice. AC-PS appears to influence the immune system of mice into developing Th1 responses and have potential for preventing infection with S. mansoni

Performance Evaluation of the Neutron Coincidence Counter for the Advanced Spent Fuel Conditioning Process

International Nuclear Information System (INIS)

Lee, S.Y.; Li, T.K.; Menlove, Howard O.; Kim, H.D.; Ko, W.I.; Park, S.W.

2005-01-01

The Advanced Spent Fuel Conditioning Process (ACP) is a pyrochemical dry reprocessing technique to convert oxide-type spent nuclear fuel into a metallic form. The Korea Atomic Energy Research Institute (KAERI) has been developing this technology for the purpose of spent fuel management and is planning to perform a lab-scale demonstration in 2006. With this technology, a significant reduction of the volume and heat load of spent fuel is expected, which could decrease the burden of safety and economics. In this study, MCNPX code calculations were carried out to estimate the performance of a neutron coincidence counter designed for measruement of the process materials in the pilot-scale ACP facility. To verify the design requirement, the singles and doubles counting rates of the detectors were simulated with the latest coincidence capability of the MCNPX code. Then, the precision of the coincidence measurements were evaluated on various process materials from the ACP. It was verified that the performance of the neutron coincidence counter could meet the design criteria for all samples in the ACP, and the material accounting system for the pilot-scale ACP facility could meet the IAEA safeguards goals.

Application of CATE 2.0 code on evaluating activated corrosion products in a PWR cooling loop

Energy Technology Data Exchange (ETDEWEB)

Zhang, Jingyu; Li, Lu; Chen, Yixue [North China Electric Power Univ., Beijing (China). School of Nuclear Science and Engineering

2017-03-15

In PWR plants, most Occupational Radiation Exposure (ORE) for personnel results from Activated Corrosion Products (ACPs) in the cooling loop. In order to evaluate the ACPs in the cooling loop, a three-region transport model is built up based on the theory of driving force from the concentration difference in CATE 2.0 code. In order to analyze the nuclide composition of ACPs, the EAF-2007 nuclear database is embedded in CATE 2.0. The case of MIT PCCL test loop is simulated to test the availability of CATE 2.0 on PWR ACPs evaluation, and the activity of Co-58 and Co-60 after operation for 42 days calculated by CATE 2.0 is consistent with that from the code CRUDSIM adopted by MIT. Then, the nuclide composition of ACPs is analyzed in detail respectively for operation of 42 days and 12 months using CATE 2.0. The results show that the short-lived nuclides contribute a majority of the activity in the regions of in-flux wall and coolant, while the long-lived nuclides contribute most of the activity in the region of out-flux wall.

Shield wall evaluation of hot cell facility for advanced spent fuel conditioning process

International Nuclear Information System (INIS)

Cho, I. J.; Kuk, D. H.; Ko, J. H.; Jung, W. M.; Yoo, G. S.; Lee, E. P.; Park, S. W.

2002-01-01

The future hot cell is located in the Irradiated Material Experiment Facility (IMEF) at the Korea Atomic Energy Research Institute (KAERI). It is β-γ type hot cell that was constructed on the base floor in IMEF building for irradiated material testing. And this hot cell will be used for carrying out the Advanced spent fuel Conditioning Process (ACP). The radiation shielding capability of hot cell should be sufficient to meet the radiation dose requirements in the related regulations. Because the radioactive sources of ACP are expected to be higher than radioactive sources of IMEF design criteria, the future hot cell in current status is unsatisfactory to hot test of ACP. So the shielding analysis of the future hot cell is performed to evaluate shielding ability of concrete shield wall. The shielding analysis included (a) identification of ACP source term; (b) photon source spectrum; (c) shielding analysis by QADS and MCNP-4C; and (d) enhancement of concrete shield wall. In this research, dose rates are obtained according to ACP source, geometry and hot cell shield wall thickness. And the evaluation and reinforcement thickness of the shield wall about future hot cell are concluded

[Genetical control of the allozymes in juniper (Juniperus excelsa Bieb.) of the Crimea].

Science.gov (United States)

Korshikov, I I; Nikolaeva, A V

2007-01-01

Genetical control of nine enzyme systems has been studied in preserved juniper species (Juniperus excelsa Bieb.) of the natural population of the mountain Crimea. Isozymes were extracted from the haploid seed endosperms and separated elecrophoretically. As a result 16 loci have been identified. Fourteen of them were polymorphic (14--Gdh, Got-1, Mdh-1, Mdh-2, Mdh-3, Acp-1, Acp-2, Acp-3, Lap-1, Dia-1, Fdh, Sod-1, Sod-2, Sod-3). Analysis of the allele segragation of the heterozygous trees confirmed their monogenic inheritance.

Fermilab ACP multi-microprocessor project

International Nuclear Information System (INIS)

Gaines, I.; Areti, H.; Biel, J.; Bracker, S.; Case, G.; Fischler, M.; Husby, D.; Nash, T.

1984-08-01

We report on the status of the Fermilab Advanced Computer Program's project to provide more cost-effective computing engines for the high energy physics community. The project will exploit the cheap, but powerful, commercial microprocessors now available by constructing modular multi-microprocessor systems. A working test bed system as well as plans for the next stages of the project are described

On the ∆ACP saga⋆

Directory of Open Access Journals (Sweden)

Santorelli Pietro

2014-01-01

Full Text Available We discuss a model in which the large SU(3 flavor violations in singly Cabibbo suppressed decays of neutral D mesons are ascribed exclusively to the final state interactions. The agreement with the experimental data on the branching ratios is obtained with large strong phase differences which are also necessary for substantial direct CP violation. While the value of the CP violating asymmetries depends on the strength of the penguin contribution, we predict an asymmetry for the decays into charged pions more than twice larger than that for charged kaons and having opposite sign.

Avaliação do polimorfismo no gene da metilenotetrahidrofolato redutase e concentração de folato e vitamina B12 em pacientes portadores do HIV-1 em tratamento com anti-retrovirais Evaluation of the polymorphisms in methylenetetrahydrofolate reductase gene and the levels of folate and B12 in HIV-infected patients under antiretroviral therapy

Directory of Open Access Journals (Sweden)

Iran Malavazi

2004-12-01

Full Text Available Neste trabalho, investigamos concentração da vitamina B12 e folato, considerando-se a influência dos genótipos da metilenotetrahidrofolato redutase, o perfil imunológico e a terapia antiretroviral utilizada na população brasileira portadora do HIV. Um grupo de 86 indivíduos portadores do HIV-1 e 29 doadores de sangue foram recrutados para compor a casuística. Entre os infectados pelo HIV-1, observou-se menor concentração de B12 no grupo com maior número de linfócitos TCD4+. Não encontramos diferença na distribuição genotípica para as mutações MTHFR C677T e A1298C entre infectados e não infectados pelo HIV-1. Indivíduos portadores do HIV, genótipo C677C, apresentaram concentrações menores de B12 em relação ao grupo controle de mesmo genótipo. A terapia antiretroviral não mostrou qualquer influência nos valores de folato e vitamina B12. Estudos adicionais são necessários para reavaliar a prevalência de menores concentrações de B12 e folato e de hiperhomocisteinemia na população portadora do HIV sob a ótica do uso de HAART e da melhoria na sobrevida dos pacientes.In this study we sought to investigate the B12 and folate levels regarding the influence of methylenetetrahydrofolate reductase genotypes, immunological profile and antiretroviral therapy in the Brazilian HIV-infected population. The study group comprised 89 HIV-infected individuals and 29 blood donors. There was a decrease in the B12 levels in the HIV-infected group with higher TCD4+ lymphocyte counts. No differences in the genotype distribution for methylenetetrahydrofolate reductase polymorphisms between the HIV-infected individuals and the controls were found. HIV-infected individuals carrying the C677C genotype presented lower B12 levels (313.91 ± 154.05 than those with the same genotype in the control group (408.27 ± 207.69. Also, the antiretroviral therapy was not a source of variation of the folate and B12 serum levels. Further studies are

Population diversity of Diaphorina citri (Hemiptera: Liviidae) in China based on whole mitochondrial genome sequences

Science.gov (United States)

BACKGROUND: Diaphorina citri (Asian citrus psyllid, ACP) transmits “Candidatus Liberibacter asiaticus”, an unculturable alpha-proteobacterium associated with citrus Huanglongbing (HLB). ACP has been reported in 11 provinces/regions in China, yet its population diversity remains unclear. In this stud...

Multi-clonal evolution of multi-drug-resistant/extensively drug-resistant Mycobacterium tuberculosis in a high-prevalence setting of Papua New Guinea for over three decades

Science.gov (United States)

Bainomugisa, Arnold; Lavu, Evelyn; Hiashiri, Stenard; Majumdar, Suman; Honjepari, Alice; Moke, Rendi; Dakulala, Paison; Hill-Cawthorne, Grant A.; Pandey, Sushil; Marais, Ben J.; Coulter, Chris; Coin, Lachlan

2018-01-01

An outbreak of multi-drug resistant (MDR) tuberculosis (TB) has been reported on Daru Island, Papua New Guinea. Mycobacterium tuberculosis strains driving this outbreak and the temporal accrual of drug resistance mutations have not been described. Whole genome sequencing of 100 of 165 clinical isolates referred from Daru General Hospital to the Supranational reference laboratory, Brisbane, during 2012–2015 revealed that 95 belonged to a single modern Beijing sub-lineage strain. Molecular dating suggested acquisition of streptomycin and isoniazid resistance in the 1960s, with potentially enhanced virulence mediated by an mycP1 mutation. The Beijing sub-lineage strain demonstrated a high degree of co-resistance between isoniazid and ethionamide (80/95; 84.2 %) attributed to an inhA promoter mutation combined with inhA and ndh coding mutations. Multi-drug resistance, observed in 78/95 samples, emerged with the acquisition of a typical rpoB mutation together with a compensatory rpoC mutation in the 1980s. There was independent acquisition of fluoroquinolone and aminoglycoside resistance, and evidence of local transmission of extensively drug resistant (XDR) strains from 2009. These findings underline the importance of whole genome sequencing in informing an effective public health response to MDR/XDR TB. PMID:29310751

Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

Science.gov (United States)

Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

2018-03-01

Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

Noninvasive ventilation for severely acidotic patients in respiratory intermediate care units : Precision medicine in intermediate care units.

Science.gov (United States)

Masa, Juan F; Utrabo, Isabel; Gomez de Terreros, Javier; Aburto, Myriam; Esteban, Cristóbal; Prats, Enric; Núñez, Belén; Ortega-González, Ángel; Jara-Palomares, Luis; Martin-Vicente, M Jesus; Farrero, Eva; Binimelis, Alicia; Sala, Ernest; Serrano-Rebollo, José C; Barrot, Emilia; Sánchez-Oro-Gomez, Raquel; Fernández-Álvarez, Ramón; Rodríguez-Jerez, Francisco; Sayas, Javier; Benavides, Pedro; Català, Raquel; Rivas, Francisco J; Egea, Carlos J; Antón, Antonio; Peñacoba, Patricia; Santiago-Recuerda, Ana; Gómez-Mendieta, M A; Méndez, Lidia; Cebrian, José J; Piña, Juan A; Zamora, Enrique; Segrelles, Gonzalo

2016-07-07

Severe acidosis can cause noninvasive ventilation (NIV) failure in chronic obstructive pulmonary disease (COPD) patients with acute hypercapnic respiratory failure (AHRF). NIV is therefore contraindicated outside of intensive care units (ICUs) in these patients. Less is known about NIV failure in patients with acute cardiogenic pulmonary edema (ACPE) and obesity hypoventilation syndrome (OHS). Therefore, the objective of the present study was to compare NIV failure rates between patients with severe and non-severe acidosis admitted to a respiratory intermediate care unit (RICU) with AHRF resulting from ACPE, COPD or OHS. We prospectively included acidotic patients admitted to seven RICUs, where they were provided NIV as an initial ventilatory support measure. The clinical characteristics, pH evolutions, hospitalization or RICU stay durations and NIV failure rates were compared between patients with a pH ≥ 7.25 and a pH acidosis were similar among the groups (45 % in the ACPE group, 41 % in the COPD group, and 38 % in the OHS group). Most of the patients with severe acidosis had increased disease severity compared with those with non-severe acidosis: the APACHE II scores were 21 ± 7.2 and 19 ± 5.8 for the ACPE patients (p acidosis also exhibited worse arterial blood gas parameters: the PaCO2 levels were 87 ± 22 and 70 ± 15 in the ACPE patients (p acidosis required a longer duration to achieve pH normalization than those with non-severe acidosis (patients with a normalized pH after the first hour: ACPE, 8 % vs. 43 %, p acidosis in the three disease groups (ACPE, 16 % vs. 12 %; COPD, 7 % vs. 7 %; and OHS, 11 % vs. 4 %). No common predictive factor for NIV failure was identified among the groups. ACPE, COPD and OHS patients with AHRF and severe acidosis (pH ≤ 7.25) who are admitted to an RICU can be successfully treated with NIV in these units. These results may be used to determine precise RICU admission criteria.

Variation in sperm displacement and its association with accessory gland protein loci in Drosophila melanogaster.

Science.gov (United States)

Clark, A G; Aguadé, M; Prout, T; Harshman, L G; Langley, C H

1995-01-01

Genes that influence mating and/or fertilization success may be targets for strong natural selection. If females remate frequently relative to the duration of sperm storage and rate of sperm use, sperm displacement may be an important component of male reproductive success. Although it has long been known that mutant laboratory stocks of Drosophila differ in sperm displacement, the magnitude of the naturally occurring genetic variation in this character has not been systematically quantified. Here we report the results of a screen for variation in sperm displacement among 152 lines of Drosophilia melanogaster that were made homozygous for second and/or third chromosomes recovered from natural populations. Sperm displacement was assayed by scoring the progeny of cn;bw females that had been mated sequentially to cn;bw and tested males in either order. Highly significant differences were seen in both the ability to displace sperm that is resident in the female's reproductive tract and in the ability to resist displacement by subsequent sperm. Most lines exhibited nearly complete displacement, having nearly all progeny sired by the second male, but several lines had as few as half the progeny fathered by the second male. Lines that were identified in the screen for naturally occurring variation in sperm displacement were also characterized for single-strand conformation polymorphisms (SSCP) at seven accessory gland protein (Acp) genes, Glucose dehydrogenase (Gld), and Esterase-6 (Est-6). Acp genes encode proteins that are in some cases known to be transmitted to the female in the seminal fluid and are likely candidates for genes that might mediate the phenomenon of sperm displacement. Significant associations were found between particular Acp alleles at four different loci (Acp26Aa/Ab, Acp29B, Acp36DE and Acp53E) and the ability of males to resist displacement by subsequent sperm. There was no correlation between the ability to displace resident sperm and the ability

The Impact of Deep Versus Moderate Hypothermia on Postoperative Kidney Function After Elective Aortic Hemiarch Repair.

Science.gov (United States)

Arnaoutakis, George J; Vallabhajosyula, Prashanth; Bavaria, Joseph E; Sultan, Ibrahim; Siki, Mary; Naidu, Suveeksha; Milewski, Rita K; Williams, Matthew L; Hargrove, W Clark; Desai, Nimesh D; Szeto, Wilson Y

2016-10-01

There remains concern that moderate hypothermic circulatory arrest (MHCA) with antegrade cerebral perfusion (ACP) may provide suboptimal distal organ protection compared with deep hypothermic circulatory arrest (DHCA) with retrograde cerebral perfusion (RCP). We compared postoperative acute kidney injury (AKI) in in patients who underwent elective hemiarch repair with either DHCA/RCP or MHCA/ACP. This was a retrospective review of all patients undergoing elective aortic hemiarch reconstruction for aneurysmal disease between 2009 and 2014. Patients were stratified according to the use of DHCA/RCP versus MHCA/ACP. The primary outcome was the occurrence of AKI at 48 hours, as defined by the Risk, Injury, Failure, Loss, End-Stage (RIFLE ) criteria. A multivariable logistic regression identified risk factors for AKI. One hundred eighteen patients who underwent ACP and 471 patients who underwent RCP were included. The mean lowest temperature was 26.4°C in patients who underwent MHCA/ACP and 17.5°C in patients who underwent DHCA/RCP. Baseline demographics were similar except that patients who underwent DHCA/RCP were more likely to have peripheral arterial disease or bicuspid aortic valves. Cardiopulmonary bypass and aortic cross-clamp times were shorter in the MHCA/ACP group. AKI occurred in 19 (16.2%) patients who underwent MHCA/ACP and 67 (14.3%) patients who underwent DHCA/RCP. Four (0.8%) patients who underwent DHCA/RCP required postoperative dialysis. In-hospital mortality tended to increase with increasing RIFLE classification (RIFLE class-0 (No AKI) = 0.41%; Risk = 1.35%, and Injury = 10.0%; p = 0.09). On multivariable analysis, the lowest temperature and cerebral perfusion strategy were not significant predictors of AKI. Lower baseline glomerular filtration rate (GFR), lower preoperative ejection fraction, and longer cardiopulmonary bypass (CPB) time were independently associated with higher AKI. We applied the sensitive RIFLE criteria to examine AKI in

Advance care planning in patients with primary malignant brain tumours: a systematic review

Directory of Open Access Journals (Sweden)

Krystal Song

2016-10-01

Full Text Available Advance care planning (ACP is a process of reflection and communication of a person’s future health care preferences, and has been shown to improve end-of-life care for patients. The aim of this systematic review is to present an evidence-based overview of ACP in patients with primary malignant brain tumours (pmBT. A comprehensive literature search was conducted using medical and health science electronic databases (PubMed, Cochrane, Embase, MEDLINE, ProQuest, Social Care Online, Scopus and Web of Science up to July 2016. Manual search of bibliographies of articles and grey literature search were also conducted. Two independent reviewers selected studies, extracted data and assessed the methodologic quality of the studies using the Critical Appraisal Skills Program’s appraisal tools. All studies were included irrespective of the study design. A meta-analysis was not possible due to heterogeneity amongst included studies; therefore, a narrative analysis was performed for best evidence synthesis. Overall, 19 studies were included (1 RCT, 17 cohort studies, 1 qualitative study with 4686 participants. All studies scored low to moderate on the methodological quality assessment, implying high risk of bias. A single RCT evaluating a video decision support tool in facilitating ACP in pmBT patients showed a beneficial effect in promoting comfort care and gaining confidence in decision–making. However, the effect of the intervention on quality of life and care at the end-of-life were unclear. There was a low rate of use of ACP discussions at the end-of-life. Advance Directive completion rates and place of death varied between different studies. Positive effects of ACP included lower hospital readmission rates, and intensive care unit utilization. None of the studies assessed mortality outcomes associated with ACP. In conclusion, this review found some beneficial effects of ACP in pmBT. The literature still remains limited in this area, with lack of

Trends in Advance Care Planning in Patients With Cancer: Results From a National Longitudinal Survey.

Science.gov (United States)

Narang, Amol K; Wright, Alexi A; Nicholas, Lauren H

2015-08-01

Advance care planning (ACP) may prevent end-of-life (EOL) care that is nonbeneficial and discordant with patient wishes. Despite long-standing recognition of the merits of ACP in oncology, it is unclear whether participation in ACP by patients with cancer has increased over time. To characterize trends in durable power of attorney (DPOA) assignment, living will creation, and participation in discussions of EOL care preferences and to explore associations between ACP subtypes and EOL treatment intensity as reflected in EOL care decisions and terminal hospitalizations. We analyzed prospectively collected survey data from 1985 next-of-kin surrogates of Health and Retirement Study (HRS) participants with cancer who died between 2000 and 2012, including data from in-depth "exit" interviews conducted with the surrogates after the participant's death. The HRS is a nationally representative, biennial, longitudinal panel study of US residents older than 50 years. Trends in ACP subtypes were tested, and multivariable logistic regression models examined for associations between ACP subtypes and measures of treatment intensity. Trends in the surrogate-reported frequency of DPOA assignment, living will creation, and participation in discussions of EOL care preferences; associations between ACP subtypes and both surrogate-reported EOL care decisions and terminal hospitalizations. From 2000 to 2012, there was an increase in DPOA assignment (52% to 74%, P = .03), without significant change in use of living wills (49% to 40%, P = .63) or EOL discussions (68% to 60%, P = .62). Surrogate reports that patients received "all care possible" at EOL increased during the period (7% to 58%, P = .004), and rates of terminal hospitalizations were unchanged (29% to 27%, P = .70). Limiting or withholding treatment was associated with living wills (adjusted odds ratio [AOR], 2.51; 95% CI, 1.53-4.11; P EOL discussions (AOR, 1.93; 95% CI, 1.53-3.14; P = .002) but not with

Implementing an Advance Care Planning Intervention in Community Settings with Older Latinos: A Feasibility Study.

Science.gov (United States)

Nedjat-Haiem, Frances R; Carrion, Iraida V; Gonzalez, Krystyna; Quintana, Alejandra; Ell, Kathleen; O'Connell, Mary; Thompson, Beti; Mishra, Shiraz I

2017-09-01

Older Latinos with serious medical conditions such as cancer and other chronic diseases lack information about advance care planning (ACP). ACP Intervention (ACP-I Plan) was designed for informational and communication needs of older Latinos to improve communication and advance directives (ADs). To determine the feasibility of implementing ACP-I Plan among seriously ill, older Latinos (≥50 years) in Southern New Mexico with one or more chronic diseases (e.g., cancer, heart disease, renal/liver failure, stroke, hypertension, diabetes, chronic obstructive pulmonary disease, and HIV/AIDS). We conducted a prospective, pretest/post-test, two-group, randomized, community-based pilot trial by using mixed data collection methods. Older Latino/Hispanic participants were recruited from community-based settings in Southern New Mexico. All participants received ACP education, whereas the intervention group added: (1) emotional support addressing psychological distress; and (2) systems navigation for resource access, all of which included interactive ACP treatment decisional support and involved motivational interview (MI) methods. Purposive sampling was guided by a sociocultural framework to recruit Latino participants from community-based settings in Southern New Mexico. Feasibility of sample recruitment, implementation, and retention was assessed by examining the following: recruitment strategies, trial enrollment, retention rates, duration of MI counseling, type of visit (home vs. telephone), and satisfaction with the program. We contacted 104 patients, enrolled 74 randomized to usual care 39 (UC) and treatment 35 (TX) groups. Six dropped out before the post-test survey, three from TX before the post-test survey because of sickness (n = 1) or could not be located (n = 2), and the same happened for UC. Completion rates were 91.4% UC and 92.3% TX groups. All participants were Latino/Hispanic, born in the United States (48%) or Mexico (51.4%) on average in the United

Assessment of the disinfection capacity and eco-toxicological impact of atmospheric cold plasma for treatment of food industry effluents.

Science.gov (United States)

Patange, Apurva; Boehm, Daniela; Giltrap, Michelle; Lu, Peng; Cullen, P J; Bourke, Paula

2018-08-01

Generation of wastewater is one of the main environmental sustainability issues across food sector industries. The constituents of food process effluents are often complex and require high energy and processing for regulatory compliance. Wastewater streams are the subject of microbiological and chemical criteria, and can have a significant eco-toxicological impact on the aquatic life. Thus, innovative treatment approaches are required to mitigate environmental impact in an energy efficient manner. Here, dielectric barrier discharge atmospheric cold plasma (ACP) was evaluated for control of key microbial indicators encountered in food industry effluent. This study also investigated the eco-toxicological impact of cold plasma treatment of the effluents using a range of aquatic bioassays. Continuous ACP treatment was applied to synthetic dairy and meat effluents. Microbial inactivation showed treatment time dependence with significant reduction in microbial populations within 120 s, and to undetectable levels after 300 s. Post treatment retention time emerged as critical control parameter which promoted ACP bacterial inactivation efficiency. Moreover, ACP treatment for 20 min achieved significant reduction (≥2 Log 10 ) in Bacillus megaterium endospores in wastewater effluent. Acute aquatic toxicity was assessed using two fish cell lines (PLHC-1 and RTG-2) and a crustacean model (Daphnia magna). Untreated effluents were toxic to the aquatic models, however, plasma treatment limited the toxic effects. Differing sensitivities were observed to ACP treated effluents across the different test bio-assays in the following order: PLHC-1 > RTG-2 ≥ D. magna; with greater sensitivity retained to plasma treated meat effluent than dairy effluent. The toxic effects were dependent on concentration and treatment time of the ACP treated effluent; with 30% cytotoxicity in D. magna and fish cells observed after 24 h of exposure to ACP treated effluent for

Sclerenchymatous ring as a barrier to phloem feeding by Asian citrus psyllid: Evidence from electrical penetration graph and visualization of stylet pathways

Science.gov (United States)

Asian citrus psyllid (ACP) feeding behaviors play a significant role in the transmission of the phloem-limited Candidatus Liberibacter asiaticus (CLas) bacteria that cause citrus greening disease. Sustained phloem ingestion by ACP on CLas infected plants is very important in pathogen acquisition and...

Advance care planning in palliative care for people with intellectual disabilities: a systematic review.

NARCIS (Netherlands)

Voss, H.; Vogel, A.; Wagemans, A.M.A.; Francke, A.L.; Metsemakers, J.F.M.; Courtens, A.M.; Veer, A.J.E. de

2017-01-01

Context: Advance care planning (ACP) is defined as a person-centred, ongoing process of communication that facilitates patients' understanding, reflection and discussion of goals, values and preferences for future care. There is evidence for the general palliative care population that ACP increases

Efficacy of an autodisseminator of an entomopathogenic fungus, Isaria fumosorosea, to suppress Asian citrus psyllid, Diaphorina citri, under greenhouse conditions

Science.gov (United States)

The Asian citrus psyllid (ACP), transmits the causative agents of citrus greening disease or huanglongbing (HLB), the most devastating disease of citrus trees in the world today. ACP dwelling in noncommercial citrus (neighborhoods, commercial landscapes, etc.) can stymie area-wide management program...

Developing the Storyline for an Advance Care Planning Video for Surgery Patients: Patient-Centered Outcomes Research Engagement from Stakeholder Summit to State Fair.

Science.gov (United States)

Aslakson, Rebecca A; Schuster, Anne L R; Lynch, Thomas J; Weiss, Matthew J; Gregg, Lydia; Miller, Judith; Isenberg, Sarina R; Crossnohere, Norah L; Conca-Cheng, Alison M; Volandes, Angelo E; Smith, Thomas J; Bridges, John F P

2018-01-01

Patient-centered outcomes research (PCOR) methods and social learning theory (SLT) require intensive interaction between researchers and stakeholders. Advance care planning (ACP) is valuable before major surgery, but a systematic review found no extant perioperative ACP tools. Consequently, PCOR methods and SLT can inform the development of an ACP educational video for patients and families preparing for major surgery. The objective is to develop and test acceptability of an ACP video storyline. The design is a stakeholder-guided development of the ACP video storyline. Design-thinking methods explored and prioritized stakeholder perspectives. Patients and family members evaluated storyboards containing the proposed storyline. The study was conducted at hospital outpatient surgical clinics, in-person stakeholder summit, and the 2014 Maryland State Fair. Measurements are done through stakeholder engagement and deidentified survey. Stakeholders evaluated and prioritized evidence from an environmental scan. A surgeon, family member, and palliative care physician team iteratively developed a script featuring 12 core themes and worked with a medical graphic designer to translate the script into storyboards. For 10 days, 359 attendees of the 2014 Maryland State Fair evaluated the storyboards and 87% noted that they would be "very comfortable" or "comfortable" seeing the storyboard before major surgery, 89% considered the storyboards "very helpful" or "helpful," and 89% would "definitely recommend" or "recommend" this story to others preparing for major surgery. Through an iterative process utilizing diverse PCOR engagement methods and informed by SLT, storyboards were developed for an ACP video. Field testing revealed the storyline to be highly meaningful for surgery patients and family members.

Clinical utility of FDG PET/CT in acute complicated pyelonephritis - results from an observational study

Energy Technology Data Exchange (ETDEWEB)

Wan, Chih-Hsing [Mackay Memorial Hospital at Taipei, Department of Nuclear Medicine, Taipei (China); Tseng, Jing-Ren; Yen, Tzu-Chen [Chang Gung Memorial Hospital at Linkou, Department of Nuclear Medicine and Center for Advanced Molecular Imaging and Translation, Taoyuan (China); Chang Gung University, Department of Medical Imaging and Radiological Science, College of Medicine, Taoyuan (China); Lee, Ming-Hsun [Chang Gung Memorial Hospital at Linkou, Division of Infectious Diseases, Department of Internal Medicine, Taoyuan (China); Yang, Lan-Yan [Chang Gung Memorial Hospital at Linkou, Biostatistics Unit, Clinical Trial Center, Taoyuan (China)

2018-03-15

Acute complicated pyelonephritis (ACP) is an upper urinary tract infection associated with coexisting urinary tract abnormalities or medical conditions that could predispose to serious outcomes or treatment failures. Although CT and magnetic resonance imaging (MRI) are frequently used in patients with ACP, the clinical value of {sup 18}F-fluorodeoxyglucose positron emission tomography and computed tomography (FDG PET/CT) has not been systematically investigated. This single-center retrospective study was designed to evaluate the potential usefulness of FDG PET/CT in patients with ACP. Thirty-one adult patients with ACP who underwent FDG PET/CT were examined. FDG PET/CT imaging characteristics, including tracer uptake patterns, kidney volumes, and extrarenal imaging findings, were reviewed in combination with clinical data and conventional imaging results. Of the 31 patients, 19 (61%) showed focal FDG uptake. The remaining 12 study participants showed a diffuse FDG uptake pattern. After volumetric approximation, the affected kidneys were found to be significantly enlarged. Patients who showed a focal uptake pattern had a higher frequency of abscess formation requiring drainage. ACP patients showing diffuse tracer uptake patterns had a more benign clinical course. Seven patients had suspected extrarenal coinfections, and FDG PET/CT successfully confirmed the clinical suspicion in five cases. FDG PET/CT was as sensitive as CT in identifying the six patients (19%) who developed abscesses. Notably, FDG PET/CT findings caused a modification to the initial antibiotic regimen in nine patients (29%). FDG PET/CT may be clinically useful in the assessment of patients with ACP who have a progressive disease course. (orig.)

Molecular dynamics investigations of BioH protein substrate specificity for biotin synthesis.

Science.gov (United States)

Xue, Qiao; Cui, Ying-Lu; Zheng, Qing-Chuan; Zhang, Hong-Xing

2016-05-01

BioH, an enzyme of biotin synthesis, plays an important role in fatty acid synthesis which assembles the pimelate moiety. Pimeloyl-acyl carrier protein (ACP) methyl ester, which is long known to be a biotin precursor, is the physiological substrate of BioH. Azelayl methyl ester, which has a longer chain than pimeloyl methyl ester, conjugated to ACP is also indeed accepted by BioH with very low rate of hydrolysis. To date, the substrate specificity for BioH and the molecular origin for the experimentally observed rate changes of hydrolysis by the chain elongation have remained elusive. To this end, we have investigated chain elongation effects on the structures by using the fully atomistic molecular dynamics simulations combined with binding free energy calculations. The results indicate that the substrate specificity is determined by BioH together with ACP. The added two methylenes would increase the structural flexibility by protein motions at the interface of ACP and BioH, instead of making steric clashes with the side chains of the BioH hydrophobic cavity. On the other hand, the slower hydrolysis of azelayl substrate is suggested to be associated with the loose of contacts between BioH and ACP, and with the lost electrostatic interactions of two ionic/hydrogen bonding networks at the interface of the two proteins. The present study provides important insights into the structure-function relationships of the complex of BioH with pimeloyl-ACP methyl ester, which could contribute to further understanding about the mechanism of the biotin synthetic pathway, including the catalytic role of BioH.

Homing peptide guiding optical molecular imaging for the diagnosis of bladder cancer

Science.gov (United States)

Yang, Xiao-feng; Pang, Jian-zhi; Liu, Jie-hao; Zhao, Yang; Jia, Xing-you; Li, Jun; Liu, Reng-xin; Wang, Wei; Fan, Zhen-wei; Zhang, Zi-qiang; Yan, San-hua; Luo, Jun-qian; Zhang, Xiao-lei

2014-11-01

Background: The limitations of primary transurethral resection of bladder tumor (TURBt) have led the residual tumors rates as high as 75%. The intraoperative fluorescence imaging offers a great potential for improving TURBt have been confirmed. So we aim to distinguish the residual tumors and normal mucosa using fluorescence molecular imaging formed by conjugated molecule of the CSNRDARRC bladder cancer homing peptide with fluorescent dye. The conjugated molecule was abbreviated FIuo-ACP. In our study, we will research the image features of FIuo-ACP probe targeted bladder cancer for fluorescence molecular imaging diagnosis for bladder cancer in vivo and ex vivo. Methods: After the FIuo-ACP probe was synthetized, the binding sites, factors affecting binding rates, the specificity and the targeting of Fluo-ACP labeled with bladder cancer cells were studied respectively by laser scanning confocal microscope (LSCM), immunofluorescence and multispectral fluorescence ex vivo optical molecular imaging system. Results: The binding sites were located in nucleus and the binding rates were correlated linearly with the dose of probe and the grade of pathology. Moreover, the probe has a binding specificity with bladder cancer in vivo and ex vivo. Tumor cells being labeled by the Fluo-ACP, bright green spots were observed under LSCM. The tissue samples and tumor cells can be labeled and identified by fluorescence microscope. Optical molecular imaging of xenograft tumor tissues was exhibited as fluorescent spots under EMCCD. Conclusion: The CSNRDARRC peptides might be a useful bladder cancer targeting vector. The FIuo-ACP molecular probe was suitable for fluorescence molecular imaging diagnosis for bladder cancer in vivo and ex vivo.

Feasibility of a Video-Based Advance Care Planning Website to Facilitate Group Visits among Diverse Adults from a Safety-Net Health System.

Science.gov (United States)

Zapata, Carly; Lum, Hillary D; Wistar, Emily; Horton, Claire; Sudore, Rebecca L

2018-02-20

Primary care providers in safety-net settings often do not have time to discuss advance care planning (ACP). Group visits (GV) may be an efficient means to provide ACP education. To assess the feasibility and impact of a video-based website to facilitate GVs to engage diverse adults in ACP. Feasibility pilot among patients who were ≥55 years of age from two primary care clinics in a Northern California safety-net setting. Participants attended two 90-minute GVs and viewed the five steps of the movie version of the PREPARE website ( www.prepareforyourcare.org ) concerning surrogates, values, and discussing wishes in video format. Two clinician facilitators were available to encourage participation. We assessed pre-to-post ACP knowledge, whether participants designated a surrogate or completed an advance directive (AD), and acceptability of GVs and PREPARE materials. We conducted two GVs with 22 participants. Mean age was 64 years (±7), 55% were women, 73% nonwhite, and 55% had limited literacy. Knowledge improved about surrogate designation (46% correct pre vs. 85% post, p = 0.01) and discussing decisions with others (59% vs. 90%, p = 0.01). Surrogate designation increased (48% vs. 85%, p = 0.01) and there was a trend toward AD completion (9% vs. 24%, p = 0.21). Participants rated the GVs and PREPARE materials a mean of 8 (±3.1) on a 10-point acceptability scale. Using the PREPARE movie to facilitate ACP GVs for diverse adults in safety net, primary care settings is feasible and shows potential for increasing ACP engagement.

Manufacturing and testing of active composite panels with embedded piezoelectric sensors and actuators: wires out by molded-in holes

Science.gov (United States)

Ghasemi-Nejhad, Mehrdad N.; Pourjalali, Saeid

2003-08-01

This work presents manufacturing and testing of active composite panels (ACPs) with embedded piezoelectric sensors and actuators. The composite material employed here is a plain weave carbon epoxy prepreg fabric with about 0.33 mm ply thickness. The piezoelectric patches employed here are Continuum Control Corporation, CCC, (recently Continuum Photonics, Inc) active fiber composite patches with 0.33 mm thickness, i.e. close to the composite ply thickness. Composite cut-out layers are used to fill the space around the embedded piezoelectric patches to minimize the problems associated with ply drops in composites. The piezoelectric patches were embedded inside the composite laminate. High-temperature wires were soldered to the piezoelectric leads, insulated from the carbon substructure by high-temperature materials, and were taken out of the composite laminates employing a molded-in hole technique that reduces the stress concentration as opposed to a drilled hole, and thereby enhancing the performance of the composite structure. The laminated ACP"s were co-cured inside an autoclave employing the cure cycle recommended by the composite material supplier. The curie temperature of the embedded piezoelectric patches should be well above the curing temperature of the composite materials as was the case here. The manufactured ACP beams and plates were trimmed and then tested for their functionality. Vibration suppression as well as simultaneous vibration suppression and precision positioning tests, using PID control as well as Hybrid Adaptive Control techniques were successfully conducted on the manufactured ACP beams and their functionality were demonstrated. Recommendations on the use of this embedding technique for ACPs are provided.

In vitro evaluation of casein phosphopeptide-amorphous calcium phosphate effect on the shear bond strength of dental adhesives to enamel.

Science.gov (United States)

Shadman, Niloofar; Ebrahimi, Shahram Farzin; Shoul, Maryam Azizi; Sattari, Hasti

2015-01-01

Casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) is applied for remineralization of early caries lesions or tooth sensitivity conditions and may affect subsequent resin bonding. This in vitro study investigated the effect of CPP-ACP on the shear bond strength of dental adhesives to enamel. Sixty extracted human molar teeth were selected and randomly divided into three groups and six subgroups. Buccal or lingual surfaces of teeth were prepared to create a flat enamel surface. Adhesives used were Tetric N-Bond, AdheSE and AdheSE One F. In three subgroups, before applying adhesives, enamel surfaces were treated with Tooth Mousse CPP-ACP for one hour, rinsed and stored in 37°C temperature with 100% humidity. This procedure was repeated for 5 days and then adhesives were applied and Tetric N-Ceram composite was adhered to the enamel. This procedure was also fulfilled for the other three subgroups without CPP-ACP treatment. After 24 hour water storage, samples were tested for shear bond strength test in a universal testing machine. Failure modes were determined by stereomicroscope. Data were analyzed by t-test and one-way analysis of variance with P enamel only in Tetric N-Bond (P > 0.05). In non-applied CPP-ACP subgroups, there were statistically significant differences among all subgroups. Tetric N-Bond had the highest and AdheSE One F had the lowest shear bond strength. CPP-ACP application reduces the shear bond strength of AdheSE and AdheSE One F to enamel but not Tetric N-Bond.

In vitro evaluation of casein phosphopeptide-amorphous calcium phosphate effect on the shear bond strength of dental adhesives to enamel

Directory of Open Access Journals (Sweden)

Niloofar Shadman

2015-01-01

Full Text Available Background: Casein phosphopeptide-amorphous calcium phosphate (CPP-ACP is applied for remineralization of early caries lesions or tooth sensitivity conditions and may affect subsequent resin bonding. This in vitro study investigated the effect of CPP-ACP on the shear bond strength of dental adhesives to enamel. Materials and Methods: Sixty extracted human molar teeth were selected and randomly divided into three groups and six subgroups. Buccal or lingual surfaces of teeth were prepared to create a flat enamel surface. Adhesives used were Tetric N-Bond, AdheSE and AdheSE One F. In three subgroups, before applying adhesives, enamel surfaces were treated with Tooth Mousse CPP-ACP for one hour, rinsed and stored in 37°C temperature with 100% humidity. This procedure was repeated for 5 days and then adhesives were applied and Tetric N-Ceram composite was adhered to the enamel. This procedure was also fulfilled for the other three subgroups without CPP-ACP treatment. After 24 hour water storage, samples were tested for shear bond strength test in a universal testing machine. Failure modes were determined by stereomicroscope. Data were analyzed by t-test and one-way analysis of variance with P 0.05. In non-applied CPP-ACP subgroups, there were statistically significant differences among all subgroups. Tetric N-Bond had the highest and AdheSE One F had the lowest shear bond strength. Conclusion: CPP-ACP application reduces the shear bond strength of AdheSE and AdheSE One F to enamel but not Tetric N-Bond.

Can Playing an End-of-Life Conversation Game Motivate People to Engage in Advance Care Planning?

Science.gov (United States)

Van Scoy, Lauren J; Green, Michael J; Reading, Jean M; Scott, Allison M; Chuang, Cynthia H; Levi, Benjamin H

2017-09-01

Advance care planning (ACP) involves several behaviors that individuals undertake to prepare for future medical care should they lose decision-making capacity. The goal of this study was to assess whether playing a conversation game could motivate participants to engage in ACP. Sixty-eight English-speaking, adult volunteers (n = 17 games) from communities around Hershey, Pennsylvania, and Lexington, Kentucky, played a conversation card game about end-of-life issues. Readiness to engage in 4 ACP behaviors was measured by a validated questionnaire (based on the transtheoretical model) immediately before and 3 months postgame and a semistructured phone interview. These behaviors were (1) completing a living will; (2) completing a health-care proxy; (3) discussing end-of-life wishes with loved ones; and (4) discussing quality versus quantity of life with loved ones. Participants' (n = 68) mean age was 51.3 years (standard deviation = 0.7, range: 22-88); 94% of the participants were caucasian and 67% were female. Seventy-eight percent of the participants engaged in ACP behaviors within 3 months of playing the game (eg, updating documents, discussing end-of-life issues). Furthermore, 73% of the participants progressed in stage of change (ie, readiness) to perform at least 1 of the 4 behaviors. Scores on measures of decisional balance and processes of change increased significantly by 3 months postintervention. This pilot study found that individuals who played a conversation game had high rates of performing ACP behaviors within 3 months. These findings suggest that using a game format may be a useful way to motivate people to perform important ACP behaviors.

Preliminary results of endorectal surface coil magnetic resonance imaging for local staging of prostate cancer

NARCIS (Netherlands)

Jager, G. J.; Barentsz, J. O.; de la Rosette, J. J.; Rosenbusch, G.

1994-01-01

To evaluate the effectiveness of endorectal surface coil (ERC) magnetic resonance imaging (MRI) in the local staging of adenocarcinoma of the prostate (ACP). A total of 23 patients who were considered candidates for radical prostatectomy because of clinically localized ACP were examined by ERC-MRI.

Behavioral assay on Asian citrus psyllid attraction to orange jasmine

Science.gov (United States)

The Asian citrus psyllid (ACP) is an important pest because it transmits a bacterium putatively responsible for huanglongbing, a devastating citrus disease. Research on ACP chemical ecology is of interest with respect to identifying attractants and repellents for managing the psyllid. We report on a...

Advance Care Planning and Physician Orders in Nursing Home Residents With Dementia: A Nationwide Retrospective Study Among Professional Caregivers and Relatives

NARCIS (Netherlands)

Vandervoort, A.; Houttekier, D.; Block, L.; van der Steen, J.T.; van der Stichele, R.; Deliens, L.

2014-01-01

Context: Advance care planning (ACP) is key to good palliative care for nursing home (NH) residents with dementia. Objectives: We examined the extent to which the family physicians (FPs), nurses, and the relative most involved in the resident's care are informed about ACP, written advance

H NMR analyses of Citrus macrophylla subjected to Asian citrus psyllid (Diaphorina citri Kuwayama) feeding

Science.gov (United States)

The Asian citrus psyllid (ACP) is a phloem feeding insect that can host and transmit the bacterium Candidatus Liberibacter asiaticus (CLas), which is the putative causative agent of the economically important citrus disease, Huanglongbing (HLB). ACP are widespread in Florida, and are spreading in Ca...

Acetyl-Phosphate Is a Critical Determinant of Lysine Acetylation in E. coli

DEFF Research Database (Denmark)

Weinert, Brian T; Iesmantavicius, Vytautas; Wagner, Sebastian A

2013-01-01

Lysine acetylation is a frequently occurring posttranslational modification in bacteria; however, little is known about its origin and regulation. Using the model bacterium Escherichia coli (E. coli), we found that most acetylation occurred at a low level and accumulated in growth-arrested cells...... acetylate lysine residues in vitro and that AcP levels are correlated with acetylation levels in vivo, suggesting that AcP may acetylate proteins nonenzymatically in cells. These results uncover a critical role for AcP in bacterial acetylation and indicate that most acetylation in E. coli occurs at a low...

Phase analysis in patients with Wolff-Parkinson-White syndrome. Correlations to surgically confirmed accessory conduction pathways

Energy Technology Data Exchange (ETDEWEB)

Nakajima, Kenichi; Bunko, Hisashi; Tada, Akira; Taki, Junichi; Tonami, Norihisa

1983-09-01

Twenty-five patients with Wolff-Parkinson-White (WPW) syndrome who underwent surgical division of the accessory conduction pathway (ACP) were studied by gated blood pool studies and phase analyses. All of 11 patients with right cardiac type (R-type) had abnormal initial phase in the right ventricle (RV), while 10 out of 14 patients with left cardiac type (L-type) had initial phase in the left ventricle (LV). However, in 4 L-type patients, there were no significant differences in the initiation of both ventricular contractions. In 10 patients who had radionuclide studies before and after surgical division of the ACP, the ventricular contraction patterns were apparently changed and the abnormal wall motions induced by the presence of ACPs disappeared. These observations indicate that the abnormal initial contraction is associated with pre-excitation of WPW syndrome. Sensitivities to identify the side of preexcitation were 100% (11/11) for R-type and 71% (10/14) for L-type. However, regarding the detection of the precise site of ACP, the agreement was 48% (12/25). Therefore, as a method of preoperative study, it seemed difficult to identify the precise localization of the ACP by phase analysis alone. Phase analysis provided interesting informations and was useful for evaluating patients with WPW syndrome before and after surgery. (author).

Phase analysis in patients with Wolff-Parkinson-White syndrome

International Nuclear Information System (INIS)

Nakajima, Kenichi; Bunko, Hisashi; Tada, Akira; Taki, Junichi; Tonami, Norihisa

1983-01-01

Twenty-five patients with Wolff-Parkinson-White (WPW) syndrome who underwent surgical division of the accessory conduction pathway (ACP) were studied by gated blood pool studies and phase analyses. All of 11 patients with right cardiac type (R-type) had abnormal initial phase in the right ventricle (RV), while 10 out of 14 patients with left cardiac type (L-type) had initial phase in the left ventricle (LV). However, in 4 L-type patients, there were no significant differences in the initiation of both ventricular contractions. In 10 patients who had radionuclide studies before and after surgical division of the ACP, the ventricular contraction patterns were apparently changed and the abnormal wall motions induced by the presence of ACPs disappeared. These observations indicate that the abnormal initial contraction is associated with pre-excitation of WPW syndrome. Sensitivities to identify the side of preexcitation were 100% (11/11) for R-type and 71% (10/14) for L-type. However, regarding the detection of the precise site of ACP, the agreement was 48% (12/25). Therefore, as a method of preoperative study, it seemed difficult to identify the precise localization of the ACP by phase analysis alone. Phase analysis provided interesting informations and was useful for evaluating patients with WPW syndrome before and after surgery. (author)

Metalized polyethylene mulch to repel Asian citrus psyllid, slow spread of huanglongbing and improve growth of new citrus plantings.

Science.gov (United States)

Croxton, Scott D; Stansly, Philip A

2014-02-01

Greening or huanglongbing (HLB) is a debilitating disease of citrus caused by Candidatus Liberibactor asiaticus and transmitted by the Asian citrus psyllid (ACP), Diaphorina citri. HLB now occurs worldwide in all major citrus growing regions except the Mediterranean and Australia. Management relies principally on insecticidal control of the ACP vector, but is insufficient, even for young trees which are most susceptible to the disease. We tested the ability of metalized polyethylene mulch to repel adult ACP as well as effects on incidence of HLB and early tree growth. Metalized mulch significantly reduced ACP populations and HLB incidence compared to whiteface mulch or bare ground. In addition, metalized mulch, together with the associated drip irrigation and fertigation system, increased soil moisture, reduced weed pressure, and increased tree growth rate. Metalized mulch slows spread of ACP and therefore HLB pressure on young citrus trees. Metalized mulch can thereby augment current control measures for young trees based primarily on systemic insecticides. Additional costs could be compensated for by increased tree growth rate which would shorten time to crop profitability. These advantages make a compelling case for large-scale trials using metalized mulch in young citrus plantings threatened by HLB. © 2013 Society of Chemical Industry.

The Lipopolysaccharide Lipid A Long-Chain Fatty Acid Is Important for Rhizobium leguminosarum Growth and Stress Adaptation in Free-Living and Nodule Environments.

Science.gov (United States)

Bourassa, Dianna V; Kannenberg, Elmar L; Sherrier, D Janine; Buhr, R Jeffrey; Carlson, Russell W

2017-02-01

Rhizobium bacteria live in soil and plant environments, are capable of inducing symbiotic nodules on legumes, invade these nodules, and develop into bacteroids that fix atmospheric nitrogen into ammonia. Rhizobial lipopolysaccharide (LPS) is anchored in the bacterial outer membrane through a specialized lipid A containing a very long-chain fatty acid (VLCFA). VLCFA function for rhizobial growth in soil and plant environments is not well understood. Two genes, acpXL and lpxXL, encoding acyl carrier protein and acyltransferase, are among the six genes required for biosynthesis and transfer of VLCFA to lipid A. Rhizobium leguminosarum mutant strains acpXL, acpXL - /lpxXL - , and lpxXL - were examined for LPS structure, viability, and symbiosis. Mutations in acpXL and lpxXL abolished VLCFA attachment to lipid A. The acpXL mutant transferred a shorter acyl chain instead of VLCFA. Strains without lpxXL neither added VLCFA nor a shorter acyl chain. In all strains isolated from nodule bacteria, lipid A had longer acyl chains compared with laboratory-cultured bacteria, whereas mutant strains displayed altered membrane properties, modified cationic peptide sensitivity, and diminished levels of cyclic β-glucans. In pea nodules, mutant bacteroids were atypically formed and nitrogen fixation and senescence were affected. The role of VLCFA for rhizobial environmental fitness is discussed.

First derivative spectrofluorimetric determination of zopiclone and its degradation product, 2-amino-5-chloropyridine, in pharmaceutical formulations with preliminary tool in biological fluids for clinical evidence of zopiclone intake

Science.gov (United States)

Al-Attas, Amirah S.; Nasr, Jenny Jeehan; Shalan, Shereen; Belal, Fathalla

2017-06-01

A simple, fast, sensitive and stability-indicating derivative spectrofluorimetric method is presented for the assay of zopiclone (ZOP), a drug with hypnotic effect, and its main degradation product and major contaminant, 2-amino-5-chloropyridine (ACP). The method is based on measuring the inherent fluorescence intensity of both drugs at λex = 300 nm in methanol, then differentiation using D1 (first derivative technique). The developed method was found to be rectilinear over a range of 0.2-4 μg/mL of ZOP and 4-100 ng/mL of ACP. The limits of detection were 0.05 μg/mL of ZOP and 0.2 ng/mL of ACP with the limit of quantitation of 0.17 μg/mL of ZOP and 0.7 ng/mL of ACP. The outcoming results of the proposed method were compared to those obtained by a reference method showing no significant statistical difference between them concerning precision and accuracy. Additionally, the developed method was applied for detecting ACP in spiked human urine and plasma specimens as a tool of clinical evidence of zopiclone intake that can be easily implemented in forensic laboratories. The proposed method was validated as per ICH guidelines.

ROS-mediated genotoxicity of asbestos-cement in mammalian lung cells in vitro

Directory of Open Access Journals (Sweden)

Rödelsperger Klaus

2005-10-01

Full Text Available Abstract Asbestos is a known carcinogen and co-carcinogen. It is a persisting risk in our daily life due to its use in building material as asbestos-cement powder. The present study done on V79-cells (Chinese hamster lung cells demonstrates the cytotoxic and genotoxic potential of asbestos-cement powder (ACP in comparison with chrysotile asbestos. A co-exposure of chrysotile and ACP was tested using the cell viability test and the micronucleus assay. The kinetochore analysis had been used to analyse the pathway causing such genotoxic effects. Thiobarbituric acid-reactive substances were determined as evidence for the production of reactive oxygen species. Both, asbestos cement as well as chrysotile formed micronuclei and induced loss of cell viability in a concentration- and time- dependent way. Results of TBARS analysis and iron chelator experiments showed induction of free radicals in ACP- and chrysotile exposed cultures. CaSO4 appeared to be a negligible entity in enhancing the toxic potential of ACP. The co-exposure of both, ACP and chrysotile, showed an additive effect in enhancing the toxicity. The overall study suggests that asbestos-cement is cytotoxic as well as genotoxic in vitro. In comparison to chrysotile the magnitude of the toxicity was less, but co-exposure increased the toxicity of both.

The effectiveness of acupuncture as a treatment for tinnitus: a randomized controlled trial using 99mTc-ECD SPECT

International Nuclear Information System (INIS)

Laureano, Maura Regina; Braga Neto, Pedro; Ligia Sanchez, Maura; Cogo Moreira, Hugo; Ribeiro de Almeida, Roberta; Parolin Jackowski, Andrea; Onishi, Ektor Tsuneo; Affonseca Bressan, Rodrigo; Batista, Ilza Rosa; Alves Reis, Marilia; Vieira Castiglioni, Mario Luiz; Vargas Garcia, Michele; Neves de Andrade, Adriana; Jara Garrido, Griselda

2016-01-01

Investigate the effect of acupuncture on brain perfusion using ethyl cysteinate dimer single-photon emission computed tomography ( 99m Tc-ECD SPECT) in patients with tinnitus. This randomized, single-blind, sham-control study examined patients (18-60 years old) with normal hearing and chronic, idiopathic, continuous tinnitus. Fifty-seven subjects were randomly assigned to true (n = 30) or sham (n = 27) acupuncture (ACP); 99m Tc-ECD SPECT examinations were performed before and after 12 twice-weekly ACP sessions. Secondary outcomes included changes in the Tinnitus Handicap Inventory (THI), Visual Analog Scale (VAS), Hamilton Anxiety Scale (HAS) and Beck Depression Inventory (BDI). Imaging data were analysed using Statistical Parametric Mapping (SPM8) software. Regression models were used to examine secondary outcomes via two paradigms: intention-to-treat (ITT; where multiple imputations were conducted because of study attrition) and complete cases. No between-group brain perfusion differences were observed. However, a significant improvement in THI scores was observed at the end of true ACP treatment for all domains (all p values < 0.01) except the catastrophic scale. ACP might reduce the effects of tinnitus on daily life; however, additional studies should be conducted to verify the effects of ACP on the neural architecture and brain function of tinnitus patients. (orig.)

Advance care planning within survivorship care plans for older cancer survivors: A systematic review.

Science.gov (United States)

O'Caoimh, Rónán; Cornally, Nicola; O'Sullivan, Ronan; Hally, Ruth; Weathers, Elizabeth; Lavan, Amanda H; Kearns, Tara; Coffey, Alice; McGlade, Ciara; Molloy, D William

2017-11-01

Advances in the medical treatment of cancer have increased the number of survivors, particularly among older adults, who now represent the majority of these. Survivorship care plans (SCPs) are documents that cancer patients receive summarising their care, usually at the end of treatment but preferably from initial diagnosis. These may increase patient satisfaction and represent an opportunity to initiate preventative strategies and address future care needs. Advance care planning (ACP), incorporating advance healthcare decision-making, including formal written directives, increases satisfaction and end-of-life care. This paper systematically reviews evaluations of ACP within SCPs among older (≥65 years) cancer survivors. No studies meeting the inclusion criteria were identified by search strategies conducted in PubMed/MEDLINE and the Cochrane databases. One paper examined cancer survivors' mainly positive views of ACP. Another discussed the use of a SCP supported by a 'distress inventory' that included an advance care directive (living will) as an issue, though no formal evaluation was reported. Although ACP is important for older adults, no study was found that evaluated its role within survivorship care planning. Despite the risk of recurrence and the potential for morbidity and mortality, especially among older cancer survivors, ACP is not yet a feature of SCPs. Copyright © 2017 Elsevier B.V. All rights reserved.

Addressing second-career teachers' earlier experiences

NARCIS (Netherlands)

Tigchelaar, A.

2012-01-01

Alternative certification programmes (ACPs) for second-career teachers are seen as a solution to teacher shortages because they offer a way to expand a pool of qualified teachers by attracting individuals who might otherwise not have become teachers. The principal virtue of ACPs is that they are

An algebra of reversible computation.

Science.gov (United States)

Wang, Yong

2016-01-01

We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.

ADAPTIVE CONTEXT PROCESSING IN ON-LINE HANDWRITTEN CHARACTER RECOGNITION

NARCIS (Netherlands)

Iwayama, N.; Ishigaki, K.

2004-01-01

We propose a new approach to context processing in on-line handwritten character recognition (OLCR). Based on the observation that writers often repeat the strings that they input, we take the approach of adaptive context processing. (ACP). In ACP, the strings input by a writer are automatically

Safeguardability of advanced spent fuel conditioning process

Energy Technology Data Exchange (ETDEWEB)

Li, T. K. (Tien K.); Lee, S. Y. (Sang Yoon); Burr, Tom; Russo, P. A. (Phyllis A.); Menlove, Howard O.; Kim, H. D.; Ko, W. I. (Won Il); Park, S. W.; Park, H. S.

2004-01-01

The Advanced Spent Fuel Conditioning Process (ACP) is an electro-metallurgical treatment technique to convert oxide-type spent nuclear fuel into a metallic form. The Korea Atomic Energy Research Institute (KAERI) has been developing this technology since 1977 for the purpose of spent fuel management and is planning to perform a lab-scale demonstration in 2006. By using of this technology, a significant reduction of the volume and heat load of spent fuel is expected, which would lighten the burden of final disposal in terms of disposal size, safety and economics. In the framework of collaboration agreement to develop the safeguards system for the ACP, a joint study on the safeguardability of the ACP technology has been performed by the Los Alamos National Laboratory (LANL) and the KAERI since 2002. In this study, the safeguardability of the ACP technology was examined for the pilot-scale facility. The process and material flows were conceptually designed, and the uncertainties in material accounting were estimated with international target values.

High performance parallel computers for science: New developments at the Fermilab advanced computer program

International Nuclear Information System (INIS)

Nash, T.; Areti, H.; Atac, R.

1988-08-01

Fermilab's Advanced Computer Program (ACP) has been developing highly cost effective, yet practical, parallel computers for high energy physics since 1984. The ACP's latest developments are proceeding in two directions. A Second Generation ACP Multiprocessor System for experiments will include $3500 RISC processors each with performance over 15 VAX MIPS. To support such high performance, the new system allows parallel I/O, parallel interprocess communication, and parallel host processes. The ACP Multi-Array Processor, has been developed for theoretical physics. Each $4000 node is a FORTRAN or C programmable pipelined 20 MFlops (peak), 10 MByte single board computer. These are plugged into a 16 port crossbar switch crate which handles both inter and intra crate communication. The crates are connected in a hypercube. Site oriented applications like lattice gauge theory are supported by system software called CANOPY, which makes the hardware virtually transparent to users. A 256 node, 5 GFlop, system is under construction. 10 refs., 7 figs

Measurement of CP asymmetries in D±→η′π± and Ds±→η′π± decays

Directory of Open Access Journals (Sweden)

R. Aaij

2017-08-01

Full Text Available A search for CP violation in D±→η′π± and Ds±→η′π± decays is performed using proton–proton collision data, corresponding to an integrated luminosity of 3 fb−1, recorded by the LHCb experiment at centre-of-mass energies of 7 and 8 TeV. The measured CP-violating charge asymmetries are ACP(D±→η′π±=(−0.61±0.72±0.53±0.12% and ACP(Ds±→η′π±=(−0.82±0.36±0.22±0.27%, where the first uncertainties are statistical, the second systematic, and the third are the uncertainties on the ACP(D±→KS0π± and ACP(Ds±→ϕπ± measurements used for calibration. The results represent the most precise measurements of these asymmetries to date.

High performance parallel computers for science

International Nuclear Information System (INIS)

Nash, T.; Areti, H.; Atac, R.; Biel, J.; Cook, A.; Deppe, J.; Edel, M.; Fischler, M.; Gaines, I.; Hance, R.

1989-01-01

This paper reports that Fermilab's Advanced Computer Program (ACP) has been developing cost effective, yet practical, parallel computers for high energy physics since 1984. The ACP's latest developments are proceeding in two directions. A Second Generation ACP Multiprocessor System for experiments will include $3500 RISC processors each with performance over 15 VAX MIPS. To support such high performance, the new system allows parallel I/O, parallel interprocess communication, and parallel host processes. The ACP Multi-Array Processor, has been developed for theoretical physics. Each $4000 node is a FORTRAN or C programmable pipelined 20 Mflops (peak), 10 MByte single board computer. These are plugged into a 16 port crossbar switch crate which handles both inter and intra crate communication. The crates are connected in a hypercube. Site oriented applications like lattice gauge theory are supported by system software called CANOPY, which makes the hardware virtually transparent to users. A 256 node, 5 GFlop, system is under construction

A survey of U.S. prosthodontists and dental schools on the current materials and methods for final impressions for complete denture prosthodontics.

Science.gov (United States)

Petrie, Cynthia S; Walker, Mary P; Williams, Karen

2005-12-01

The purpose of this study was to survey members of The American College of Prosthodontists (ACP) to evaluate current materials and methods for final impressions for complete denture prosthodontics in the United States. In addition, those methods were compared with methods and materials taught in U.S. dental schools via a second survey sent to the chairpersons of prosthodontic/restorative departments. An anonymous questionnaire was mailed to all 1762 active ACP members in the United States in 2003. A slightly modified questionnaire was also distributed to chairpersons of prosthodontic/restorative departments in the 54 U.S. dental schools. Data analysis was performed via frequency distribution and chi-square statistics. Nine hundred and forty-five questionnaires were returned by members of the ACP (54% return rate) and 42 questionnaires were returned by the U.S. dental schools (78% return rate). The majority of the reporting prosthodontists (88%) and dental schools (98%) use a border-molded custom tray for final impressions for complete denture prosthodontics. The most popular material for border molding was plastic modeling compound (67% of reporting ACP members, and 95% of the responding dental schools). Variability of the materials used for final impressions was observed, with the most popular materials being polyvinylsiloxane for the ACP members (36%) and polysulfide for the dental schools (64%). Statistically significant differences were found in the materials used for border molding by prosthodontists based on the time elapsed since completion of prosthodontic training. No differences were found in the materials used for impression of edentulous arches based on years of experience. Geographic location did not influence the materials and methods used by prosthodontists for complete denture final impressions. There was variability of the materials and techniques used for final impressions by ACP members and dental schools; however, overall there was an agreement

Água de coco em pó como suplemento hidroeletrolítico e energético para atletas

Directory of Open Access Journals (Sweden)

Antônio Carlos Lopes Pinto

2015-10-01

Full Text Available RESUMOIntrodução:O uso de bebidas esportivas vem sendo adotado em diversas modalidades com o intuito de propiciar hidratação adequada durante atividades físicas. A água do coco verde vem sendo usada como repositor de eletrólitos devido à sua composição físico-química rica em sais minerais.Objetivo:Avaliar uma bebida esportiva à base de água de coco em pó (ACP a partir de um blend de ACP com polpa de maracujá (Passiflora edulis S. voltada ao mercado de alimentos funcionais, com o objetivo de melhorar o desempenho de atletas amadores e profissionais em relação a um produto repositor eletrolítico já estabelecido no mercado (Gatorade sabor maracujá.Métodos:O experimento obedeceu a um delineamento inteiramente casualizado em esquema fatorial 2 x 2 x 3 (2 gêneros x 2 tipos de bebidas x 3 dias da semana, comparando o desempe-nho de dois grupos de atletas, sendo cinco atletas do sexo masculino e cinco atletas do sexo feminino, em relação à eficácia de dois suplementos hidroeletrolíticos (ACP com 20% de polpa de maracujá e Gatorade sabor maracujá em diferentes dias da semana (segunda-feira, quarta-feira e sexta-feira.Resultados:ACP com polpa de maracujá apresentou resultados semelhantes ao Gatorade sabor maracujá em relação à os-molaridade plasmática do sangue dos atletas, os quais não apresentaram nenhuma perda de desempenho e tiveram maior conforto gástrico ao se hidratarem com ACP com polpa de maracujá.Conclusão:As respostas fisiológicas mostram a eficiência de ACP com polpa de maracujá como um repositor de eletrólitos seme-lhante ao do produto Gatorade sabor maracujá, podendo assim ACP com polpa de maracujá também ser utilizada como uma bebida esportiva.

Economic injury levels for Asian citrus psyllid control in process oranges from mature trees with high incidence of huanglongbing.

Directory of Open Access Journals (Sweden)

Cesar Monzo

Full Text Available The Asian citrus psyllid (ACP, Diaphorina citri Kuwayama, is the key pest of citrus wherever it occurs due to its role as vector of huanglongbing (HLB also known as citrus greening disease. Insecticidal vector control is considered to be the primary strategy for HLB management and is typically intense owing to the severity of this disease. While this approach slows spread and also decreases severity of HLB once the disease is established, economic viability of increasingly frequent sprays is uncertain. Lacking until now were studies evaluating the optimum frequency of insecticide applications to mature trees during the growing season under conditions of high HLB incidence. We related different degrees of insecticide control with ACP abundance and ultimately, with HLB-associated yield losses in two four-year replicated experiments conducted in commercial groves of mature orange trees under high HLB incidence. Decisions on insecticide applications directed at ACP were made by project managers and confined to designated plots according to experimental design. All operational costs as well as production benefits were taken into account for economic analysis. The relationship between management costs, ACP abundance and HLB-associated economic losses based on current prices for process oranges was used to determine the optimum frequency and timing for insecticide applications during the growing season. Trees under the most intensive insecticidal control harbored fewest ACP resulting in greatest yields. The relationship between vector densities and yield loss was significant but differed between the two test orchards, possibly due to varying initial HLB infection levels, ACP populations or cultivar response. Based on these relationships, treatment thresholds during the growing season were obtained as a function of application costs, juice market prices and ACP densities. A conservative threshold for mature trees with high incidence of HLB would help

Cold Plasma Inactivation of Bacterial Biofilms and Reduction of Quorum Sensing Regulated Virulence Factors.

Directory of Open Access Journals (Sweden)

Dana Ziuzina

Full Text Available The main objectives of this work were to investigate the effect of atmospheric cold plasma (ACP against a range of microbial biofilms commonly implicated in foodborne and healthcare associated human infections and against P. aeruginosa quorum sensing (QS-regulated virulence factors, such as pyocyanin, elastase (Las B and biofilm formation capacity post-ACP treatment. The effect of processing factors, namely treatment time and mode of plasma exposure on antimicrobial activity of ACP were also examined. Antibiofilm activity was assessed for E. coli, L. monocytogenes and S. aureus in terms of reduction of culturability and retention of metabolic activity using colony count and XTT assays, respectively. All samples were treated 'inpack' using sealed polypropylene containers with a high voltage dielectric barrier discharge ACP generated at 80 kV for 0, 60, 120 and 300 s and a post treatment storage time of 24 h. According to colony counts, ACP treatment for 60 s reduced populations of E. coli to undetectable levels, whereas 300 s was necessary to significantly reduce populations of L. monocytogenes and S. aureus biofilms. The results obtained from XTT assay indicated possible induction of viable but non culturable state of bacteria. With respect to P. aeruginosa QS-related virulence factors, the production of pyocyanin was significantly inhibited after short treatment times, but reduction of elastase was notable only after 300 s and no reduction in actual biofilm formation was achieved post-ACP treatment. Importantly, reduction of virulence factors was associated with reduction of the cytotoxic effects of the bacterial supernatant on CHO-K1 cells, regardless of mode and duration of treatment. The results of this study point to ACP technology as an effective strategy for inactivation of established biofilms and may play an important role in attenuation of virulence of pathogenic bacteria. Further investigation is warranted to propose direct evidence

Utilising advance care planning videos to empower perioperative cancer patients and families: a study protocol of a randomised controlled trial.

Science.gov (United States)

Aslakson, Rebecca A; Isenberg, Sarina R; Crossnohere, Norah L; Conca-Cheng, Alison M; Yang, Ting; Weiss, Matthew; Volandes, Angelo E; Bridges, John F P; Roter, Debra L

2017-06-06

Despite positive health outcomes associated with advance care planning (ACP), little research has investigated the impact of ACP in surgical populations. Our goal is to evaluate how an ACP intervention video impacts the patient centredness and ACP of the patient-surgeon conversation during the presurgical consent visit. We hypothesise that patients who view the intervention will engage in a more patient-centred communication with their surgeons compared with patients who view a control video. Randomised controlled superiority trial of an ACP video with two study arms (intervention ACP video and control video) and four visits (baseline, presurgical consent, postoperative 1 week and postoperative 1 month). Surgeons, patients, principal investigator and analysts are blinded to the randomisation assignment. Single, academic, inner city and tertiary care hospital. Data collection began July 16, 2015 and continues to March 2017. Patients recruited from nine surgical oncology clinics who are undergoing major cancer surgery. In the intervention arm, patients view a patient preparedness video developed through extensive engagement with patients, surgeons and other stakeholders. Patients randomised to the control arm viewed an informational video about the hospital surgical programme. Primary Outcome: Patient centredness and ACP of patient-surgeon conversations during the presurgical consent visit as measured through the Roter Interaction Analysis System. patient Hospital Anxiety and Depression Scale score; patient goals of care; patient, companion and surgeon satisfaction; video helpfulness; medical decision maker designation; and the frequency patients watch the video. Intent-to-treat analysis will be used to assess the impact of video assignment on outcomes. Sensitivity analyses will assess whether there are differential effects contingent on patient or surgeon characteristics. This study has been approved by the Johns Hopkins School of Medicine institutional review

Disinfection of fresh chicken breast fillets with in-package atmospheric cold plasma: effect of treatment voltage and time

Science.gov (United States)

Effects of treatment voltage and time of in-package atmospheric cold plasma (ACP) were studied on ozone formation, microbiological quality, surface color, and pH of fresh chicken fillets. Samples were sealed in food trays in air, treated with a dielectric-barrier-discharge (DBD) ACP system, and stor...

Thoughts on the future. The perspectives of people with early-stage Alzheimer's disease and the implications for advance care planning.

NARCIS (Netherlands)

de Boer, M.E.; Dröes, R.M.; Jonker, C.; Eefsting, J.A.; Hertogh, C.M.P.M.

2012-01-01

Background: Early diagnosis in dementia is promoted to allow patients to engage in advance care planning (ACP) while still competent to do so and thereby to extend their autonomy into futures in which they lack decision-making capacity. However, engagement of people with dementia in ACP lags behind.

Tartrate-resistant acid phosphatase (TRAP/ACP5) promotes metastasis-related properties via TGFβ2/TβR and CD44 in MDA-MB-231 breast cancer cells.

Science.gov (United States)

Reithmeier, Anja; Panizza, Elena; Krumpel, Michael; Orre, Lukas M; Branca, Rui M M; Lehtiö, Janne; Ek-Rylander, Barbro; Andersson, Göran

2017-09-15

Tartrate-resistant acid phosphatase (TRAP/ACP5), a metalloenzyme that is characteristic for its expression in activated osteoclasts and in macrophages, has recently gained considerable focus as a driver of metastasis and was associated with clinically relevant parameters of cancer progression and cancer aggressiveness. MDA-MB-231 breast cancer cells with different TRAP expression levels (overexpression and knockdown) were generated and characterized for protein expression and activity levels. Functional cell experiments, such as proliferation, migration and invasion assays were performed as well as global phosphoproteomic and proteomic analysis was conducted to connect molecular perturbations to the phenotypic changes. We identified an association between metastasis-related properties of TRAP-overexpressing MDA-MB-231 breast cancer cells and a TRAP-dependent regulation of Transforming growth factor (TGFβ) pathway proteins and Cluster of differentiation 44 (CD44). Overexpression of TRAP increased anchorage-independent and anchorage-dependent cell growth and proliferation, induced a more elongated cellular morphology and promoted cell migration and invasion. Migration was increased in the presence of the extracellular matrix (ECM) proteins osteopontin and fibronectin and the basement membrane proteins collagen IV and laminin I. TRAP-induced properties were reverted upon shRNA-mediated knockdown of TRAP or treatment with the small molecule TRAP inhibitor 5-PNA. Global phosphoproteomics and proteomics analyses identified possible substrates of TRAP phosphatase activity or signaling intermediates and outlined a TRAP-dependent regulation of proteins involved in cell adhesion and ECM organization. Upregulation of TGFβ isoform 2 (TGFβ2), TGFβ receptor type 1 (TβR1) and Mothers against decapentaplegic homolog 2 (SMAD2), as well as increased intracellular phosphorylation of CD44 were identified upon TRAP perturbation. Functional antibody-mediated blocking and chemical

Noninvasive Localization of Accessory Pathways in Wolff-Parkinson-White Syndrome by Three-Dimensional Speckle Tracking Echocardiography.

Science.gov (United States)

Ishizu, Tomoko; Seo, Yoshihiro; Igarashi, Miyako; Sekiguchi, Yukio; Machino-Ohtsuka, Tomoko; Ogawa, Kojiro; Kuroki, Kenji; Yamamoto, Masahiro; Nogami, Akihiko; Kawakami, Yasushi; Aonuma, Kazutaka

2016-06-01

We have developed a noninvasive isochrone activation imaging (AI) system with 3-dimensional (3D) speckle tracking echocardiography (STE), which allows visualization of the wavefront image of mechanical propagation of the accessory pathway (ACP) in Wolff-Parkinson-White syndrome. Patients with manifest Wolff-Parkinson-White syndrome were imaged in 3D-STE AI mode, which quantified the time from QRS onset to regional endocardial deformation. In 2 patients with left- and right-side ACP, we confirmed that intraoperative contact endocardial electric mapping and the 3D-STE AI system showed comparable images pre- and postablation. In normal heart assessment by 3D-echo AI, the earliest activation sites were found at the attachment of the papillary muscles in the left ventricle and midseptum in the right ventricle, and none showed earliest activation at the peri-atrioventricular valve annuli. An analyzer who was unaware of the clinical information assessed 39 ACP locations in 38 Wolff-Parkinson-White syndrome patients using 3D-STE. All showed abnormal perimitral or tricuspid annular activations, and the location of 34 ACP (87%) showed agreement with the successful ablation sites within a 2-o'clock range. Especially for left free wall ACP, 17/18 (94%) showed consistency with the ablation site within a 2 o'clock range. Among 15 ACP at the ventricular septum, 9 (60%) showed early local activation in both right and left sides of the septum. Isochrone AI with 3D-STE may be a promising noninvasive imaging tool to assess cardiac synchronized activation in normal hearts and detect abnormal breakthrough of mechanical activation from both atrioventricular annuli in Wolff-Parkinson-White syndrome. © 2016 American Heart Association, Inc.

Public Opinion Regarding Financial Incentives to Engage in Advance Care Planning and Complete Advance Directives.

Science.gov (United States)

Auriemma, Catherine L; Chen, Lucy; Olorunnisola, Michael; Delman, Aaron; Nguyen, Christina A; Cooney, Elizabeth; Gabler, Nicole B; Halpern, Scott D

2017-09-01

The Centers for Medicare & Medicaid Services (CMS) recently instituted physician reimbursements for advance care planning (ACP) discussions with patients. To measure public support for similar programs. Cross-sectional online and in-person surveys. English-speaking adults recruited at public parks in Philadelphia, Pennsylvania, from July to August 2013 and online through survey sampling international Web-based recruitment platform in July 2015. Participants indicated support for 6 programs designed to increase advance directive (AD) completion or ACP discussion using 5-point Likert scales. Participants also indicated how much money (US$0-US$1000) was appropriate to incentivize such behaviors, compared to smoking cessation or colonoscopy screening. We recruited 883 participants: 503 online and 380 in-person. The status quo of no systematic approach to motivate AD completion was supported by 67.0% of participants (63.9%-70.1%). The most popular programs were paying patients to complete ADs (58.0%; 54.5%-61.2%) and requiring patients to complete ADs or declination forms for health insurance (54.1%; 50.8%-57.4%). Participants more commonly supported paying patients to complete ADs than paying physicians whose patients complete ADs (22.6%; 19.8%-25.4%) or paying physicians who document ACP discussions (19.1%; 16.5%-21.7%; both P < .001). Participants supported smaller payments for AD completion and ACP than for obtaining screening colonoscopies or stopping smoking. Americans view payments for AD completion or ACP more skeptically than for other health behaviors and prefer that such payments go to patients rather than physicians. The current CMS policy of reimbursing physicians for ACP conversations with patients was the least preferred of the programs evaluated.

The increasing of enamel calcium level after casein phosphopeptideamorphous calcium phosphate covering

Directory of Open Access Journals (Sweden)

Widyasri Prananingrum

2012-06-01

Full Text Available Background: Caries process is characterized by the presence of demineralization. Demineralization is caused by organic acids as a result of carbohydrate substrate fermentation. Remineralization is a natural repair process for non-cavitated lesions. Remineralization occurs if there are Ca2+ and PO43- ions in sufficient quantities. Casein-amorphous calcium phosphate phosphopeptide (CPP-ACP is a paste material containing milk protein (casein, that actually contains minerals, such as calcium and phosphate. The casein ability to stabilize calcium phosphate and enhance mineral solubility and bioavailability confers upon CPP potential to be biological delivery vehicles for calcium and phosphate. Purpose: The aim of this study was to determine the calcium levels in tooth enamel after being covered with CPP-ACP 2 times a day for 3, 14 and 28 days. Methods: Sample were bovine incisors of 3 year old cows divided into 4 groups, namely group I as control group, group II, III and IV as treatment groups covered with CPP-ACP 2 times a day. All of those teeth were then immersed in artificial saliva. Group II was immersed for 3 days, while group III was immersed for 14 days, and group IV was immersed for 28 days. One drop of CPP-ACP was used to cover the entire labial surface of teeth. The measurement of the calcium levels was then conducted by using titration method. All data were analyzed by One- Way ANOVA test with 5% degree of confidence. Results: The results showed significant difference of the calcium levels in tooth enamel of those groups after covered with CPP-ACP 2 times a day for 3, 14 and 28 days (p = 0.001. There is also significant difference of the calcium levels in tooth enamel of those treatment groups and the control group (p = 0.001. Conclusion: The calcium levels of tooth enamel are increased after covered with CPP-ACP 2 times a day for 3, 14 and 28 days.Latar belakang: Proses terjadinya karies gigi ditandai oleh adanya demineralisasi

Methodological study of radionuclide tomographic phase analysis in localization of accessory conduction pathway in patients with wolff-parkinson-white syndrome

International Nuclear Information System (INIS)

Wo Jinshan; Zhu Junren; Li Zhishan

1994-01-01

In this study, the methodology of tomographic phase analysis to detect the site of accessory conduction pathway (ACP) in patients with Wolff-Parkinson-White syndrome was presented. We analyzed the major factors that affect image reconstruction, selection of tomographic planes and phase analysis, also discussed the key step for reconstruction short-axial section that parallel and closest to the level of atrio-ventricular rings. Of five patients undergoing this procedure prior to surgery, tomographic phase analysis correctly identified the site of ACP confirmed by epicardial mapping in all of the five patients. Our results suggest this approach to be an objective, clear and correct one for localizing ACP

Molecular pathology of adamantinomatous craniopharyngioma: review and opportunities for practice.

Science.gov (United States)

Apps, John Richard; Martinez-Barbera, Juan Pedro

2016-12-01

Since the first identification of CTNNB1 mutations in adamantinomatous craniopharyngioma (ACP), much has been learned about the molecular pathways and processes that are disrupted in ACP pathogenesis. To date this understanding has not translated into tangible patient benefit. The recent development of novel techniques and a range of preclinical models now provides an opportunity to begin to support treatment decisions and develop new therapeutics based on molecular pathology. In this review the authors summarize many of the key findings and pathways implicated in ACP pathogenesis and discuss the challenges that need to be tackled to translate these basic science findings for the benefit of patients.

Trends in advance care planning in cancer patients: Results from a national, longitudinal survey

Science.gov (United States)

Narang, Amol K.; Wright, Alexi A.; Nicholas, Lauren H.

2015-01-01

Importance Advance care planning (ACP) may prevent end-of-life (EOL) care that is non-beneficial and discordant with patient wishes. Despite long-standing recognition of the merits of ACP in oncology, it is unclear whether cancer patients’ participation in ACP has increased over time. Objective To characterize trends in durable power of attorney (DPOA) assignment, living will creation, and participation in discussions of EOL care preferences, and to explore associations between ACP subtypes and EOL treatment intensity, as reflected in EOL care decisions and terminal hospitalizations. Design Prospectively collected survey data from the Health and Retirement Study (HRS), including data from in-depth “exit” interviews conducted with next-of-kin surrogates following the death of an HRS participant. Trends in ACP subtypes were tested, and multivariable logistic regression models examined associations between ACP subtypes and measures of treatment intensity. Setting HRS, a nationally representative, biennial, longitudinal panel study of U.S. residents over age 50. Participants 1,985 next-of-kin surrogates of HRS participants with cancer who died between 2000 and 2012. Main Outcome and Measures Trends in the surrogate-reported frequency of DPOA assignment, living will creation, and participation in discussions of EOL care preferences, as well as associations between ACP subtypes and surrogate-reported EOL care decisions/terminal hospitalizations. Results From 2000-2012, there was an increase in DPOA assignment (52% to 74%, p=0.03), without change in use of living wills (49% to 40%, p=0.63) or EOL discussions (68% to 60%, p=0.62). Surrogates increasingly reported that patients received “all care possible” at EOL (7% to 58%, p=0.004), and rates of terminal hospitalizations were unchanged (29% to 27%, p=0.70). Both living wills and EOL discussions were associated with limiting/withholding treatment [living will: adjusted odds ratio (AOR)=2.51, 95% confidence

Patient autonomy and advance care planning: a qualitative study of oncologist and palliative care physicians' perspectives.

Science.gov (United States)

Johnson, Stephanie B; Butow, Phyllis N; Kerridge, Ian; Tattersall, Martin H N

2018-02-01

Patients' are encouraged to participate in advance care planning (ACP) in order to enhance their autonomy. However, controversy exists as to what it means to be autonomous and there is limited understanding of how social and structural factors may influence cancer patients' ability to exercise their autonomy. The objective of this study is to explore oncologists' and palliative care physicians' understanding of patient autonomy, how this influences reported enactment of decision-making at the end of life (EOL), and the role of ACP in EOL care. Qualitative semi-structured interviews were conducted with consultant oncologists (n = 11) and palliative medicine doctors (n = 7) working in oncology centres and palliative care units across Australia. We found that doctors generally conceptualized autonomy in terms of freedom from interference but that there was a profound disconnect between this understanding of autonomy and clinical practice in EOL decision-making. The clinicians in our study privileged care, relationships and a 'good death' above patient autonomy, and in practice were reluctant to 'abandon' their patients to total non-interference in decision-making. Patient autonomy in healthcare is bounded, as while patients were generally encouraged to express their preferences for care, medical norms about the quality and 'reasonableness' of care, the availability of services and the patients' family relationships act to enhance or limit patients' capacity to realize their preferences. While for many, this disconnect between theory and practice did not diminish the rhetorical appeal of ACP; for others, this undermined the integrity of ACP, as well as its relevance to care. For some, ACP had little to do with patient autonomy and served numerous other ethical, practical and political functions. The ethical assumptions regarding patient autonomy embedded in academic literature and policy documents relating to ACP are disconnected from the realities of clinical care

Análisis del impacto de los principales museos de Asia

OpenAIRE

HUA, SAI

2015-01-01

[EN] Today, Museum and Institutions have tried to adapt the change of society and technology, and the social networks are the best way to create this environment. In recent years, Western museums and Institutions have been connected with social networks for getting more diffusion. But in Asia, the implementation of these social networks, due to the political, economic and social requirements, Asia has their own social networks, in the interest for increasing the social branch between its inha...

Does Teaching Experience Matter? Examining Biology Teachers' Prior Knowledge for Teaching in an Alternative Certification Program

Science.gov (United States)

Friedrichsen, Patricia J.; Abell, Sandra K.; Pareja, Enrique M.; Brown, Patrick L.; Lankford, Deanna M.; Volkmann, Mark J.

2009-01-01

Alternative certification programs (ACPs) have been proposed as a viable way to address teacher shortages, yet we know little about how teacher knowledge develops within such programs. The purpose of this study was to investigate prior knowledge for teaching among students entering an ACP, comparing individuals with teaching experience to those…

Occult Metabolic Bone Disease in Chronic Pancreatitis | Hari Kumar ...

African Journals Online (AJOL)

Background: Chronic pancreatitis (CP) leads to malabsorption and metabolic bone disease (MBD). Alcoholic CP (ACP) and tropical CP (TCP) are the two common types of CP. Objective: We investigated the presence of occult MBD in patients with CP and compared the same between ACP and TCP. Materials and Methods: ...

Combining casein phosphopeptide-amorphous calcium phosphate with fluoride: synergistic remineralization potential of artificially demineralized enamel or not?

Science.gov (United States)

Elsayad, Iman; Sakr, Amal; Badr, Yahia

2009-07-01

Recaldent is a product of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP). The remineralizing potential of CPP-ACP per se, or when combined with 0.22% Fl gel on artificially demineralized enamel using laser florescence, is investigated. Mesial surfaces of 15 sound human molars are tested using a He-Cd laser beam at 441.5 nm with 18-mW power as an excitation source on a suitable setup based on a Spex 750-M monochromator provided with a photomultiplier tube (PMT) for detection of collected autofluorescence from sound enamel. Mesial surfaces are subjected to demineralization for ten days. The spectra from demineralized enamel are measured. Teeth are divided into three groups according to the remineralizing regimen: group 1 Recaldent per se, group 2 Recaldent combined with fluoride gel and ACP, and group 3 artificial saliva as a positive control. After following these protocols for three weeks, the spectra from the remineralized enamel are measured. The spectra of enamel autofluorescence are recorded and normalized to peak intensity at about 540 nm to compare spectra from sound, demineralized, and remineralized enamel surfaces. A slight red shift occurred in spectra from demineralized enamel, while a blue shift may occur in remineralized enamel. Group 2 shows the highest remineralizing potential. Combining fluoride and ACP with CPP-ACP can give a synergistic effect on enamel remineralization.

A Biotin Biosynthesis Gene Restricted to Helicobacter

Science.gov (United States)

Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.

2016-01-01

In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423

Nonsteroidal Selective Androgen Receptor Modulators and Selective Estrogen Receptor β Agonists Moderate Cognitive Deficits and Amyloid-β Levels in a Mouse Model of Alzheimer’s Disease

Science.gov (United States)

2013-01-01

Decreases of the sex steroids, testosterone and estrogen, are associated with increased risk of Alzheimer’s disease. Testosterone and estrogen supplementation improves cognitive deficits in animal models of Alzheimer’s disease. Sex hormones play a role in the regulation of amyloid-β via induction of the amyloid-β degrading enzymes neprilysin and insulin-degrading enzyme. To mimic the effect of dihydrotestosterone (DHT), we administered a selective androgen receptor agonist, ACP-105, alone and in combination with the selective estrogen receptor β (ERβ) agonist AC-186 to male gonadectomized triple transgenic mice. We assessed long-term spatial memory in the Morris water maze, spontaneous locomotion, and anxiety-like behavior in the open field and in the elevated plus maze. We found that ACP-105 given alone decreases anxiety-like behavior. Furthermore, when ACP-105 is administered in combination with AC-186, they increase the amyloid-β degrading enzymes neprilysin and insulin-degrading enzyme and decrease amyloid-β levels in the brain as well as improve cognition. Interestingly, the androgen receptor level in the brain was increased by chronic treatment with the same combination treatment, ACP-105 and AC-186, not seen with DHT or ACP-105 alone. Based on these results, the beneficial effect of the selective ERβ agonist as a potential therapeutic for Alzheimer’s disease warrants further investigation. PMID:24020966

Quantitative analysis of zopiclone, N-desmethylzopiclone, zopiclone N-oxide and 2-amino-5-chloropyridine in urine using LC-MS-MS.

Science.gov (United States)

Nilsson, Gunnel H; Kugelberg, Fredrik C; Ahlner, Johan; Kronstrand, Robert

2014-01-01

A simple liquid chromatography-tandem mass spectrometry method was validated to allow determination of zopiclone (ZOP), N-desmethylzopiclone (NDZOP), zopiclone N-oxide (ZOPNO) and 2-amino-5-chloropyridine (ACP) in urine at concentrations up to 3,000 ng/mL within 3.5 min. This method was used for quantitative analysis of the analytes in authentic urine samples obtained 10 h after oral administration of zopiclone (Imovane(®)) and in aliquots of the same urine samples after different storage conditions. In addition, pH of each studied urine sample was measured over time. The results showed that formation of ACP occurred at elevated pH and/or temperature by degradation of ZOP, NDZOP and ZOPNO. This method was also applied to samples obtained from two female victims of drug-facilitated assault. One sample had been exposed to long-term storage conditions at different temperatures and at pH >8.2, which resulted in high concentrations of ACP. The other sample, which was exposed to pH urine, time of storage and/or the temperature conditions. For correct interpretation in forensic cases, ZOP, its major metabolites and ACP should be analyzed. When ACP is identified in urine, the concentrations of ZOP, NDZOP and ZOPNO should be interpreted with great caution. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Incremental cost of implementing residual insecticide treatment with delthametrine on top of intensive routine Aedes aegypti control.

Science.gov (United States)

Baly, Alberto; Gonzalez, Karelia; Cabrera, Pedro; Popa, Julio C; Toledo, Maria E; Hernandez, Claudia; Montada, Domingo; Vanlerberghe, Veerle; Van der Stuyft, Patrick

2016-05-01

Information on the cost of implementing residual insecticide treatment (RIT) for Aedes control is scarce. We evaluated the incremental cost on top of intensive conventional routine activities of the Aedes control programme (ACP) in the city of Santiago de Cuba, Cuba. We conducted the cost analysis study in 2011-2012, from the perspective of the ACP. Data sources were bookkeeping records, activity registers of the Provincial ACP Centre and the accounts of an RIT implementation study in 21 clusters of on average four house blocks comprising 5180 premises. The annual cost of the routine ACP activities was 19.66 US$ per household. RIT applications in rounds at 4-month intervals covering, on average, 97.2% and using 8.5 g of delthametrine annually per household, cost 3.06 US$ per household per year. Delthametrine comprised 66.5% of this cost; the additional cost for deploying RIT comprised 15.6% of the total ACP routine cost and 27% of the cost related to routine adult stage Aedes control. The incremental cost of implementing RIT is high. It should be weighed against the incremental effect on the burden caused by the array of pathogens transmitted by Aedes. The cost could be reduced if the insecticide became cheaper, by limiting the number of yearly applications or by targeting transmission hot spots. © 2016 John Wiley & Sons Ltd.

[Truth telling and advance care planning at the end of life].

Science.gov (United States)

Hu, Wen-Yu; Yang, Chia-Ling

2009-02-01

One of the core values in terminal care the respect of patient 'autonomy'. This essay begins with a discussion of medical ethics principles and the Natural Death Act in Taiwan and then summarizes two medical ethical dilemmas, truth telling and advance care planning (ACP), faced in the development of hospice and palliative care in Taiwan. The terminal truth telling process incorporates the four basic principles of Assessment and preparation, Communication with family, Truth-telling process, and Support and follow up (the so-called "ACTs"). Many experts suggest practicing ACP by abiding by the following five steps: (1) presenting and illustrating topics; (2) facilitating a structured discussion; (3) completing documents with advanced directives (ADs); (4) reviewing and updating ADs; and (5) applying ADs in clinical circumstances. Finally, the myths and challenges in truth telling and ADs include the influence of healthcare system procedures and priorities, inadequate communication skills, and the psychological barriers of medical staffs. Good communication skills are critical to truth telling and ACP. Significant discussion about ACP should help engender mutual trust between patients and the medical staffs who take the time to establish such relationships. Promoting patient autonomy by providing the opportunity of a good death is an important goal of truth telling and ACP in which patients have opportunities to choose their terminal treatment.

Characterization of the "Escherichia Coli" Acyl Carrier Protein Phosphodiesterase

Science.gov (United States)

Thomas, Jacob

2009-01-01

Acyl carrier protein (ACP) is a small essential protein that functions as a carrier of the acyl intermediates of fatty acid synthesis. ACP requires the posttranslational attachment of a 4'phosphopantetheine functional group, derived from CoA, in order to perform its metabolic function. A Mn[superscript 2+] dependent enzymatic activity that removes…

Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

Directory of Open Access Journals (Sweden)

Navisha Dookie

2016-10-01

Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

Exogenous fatty acid metabolism in bacteria.

Science.gov (United States)

Yao, Jiangwei; Rock, Charles O

2017-10-01

Bacterial type II fatty acid synthesis (FASII) is a target for novel antibiotic development. All bacteria encode for mechanisms to incorporate exogenous fatty acids, and some bacteria can use exogenous fatty acids to bypass FASII inhibition. Bacteria encode three different mechanisms for activating exogenous fatty acids for incorporation into phospholipid synthesis. Exogenous fatty acids are converted into acyl-CoA in Gammaproteobacteria such as E. coli. Acyl-CoA molecules constitute a separate pool from endogenously synthesized acyl-ACP. Acyl-CoA can be used for phospholipid synthesis or broken down by β-oxidation, but cannot be used for lipopolysaccharide synthesis. Exogenous fatty acids are converted into acyl-ACP in some Gram-negative bacteria. The resulting acyl-ACP undergoes the same fates as endogenously synthesized acyl-ACP. Exogenous fatty acids are converted into acyl-phosphates in Gram-positive bacteria, and can be used for phospholipid synthesis or become acyl-ACP. Only the order Lactobacillales can use exogenous fatty acids to bypass FASII inhibition. FASII shuts down completely in presence of exogenous fatty acids in Lactobacillales, allowing Lactobacillales to synthesize phospholipids entirely from exogenous fatty acids. Inhibition of FASII cannot be bypassed in other bacteria because FASII is only partially down-regulated in presence of exogenous fatty acid or FASII is required to synthesize essential metabolites such as β-hydroxyacyl-ACP. Certain selective pressures such as FASII inhibition or growth in biofilms can select for naturally occurring one step mutations that attenuate endogenous fatty acid synthesis. Although attempts have been made to estimate the natural prevalence of these mutants, culture-independent metagenomic methods would provide a better estimate. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Development of spent fuel remote handling technology

Energy Technology Data Exchange (ETDEWEB)

Park, B. S.; Yoon, J. S.; Hong, H. D. (and others)

2007-02-15

In this research, the remote handling technology was developed for the ACP application. The ACP gives a possible solution to reduce the rapidly cumulative amount of spent fuels generated from the nuclear power plants in Korea. The remote technologies developed in this work are a slitting device, a voloxidizer, a modified telescopic servo manipulator and a digital mock-up. A slitting device was developed to declad the spent fuel rod-cuts and collect the spent fuel UO{sub 2} pellets. A voloxidizer was developed to convert the spent fuel UO{sub 2} pellets obtained from the slitting process in to U{sub 3}O{sub 8} powder. Experiments were performed to test the capabilities and remote operation of the developed slitting device and voloxidizer by using simulated rod-cuts and fuel in the ACP hot cell. A telescopic servo manipulator was redesigned and manufactured improving the structure of the prototype. This servo manipulator was installed in the ACP hot cell, and the target module for maintenance of the process equipment was selected. The optimal procedures for remote operation were made through the maintenance tests by using the servo manipulator. The ACP digital mockup in a virtual environment was established to secure a reliability and safety of remote operation and maintenance. The simulation for the remote operation and maintenance was implemented and the operability was analyzed. A digital mockup about the preliminary conceptual design of an enginnering-scale ACP was established, and an analysis about a scale of facility and remote handling was accomplished. The real-time diagnostic technique was developed to detect the possible fault accidents of the slitting device. An assessment of radiation effect for various sensors was also conducted in the radiation environment.

Behavioral, Ultrastructural and Chemical Studies on the Honeydew and Waxy Secretions by Nymphs and Adults of the Asian Citrus Psyllid Diaphorina citri (Hemiptera: Psyllidae)

Science.gov (United States)

Ammar, El-Desouky; Alessandro, Rocco; Shatters Jr, Robert G.; Hall, David G.

2013-01-01

The Asian citrus psyllid (ACP), Diaphorina citri (Hemiptera: Psyllidae) is the primary vector of the bacterium causing citrus huanglongbing (citrus greening), the most serious disease of citrus worldwide. Psyllids and other hemipterans produce large amounts of honeydew, which has been used previously as an indicator of phloem sap composition and insect feeding or metabolism. Behavioral, ultrastructural and chemical studies on ACP, its honeydew and waxy secretions showed important differences between nymphs, males and females, and suggested some mechanisms by which the psyllids, especially nymphs and adult females, can minimize their contamination with honeydew excretions. The anal opening in ACP, near the posterior end of the abdomen, is on the ventral side in nymphs and on the dorsal side in adult males and females. Video recordings showed that adult males produce clear sticky droplets of honeydew gently deposited behind their body on the leaf surface, whereas adult females produce whitish honeydew pellets powerfully propelled away from the female body, probably to get their excretions away from eggs and newly hatched nymphs. ACP nymphs produce long ribbons or tubes of honeydew that frequently stay attached to the exuviae after molting, or drop when feeding on the lower side of citrus leaves. Furthermore, honeydew excretions of both nymphs and adult females are covered with a thin layer of whitish waxy material ultrastructurally composed of a convoluted network of long fine filaments or ribbons. This material is extruded from intricate arrays of wax pores in the circumanal ring (around the anus) that is found in nymphs and females but not in males of ACP or other psyllid species. Infrared microscopy and mass spectroscopy revealed that, in addition to various sugars, honeydew excretions of ACP nymphs and females are covered with a thin layer of wax similar in profile to ester waxes. PMID:23762268

Safeguardability assessment on pilot-scale advanced spent fuel conditioning facility

International Nuclear Information System (INIS)

Lee, S.Y.; Li, T.K.; Pickett, S.E.; Miller, M.C.; Ko, W.I.; Kim, H.D.

2006-01-01

Full text: In South Korea, approximately 6,000 metric tons of spent nuclear fuel from commercial reactor operation has been accumulated with the expectation of more than 30,000 metric tons, three times the present storage capacity, by the end of 2040. To resolve these challenges in spent fuel management, the Korea Atomic Energy Research Institute (KAERI) has been developing a dry reprocessing technology called Advanced Spent Fuel Conditioning Process (ACP). This is an electrometallurgical treatment technique to convert oxide-type spent fuel into a metallic form, and the electrolytic reduction (ER) technology developed recently is known as a more efficient concept for spent fuel conditioning. The goal of the ACP study is to recover more than 99% of the actinide elements into a metallic form with minimizing the volume and heat load of spent fuel. The significant reduction of the volume and heat load of spent fuel is expected to lighten the burden of final disposal in terms of disposal size, safety, and economics. In the framework of R and D collaboration for the ACP safeguards, a joint study on the safeguardability of the ACP technology has been performed by the Los Alamos National Laboratory (LANL) and KAERI. The purpose of this study is to address the safeguardability of the ACP technology, through analysis of material flow and development of a proper safeguards system that meet IAEA's comprehensive safeguards objective. The sub-processes and material flow of the pilot-scale ACP facility were analyzed, and subsequently the relevant material balance area (MBA) and key measurement point (KMP) were designed for material accounting. The uncertainties in material accounting were also estimated with international target values, and design requirements for the material accounting systems were derived

Antegrade versus retrograde cerebral perfusion for hemiarch replacement with deep hypothermic circulatory arrest: does it matter? A propensity-matched analysis.

Science.gov (United States)

Ganapathi, Asvin M; Hanna, Jennifer M; Schechter, Matthew A; Englum, Brian R; Castleberry, Anthony W; Gaca, Jeffrey G; Hughes, G Chad

2014-12-01

The choice of cerebral perfusion strategy for aortic arch surgery has been debated, and the superiority of antegrade (ACP) or retrograde (RCP) cerebral perfusion has not been shown. We examined the early and late outcomes for ACP versus RCP in proximal (hemi-) arch replacement using deep hypothermic circulatory arrest (DHCA). A retrospective analysis of a prospectively maintained database was performed for all patients undergoing elective and nonelective hemiarch replacement at a single referral institution from June 2005 to February 2013. Total arch cases were excluded to limit the analysis to shorter DHCA times and a more uniform patient population for whom clinical equipoise regarding ACP versus RCP exists. A total of 440 procedures were identified, with 360 (82%) using ACP and 80 (18%) using RCP. The endpoints included 30-day/in-hospital and late outcomes. A propensity score with 1:1 matching of 40 pre- and intraoperative variables was used to adjust for differences between the 2 groups. All 80 RCP patients were propensity matched to a cohort of 80 similar ACP patients. The pre- and intraoperative characteristics were not significantly different between the 2 groups after matching. No differences were found in 30-day/in-hospital mortality or morbidity outcomes. The only significant difference between the 2 groups was a shorter mean operative time in the RCP cohort (P = .01). No significant differences were noted in late survival (P = .90). In proximal arch operations using DHCA, equivalent early and late outcomes can be achieved with RCP and ACP, although the mean operative time is significantly less with RCP, likely owing to avoidance of axillary cannulation. Questions remain regarding comparative outcomes with straight DHCA and lesser degrees of hypothermia. Copyright © 2014 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

Sampling Methods for Detection and Monitoring of the Asian Citrus Psyllid (Hemiptera: Psyllidae).

Science.gov (United States)

Monzo, C; Arevalo, H A; Jones, M M; Vanaclocha, P; Croxton, S D; Qureshi, J A; Stansly, P A

2015-06-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama is a key pest of citrus due to its role as vector of citrus greening disease or "huanglongbing." ACP monitoring is considered an indispensable tool for management of vector and disease. In the present study, datasets collected between 2009 and 2013 from 245 citrus blocks were used to evaluate precision, sensitivity for detection, and efficiency of five sampling methods. The number of samples needed to reach a 0.25 standard error-mean ratio was estimated using Taylor's power law and used to compare precision among sampling methods. Comparison of detection sensitivity and time expenditure (cost) between stem-tap and other sampling methodologies conducted consecutively at the same location were also assessed. Stem-tap sampling was the most efficient sampling method when ACP densities were moderate to high and served as the basis for comparison with all other methods. Protocols that grouped trees near randomly selected locations across the block were more efficient than sampling trees at random across the block. Sweep net sampling was similar to stem-taps in number of captures per sampled unit, but less precise at any ACP density. Yellow sticky traps were 14 times more sensitive than stem-taps but much more time consuming and thus less efficient except at very low population densities. Visual sampling was efficient for detecting and monitoring ACP at low densities. Suction sampling was time consuming and taxing but the most sensitive of all methods for detection of sparse populations. This information can be used to optimize ACP monitoring efforts. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Comparison of the sedative effects of nalbuphine and butorphanol, alone or in combination with acepromazine in dogs.

Science.gov (United States)

Gomes, Viviane H; Oliveira, Renato Ls; Marques, Juliana Lr; Coelho, Cassia Mm; Silva, Marta Fa

2018-01-01

To compare sedation and effects on heart rate (HR), mean arterial pressure (MAP) and respiratory rate (f R ) of nalbuphine and butorphanol, alone or combined with acepromazine in dogs. Prospective, randomized experimental trial. Eight healthy Beagle dogs, aged (mean ± standard deviation) 3.4 ± 0.5 years and weighing 11.0 ± 1.3 kg. Each dog was treated four times: physiological saline (1 mL) combined with nalbuphine (0.5 mg kg -1 ; SAL-NAL) or butorphanol (0.15 mg kg -1 ; SAL-BUT), and acepromazine (0.05 mg kg -1 ) combined with nalbuphine (0.5 mg kg -1 ; ACP-NAL) or butorphanol (0.15 mg kg -1 ; ACP-BUT), intravenously (IV). The degree of sedation, assessed by a numeric descriptive scale (NDS) and simple numerical scale (SNS), HR, MAP, f R and rectal temperature (RT), were recorded before and 20 minutes after administration of saline or acepromazine, then 15, 30, 60, 90 and 120 minutes after nalbuphine or butorphanol. Values were compared with baseline and among treatments. Mild sedation was recorded for SAL-NAL and SAL-BUT, and moderate sedation for ACP-NAL and ACP-BUT. NDS and SNS scores were higher for SAL-BUT and ACP-BUT at some time points when compared with SAL-NAL and ACP-NAL, respectively (p 0.5 °C) compared with SAL-NAL (38.0 ± 0.5 °C) at 60-120 minutes (p < 0.05). Butorphanol promoted a higher sedative effect than nalbuphine when alone and combined with acepromazine. IV administration of nalbuphine or butorphanol, with or without acepromazine, at the doses studied, resulted in minimal decreases in MAP, HR, f R and RT. Copyright © 2017. Published by Elsevier Ltd.

Stylet morphometrics and citrus leaf vein structure in relation to feeding behavior of the Asian citrus psyllid Diaphorina citri, vector of citrus huanglongbing bacterium.

Directory of Open Access Journals (Sweden)

El-Desouky Ammar

Full Text Available The Asian citrus psyllid (ACP, Diaphorina citri (Hemiptera: Psyllidae, is the primary vector of the phloem-limited bacterium Candidatus Liberibacter asiaticus (LAS associated with huanglongbing (HLB, citrus greening, considered the world's most serious disease of citrus. Stylet morphometrics of ACP nymphs and adults were studied in relation to citrus vein structure and to their putative (histologically verified feeding sites on Valencia orange leaves. ACP nymphs preferred to settle and feed on the lower (abaxial side of young leaves either on secondary veins or on the sides of the midrib, whereas adults preferred to settle and feed on the upper (adaxial or lower secondary veins of young or old leaves. Early instar nymphs can reach and probe the phloem probably because the distance to the phloem is considerably shorter in younger than in mature leaves, and is shorter from the sides of the midrib compared to that from the center. Additionally, the thick-walled 'fibrous ring' (sclerenchyma around the phloem, which may act as a barrier to ACP stylet penetration into the phloem, is more prominent in older than in younger leaves and in the center than on the sides of the midrib. The majority (80-90% of the salivary sheath termini produced by ACP nymphs and adults that reached a vascular bundle were associated with the phloem, whereas only 10-20% were associated with xylem vessels. Ultrastructural studies on ACP stylets and LAS-infected leaves suggested that the width of the maxillary food canal in first instar nymphs is wide enough for LAS bacteria to traverse during food ingestion (and LAS acquisition. However, the width of the maxillary salivary canal in these nymphs may not be wide enough to accommodate LAS bacteria during salivation (and LAS inoculation into host plants. This may explain the inability of early instar nymphs to transmit LAS/HLB in earlier reports.

Impact of different temperatures on survival and energy metabolism in the Asian citrus psyllid, Diaphorina citri Kuwayama.

Science.gov (United States)

El-Shesheny, Ibrahim; Hijaz, Faraj; El-Hawary, Ibrahim; Mesbah, Ibrahim; Killiny, Nabil

2016-02-01

Temperature influences the life history and metabolic parameters of insects. Asian citrus psyllid (ACP), Diaphorina citri is a tropical and subtropical pest. ACP invaded new regions around the world and threatened the citrus industry as a vector for Huanglongbing (HLB) disease. ACP is widely distributed and can survive high (up to 45 °C) and low temperatures (as low as -6 °C). The precise mechanism of temperature tolerance in ACP is poorly understood. We investigated adult survival, cellular energy balance, gene expression, and nucleotide and sugar-nucleotide changes under the effect of different temperature regimes (0 °C to 45 °C with 5 °C intervals). The optimum temperatures for survival were 20 and 25 °C. Low temperatures of 0 °C and 5 °C caused 50% mortality after 2 and 4 days respectively, while one day at high temperature (40 °C and 45 °C) caused more than 95% mortality. The lowest quantity of ATP (3.69 ± 1.6 ng/insect) and the maximum ATPase enzyme activities (57.43 ± 7.6 μU/insect) were observed at 25 °C. Correlation between ATP quantities and ATPase activity was negative. Gene expression of hsp 70, V-type proton ATPase catalytic subunit A and ATP synthase α subunit matched these results. Twenty-four nucleotides and sugar-nucleotides were quantified using HPLC in ACP adults maintained at low, high, and optimum temperatures. The nucleotide profiles were different among treatments. The ratios between AMP:ATP and ADP:ATP were significantly decreased and positively correlated to adults survival, whereas the adenylate energy charge was increased in response to low and high temperatures. Exploring energy metabolic regulation in relation with adult survival might help in understanding the physiological basis of how ACP tolerates newly invaded regions. Copyright © 2015 Elsevier Inc. All rights reserved.

Behavioral, ultrastructural and chemical studies on the honeydew and waxy secretions by nymphs and adults of the Asian citrus psyllid Diaphorina citri (Hemiptera: Psyllidae.

Directory of Open Access Journals (Sweden)

El-Desouky Ammar

Full Text Available The Asian citrus psyllid (ACP, Diaphorina citri (Hemiptera: Psyllidae is the primary vector of the bacterium causing citrus huanglongbing (citrus greening, the most serious disease of citrus worldwide. Psyllids and other hemipterans produce large amounts of honeydew, which has been used previously as an indicator of phloem sap composition and insect feeding or metabolism. Behavioral, ultrastructural and chemical studies on ACP, its honeydew and waxy secretions showed important differences between nymphs, males and females, and suggested some mechanisms by which the psyllids, especially nymphs and adult females, can minimize their contamination with honeydew excretions. The anal opening in ACP, near the posterior end of the abdomen, is on the ventral side in nymphs and on the dorsal side in adult males and females. Video recordings showed that adult males produce clear sticky droplets of honeydew gently deposited behind their body on the leaf surface, whereas adult females produce whitish honeydew pellets powerfully propelled away from the female body, probably to get their excretions away from eggs and newly hatched nymphs. ACP nymphs produce long ribbons or tubes of honeydew that frequently stay attached to the exuviae after molting, or drop when feeding on the lower side of citrus leaves. Furthermore, honeydew excretions of both nymphs and adult females are covered with a thin layer of whitish waxy material ultrastructurally composed of a convoluted network of long fine filaments or ribbons. This material is extruded from intricate arrays of wax pores in the circumanal ring (around the anus that is found in nymphs and females but not in males of ACP or other psyllid species. Infrared microscopy and mass spectroscopy revealed that, in addition to various sugars, honeydew excretions of ACP nymphs and females are covered with a thin layer of wax similar in profile to ester waxes.

Characteristics of antrochoanal polyps in the pediatric age group

International Nuclear Information System (INIS)

AlMazrou, Khalid A; Bukhari, Manal; AlFayez, Abdurhman I

2009-01-01

To evaluate and compare the clinical and the pathological characteristics of antrochoanal polyps (ACPS) in adults and children. Medical records of 35 patients (19 children, 16 adults) operated upon for ACPS between 1995 and 2005 at an academic tertiary center were reviewed retrospectively. Demographic characteristics, clinical presentation, surgical management, histological findings and recurrence rate were compared. Of the 35 patients, 19 (54%) were children (mean age, 12.6 years) and 16 (46%) were adults (mean age, 31.4 years). Nasal obstruction was the most common presenting symptom in both groups. The incidence of snoring and/or obstructive sleep apnea was statistically significant, more common among the pediatric age group as compared to the adult group ( P =.001). Epistaxis was also found to be more common among the pediatric age group ( P =.027), while sinusitis was noted to be significantly more common among the adult group ( P =.019).Transnasal endoscopic removal of ACPS was performed in 12 (63.1%) children and 11 (68.7%) adults. A combined open/endoscopic approach was required in 36.9% of children and 31.3% of adults. On histologic examination, allergic ACPS (the mucosal surface is respiratory epithelium, no mucus glands, abundant eosinophils) was more common than inflammatory ACPS (the mucosal surface is respiratory epithelium, no mucus glands, abundant neutrophils) in children (2.8:1) as compared to adults (0.8:1) ( P =.045). All of our patients were followed with endoscopic examination for a period ranging from 9 to 42 months (mean, 24 months). Recurrence of ACPS was identified in 2 children and 1 adult. Antrochoanal polyps are a rare clinical entity. Children have unique clinical and pathological features as compared to adults. Endoscopic excision is safe and effective in the pediatric age group and has the capability to ensure complete removal and lower recurrence rate. (author)

Engagement in Advance Care Planning and Surrogates' Knowledge of Patients' Treatment Goals.

Science.gov (United States)

Fried, Terri R; Zenoni, Maria; Iannone, Lynne; O'Leary, John; Fenton, Brenda T

2017-08-01

A key objective of advance care planning (ACP) is improving surrogates' knowledge of patients' treatment goals. Little is known about whether ACP outside of a trial accomplishes this. The objective was to examine patient and surrogate reports of ACP engagement and associations with surrogate knowledge of goals. Cohort study SETTING: Primary care in a Veterans Affairs Medical Center. 350 community-dwelling veterans age ≥55 years and the individual they would choose to make medical decisions on their behalf, interviewed separately. Treatment goals were assessed by veterans' ratings of 3 health states: severe physical disability, cognitive disability, and pain, as an acceptable or unacceptable result of treatment for severe illness. Surrogates had knowledge if they correctly predicted all 3 responses. Veterans and surrogates were asked about living will and health care proxy completion and communication about life-sustaining treatment and quality versus quantity of life (QOL). Over 40% of dyads agreed that the veteran had not completed a living will or health care proxy and that there was no QOL communication. For each activity, sizeable proportions (18-34%) disagreed about participation. In dyads who agreed QOL communication had occurred, 30% of surrogates had knowledge, compared to 21% in dyads who agreed communication had not occurred and 15% in dyads who disagreed (P = .01). This relationship persisted in multivariable analysis. Agreement about other ACP activities was not associated with knowledge. Disagreement about ACP participation was common. Agreement about communication regarding QOL was modestly associated with surrogate knowledge of treatment goals. Eliciting surrogates' perspectives is critical to ACP. Even dyads who agree about participation may need additional support for successful engagement. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

Biochemical changes in the kidney and liver of rats following administration of ethanolic extract of Psidium guajava leaves.

Science.gov (United States)

Adeyemi, O S; Akanji, M A

2011-09-01

Furtherance to a previous report on the anti-trypanosomal properties of Psidium guajava aqueous leaf extract in rats experimentally infected with Trypanosoma brucei brucei, we have evaluated the effects of the daily intraperitoneal administration of P. guajava leaf extract to rats on the activities of alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT) and acid phosphatase (ACP) in the kidney, liver and serum. The results obtained revealed that the administration of the extract produced significant increase in the serum activities of AST, ALT, ALP and ACP when compared with the control (p < 0.05). Also AST, ALT and ALP and ACP activities in the tissues of animals administered the extract revealed inconsistent changes (p < 0.05) relative to control. The increase in the serum activity of ALP may be an indicator that there was a likely compromise to the integrity of the plasma membrane as a result of the ethanolic extract administration. This could have caused leakages of the other enzymes investigated, which may explain the corresponding increases in the serum activities of AST, ALT and ACP observed.

Diagnosis of accessory conduction pathway using ECG-gated emission CT analysis. Studies in patients with WPW syndrome who underwent surgery

Energy Technology Data Exchange (ETDEWEB)

Misaki, Takuro; Mukai, Keiichi; Tsubota, Makoto; Iwa, Takashi; Nakajima, Ken-ichi; Hisada, Kin-ichi

1987-09-01

Pinpointing the location of accessory conduction pathway (ACP) is of great importance in the surgical treatment for Wolff-Parkinson-White (WPW) syndrome. For this purpose, this study explored the usefulness of ECG-gated emission computed tomography (Gated-ECT) in 30 patients who preoperatively underwent Gated-ECT. The site of earliest contraction at level of atrioventicular valves, obtained on tomographic phase analysis, was compared with the site of earliest activation, obtained on epicardial mapping during surgery. The concordance rate of the two methods was 94 % (28/30). Among them, one patient was found to have the association of corrected transposition of great arteries on Gated-ECT. Gated-ECT was, however, of limited value in differentiating right posterior ACP from right postseptal ACP. The discordance between the sites of earliest contraction and activation, which was observed in the two others, was likely due to decreased wall motion resulting from myocardial disturbance. Gated-ECT may have a diagnostic potential for the location of ACP, especially in view of providing images that corresponded to the surgical anatomy. (Namekawa, K.).

Diagnosis of accessory conduction pathway using ECG-gated emission CT analysis

International Nuclear Information System (INIS)

Misaki, Takuro; Mukai, Keiichi; Tsubota, Makoto; Iwa, Takashi; Nakajima, Ken-ichi; Hisada, Kin-ichi

1987-01-01

Pinpointing the location of accessory conduction pathway (ACP) is of great importance in the surgical treatment for Wolff-Parkinson-White (WPW) syndrome. For this purpose, this study explored the usefulness of ECG-gated emission computed tomography (Gated-ECT) in 30 patients who preoperatively underwent Gated-ECT. The site of earliest contraction at level of atrioventicular valves, obtained on tomographic phase analysis, was compared with the site of earliest activation, obtained on epicardial mapping during surgery. The concordance rate of the two methods was 94 % (28/30). Among them, one patient was found to have the association of corrected transposition of great arteries on Gated-ECT. Gated-ECT was, however, of limited value in differentiating right posterior ACP from right postseptal ACP. The discordance between the sites of earliest contraction and activation, which was observed in the two others, was likely due to decreased wall motion resulting from myocardial disturbance. Gated-ECT may have a diagnostic potential for the location of ACP, especially in view of providing images that corresponded to the surgical anatomy. (Namekawa, K.)

Preliminary assessment of safeguardability on the concepture design of advanced spent fuel conditioning process

Energy Technology Data Exchange (ETDEWEB)

Lee, Sang Yoon; Ha, Jang Ho; Ko, Won Il; Song, Dae Yong; Kim, Ho Dong

2003-04-01

In this report, a preliminary study on the safeguardability of ACP (Advanced spent fuel Conditioning Process) was conducted with Los Alamos National Laboratory. The proposed ACP concept is an electrometallurgical treatment technique to convert oxide-type spent nuclear fuels into metal forms, which can achieve significant reduction of the volume and heat load of spent fuel to be stored and disposed of. For the safeguardability analysis of the ACP facility, sub-processes and their KMPs (Key Measurement Points) were defined first, and then their material flows were analyzed. Finally, the standard deviation of the Inventory Difference (ID) value of the facility was estimated with assumption by assuming international target values for the uncertainty of measurement methods and their uncertainty. From the preliminary calculation, we concluded that if the assumptions regarding measurement instruments can be achieved in a safeguards system for the ACP facility, the safeguards goals of International Atomic Energy Agency (IAEA) could be met. In the second phase of this study, further study on sensitivity analyses considering various factors such as measurement errors, facility capacities, MBA periods etc. may be needed.

An Access Control Protocol for Wireless Sensor Network Using Double Trapdoor Chameleon Hash Function

Directory of Open Access Journals (Sweden)

Tejeshwari Thakur

2016-01-01

Full Text Available Wireless sensor network (WSN, a type of communication system, is normally deployed into the unattended environment where the intended user can get access to the network. The sensor nodes collect data from this environment. If the data are valuable and confidential, then security measures are needed to protect them from the unauthorized access. This situation requires an access control protocol (ACP in the design of sensor network because of sensor nodes which are vulnerable to various malicious attacks during the authentication and key establishment and the new node addition phase. In this paper, we propose a secured ACP for such WSN. This protocol is based on Elliptic Curve Discrete Log Problem (ECDLP and double trapdoor chameleon hash function which secures the WSN from malicious attacks such as node masquerading attack, replay attack, man-in-the-middle attack, and forgery attacks. Proposed ACP has a special feature known as session key security. Also, the proposed ACP is more efficient as it requires only one modular multiplication during the initialization phase.

Preliminary assessment of safeguardability on the concepture design of advanced spent fuel conditioning process

International Nuclear Information System (INIS)

Lee, Sang Yoon; Ha, Jang Ho; Ko, Won Il; Song, Dae Yong; Kim, Ho Dong

2003-04-01

In this report, a preliminary study on the safeguardability of ACP (Advanced spent fuel Conditioning Process) was conducted with Los Alamos National Laboratory. The proposed ACP concept is an electrometallurgical treatment technique to convert oxide-type spent nuclear fuels into metal forms, which can achieve significant reduction of the volume and heat load of spent fuel to be stored and disposed of. For the safeguardability analysis of the ACP facility, sub-processes and their KMPs (Key Measurement Points) were defined first, and then their material flows were analyzed. Finally, the standard deviation of the Inventory Difference (ID) value of the facility was estimated with assumption by assuming international target values for the uncertainty of measurement methods and their uncertainty. From the preliminary calculation, we concluded that if the assumptions regarding measurement instruments can be achieved in a safeguards system for the ACP facility, the safeguards goals of International Atomic Energy Agency (IAEA) could be met. In the second phase of this study, further study on sensitivity analyses considering various factors such as measurement errors, facility capacities, MBA periods etc. may be needed

Atomic force microscopic comparison of remineralization with casein-phosphopeptide amorphous calcium phosphate paste, acidulated phosphate fluoride gel and iron supplement in primary and permanent teeth: An in-vitro study

Directory of Open Access Journals (Sweden)

Nikita Agrawal

2014-01-01

Full Text Available Context: Demineralization of tooth by erosion is caused by frequent contact between the tooth surface and acids present in soft drinks. Aim: The present study objective was to evaluate the remineralization potential of casein-phosphopeptide-amorphous calcium phosphate (CPP-ACP paste, 1.23% acidulated phosphate fluoride (APF gel and iron supplement on dental erosion by soft drinks in human primary and permanent enamel using atomic force microscopy (AFM. Materials and Methods: Specimens were made from extracted 15 primary and 15 permanent teeth which were randomly divided into three treatment groups: CPP-ACP paste, APF gel and iron supplement. AFM was used for baseline readings followed by demineralization and remineralization cycle. Results and Statistics: Almost all group of samples showed remineralization that is a reduction in surface roughness which was higher with CPP-ACP paste. Statistical analysis was performed using by one-way ANOVA and Mann-Whitney U-test with P < 0.05. Conclusions: It can be concluded that the application of CPP-ACP paste is effective on preventing dental erosion from soft drinks.

Do older adults with Alzheimer's disease engage in estate planning and advance care planning preparation?

Science.gov (United States)

Choi, Shinae; Kim, Minjung; McDonough, Ian M

2018-04-18

This study investigated the estate planning and advance care planning (ACP) of older adults diagnosed with Alzheimer's disease (AD) for the presence of (1) a valid will, (2) a durable power of attorney for health care, and (3) a living will. We analyzed 10,273 adults aged 65 and older from the 2012 Health and Retirement Study (HRS) using multilevel logistic regression. We found that a diagnosis of AD was significantly associated with the ACP variables. Older adults with AD were more likely to assign a durable power of attorney for health care and have a written living will than older adults without an AD diagnosis. However, we found no significant association between a diagnosis of AD and having a valid will. These findings were robust when adjusting for demographic and socioeconomic variables. Other factors decreased engagement in estate planning and ACP, including lower socioeconomic status, being male, and being a minority. Our findings suggest that a diagnosis of AD is associated with more engagement in ACP for individuals and their families, but important barriers exist for people with fewer resources.

Facilitating advance care planning in community palliative care: conversation starters across the client journey.

Science.gov (United States)

Blackford, Jeanine; Street, Annette F

2013-03-01

This paper describes the development of a tool for palliative care nurses to initiate and facilitate advance care planning (ACP) conversations in community palliative care practice. Seven community palliative care services located across Australia participated in a multi-site action research project. Data included participant observation, individual and focus group interviews with palliative care health professionals, and medical record audit. A directed content analysis used a pre-established palliative care practice framework of referral, admission, ongoing management, and terminal/discharge care. From this framework a Conversation Starter Tool for ACP was developed. The Tool was then used in orientation and continuing nurse education programmes. It provided palliative care nurses the opportunity to introduce and progress ACP conversations.

Genotypic analysis of multidrug-resistant tuberculosis isolates from extra pulmonary tuberculosis cases in tertiary care centers in Northern India

Directory of Open Access Journals (Sweden)

Anand K Maurya

2016-01-01

Conclusion: The prevalence (13.4% of MDR-TB among EPTB was high, and the most prominent mutations in rpoB, katG, and inhA genes were S531L (67.3%, S315T1 (94.5%, and C15T (20%, respectively. Beijing stains are significantly associated with MDR-TB among EPTB in this region. We found that the transmission of prominent mutations contributes to an unexpected increase in primary resistance, including MDR-TB cases in Northern India.

High-Frequency Percussive Ventilation and Low Tidal Volume Ventilation in Burns: A Randomized Controlled Trial

Science.gov (United States)

2010-01-01

incidence of ventilator-associated pneumonia ( VAP ) in patients with inha- lation injury when supported with HFPV compared with conventional modes of...mean ratio of PaO2 to FIO2 was 58 6 with a mean positive end- expiratory pressure of 22 2 cm H2O before rescue. Two of these patients were...a sample size of 110 patients in each arm would have been required to detect a difference in VAP with 80% power. A multicentered study would be

Extracellular release of acid phosphatase from blood stream forms ...

African Journals Online (AJOL)

Phase separation of the extracts using the detergent Triton X-114 (TX-114), resulted in protein partitioning into aqueous and detergent phases. ACP activity was higher in the detergent phases (56.2 μmol/min and 28.8 μmol/min) of WPE and ESE respectively. ACP activity recorded in the aqueous phases of WPE and EPE ...

Untitled

African Journals Online (AJOL)

Procedure. ACP was precipitated by mixing pre-buffered (tris-HCl, 0.15 M; .... the concurrent presence of both the apatitic and B-tcp phases at this temperature. Second, at a .... of Sr2t to stabilize ACP has been attributed to a possible initial competition of Sr2+ with ... Research and Training in Italian Laboratories". The author ...

"A" shape plate for open rigid internal fixation of mandible condyle neck fracture.

Science.gov (United States)

Kozakiewicz, Marcin; Swiniarski, Jacek

2014-09-01

Reduction of the fracture is crucial for proper outcome of the treatment. The stability of reduction is closed connected to the method of its fixation. The topic of condylar fracture osteosynthesis still remains highly controversial and challenging. That is why authors decided to propose novel design of the fixating plate and the example of its application. The aim of this study was to present A-shape plate dedicated to rigid fixation of mandible condyle neck fracture. A-shape condylar plate (ACP) design is prepared of 1.0 mm thick titanium alloy (grade 5) sheet: posterior and anterior bars are reinforced by widening to 2.5 mm and anatomically curved along the compression and traction lines in ramus and condylar neck. Superior three-hole-group has triangular organization and located on the level of condylar head. The inferior extensions of the bars are equipped in three holes located at each of lower tails. Connecting bar (2.0 mm wide) connects the first hole of each lower tails closing upper part of ACP in triangular shape. The connecting bar runs along compression line of condylar neck. Holes in ACP has 2.0 mm diameter for locking or normal screws. Height of ACP is 31 mm. The proposed new type of plate was compared by finite element analysis (FEA) to nowadays manufactured 9-hole trapezoid plate as the most similar device. ACP design was evaluated by finite element analysis (FEA) and later applied in patient affected with high condylar neck fracture complicated by fracture of coronoid process. FEA revealed high strength of ACP and more stabile fixation than trapezoid plate. The result was caused by multipoint fixation at three regions of the plate and reinforced bars supported by semi-horizontal connecting bar. Clinical application of ACP was as versatile as makes possible to simultaneous fixation of high condylar neck and coronoid process fracture. Application of proposed A-shape condylar plate would be possible in all levels of neck fractures and can be use

Advance Care Planning in Nursing Home Patients With Dementia: A Qualitative Interview Study Among Family and Professional Caregivers.

Science.gov (United States)

van Soest-Poortvliet, Mirjam C; van der Steen, Jenny T; Gutschow, Giselka; Deliens, Luc; Onwuteaka-Philipsen, Bregje D; de Vet, Henrica C W; Hertogh, Cees M P M

2015-11-01

The aim of this study was to describe the process of advance care planning (ACP) and to explore factors related to the timing and content of ACP in nursing home patients with dementia, as perceived by family, physicians, and nurses. A qualitative descriptive study. A total of 65 in-depth qualitative interviews were held with families, on-staff elderly care physicians, and nurses of 26 patients with dementia who died in the Dutch End Of Life in Dementia (DEOLD) study. Interviews were coded and analyzed to find themes. Family, nurses, and physicians of all patients indicated they had multiple contact moments during nursing home stay in which care goals and treatment decisions were discussed. Nearly all interviewees indicated that physicians took the initiative for these ACP discussions. Care goals discussed and established during nursing home stay and the terminology to describe care goals varied between facilities. Regardless of care goals and other factors, cardiopulmonary resuscitation (CPR) and hospitalization were always discussed in advance with family and commonly resulted in a do-not-resuscitate (DNR) and a do-not-hospitalize (DNH) order. The timing of care planning discussions about other specific treatments or conditions and the content of treatment decisions varied. The factors that emerged from the interviews as related to ACP were general strategies that guided physicians in initiating ACP discussions, patient's condition, wishes expressed by patient or family, family's willingness, family involvement, continuity of communication, consensus with or within family, and general nursing home policy. Two influential underlying strategies guided physicians in initiating ACP discussions: (1) wait for a reason to initiate discussions, such as a change in health condition and (2) take initiative to discuss possible treatments (actively, including describing scenarios). ACP is a multifactorial process, which may lean on professional caregivers' guidance. The most

Effects of the incorporation of ε-aminocaproic acid/chitosan particles to fibrin on cementoblast differentiation and cementum regeneration.

Science.gov (United States)

Park, Chan Ho; Oh, Joung-Hwan; Jung, Hong-Moon; Choi, Yoonnyoung; Rahman, Saeed Ur; Kim, Sungtae; Kim, Tae-Il; Shin, Hong-In; Lee, Yun-Sil; Yu, Frank H; Baek, Jeong-Hwa; Ryoo, Hyun-Mo; Woo, Kyung Mi

2017-10-01

Cementum formation on the exposed tooth-root surface is a critical process in periodontal regeneration. Although various therapeutic approaches have been developed, regeneration of integrated and functional periodontal complexes is still wanting. Here, we found that the OCCM30 cementoblasts cultured on fibrin matrix express substantial levels of matrix proteinases, leading to the degradation of fibrin and the apoptosis of OCCM30 cells, which was reversed upon treatment with a proteinase inhibitor, ε-aminocaproic acid (ACA). Based on these findings, ACA-releasing chitosan particles (ACP) were fabricated and ACP-incorporated fibrin (fibrin-ACP) promoted the differentiation of cementoblasts in vitro, as confirmed by bio-mineralization and expressions of molecules associated with mineralization. In a periodontal defect model of beagle dogs, fibrin-ACP resulted in substantial cementum formation on the exposed root dentin in vivo, compared to fibrin-only and enamel matrix derivative (EMD) which is used clinically for periodontal regeneration. Remarkably, the fibrin-ACP developed structural integrations of the cementum-periodontal ligament-bone complex by the Sharpey's fiber insertion. In addition, fibrin-ACP promoted alveolar bone regeneration through increased bone volume of tooth roof-of-furcation defects and root coverage. Therefore, fibrin-ACP can promote cementogenesis and osteogenesis by controlling biodegradability of fibrin, implicating the feasibility of its therapeutic use to improve periodontal regeneration. Cementum, the mineralized layer on root dentin surfaces, functions to anchor fibrous connective tissues on tooth-root surfaces with the collagenous Sharpey's fibers integration, of which are essential for periodontal functioning restoration in the complex. Through the cementum-responsible fiber insertions on tooth-root surfaces, PDLs transmit various mechanical responses to periodontal complexes against masticatory/occlusal stimulations to support teeth

Policing starter unit selection of the enterocin type II polyketide synthase by the type II thioesterase EncL.

Science.gov (United States)

Kalaitzis, John A; Cheng, Qian; Meluzzi, Dario; Xiang, Longkuan; Izumikawa, Miho; Dorrestein, Pieter C; Moore, Bradley S

2011-11-15

Enterocin is an atypical type II polyketide synthase (PKS) product from the marine actinomycete 'Streptomyces maritimus'. The enterocin biosynthesis gene cluster (enc) codes for proteins involved in the assembly and attachment of the rare benzoate primer that initiates polyketide assembly with the addition of seven malonate molecules and culminates in a Favorskii-like rearrangement of the linear poly-β-ketone to give its distinctive non-aromatic, caged core structure. Fundamental to enterocin biosynthesis, which utilizes a single acyl carrier protein (ACP), EncC, for both priming with benzoate and elongating with malonate, involves maintaining the correct balance of acyl-EncC substrates for efficient polyketide assembly. Here, we report the characterization of EncL as a type II thioesterase that functions to edit starter unit (mis)priming of EncC. We performed a series of in vivo mutational studies, heterologous expression experiments, in vitro reconstitution studies, and Fourier-transform mass spectrometry-monitored competitive enzyme assays that together support the proposed selective hydrolase activity of EncL toward misprimed acetyl-ACP over benzoyl-ACP to facilitate benzoyl priming of the enterocin PKS complex. While this system resembles the R1128 PKS that also utilizes an editing thioesterase (ZhuC) to purge acetate molecules from its initiation module ACP in favor of alkylacyl groups, the enterocin system is distinct in its usage of a single ACP for both priming and elongating reactions with different substrates. Copyright © 2011 Elsevier Ltd. All rights reserved.

Measurements of canine aqueous humor inflammatory mediators and the effect of carprofen following anterior chamber paracentesis.

Science.gov (United States)

Pinard, Chantale L; Gauvin, Dominique; Moreau, Maxim; Martel-Pelletier, Johanne; Pelletier, Jean-Pierre; Troncy, Eric

2011-09-01

Phase I: To evaluate levels of prostaglandin E(2) (PGE(2) ), nitrites and nitrates (NO(x) ), tumor necrosis factor-alpha (TNF-α) and expression of inducible cyclo-oxygenase (COX-2), nitric oxide synthase (NOS-2), and matrix metalloproteinases (MMP-3 and -9) in canine aqueous humor following repeated anterior chamber paracenteses (ACP). Phase II: to evaluate the effect of carprofen on PGE(2) , NO(x) , and TNF-α in canine aqueous humor following ACP. Four beagles in phase I and 8 beagles in phase II. Phase I: ACP was performed at time (T) 0, 4 and 8 h. Phase II: A randomized, placebo-controlled cross-over design with four dogs per group where carprofen was given 4.4 mg/kg/day on day (D) 1, 2 and 3. ACP was performed at T0 and T1.5 on D3. Statistical analysis was performed with repeated measures anova and post hoc Tukey-Kramer multiple-comparison procedure. In phase II, TNF-α level was analyzed with a Wilcoxon signed-rank test. Phase I: PGE(2) significantly increased (P carprofen group (P = 0.037). NO(x) and TNF-α did not statistically increase in either group. Following ACP, significant increases in PGE(2) levels confirmed inflammation characterized by a rise of COX-2. The NO(x) pathway took longer to induce as compared with PGE(2) . Carprofen decreased PGE(2) levels and could help control intraocular inflammation. © 2011 American College of Veterinary Ophthalmologists.

A call to improve practice concerning cultural sensitivity in advance directives: a review of the literature.

Science.gov (United States)

Zager, B Sue; Yancy, Margaret

2011-12-01

The Patient Self Determination Act of 1990 mandates healthcare providers (HCP) to speak with patients about end-of-life preferences and advance directives (AD). HCP work with patients of varying cultures, and standard ADs do not address cultural differences. In order to understand various cultural beliefs, cultural sensitivity is important especially when discussing advance care planning (ACP). Individuals from differing ethnic backgrounds are likely to turn to their traditional norms of practice when ill or treatment choices must be made. An AD that addresses varying cultural values and beliefs was sought. A comprehensive review of the literature was conducted. Articles selected for review included qualitative and quantitative studies. The evidence was evaluated and synthesized for information related to cultural sensitivity and ADs. Three common themes emerged related to ACP discussions and culture. Healthcare provider awareness, communication, and education concerning cultural differences and ACP assisted in meeting the needs for end-of-life planning in the current era of increased globalization. Education for HCP on cultural differences and how to lead discussions promoted ACP. ADs are an essential part of health care and promote patient-centered care. (HCP) should be able to recognize differing cultural values and beliefs in order to initiate conversations about end of life. Initiating conversations about ACP can be facilitated by using open-ended questions that respect the values and beliefs of various cultures. Copyright ©2011 Sigma Theta Tau International.

Wellness in Sickness and Health (The W.I.S.H. Project): Advance Care Planning Preferences and Experiences Among Elderly Latino Patients.

Science.gov (United States)

Maldonado, Lauren Y; Goodson, Ruth B; Mulroy, Matthew C; Johnson, Emily M; Reilly, Jo M; Homeier, Diana C

2017-10-25

To assess advance care planning (ACP) preferences, experiences, and comfort in discussing end-of-life (EOL) care among elderly Latinos. Patients aged 60 and older from the Los Angeles County and University of Southern California (LAC+USC) Medical Center Geriatrics Clinic (n = 41) participated in this intervention. Trained staff conducted ACP counseling with participants in their preferred language, which included: (a) pre-counseling survey about demographics and EOL care attitudes, (b) discussion of ACP and optional completion of an advance directive (AD), and (c) post-session survey. Patients were primarily Spanish speaking with an average of 2.7 chronic medical conditions. Most had not previously documented (95%) or discussed (76%) EOL wishes. Most were unaware they had control over their EOL treatment (61%), but valued learning about EOL options (83%). Post-counseling, 85% reported comfort discussing EOL goals compared to 66% pre-session, and 88% elected to complete an AD. Nearly half of patients reported a desire to discuss EOL wishes sooner. Elderly Latino patients are interested in ACP, given individualized, culturally competent counseling in their preferred language. Patients should be offered the opportunity to discuss and document EOL wishes at all primary care appointments, regardless of health status. Counseling should be completed in the patient's preferred language, using culturally competent materials, and with family members present if this is the patient's preference. Cultural-competency training for providers could enhance the impact of EOL discussions and improve ACP completion rates for Latino patients.

Bioactive Polymeric Composites for Tooth Mineral Regeneration: Physicochemical and Cellular Aspects

Science.gov (United States)

Skrtic, Drago; Antonucci, Joseph M.

2011-01-01

Our studies of amorphous calcium phosphate (ACP)-based dental materials are focused on the design of bioactive, non-degradable, biocompatible, polymeric composites derived from acrylic monomer systems and ACP by photochemical or chemically activated polymerization. Their intended uses include remineralizing bases/liners, orthodontic adhesives and/or endodontic sealers. The bioactivity of these materials originates from the propensity of ACP, once exposed to oral fluids, to release Ca and PO4 ions (building blocks of tooth and bone mineral) in a sustained manner while spontaneously converting to thermodynamically stable apatite. As a result of ACP's bioactivity, local Ca- and PO4-enriched environments are created with supersaturation conditions favorable for the regeneration of tooth mineral lost to decay or wear. Besides its applicative purpose, our research also seeks to expand the fundamental knowledge base of structure-composition-property relationships existing in these complex systems and identify the mechanisms that govern filler/polymer and composite/tooth interfacial phenomena. In addition to an extensive physicochemical evaluation, we also assess the leachability of the unreacted monomers and in vitro cellular responses to these types of dental materials. The systematic physicochemical and cellular assessments presented in this study typically provide model materials suitable for further animal and/or clinical testing. In addition to their potential dental clinical value, these studies suggest the future development of calcium phosphate-based biomaterials based on composite materials derived from biodegradable polymers and ACP, and designed primarily for general bone tissue regeneration. PMID:22102967

ACP Facility Safety Surveillance System Installation

International Nuclear Information System (INIS)

You, Gil Sung; Kook, D. H.; Choung, W. M.; Ku, J. H.; Cho, I. J.; You, G. S.; Kwon, K. C.; Lee, W. K.; Lee, E. P.

2006-10-01

The Advanced spent fuel Conditioning Process is under development for effective management of spent fuel by converting UO 2 into U-metal. For demonstration of this process, α-γ type new hotcell was built in the IMEF basement. All facilities which treat radioactive materials must manage CCTV system which is under control of Health Physics department. Three main points (including hotcell rear door area) have each camera, but operators who are in charge of facility management need to check the safety of the facility immediately through the network in his office. This needs introduce additional network cameras installation and this new surveillance system is expected to update the whole safety control ability with existing system

Genetically engineered mouse models of craniopharyngioma: an opportunity for therapy development and understanding of tumor biology.

Science.gov (United States)

Apps, John Richard; Martinez-Barbera, Juan Pedro

2017-05-01

Adamantinomatous craniopharyngioma (ACP) is the commonest tumor of the sellar region in childhood. Two genetically engineered mouse models have been developed and are giving valuable insights into ACP biology. These models have identified novel pathways activated in tumors, revealed an important function of paracrine signalling and extended conventional theories about the role of organ-specific stem cells in tumorigenesis. In this review, we summarize these mouse models, what has been learnt, their limitations and open questions for future research. We then discussed how these mouse models may be used to test novel therapeutics against potentially targetable pathways recently identified in human ACP. © 2017 The Authors. Brain Pathology published by John Wiley & Sons Ltd on behalf of International Society of Neuropathology.

Towards an Approach of Semantic Access Control for Cloud Computing

Science.gov (United States)

Hu, Luokai; Ying, Shi; Jia, Xiangyang; Zhao, Kai

With the development of cloud computing, the mutual understandability among distributed Access Control Policies (ACPs) has become an important issue in the security field of cloud computing. Semantic Web technology provides the solution to semantic interoperability of heterogeneous applications. In this paper, we analysis existing access control methods and present a new Semantic Access Control Policy Language (SACPL) for describing ACPs in cloud computing environment. Access Control Oriented Ontology System (ACOOS) is designed as the semantic basis of SACPL. Ontology-based SACPL language can effectively solve the interoperability issue of distributed ACPs. This study enriches the research that the semantic web technology is applied in the field of security, and provides a new way of thinking of access control in cloud computing.

Study of CP asymmetry in B^{0}-B[over ¯]^{0} mixing with inclusive dilepton events.

Science.gov (United States)

Lees, J P; Poireau, V; Tisserand, V; Grauges, E; Palano, A; Eigen, G; Stugu, B; Brown, D N; Kerth, L T; Kolomensky, Yu G; Lee, M J; Lynch, G; Koch, H; Schroeder, T; Hearty, C; Mattison, T S; McKenna, J A; So, R Y; Khan, A; Blinov, V E; Buzykaev, A R; Druzhinin, V P; Golubev, V B; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Todyshev, K Yu; Lankford, A J; Mandelkern, M; Dey, B; Gary, J W; Long, O; Campagnari, C; Franco Sevilla, M; Hong, T M; Kovalskyi, D; Richman, J D; West, C A; Eisner, A M; Lockman, W S; Panduro Vazquez, W; Schumm, B A; Seiden, A; Chao, D S; Cheng, C H; Echenard, B; Flood, K T; Hitlin, D G; Miyashita, T S; Ongmongkolkul, P; Porter, F C; Röhrken, M; Andreassen, R; Huard, Z; Meadows, B T; Pushpawela, B G; Sokoloff, M D; Sun, L; Bloom, P C; Ford, W T; Gaz, A; Smith, J G; Wagner, S R; Ayad, R; Toki, W H; Spaan, B; Bernard, D; Verderi, M; Playfer, S; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Fioravanti, E; Garzia, I; Luppi, E; Piemontese, L; Santoro, V; Calcaterra, A; de Sangro, R; Finocchiaro, G; Martellotti, S; Patteri, P; Peruzzi, I M; Piccolo, M; Rama, M; Zallo, A; Contri, R; Lo Vetere, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Bhuyan, B; Prasad, V; Adametz, A; Uwer, U; Lacker, H M; Dauncey, P D; Mallik, U; Chen, C; Cochran, J; Prell, S; Ahmed, H; Gritsan, A V; Arnaud, N; Davier, M; Derkach, D; Grosdidier, G; Le Diberder, F; Lutz, A M; Malaescu, B; Roudeau, P; Stocchi, A; Wormser, G; Lange, D J; Wright, D M; Coleman, J P; Fry, J R; Gabathuler, E; Hutchcroft, D E; Payne, D J; Touramanis, C; Bevan, A J; Di Lodovico, F; Sacco, R; Cowan, G; Bougher, J; Brown, D N; Davis, C L; Denig, A G; Fritsch, M; Gradl, W; Griessinger, K; Hafner, A; Schubert, K R; Barlow, R J; Lafferty, G D; Cenci, R; Hamilton, B; Jawahery, A; Roberts, D A; Cowan, R; Sciolla, G; Cheaib, R; Patel, P M; Robertson, S H; Neri, N; Palombo, F; Cremaldi, L; Godang, R; Sonnek, P; Summers, D J; Simard, M; Taras, P; De Nardo, G; Onorato, G; Sciacca, C; Martinelli, M; Raven, G; Jessop, C P; LoSecco, J M; Honscheid, K; Kass, R; Feltresi, E; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simi, G; Simonetto, F; Stroili, R; Akar, S; Ben-Haim, E; Bomben, M; Bonneaud, G R; Briand, H; Calderini, G; Chauveau, J; Leruste, Ph; Marchiori, G; Ocariz, J; Biasini, M; Manoni, E; Pacetti, S; Rossi, A; Angelini, C; Batignani, G; Bettarini, S; Carpinelli, M; Casarosa, G; Cervelli, A; Chrzaszcz, M; Forti, F; Giorgi, M A; Lusiani, A; Oberhof, B; Paoloni, E; Perez, A; Rizzo, G; Walsh, J J; Lopes Pegna, D; Olsen, J; Smith, A J S; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Pilloni, A; Piredda, G; Bünger, C; Dittrich, S; Grünberg, O; Hess, M; Leddig, T; Voß, C; Waldi, R; Adye, T; Olaiya, E O; Wilson, F F; Emery, S; Vasseur, G; Anulli, F; Aston, D; Bard, D J; Cartaro, C; Convery, M R; Dorfan, J; Dubois-Felsmann, G P; Dunwoodie, W; Ebert, M; Field, R C; Fulsom, B G; Graham, M T; Hast, C; Innes, W R; Kim, P; Leith, D W G S; Lewis, P; Lindemann, D; Luitz, S; Luth, V; Lynch, H L; MacFarlane, D B; Muller, D R; Neal, H; Perl, M; Pulliam, T; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Snyder, A; Su, D; Sullivan, M K; Va'vra, J; Wisniewski, W J; Wulsin, H W; Purohit, M V; White, R M; Wilson, J R; Randle-Conde, A; Sekula, S J; Bellis, M; Burchat, P R; Puccio, E M T; Alam, M S; Ernst, J A; Gorodeisky, R; Guttman, N; Peimer, D R; Soffer, A; Spanier, S M; Ritchie, J L; Ruland, A M; Schwitters, R F; Wray, B C; Izen, J M; Lou, X C; Bianchi, F; De Mori, F; Filippi, A; Gamba, D; Lanceri, L; Vitale, L; Martinez-Vidal, F; Oyanguren, A; Villanueva-Perez, P; Albert, J; Banerjee, Sw; Beaulieu, A; Bernlochner, F U; Choi, H H F; King, G J; Kowalewski, R; Lewczuk, M J; Lueck, T; Nugent, I M; Roney, J M; Sobie, R J; Tasneem, N; Gershon, T J; Harrison, P F; Latham, T E; Band, H R; Dasu, S; Pan, Y; Prepost, R; Wu, S L

2015-02-27

We present a measurement of the asymmetry A_{CP} between same-sign inclusive dilepton samples ℓ^{+}ℓ^{+} and ℓ^{-}ℓ^{-} (ℓ=e, μ) from semileptonic B decays in ϒ(4S)→BB[over ¯] events, using the complete data set recorded by the BABAR experiment near the ϒ(4S) resonance, corresponding to 471×10^{6} BB[over ¯] pairs. The asymmetry A_{CP} allows comparison between the mixing probabilities P(B[over ¯]^{0}→B^{0}) and P(B^{0}→B[over ¯]^{0}), and therefore probes CP and T violation. The result, A_{CP}=[-3.9±3.5(stat)±1.9(syst)]×10^{-3}, is consistent with the standard model expectation.

Ecology, physiology, and phylogeny of deep subsurface Sphingomonas sp.

Science.gov (United States)

Fredrickson, J K; Balkwill, D L; Romine, M F; Shi, T

1999-10-01

Several new species of the genus Sphingomonas including S. aromaticivorans, S. stygia, and S. subterranea that have the capacity for degrading a broad range of aromatic compounds including toluene, naphthalene, xylenes, p-cresol, fluorene, biphenyl, and dibenzothiophene, were isolated from deeply-buried (>200 m) sediments of the US Atlantic coastal plain (ACP). In S. aromaticivorans F199, many of the genes involved in the catabolism of these aromatic compounds are encoded on a 184-kb conjugative plasmid; some of the genes involved in aromatic catabolism are plasmid-encoded in the other strains as well. Members of the genus Sphingomonas were common among aerobic heterotrophic bacteria cultured from ACP sediments and have been detected in deep subsurface environments elsewhere. The major source of organic carbon for heterotrophic metabolism in ACP deep aquifers is lignite that originated from plant material buried with the sediments. We speculate that the ability of the subsurface Sphingomonas strains to degrade a wide array of aromatic compounds represents an adaptation for utilization of sedimentary lignite. These and related subsurface Sphingomonas spp may play an important role in the transformation of sedimentary organic carbon in the aerobic and microaerobic regions of the deep aquifers of the ACP.

The Department of Energy's Atmospheric Chemistry Program: A critical review

International Nuclear Information System (INIS)

1991-01-01

In response to a request from the Department of Energy's (DOE) Office of Health and Environmental Research (OHER), the Committee on Atmospheric Chemistry has reviewed OHER's Atmospheric Chemistry Program (ACP). This report contains the committee's evaluation and critique arising from that review. The review process included a two-day symposium held at the National Academy of Sciences on September 25 and 26, 1990, that focused on presenting the ACP's current components, recent scientific accomplishments, and scientific plans. Following the symposium, committee members met in a one-day executive session to formulate and outline this report. In undertaking this review, OHER and ACP management requested that the committee attempt to answer several specific questions involving the program's technical capability and productivity, its leadership and organization, and its future direction. These questions are given in the Appendix. This report represents the committee's response to the questions posed in the Appendix. Chapter I explores the committee's view of the role that atmospheric chemistry could and should assume within the DOE and its prospective National Energy Strategy. Chapter 2 assesses the current ACP, Chapter 3 presents recommendations for revising and strengthening it, and Chapter 4 restates the committee's conclusions and recommendations

Micro-CT and FE-SEM enamel analyses of calcium-based agent application after bleaching.

Science.gov (United States)

Gomes, Mauricio Neves; Rodrigues, Flávia Pires; Silikas, Nick; Francci, Carlos Eduardo

2018-03-01

The objective of the present study is to evaluate the effects of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) on bleached enamel. A bleaching agent (35% hydrogen peroxide) was applied, 4 × 8 min on premolar teeth (n = 8). A CPP-ACP paste was applied for 7 days. Prior and post-treatment, microtomography images were obtained and 3D regions of interest (ROIs) were selected, from outer enamel, extending to 110.2-μm depth. CT parameters of structure: thickness (St.Th), separation (St.Sp), and fragmentation index (Fr.I.) were calculated for each (ROI). Data was submitted to paired t tests at a 95% confidence level. The samples were evaluated at 3000 to 100,000 magnification. Quantitative analysis of enamel mineral content was also determined by SEM EDX. There was a significant increase in structure thickness and calcium content. The phosphorus content increased after bleaching. There was also a decreased separation and fragmentation index on the outer enamel to a depth of 56.2 μm (p spaces between the hydroxyapatite crystals appeared around the enamel prisms, 7 days after the CPP-ACP application. The application of a CPP-ACP provides a compact structure on the enamel's outer surface, for 7 days, due to calcium deposition. CT parameters seem to be a useful tool for mineralizing and remineralizing future studies. CPP-ACP neutralizes any adverse effects on enamel surface when applied during a week after bleaching and minimizes any side effects of the bleaching treatment due to a more compact structure.

How much do health care providers value a community-based asthma care program? – a survey to collect their opinions on the utilities of and barriers to its uptake

Directory of Open Access Journals (Sweden)

McLimont Susan

2009-05-01

Full Text Available Abstract Background A comprehensive asthma care program (ACP based on Canadian Asthma Consensus Guidelines was implemented in 8 primary care sites in Ontario, Canada. A survey was distributed to health care providers' (HCPs to collect their opinions on the utilities of and barriers to the uptake of the ACP. Methods A 39-item self-administered survey was mailed to 184 HCPs and support staff involved in delivering the ACP at the end of implementation. The items were presented in mixed formats with most items requiring responses on a five-point Likert scale. Distributions of responses were analyzed and compared across types of HCPs and sites. Results Of the 184 surveys distributed, 108 (59% were returned, and of that, 83 were completed by HCPs who had clinical contact with the patients. Overall, 95% of the HCPs considered the ACP useful for improving asthma care management. Most HCPs favored using the asthma care map (72%, believed it decreased uncertainties and variations in patient management (91%, and considered it a convenient and reliable source of information (86%. The most commonly reported barrier was time required to complete the asthma care map. Over half of the HCPs reported challenges to using spirometry, while almost 40% identified barriers to using the asthma action plan. Conclusion Contrary to the notion that physicians believe that guidelines foster cookbook medicine, our study showed that HCPs believed that the ACP offered an effective and reliable approach for enhancing asthma care and management in primary care.

Effects of Treatment with Various Remineralizing Agents on the Microhardness of Demineralized Enamel Surface

Directory of Open Access Journals (Sweden)

Kiana Salehzadeh Esfahani

2015-12-01

Full Text Available Background and aims. Remineralization of incipient caries is one of the goals in dental health care. The present study aimed at comparing the effects of casein phosphopeptide-amorphous calcium phosphate complex (CPP-ACP, Remin Pro®, and 5% sodium fluoride varnish on remineralization of enamel lesions. Materials and methods. In this in vitro study, 60 enamel samples were randomly allocated to six groups of 10. After four days of immersion in demineralizing solution, microhardness of all samples was measured. Afterward, groups 1-3 under-went one-time treatment with fluoride varnish, CPP-ACP, and Remin Pro®, respectively. Microhardness of groups 4-6 was measured not only after one-month treatment with the above-mentioned materials (for eight hours a day, but also after re-exposing to the demineralizing solution. The results were analyzed by one-way analysis of variance (ANOVA, repeated measures ANOVA, and Fisher’s least significant difference (LSD test. Results. None of the regimens could increase microhardness in groups 1-3. However, one-month treatment regimens in groups 4-6 caused a significant increase in microhardness. The greatest microhardness was detected in the group treated with CPP-ACP (P = 0.001. In addition, although microhardness reduced following re-demineralization in all three groups, the mean reduction was minimum in the CPP-ACP-treated group (P < 0.001. Conclusion. While long-term repeated application of all compounds improved microhardness, the remineralization potential of CPP-ACP was significantly higher than that of Remin Pro® and sodium fluoride varnish.

Do craniopharyngioma molecular signatures correlate with clinical characteristics?

Science.gov (United States)

Omay, Sacit Bulent; Chen, Yu-Ning; Almeida, Joao Paulo; Ruiz-Treviño, Armando Saul; Boockvar, John A; Stieg, Philip E; Greenfield, Jeffrey P; Souweidane, Mark M; Kacker, Ashutosh; Pisapia, David J; Anand, Vijay K; Schwartz, Theodore H

2018-05-01

OBJECTIVE Exome sequencing studies have recently demonstrated that papillary craniopharyngiomas (PCPs) and adamantinomatous craniopharyngiomas (ACPs) have distinct genetic origins, each primarily driven by mutually exclusive alterations: either BRAF ( V600E), observed in 95% of PCPs, or CTNNB1, observed in 75%-96% of ACPs. How the presence of these molecular signatures, or their absence, correlates with clinical, radiographic, and outcome variables is unknown. METHODS The pathology records for patients who underwent surgery for craniopharyngiomas between May 2000 and March 2015 at Weill Cornell Medical College were reviewed. Craniopharyngiomas were identified and classified as PCP or ACP. Patients were placed into 1 of 3 groups based on their genomic mutations: BRAF mutation only, CTNNB1 mutation only, and tumors with neither of these mutations detected (not detected [ND]). Demographic, radiological, and clinical variables were collected, and their correlation with each genomic group was tested. RESULTS Histology correlated strongly with mutation group. All BRAF tumors with mutations were PCPs, and all CTNNB1 with mutations and ND tumors were ACPs. Preoperative and postoperative clinical symptoms and radiographic features did not correlate with any mutation group. There was a statistically significant relationship (p = 0.0323) between the age group (pediatric vs adult) and the mutation groups. The ND group tumors were more likely to involve the sella (p = 0.0065). CONCLUSIONS The mutation signature in craniopharyngioma is highly predictive of histology. The subgroup of tumors in which these 2 mutations are not detected is more likely to occur in children, be located in the sella, and be of ACP histology.

Effect of Casein Phosphopeptide-Amorphous Calcium Phosphate and Three Calcium Phosphate on Enamel Microhardness.

Science.gov (United States)

Haghgou, En Hr; Haghgoo, Roza; Roholahi, Mohamad R; Ghorbani, Zahra

2017-07-01

This study aims to investigate the effect of casein phos-phopeptide-amorphous calcium phosphate and three calcium phosphate (CPP-ACP and TCP) on increasing the microhardness of human enamel after induction of erosion. A total of 26 healthy human-impacted third molar teeth were chosen, and their hardness measured using a microhardness testing machine. The samples were immersed in Coca Cola (pH = 4.7) for 8 minutes. Then, micro-hardness was measured again, and these samples were randomly divided into four groups (two control groups and two experimental groups). (1) Negative control group: Artificial saliva was used for 10 minutes, (2) positive control group: Fluoride gel was used for 10 minutes, (3) β-TCP group: TCP was used for 10 minutes, (4) CCP-ACP group: CCP-ACP was used for 10 minutes. The final microhardness of those samples was measured, and the changes in microhardness of teeth within group and between groups were analyzed using the paired and analysis of variance tests respectively. Results were considered statistically significant at a level of p < 0.05. No significant difference was observed in microhard-ness between CPP-ACP group and TCP group (p = 0.368) during the time microhardness significantly dropped after soaking in soda. Casein phosphopeptide-amorphous calcium phosphate and TCP increased the microhardness of teeth. The increase in hardness in the TCP group was higher than in the CPP-ACP group, but this difference was not significant (p = 0.36). Casein phosphopeptide-amorphous calcium phosphate and TCP can affect the remineralization of erosive lesions.

The phosphopantetheinyl transferases: catalysis of a post-translational modification crucial for life

DEFF Research Database (Denmark)

Beld, Joris; Sonnenschein, Eva; Vickery, Christopher R.

2013-01-01

Covering: up to 2013 Although holo-acyl carrier protein synthase, AcpS, a phosphopantetheinyl transferase (PPTase), was characterized in the 1960s, it was not until the publication of the landmark paper by Lambalot et al. in 1996 that PPTases garnered wide-spread attention being classified...... knowledge on this class of enzymes that post-translationally install a 4′-phosphopantetheine arm on various carrier proteins....

Measurement of the CP asymmetry in B- -> (Ds-D0) and B- -> (D-D0) decays

NARCIS (Netherlands)

Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Dufour, L.; Mulder, M; Onderwater, C. J. G.; Pellegrino, A.; Tolk, S.; van Veghel, M.

2018-01-01

The CP asymmetry in B- -> (Ds-D0) and B- -> (D-D0) decays is measured using LHCb data corresponding to an integrated luminosity of 3.0 fb(-1), collected in pp collisions at centre-of-mass energies of 7 and 8TeV. The results are A(CP) (B- -> (Ds-D0)) = (-0.4 +/- 0.5 +/- 0.5)% and A(CP) (B- -> (D-D0))

Facile electrochemical pretreatment of multiwalled carbon nanotube - Polydimethylsiloxane paste electrode for enhanced detection of dopamine and uric acid

Science.gov (United States)

Buenaventura, Angelo Gabriel E.; Yago, Allan Christopher C.

2018-05-01

A facile electrochemical pretreatment via anodization was done on Carbon Paste Electrodes (CPEs) composed of Multiwalled Carbon Nanotubes (MWCNTs) and Polydimethylsiloxane (PDMS) binder to produce `anodized' CPEs (ACPE). Cyclic Voltammetry (CV) technique was used to anodize the CPEs. The anodization step, performed in various solutions (0.2 M NaOH(aq), 0.06 M BR Buffer at pH 7.0, and 0.2 M HNO3(aq)), were found to enhance the electrochemical properties of the ACPEs compared to non-anodized CPE. Electrochemical Impedance Spectroscopy (EIS) measurements revealed a significantly lower charge transfer resistance (Rct) for the ACPEs (4.01-6.25 kΩ) as compared to CPE (25.9 kΩ). Comparison of the reversibility analysis for Fe(CN)63-/4- redox couple showed that the ACPEs have peak current ratio (Ia/Ic) at range of 0.97-1.10 while 1.92 for the CPE; this result indicated better electrochemical reversible behaviors for Fe(CN)63-/4- redox couple using the ACPEs. CV Anodization process was further optimized by varying solution and CV parameters (i.e. pH, composition, number of cycles, and potential range), and the resulting optimized ACPE was used for enhanced detection of Dopamine (DA) and Uric Acid (UA) in the presence of excess Ascorbic Acid (AA). Employing Differential Pulse Voltammetry technique, enhanced voltammetric signal for DA and significant peak separation between DA and UA was obtained. The anodic peak currents for the oxidation of DA and UA appeared at 0.263V and 0.414 V, respectively, and it was observed to be linearly increasing with increasing concentrations of biomolecules (25-100 µM). The detection limit was determined to be 3.86 µM for DA and 5.61 µM for UA. This study showed a quick and cost-effective pretreatment for CPEs based on MWCNT-PDMS composite which lead to significant enhancement on its electrochemical properties.

Genotypic characterization of multi-drug-resistant Mycobacterium tuberculosis isolates in Myanmar.

Science.gov (United States)

Aye, Khin Saw; Nakajima, Chie; Yamaguchi, Tomoyuki; Win, Min Min; Shwe, Mu Mu; Win, Aye Aye; Lwin, Thandar; Nyunt, Wint Wint; Ti, Ti; Suzuki, Yasuhiko

2016-03-01

The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-TB would be effective. To develop such tests, information on the frequency and distribution of mutations associating with phenotypic drug resistance in Mycobacterium tuberculosis is required in each country. During 2010, the common mutations in the rpoB, katG and inhA of 178 phenotypically MDR M. tuberculosis isolates collected by the National Tuberculosis Control Program (NTP) in Myanmar were investigated by DNA sequencing. Mutations affecting the 81-bp rifampicin (RIF) resistance-determining region (RRDR) of the rpoB were identified in 127 of 178 isolates (71.3%). Two of the most frequently affected codons were 531 and 526, with percentages of 48.3% and 14.0% respectively. For isoniazid (INH) resistance, 114 of 178 MDR-TB isolates (64.0%) had mutations in the katG in which a mutation-conferring amino acid substitution at codon 315 from Ser to Thr was the most common. Mutations in the inhA regulatory region were also detected in 20 (11.2%) isolates, with the majority at position -15. Distinct mutation rate and pattern from surrounding countries might suggest that MDR-TB has developed and spread domestically in Myanmar. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

[Description of Mycobacterium tuberculosis mutations conferring resistance to rifampicin and isoniazid detected by GenoType® MTBDRplus V.2 in Colombia].

Science.gov (United States)

Llerena, Claudia; Medina, Raquel

2017-01-24

The GenoType®MTBDRplusV.2 assay is a molecular technique endorsed by the World Health Organization and the Pan American Health Organization that allows for the identification of the Mycobacterium tuberculosis complex and the detection of mutations in the rpoβ gene for rifampicin resistance, and katG and inhA genes for isoniazid resistance. Due to the genetic variability in the circulating strains around the world, the national tuberculosis control programs should assess the performance of these new diagnostic technologies and their use under program conditions as rapid tests. To describe the mutations identified by the GenoType®MTBDRplusV.2 assay in pulmonary samples and Mycobacterium tuberculosis isolates in the Laboratorio Nacional de Referencia of the Instituto Nacional de Salud in 2014. We conducted a retrospective, descriptive study to detect the expression of inhA, KatG and rpoβ genes, responsible for resistence against isoniazid and rifampicin using the GenoType® MTBDRplus V.2 assay in 837 samples and isolates from tuberculosis cases. Several mutations in the rpoβ gene were identified. Ser531Leu was the most frequent (36.6%) followed by Asp516Val (21.6%), while Ser315Thr1 was the most frequent mutation in the katG gene (91.9%). We were able to identify different mutations present in MDR-TB strains in the country, with frequencies similar to those reported in other countries in the South American region.

Significance of Coexisting Mutations on Determination of the Degree of Isoniazid Resistance in Mycobacterium tuberculosis Strains.

Science.gov (United States)

Karunaratne, Galbokka Hewage Roshanthi Eranga; Wijesundera, Sandhya Sulochana; Vidanagama, Dhammika; Adikaram, Chamila Priyangani; Perera, Jennifer

2018-04-23

The emergence and spread of drug-resistant tuberculosis (TB) pose a threat to TB control in Sri Lanka. Isoniazid (INH) is a key element of the first-line anti-TB treatment regimen. Resistance to INH is mainly associated with point mutations in katG, inhA, and ahpC genes. The objective of this study was to determine mutations of these three genes in INH-resistant Mycobacterium tuberculosis (MTb) strains in Sri Lanka. Complete nucleotide sequence of the three genes was amplified by polymerase chain reaction and subjected to DNA sequencing. Point mutations in the katG gene were identified in 93% isolates, of which the majority (78.6%) were at codon 315. Mutations at codons 212 and 293 of the katG gene have not been reported previously. Novel mutations were recognized in the promoter region of the inhA gene (C deletion at -34), fabG1 gene (codon 27), and ahpC gene (codon 39). Single S315T mutation in the katG gene led to a high level of resistance, while a low level of resistance with high frequency (41%) was observed when katG codon 315 coexisted with the mutation at codon 463. Since most of the observed mutations of all three genes coexisted with the katG315 mutation, screening of katG315 mutations will be a useful marker for molecular detection of INH resistance of MTb in Sri Lanka.

Prevalence of intrauterine adhesions after the application of hyaluronic acid gel after dilatation and curettage in women with at least one previous curettage: short-term outcomes of a multicenter, prospective randomized controlled trial.

Science.gov (United States)

Hooker, Angelo B; de Leeuw, Robert; van de Ven, Peter M; Bakkum, Erica A; Thurkow, Andreas L; Vogel, Niels E A; van Vliet, Huib A A M; Bongers, Marlies Y; Emanuel, Mark H; Verdonkschot, Annelies E M; Brölmann, Hans A M; Huirne, Judith A F

2017-05-01

To examine whether intrauterine application of auto-crosslinked hyaluronic acid (ACP) gel, after dilatation and curettage (D&C), reduces the incidence of intrauterine adhesions (IUAs). Multicenter; women and assessors blinded prospective randomized trial. University and university-affiliated teaching hospitals. A total of 152 women with a miscarriage of Gynecological Endoscopy classifications systems of adhesions. Intrauterine application of ACP gel after D&C for miscarriage in women with at least one previous D&C seems to reduce the incidence and severity of IUAs but does not eliminate the process of adhesion formation completely. Future studies are needed to confirm our findings and to evaluate the effect of ACP gel on fertility and reproductive outcomes. NTR 3120. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Advance care planning - a multi-centre cluster randomised clinical trial

DEFF Research Database (Denmark)

Rietjens, Judith A C; Korfage, Ida J; Dunleavy, Lesley

2016-01-01

patients, relatives and professional caregivers about patients' values and care preferences. It raises awareness of the need to anticipate possible future deterioration of health. ACP has the potential to improve current and future healthcare decision-making, provide patients with a sense of control......BACKGROUND: Awareness of preferences regarding medical care should be a central component of the care of patients with advanced cancer. Open communication can facilitate this but can occur in an ad hoc or variable manner. Advance care planning (ACP) is a formalized process of communication between...... Choices program from the perspectives of patients, their Personal Representatives, healthcare providers and facilitators. DISCUSSION: Transferring the concept of ACP from care of the elderly to patients with advanced cancer, who on average are younger and retain their mental capacity for a larger part...

Potential evolution of neurosurgical treatment paradigms for craniopharyngioma based on genomic and transcriptomic characteristics.

Science.gov (United States)

Robinson, Leslie C; Santagata, Sandro; Hankinson, Todd C

2016-12-01

The recent genomic and transcriptomic characterization of human craniopharyngiomas has provided important insights into the pathogenesis of these tumors and supports that these tumor types are distinct entities. Critically, the insights provided by these data offer the potential for the introduction of novel therapies and surgical treatment paradigms for these tumors, which are associated with high morbidity rates and morbid conditions. Mutations in the CTNNB1 gene are primary drivers of adamantinomatous craniopharyngioma (ACP) and lead to the accumulation of β-catenin protein in a subset of the nuclei within the neoplastic epithelium of these tumors. Dysregulation of epidermal growth factor receptor (EGFR) and of sonic hedgehog (SHH) signaling in ACP suggest that paracrine oncogenic mechanisms may underlie ACP growth and implicate these signaling pathways as potential targets for therapeutic intervention using directed therapies. Recent work shows that ACP cells have primary cilia, further supporting the potential importance of SHH signaling in the pathogenesis of these tumors. While further preclinical data are needed, directed therapies could defer, or replace, the need for radiation therapy and/or allow for less aggressive surgical interventions. Furthermore, the prospect for reliable control of cystic disease without the need for surgery now exists. Studies of papillary craniopharyngioma (PCP) are more clinically advanced than those for ACP. The vast majority of PCPs harbor the BRAF v600e mutation. There are now 2 reports of patients with PCP that had dramatic therapeutic responses to targeted agents. Ongoing clinical and research studies promise to not only advance our understanding of these challenging tumors but to offer new approaches for patient management.

Recombinant Passenger Proteins Can Be Conveniently Purified by One-Step Affinity Chromatography.

Science.gov (United States)

Wang, Hua-zhen; Chu, Zhi-zhan; Chen, Chang-chao; Cao, Ao-cheng; Tong, Xin; Ouyang, Can-bin; Yuan, Qi-hang; Wang, Mi-nan; Wu, Zhong-kun; Wang, Hai-hong; Wang, Sheng-bin

2015-01-01

Fusion tag is one of the best available tools to date for enhancement of the solubility or improvement of the expression level of recombinant proteins in Escherichia coli. Typically, two consecutive affinity purification steps are often necessitated for the purification of passenger proteins. As a fusion tag, acyl carrier protein (ACP) could greatly increase the soluble expression level of Glucokinase (GlcK), α-Amylase (Amy) and GFP. When fusion protein ACP-G2-GlcK-Histag and ACP-G2-Amy-Histag, in which a protease TEV recognition site was inserted between the fusion tag and passenger protein, were coexpressed with protease TEV respectively in E. coli, the efficient intracellular processing of fusion proteins was achieved. The resulting passenger protein GlcK-Histag and Amy-Histag accumulated predominantly in a soluble form, and could be conveniently purified by one-step Ni-chelating chromatography. However, the fusion protein ACP-GFP-Histag was processed incompletely by the protease TEV coexpressed in vivo, and a large portion of the resulting target protein GFP-Histag aggregated in insoluble form, indicating that the intracellular processing may affect the solubility of cleaved passenger protein. In this context, the soluble fusion protein ACP-GFP-Histag, contained in the supernatant of E. coli cell lysate, was directly subjected to cleavage in vitro by mixing it with the clarified cell lysate of E. coli overexpressing protease TEV. Consequently, the resulting target protein GFP-Histag could accumulate predominantly in a soluble form, and be purified conveniently by one-step Ni-chelating chromatography. The approaches presented here greatly simplify the purification process of passenger proteins, and eliminate the use of large amounts of pure site-specific proteases.

Remote control of regioselectivity in acyl-acyl carrier protein-desaturases.

Science.gov (United States)

Guy, Jodie E; Whittle, Edward; Moche, Martin; Lengqvist, Johan; Lindqvist, Ylva; Shanklin, John

2011-10-04

Regiospecific desaturation of long-chain saturated fatty acids has been described as approaching the limits of the discriminatory power of enzymes because the substrate entirely lacks distinguishing features close to the site of dehydrogenation. To identify the elusive mechanism underlying regioselectivity, we have determined two crystal structures of the archetypal Δ9 desaturase from castor in complex with acyl carrier protein (ACP), which show the bound ACP ideally situated to position C9 and C10 of the acyl chain adjacent to the diiron active site for Δ9 desaturation. Analysis of the structures and modeling of the complex between the highly homologous ivy Δ4 desaturase and ACP, identified a residue located at the entrance to the binding cavity, Asp280 in the castor desaturase (Lys275 in the ivy desaturase), which is strictly conserved within Δ9 and Δ4 enzymes but differs between them. We hypothesized that interaction between Lys275 and the phosphate of the pantetheine, seen in the ivy model, is key to positioning C4 and C5 adjacent to the diiron center for Δ4 desaturation. Mutating castor Asp280 to Lys resulted in a major shift from Δ9 to Δ4 desaturation. Thus, interaction between desaturase side-chain 280 and phospho-serine 38 of ACP, approximately 27 Å from the site of double-bond formation, predisposes ACP binding that favors either Δ9 or Δ4 desaturation via repulsion (acidic side chain) or attraction (positively charged side chain), respectively. Understanding the mechanism underlying remote control of regioselectivity provides the foundation for reengineering desaturase enzymes to create designer chemical feedstocks that would provide alternatives to those currently obtained from petrochemicals.

Monoclonal antibody-based serological methods for detection of Cucumber green mottle mosaic virus

Directory of Open Access Journals (Sweden)

Qian Yajuan

2011-05-01

Full Text Available Abstract Background Cucumber green mottle mosaic virus (CGMMV, a member of the genus Tobamovirus, can be transmitted by seeds and infects many cucurbit species, causing serious yield losses in cucumber and watermelon plants. In this paper, five serological methods including antigen-coated plate enzyme-linked immunosorbent assay (ACP-ELISA, triple antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA, Dot-immunobinding assay (DBIA, direct tissue blot immunoassay (DTBIA and immunocapture reverse transcriptase polymerase chain reaction (IC-RT-PCR were described for detection and diagnosis of CGMMV. Results Using the purified CGMMV particles as immunogens, six murine monoclonal antibodies (MAbs were produced. Five serological methods were established using the MAb 4H1 and detection sensitivity was compared using purified preparations and infected-plant tissue extracts. The detection sensitivity of ACP-ELISA was 0.16 ng of purified CGMMV, whereas TAS-ELISA was more sensitive than ACP-ELISA with a minimum detection of 0.04 ng of purified CGMMV. The sensitivities of TAS-ELISA and DBIA were similar for detecting CGMMV in infected-plant tissue extracts, and were four times higher than ACP-ELISA. The IC-RT-PCR was the most sensitive method, which could detect as little as 0.1 pg of purified virus. The detection sensitivity of IC-RT-PCR for CGMMV-infected plant tissues was about 400 times higher than that of TAS-ELISA and DBIA. Conclusions The established ACP-ELISA, TAS-ELISA, DBIA and DTBIA are suitable for routine CGMMV detection of large-scale samples in the field survey, while IC-RT-PCR is more sensitive and suitable for acquiring information about the viral genome.

Asian Citrus Psyllid Expression Profiles Suggest Candidatus Liberibacter Asiaticus-Mediated Alteration of Adult Nutrition and Metabolism, and of Nymphal Development and Immunity.

Directory of Open Access Journals (Sweden)

Meenal Vyas

Full Text Available The Asian citrus psyllid (ACP Diaphorina citri Kuwayama (Hemiptera: Psyllidae is the insect vector of the fastidious bacterium Candidatus Liberibacter asiaticus (CLas, the causal agent of citrus greening disease, or Huanglongbing (HLB. The widespread invasiveness of the psyllid vector and HLB in citrus trees worldwide has underscored the need for non-traditional approaches to manage the disease. One tenable solution is through the deployment of RNA interference technology to silence protein-protein interactions essential for ACP-mediated CLas invasion and transmission. To identify psyllid interactor-bacterial effector combinations associated with psyllid-CLas interactions, cDNA libraries were constructed from CLas-infected and CLas-free ACP adults and nymphs, and analyzed for differential expression. Library assemblies comprised 24,039,255 reads and yielded 45,976 consensus contigs. They were annotated (UniProt, classified using Gene Ontology, and subjected to in silico expression analyses using the Transcriptome Computational Workbench (TCW (http://www.sohomoptera.org/ACPPoP/. Functional-biological pathway interpretations were carried out using the Kyoto Encyclopedia of Genes and Genomes databases. Differentially expressed contigs in adults and/or nymphs represented genes and/or metabolic/pathogenesis pathways involved in adhesion, biofilm formation, development-related, immunity, nutrition, stress, and virulence. Notably, contigs involved in gene silencing and transposon-related responses were documented in a psyllid for the first time. This is the first comparative transcriptomic analysis of ACP adults and nymphs infected and uninfected with CLas. The results provide key initial insights into host-parasite interactions involving CLas effectors that contribute to invasion-virulence, and to host nutritional exploitation and immune-related responses that appear to be essential for successful ACP-mediated circulative, propagative CLas

Combining 'omics and microscopy to visualize interactions between the Asian citrus psyllid vector and the Huanglongbing pathogen Candidatus Liberibacter asiaticus in the insect gut.

Directory of Open Access Journals (Sweden)

Angela Kruse

Full Text Available Huanglongbing, or citrus greening disease, is an economically devastating bacterial disease of citrus. It is associated with infection by the gram-negative bacterium Candidatus Liberibacter asiaticus (CLas. CLas is transmitted by Diaphorina citri, the Asian citrus psyllid (ACP. For insect transmission to occur, CLas must be ingested during feeding on infected phloem sap and cross the gut barrier to gain entry into the insect vector. To investigate the effects of CLas exposure at the gut-pathogen interface, we performed RNAseq and mass spectrometry-based proteomics to analyze the transcriptome and proteome, respectively, of ACP gut tissue. CLas exposure resulted in changes in pathways involving the TCA cycle, iron metabolism, insecticide resistance and the insect's immune system. We identified 83 long non-coding RNAs that are responsive to CLas, two of which appear to be specific to the ACP. Proteomics analysis also enabled us to determine that Wolbachia, a symbiont of the ACP, undergoes proteome regulation when CLas is present. Fluorescent in situ hybridization (FISH confirmed that Wolbachia and CLas inhabit the same ACP gut cells, but do not co-localize within those cells. Wolbachia cells are prevalent throughout the gut epithelial cell cytoplasm, and Wolbachia titer is more variable in the guts of CLas exposed insects. CLas is detected on the luminal membrane, in puncta within the gut epithelial cell cytoplasm, along actin filaments in the gut visceral muscles, and rarely, in association with gut cell nuclei. Our study provides a snapshot of how the psyllid gut copes with CLas exposure and provides information on pathways and proteins for targeted disruption of CLas-vector interactions at the gut interface.

A Randomized Controlled Trial of a Cardiopulmonary Resuscitation Video in Advance Care Planning for Progressive Pancreas and Hepatobiliary Cancer Patients

Science.gov (United States)

Volandes, Angelo E.; Chen, Ling Y.; Gary, Kristen A.; Li, Yuelin; Agre, Patricia; Levin, Tomer T.; Reidy, Diane L.; Meng, Raymond D.; Segal, Neil H.; Yu, Kenneth H.; Abou-Alfa, Ghassan K.; Janjigian, Yelena Y.; Kelsen, David P.; O'Reilly, Eileen M.

2013-01-01

Abstract Background Cardiopulmonary resuscitation (CPR) is an important advance directive (AD) topic in patients with progressive cancer; however such discussions are challenging. Objective This study investigates whether video educational information about CPR engenders broader advance care planning (ACP) discourse. Methods Patients with progressive pancreas or hepatobiliary cancer were randomized to an educational CPR video or a similar CPR narrative. The primary end-point was the difference in ACP documentation one month posttest between arms. Secondary end-points included study impressions; pre- and post-intervention knowledge of and preferences for CPR and mechanical ventilation; and longitudinal patient outcomes. Results Fifty-six subjects were consented and analyzed. Rates of ACP documentation (either formal ADs or documented discussions) were 40% in the video arm (12/30) compared to 15% in the narrative arm (4/26), OR=3.6 [95% CI: 0.9–18.0], p=0.07. Post-intervention knowledge was higher in both arms. Posttest, preferences for CPR had changed in the video arm but not in the narrative arm. Preferences regarding mechanical ventilation did not change in either arm. The majority of subjects in both arms reported the information as helpful and comfortable to discuss, and they recommended it to others. More deaths occurred in the video arm compared to the narrative arm, and more subjects died in hospice settings in the video arm. Conclusions This pilot randomized trial addressing downstream ACP effects of video versus narrative decision tools demonstrated a trend towards more ACP documentation in video subjects. This trend, as well as other video effects, is the subject of ongoing study. PMID:23725233

Response of tissue lysosomes in Gamma-irradiated rats and possible modulation through diclofenac treatment

International Nuclear Information System (INIS)

Hassan, S.H.S.; Abu-Ghadeer, A.R.M.; Osman, S.A.A.

1995-01-01

The effect of pre and post-irradiation treatment of rats with diclofenac (5 mg kg-1) for modulating the damaging effect of radiation on tissue lysosomes was investigated. The parameters used for this study were the activity level of acid phosphatase (ACP) and acid ribonuclease (RNase) activities, both being hydrolytic enzymes of lysosomes. The activities of ACP and RNase in liver, spleen, intestine, kidney, lung and brain were determined at different times up to 14 days after irradiation (4(Gy). Lysosomal affection was represented by time dependent significant increase in ACP activity in all the tissue homogenates of the investigated organs 3, 7 and 14 days after irradiation at 4 Gy. Gamma irradiation at 4 Gy resulted also in a significant rise in RNase activity of all the tissue organs 3 days post-irradiation. However, gradual decrease in the enzyme activity was recorded 7 and 14 days following irradiation. Diclofenac, pre (as prophylactic) and post (as therapeutic) irradiation treatment of rats successfully restored the increase in the enzymatic activities of ACP and RNase nearly to their normal levels in all the investigated organs. The beneficial effect of diclofenac inhibited completely the effect of irradiation at 14 days post-exposure. 2 figs., 2 tabs

Comparison between the effects of trigger point mesotherapy versus acupuncture points mesotherapy in the treatment of chronic low back pain: a short term randomized controlled trial.

Science.gov (United States)

Di Cesare, Annalisa; Giombini, Arrigo; Di Cesare, Mariachiara; Ripani, Maurizio; Vulpiani, Maria Chiara; Saraceni, Vincenzo Maria

2011-02-01

The goal of this study was to compare the effects of trigger point (TRP) mesotherapy and acupuncture (ACP) mesotherapy in the treatment of patients with chronic low back pain. Short term randomized controlled trial. 62 subjects with chronic low back pain were recruited at outpatients Physical Medicine and Rehabilitation Clinic at the University of Rome "La Sapienza" in the period between July 2006 and May 2008. Study subjects were assigned to receive 4 weeks treatments with either trigger point mesotherapy (TRP mesotherapy, n=29) or acupoints mesotherapy (ACP mesotherapy, n=33). Pain intensity with a pain visual analogic scale (VAS) and verbal rating scale (VRS) and pain disability with McGill Pain Questionnaire Short Form (SFMPQ), Roland Morris Disability Questionnaire (RMQ) and Oswestry Low Back Pain Disability Questionaire (ODQ). ACP mesotherapy shows a more effective results in VRS and VAS measures in the follow-up (p(VRS)=mesotherapy group. Our results suggest that the response to ACP mesotherapy may be greater than the response to TRP mesotherapy in the short term follow-up. This technique could be nevertheless a viable option as an adjunct treatment in an overall treatment planning of CLBP. Copyright © 2010 Elsevier Ltd. All rights reserved.

Are the criteria of Tabar and Dean still relevant to radial scar?

Energy Technology Data Exchange (ETDEWEB)

Boute, Veronique [Department of Senology, Centre Francois Baclesse, 14076 Caen, Cedex 5 (France); Goyat, Isabelle [Department of Senology, Centre Francois Baclesse, 14076 Caen, Cedex 5 (France); Denoux, Yves [Department of Pathology, Centre Francois Baclesse, 14076 Caen, Cedex 5 (France); Lacroix, Joelle [Department of Senology, Centre Francois Baclesse, 14076 Caen, Cedex 5 (France); Marie, Brigitte [Department of Senology, Centre Francois Baclesse, 14076 Caen, Cedex 5 (France); Michels, Jean-J. [Department of Pathology, Centre Francois Baclesse, 14076 Caen, Cedex 5 (France)]. E-mail: michels@baclesse.fr

2006-11-15

Objective: Aschoff's center of proliferation (ACP), poses significant problems of differential diagnosis both in imagery and histology with infiltrating carcinoma. Up to now the criteria of Tabar and Dean (classical criteria) are considered as diagnostically relevant. Material: A retrospective study of 113 cases, enabled us to study their clinical, radiological and histological aspects. Results: The ACP is a subclinical and seldom palpable entity (12%). The radiological signs of ACP are quite variable. The classical criteria lack specificity and are observed only in 48% of our stellate images. Whereas the frequency of microcalcifications is high (58.5% of the cases), their presence and their type are not predictive of an associated malignancy. The echographic diagnosis of ACP could be made in 55% of the cases but the echographic semiology lacked specificity. We noticed an associated atypical epithelial hyperplasia in 28.5% of the cases, intraductal or lobular in situ carcinoma in 9% and/or a ductal invasive carcinoma in 2% of the cases. Neither tumor size, age of the patients, nor any radiological signs were predictive of such an association. Conclusions: The classical criteria are not completely reliable and are observed only in half of our stellate images, whereas microcalcifications are often present but are not predictive of an associated malignancy.

An Innovative Approach to Treat Incisors Hypomineralization (MIH): A Combined Use of Casein Phosphopeptide-Amorphous Calcium Phosphate and Hydrogen Peroxide-A Case Report.

Science.gov (United States)

Mastroberardino, Stefano; Campus, Guglielmo; Strohmenger, Laura; Villa, Alessandro; Cagetti, Maria Grazia

2012-01-01

Molar Incisor Hypomineralization (MIH) is characterized by a developmentally derived deficiency in mineral enamel. Affected teeth present demarcated enamel opacities, ranging from white to brown; also hypoplasia can be associated. Patient frequently claims aesthetic discomfort if anterior teeth are involved. This problem leads patients to request a bleaching treatment to improve aestheticconditions.Nevertheless, hydrogen peroxide can produce serious side-effects, resulting from further mineral loss. Microabrasion and/or a composite restoration are the treatments of choice in teeth with mild/moderate MIH, but they also need enamel loss. Recently, a new remineralizing agent based on Casein Phosphopeptide-Amorphous Calcium Phosphate (CPP-ACP) has been proposed to be effective in hypomineralized enamel, improving also aesthetic conditions. The present paper presents a case report of a young man with white opacities on incisors treated with a combined use of CPP-ACP mousse and hydrogen peroxide gel to correct the aesthetic defect. The patient was instructed to use CPP-ACP for two hours per day for three months in order to obtain enamel remineralization followed by a combined use of CPP-ACP and bleaching agent for further two months. At the end of this five-month treatment, a noticeable aesthetic improvement of the opacities was observed.

An Innovative Approach to Treat Incisors Hypomineralization (MIH: A Combined Use of Casein Phosphopeptide-Amorphous Calcium Phosphate and Hydrogen Peroxide—A Case Report

Directory of Open Access Journals (Sweden)

Stefano Mastroberardino

2012-01-01

Full Text Available Molar Incisor Hypomineralization (MIH is characterized by a developmentally derived deficiency in mineral enamel. Affected teeth present demarcated enamel opacities, ranging from white to brown; also hypoplasia can be associated. Patient frequently claims aesthetic discomfort if anterior teeth are involved. This problem leads patients to request a bleaching treatment to improve aestheticconditions.Nevertheless, hydrogen peroxide can produce serious side-effects, resulting from further mineral loss. Microabrasion and/or a composite restoration are the treatments of choice in teeth with mild/moderate MIH, but they also need enamel loss. Recently, a new remineralizing agent based on Casein Phosphopeptide-Amorphous Calcium Phosphate (CPP-ACP has been proposed to be effective in hypomineralized enamel, improving also aesthetic conditions. The present paper presents a case report of a young man with white opacities on incisors treated with a combined use of CPP-ACP mousse and hydrogen peroxide gel to correct the aesthetic defect. The patient was instructed to use CPP-ACP for two hours per day for three months in order to obtain enamel remineralization followed by a combined use of CPP-ACP and bleaching agent for further two months. At the end of this five-month treatment, a noticeable aesthetic improvement of the opacities was observed.

Paediatric advance care planning survey: a cross-sectional examination of congruence and discordance between adolescents with HIV/AIDS and their families.

Science.gov (United States)

Lyon, Maureen E; Dallas, Ronald H; Garvie, Patricia A; Wilkins, Megan L; Garcia, Ana; Cheng, Yao Iris; Wang, Jichuan

2017-09-21

To identify patient-reported paediatric advance care planning (pACP) needs of adolescents living with HIV and to examine the congruence with their family's perception of their needs. A cross-sectional survey among six paediatric hospital-based outpatient HIV specialty clinics. Participants included 48 adolescent/family dyads (n=96 participants) within a larger study facilitating pACP. The main outcome measure was the Lyon Advance Care Planning Survey - Adolescent and Surrogate Versions-Revised. Adolescents' mean age was 18 years (range ≥14-congruence in pACP needs within adolescent/family dyads. There was substantial congruence in that being free from pain (PABAK=0.83), and understanding your treatment choices (PABAK=0.92) were very important or important. There was discordance about being off machines that extend life (PABAK=0.08) and when is the best time to bring up EOL decisions (PABAK=0.32). Areas of discordance were associated with life-sustaining choices and when to have the EOL conversation. Targeted, adolescent/family-centred, evidence-based pACP interventions are needed to improve family understanding of youth's EOL wishes. NCT01289444; Results. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

A novel fluorescence biosensor for sensitivity detection of tyrosinase and acid phosphatase based on nitrogen-doped graphene quantum dots.

Science.gov (United States)

Qu, Zhengyi; Na, Weidan; Liu, Xiaotong; Liu, Hua; Su, Xingguang

2018-01-02

In this paper, we developed a sensitive fluorescence biosensor for tyrosinase (TYR) and acid phosphatase (ACP) activity detection based on nitrogen-doped graphene quantum dots (N-GQDs). Tyrosine could be catalyzed by TYR to generate dopaquinone, which could efficiently quench the fluorescence of N-GQDs, and the degree of fluorescence quenching of N-GQDs was proportional to the concentration of TYR. In the presence of ACP, l-Ascorbic acid-2-phosphate (AAP) was hydrolyzed to generate ascorbic acid (AA), and dopaquinone was reduced to l-dopa, resulting in the fluorescence recovery of the quenched fluorescence by dopaquinone. Thus, a novel fluorescence biosensor for the detection of TYR and ACP activity based on N-GQDs was constructed. Under the optimized experimental conditions, the fluorescence intensity was linearly correlated with the concentration of TYR and ACP in the range of 0.43-3.85 U mL -1 and 0.04-0.7 mU mL -1 with a detection limit of 0.15 U mL -1 and 0.014 mU mL -1 , respectively. The feasibility of the proposed biosensor in real samples assay was also studied and satisfactory results were obtained. Copyright © 2017 Elsevier B.V. All rights reserved.

TOR complex 2 localises to the cytokinetic actomyosin ring and controls the fidelity of cytokinesis.

Science.gov (United States)

Baker, Karen; Kirkham, Sara; Halova, Lenka; Atkin, Jane; Franz-Wachtel, Mirita; Cobley, David; Krug, Karsten; Maček, Boris; Mulvihill, Daniel P; Petersen, Janni

2016-07-01

The timing of cell division is controlled by the coupled regulation of growth and division. The target of rapamycin (TOR) signalling network synchronises these processes with the environmental setting. Here, we describe a novel interaction of the fission yeast TOR complex 2 (TORC2) with the cytokinetic actomyosin ring (CAR), and a novel role for TORC2 in regulating the timing and fidelity of cytokinesis. Disruption of TORC2 or its localisation results in defects in CAR morphology and constriction. We provide evidence that the myosin II protein Myp2 and the myosin V protein Myo51 play roles in recruiting TORC2 to the CAR. We show that Myp2 and TORC2 are co-dependent upon each other for their normal localisation to the cytokinetic machinery. We go on to show that TORC2-dependent phosphorylation of actin-capping protein 1 (Acp1, a known regulator of cytokinesis) controls CAR stability, modulates Acp1-Acp2 (the equivalent of the mammalian CAPZA-CAPZB) heterodimer formation and is essential for survival upon stress. Thus, TORC2 localisation to the CAR, and TORC2-dependent Acp1 phosphorylation contributes to timely control and the fidelity of cytokinesis and cell division. © 2016. Published by The Company of Biologists Ltd.

Localization and dynamics of Wolbachia infection in Asian citrus psyllid Diaphorina citri, the insect vector of the causal pathogens of Huanglongbing.

Science.gov (United States)

Ren, Su-Li; Li, Yi-Han; Ou, Da; Guo, Yan-Jun; Qureshi, Jawwad A; Stansly, Philip A; Qiu, Bao-Li

2018-03-23

Wolbachia is a group of intracellular bacteria that infect a wide range of arthropods including the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama. This insect is the vector of Candidatus Liberibacter asiaticus (CLas), the causal pathogen of Huanglongbing or citrus greening disease. Here, we investigated the localization pattern and infection dynamics of Wolbachia in different developmental stages of ACP. Results revealed that all developmental stages of ACP including egg, 1st-5th instar nymphs, and adults of both gender were infected with Wolbachia. FISH visualization of an ACP egg showed that Wolbachia moved from the egg stalk of newly laid eggs to a randomly distributed pattern throughout the egg prior to hatching. The infection rate varied between nymphal instars. The titers of Wolbachia in fourth and fifth instar nymphs were significantly higher than those in the first and second instar nymphs. Wolbachia were scattered in all nymphal stages, but with highest intensity in the U-shaped bacteriome located in the abdomen of the nymph. Wolbachia was confined to two symmetrical organizations in the abdomen of newly emerged female and male adults. The potential mechanisms of Wolbachia infection dynamics are discussed. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Odorants for surveillance and control of the Asian Citrus Psyllid (Diaphorina citri.

Directory of Open Access Journals (Sweden)

Iliano V Coutinho-Abreu

Full Text Available The Asian Citrus Psyllid (ACP, Diaphorina citri, can transmit the bacterium Candidatus Liberibacter while feeding on citrus flush shoots. This bacterium causes Huanglongbing (HLB, a major disease of citrus cultivation worldwide necessitating the development of new tools for ACP surveillance and control. The olfactory system of ACP is sensitive to variety of odorants released by citrus plants and offers an opportunity to develop new attractants and repellents.In this study, we performed single-unit electrophysiology to identify odorants that are strong activators, inhibitors, and prolonged activators of ACP odorant receptor neurons (ORNs. We identified a suite of odorants that activated the ORNs with high specificity and sensitivity, which may be useful in eliciting behavior such as attraction. In separate experiments, we also identified odorants that evoked prolonged ORN responses and antagonistic odorants able to suppress neuronal responses to activators, both of which can be useful in lowering attraction to hosts. In field trials, we tested the electrophysiologically identified activating odorants and identified a 3-odor blend that enhances trap catches by ∼230%.These findings provide a set of odorants that can be used to develop affordable and safe odor-based surveillance and masking strategies for this dangerous pest insect.

Probing the Selectivity and Protein•Protein Interactions of a Non-Reducing Fungal Polyketide Synthase Using Mechanism-Based Crosslinkers

Science.gov (United States)

Bruegger, Joel; Haushalter, Bob; Vagstad, Anna; Shakya, Gaurav; Mih, Nathan; Townsend, Craig A.; Burkart, Michael D.; Tsai, Shiou-Chuan

2013-01-01

SUMMARY Protein•protein interactions, which often involve interactions between an acyl carrier protein (ACP) and its partner enzymes, are important for coordinating polyketide biosynthesis. However, the nature of such interactions is not well understood, especially in the fungal non-reducing polyketide synthases (NR-PKSs) that biosynthesize toxic and pharmaceutically important polyketides. Here, we employ a mechanism-based crosslinker to successfully probe ACP and ketosynthase (KS) domain interactions in NR-PKSs. We found that crosslinking efficiency is closely correlated with the strength of ACP•KS interactions, and that KS demonstrates strong starter unit selectivity. We further identified positively charged surface residues by KS mutagenesis, which mediate key interactions with the negatively-charged ACP surface. Such complementary/matching contact pairs can serve as “adapter surfaces” for future efforts to generate new polyketides using NR-PKSs. PMID:23993461

Determination of complex formation constants by phase sensitive alternating current polarography: Cadmium-polymethacrylic acid and cadmium-polygalacturonic acid.

Science.gov (United States)

Garrigosa, Anna Maria; Gusmão, Rui; Ariño, Cristina; Díaz-Cruz, José Manuel; Esteban, Miquel

2007-10-15

The use of phase sensitive alternating current polarography (ACP) for the evaluation of complex formation constants of systems where electrodic adsorption is present has been proposed. The applicability of the technique implies the previous selection of the phase angle where contribution of capacitive current is minimized. This is made using Multivariate Curve Resolution by Alternating Least Squares (MCR-ALS) in the analysis of ACP measurements at different phase angles. The method is checked by the study of the complexation of Cd by polymethacrylic (PMA) and polygalacturonic (PGA) acids, and the optimal phase angles have been ca. -10 degrees for Cd-PMA and ca. -15 degrees for Cd-PGA systems. The goodness of phase sensitive ACP has been demonstrated comparing the determined complex formation constants with those obtained by reverse pulse polarography, a technique that minimizes the electrode adsorption effects on the measured currents.

Noninvasive mechanical ventilation in chronic obstructive pulmonary disease and in acute cardiogenic pulmonary edema.

Science.gov (United States)

Rialp Cervera, G; del Castillo Blanco, A; Pérez Aizcorreta, O; Parra Morais, L

2014-03-01

Noninvasive ventilation (NIV) with conventional therapy improves the outcome of patients with acute respiratory failure due to hypercapnic decompensation of chronic obstructive pulmonary disease (COPD) or acute cardiogenic pulmonary edema (ACPE). This review summarizes the main effects of NIV in these pathologies. In COPD, NIV improves gas exchange and symptoms, reducing the need for endotracheal intubation, hospital mortality and hospital stay compared with conventional oxygen therapy. NIV may also avoid reintubation and may decrease the length of invasive mechanical ventilation. In ACPE, NIV accelerates the remission of symptoms and the normalization of blood gas parameters, reduces the need for endotracheal intubation, and is associated with a trend towards lesser mortality, without increasing the incidence of myocardial infarction. The ventilation modality used in ACPE does not affect the patient prognosis. Copyright © 2012 Elsevier España, S.L. y SEMICYUC. All rights reserved.

Effect of release sheet on the preparation of CF paper/aluminium phosphate composite; Tanso sen`i paper/rinsan aluminium fukugo zairyo choseiji ni okeru hakurizai no eikyo

Energy Technology Data Exchange (ETDEWEB)

Hoshii, S.; Kojima, A. [Gunma National College of Technology, Gunma (Japan); Otani, S. [Tokai University, Tokyo (Japan). School of High-Technology for Human Walfare

1995-12-27

A composite material was prepared with carbon fiber (CF) and a matrix of phosphate (as named ACP) mainly consisting of aluminum phosphate. CF was used in the form of felt cloth. Prepreg was made with CF and ACP, which was laminated and formed under pressure in a hot press into a composite. The prepreg was pretreated by drying at 80{degree}C to form a compact matrix and to increase the adhesion between laminated prepregs. At the hot press treatment thorough removal of water was tried by using absorbent sheet and release sheet to form a compact structure. Consequently, porosity of CF/ACP composite decreased, and its bulk density and bending strength increased. SEM observation showed the formation of vitreous and compact matrix. Besides, adhesion between prepregs and shear fracture resistance were improved. 24 refs., 3 figs., 3 tabs.

Progress of experimental research on nuclear safety in NPIC

Energy Technology Data Exchange (ETDEWEB)

Gong, Houjun; Zan, Yuanfeng; Peng, Chuanxin; Xi, Zhao; Zhang, Zhen; Wang, Ying; He, Yanqiu; Huang, Yanping [Nuclear Power Institute of China, Chengdu (China)

2016-05-15

Two kinds of Generation III commercial nuclear power plants have been developed in CNNC (China National Nuclear Corporation), one is a small modular reactor ACP100 having an equivalent electric power 100 MW, and the other is HPR1000 (once named ACP1000) having an equivalent electric power 1 000 MW. Both NPPs widely adopted the design philosophy of advanced passive safety systems and considered the lessons from Fukushima Daichi nuclear accident. As the backbone of the R and D of ACP100 and HPR1000, NPIC (Nuclear power Institute of China) has finished the engineering verification test of main safety systems, including passive residual heat removal experiments, reactor cavity injection experiments, hydrogen combustion experiments, and passive autocatalytic recombiner experiments. Above experimental work conducted in NPIC and further research plan of nuclear safety are introduced in this paper.

Milk enzyme activities and subclinical mastitis among women in Guinea-Bissau

DEFF Research Database (Denmark)

Rasmussen, Lill Brith Wium; Hartvig, Ditte Luise; Kæstel, Pernille

2008-01-01

research as indicators of SCM, udder health, and milk quality. Study Design: To investigate if milk enzyme activities and the inflammatory interleukin 8 (IL-8) level are increased in women with SCM, we measured sodium, potassium, NAGase, LDH, AcP, AP, and IL-8 in breastmilk samples collected at 2 months......Background: Subclinical mastititis (SCM) is a condition with raised milk concentration of sodium and milk immune factors. The milk enzymes N-acetyl-β-D-glucosaminidase (NAGase), lactate dehydrogenase (LDH), acid phosphatase (AcP), and alkaline phosphatase (AP) have attracted attention in dairy...... in univariate linear regression (p enzymes and IL-8). Conclusions: A positive association between the Na/K ratio and the breastmilk enzymes NAGase, LDH, AcP, and AP was found. Breastmilk enzymes have not previously been investigated in relation to SCM in women, and further...

The Lome Conventions and Their Implications for the United States,

Science.gov (United States)

1981-11-01

domestic1consumption (Benin, 1977), a devaluation of the local currency (Sudan, 1978) or, most frequently, a decline in the share of production traditionally...increasing amounts of oil from Nigeria and minerals from other ACP states. Meanwhile, the continental Comounity mmbers continued to import most of their...the IMF has far more stringent repayment terms than does STABEX. Nevertheless, the CFF remains a more important source of "bailout" funds for ACP

Clinicohemodynamic and roentgenologic correlations in patients with artificial pacemakers

International Nuclear Information System (INIS)

Tatarchenko, I.P.; Iskenderov, B.G.; Koledinov, V.I.; Zhivotovskaya, G.G.

1987-01-01

The clinical pattern, central hemodynamics and roentgenologic data are studied in 34 patients with artificial cardiac pacemaker (ACP) to solve the problem on adequate medicamental therapy of heart failure (HF). Heart sizes and the state of a pulmonary image are estimated roentgenologically. Two types of cardiac-vessel system reactions on physical load: adequate and nonadequate - are detected. Implantation of ACP in patients with the nonadequate reaction does not lead to total liquidation of HF

Clinicohemodynamic and roentgenologic correlations in patients with artificial pacemakers

Energy Technology Data Exchange (ETDEWEB)

Tatarchenko, I P; Iskenderov, B G; Koledinov, V I; Zhivotovskaya, G G

1987-05-01

The clinical pattern, central hemodynamics and roentgenologic data are studied in 34 patients with artificial cardiac pacemaker (ACP) to solve the problem on adequate medicamental therapy of heart failure (HF). Heart sizes and the state of a pulmonary image are estimated roentgenologically. Two types of cardiac-vessel system reactions on physical load: adequate and nonadequate - are detected. Implantation of ACP in patients with the nonadequate reaction does not lead to total liquidation of HF.

Physicians’ experience adopting the electronic transfer of care communication tool: barriers and opportunities

Directory of Open Access Journals (Sweden)

de Grood C

2015-01-01

Full Text Available Chloe de Grood, Katherine Eso, Maria Jose Santana Department of Community Health Sciences, W21C Research and Innovation Centre, Institute of Public Health, University of Calgary, Calgary, AB, Canada Purpose: The purpose of this study was to assess physicians' perceptions on a newly developed electronic transfer of care (e-TOC communication tool and identify barriers and opportunities toward its adoption. Participants and methods: The study was conducted in a tertiary care teaching center as part of a randomized controlled trial assessing the efficacy of an e-TOC communication tool. The e-TOC technology was developed through iterative consultation with stakeholders. This e-TOC summary was populated by acute care physicians (AcPs and communicated electronically to community care physicians (CcPs. The AcPs consisted of attending physicians, resident trainees, and medical students rotating through the Medical Teaching Unit. The CcPs were health care providers caring for patients discharged from hospital to the community. AcPs and CcPs completed validated surveys assessing their experience with the newly developed e-TOC tool. Free text questions were added to gather general comments from both groups of physicians. Units of analysis were individual physicians. Data from the surveys were analyzed using mixed methods. Results: AcPs completed 138 linked pre- and post-rotation surveys. At post-rotation, each AcP completed an average of six e-TOC summaries, taking an average of 37 minutes per e-TOC summary. Over 100 CcPs assessed the quality of the TOC summaries, with an overall rating of 8.3 (standard deviation: 1.48; on a scale of 1–10. Thematic analyses revealed barriers and opportunities encountered by physicians toward the adoption of the e-TOC tool. While the AcPs highlighted issues with timeliness, usability, and presentation, the CcPs identified barriers accessing the web-based TOC summaries, emphasizing that the summaries were timely and the

Effect of the PREPARE Website vs an Easy-to-Read Advance Directive on Advance Care Planning Documentation and Engagement Among Veterans: A Randomized Clinical Trial.

Science.gov (United States)

Sudore, Rebecca L; Boscardin, John; Feuz, Mariko A; McMahan, Ryan D; Katen, Mary T; Barnes, Deborah E

2017-08-01

Documentation rates of patients' medical wishes are often low. It is unknown whether easy-to-use, patient-facing advance care planning (ACP) interventions can overcome barriers to planning in busy primary care settings. To compare the efficacy of an interactive, patient-centered ACP website (PREPARE) with an easy-to-read advance directive (AD) to increase planning documentation. This was a comparative effectiveness randomized clinical trial from April 2013 to July 2016 conducted at multiple primary care clinics at the San Francisco VA Medical Center. Inclusion criteria were age of a least 60 years; at least 2 chronic and/or serious conditions; and 2 or more primary care visits; and 2 or more additional clinic, hospital, or emergency room visits in the last year. Participants were randomized to review PREPARE plus an easy-to-read AD or the AD alone. There were no clinician and/or system-level interventions or education. Research staff were blinded for all follow-up measurements. The primary outcome was new ACP documentation (ie, legal forms and/or discussions) at 9 months. Secondary outcomes included patient-reported ACP engagement at 1 week, 3 months, and 6 months using validated surveys of behavior change process measures (ie, 5-point knowledge, self-efficacy, readiness scales) and action measures (eg, surrogate designation, using a 0-25 scale). We used intention-to-treat, mixed-effects logistic and linear regression, controlling for time, health literacy, race/ethnicity, baseline ACP, and clustering by physician. The mean (SD) age of 414 participants was 71 (8) years, 38 (9%) were women, 83 (20%) had limited literacy, and 179 (43%) were nonwhite. No participant characteristic differed significantly among study arms at baseline. Retention at 6 months was 90%. Advance care planning documentation 6 months after enrollment was higher in the PREPARE arm vs the AD-alone arm (adjusted 35% vs 25%; odds ratio, 1.61 [95% CI, 1.03-2.51]; P = .04). PREPARE also resulted

Mutational analysis of the myxovirescin biosynthetic gene cluster reveals novel insights into the functional elaboration of polyketide backbones.

Science.gov (United States)

Simunovic, Vesna; Müller, Rolf

2007-07-23

It has been proposed that two acyl carrier proteins (ACPs)-TaB and TaE--and two 3-hydroxy-3-methylglutaryl synthases (HMGSs)--TaC and TaF--could constitute two functional ACP-HMGS pairs (TaB/TaC and TaE/TaF) responsible for the incorporation of acetate and propionate units into the myxovirescin A scaffold, leading to the formation of beta-methyl and beta-ethyl groups, respectively. It has been suggested that three more proteins--TaX and TaY, which are members of the superfamily of enoyl-CoA hydratases (ECHs), and a variant ketosynthase (KS) TaK--are shared between two ACP-HMGS pairs, to give the complete set of enzymes required to perform the beta-alkylations. The beta-methyl branch is presumably further hydroxylated (by TaH) and methylated to produce the methoxymethyl group observed in myxovirescin A. To substantiate this hypothesis, a series of gene-deletion mutants were created, and the effects of these mutations on myxovirescin production were examined. As predicted, DeltataB and DeltataE ACP mutants revealed similar phenotypes to their associated HMGS mutants DeltataC and DeltataF, respectively, thus providing direct evidence for the role of TaE/TaF in the formation of the beta-ethyl branch and implying a role for TaB/TaC in the formation of the beta-methyl group. Production of myxovirescin A was dramatically reduced in a DeltataK mutant and abolished in both the DeltataX and the DeltataY mutant backgrounds. Analysis of a DeltataH mutant confirmed the role of the cytochrome P450 TaH in hydroxylation of the beta-methyl group. Taken together, these experiments support a model in which the discrete ACPs TaB and TaE are compatible only with their associated HMGSs TaC and TaF, respectively, and function in a substrate-specific manner. Both TaB and TaC are essential for myxovirescin production, and the TaB/TaC pair can rescue antibiotic production in the absence of either TaE or TaF. Finally, the reduced level of myxovirescin production in the DeltataE mutant

Analysis of Taiwan patents for the medicinal mushroom "Niu-Chang- Chih".

Science.gov (United States)

Chen, Yu-Fen; Lu, Wen-Ling; Wu, Ming-Der; Yuan, Gwo-Fang

2013-04-01

"Niu-Chang-Chih" (Antrodia cinnanomea) is a medicinal mushroom that has only been collected from the aromatic tree, Cinnamomum kanehirai, which is native to Taiwan. A total of 105 Taiwan patent applications and patents for "Niu-Chang-Chih" were collected and analyzed. Patent applications and granted patents claiming newly identified functional components from "Niu-Chang-Chih," biologically pure cultures of the mushroom strain, and cultivation of "Niu-Chang-Chih" were examined. Several applications and patents claim identified active compounds from "Niu-Chang- Chih," which provide better patent protection. These newly identified functional compounds include cyclohexanones, maleic and succinic acid derivatives, labdane diterpenoids, and benzenoids. Newly identified functional proteins include a glutathione-dependent formaldehyde dehydrogenase (GFD), a glycoprotein named ACA1, and a laccase. Newly identified functional polysaccharides include ACP1, ACP2, and ACP3. The number of patents for newly identified compounds and their uses are expected to continue growing.

Low temperature preparation of α-tricalcium phosphate and its mechanical properties

Directory of Open Access Journals (Sweden)

Song Wang

2017-06-01

Full Text Available In this work, α-tricalcium phosphate (α-TCP was successfully prepared by the thermal transformation of amorphous calcium phosphate (ACP precursor. β-cyclodextrin (β-CD was used for preparation of ACP precursor and played an important role in designing its special structure. The phase composition and microstructures of the obtained α-TCP at different annealing temperature were analysed by X-ray diffraction and scanning electron microscope, and confirmed that α-TCP can be prepared at 650°C for 3 h using ACP as precursor, which is much lower than the phase transition temperature of α-TCP. Mechanical properties were tested 24 h after mixing the obtained α-TCP with 30 wt.% of deionised water. The compressive strength and the flexural strength were 26.4MPa and 12.0MPa, respectively. The flexural strength was higher than that of α-TCP prepared by other methods.

Why don't end-of-life conversations go viral? A review of videos on YouTube.

Science.gov (United States)

Mitchell, Imogen A; Schuster, Anne L R; Lynch, Thomas; Smith, Katherine Clegg; Bridges, John F P; Aslakson, Rebecca A

2017-06-01

To identify videos on YouTube concerning advance care planning (ACP) and synthesise existing video content and style elements. Informed by stakeholder engagement, two researchers searched YouTube for ACP videos using predefined search terms and snowballing techniques. Videos identified were reviewed and deemed ineligible for analysis if they: targeted healthcare professionals; contained irrelevant content; focused on viewers under the age of 18; were longer than 7 min in duration; received fewer than 150 views; were in a language other than English; or were a duplicate version. For each video, two investigators independently extracted general information as well as video content and stylistic characteristics. The YouTube search identified 23 100 videos with 213 retrieved for assessment and 42 meeting eligibility criteria. The majority of videos had been posted to YouTube since 2010 and produced by organisations in the USA (71%). Viewership ranged from 171 to 10 642. Most videos used a documentary style and featured healthcare providers (60%) rather than patients (19%) or families (45%). A minority of videos (29%) used upbeat or hopeful music. The videos frequently focused on completing legal medical documents (86%). None of the ACP videos on YouTube went viral and a relatively small number of them contained elements endorsed by stakeholders. In emphasising the completion of legal medical documents, videos may have failed to support more meaningful ACP. Further research is needed to understand the features of videos that will engage patients and the wider community with ACP and palliative and end-of-life care conversations. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Results of Absolute Cavity Pyrgeometer and Infrared Integrating Sphere Comparisons

Energy Technology Data Exchange (ETDEWEB)

Reda, Ibrahim M [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Sengupta, Manajit [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Dooraghi, Michael R [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Grobner, Julian [Physikalisch-Meteorologisches Observatorium Davos (PMOD); Thomann, Christian [Physikalisch-Meteorologisches Observatorium Davos (PMOD); Long, Chuck [National Oceanic and Atmospheric Administration; McComiskey, Allison [National Oceanic and Atmospheric Administration; Hall, Emiel [National Oceanic and Atmospheric Administration; Wacker, Stefan [Deutscher Wetterdienst

2018-03-05

Accurate and traceable atmospheric longwave irradiance measurements are required for understanding radiative impacts on the Earth's energy budget. The standard to which pyrgeometers are traceable is the interim World Infrared Standard Group (WISG), maintained in the Physikalisch-Meteorologisches Observatorium Davos (PMOD). The WISG consists of four pyrgeometers that were calibrated using Rolf Philipona's Absolute Sky-scanning Radiometer [1]. The Atmospheric Radiation Measurement (ARM) facility has recently adopted the WISG to maintain the traceability of the calibrations of all Eppley precision infrared radiometer (PIR) pyrgeometers. Subsequently, Julian Grobner [2] developed the infrared interferometer spectrometer and radiometer (IRIS) radiometer, and Ibrahim Reda [3] developed the absolute cavity pyrgeometer (ACP). The ACP and IRIS were developed to establish a world reference for calibrating pyrgeometers with traceability to the International System of Units (SI). The two radiometers are unwindowed with negligible spectral dependence, and they are traceable to SI units through the temperature scale (ITS-90). The two instruments were compared directly to the WISG three times at PMOD and twice at the Southern Great Plains (SGP) facility to WISG-traceable pyrgeometers. The ACP and IRIS agreed within +/- 1 W/m2 to +/- 3 W/m2 in all comparisons, whereas the WISG references exhibit a 2-5 Wm2 low bias compared to the ACP/IRIS average, depending on the water vapor column, as noted in Grobner et al. [4]. Consequently, a case for changing the current WISG has been made by Grobner and Reda. However, during the five comparisons the column water vapor exceeded 8 mm. Therefore, it is recommended that more ACP and IRIS comparisons should be held under different environmental conditions and water vapor column content to better establish the traceability of these instruments to SI with established uncertainty.

Mechanism and Stereochemistry of Polyketide Chain Elongation and Methyl Group Epimerization in Polyether Biosynthesis.

Science.gov (United States)

Xie, Xinqiang; Garg, Ashish; Khosla, Chaitan; Cane, David E

2017-03-01

The polyketide synthases responsible for the biosynthesis of the polyether antibiotics nanchangmycin (1) and salinomycin (4) harbor a number of redox-inactive ketoreductase (KR 0 ) domains that are implicated in the generation of C2-epimerized (2S)-2-methyl-3-ketoacyl-ACP intermediates. Evidence that the natural substrate for the polyether KR 0 domains is, as predicted, a (2R)-2-methyl-3-ketoacyl-ACP intermediate, came from a newly developed coupled ketosynthase (KS)-ketoreductase (KR) assay that established that the decarboxylative condensation of methylmalonyl-CoA with S-propionyl-N-acetylcysteamine catalyzed by the Nan[KS1][AT1] didomain from module 1 of the nanchangmycin synthase generates exclusively the corresponding (2R)-2-methyl-3-ketopentanoyl-ACP (7a) product. In tandem equilibrium isotope exchange experiments, incubation of [2- 2 H]-(2R,3S)-2-methyl-3-hydroxypentanoyl-ACP (6a) with redox-active, epimerase-inactive EryKR6 from module 6 of the 6-deoxyerythronolide B synthase and catalytic quantities of NADP + in the presence of redox-inactive, recombinant NanKR1 0 or NanKR5 0 , from modules 1 and 5 of the nanchangmycin synthase, or recombinant SalKR7 0 from module 7 of the salinomycin synthase, resulted in first-order, time-dependent washout of deuterium from 6a. Control experiments confirmed that this washout was due to KR 0 -catalyzed isotope exchange of the reversibly generated, transiently formed oxidation product [2- 2 H]-(2R)-2-methyl-3-ketopentanoyl-ACP (7a), consistent with the proposed epimerase activity of each of the KR 0 domains. Although they belong to the superfamily of short chain dehydrogenase-reductases, the epimerase-active KR 0 domains from polyether synthases lack one or both residues of the conserved Tyr-Ser dyad that has previously been implicated in KR-catalyzed epimerizations.

Economic (gross cost) analysis of systematically implementing a programme of advance care planning in three Irish nursing homes.

Science.gov (United States)

O'Sullivan, Ronan; Murphy, Aileen; O'Caoimh, Rónán; Cornally, Nicola; Svendrovski, Anton; Daly, Brian; Fizgerald, Carol; Twomey, Cillian; McGlade, Ciara; Molloy, D William

2016-04-26

Although advance care planning (ACP) and the use of advanced care directives (ACD) and end-of-life care plans are associated with a reduction in inappropriate hospitalisation, there is little evidence supporting the economic benefits of such programmes. We assessed the economic impact (gross savings) of the Let Me Decide (LMD) ACP programme in Ireland, specifically the impact on hospitalisations, bed days and location of resident deaths, before and after systematic implementation of the LMD-ACP combined with a palliative care education programme. The LMD-ACP was introduced into three long-term care (LTC) facilities in Southern Ireland and outcomes were compared pre and post implementation. In addition, 90 staff were trained in a palliative care educational programme. Economic analysis including probabilistic sensitivity analysis was performed. The uptake of an ACD or end-of-life care post-implementation rose from 25 to 76%. Post implementation, there were statistically significant decreases in hospitalisation rates from baseline (hospitalisation incidents declined from 27.8 to 14.6%, z = 3.96, p Economic analysis suggested a cost-reduction related to reduced hospitalisations ranging between €10 and €17.8 million/annum and reduction in ambulance transfers, estimated at €0.4 million/annum if these results were extrapolated nationally. When unit costs and LOS estimates were varied in scenario analyses, the expected cost reduction owing to reduced hospitalisations, ranged from €17.7 to €42.4 million nationally. Implementation of the LMD-ACP (ACD/end-of-life care plans combined with palliative care education) programme resulted in reduced rates of hospitalisation. Despite an increase in LOS, likely reflecting more complex care needs of admitted residents, gross costs were reduced and scenario analysis projected large annual savings if these results were extrapolated to the wider LTC population in Ireland.

Surface remineralization potential of casein phosphopeptide-amorphous calcium phosphate on enamel eroded by cola-drinks: An in-situ model study

Directory of Open Access Journals (Sweden)

Navneet Grewal

2013-01-01

Full Text Available Aim: The aim of this study was to investigate the remineralization potential of casein phosphopeptide-amorphous calcium phosphate (CPP-ACP on enamel eroded by cola drinks. Subjects and Methods: A total of 30 healthy subjects were selected from a random sample of 1200 children and divided into two groups of 15 each wherein calcium and phosphorus analyses and scanning electron microscope (SEM analysis was carried out to investigate the remineralization of enamel surface. A total of 30 non-carious premolar teeth were selected from the human tooth bank (HTB to prepare the in-situ appliance. Three enamel slabs were prepared from the same. One enamel slab was used to obtain baseline values and the other two were embedded into the upper palatal appliances prepared on the subjects′ maxillary working model. The subjects wore the appliance after which 30 ml cola drink exposure was given. After 15 days, the slabs were removed and subjected to respective analysis. Statistical Analysis Used: Means of all the readings of soluble calcium and phosphorous levels at baseline,post cola-drink exposure and post cpp-acp application were subjected to statistical analysis SPSS11.5 version.Comparison within groups and between groups was carried out using ANOVA and F-values at 1% level of significance. Results: Decrease in calcium solubility of enamel in the CPP-ACP application group as compared to post-cola drink exposure group (P < 0.05 was seen. Distinctive change in surface topography of enamel in the post-CPP-ACP application group as compared to post-cola drink exposure group was observed. Conclusion: CPP-ACP significantly promoted remineralization of enamel eroded by cola drinks as revealed by significant morphological changes seen in SEM magnification and spectrophotometric analyses.

High fidelity does not preclude colonization: range expansion of molting Black Brant on the Arctic coast of Alaska

Science.gov (United States)

Flint, Paul L.; Meixell, Brandt W.; Mallek, Edward J.

2014-01-01

High rates of site fidelity have been assumed to infer static distributions of molting geese in some cases. To test this assumption, we examined movements of individually marked birds to understand the underlying mechanisms of range expansion of molting Black Brant (Branta bernicla nigricans) on the Arctic Coastal Plain (ACP) of Alaska. The Teshekpuk Lake Special Area (TLSA) on the ACP was created to protect the primary molting area of Brant. When established in 1977, the TLSA was thought to include most, if not all, wetlands used by molting Brant on the ACP. From 2010 to 2013, we surveyed areas outside the TLSA and counted an average of 9800 Brant per year, representing 29–37% of all molting Brant counted on the ACP. We captured and banded molting Brant in 2011 and 2012 both within the TLSA and outside the TLSA at the Piasuk River Delta and Cape Simpson to assess movements of birds among areas across years. Estimates of movement rates out of the TLSA exceeded those into the TLSA, demonstrating overall directional dispersal. We found differences in sex and age ratios and proportions of adult females with brood patches, but no differences in mass dynamics for birds captured within and outside the TLSA. Overall fidelity rates to specific lakes (0.81, range = 0.49–0.92) were unchanged from comparable estimates obtained in the early 1990s. We conclude that Brant are dispersing from the TLSA into new molting areas while simultaneously redistributing within the TLSA, likely as a consequence of changes in relative habitat quality. Shifts in distribution resulted from colonization of new areas by young birds as well as low levels of directional dispersal of birds that previously molted in the TLSA. Based on combined counts, the overall number of molting Brant across the ACP has increased substantially.

The Effect of Casein Phosphopeptide-Amorf Calcium Phosphate and Acidulated Phosphate Fluoride Gel on Dental Erosion in Primary Teeth: An in Vitro Study.

Science.gov (United States)

Maden, Eda Arat; Acar, Özge; Altun, Ceyhan; Polat, Günseli Güven

This study aimed to investigate the effect of acidulated phosphate fluoride (APF) gel and casein phosphopeptide/amorphous calciumphosphate (CPP-ACP) on the dental erosion produced by carbonated soft drink in primary teeth. This study evaluated by an in vitro model the effect of APF gel and CPP-ACP on the dental enamel previously subjected to erosive challenge with carbonated soft drink. Sixty sound human primary molars were prepared by embedding the crown sections in acrylic resin blocks leaving the enamel surfaces exposed. The surface roughness of the enamel was measured with prophilometry at baseline. Specimens were randomly divided into three treatment groups (n:20): artificial saliva, CPP-ACP, 1.23% APF gel. All specimens were then exposed to an erosive challenge of carbonated soft drink and artificial saliva for 20 cycles of 20 seconds each. Demineralization-remineralization cycles was repeated twice at eight-hour intervals and roughness values were measured. Enamel samples were treated with artificial saliva, CPP-ACP, 1.23% APF gel applied for 10 min after erosive challenge. The arithmetic average roughness (Ra) readings were recorded after remineralization agents were applied. The mean surface roughness in all groups increased significantly after erosion process and decreased after remineralization treatment. After treatment, the mean surface roughness of the 1.23% APF gel group was significantly less than the other groups and the mean surface roughness of the artificial saliva group was significantly more than the other groups. 1.23% APF gel showed the highest protective effect against erosive enamel loss. Under the conditions of this study, artificial saliva, CPP-ACP and 1.23% APF treatments were able to reduce erosive enamel loss produced by carbonated soft drink in primary teeth. However, 1.23% APF gel showed the highest protective effect against erosive enamel loss.

Fluoride Varnishes against Dental Erosion Caused by Soft Drink Combined with Pediatric Liquid Medicine.

Science.gov (United States)

Alexandria, Adílis Kalina; Valença, Ana Maria Gondim; Cabral, Lúcio Mendes; Maia, Lucianne Cople

2017-01-01

The present study evaluated the effect of NaF and CPP-ACP/NaF varnishes to reduce erosion produced by soft drink (SD) combined or not with pediatric liquid medicine. Enamel specimens were pre-treated with fluoride varnish, according to the following groups: NaF varnish (Duraphat®) or CPP-ACP/NaF varnish (MI varnishTM). Two types of erosive cycles were made: by soft drink erosion (SDE) or by pediatric liquid medicine plus soft drink erosion (PLM/SDE). Bovine enamel specimens were randomly assigned in six groups (n=10): G1=NaF + SDE; G2=CPP-ACP/NaF + SDE; G3=Distilled and deionized (DD) water + SDE; G4=NaF + PLM/SDE; G5=CPP-ACP/NaF + PLM/SDE and G6=DD water + PLM/SDE. Before treatments, the sample surface was divided in two areas (unexposed area-UA and exposed area-EA). The specimens were evaluated by 3D non-contact profilometry technique to determinate tooth structure loss (TSL) and surface roughness (Sa). Scanning electron microscopy (SEM) analysis was also performed. After SDE, G2 presented the lowest TSL values compared to G3 (p=0.008). G1 and G2 did not differ between them (p=0.203) and no groups differed among them despite Sa. Regarding TSL and Sa, G4 and G5 differed from G6 (p=0.0001), but not between them (p=1.00). Examining 3D and SEM images, the greatest differences between UA and EA were observed for G3 and G6. CPP-ACP/NaF varnish seems to be a promising treatment to reduce enamel loss from the erosion produced by a soft drink. Both varnishes also showed capacity to reduce TSL and Sa after erosion by soft drink combined to pediatric liquid medicine.

Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

Science.gov (United States)

Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

2012-06-01

Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

Clinico-chemical studies on subacute cadmium poisoning in rabbits

Energy Technology Data Exchange (ETDEWEB)

Yoshikawa, H; Ohsawa, M; Kaneta, M

1974-01-01

GOT, GPT, LDH, total Ac-P, prostatic Ac-P, cholesterol, free fatty acid, Ca, and P in plasma were measured once a week on rabbits injected subcutaneously with 0.5 and 1.0 mg Cd/kg daily for 11 weeks respectively, and Cd, Cu, Mn, and Zn contents in organs were determined at the termination of the experiment. Prostatic Ac-P activity, cholesterol, and free fatty acid levels in plasma rose in the early stage of administration, and GOT, GPT, LDH, and Al-P activities rose in the latter stage of administration. Ca and P levels in plasma did not change in any periods of the experiment. From these results, it could be concluded that a measurement of prostatic Ac-P, cholesterol, and free fatty acid is adequate to evaluate excess intake of Cd. Cd contents in heart, lungs, spleen, and testes of rabbits injected with 1.0 mg Cd/kg increased significantly compared with those with 0.5 mg Cd/kg, but a difference between the two groups in Cd contents in liver, kidneys and submandibular glands which contained high concentration of Cd was not recognized. Zn contents in organs of rabbits injected with Cd increased remarkably, while Cu contents decreased generally. This phenomenon was especially remarkable in liver and kidneys. 31 references, 7 figures, 2 tables.

Does the calcification of adamantinomatous craniopharyngioma resemble the calcium deposition of osteogenesis/odontogenesis?

Science.gov (United States)

Song-Tao, Qi; Xiao-Rong, Yan; Jun, Pan; Yong-Jian, Deng; Jin, Liang; Guang-Long, Huang; Yun-Tao, Lu; Jian, Ruan; Xiang-Zhao, Li; Jia-Ming, Xu

2014-02-01

Calcification in adamantinomatous craniopharyngioma (ACP) is troublesome for surgical intervention. The aim of this study was to examine the osteogenic proteins that play important roles in the calcium deposition of the odontogenic/osteogenic tissues in craniopharyngioma. Craniopharyngiomas (n = 89) were investigated for the presence and expression pattern of the osteoinductive/odontoinductive factor bone morphogenetic protein-2 (Bmp2) and two osteoblastic differentiation makers, Runt-related transcription factor-2 (Runx2) and Osterix, using immunohistochemistry and Western blotting. Our results showed that Bmp2, Runx2 and Osterix levels increased in cases with high calcification and correlated positively with the degree of calcification in ACP, whereas they showed little or no expression in squamous papillary craniopharyngioma. In ACP, Bmp2 was expressed primarily in the stellate reticulum and whorl-like array cells; Runx2 and Osterix tended to be expressed in calcification-related epithelia, including whorl-like array cells and epithelia in/around wet keratin and calcification lesions. Our study indicated, for the first time, that osteogenic factor Bmp2 may play an important role in the calcification of ACP via autocrine or paracrine mechanisms. Given the presence of osteogenic markers (Runx2 and Osterix), craniopharyngioma cells could differentiate into an osteoblast-like lineage, and the process of craniopharyngioma calcification resembles that which occurs in osteogenesis/odontogenesis. © 2014 John Wiley & Sons Ltd.

Antisense oligonucleotides targeting translation inhibitory elements in 5' UTRs can selectively increase protein levels.

Science.gov (United States)

Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T

2017-09-19

A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Rice varieties in relation to rice bread quality.

Science.gov (United States)

Han, Hye Min; Cho, Jun Hyeon; Kang, Hang Won; Koh, Bong Kyung

2012-05-01

It is difficult to predict rice bread quality only from the amylose content (AC) or dough characteristics of new lines produced by rice breeding programmes. This study investigated the AC relative to bread baking quality of rice varieties developed in Korea, and identified specific characteristics that contribute to rice bread quality. Manmibyeo, Jinsumi, Seolgaeng and Hanareumbyeo were classified as low AC, YR24088 Acp9, Suweon517, Chenmaai and Goamibyeo as intermediate AC and Milyang261 as high AC. Suweon517, Milyang261 and Manmibyeo had a high water absorption index (WAI), while Goamibyeo, YR24088 Acp9, Jinsumi, Seolgaeng, Hanareumbyeo and Chenmaai had a low WAI. The gelatinisation enthalpy of flour varied from 9.2 J g(-1) in Milyang261 to 14.8 J g(-1) in YR24088 Acp9. After 7 days of storage the rate of flour retrogradation and crumb firmness were weakly correlated, with the exception of Jinsumi. Bread volumes of Jinsumi, Chenmaai, YR24088 Acp9 and Goamibyeo were comparable to that of wheat flour, but the rest were unsuited to bread making because of their low volume and hard crumb texture. Based on volume, texture and crumb firmness ratio, Chenmaai and Goamibyeo were the most appropriate varieties for making bread. An intermediate AC and low WAI were the primary indicators of rice bread flour quality. Copyright © 2011 Society of Chemical Industry.

From Allergens to Battery Anodes: Nature-Inspired, Pollen Derived Carbon Architectures for Room- and Elevated- Temperature Li-ion Storage

Science.gov (United States)

Tang, Jialiang; Pol, Vilas G.

2016-02-01

The conversion of allergic pollen grains into carbon microstructures was carried out through a facile, one-step, solid-state pyrolysis process in an inert atmosphere. The as-prepared carbonaceous particles were further air activated at 300 °C and then evaluated as lithium ion battery anodes at room (25 °C) and elevated (50 °C) temperatures. The distinct morphologies of bee pollens and cattail pollens are resembled on the final architecture of produced carbons. Scanning Electron Microscopy images shows that activated bee pollen carbon (ABP) is comprised of spiky, brain-like, and tiny spheres; while activated cattail pollen carbon (ACP) resembles deflated spheres. Structural analysis through X-ray diffraction and Raman spectroscopy confirmed their amorphous nature. X-ray photoelectron spectroscopy analysis of ABP and ACP confirmed that both samples contain high levels of oxygen and small amount of nitrogen contents. At C/10 rate, ACP electrode delivered high specific lithium storage reversible capacities (590 mAh/g at 50 °C and 382 mAh/g at 25 °C) and also exhibited excellent high rate capabilities. Through electrochemical impedance spectroscopy studies, improved performance of ACP is attributed to its lower charge transfer resistance than ABP. Current studies demonstrate that morphologically distinct renewable pollens could produce carbon architectures for anode applications in energy storage devices.

Autologous proliferative therapies in recalcitrant lateral epicondylitis.

Science.gov (United States)

Tetschke, Elisa; Rudolf, Margit; Lohmann, Christoph H; Stärke, Christian

2015-09-01

This study investigates the clinical effects of autologous conditioned plasma (ACP) injections and low-level laser application as therapy options for chronic lateral epicondylitis. A total of 52 patients with chronic lateral epicondylitis were evaluated in this study; 26 of these patients received three ACP injections and the control group, with 26 patients, received 12 laser applications, with standardized physical therapy for all patients afterward. Control examinations took place before treatment, after 2 and 6 mos, and in the 1 yr final follow-up. The control examination included the visual analog scale for pain and Disabilities of the Arm, Shoulder and Hand outcome measure scores. The analysis at final follow-up after 1 yr showed that both treatment options resulted in successful therapy outcome for the patients. In total, 63.5 % were successfully treated. Successful treatment was defined as more than 30% improvement in the visual analog score and more than 10.2 points in the Disabilities of the Arm, Shoulder and Hand score. Both groups showed a significant improvement in time response. This study demonstrates the beneficial effects of autologous proliferative therapies in the treatment of lateral epicondylitis. The data show that laser application and ACP therapy lead to a clinical improvement in epicondylopathia. Especially the new treatment with ACP can be highlighted as an alternative and as an easy-to-apply therapy option for clinical practice.

[A multidiscipline clinical and biological approach to the study of psychotic types of autistic spectrum disorders in children].

Science.gov (United States)

Simashkova, N V; Iakupova, L P; Kliushnik, T P; Koval'-Zaĭtsev, A A

2013-01-01

The current problem of heterogeneity of psychotic types of autistic spectrum disorders (ASD) is reviewed. The authors present results of a multidiscipline psychopathological, pathopsychological, neurophysiological and immunological examination of 87 patients, aged from 3 to 14 years, with psychotic types of ASD: childhood psychosis (CP) and atypical childhood psychosis (ACP). Significant differences in clinical presentations of CP and ACP that were correlated with pathopsychological, neurophysiological and immunological disorders were found. These findings support different nosological entities of these types of ASD.

Blair's Hill Nursing Home, Blair's Hill, Sunday's Well, Cork.

LENUS (Irish Health Repository)

Cornally, Nicola

2015-11-01

The \\'Let Me Decide\\' Advance Care Planning (LMD-ACP) programme offers a structured approach to End-of-Life (EoL) care planning in long-term care for residents with and without capacity to complete an advance care directive\\/plan. The programme was implemented in three homes in the South of Ireland, with a view to improving quality of care at end of life. This paper will present an evaluation of the systematic implementation of the LMD-ACP programme in the homes.

TLC City West, Cooldown Commons, Fortunestown Lane, Citywest, Co. Dublin.

LENUS (Irish Health Repository)

Cornally, Nicola

2015-11-01

The \\'Let Me Decide\\' Advance Care Planning (LMD-ACP) programme offers a structured approach to End-of-Life (EoL) care planning in long-term care for residents with and without capacity to complete an advance care directive\\/plan. The programme was implemented in three homes in the South of Ireland, with a view to improving quality of care at end of life. This paper will present an evaluation of the systematic implementation of the LMD-ACP programme in the homes.

St. John's Hospital, Ballytivnan, Sligo.