WorldWideScience

Sample records for inha enoil-acp redutase

  1. Screening of a Novel Fragment Library with Functional Complexity against Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C

    2018-04-06

    Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  2. Mutações no gene da metilenotetrahidrofolato redutase e síndrome de Down

    Directory of Open Access Journals (Sweden)

    Laura Brunelli das Neves Grillo

    2002-12-01

    Full Text Available Sindrome de Down (SD é uma alteração genética e metabólica complexa atribuída à presença de três cópias do cromossomo 21. O cromossomo extra em 93% dos casos é de origem materna e é resultante de uma segregação anormal durante a meiose (não-disjunção. Com exceção da idade materna avançada, fatores de risco para a não-disjunção meiótica não estão bem estabelecidos. Um estudo preliminar sugeriu que o metabolismo anormal do folato e a mutação 677 (C->T no gene da metilenotetrahidrofolato redutase (MTHFR podem ser fatores de risco maternos para a SD. A freqüência das mutações MTHFR 677 (C->T e 1.298 (A->C foram avaliadas em 36 mães de crianças com SD e em 200 indivíduos-controle. Os resultados demonstraram que as mutações 677 (C->T e 1.298 (A->C são mais prevalentes entre mães de crianças com SD do que nos controles. A heterozigose das duas mutações foi a combinação mais freqüente. O resultado desse estudo inicial sugere que mutações no gene da MTHFR seriam um fator de risco para a SD.

  3. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology.

    Science.gov (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A

    2016-12-06

    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  4. Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor

    Directory of Open Access Journals (Sweden)

    María Martínez-Hoyos

    2016-06-01

    Full Text Available Despite being one of the first antitubercular agents identified, isoniazid (INH is still the most prescribed drug for prophylaxis and tuberculosis (TB treatment and, together with rifampicin, the pillars of current chemotherapy. A high percentage of isoniazid resistance is linked to mutations in the pro-drug activating enzyme KatG, so the discovery of direct inhibitors (DI of the enoyl-ACP reductase (InhA has been pursued by many groups leading to the identification of different enzyme inhibitors, active against Mycobacterium tuberculosis (Mtb, but with poor physicochemical properties to be considered as preclinical candidates. Here, we present a series of InhA DI active against multidrug (MDR and extensively (XDR drug-resistant clinical isolates as well as in TB murine models when orally dosed that can be a promising foundation for a future treatment.

  5. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent (CNRS-UMR); (Einstein); (TAM)

    2011-08-24

    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.

  6. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis.

    Science.gov (United States)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C; Jacobs, William R; Kremer, Laurent

    2010-12-01

    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA_T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development. © 2010 Blackwell Publishing Ltd.

  7. Multiple receptor conformers based molecular docking study of fluorine enhanced ethionamide with mycobacterium enoyl ACP reductase (InhA).

    Science.gov (United States)

    Khan, Akib Mahmud; Shawon, Jakaria; Halim, Mohammad A

    2017-10-01

    A major limitation in current molecular docking method is that of failure to account for receptor flexibility. Herein we report multiple receptor conformers based molecular docking as a practical alternative to account for the receptor flexibility. Multiple (forty) conformers of Mycobacterium Enoyl ACP Reductase (InhA) are generated from Molecular Dynamics simulation and twenty crystallographic structures of InhA bound to different inhibitors are obtained from the Protein Data Bank. Fluorine directed modifications are performed to currently available anti-tuberculosis drug ethionamide. The modified drugs are optimized using B3LYP 6-31G (d,p) level of theory. Dipole moment, frontier orbital gap and thermodynamical properties such as electronic energy, enthalpy and Gibbs free energy of these optimized drugs are investigated. These drugs are subsequently docked against the conformers of InhA. Molecular docking against multiple InhA conformations show variation in ligand binding affinity and suggest that Ser94, Gly96, Lys165 and Ile194 amino acids play critical role on strong drug-InhA interaction. Modified drug N1 showed greater binding affinity compared to EN in most conformations. Structure of PDB ID: 2NSD and snapshot conformer at 5.5ns show most favorable binding with N1 compared to other conformers. Fluorine participates in forming fluorine bonds and contributes significantly in increasing binding affinity. Our study reveal that addition of trifluoromethyl group explicitly shows promise in improving thermodynamic properties and in enhancing hydrogen bonding and non-bonded interactions. Molecular dynamics (MD) simulation show that EN and N1 remained in the binding pocket similar to the docked pose of EN-InhA and E1-InhA complexes and also suggested that InhA binds to its inhibitor in inhibitor-induced folding manner. ADMET calculations predict modified drugs to have improved pharmacokinetic properties. Our study concludes that multiple receptor conformers based

  8. AMPLIFIKASI DAN IDENTIFIKASI MUTASI REGIO PROMOTER inhA PADA ISOLAT Mycobacterium tuberculosis MULTIDRUG RESISTANCE DENGAN TEKNIK POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum

    2014-10-01

    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  9. Miopatia por deficiência de succinato-citocromo-C-redutase: possível defeito no complexo II da cadeia respiratória

    Directory of Open Access Journals (Sweden)

    Lineu Cesar Werneck

    1989-12-01

    Full Text Available Relato do caso de mulher de 24 anos de idade que apresentava astenia desde a puberdade, com agravamento nos últimos anos, cuja biópsia muscular revelou grande acúmulo de mitocôndrias. As dosagens dos enzimas mitocondriais mostrou importante redução da succinato-citocromo-C-redutase, sugerindo defeito na cadeia respiratória a nível do complexo II. Medicada com altas doses de vitamina C e K, melhorou da força muscular. São feitas considerações a respeito das principais síndromes com miopatias mitocondriais, bem como a respeito dos métodos de investigação em defeitos da cadeia respiratória.

  10. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability.

    Science.gov (United States)

    Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A

    2017-07-05

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

  11. Contribution of katG, ahpC and inhA mutations to the detection of isoniazid-resistant Mycobacterium tuberculosis isolates from Lebanon and Syria

    Directory of Open Access Journals (Sweden)

    F Dabboussi

    2015-01-01

    Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.

  12. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability

    OpenAIRE

    Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.

    2017-01-01

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...

  13. An Effective Approach for Clustering InhA Molecular Dynamics Trajectory Using Substrate-Binding Cavity Features.

    Directory of Open Access Journals (Sweden)

    Renata De Paris

    Full Text Available Protein receptor conformations, obtained from molecular dynamics (MD simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to

  14. Rational Modulation of the Induced-Fit Conformational Change for Slow-Onset Inhibition in Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Lai, Cheng-Tsung; Li, Huei-Jiun; Yu, Weixuan; Shah, Sonam; Bommineni, Gopal R; Perrone, Victoria; Garcia-Diaz, Miguel; Tonge, Peter J; Simmerling, Carlos

    2015-08-04

    Slow-onset enzyme inhibitors are the subject of considerable interest as an approach to increasing the potency of pharmaceutical compounds by extending the residence time of the inhibitor on the target (the lifetime of the drug-receptor complex). However, rational modulation of residence time presents significant challenges because it requires additional mechanistic insight, such as the nature of the transition state for postbinding isomerization. Our previous work, based on X-ray crystallography, enzyme kinetics, and molecular dynamics simulation, suggested that the slow step in inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA involves a change in the conformation of the substrate binding loop from an open state in the initial enzyme-inhibitor complex to a closed state in the final enzyme-inhibitor complex. Here, we use multidimensional free energy landscapes for loop isomerization to obtain a computational model for the transition state. The results suggest that slow-onset inhibitors crowd key side chains on helices that slide past each other during isomerization, resulting in a steric clash. The landscapes become significantly flatter when residues involved in the steric clash are replaced with alanine. Importantly, this lower barrier can be increased by rational inhibitor redesign to restore the steric clash. Crystallographic studies and enzyme kinetics confirm the predicted effects on loop structure and flexibility, as well as inhibitor residence time. These loss and regain of function studies validate our mechanistic hypothesis for interactions controlling substrate binding loop isomerization, providing a platform for the future design of inhibitors with longer residence times and better in vivo potency. Similar opportunities for slow-onset inhibition via the same mechanism are identified in other pathogens.

  15. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  16. Encoded library technology as a source of hits for the discovery and lead optimization of a potent and selective class of bactericidal direct inhibitors of Mycobacterium tuberculosis InhA.

    Science.gov (United States)

    Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas

    2014-02-27

    Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.

  17. ACCUMULATION OF NITROGEN COMPOUNDS AND NITRATE REDUCTASE ACTIVITY IN LETTUCE CULTIVATED IN DIFFERENT CROP SYSTEMS ACÚMULO DE COMPOSTOS NITROGENADOS E ATIVIDADE DA REDUTASE DO NITRATO EM ALFACE PRODUZIDA EM DIFERENTES SISTEMAS DE CULTIVO

    Directory of Open Access Journals (Sweden)

    Fernanda Nunes Ibrahim

    2008-09-01

    limits recommended by literature.

    KEY-WORDS: Vegetables; quality; nitrite; metabolism of nitrogen.

    O teor de nitrato é um importante índice da qualidade dos alimentos, pois quando ingerido nitrato é reduzido a nitrito, o qual pode gerar compostos prejudiciais ao organismo humano. Diante disso, o presente trabalho teve como objetivo estudar o transporte e acúmulo de compostos nitrogenados e a atividade da enzima redutase do nitrato em alface cultivar 'Vera' produzida em Registro (SP em diferentes sistemas de cultivo. Foram coletadas amostras da seiva do xilema, da parte aérea e da raiz das plantas para quantificação de compostos nitrogenados e atividade da redutase do nitrato in vivo. A concentração de nitrato na seiva xilema, os teores de nitrato e aminoácidos, bem como a atividade da redutase do nitrato, demonstraram transporte, acumulação e assimilação mais intensos em plantas cultivadas em hidroponia, seguido do sistema convencional e por último, do orgânico. O caule da planta nos três sistemas de cultivo apresentou capacidade elevada de acumulação e assimilação de compostos nitrogenados. A atividade da redutase do nitrato nas folhas foi superior a da raiz. O teor de nitrato, independente do sistema de cultivo, variou de 24,32 a 800,06 mg Kg-1 de MF nas diferentes partes da planta. Contudo, não excedeu os limites máximos recomendados pela literatura.

  18. Correlations of mutations in katG, oxyR-ahpC and inhA genes and in vitro susceptibility in Mycobacterium tuberculosis clinical strains segregated by spoligotype families from tuberculosis prevalent countries in South America

    Directory of Open Access Journals (Sweden)

    Suffys Philip N

    2009-02-01

    Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.

  19. Methylenetetrahydrofolate reductase gene polymorphism is not related to the risk of ischemic cerebrovascular disease in a Brazilian population Polimorfismo no gene de metilenetetrahidrofolato redutase não está relacionado com o risco de doença cerebrovascular isquêmica em uma população brasileira

    Directory of Open Access Journals (Sweden)

    Samuel Katsuyuki Shinjo

    2007-01-01

    Full Text Available PURPOSE: Data are conflicting concerning the risk for ischemic stroke associated with a common polymorphism in the gene encoding 5,10-methylenetetrahydrofolate reductase C677T, which predisposes carriers to hyperhomocysteinemia. A meta-analysis study suggested that the 5,10-methylenetetrahydrofolate reductase 677TT genotype might have a small influence in determining susceptibility to ischemic stroke. METHODS: We analyzed the 5,10-methylenetetrahydrofolate reductase 677TT genotype polymorphism in Brazilian subjects with ischemic stroke, using a case-control design. RESULTS: We compared 5,10-methylenetetrahydrofolate reductase genotypes in groups of subjects presenting ischemic stroke (n = 127 and normal control (n = 126 and found an odds ratio of 1.97 (95% CI, 0.84-4.64 in a multivariate analysis in which results were adjusted to baseline clinical characteristics of study participants. CONCLUSION: We found that the homozygous 5,10-methylenetetrahydrofolate reductase C677T genotype was not a risk factor for ischemic stroke in these Brazilian subjects.OBJETIVO: Os dados são conflitantes em relação a risco de acidente cerebrovascular associado a polimorfismo do gene 5,10-metilenetetrahidrofolato redutase C677T, o qual predispõe a hiperhomocisteinemia. Um estudo de meta-análise sugere que o genotipo 5,10-metilenetetrahidrofolato redutase 677TT poderia ter uma pequena influência em determinar susceptibilidade a acidente cerebrovascular. MÉTODOS: Analisamos este polimorfismo em indivíduos brasileiros com acidente cerebrovascular isquêmico, baseando-se em um estudo de caso-controle. RESULTADOS: Comparamos os genótipos 5,10-metilenetetrahidrofolato redutase em grupos de indivíduos com acidente cerebrovascular isquêmico (n=127 e controle normal (n=126, e encontramos Odds Ratio de 1,97 (IC 95% 0,84 - 4,64 em uma análise multivariada, na qual os resultados foram ajustados a características clínicas basais dos indivíduos estudados. DISCUSS

  20. A conservative region of the mercuric reductase gene (merA as a molecular marker of bacterial mercury resistance Região conservada do gene da mercúrio redutase (merA como marcador molecular da resistência bacteriana ao mercúrio

    Directory of Open Access Journals (Sweden)

    Adriana Sotero-Martins

    2008-06-01

    Full Text Available The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II to Hg0, which is dependent of the mercuric reductase enzyme (MerA activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains.O mecanismo de resistência bacteriana ao mercúrio mais comum é baseada na redução do Hg(II a Hg0, através da atividade da enzima mercúrio redutase (MerA. O uso do fragmento de 431 pb amplificado de uma região conservada do gene merA, que codifica a enzima MerA,foi utilizado como marcador molecular deste mecanismo, permitindo a identificação de bactérias resistentes ao mercúrio.

  1. Avaliação do polimorfismo no gene da metilenotetrahidrofolato redutase e concentração de folato e vitamina B12 em pacientes portadores do HIV-1 em tratamento com anti-retrovirais Evaluation of the polymorphisms in methylenetetrahydrofolate reductase gene and the levels of folate and B12 in HIV-infected patients under antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Iran Malavazi

    2004-12-01

    Full Text Available Neste trabalho, investigamos concentração da vitamina B12 e folato, considerando-se a influência dos genótipos da metilenotetrahidrofolato redutase, o perfil imunológico e a terapia antiretroviral utilizada na população brasileira portadora do HIV. Um grupo de 86 indivíduos portadores do HIV-1 e 29 doadores de sangue foram recrutados para compor a casuística. Entre os infectados pelo HIV-1, observou-se menor concentração de B12 no grupo com maior número de linfócitos TCD4+. Não encontramos diferença na distribuição genotípica para as mutações MTHFR C677T e A1298C entre infectados e não infectados pelo HIV-1. Indivíduos portadores do HIV, genótipo C677C, apresentaram concentrações menores de B12 em relação ao grupo controle de mesmo genótipo. A terapia antiretroviral não mostrou qualquer influência nos valores de folato e vitamina B12. Estudos adicionais são necessários para reavaliar a prevalência de menores concentrações de B12 e folato e de hiperhomocisteinemia na população portadora do HIV sob a ótica do uso de HAART e da melhoria na sobrevida dos pacientes.In this study we sought to investigate the B12 and folate levels regarding the influence of methylenetetrahydrofolate reductase genotypes, immunological profile and antiretroviral therapy in the Brazilian HIV-infected population. The study group comprised 89 HIV-infected individuals and 29 blood donors. There was a decrease in the B12 levels in the HIV-infected group with higher TCD4+ lymphocyte counts. No differences in the genotype distribution for methylenetetrahydrofolate reductase polymorphisms between the HIV-infected individuals and the controls were found. HIV-infected individuals carrying the C677C genotype presented lower B12 levels (313.91 ± 154.05 than those with the same genotype in the control group (408.27 ± 207.69. Also, the antiretroviral therapy was not a source of variation of the folate and B12 serum levels. Further studies are

  2. Mecanismos de acción y de resistencia a rifampicina e isoniacida en Mycobacterium tuberculosis: nueva información sobre viejos conocidos Mechanisms of action of and resistance to rifampicin and isoniazid in Mycobacterium tuberculosis: new information on old friends

    Directory of Open Access Journals (Sweden)

    A. I. De la Iglesia

    2006-04-01

    Full Text Available La tuberculosis constituye todavía una de la causas más frecuentes de mortalidad en el mundo. A pesar de la implementación de tratamientos con cuatro drogas antituberculosas, la aparición de cepas resistentes y multirresistentes ha comprometido la eficacia de los mismos. Dos de las drogas en uso, la rifampicina y la isoniacida, recibieron gran atención por su importancia terapéutica, incluso se han identificado los genes involucrados en los mecanismos de resistencia y los que codifican para sus blancos moleculares. La rifampicina es un inhibidor de la subunidad beta de la ARN polimerasa de procariotas, incluido Mycobacterium tuberculosis. La resistencia a esta droga está principalmente mediada por mutaciones agrupadas en una región del gen rpoB. Una pequeña fracción de cepas resistentes no mostró mutaciones en rpoB, lo que sugiere la existencia de otros mecanismos de resistencia, posiblemente eflujo de la droga. La isoniacida es una prodroga que se activa por la catalasa-peroxidasa KatG. Mutaciones en katG son las más comúnmente identificadas en cepas clínicas de M. tuberculosis resistentes a isoniacida, confiriendo altos niveles de resistencia. Sin embargo, el blanco molecular de acción para la isoniacida es la InhA, una enoil-ACP reductasa involucrada en la vía de síntesis de los ácidos micólicos. Otras mutaciones involucradas en la resistencia a la isoniacida afectan al gen ndh, que codifica para la NADH deshidrogenasa.Human tuberculosis is still one of the most frequent causes of death worldwide. Despite the implementation of therapeutic regimes combining four drugs, the rise of resistant and multidrug-resistant Mycobacterium tuberculosis strains has compromised their efficacy. Two of the most effective anti-tubercular drugs in use, rifampicin and isoniazid, have been closely studied due to their therapeutic importance. These studies have led to the identification of the genes involved in resistance mechanisms and of those

  3. The frequency of β-globin gene haplotypes, α-thalassemia and genetic polymorphisms of methylenetetrahydrofolate reductase, factor V Leiden and prothrombin genes in children with sickle cell disease in Rio de Janeiro, Brazil Frequência dos haplótipos da globina beta, da talassemia alfa e dos polimorfismos genéticos dos genes da metilenotetrahidrofolato redutase, do fator V Leiden e da protrombina em crianças com doença falciforme no Rio de Janeiro, Brasil

    Directory of Open Access Journals (Sweden)

    Isaac L. Silva Filho

    2010-02-01

    Full Text Available A freqüência dos haplótipos beta S e beta C do gene da globina e a prevalência de talassemia alfa e de mutações nos genes da metilenotetrahidrofolato redutase (MTHFR-C677T, do fator V de Leiden e da protrombina (G20210A foi estudada em crianças com doença falciforme do Rio de Janeiro. O haplótipo Bantu foi o mais freqüente (65,9%, 21,2% das crianças (18% heterozigotas e 3% homozigotas apresentam talassemia com mutação alfa 3.7kb, ao contrário da mutação alfa 4.2kb que não foi encontrada. Os alelos 677CT e 677TT da MTHFR foram observados em 20,2% e 4,8%, respectivamente. Os haplótipos Camarões, Árabe-Indiano e Senegal não foram detectados na amostra estudada, bem como mutações no gene do fator V de Leiden e da protrombina. Somente o haplótipo beta C CI foi observado. Esse é o primeiro estudo realizado em uma amostra proveniente do Programa de Triagem Neonatal para Hemoglobinopatias do estado do Rio de Janeiro. Apesar do Rio de Janeiro ser a segunda maior cidade brasileira e seus habitantes expressarem o elevado grau de miscigenação ocorrida no país, nossos resultados ainda coincidem com os registros históricos dos fluxos migratórios do gene beta S para o Brasil, bem como refletem a forte influência de indivíduos de origem africana na população do Rio de Janeiro.

  4. Biomass accumulation, photochemical efficiency of photosystem II, nutrient contents and nitrate reductase activity in young rosewood plants (Aniba rosaeodora Ducke submitted to different NO3-:NH4+ ratios Acúmulo de biomassa, eficiência fotoquímica do fotossistema II, conteúdo de nutrientes e atividade da redutase do nitrato em plantas jovens de pau-rosa (Aniba rosaeodora Ducke submetidas a diferentes relações NO3-:NH4+

    Directory of Open Access Journals (Sweden)

    Denize Caranhas de Sousa Barreto

    2007-01-01

    Full Text Available The rosewood (Aniba rosaeodora Ducke is a native tree species of Amazon rainforest growing naturally in acidic forest soils with reduced redox potential. However, this species can also been found growing in forest gaps containing oxide soils. Variations in the forms of mineral nitrogen (NO3- or NH4+ may be predicted in these different edaphic conditions. Considering that possibility, an experiment was carried out to analyze the effects of different NO3-:NH4+ ratios on the growth performance, mineral composition, chloroplastid pigment contents, photochemical efficiency photosystem II (PSII, and nitrate redutase activity (RN, E.C.1.6.6.1 on A. rosaeodora seedlings. Nine-month-old seedlings were grown in pots with a washed sand capacity of 7.5 kg and submitted to different NO3-:NH4+ ratios (T1 = 0:100%, T2 = 25:75%, T3 = 50:50%, T4 = 75:25%, and T5 = 100:0%. The lowest relative growth rate was observed when the NO3-:NH4+ ratio was equal to 0:100%. In general, high concentrations of NO3- rather than NH4+ favored a greater nutrient accumulation in different parts of the plant. For the chloroplastid pigment, the highest Chl a, Chl b, Chl tot, Chl a/b and Chl tot/Cx+c contents were found in the treatment with 75:25% of NO3-:NH4+, and for Chl b and Cx+c it was observed no difference. In addition, there was a higher photochemical efficiency of PSII (Fv/Fm when high NO3- concentrations were used. A linear and positive response for the nitrate reductase activity was recorded when the nitrate content increased on the culture substrate. Our results suggest that A. rosaeodora seedlings have a better growth performance when the NO3- concentrations in the culture substrate were higher than the NH4+ concentrations.O pau-rosa (Aniba rosaeodora Ducke habita, naturalmente, solos florestais ácidos com potencial redox reduzido. No entanto, estas espécies têm sido encontradas também em clareiras que, teoricamente, apresentam solos mais oxidados. Nestas diferentes

  5. Metil coenzima M redutase (MCR e o fator 430 (F430

    Directory of Open Access Journals (Sweden)

    Nakagaki Shirley

    2006-01-01

    Full Text Available This review presents studies on methyl coenzyme M reductase, the biological system Factor 430 (F430 and the use of nickel(II complexes as structural and functional models. The ability of F430 and nickel(II macrocycle complexes to mediate the reductive dehalogenation of cyclohexyl halogens and the CH3-S bond cleavage of methyl CoM (by sodium borohydride and some intermediate species proposed for the catalytic cycle of the biological system F430 was reviewed. The importance of the structure of the nickel complexes and the condition of the catalytic reduction reaction are also discussed.

  6. Metil coenzima M redutase (MCR e o fator 430 (F430

    Directory of Open Access Journals (Sweden)

    Shirley Nakagaki

    2006-10-01

    Full Text Available This review presents studies on methyl coenzyme M reductase, the biological system Factor 430 (F430 and the use of nickel(II complexes as structural and functional models. The ability of F430 and nickel(II macrocycle complexes to mediate the reductive dehalogenation of cyclohexyl halogens and the CH3-S bond cleavage of methyl CoM (by sodium borohydride and some intermediate species proposed for the catalytic cycle of the biological system F430 was reviewed. The importance of the structure of the nickel complexes and the condition of the catalytic reduction reaction are also discussed.

  7. Avaliação do tempo de secagem e da atividade de óxido-redutases de yacon (Smallanthus sonchifolius sob tratamento químico Drying evaluation time and yacon (Smallanthus sonchifolius enzymatic activity inhibition under chemical treatment

    Directory of Open Access Journals (Sweden)

    Vivianne Montarroyos Padilha

    2009-10-01

    Full Text Available Evidências científicas reconhecem o yacon (Smallanthus sonchifolius como fonte promissora de frutanos, tais como inulina e frutooligossacarídeos (FOS. No entanto, a presença de compostos fenólicos torna-o suscetível à reação de escurecimento enzimático. Este trabalho teve como objetivo avaliar o emprego de agentes químicos no processamento de yacon, para obtenção de farinha, a fim de inibir o escurecimento enzimático do produto e favorecer o tempo de secagem. Amostras de yacon sem inibição química, de yacon submetido à solução de cloreto de cálcio 1,0g 100g-1 por 30 minutos e de yacon submetido à solução de metabissulfito de potássio 0,5g 100g-1 por 5 minutos foram secas a 55°C, em estufa ventilada, e o teor de água e curvas de secagem foram determinados. As atividades das enzimas peroxidase (POD e polifenoloxidase (PPO foram determinadas antes e após a secagem como um possível marcador bioquímico do escurecimento enzimático desse tubérculo. No parâmetro umidade, os três tratamentos apresentaram-se semelhantes; porém, o tratamento 2 (cloreto de cálcio reduziu a umidade no menor tempo. Antes e após o tratamento térmico, a atividade enzimática foi maior no tratamento 3 (metabissulfito de potássio. As atividades enzimáticas não foram inativadas completamente pela ação térmica. Para a obtenção da farinha de yacon, o tratamento com cloreto de cálcio 1,0g 100g-1 por 30 minutos foi o que apresentou melhor resultado. Apesar de não inibir totalmente a atividade das enzimas POD e PPO foi o melhor tratamento de inativação, propiciando menor tempo de secagem e melhor firmeza da matéria-prima e facilitando o processamento para obtenção da farinha.Scientific evidences acknowledged the yacon (Smallanthus sonchifolius like a promise source of fructans, as inulin and fructooligosaccharides - FOS, meanwhile, the presence of phenolic coumpounds became this susceptible to enzimatic browning reaction. This project aimed to evaluate the use of chemical agents in yacon processing to obtain flour in a way that inhibits enzymatic darkening of the product besides determining the enzymatic activity in these treatments. Samples of yacon without chemical inhibitions, yacon treated with 1.0g 100g-1 calcium chloride for 30 seconds and yacon treated with 0.5g 100g-1 potassium metabisulfite for 5 minutes were dried at 55oC in a ventilated greenhouse and the proportions of humidity and drying curves were determined. The peroxidase activities and polyphenol oxidase enzymes were checked before and after being dried with an enzymatic darkening possible biochemist marker of this tubercle. Regarding humidity Parameter all the three treatment were equivalent, but treatment 2 (calcium chloride reduced the humidity in lower time. Before and after the thermal treatment the enzymatic activity was higher in treatment 3 (potassium metabisulfite. The thermal action did not inhibit completely polyphenol oxidase and peroxidase. The treatment with calcium chloride at 1.0g 100g-1 for 30 minutes to obtain yacon flour was the one with better result despite the fact that it did not inhibit completely peroxidase and polyphenol oxidase enzymes activity, offering a better drying time better material of row firmness , facilitating the process for obtaining the meal.

  8. A conservative region of the mercuric reductase gene (merA) as a molecular marker of bacterial mercury resistance Região conservada do gene da mercúrio redutase (merA) como marcador molecular da resistência bacteriana ao mercúrio

    OpenAIRE

    Adriana Sotero-Martins; Michele Silva de Jesus; Michele Lacerda; Josino Costa Moreira; Ana Luzia Lauria Filgueiras; Paulo Rubens Guimarães Barrocas

    2008-01-01

    The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II) to Hg0, which is dependent of the mercuric reductase enzyme (MerA) activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA) gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains.O mecanismo de resistência bacteriana ao mercúrio mais comum é baseada na redução do Hg(II) a Hg0, através da ativida...

  9. Farmacocinética, metabolismo e excreção renal da doxorrubicina em pacientes com câncer de mama

    OpenAIRE

    Leandro Francisco Pippa

    2016-01-01

    O presente estudo visa descrever a farmacocinética, o metabolismo e a excreção renal da doxorrubicina, uma antraciclina utilizada no tratamento do câncer de mama. A doxorrubicina é biotransformada a doxorrubicinol pelas enzimas carbonil redutase 1 e 3 e aldo-ceto redutase. Foram investigadas 12 pacientes portadoras de câncer de mama no primeiro ciclo de tratamento adjuvante ou neoadjuvante com doxorrubicina (60 mg/m2) administrada por infusão intravenosa durante 30 min. As amostras seriadas d...

  10. DIvERTICULE DE ZENKER

    African Journals Online (AJOL)

    origine de complications respiratoires aigues (détresse respiratoire aigue, pneumopathie d'inha- lation) ou chronique (bronchite chronique, asthme) qui surviennent dans 20 % des cas [8]. L'examen clinique est souvent normal. Cependant une.

  11. Outcomes of cancer surgery after inhalational and intravenous anesthesia

    DEFF Research Database (Denmark)

    Soltanizadeh, Sinor; Degett, Thea H; Gögenur, Ismail

    2017-01-01

    Perioperative factors are probably essential for different oncological outcomes. This systematic review investigates the literature concerning overall mortality and postoperative complications after cancer surgery with inhalational (INHA) and intravenous anesthesia (TIVA). A search was conducted...

  12. Action mechanism of inhibin α-subunit on the development of Sertoli cells and first wave of spermatogenesis in mice.

    Directory of Open Access Journals (Sweden)

    Kailai Cai

    Full Text Available Inhibin is an important marker of Sertoli cell (SC activity in animals with impaired spermatogenesis. However, the precise relationship between inhibin and SC activity is unknown. To investigate this relationship, we partially silenced both the transcription and translation of the gene for the α-subunit of inhibin, Inha, using recombinant pshRNA vectors developed with RNAi-Ready pSIREN-RetroQ-ZsGreen Vector (Clontech Laboratories, Mountain View, Calif. We found that Inha silencing suppresses the cell-cycle regulators Cyclin D1 and Cyclin E and up-regulates the cell-cycle inhibitor P21 (as detected by Western blot analysis, thereby increasing the number of SCs in the G1 phase of the cell cycle and decreasing the amount in the S-phase of the cell cycle (as detected by flow cytometry. Inha silencing also suppressed Pdgfa, Igf1, and Kitl mRNA levels and up-regulated Tgfbrs, Inhba, Inhbb, Cyp11a1, Dhh, and Tjp1 mRNA levels (as indicated by real-time polymerase chain reaction [PCR] analysis. These findings indicate that Inha has the potential to influence the availability of the ligand inhibin and its antagonist activin in the SC in an autocrine manner and inhibit the progression of SC from G1 to S. It may also participate in the development of the blood-testis barrier, Leydig cells, and spermatogenesis through its effect on Dhh, Tjp1, Kitl, and Pdgfa. Real-time PCR and Western blot analyses of Inha, Inhba, and Inhbb mRNA and Inha levels over time show that Inha plays an important role in the formation of round spermatid during the first wave of spermatogenesis in mice.

  13. Syntheses of copper complexes of nicotinohydroxamic and ...

    African Journals Online (AJOL)

    Nicotinohydroxamic acid (NHA) and isonicotinohydroxamic acid (INHA) were synthesized, characterized by electronic and spectral studies,magnetic measurements and their pKa determined spectrophotometrically as 8.68 ± 0.02 in aqueous medium of 0.1mol dm-3 I=ionic strength. The composition of the complexes was ...

  14. Recognizing Multi-user Activities using Wearable Sensors in a Smart Home

    DEFF Research Database (Denmark)

    Wang, Liang; Gu, Tao; Tao, Xianping

    2010-01-01

    The advances of wearable sensors and wireless networks oer many opportunities to recognize human activities from sensor readings in pervasive computing. Existing work so far focuses mainly on recognizing activities of a single user in a home environment. However, there are typically multiple inha...

  15. Effect of revaccination with BCG in early childhood on mortality: randomised trial in Guinea-Bissau

    DEFF Research Database (Denmark)

    Roth, A.E.; Benn, Christine Stabell; Ravn, H.

    2010-01-01

    Objective To determine whether BCG revaccination at 19 months of age reduces overall child mortality. Design Randomised trial, with follow-up to age 5. Setting A health project in Bissau, Guinea-Bissau, which maintains a health and demographic surveillance system in an urban area with 90 000 inha...

  16. [2- (2, 4-dimethylphenylthio) phenyl] aniline and it

    Indian Academy of Sciences (India)

    Sambhaji

    MgSO4, 0.5 g aspargine and 2 ml glycerol in distilled water (100 ml) followed by pH ..... aniline and its derivatives with the crystal structure of. Page 13. 13. Mycobacterium tuberculosis enoyl-acyl carrier protein reductase (InhA) (PDB ID: 4TZK).

  17. Investigation of isoniazid and ethionamide cross-resistance by whole genome sequencing and association with poor treatment outcomes of multidrug-resistant tuberculosis patients in South Africa

    Directory of Open Access Journals (Sweden)

    L Malinga

    2016-01-01

    Conclusion: Baseline ETH molecular resistance before second-line treatment is a concern. Unfavorable treatment outcomes of patients with ethA, ethR, and inhA mutations highlight the importance of genotypic testing before initiation of treatment containing ETH. The clinical significance of whole genome analysis for early detection of mutations predictive of treatment failure needs further investigation.

  18. Inhibition of cell proliferation by a selective inhibitor of the Ca{sup 2+}-activated Cl{sup -} channel, Ano1

    Energy Technology Data Exchange (ETDEWEB)

    Mazzone, Amelia; Eisenman, Seth T.; Strege, Peter R. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Yao, Zhen [Laboratory of Molecular Genetics, UCSF, San Francisco, CA (United States); Ordog, Tamas; Gibbons, Simon J. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Farrugia, Gianrico, E-mail: farrugia.gianrico@mayo.edu [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States)

    2012-10-19

    Highlights: Black-Right-Pointing-Pointer T16A{sub inh}-A01 blocked Ano1 currents in HEK cells expressing Ano1. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation in ICC primary cultures and CFPAC-1 cell line. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation of ICC in intact smooth muscle strips. -- Abstract: Background: Ion channels play important roles in regulation of cellular proliferation. Ano1 (TMEM16A) is a Ca{sup 2+}-activated Cl{sup -} channel expressed in several tumors and cell types. In the muscle layers of the gastrointestinal tract Ano1 is selectively expressed in interstitial cells of Cajal (ICC) and appears to be required for normal gastrointestinal slow wave electrical activity. However, Ano1 is expressed in all classes of ICC, including those that do not generate slow waves suggesting that Ano1 may have other functions. Indeed, a role for Ano1 in regulating proliferation of tumors and ICC has been recently suggested. Recently, a high-throughput screen identified a small molecule, T16A{sub inh}-A01 as a specific inhibitor of Ano1. Aim: To investigate the effect of the T16A{sub inh}-A01 inhibitor on proliferation in ICC and in the Ano1-expressing human pancreatic cancer cell line CFPAC-1. Methods: Inhibition of Ano1 was demonstrated by whole cell voltage clamp recordings of currents in cells transfected with full-length human Ano1. The effect of T16A{sub inh}-A01 on ICC proliferation was examined in situ in organotypic cultures of intact mouse small intestinal smooth muscle strips and in primary cell cultures prepared from these tissues. ICC were identified by Kit immunoreactivity. Proliferating ICC and CFPAC-1 cells were identified by immunoreactivity for the nuclear antigen Ki67 or EdU incorporation, respectively. Results: T16A{sub inh}-A01 inhibited Ca{sup 2+}-activated Cl{sup -} currents by 60% at 10 {mu}M in a voltage-independent fashion. Proliferation of ICC was significantly reduced in primary cultures

  19. Redução de nitrato em plantas jovens de café cultivadas em diferentes níveis de luz e de nitrogênio Nitrate reduction in young coffee trees grown under different levels of light and nitrogen

    Directory of Open Access Journals (Sweden)

    Maria Luiza Carvalho Carelli

    1990-01-01

    Full Text Available Foi estudado o efeito de níveis de luz e de nitrogênio na atividade da enzima redutase de nitrato e nos teores de nitrato e de açúcares nas folhas de plantas jovens de café (Coffea arabica L, assim como as possíveis relações entre a disponibilidade desses compostos e a atividade enzimática. Foram utilizadas plantas de dez meses de idade cultivadas em vasos contendo uma mistura de terra mais composto, e mantidas em condições ambientais em pleno sol e em 50% da luz solar. Metade das plantas de cada tratamento de luz foi suplementada semanalmente com nitrogênio. Os resultados mostraram que a atividade da redutase de nitrato, nos dois tratamentos de luz, foi maior nas plantas suplementadas com nitrogênio. Para um mesmo nível de nitrogênio, as plantas cultivadas em pleno sol apresentaram menor atividade da redutase de nitrato, maiores teores de nitrato e de açúcares e maiores taxas de transpiração, do que as cultivadas na sombra. Tais resultados indicam que a menor atividade da redutase de nitrato nas plantas cultivadas em pleno sol aparentemente não foi devida a limitações na disponibilidade de nitrato e de açúcares para fornecer a energia necessária para a redução de nitrato.The effect of levels of light and nitrogen on the activity of the enzyme nitrate reductase and its relationship with the availability of sugars and nitrate was studied in leaves of coffee plants (Coffea arabica L. cv. Catual. Ten month old plants were grown on pots containing a mixture of soil and compost, and were kept at full or 50% sunlight. Half of the plants of each light treatment received nitrogen supply. The results showed that the activity of nitrate reductase was higher on plants supplied with nitrogen at both light treatments. For the same nitrogen level, plants grown under full sunlight presented lower nitrate reductase activity, higher nitrate and sugars concentrations, and higher transpiration rates than plants kept at 50% sunlight

  20. [DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico].

    Science.gov (United States)

    Bolado-Martínez, Enrique; Pérez-Mendoza, Ansix; Alegría-Morquecho, Francisco Monserrat; Candia-Plata, María del Carmen; Aguayo-Verdugo, María del Rosario; Alvarez-Hernández, Gerardo

    2012-01-01

    To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

  1. Characterization of mutations causing rifampicin and isoniazid resistance of Mycobacterium tuberculosis in Syria.

    Science.gov (United States)

    Madania, Ammar; Habous, Maya; Zarzour, Hana; Ghoury, Ifad; Hebbo, Barea

    2012-01-01

    In order to characterize mutations causing rifampicin and isoniazid resistance of M. tuberculosis in Syria, 69 rifampicin resistant (Rif(r)) and 72 isoniazid resistant (Inh(r)) isolates were screened for point mutations in hot spots of the rpoB, katG and inhA genes by DNA sequencing and real time PCR. Of 69 Rif(r) isolates, 62 (90%) had mutations in the rifampin resistance determining region (RRDR) of the rpoB gene, with codons 531 (61%), 526 (13%), and 516 (8.7%) being the most commonly mutated. We found two new mutations (Asp516Thr and Ser531Gly) described for the first time in the rpoB-RRDR in association with rifampicin resistance. Only one mutation (Ile572Phe) was found outside the rpoB-RRDR. Of 72 Inh(r) strains, 30 (41.6%) had a mutation in katGcodon315 (with Ser315Thr being the predominant alteration), and 23 (32%) harbored the inhA(-15C-->T) mutation. While the general pattern of rpoB-RRDR and katG mutations reflected those found worldwide, the prevalence of the inhA(-15C-->T mutation was above the value found in most other countries, emphasizing the great importance of testing the inhA(-15C-->T) mutation for prediction of isoniazid resistance in Syria. Sensitivity of a rapid test using real time PCR and 3'-Minor groove binder (MGB) probes in detecting Rif(r) and Inh(r) isolates was 90% and 69.4%, respectively. This demonstrates that a small set of MGB-probes can be used in real time PCR in order to detect most mutations causing resistance to rifampicin and isoniazid.

  2. Polymorphisms in Isoniazid and Prothionamide Resistance Genes of the Mycobacterium tuberculosis Complex

    KAUST Repository

    Projahn, M.; Koser, C. U.; Homolka, S.; Summers, D. K.; Archer, John A.C.; Niemann, S.

    2011-01-01

    Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.

  3. Análisis del impacto de los principales museos de Asia

    OpenAIRE

    HUA, SAI

    2015-01-01

    [EN] Today, Museum and Institutions have tried to adapt the change of society and technology, and the social networks are the best way to create this environment. In recent years, Western museums and Institutions have been connected with social networks for getting more diffusion. But in Asia, the implementation of these social networks, due to the political, economic and social requirements, Asia has their own social networks, in the interest for increasing the social branch between its inha...

  4. Mutaciones asociadas con resistencia a rifampicina o isoniazida en aislamientos clínicos de M. tuberculosis de Sonora, México DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico

    Directory of Open Access Journals (Sweden)

    Enrique Bolado-Martínez

    2012-04-01

    Full Text Available OBJETIVO: Realizar el análisis de regiones específicas de genes asociados con resistencia a isoniazida o rifampicina. MATERIAL Y MÉTODOS: Se estudiaron 22 cepas de M. tuberculosis, aisladas en Sonora, México. Se utilizaron iniciadores para regiones específicas de los genes rpoB, katG e inhA y la región ahpC-oxyR. Los productos de PCR se secuenciaron y analizaron. RESULTADOS: Se identificaron mutaciones en la región promotora del gen inhA, región ahpC-oxyR, codón 315 del gen katG y codones 451 ó 456 del gen rpoB. CONCLUSIONES: La identificación de mutaciones no descritas previamente obliga a continuar el análisis genotípico de cepas aisladas en Sonora.OBJECTIVE: To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. MATERIALS AND METHODS: Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. RESULTS: Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. CONCLUSIONS: Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

  5. Polymorphisms in Isoniazid and Prothionamide Resistance Genes of the Mycobacterium tuberculosis Complex

    KAUST Repository

    Projahn, M.

    2011-06-27

    Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.

  6. Proteomic Analysis of Bacillus thuringiensis Strain 4.0718 at Different Growth Phases

    Directory of Open Access Journals (Sweden)

    Xiaohui Li

    2012-01-01

    Full Text Available The growth process of Bacillus thuringiensis Bt4.0718 strain was studied using proteomic technologies. The proteins of Bt whole cells at three phases—middle vegetative, early sporulation, and late sporulation—were extracted with lysis buffer, followed with separation by 2-DE and identified by MALDI-TOF/TOF MS. Bioactive factors such as insecticidal crystal proteins (ICPs including Cry1Ac(3, Cry2Aa, and BTRX28, immune inhibitor (InhA, and InhA precursor were identified. InhA started to express at the middle vegetative phase, suggesting its contribution to the survival of Bt in the host body. At the early sporulation phase, ICPs started their expression. CotJC, OppA, ORF1, and SpoIVA related to the formation of crystals and spores were identified, the expression characteristics of which ensured the stable formation of crystals and spores. This study provides an important foundation for further exploration of the stable expression of ICPs, the smooth formation of crystals, and the construction of recombinant strains.

  7. Anti-Müllerian Hormone and Inhibin-A, but not Inhibin-B or Insulin-Like Peptide-3, may be Used as Surrogates in the Diagnosis of Polycystic Ovary Syndrome in Adolescents: Preliminary Results.

    Science.gov (United States)

    Yetim, Aylin; Yetim, Çağcıl; Baş, Firdevs; Erol, Oğuz Bülent; Çığ, Gülnaz; Uçar, Ahmet; Darendeliler, Feyza

    2016-09-01

    Polycystic ovary syndrome (PCOS) is a common endocrine problem in adolescents with an increasing prevalence of 30%. Pursuing new biomarkers with high specificity and sensitivity in the diagnosis of PCOS in adolescents is currently an active area of research. We aimed to investigate the diagnostic value of anti-Müllerian hormone (AMH), insulin-like peptide-3 (INSL3), inhibin-A (INH-A), and inhibin-B (INH-B) in adolescents with PCOS and also to determine the association, if any, between these hormones and clinical/laboratory findings related with hyperandrogenism. The study group comprised 53 adolescent girls aged between 14.5 and 20 years who were admitted to our outpatient clinic with symptoms of hirsutism and/or irregular menses and diagnosed as having PCOS in accordance with the Rotterdam criteria. Twenty-six healthy peers, eumenorrheic for at least two years and body mass index-matched, constituted the controls. Fasting blood samples for hormones [luteinizing hormone (LH), follicle-stimulating hormone (FSH), dehydroepiandrosterone-sulfate (DHEAS), androstenedione (D4-A), total/free testosterone (T/fT), sex hormone binding globulin (SHBG), AMH, INSL3, INH-A, INH-B] were drawn after an overnight fast. In the PCOS group, 83% of the subjects were oligomenorrheic/amenorrheic and 87% had hirsutism. The LH, LH/FSH ratio, total T, fT, free androgen-index (FAI), DHEAS levels were significantly higher (p=0.005, p=0.042, p=0.047, pPCOS patients as compared to the controls. Although the INSL-3 and INH-B levels showed no difference between the groups (p>0.05), AMH and INH-A levels were found to be significantly higher in the PCOS group compared to the controls (pPCOS. When AMH and INH-A were used in combination, the sensitivity (96.2%) increased. INSL3 and INH-B were not found to have diagnostic value in adolescents with PCOS. On the other hand, it was shown that INH-A could be used as a new diagnostic biomarker in addition to AMH.

  8. Isoniazid acetylating phenotype in patients with paracoccidioidomycosis and its relationship with serum sulfadoxin levels, glucose-6-phosphate dehydrogenase and glutathione reductase activities

    Directory of Open Access Journals (Sweden)

    Benedito Barraviera

    1991-06-01

    Full Text Available The authors evaluated the isoniazid acetylating phenotype and measured hematocrit, hemoglobin, glucose-6-phosphate dehydrogenase and glutathione reductase activities plus serum sulfadoxin levels in 39 patients with paracoccidioidomycosis (33 males and 6 females aged 17 to 58 years. Twenty one (53.84% of the patients presented a slow acetylatingphenotype and 18(46.16% a fast acetylating phenotype. Glucose-6-phosphate- dehydrogenase (G6PD acti vity was decreased in 5(23.80% slow acetylators and in 4(22.22% fast acetylators. Glutathione reductase activity was decreased in 14 (66.66% slow acetylators and in 12 (66.66% fast acetylators. Serum levels of free and total sulfadoxin Were higher in slow acetylator (p Os autores avaliaram o fenótipo acetilador da isoniazida, hematócrito, hemoglobina, atividade da glicose-6- fosfato desidrogenase, glutationa redutase e os níveis séricos de sulfadoxina de 39 doentes com paracoccidíoidomicose, senão 33 do sexo masculino e 6 do feminino, com idades compreendidas entre 17 e 58 anos. Vinte e um (53,84% doentes apresentaram fenótipo acetilador lento e 18 (46,16% rápido. A atividade da glicose-6-fosfato desidrogenase (G6PD esteve diminuída em 5 (23,80% acetiladores lentos e 4 (22,22% rápidos. A atividade da glutationa redutase esteve diminuída em 14 (66,66% acetiladores lentos e 12 (66,66% rápidos. Os níveis séricos de sulfadoxina livre e total foram maiores nos acetiladores lentos (p < 0,02. A análise dos resultados permite concluir que os níveis séricos de sulfadoxina relaciona-se com o fenótipo acetilador. Além disso, os níveis estiveram sempre acima de 50 µg/ml, níveis estes considerados terapêuticos. Por outro lado, a deficiência de glutationa redutase pode estar relacionada com a má absorção intestinal de nutrientes, entre eles riboflavina, vitamina precursora de FAD.

  9. Is IQG-607 a Potential Metallodrug or Metallopro-Drug With a Defined Molecular Target in Mycobacterium tuberculosis?

    Directory of Open Access Journals (Sweden)

    Bruno L. Abbadi

    2018-05-01

    Full Text Available The emergence of strains of Mycobacterium tuberculosis resistant to isoniazid (INH has underscored the need for the development of new anti-tuberculosis agents. INH is activated by the mycobacterial katG-encoded catalase-peroxidase, forming an acylpyridine fragment that is covalently attached to the C4 of NADH. This isonicotinyl-NAD adduct inhibits the activity of 2-trans-enoyl-ACP(CoA reductase (InhA, which plays a role in mycolic acid biosynthesis. A metal-based INH analog, Na3[FeII(CN5(INH]·4H2O, IQG-607, was designed to have an electronic redistribution on INH moiety that would lead to an intramolecular electron transfer to bypass KatG activation. HPLC and EPR studies showed that the INH moiety can be oxidized by superoxide or peroxide yielding similar metabolites and isonicotinoyl radical only when associated to IQG-607, thereby supporting redox-mediated drug activation as a possible mechanism of action. However, IQG-607 was shown to inhibit the in vitro activity of both wild-type and INH-resistant mutant InhA enzymes in the absence of KatG activation. IQG-607 given by the oral route to M. tuberculosis-infected mice reduced lung lesions. Experiments using early and late controls of infection revealed a bactericidal activity for IQG-607. HPLC and voltammetric methods were developed to quantify IQG-607. Pharmacokinetic studies showed short half-life, high clearance, moderate volume of distribution, and low oral bioavailability, which was not altered by feeding. Safety and toxic effects of IQG-607 after acute and 90-day repeated oral administrations in both rats and minipigs showed occurrence of mild to moderate toxic events. Eight multidrug-resistant strains (MDR-TB were resistant to IQG-607, suggesting an association between katG mutation and increasing MIC values. Whole genome sequencing of three spontaneous IQG-607-resistant strains harbored katG gene mutations. MIC measurements and macrophage infection experiments with a laboratorial

  10. [Sex differentiation of central nervous system--brain of man and woman].

    Science.gov (United States)

    Arai, Yasumasa

    2004-02-01

    Sex differentiation of human brain is mostly dependent on the prenatal exposure to androgen(testosterone). Congenital aromatase deficiency does not disturb male brain development in men. This is quite different from experimental evidence from rodents whose brains need intraneuronal aromatization from androgen to estrogen to induce sex differentiation. There is evidence for male-female differences in brain structures. Some of them(INHA-3) appear to be related with sexual orientation. The other(BNST) might participate in forming gender-identity. In addition, sexually dimorphic features are recognized in some cognitive activities. The possible involvement of genetic factors in human brain sex differentiation is also discussed.

  11. Genotypic analysis of multidrug-resistant tuberculosis isolates from extra pulmonary tuberculosis cases in tertiary care centers in Northern India

    Directory of Open Access Journals (Sweden)

    Anand K Maurya

    2016-01-01

    Conclusion: The prevalence (13.4% of MDR-TB among EPTB was high, and the most prominent mutations in rpoB, katG, and inhA genes were S531L (67.3%, S315T1 (94.5%, and C15T (20%, respectively. Beijing stains are significantly associated with MDR-TB among EPTB in this region. We found that the transmission of prominent mutations contributes to an unexpected increase in primary resistance, including MDR-TB cases in Northern India.

  12. High-Frequency Percussive Ventilation and Low Tidal Volume Ventilation in Burns: A Randomized Controlled Trial

    Science.gov (United States)

    2010-01-01

    incidence of ventilator-associated pneumonia ( VAP ) in patients with inha- lation injury when supported with HFPV compared with conventional modes of...mean ratio of PaO2 to FIO2 was 58 6 with a mean positive end- expiratory pressure of 22 2 cm H2O before rescue. Two of these patients were...a sample size of 110 patients in each arm would have been required to detect a difference in VAP with 80% power. A multicentered study would be

  13. Aqueous Molecular Dynamics Simulations of the M. tuberculosis Enoyl-ACP Reductase-NADH System and Its Complex with a Substrate Mimic or Diphenyl Ethers Inhibitors

    Directory of Open Access Journals (Sweden)

    Camilo Henrique da Silva Lima

    2015-10-01

    Full Text Available Molecular dynamics (MD simulations of 12 aqueous systems of the NADH-dependent enoyl-ACP reductase from Mycobacterium tuberculosis (InhA were carried out for up to 20–40 ns using the GROMACS 4.5 package. Simulations of the holoenzyme, holoenzyme-substrate, and 10 holoenzyme-inhibitor complexes were conducted in order to gain more insight about the secondary structure motifs of the InhA substrate-binding pocket. We monitored the lifetime of the main intermolecular interactions: hydrogen bonds and hydrophobic contacts. Our MD simulations demonstrate the importance of evaluating the conformational changes that occur close to the active site of the enzyme-cofactor complex before and after binding of the ligand and the influence of the water molecules. Moreover, the protein-inhibitor total steric (ELJ and electrostatic (EC interaction energies, related to Gly96 and Tyr158, are able to explain 80% of the biological response variance according to the best linear equation, pKi = 7.772 − 0.1885 × Gly96 + 0.0517 × Tyr158 (R2 = 0.80; n = 10, where interactions with Gly96, mainly electrostatic, increase the biological response, while those with Tyr158 decrease. These results will help to understand the structure-activity relationships and to design new and more potent anti-TB drugs.

  14. [Description of Mycobacterium tuberculosis mutations conferring resistance to rifampicin and isoniazid detected by GenoType® MTBDRplus V.2 in Colombia].

    Science.gov (United States)

    Llerena, Claudia; Medina, Raquel

    2017-01-24

    The GenoType®MTBDRplusV.2 assay is a molecular technique endorsed by the World Health Organization and the Pan American Health Organization that allows for the identification of the Mycobacterium tuberculosis complex and the detection of mutations in the rpoβ gene for rifampicin resistance, and katG and inhA genes for isoniazid resistance. Due to the genetic variability in the circulating strains around the world, the national tuberculosis control programs should assess the performance of these new diagnostic technologies and their use under program conditions as rapid tests. To describe the mutations identified by the GenoType®MTBDRplusV.2 assay in pulmonary samples and Mycobacterium tuberculosis isolates in the Laboratorio Nacional de Referencia of the Instituto Nacional de Salud in 2014. We conducted a retrospective, descriptive study to detect the expression of inhA, KatG and rpoβ genes, responsible for resistence against isoniazid and rifampicin using the GenoType® MTBDRplus V.2 assay in 837 samples and isolates from tuberculosis cases. Several mutations in the rpoβ gene were identified. Ser531Leu was the most frequent (36.6%) followed by Asp516Val (21.6%), while Ser315Thr1 was the most frequent mutation in the katG gene (91.9%). We were able to identify different mutations present in MDR-TB strains in the country, with frequencies similar to those reported in other countries in the South American region.

  15. Multi-clonal evolution of multi-drug-resistant/extensively drug-resistant Mycobacterium tuberculosis in a high-prevalence setting of Papua New Guinea for over three decades

    Science.gov (United States)

    Bainomugisa, Arnold; Lavu, Evelyn; Hiashiri, Stenard; Majumdar, Suman; Honjepari, Alice; Moke, Rendi; Dakulala, Paison; Hill-Cawthorne, Grant A.; Pandey, Sushil; Marais, Ben J.; Coulter, Chris; Coin, Lachlan

    2018-01-01

    An outbreak of multi-drug resistant (MDR) tuberculosis (TB) has been reported on Daru Island, Papua New Guinea. Mycobacterium tuberculosis strains driving this outbreak and the temporal accrual of drug resistance mutations have not been described. Whole genome sequencing of 100 of 165 clinical isolates referred from Daru General Hospital to the Supranational reference laboratory, Brisbane, during 2012–2015 revealed that 95 belonged to a single modern Beijing sub-lineage strain. Molecular dating suggested acquisition of streptomycin and isoniazid resistance in the 1960s, with potentially enhanced virulence mediated by an mycP1 mutation. The Beijing sub-lineage strain demonstrated a high degree of co-resistance between isoniazid and ethionamide (80/95; 84.2 %) attributed to an inhA promoter mutation combined with inhA and ndh coding mutations. Multi-drug resistance, observed in 78/95 samples, emerged with the acquisition of a typical rpoB mutation together with a compensatory rpoC mutation in the 1980s. There was independent acquisition of fluoroquinolone and aminoglycoside resistance, and evidence of local transmission of extensively drug resistant (XDR) strains from 2009. These findings underline the importance of whole genome sequencing in informing an effective public health response to MDR/XDR TB. PMID:29310751

  16. Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Navisha Dookie

    2016-10-01

    Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

  17. Significance of Coexisting Mutations on Determination of the Degree of Isoniazid Resistance in Mycobacterium tuberculosis Strains.

    Science.gov (United States)

    Karunaratne, Galbokka Hewage Roshanthi Eranga; Wijesundera, Sandhya Sulochana; Vidanagama, Dhammika; Adikaram, Chamila Priyangani; Perera, Jennifer

    2018-04-23

    The emergence and spread of drug-resistant tuberculosis (TB) pose a threat to TB control in Sri Lanka. Isoniazid (INH) is a key element of the first-line anti-TB treatment regimen. Resistance to INH is mainly associated with point mutations in katG, inhA, and ahpC genes. The objective of this study was to determine mutations of these three genes in INH-resistant Mycobacterium tuberculosis (MTb) strains in Sri Lanka. Complete nucleotide sequence of the three genes was amplified by polymerase chain reaction and subjected to DNA sequencing. Point mutations in the katG gene were identified in 93% isolates, of which the majority (78.6%) were at codon 315. Mutations at codons 212 and 293 of the katG gene have not been reported previously. Novel mutations were recognized in the promoter region of the inhA gene (C deletion at -34), fabG1 gene (codon 27), and ahpC gene (codon 39). Single S315T mutation in the katG gene led to a high level of resistance, while a low level of resistance with high frequency (41%) was observed when katG codon 315 coexisted with the mutation at codon 463. Since most of the observed mutations of all three genes coexisted with the katG315 mutation, screening of katG315 mutations will be a useful marker for molecular detection of INH resistance of MTb in Sri Lanka.

  18. Can statins improve outcome in colorectal surgery?: Part I

    Directory of Open Access Journals (Sweden)

    Júlio César M Santos Jr

    2012-09-01

    Full Text Available Statins are recommended for people who have high serum cholesterol, and this role of statins has been well documented. However, some activities of statins, independent of their lipid-lowering effect, in conditions such as systemic inflammatory response syndrome, nephropathy, and other anti-inflammatory activities that reduce proinflammatory cytokines, are called "pleiotropic" effects of statins. For this reason, many candidates for surgical treatment are users of statins. As a result, benefits are observed in these patients, such as minimized postoperative complications, especially in cardiac or coronary surgery. This study was designed with the purpose of determining the current status of the use of statins as an adjuvant in the prevention of postoperative complications in colorectal surgery. Ongoing studies and future researches will help clarify the potential impact of statins on the prophylaxis of postoperative complications.As estatinas são drogas com o poder de inibir a hidroxi-metil-glutaril coenzima A redutase (HMG-CoA redutase, enzima que age na ativação da cadeia metabólica do colesterol. Portanto, sua principal ação, entre outros efeitos, é diminuir a concentração sérica total desse lipídeo. Por essa razão, muitas pessoas candidatas ao tratamento cirúrgico são pacientes usuários das estatinas. Seus outros efeitos, independente de sua capacidade para baixar os lipídeos circulantes, são denominados "efeitos pleiotrópicos" e estão, principalmente, relacionados à ação de bloqueio das atividades pró-inflamatórias, sobretudo minimizando, nos cardiopatas ou coronariopatas submetidos às operações cardíacas ou coronarianas, a prevalência da síndrome da reação inflamatória sistêmica, inclusive quando desencadeada por infecção. Estudos recentes têm sido elaborados para maiores conhecimentos dos mecanismos de ação das estatinas, especialmente em pacientes cardiopatas submetidos a tratamentos cirúrgicos n

  19. Methemoglobinemia associated with loxoscelism Meta-hemoglobinemia associada ao loxoscelismo

    Directory of Open Access Journals (Sweden)

    Orlando C. de O. Barreto

    1990-02-01

    Full Text Available In twenty five patients who presented the cutaneous form of loxoscelism, serum haptoglobin and lactic dehydrogenase, erythrocyte glucose-6-phosphate dehydrogenase, glutathione reductase, glutathione peroxidase, methemoglobin, bilirubin and reticulocytes were investigated after bite. No hemolysis was detected but an increase in methemoglobin was found in 54% of the cases; in 7% it was between 1.1% and 2%, in 27% it ranged from 2.1% to 4%, and in 20% from 4.1% to 8%. Blood samples of a normal, blood group 0 individual and of a patient who exhibited methemoglobinemia after Loxosceles bite were incubated separately with antisera against Loxosceles gaucho, Crotalus terrificus, Bothrops jararaca, with Loxosceles gaucho venom and 0.3% phenol. No methemoglobin was found after 1, 4,8 and 15 days in both sets of samples. At the 25th day all the samples, including the controls, exhibited similar methemoglobin reductase decrease. The data suggest that the methemoglobinemia which occurs in 50% of the patients probably arises from in vivo venom metabolism, inasmuch as the crude venom does not induce methemoglobinemia.Vinte e cinco pacientes que apresentaram a forma cutânea do loxoscelismo foram estudados após a picada, determinando-se a glicose-6-fosfato desidrogenase, glutationa redutase e glutationa peroxidase eritrocitárias, haptoglobina e latico desidrogenase séricas, bilirrubina, reticulócitos e meta-hemoglobina. Não foi observada hemólise aumentada, mas foi detectado aumento da meta-hemoglobina em 54% dos casos: em 7% entre 1,1% e 2%, em 27% variou de 2,1% a 4%, e em 20% de 4,1 a 8%. Amostras de sangue de um indivíduo normal do grupo 0 de uma paciente que exibiu meta-hemoglobina após picada por Loxosceles foram incubadas separadamente com anti-soros contra Loxosceles gancho, Crotalus terrificus e Bothrops jararaca, com veneno de Loxosceles gaucho e fenol a 3%, e não se detectou aumento de meta-hemoglobina depois de 1, 4, 8 e 15 dias em todas

  20. Diagnostic moléculaire du complexe Mycobacterium tuberculosis résistant à l'isoniazide et à la rifampicine au Burkina Faso

    Science.gov (United States)

    Désire, Ilboudo; Cyrille, Bisseye; Florencia, Djigma; Souba, Diande; Albert, Yonli; Valerie, Bazie Jean Telesphore; Rebecca, Compaore; Charlemagne, Gnoula; Tamboura, Djibril; Rémy, Moret; Virginio, Pietra; Simplice, Karou Damintoti; Martial, Ouedraogo; Jacques, Simpore

    2015-01-01

    Introduction Cette étude a eu pour objectifs de diagnostiquer la tuberculose pulmonaire par l'examen microscopique et par la PCR des crachats et de déterminer les bases moléculaires de la résistance à la rifampicine et à l'isoniazide. Méthodes Le diagnostic du Complexe Mycobacterium Tuberculosis (CMTB) a été effectué par microscopie après coloration au Ziehl Nielsen et par PCR en temps réel en utilisant le kit d'identification du complexe MTB (Sacace Biotechnologie, Italie). Les résistances à la Rifampicine et à l'Isoniazide ont été étudiées par la technique de la PCR en utilisant le kit MTB résistance 8 (Sacace, Biotechnologie). Résultats Sur les 59 patients diagnostiqués pour la tuberculose pulmonaire, 59,3% étaient positifs en microscopie optique et 44,1% étaient positifs par PCR en Temps réel. Les résistances à la rifampicine (rpoB) et à l'isoniazide (katG et inhA) ont été observées chez 9 patients. La résistance à la rifampicine était due aux mutations (Asp516Val, Ser531Trp, Leu533Pro) et celle à l'isoniazide par les substitutions Ser315Thr du gène katG et C209T du gène inhA. Les multi résistances à la rifampicine et à l'isoniazide ont été observées dans 55,5% des échantillons et concernaient les associations: ropBAsp513Val + inhAC209T et rpoBLeu533Pro + katGSer315Thr. Conclusion La PCR en temps réel qui permet l'identification des allèles mutants rpoB, katG et inhA de M. tuberculosis est un outil de diagnostic épidémiologique de grande importance car elle permet de déterminer le niveau de résistance à la rifampicine et à l'isoniazide. PMID:26491516

  1. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  2. Atividade alelopática dos lixiviados de Asemeia extraaxillaris (Polygalaceae sobre o crescimento de Ipomoea cordifolia

    Directory of Open Access Journals (Sweden)

    C.B. SILVA

    2016-01-01

    Full Text Available RESUMO O objetivo desse trabalho foi avaliar a atividade alelopática dos lixiviados das raízes e folhas secas de Asemeia extraaxillaris sobre o crescimento de corda de viola Ipomoea cordifolia em casa de vegetação, para avaliação dos efeitos sobre o estresse oxidativo. Nos bioensaios foram utilizadas três concentrações (0,25 - 5,00 e 10,00 g e um controle, com quatro repetições de 10 plantas, cultivadas em solo durante 30 dias. Os lixiviados possuem ação alelopática e o maior efeito foi verificado para o pó das raizes. O efeito inibitório foi dose-dependente e o aumento do estresse oxidativo foi observado pelos níveis da catalase, peroxidase, superóxido dismutase, glutationa redutase, peroxidação lipídica e síntese de formazan. Concluiu-se que A. extraaxillaris possui substâncias capazes de afetar a emergência, o crescimento e o estresse oxidativo de I. cordifolia.

  3. Phylogeographical analysis reveals multiple conservation units in brook lampreys Lampetra planeri of Portuguese streams.

    Science.gov (United States)

    Pereira, A M; Robalo, J I; Freyhof, J; Maia, C; Fonseca, J P; Valente, A; Almada, V C

    2010-08-01

    The populations of brook lamprey Lampetra planeri of Portuguese Rivers were analysed phylogeographically using a fragment of 644 bp of the mitochondrial control region of 158 individuals from six populations. Samples representing L. planeri and migratory lampreys Lampetra fluviatilis of rivers draining to the North Sea and the Baltic Sea were also included to assess the relationships of Portuguese samples. The data support a clear differentiation of all the populations studied. Several populations, which are isolated among themselves and also from the migratory lampreys, proved to be entirely composed of private haplotypes, a finding that supports some time of independent evolutionary history for these populations. This, combined with the geographic confinement to small water bodies, justifies the recognition of at least four conservation units in the Portuguese rivers Sado, São Pedro, Nabão and Inha.

  4. Special Aviation Fire and Explosion Reduction (SAFER) Advisory Committee. Volume IIB.

    Science.gov (United States)

    1980-06-26

    alternates be identified collectively as the "SAFER Advisory Committee," or simply the Committee. 2. That the Committee serve as the decision-making body...iefta 10 e - Avisttln Kal £s1a~r*W. Odke Of W- rPs A..ecn~e "I t12, AdOWt(~ 0 W ae Itirea~t pgsPer110 I’o Mhet Cuxlser Attenton. Rulem LlozkCL is ira...factors, such as bur.t.it ot inha~ation of toxic gases. It is only in recent years that t-e :37 o actempted to collect such data. 4. Except for the KC

  5. Exploration of freely available web-interfaces for comparative homology modelling of microbial proteins.

    Science.gov (United States)

    Nema, Vijay; Pal, Sudhir Kumar

    2013-01-01

    This study was conducted to find the best suited freely available software for modelling of proteins by taking a few sample proteins. The proteins used were small to big in size with available crystal structures for the purpose of benchmarking. Key players like Phyre2, Swiss-Model, CPHmodels-3.0, Homer, (PS)2, (PS)(2)-V(2), Modweb were used for the comparison and model generation. Benchmarking process was done for four proteins, Icl, InhA, and KatG of Mycobacterium tuberculosis and RpoB of Thermus Thermophilus to get the most suited software. Parameters compared during analysis gave relatively better values for Phyre2 and Swiss-Model. This comparative study gave the information that Phyre2 and Swiss-Model make good models of small and large proteins as compared to other screened software. Other software was also good but is often not very efficient in providing full-length and properly folded structure.

  6. Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

    KAUST Repository

    Dalla Costa, Elis R.; Vasconcelos, Sidra E. G.; Esteves, Leonardo S.; Gomes, Harrison M.; Gomes, Lia L.; Almeida da Silva, Pedro; Perdigã o, Joã o; Portugal, Isabel; Viveiros, Miguel; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Rastogi, Nalin; Unis, Gisela; Rossetti, Maria Lucia R.; Suffys, Philip Noel

    2015-01-01

    We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

  7. The effect of neutral-surface iron oxide nanoparticles on cellular uptake and signaling pathways

    Directory of Open Access Journals (Sweden)

    Kim E

    2016-09-01

    Full Text Available Eunjoo Kim,1 Joon Mee Kim,2 Lucia Kim,2 Suk Jin Choi,2 In Suh Park,2 Jee Young Han,2 Young Chae Chu,2 Eun Sook Choi,1 Kun Na,3 Soon-Sun Hong4 1Division of Nano and Energy Convergence Research, Daegu Gyeongbuk Institute of Science and Technology (DGIST, Daegu, 2Department of Pathology, Inha University College of Medicine, Incheon, 3Department of Biotechnology, Catholic University of Korea, Bucheon, 4Department of Biomedical Sciences, Inha University College of Medicine, Incheon, South Korea Abstract: In recent years, iron oxide nanoparticles (IONPs have been applied widely to biomedical fields. However, the relationship between the physicochemical properties of IONPs and their biological behavior is not fully understood yet. We prepared 3-methacryloxypropyl­trimethoxysilane (MPS-coated IONPs, which have a neutral hydrophobic surface, and compared their biological behavior to that of Resovist (ferucarbotran, a commercialized IONP formulation modified with carboxymethyl dextran. The rate of MPS-IONP uptake by human aortic endothelial cells (HAoECs was higher than ferucarbotran uptake, indicating that the neutral hydrophobic nature of MPS-IONPs allowed them to be absorbed more readily through the plasma membrane. However, the signaling pathways activated by MPS-IONPs and ferucarbotran were comparable, suggesting that surface charge is not a key factor for inducing changes in HAoECs. In vivo fate analysis showed that MPS-IONPs accumulated for longer periods in tissues than hydrophilic ferucarbotran. These findings could enlarge our understanding of NP behavior for advanced applications in the biomedical field. Keywords: iron oxide nanoparticles, neutral hydrophobic surface, signaling pathway, uptake, accumulation, reactive oxygen species (ROS

  8. Expression of Iron-Related Proteins Differentiate Non-Cancerous and Cancerous Breast Tumors

    Directory of Open Access Journals (Sweden)

    Sara Pizzamiglio

    2017-02-01

    Full Text Available We have previously reported hepcidin and ferritin increases in the plasma of breast cancer patients, but not in patients with benign breast disease. We hypothesized that these differences in systemic iron homeostasis may reflect alterations in different iron-related proteins also play a key biochemical and regulatory role in breast cancer. Thus, here we explored the expression of a bundle of molecules involved in both iron homeostasis and tumorigenesis in tissue samples. Enzyme-linked immunosorbent assay (ELISA or reverse-phase protein array (RPPA, were used to measure the expression of 20 proteins linked to iron processes in 24 non-cancerous, and 56 cancerous, breast tumors. We found that cancerous tissues had higher level of hepcidin than benign lesions (p = 0.012. The univariate analysis of RPPA data highlighted the following seven proteins differentially expressed between non-cancerous and cancerous breast tissue: signal transducer and transcriptional activator 5 (STAT5, signal transducer and activator of transcription 3 (STAT3, bone morphogenetic protein 6 (BMP6, cluster of differentiation 74 (CD74, transferrin receptor (TFRC, inhibin alpha (INHA, and STAT5_pY694. These findings were confirmed for STAT5, STAT3, BMP6, CD74 and INHA when adjusting for age. The multivariate statistical analysis indicated an iron-related 10-protein panel effective in separating non-cancerous from cancerous lesions including STAT5, STAT5_pY694, myeloid differentiation factor 88 (MYD88, CD74, iron exporter ferroportin (FPN, high mobility group box 1 (HMGB1, STAT3_pS727, TFRC, ferritin heavy chain (FTH, and ferritin light chain (FTL. Our results showed an association between some iron-related proteins and the type of tumor tissue, which may provide insight in strategies for using iron chelators to treat breast cancer.

  9. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

    Science.gov (United States)

    Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

    2012-06-01

    Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

  10. Genotypic characterization of multi-drug-resistant Mycobacterium tuberculosis isolates in Myanmar.

    Science.gov (United States)

    Aye, Khin Saw; Nakajima, Chie; Yamaguchi, Tomoyuki; Win, Min Min; Shwe, Mu Mu; Win, Aye Aye; Lwin, Thandar; Nyunt, Wint Wint; Ti, Ti; Suzuki, Yasuhiko

    2016-03-01

    The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-TB would be effective. To develop such tests, information on the frequency and distribution of mutations associating with phenotypic drug resistance in Mycobacterium tuberculosis is required in each country. During 2010, the common mutations in the rpoB, katG and inhA of 178 phenotypically MDR M. tuberculosis isolates collected by the National Tuberculosis Control Program (NTP) in Myanmar were investigated by DNA sequencing. Mutations affecting the 81-bp rifampicin (RIF) resistance-determining region (RRDR) of the rpoB were identified in 127 of 178 isolates (71.3%). Two of the most frequently affected codons were 531 and 526, with percentages of 48.3% and 14.0% respectively. For isoniazid (INH) resistance, 114 of 178 MDR-TB isolates (64.0%) had mutations in the katG in which a mutation-conferring amino acid substitution at codon 315 from Ser to Thr was the most common. Mutations in the inhA regulatory region were also detected in 20 (11.2%) isolates, with the majority at position -15. Distinct mutation rate and pattern from surrounding countries might suggest that MDR-TB has developed and spread domestically in Myanmar. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  11. Bacillus anthracis Overcomes an Amino Acid Auxotrophy by Cleaving Host Serum Proteins

    Science.gov (United States)

    Terwilliger, Austen; Swick, Michelle C.; Pflughoeft, Kathryn J.; Pomerantsev, Andrei; Lyons, C. Rick; Koehler, Theresa M.

    2015-01-01

    ABSTRACT Bacteria sustain an infection by acquiring nutrients from the host to support replication. The host sequesters these nutrients as a growth-restricting strategy, a concept termed “nutritional immunity.” Historically, the study of nutritional immunity has centered on iron uptake because many bacteria target hemoglobin, an abundant circulating protein, as an iron source. Left unresolved are the mechanisms that bacteria use to attain other nutrients from host sources, including amino acids. We employed a novel medium designed to mimic the chemical composition of human serum, and we show here that Bacillus anthracis, the causative agent of anthrax disease, proteolyzes human hemoglobin to liberate essential amino acids which enhance its growth. This property can be traced to the actions of InhA1, a secreted metalloprotease, and extends to at least three other serum proteins, including serum albumin. The results suggest that we must also consider proteolysis of key host proteins to be a way for bacterial pathogens to attain essential nutrients, and we provide an experimental framework to determine the host and bacterial factors involved in this process. IMPORTANCE The mechanisms by which bacterial pathogens acquire nutrients during infection are poorly understood. Here we used a novel defined medium that approximates the chemical composition of human blood serum, blood serum mimic (BSM), to better model the nutritional environment that pathogens encounter during bacteremia. Removing essential amino acids from BSM revealed that two of the most abundant proteins in blood—hemoglobin and serum albumin—can satiate the amino acid requirement for Bacillus anthracis, the causative agent of anthrax. We further demonstrate that hemoglobin is proteolyzed by the secreted protease InhA1. These studies highlight that common blood proteins can be a nutrient source for bacteria. They also challenge the historical view that hemoglobin is solely an iron source for

  12. Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

    Directory of Open Access Journals (Sweden)

    Anand Kumar Maurya

    2013-01-01

    Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

  13. Automatic design of decision-tree induction algorithms tailored to flexible-receptor docking data.

    Science.gov (United States)

    Barros, Rodrigo C; Winck, Ana T; Machado, Karina S; Basgalupp, Márcio P; de Carvalho, André C P L F; Ruiz, Duncan D; de Souza, Osmar Norberto

    2012-11-21

    This paper addresses the prediction of the free energy of binding of a drug candidate with enzyme InhA associated with Mycobacterium tuberculosis. This problem is found within rational drug design, where interactions between drug candidates and target proteins are verified through molecular docking simulations. In this application, it is important not only to correctly predict the free energy of binding, but also to provide a comprehensible model that could be validated by a domain specialist. Decision-tree induction algorithms have been successfully used in drug-design related applications, specially considering that decision trees are simple to understand, interpret, and validate. There are several decision-tree induction algorithms available for general-use, but each one has a bias that makes it more suitable for a particular data distribution. In this article, we propose and investigate the automatic design of decision-tree induction algorithms tailored to particular drug-enzyme binding data sets. We investigate the performance of our new method for evaluating binding conformations of different drug candidates to InhA, and we analyze our findings with respect to decision tree accuracy, comprehensibility, and biological relevance. The empirical analysis indicates that our method is capable of automatically generating decision-tree induction algorithms that significantly outperform the traditional C4.5 algorithm with respect to both accuracy and comprehensibility. In addition, we provide the biological interpretation of the rules generated by our approach, reinforcing the importance of comprehensible predictive models in this particular bioinformatics application. We conclude that automatically designing a decision-tree algorithm tailored to molecular docking data is a promising alternative for the prediction of the free energy from the binding of a drug candidate with a flexible-receptor.

  14. Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

    KAUST Repository

    Dalla Costa, Elis R.

    2015-09-23

    We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

  15. Phenotypic low-level isoniazid resistance as a marker to predict ethionamide resistance in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Salima Qamar

    2017-01-01

    Full Text Available Background: Tuberculosis is one of the most prevalent diseases in Pakistan. Pakistan has the highest burden of MDR-TB in the Eastern Mediterranean region. Ethionamide is an anti-tuberculous drug frequently used to treat MDR-TB. Its drug susceptibility testing is not easily available in resource limited settings. Since it acts on the same target protein as isoniazid (inhA protein encoded by inhA gene, we sought to find out if phenotypic isoniazid resistance can be a marker of ethionamide resistance. Materials and Methods: This was a retrospective observational study conducted at the Aga Khan University hospital section of microbiology. Data was retrieved between 2011 to 2014 for all culture positive MTB strains. All culture positive MTB isolates with susceptibilities to isoniazid and ethionamide recorded were included in the study. Isoniazid and ethionamide susceptibilities were performed using agar proportion method on Middlebrook 7H10 agar. Rate of Ethionamide resistance between low-level isoniazid resistant, high level isoniazid resistant and isoniazid sensitive MTB was compared. Results: A total of 11,274 isolates were included in the study. A statistically significant association (P < 0.001 was found between Ethionamide resistance and low-level isoniazid resistance (26.6% as compared to high-level isoniazid resistance (8.85% and isoniazid sensitivity (0.71% in MTB strains. However this association was not seen in XDR-TB strains. Conclusion: Low level isoniazid resistance may be used as marker for phenotypic ethionamide resistance and hence guide clinicians' choice of antituberculous agent for MDR-TB in Pakistan. Further studies involving detection of genotypic association of isoniazid and ethionamide susceptibilities are needed before a final conclusion can be derived.

  16. Deficiências de macronutrientes no estado nutricional da mamoneira cultivar Iris Deficiencies of macronutrients on nutritional status of castor bean cultivar Iris

    Directory of Open Access Journals (Sweden)

    José Lavres Junior

    2005-02-01

    Full Text Available Os objetivos deste trabalho foram avaliar o efeito da deficiência dos macronutrientes no crescimento e estado nutricional da mamoneira (Ricinus communis L. e a obtenção do quadro sintomatológico das deficiências de N, P, K, Ca, Mg e S. Cultivou-se Ricinus communis L. cultivar Iris em solução nutritiva, tendo como tratamentos soluções completa e deficientes em N, P, K, Ca, Mg e S. Foram determinadas a concentração indireta de clorofila, a atividade da redutase do nitrato, os teores solúveis de N (NO3-, P (H2PO4- e K+ e realizados testes rápidos para N, P e K. As deficiências de N, Ca, S e Mg foram as que mais restringiram a produção de massa de matéria seca, na ordem decrescente: N>Ca>S>Mg>K>P. Os maiores acúmulos de macronutrientes, no tratamento completo, foram observados nas raízes e no limbo das folhas inferiores. As concentrações críticas para N e Ca, ambas no limbo das folhas superiores e, Mg, no pecíolo das inferiores foram, respectivamente, 46,7, 13,8 e 6,5 g kg-1. As deficiências influenciaram as leituras do clorofilômetro. A atividade da redutase do nitrato guardou relação direta com a determinação da clorofila. Os teores de N (NO3-, P (H2PO4- e K+ foram menores nas folhas deficientes em N, P e K, respectivamente, o mesmo acontecendo quando avaliadas pela análise de toque.The objectives of this work were to evaluate the effect of macronutrient deficiencies on growth and on nutritional status of castor beans (Ricinus communis L., and to obtain the symptoms of the lack of N, P, K, Ca, Mg and S. Nutrient solutions containing all macronutrients and those from which one of these elements was omitted were the treatments used. The following determinations were made: chlorophyll (indirectly, nitrate reductase activity, NO3--N, H2PO4--P and K+, both on soluble fractions, and by spot tests. Deficiencies of N, Ca, S and Mg were the most limiting for dry matter production, followed in decreasing order by those of K and

  17. Nitrate levels and stages of growth in hypernodulating mutants of Lupinus albus. II. Enzymatic activity and transport of N in the xylem sap Diferentes níveis de nitrato e estágio de crescimento em mutantes hipernodulantes de Lupinus albus II. Atividade enzimática e transporte de N na seiva do xilema

    Directory of Open Access Journals (Sweden)

    Hélio Almeida Burity

    1999-04-01

    decisiva em evitar produtos inibidores da nitrogenase pelo amônio, porém poucas são as informações deste mecanismo com o qual o xilema carrega estes produtos, em compensação, este processo, pode ser a chave da função em evitar acumulação de aminoácidos nas células dos nódulos infectados. O comportamento das enzimas nitrato redutase (NR, fosfoenolpiruvato carboxilase (PEPC, glutamina sintetase (GS e dos compostos nitrogenados derivados da fixação como: N-a-amino, N-ureídos e N-amida em genótipos mutados foi observado. A atividade da enzima nitrato redutase foi altamente inflenciada pela aplicação de nitrato apresentando valores bastante superiores em relação a não aplicação do nitrato, independentemente dos genótipos, sendo que o melhor período de avaliação foi na décima semana. O genótipo L-62, com caracteríticas de resistência ao nitrato, mostrou de forma bem evidenciada que a enzima PEPC é inibida pela presença de nitrato. O genótipo L-135 (nod- fix- apresentou atividade da GS extremamente baixo, mostrando desta forma que a GS é uma enzima altamente correlacionada com a fixação. Em relação ao melhor estágio de crescimento para a GS, o Lupinus albus, deve ser avaliado na sétima semana.

  18. Metabolismo de nitrogênio em dois sistemas de cultivo de café sob veranico da estação úmida

    Directory of Open Access Journals (Sweden)

    Carmem Lacerda Lemos

    2010-02-01

    Full Text Available Com o objetivo de avaliar o efeito do veranico ocorrido na estação úmida sobre o metabolismo de nitrogênio em cafeeiros em sistema a pleno sol e associados com abacateiro (Persea americana Mill. e ingazeiro (Inga edulis Mart., foi realizado este experimento. O estudo foi conduzido em propriedade situada no município de Barra do Choça, BA, composto por plantas de café (Coffea arabica L., variedade Catuaí, sendo caracterizados dois campos experimentais (sistema sombreado x sistema a pleno sol. As avaliações foram realizadas em janeiro (período de veranico e março (final da estação úmida, em cinco repetições por campo experimental. Os dados foram submetidos ao teste t por meio do programa SAEG, versão 9.1. Maior teor de NO3 - foi verificado no sistema a pleno sol, tanto no período de veranico como no final da estação úmida. Em março foi observado maior acúmulo de N-orgânico no terço superior do cafeeiro a pleno sol e no terço médio do cafeeiro sombreado. Maiores teores de nitrogênio total e a tendência de maior atividade enzimática da redutase do nitrato foram verificados nos sistemas arborizados, quando avaliados dentro do mesmo terço do cafeeiro nas duas estações.

  19. Carvedilol atenua o estresse oxidativo na cardiopatia chagásica crônica

    Directory of Open Access Journals (Sweden)

    Patrícia Budni

    2012-03-01

    Full Text Available FUNDAMENTO: Há cada vez mais evidências sugerindo que doença de Chagas envolve dano oxidativo e contribui para a progressão da doença cardíaca. OBJETIVO: Avaliar o efeito do carvedilol sobre marcadores de estresse oxidativo na doença de Chagas crônica. MÉTODOS: A população de estudo incluiu 42 pacientes com cardiopatia chagásica e os biomarcadores de estresse oxidativo foram medidos antes e após um período de seis meses de tratamento com carvedilol (37,5 mg/dia. Os pacientes foram considerados de acordo com a classificação de Los Andes, e a atividade da superóxido dismutase, catalase, glutationa peroxidase, S-transferase e redutase, mieloperoxidase e adenosina deaminase; e os níveis de glutationa reduzida, de espécies reativas do ácido tiobarbitúrico, proteína carbonil, vitamina E e óxido nítrico foram medidos no sangue. RESULTADOS: Após o tratamento com carvedilol, todos os grupos apresentaram reduções significativas nos níveis de proteína carbonil e glutationa reduzida, enquanto os níveis de óxido nítrico e atividade da adenosina aumentaram significativamente somente no grupo IA. Além disso, a maioria das enzimas antioxidantes apresentou diminuição de suas atividades, nos grupos IA e IB. CONCLUSÃO: Os dados sugerem que o tratamento com carvedilol foi eficaz na atenuação do dano oxidativo, um efeito que pode ser particularmente importante em doença de Chagas crônica com cardiopatia.

  20. Efeito do processamento UAT (Ultra Alta Temperatura sobre as características físico-químicas do leite Effect of UHT (Ultra High Temperature processing on the physicochemical characteristics of milk

    Directory of Open Access Journals (Sweden)

    Ana Maria Centola Vidal Martins

    2008-06-01

    Full Text Available Com o objetivo de analisar as características físico-químicas do leite UAT durante sua industrialização e de comparar os resultados com a legislação vigente, foram analisadas 150 amostras, colhidas em seis etapas, em diferentes fases do processamento, sendo 60 de leite cru, 60 de leite pasteurizado e 30 de leite UAT. As amostras foram submetidas à determinação de acidez titulável, densidade, teor de gordura, extrato seco total (EST e desengordurado (ESD, ponto crioscópico, pH, redutase, estabilidade ao álcool 68% e à pesquisa das enzimas peroxidase e fosfatase alcalina. Os resultados indicaram que os valores médios do extrato seco total e do extrato desengordurado, bem como do índice crioscópico apresentaram-se, em algumas colheitas, inferiores aos estabelecidos pela legislação vigente, indicando possível aumento no teor de água do leite.With the aim of analyzing the physicochemical characteristics of UHT milk during its industrialization and comparing the results with the Brazilian legislation, 150 samples collected in six stages, in different processing phases, were analyzed, being 60 samples of raw milk, 60 of pasteurized milk and 30 of UHT milk. The samples were submitted to the analysis of Dornic acidity, density, fat content, total solids, solids-non-fat, freezing point, pH, methylene blue reduction, stability to 68% alcohol and screening for peroxidase and alkaline phosphatase enzymes. The results indicated that the mean values of total solids and solids-non-fat and freezing point, were in some collections, lower than the limits established in the Brazilian legislation, demonstrating a possible increase in milk water content.

  1. Lactobacillus plantarum strains isolated from naturally fermented sausages and their technological properties for application as starter cultures Lactobacillus plantarum isolados de salames artesanais naturalmente fermentados e suas propriedades tecnológicas como culturas iniciadoras

    Directory of Open Access Journals (Sweden)

    Maristela Cortez Sawitzki

    2009-06-01

    Full Text Available In the present study, technological properties of L. plantarum strains isolated from naturally fermented sausages manufactured in the South region of Brazil were investigated in order to obtain a starter culture. The technological properties evaluated were the following: ability to growth at different pH values, at different temperatures, in different salt concentrations and in the presence of commercial curing salt, fast production of acid, determination of D - and L - lactic acid; nitrate reductase activity; antagonistic activity and stability of the isolated cultures after fermentation, concentration, and freeze-drying process. The isolated strains showed effectiveness to improve technological properties as starter cultures.No presente estudo foram investigadas as propriedades tecnológicas de culturas de L. plantarum, isoladas de salames artesanais, naturalmente fermentados, manufaturados na região Sul do Brasil, a fim de obter um cultivo iniciador. As propriedades tecnológicas investigadas foram as seguintes: habilidade das culturas para crescer em diferentes valores de pH, em diferentes concentrações de sal e na presença de sal de cura comercial; rápida produção de ácido, produção do isômero D - ou L - ácido láctico, atividade nitrato redutase, atividade antagonística e estabilidade das culturas após processo de fermentação, concentração e liofilização. Todas as culturas apresentaram eficiência quanto às propriedades tecnológicas investigadas.

  2. Hypolipidemic activity of Moringa oleifera Lam., Moringaceae, on high fat diet induced hyperlipidemia in albino rats Atividade hipolipidemica de Moringa oleifera Lam., Moringaceae, na hiperlipidemia induzida por dieta rica em gordura em ratos albinos

    Directory of Open Access Journals (Sweden)

    Pankaj G. Jain

    2010-12-01

    Full Text Available The leaves of Moringa oleifera Lam., Moringaceae, are used by the Indians in their herbal medicine as a hypolipidemic agent in obese patients. Albino Wistar rats were fed with methanolic extract of M. oleifera (150, 300 and 600 mg/kg, p.o. and simvastatin (4 mg/kg, p.o. along with hyperlipidemic diet for 30 days. Moringa oleifera and simvastatin were found to lower the serum cholesterol, triacylglyceride, VLDL, LDL, and atherogenic index, but were found to increase the HDL as compared to the corresponding high fed cholesterol diet group (control. The Moringa oleifera methanolic extract was also investigated for its mechanism of action by estimating HMG CO-A reductase activity. Moringa oleifera was found to increase the excretion of fecal cholesterol. Thus, the study demonstrates that M. oleifera possesses a hypolipidemic effect.As folhas de Moringa oleifera Lam., Moringaceae, são usados na medicina natural da Índia como um agente hipolipemiante em pacientes obesos. Ratos albinos Wistar foram alimentados com extrato metanólico de M. oleifera (150, 300 e 600 mg/kg, p.o. e sinvastatina (4 mg/kg, p.o., juntamente com dieta hiperlipídica por 30 dias. Moringa oleifera e sinvastatina reduziram o colesterol, triacilglicerídeoss, VLDL, LDL e índice aterogênico, mas não aumentaram o HDL em comparação com o grupo controle, com dieta rica em colesterol. O mecanismo de ação do extrato metanólico de Moringa oleifera foi também investigado estimando atividade de HMG CO-A redutase. Moringa oleifera aumentou a excreção fecal de colesterol. Assim, o estudo demonstra que a M. oleifera parece ter efeito hipolipemiante.

  3. Assimilação metabólica de nitrogênio em plântulas de seringueira cultivadas com nitrato ou amônio

    Directory of Open Access Journals (Sweden)

    Andrea Yu Kwan Villar Shan

    2012-06-01

    Full Text Available O objetivo deste trabalho foi avaliar a assimilação metabólica de nitrogênio em plântulas de seringueira cultivadas na presença de nitrato ou de amônio, por meio da quantificação da atividade das enzimas redutase do nitrato (RN, glutamina sintetase (GS, glutamato sintase (GOGAT e glutamato desidrogenase (GDH. Os seguintes tratamentos foram avaliados: fontes de N - controle, sem aplicação de N; amônio a 8 mmol L-1; e nitrato a 8 mmol L-1 - e tempos de exposição - 0 e 27 dias -, em arranjo fatorial 3x2, no delineamento inteiramente casualizado, com quatro repetições. A forma amoniacal promoveu maior assimilação metabólica de N, o que resultou em maior acúmulo de aminoácidos. A assimilação, tanto da forma nítrica quanto da amoniacal, aconteceu principalmente via GS/GOGAT; parte do N nítrico é assimilado nas raízes, com pequena participação da GDH, e parte é translocada para outros órgãos. O N amoniacal é totalmente assimilado nas raízes, com significativa participação da GDH. Nas folhas, a GS participa tanto da assimilação primária como da reassimilação do amônio fotorrespirado, independentemente da fonte nitrogenada, enquanto a enzima GDH tem papel secundário, independentemente da fonte ou do tempo de exposição. A atividade da RN in vitro é detectada somente em raízes e caules.

  4. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    Directory of Open Access Journals (Sweden)

    Zakham F

    2013-11-01

    Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

  5. Whole Genome Sequencing Based Characterization of Extensively Drug-Resistant Mycobacterium tuberculosis Isolates from Pakistan

    KAUST Repository

    Ali, Asho; Hasan, Zahra; McNerney, Ruth; Mallard, Kim; Hill-Cawthorne, Grant A.; Coll, Francesc; Nair, Mridul; Pain, Arnab; Clark, Taane G.; Hasan, Rumina

    2015-01-01

    Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91-94 codons in 81% of strains; four strains had only gyr B mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded

  6. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

    Science.gov (United States)

    Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

    2013-01-01

    Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

  7. Whole Genome Sequencing Based Characterization of Extensively Drug-Resistant Mycobacterium tuberculosis Isolates from Pakistan

    KAUST Repository

    Ali, Asho

    2015-02-26

    Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91-94 codons in 81% of strains; four strains had only gyr B mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded

  8. Clinical data and molecular analysis of Mycobacterium tuberculosi isolates from drug-resistant tuberculosis patients in Goiás, Brazil

    Directory of Open Access Journals (Sweden)

    Sueli Lemes de Ávila Alves

    2011-09-01

    Full Text Available Drug resistance is one of the major concerns regarding tuberculosis (TB infection worldwide because it hampers control of the disease. Understanding the underlying mechanisms responsible for drug resistance development is of the highest importance. To investigate clinical data from drug-resistant TB patients at the Tropical Diseases Hospital, Goiás (GO, Brazil and to evaluate the molecular basis of rifampin (R and isoniazid (H resistance in Mycobacterium tuberculosis. Drug susceptibility testing was performed on 124 isolates from 100 patients and 24 isolates displayed resistance to R and/or H. Molecular analysis of drug resistance was performed by partial sequencing of the rpoB and katGgenes and analysis of the inhA promoter region. Similarity analysis of isolates was performed by 15 loci mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR typing. The molecular basis of drug resistance among the 24 isolates from 16 patients was confirmed in 18 isolates. Different susceptibility profiles among the isolates from the same individual were observed in five patients; using MIRU-VNTR, we have shown that those isolates were not genetically identical, with differences in one to three loci within the 15 analysed loci. Drug-resistant TB in GO is caused by M. tuberculosis strains with mutations in previously described sites of known genes and some patients harbour a mixed phenotype infection as a consequence of a single infective event; however, further and broader investigations are needed to support our findings.

  9. A user-friendly web portal for analyzing conformational changes in structures of Mycobacterium tuberculosis.

    Science.gov (United States)

    Hassan, Sameer; Thangam, Manonanthini; Vasudevan, Praveen; Kumar, G Ramesh; Unni, Rahul; Devi, P K Gayathri; Hanna, Luke Elizabeth

    2015-10-01

    Initiation of the Tuberculosis Structural Consortium has resulted in the expansion of the Mycobacterium tuberculosis (MTB) protein structural database. Currently, 969 experimentally solved structures are available for 354 MTB proteins. This includes multiple crystal structures for a given protein under different functional conditions, such as the presence of different ligands or mutations. In depth analysis of the multiple structures reveal that subtle differences exist in conformations of a given protein under varied conditions. Therefore, it is immensely important to understand the conformational differences between the multiple structures of a given protein in order to select the most suitable structure for molecular docking and structure-based drug designing. Here, we introduce a web portal ( http://bmi.icmr.org.in/mtbsd/torsion.php ) that we developed to provide comparative data on the ensemble of available structures of MTB proteins, such as Cα root means square deviation (RMSD), sequence identity, presence of mutations and torsion angles. Additionally, torsion angles were used to perform principal component analysis (PCA) to identify the conformational differences between the structures. Additionally, we present a few case studies to demonstrate this database. Graphical Abstract Conformational changes seen in the structures of the enoyl-ACP reductase protein encoded by the Mycobacterial gene inhA.

  10. Tritium research activities in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Ki Jung, E-mail: kjjung@nfri.re.kr [National Fusion Research Institute, Yusung-gu, Daejeon 305-333 (Korea, Republic of); Yun, Sei-Hun, E-mail: shyun@nfri.re.kr [National Fusion Research Institute, Yusung-gu, Daejeon 305-333 (Korea, Republic of); Chang, Min Ho; Kang, Hyun-Goo; Chung, Dongyou; Cho, Seungyon; Lee, Hyeon Gon [National Fusion Research Institute, Yusung-gu, Daejeon 305-333 (Korea, Republic of); Chung, Hongsuk; Choi, Woo-Seok [Korea Atomic Energy Research Institute, Yusung-gu, Daejeon 305-353 (Korea, Republic of); Song, Kyu-Min; Moon, Chang-Bae [Korea Hydro & Nuclear Power Central Research Institute, Yusung-gu, Daejeon 305-343 (Korea, Republic of); Lee, Euy Soo [Dongguk University, Jung-gu, Seoul, 100-715 (Korea, Republic of); Cho, Jungho; Kim, Dong-Sun [Kongju National University, Cheonan, Chungnam, 330-717 (Korea, Republic of); Moon, Hung-Man [Daesung Industrial Gases Co., Ltd., Danwon-gu, Ansan-si, Gyeonggi-do, 425-090 (Korea, Republic of); Noh, Seung Jeong [Dankook University, Suji-gu, Yongin-si, Gyeonggi-do, 448-701 (Korea, Republic of); Ju, Hyunchul [Inha University, Nam-gu, Incheon, 402-751 (Korea, Republic of); Hong, Tae-Whan [Korea National University of Transportation, Chungju, Chungbuk, 380-702 (Korea, Republic of)

    2016-12-15

    Highlights: • NFRI, KAERI and KHNP CRI are major leading group for the ITER tritium SDS design; studying engineering, simulation of hydride bed, risk analysis (on safety, HAZOP), basic study, control logic & sequential operation, and others. KHNP has WTRF which gives favorable experiences for collaboration researchers. • Supplementary research partners: Five Universities (Dongguk University and POSTECH, Inha University, Dankook University, Korea National Transport University, and Kongju National University) and one industrial company (Daesung Industrial Gases Co., Ltd.); studying on basic and engineering, programming & simulation on the various topics for ITER tritium SDS, TEP, ISS, ADS, and etc. - Abstract: Major progress in tritium research in the Republic of Korea began when Korea became responsible for ITER tritium Storage and Delivery System (SDS) procurement package which is part of the ITER Fuel Cycle. To deliver the tritium SDS package, a variety of research institutes, universities and industry have respectively taken roles and responsibilities in developing technologies that have led to significant progress. This paper presents the current work and status of tritium related technological research and development (R&D) in Korea and introduces future R&D plans in the area of fuel cycle systems for fusion power generation.

  11. Tibial bone fractures occurring after medioproximal tibial bone grafts for oral and maxillofacial reconstruction.

    Science.gov (United States)

    Kim, Il-Kyu; Cho, Hyun-Young; Pae, Sang-Pill; Jung, Bum-Sang; Cho, Hyun-Woo; Seo, Ji-Hoon

    2013-12-01

    Oral and maxillofacial defects often require bone grafts to restore missing tissues. Well-recognized donor sites include the anterior and posterior iliac crest, rib, and intercalvarial diploic bone. The proximal tibia has also been explored as an alternative donor site. The use of the tibia for bone graft has many benefits, such as procedural ease, adequate volume of cancellous and cortical bone, and minimal complications. Although patients rarely complain of pain, swelling, discomfort, or dysfunction, such as gait disturbance, both patients and surgeons should pay close attention to such after effects due to the possibility of tibial fracture. The purpose of this study is to analyze tibial fractures that occurring after osteotomy for a medioproximal tibial graft. An analysis was intended for patients who underwent medioproximal tibial graft between March 2004 and December 2011 in Inha University Hospital. A total of 105 subjects, 30 females and 75 males, ranged in age from 17 to 78 years. We investigated the age, weight, circumstance, and graft timing in relation to tibial fracture. Tibial fractures occurred in four of 105 patients. There were no significant differences in graft region, shape, or scale between the fractured and non-fractured patients. Patients who undergo tibial grafts must be careful of excessive external force after the operation.

  12. Estimating Fitness by Competition Assays between Drug Susceptible and Resistant Mycobacterium tuberculosis of Predominant Lineages in Mumbai, India

    Science.gov (United States)

    Bhatter, Purva; Chatterjee, Anirvan; D'souza, Desiree; Tolani, Monica; Mistry, Nerges

    2012-01-01

    Background Multi Drug Resistant Tuberculosis (MDR TB) is a threat to global tuberculosis control. A significant fitness cost has been associated with DR strains from specific lineages. Evaluation of the influence of the competing drug susceptible strains on fitness of drug resistant strains may have an important bearing on understanding the spread of MDR TB. The aim of this study was to evaluate the fitness of MDR TB strains, from a TB endemic region of western India: Mumbai, belonging to 3 predominant lineages namely CAS, Beijing and MANU in the presence of drug susceptible strains from the same lineages. Methodology Drug susceptible strains from a single lineage were mixed with drug resistant strain, bearing particular non synonymous mutation (rpoB D516V; inhA, A16G; katG, S315T1/T2) from the same or different lineages. Fitness of M.tuberculosis (M.tb) strains was evaluated using the difference in growth rates obtained by using the CFU assay system. Conclusion/Significance While MANU were most fit amongst the drug susceptible strains of the 3 lineages, only Beijing MDR strains were found to grow in the presence of any of the competing drug susceptible strains. A disproportionate increase in Beijing MDR could be an alarm for an impending epidemic in this locale. In addition to particular non synonymous substitutions, the competing strains in an environment may impact the fitness of circulating drug resistant strains. PMID:22479407

  13. EUROBAROMETER – PHYSICAL ACTIVITY OF INHABITANTS OF THE AP VOJVODINA

    Directory of Open Access Journals (Sweden)

    Zoran Milošević

    2015-05-01

    Full Text Available In this paper we have identified the characteristics of physical activity of inha¬bitants of the AP Vojvodina compared to their generation group. We used the Eurobarometer survey to test the sample comprising of 3,132 participants from major places in Vojvodina, which was divided into five generation sub-samples (aged from 15 to 24, from 25 to 39, from 40 to 54, from 55 to 69, and older than 70. The area of this study comprises four themes that are mutually linked in a meaningful way and that refer to attitudes of participants: 1 about the level and intensity of physical activity, 2 about the place of dealing with physical activity, 3 about motives for getting involved in physical activity, 4 about barriers for getting involved in physical activity. A significant difference in the four given subject topics between the five AP Vojvodina population generation subsamples has been determined based on the research results that is, the specific physical (inactivity of the local population (the APV compared to the population of the European surrounding (the EU.

  14. Differential Impact of Genetic Loci on Age at Thelarche and Menarche in Healthy Girls

    DEFF Research Database (Denmark)

    Busch, Alexander S; Hagen, Casper P; Assens, Maria

    2018-01-01

    ) were followed through puberty and genotyped for FSHB c.-211G>T (rs10835638), FSHR c.-29G>A (rs1394205), FSHR c.2039A>G (rs6116), LIN28B (rs7759938), INHA (rs4141153), MKRN3 (rs12148769), TMEM38B (rs10453225), and ZNF483 (rs10980921). Main Outcome Measures: Clinical pubertal staging and anthropometric...... data. Results: We observed an association of LIN28B (rs7759938) with age at thelarche (P year, 95% confidence interval: 0.12 to 0.42) and age at menarche (P = 0.005, 0.17 year, 0.05 to 0.29). FSHB c.-211G>T (rs10835638) and FSHR c.-29G>A (rs1394205) minor allele count...... was associated with age at thelarche (P = 0.004, 0.19 year, 0.06 to 0.31) but not with age at menarche (P = 0.97; all adjusted for body mass index z scores). Conclusion: Our results indicate a differential impact of specific genetic loci on age at thelarche and menarche in healthy girls....

  15. Analysis of facial bone fractures: An 11-year study of 2,094 patients

    Directory of Open Access Journals (Sweden)

    Hwang Kun

    2010-01-01

    Full Text Available Purpose: The medical records of these patients were reviewed and analysed to determine the clinical characteristics and treatment of facial bone fractures. Patients and Methods: This is a retrospective study of 2,094 patients with facial bone fractures from various accidents that were treated at the Inha University Hospital from 1996 to 2007. Results: The most common age group was the third decade of life (29%. Males were more common than females (3.98:1. The most common aetiology was violent assault or nonviolent traumatic injury (49.4%. The most common isolated fracture site was the nasal bone (37.7%, followed by the mandible (30%, orbital bones (7.6%, zygoma (5.7%, maxilla (1.3% and the frontal bone (0.3%. The largest group with complex fractures included the inferior region of the orbital floor and zygomaticomaxilla (14%. Closed reduction was performed in 46.3% of the cases while 39.7% of the cases required open reduction. For open reductions, the most commonly used soft-tissue approach was the intraoral approach (32.3%. The complication rate was 6.4% and the most common complication was hypoesthesia (68.4% followed by diplopia (25.6%. Conclusion: Long-term collection of epidemiological data regarding facial fractures and concomitant injuries is important for the evaluation of existing preventive measures and useful in the development of new methods of injury prevention and treatment.

  16. The Genotype MTBDRplus ver. 2.0 test as a quick indicator of resistance to rifampicin and isoniazid in Mycobacterium tuberculosis strains

    Directory of Open Access Journals (Sweden)

    Salvatore Nisticò

    2013-08-01

    Full Text Available Tuberculosis is still a global emergency and a major public health problem, in some cases related to the appearance of strains of multi drug resistance (MDR and extensive drug resistance (XDR Mycobacterium tuberculosis complex.The correct determination of antibiotic sensitivity profiles is therefore crucial to carry out appropriate treatment aimed to decrease the infectivity of each patient and to reduce mortality. The poor adherence to treatment by the patient or the use of therapies based on a single drug, as a result of incorrect requirements, promote the development of drug-resistance. Have some time on the market of molecular diagnostic tests that allow, quickly and directly from biological sample to search for resistance genes some key drugs of anti-TB therapy (Rifampicin and Isoniazid. One of the tests in question is the Genotype MTBDRplus ver 2.0 which can reveal the presence of genes for resistance to Isoniazid (INH and Rifampin (RMP.The loci analyzed are those corresponding to the rpoB gene for rifampicin, katG and inhA for isoniazid. Our study is based on the analysis of 83 strains of tubercular Mycobacteria identified and isolated from patients with tuberculosis disease and subjected to the tests sensitivity, searching for mutations and phenotypic susceptibility testing for Rifampicin and Isoniazid.The comparison of the results has shown that the results obtained using the Genotype MTBDRplus ver 2.0 test, were similar to the results obtained by the traditional susceptibility testing.

  17. Relationship between physicians' perceived stigma toward depression and physician referral to psycho-oncology services on an oncology/hematology ward.

    Science.gov (United States)

    Kim, Won-Hyoung; Bae, Jae-Nam; Lim, Joohan; Lee, Moon-Hee; Hahm, Bong-Jin; Yi, Hyeon Gyu

    2018-03-01

    This study was performed to identify relationships between physicians' perceived stigma toward depression and psycho-oncology service utilization on an oncology/hematology ward. The study participants were 235 patients in an oncology/hematology ward and 14 physicians undergoing an internal medicine residency training program in Inha University Hospital (Incheon, South Korea). Patients completed the Patient Health Questionnaire-9 (PHQ-9), and residents completed the Perceived Devaluation-Discrimination scale that evaluates perceived stigma toward depression. A total PHQ-9 score of ≥5 was defined as clinically significant depression. Physicians decided on referral on the basis of their opinions and those of their patients. The correlates of physicians' recommendation for referral to psycho-oncology services and real referrals psycho-oncology services were examined. Of the 235 patients, 143 had PHQ-9 determined depression, and of these 143 patients, 61 received psycho-oncology services. Physicians recommended that 87 patients consult psycho-oncology services. Multivariate analyses showed that lower physicians' perceived stigma regarding depression was significantly associated with physicians' recommendation for referral, and that real referral to psycho-oncology services was significantly associated with presence of a hematologic malignancy and lower physicians' perceived stigma toward depression. Physicians' perceived stigma toward depression was found to be associated with real referral to psycho-oncology services and with physician recommendation for referral to psycho-oncology services. Further investigations will be needed to examine how to reduce physicians' perceived stigma toward depression. Copyright © 2017 John Wiley & Sons, Ltd.

  18. POSSIBILIDADES DO DESENVOLVIMENTO DO TURISMO ÉTNICO NAS COMUNIDADES QUILOMBOLAS DE DIAMANTINA/MG: OPORTUNIDADES E DESAFIOS

    Directory of Open Access Journals (Sweden)

    Elcione Luciana da Silva

    2016-04-01

    Full Text Available O conceito do turismo étnico vem se desenvolvendo nas últimas décadas e envolve a valorização cultural e possibilidade de promover diversas experiências e inter-relações entre visitantes e comunidades quilombolas. Este artigo versa sobre as comunidades quilombolas (Mata dos Crioulos, Vargem do Inhaí e Quartel de Indaiá – Diamantina/MG, que vêm sofrendo conflitos e pressões de ordem territorial, o que dificulta ainda mais a manutenção da cultura local. O objetivo desta pesquisa é sugerir o desenvolvimento do turismo étnico nas mesmas como forma de desenvolvimento local e valorização do patrimônio cultural material e imaterial. Para alcançar o resultado da pesquisa foram utilizadas referências bibliográficas e documentais. Palavra-chaves: Turismo étnico; comunidades quilombolas; conflitos ambientais e territoriais.

  19. Antimicrobial susceptibility determined by the E test, Löwenstein-Jensen proportion, and DNA sequencing methods among Mycobacterium tuberculosis isolates discrepancies, preliminary results

    Directory of Open Access Journals (Sweden)

    Maria Inês Moura Freixo

    2004-02-01

    Full Text Available Mycobacterium tuberculosis strains resistant to streptomycin (SM, isoniazid (INH, and/or rifampin (RIF as determined by the conventional Löwenstein-Jensen proportion method (LJPM were compared with the E test, a minimum inhibitory concentration susceptibility method. Discrepant isolates were further evaluated by BACTEC and by DNA sequence analyses for mutations in genes most often associated with resistance to these drugs (rpsL, katG, inhA, and rpoB. Preliminary discordant E test results were seen in 75% of isolates resistant to SM and in 11% to INH. Discordance improved for these two drugs (63% for SM and none for INH when isolates were re-tested but worsened for RIF (30%. Despite good agreement between phenotypic results and sequencing analyses, wild type profiles were detected on resistant strains mainly for SM and INH. It should be aware that susceptible isolates according to molecular methods might contain other mechanisms of resistance. Although reproducibility of the LJPM susceptibility method has been established, variable E test results for some M. tuberculosis isolates poses questions regarding its reproducibility particularly the impact of E test performance which may vary among laboratories despite adherence to recommended protocols. Further studies must be done to enlarge the evaluated samples and looked possible mutations outside of the hot spot sequenced gene among discrepant strains.

  20. Germline Mutations of Inhibins in Early-Onset Ovarian Epithelial Tumors

    Science.gov (United States)

    Tournier, Isabelle; Marlin, Régine; Walton, Kelly; Charbonnier, Françoise; Coutant, Sophie; Théry, Jean-Christophe; Charbonnier, Camille; Spurrell, Cailyn; Vezain, Myriam; Ippolito, Lorena; Bougeard, Gaëlle; Roman, Horace; Tinat, Julie; Sabourin, Jean-Christophe; Stoppa-Lyonnet, Dominique; Caron, Olivier; Bressac-de Paillerets, Brigitte; Vaur, Dominique; King, Mary-Claire; Harrison, Craig; Frebourg, Thierry

    2014-01-01

    To identify novel genetic bases of early-onset epithelial ovarian tumors, we used the trio exome sequencing strategy in a patient without familial history of cancer who presented metastatic serous ovarian adenocarcinomas at 21 years of age. We identified a single de novo mutation (c.1157A>G/p.Asn386Ser) within the INHBA gene encoding the βA-subunit of inhibins/activins, which play a key role in ovarian development. In vitro, this mutation alters the ratio of secreted activins and inhibins. In a second patient with early-onset serous borderline papillary cystadenoma, we identified an unreported germline mutation (c.179G>T/p.Arg60Leu) of the INHA gene encoding the α-subunit, the partner of the βA-subunit. This mutation also alters the secreted activin/inhibin ratio, by disrupting both inhibin A and inhibin B biosynthesis. In a cohort of 62 cases, we detected an additional unreported germline mutation of the INHBA gene (c.839G>A/p.Gly280Glu). Our results strongly suggest that inhibin mutations contribute to the genetic determinism of epithelial ovarian tumors. PMID:24302632

  1. A GESTÃO INTEGRADA DO RISCO DE INUNDAÇÃO E AS COMUNIDADES LOCAIS EM PORTUGAL E NO BRASIL: CONTRIBUTOS TEÓRICOS

    Directory of Open Access Journals (Sweden)

    Francisco da Silva Costa

    2017-01-01

    Full Text Available The lack of policies that promote risk management in Portugal and Brazil is a reality, and theinvestment of resources is mainly concentrated in the resolution of crises to the detriment oftechnical and administrative measures of prevention and preparedness for emergencies.Prevention must take the necessary and indispensable measures to limit the occurrence or reduce the negative effects of a crisis. In this context, the role of local communities, such astheir participation in participatory planning, is highlighted, as it involves all stakeholders in thedevelopment of risk management policies and allows the inha bitants of vulnerable regions tochoose the level of risk they are facing. Ready to take over. The role of local communities in therisk management process thus becomes vital: this is the main stakeholder in preparing againstthese extreme events. With this c ommunication, we intend to contribute to the discussion of riskmanagement models in Portugal and Brazil, highlighting the importance of local communitiesand participatory planning as tools for the prevention and coping of disaster scenarios and theirintegr ation into common security policies And civil protection.

  2. Radiologic findings of double contrast knee arthrography

    International Nuclear Information System (INIS)

    Choi, Hye Ran; Ahn, Byeong Yeob; Kim, Mi Young; Lee, So Hyun; Suh, Chang Hae; Chung, Won Kyun

    1990-01-01

    The double contrast arthrography of the knee is a highly accurate diagnostic modality in wide rage of the clinical disorders of the knee. It allows radiological assessment of the menisci, the articular cartilages, the synovium and the ligaments. The double contrast knee arthrography was performed in 356 cases at Inha hospital for about 3 years from June 1986 to June 1989. Among them, 115 cases were abnormal, and were analyzed clinically and radiologically with the back ground of the operative finding. The results were as follows ; 1. Of the 115 cases, male were 77 and female 38. Male exceeds female in the ratio of 2 : 1. 2. The age group of 20 - 39 years was commonly involved (60%). 3. The right knee was more commonly involved than the left and the medial meniscus tear was more common (61%). The posterior horn of the meniscus was more frequently torn than the other parts of the meniscus (42%). 4. The incidence of the bucket-handle tear was the most frequent (33%). 5. The cases of the popliteal cyst were 16 (13.9%), and the combined meniscus tears were in 4 cases (25%). 6. The numbers of the discoid meniscus were 9 (7.8%), and all were present in the lateral meniscus, and combined tears were in 4 cases (44.4%). 7. The diagnostic accuracy of the double contrast knee arthrogram was 82.7% compared with operative finding. The false positive examination were 17.3%

  3. Implicações do estresse oxidativo sobre o metabolismo eritrocitário de pessoas com Síndrome de Down Implications of the oxidative stress on the erythrocyte metabolism of Down Syndrome individuals

    Directory of Open Access Journals (Sweden)

    Rinaldo H. Aguilar-da-Silva

    2003-01-01

    Full Text Available Portadores da Síndrome de Down estão sob estresse oxidativo endógeno e crônico que pode ser resultado do excesso de atividade da SOD-1. Este trabalho descreve alguns indicadores e adaptações das defesas frente aos danos oxidativos. Observamos que, nas pessoas com Síndrome de Down, a presença de estresse oxidativo (aumento de 48% na atividade da SOD-1 induziu várias adaptações no metabolismo eritrocitário, sendo que a redução da meta-hemoglobina, via aumento da atividade da meta-hemoglobina redutase (29%, garantiria a eficiência do transporte de oxigênio, enquanto o aumento da GSH (61% propiciaria a integridade funcional do eritrócito. A diminuição dos valores de concentração de hemoglobina e hematócrito, possivelmente, resulta do aumento de atividade da enzima Glicose-6-fosfato desidrogenase e redução da meia-vida eritrocítica. Os efeitos destas adaptações sob a oxigenação do sangue merecem maiores investigações.Down's Syndrome carriers are under endogenous and chronic oxidative stress that can result from an excessive SOD-1enzyme activity. This work describes some indicators and adaptations of the defense system faced with oxidative damage. We observed that, in Down's Syndrome individuals, the presence of oxidative stress (with an increase of 48% in the SOD-1 activity induced several adaptations of the erythrocyte metabolism, with a reduction of methemoglobin, through an increase of methemoglobin reductase activity (29% which guaranteed the efficiency of oxygen transportation. The increase of GSH (61% would propitiate the maintenance of the integrity of the membrane, essential to the functional integrity of erythrocytes. The decrease in the hemoglobin and hematocrit concentrations, possibly, results from the increase in the activity of the glucose-6-phosphate dehydrogenase enzyme, and a reduction in the half-life of erythrocytes. The effects of these adaptations on blood oxygenation require further investigations.

  4. Influence of a native strain of Staphylococcus xylosus on the microbiological, physicochemical and sensorial characteristics on milano salami type

    Directory of Open Access Journals (Sweden)

    Ângela Maria Fiorentini

    2010-08-01

    Full Text Available In this work, the influence of native starter cultures on the microbiological, physicochemical and sensorial characteristics of Milano salami type was studied. Two batches of Milano salami type were produced: Batch A, with the addition of Staphylococcus xylosus U5 and Batch B (control without the starter culture. The Milano salami type was characterized by an important microbial activity of coagulase-negative staphylococci (CNS that resulted in substantial growth in Batch A during the ripening with an initial count of 7.60 log cfu.g-1 and reached 9.84 log CFU.g-1 after 14 days. Bacterial enzymes that showed efficient activity under the conditions found in Milano salami type were catalase, nitrite and nitrate reductase, contributing for sensory and physicochemical properties of the product. There were no significant differences in general free fatty acids composition among the batches, while the color parameters (L *, a * and b * in the Batch A presented significantly higher values in relation to Batch B. Moreover, batch A had the higher preference in sensorial analysis.A análise da influência de culturas iniciadoras nativas nas características microbiológicas, físicoquímicas e sensoriais de salame tipo Milano foi o objeto deste estudo. Foram produzidos dois grupos de salame tipo Milano: Grupo A - com aplicação de linhagem Staphylococcus xylosus U5 enquanto o controle, Grupo B, foi produzido sem culturas iniciadoras. O salame tipo Milano foi caracterizado pela importante atividade microbiana de estafilococos coagulase negativo (SCN, que resultou significativo crescimento no Grupo A durante a maturação, com contagem inicial de 7,60 ufc.g-1 e alcançando um crescimento de 9,84 cfu.g-1 depois de 14 dias. As enzimas bacterianas que mostraram eficiente atividade sob as condições encontradas no salame tipo Milano foram catalase, nitrito e nitrato redutase, contribuindo para as propriedades físicoquímicas e sensoriais do produto. N

  5. Efeito da coenzima Q10 nos danos oxidativos induzidos pela L-tiroxina no músculo sóleo de ratos

    Directory of Open Access Journals (Sweden)

    Fabiana Barreiro de Freitas Silva

    2015-04-01

    Full Text Available INTRODUÇÃO: os músculoesqueléticos são tecidos dinâmicos que podem alterar suas características fenotípicas proporcionando melhor adaptação funcional com estímulos variados. A L-tiroxina é um hormônio produzido pela glândula tireoide e tem sido utilizada como modelo experimental para estimulação de estresse oxidativo no músculo esquelético. A coenzima Q10 é uma provitamina lipossolúvel sintetizada endogenamente e naturalmente encontrada em alimentos como carne vermelha, peixes, cereais, brócolis e espinafre. Apresenta propriedade antioxidante e tem potencial no tratamento de doenças degenerativas e neuromusculares. OBJETIVO: avaliar o efeito protetor da coenzima Q10 no músculo sóleo de ratos frente aos danos oxidativos provocados pela L-tiroxina. MÉTODOS: os ratos foram distribuídos em quatro grupos de seis animais cada: Grupo 1 controle; Grupo 2 coenzima Q10; Grupo 3 L-tiroxina e Grupo 4 coenzima Q10 e L-tiroxina. Após a eutanásia, o sangue dos animais foi colhido e foi analisada a atividade sérica das enzimas creatina quinase CK e aspartato aminotransferase AST. No homogenato do músculo sóleo foram avaliados fatores relacionados ao estresse oxidativo. RESULTADOS: a coenzima Q10 protegeu o músculo sóleo dos danos provocados pela L-tiroxina e favoreceu a manutenção da atividade das enzimas antioxidantes glutationa redutase e glutationa peroxidase, da concentração de glutationa reduzida e oxidada, além de evitar a lipoperoxidação. CONCLUSÃO: os resultados indicam que a coenzima Q10 protege o músculo sóleo de ratos dos danos oxidativos provocados pela L-tiroxina.

  6. Potenciais biomarcadores da terapia cognitivo-comportamental para o transtorno de estresse pós-traumático: uma revisão sistemática

    Directory of Open Access Journals (Sweden)

    Raquel Gonçalves

    2011-01-01

    Full Text Available CONTEXTO: O estabelecimento de biomarcadores relacionados à terapia cognitivo-comportamental (TCC é uma maneira de consolidar a eficácia do tratamento de forma mais objetiva, sendo crítico para o avanço desse campo de pesquisa. OBJETIVOS: Foi realizada uma revisão sistemática de estudos que: 1 utilizaram parâmetros biológicos para verificar a eficácia da TCC no tratamento do transtorno de estresse pós-traumático (TEPT; e 2 utilizaram esses parâmetros como preditores de resposta à CBT. MÉTODOS: Foram conduzidas buscas eletrônicas nas bases PubMed/Medline, ISI/Thompson Reuters e Pilot. RESULTADOS: Doze artigos foram selecionados para esta revisão, sendo quatro deles estudos sobre predição de resposta ao tratamento. Foi observada relação entre a eficácia da TCC e modificações nesses parâmetros, sendo a resposta da frequência cardíaca à evocação de sintomas o parâmetro mais utilizado até o presente momento. Sua redução está associada à melhora nos sintomas de TEPT. Potenciais biomarcadores de predição de resposta encontrados incluem 5α-redutase, ativação da amígdala, ativação e volume do córtex cingulado anterior e frequência cardíaca. CONCLUSÃO: Apesar da escassez de estudos e das limitações metodológicas neles observadas, investigações iniciais sugerem que os biomarcadores da TCC em pacientes com TEPT poderão ser úteis para o monitoramento mais objetivo dos efeitos do tratamento, identificação de predição de resposta e para o desenvolvimento de estratégias mais eficazes de tratamento e prevenção do desenvolvimento de TEPT.

  7. Antioxidant isoenzyme responses to nickel-induced stress in tobacco cell suspension culture Resposta de isoenzimas antioxidantes ao estresse induzido por níquel em cultura de células em suspensão de fumo

    Directory of Open Access Journals (Sweden)

    Georgia Bertoni Pompeu

    2008-01-01

    Full Text Available Exposure to nickel (Ni at high concentrations can lead to production of reactive oxygen species (ROS resulting in oxidative damage at the cellular level. We investigated the antioxidative responses of Nicotiana tabacum cv BY-2 cell suspension to Ni stress (0.075 and 0.75 mM NiCl2 over a 72 h period with special attention to potential alterations in isoenzymes of superoxide dismutase (SOD, catalase (CAT and glutathione reductase (GR. Two main SOD isoenzymes were observed, a Mn-SOD (band I and a Fe-SOD (band II, as well as one CAT isoenzyme and four GR isoenzymes. Activity staining analysis revealed that CAT activity plays a major role in the early response to Ni-induced oxidative stress, particularly when the Ni concentration used was low, whilst a specific GR isoenzyme appears to respond to the Ni-induced oxidative stress when a much higher Ni concentration was used to induce the stress for the same period of treatment. These results illustrate the importance and advantages of determining individual isoenzyme activities.A exposição ao níquel (Ni, em altas concentrações, pode levar à produção de espécies reativas de oxigênio (EAOs, resultando em danos oxidativos em nível celular. Foram investigadas as respostas antioxidativas de células em suspensão do cultivar BY-2 de Nicotiana tabacum submetidas ao estresse por Ni (0.075 e 0.75 mM de NiCl2 por 72 h, com atenção especial às alterações potencias em isoenzimas de superóxido dismutase (SOD, catalase (CAT e glutatione redutase (GR. Duas principais isoenzimas de SOD foram observadas, uma Mn-SOD (banda I e outra Fe-SOD (banda II, bem como uma isoenzima CAT e quatro isoenzimas de GR. As análises revelaram que a atividade de CAT tem papel principal no momento inicial de resposta ao estresse oxidativo induzido por Ni, particularmente, quando sua concentração foi mais baixa, enquanto uma isoenzima específica de GR parece responder a este estresse na concentração mais alta de Ni

  8. Physiological responses in the banana plantlets treateds with strobilurinsRespostas fisiológicas em mudas de banananeira tratadas com estrobilurinas

    Directory of Open Access Journals (Sweden)

    Sivia Helena Modenese-Gorla da Silva

    2012-04-01

    âmetro do pseudocaule e a massa da matéria seca da parte aérea de plantas tratadas com estrobilurinas foram superiores às de plantas não tratadas. O efeito do tratamento com fungicidas foi diferenciado, sendo mais pronunciado nas plantas tratadas com piraclostrobina do que nas plantas tratadas com azoxistrobina. Plantas tratadas com piraclostrobina apresentaram área foliar, atividade da redutase do nitrato e teor de clorofila a e de nitrogênio total foliar superiores às plantas tratadas com azoxistrobina e água, que não diferiram entre si. As estrobilurinas afetaram a fisiologia das mudas de bananeira, com destaque para a piraclostrobina.

  9. Efeito do exercício físico e estatinas na função muscular em animais com dislipidemia

    Directory of Open Access Journals (Sweden)

    Marilita Falângola Accioly

    2012-06-01

    Full Text Available As estatinas são utilizadas no tratamento das dislipidemias, com grande tolerância; no entanto, vários efeitos colaterais podem surgir, destacando-se miopatia. A prática regular do exercício físico (EF produz modificações favoráveis no perfil lipídico; entretanto, pode gerar lesões musculares. OBJETIVO: Avaliar o efeito da associação entre exercício físico e estatinas na função muscular, pela análise histológica, em modelo experimental animal com dislipidemia. MÉTODOS: Foram utilizados 80 ratos machos Wistar, distribuídos em oito grupos, incluindo animais submetidos à dieta hipercolesterolêmica (DH, sinvastatina com (G1 e sem (G2 EF; DH e fluvastatina, com (G3 e sem EF (G4; alimentados com ração comercial (RC na presença (G5 e ausência de (G6 EF; DH submetidos (G7 ou não (G8 a EF. A DH foi administrada por 90 dias, as estatinas e prática de EF em esteira rolante por oito semanas. Os animais foram sacrificados, e o músculo sóleo retirado para análise histológica. Aplicaram-se os testes t de Student pareado e análise multivariada, com nível significante para p < 0,05. RESULTADOS: As principais alterações histológicas encontradas foram fibras de diferentes diâmetros, atróficas, em degeneração, splitting, edema, infiltrado inflamatório. Essas alterações foram observadas em 90% dos animais do grupo G1, 80% do G2, 70% do G3, 30% do G4, 40% do G5 e 30% do G7. Nos grupos G6 e G8 identificaram-se fibras musculares com morfologia preservada. CONCLUSÕES: Na avaliação histológica muscular, a associação entre fluvastatina, sinvastatina e exercício físico acarreta alterações morfológicas com predomínio no uso da sinvastatina, variando de grau leve a grave, no músculo sóleo de ratos, induzidos pelos inibidores da HMG-CoA redutase.

  10. Surto psicótico pela possível interação medicamentosa de sibutramina com finasterida Psychotic episode induced by potential drug interaction of sibutramine and finasteride

    Directory of Open Access Journals (Sweden)

    Douglas Dogol Sucar

    2002-03-01

    Full Text Available É descrito um caso de interação medicamentosa em um paciente de 30 anos, que fazia com sucesso um tratamento antiobesidade com sibutramina. Esse medicamento é um saciogênico que inibe a recaptação da serotonina e da noradrenalina. Logo após a introdução da finasterida para tratamento da alopécia androgênica, o paciente passou a apresentar surto psicótico. Esse medicamento é um potente inibidor da 5-alfa-redutase do tipo II. A interação medicamentosa demonstra-se por meio de um rigoroso acompanhamento clínico e de uma aplicação do algoritmo de Naranjo. Também descrevem-se as condições clínicas gerais do paciente e sua evolução. Discutem-se os mecanismos prováveis que levaram à interação medicamentosa, com a conclusão de que a finasterida inibiu o metabolismo hepático da sibutramina. Esta deslocou a finasterida de seus pontos de ligações com as proteínas, aumentando sua fração livre plasmática e inibindo ainda mais o metabolismo da sibutramina. Com aumento de serotonina, noradrenalina e dopamina na fenda sináptica, desencadeia-se o surto psicótico.A case of drug interaction is here described in a 30-year patient undergoing a successful anti-obesity treatment with sibutramine. Sibutramine is a drug that inhibits serotonine and noradrenaline reuptake. Soon after the introduction of finasteride to treat his alopecia, a paranoid-psychotic behavior developed. Finasteride is a powerful 5-alpha-reductase type 2 inhibitor. Drug interaction is shown through a careful clinical follow-up and the application of Naranjo algorithm. The patient's general condition and clinical progression are also described. In addition, the most likely mechanisms of drug interaction are discussed. It seems that finasteride inhibited the hepatic metabolism of sibutramine that, by its turn, displaced finasteride from its plasma protein binding. This phenomenon resulted in higher plasma levels of finasteride and lower metabolism of

  11. Finasteride-associated male infertility Infertilidade masculina associada ao uso de finasterida

    Directory of Open Access Journals (Sweden)

    Sidney Glina

    2004-01-01

    Full Text Available Finasteride is a potent and specific inhibitor of the 5alpha-reductase enzyme in men. Clinical studies have shown that finasteride 1mg/day is effective for promoting hair growth in men with male pattern hair loss. However, there is a concern about the use of finasteride, especially in young fertile patients, because of its action on testosterone metabolism. This paper describes 3 cases of young patients who had very poor seminal quality during finasteride treatment (1 mg/day, and their seminal quality greatly improved after cessation of finasteride treatment. Two of them presented with a left varicocele and the other was obese. We hypothesize that finasteride may not dramatically change the spermatogenesis process in healthy men, but in patients with conditions related to infertility, an amplification of the negative influence of finasteride could occur. Future studies should be done to clarify the extent of the effect of finasteride in patients fertility problems.A finasterida é um potente e específico inibidor da enzima 5alfa-redutase em homens. Estudos clínicos demonstraram que finasterida 1mg/dia diminui a progressão da queda e aumenta o crescimento do cabelo em homens que sofrem de queda de cabelo hereditária. Por sua influência no metabolismo dos andrógenos existe uma preocupação a respeito do seu uso, principalmente em pacientes em idade fértil. Neste trabalho são descritos 3 casos de pacientes jovens, que apresentaram piora do espermograma durante o uso continuado de finasterida 1mg revertida após a suspensão do mesmo. Dois deles tinham varicocele unilateral e o terceiro era obeso. Aparentemente o tratamento com finasterida promoveu alteração significativa na qualidade seminal. Pode-se especular que talvez a finasterida por si só não traga alteração para a espermatogênese como reportado por Overstreet et al. (1999, mas que em pacientes de risco com possíveis causas de infertilidade associadas, possa ocorrer a

  12. Genetic structure of Antioquia Holstein from two SNPs and association with dairy traits

    Directory of Open Access Journals (Sweden)

    Stephania Madrid G

    2015-11-01

    Full Text Available Objective. Analyze the structure and genetic differentiation of a population of Antioquia Holstein cows from the polymorphisms A192G of INHA and A-320T of FSHR, and explore the association of the genotypic combinations with milk traits. Materials and methods. 1240 lactations of 356 animals from 9 herds in 6 municipalities of Antioquia were analyzed. Genotyping was performed by PCR-RFLP. Structure and genetic diversity parameters were determined using GenAlex software. The association of genotypes combinations with productive and reproductive traits was explored through a linear mixed model. Results. SNP A192G showed a frequency of 0.534 and 0.466 for A and G alleles respectively and SNP A-320T had a frequency of 0.660 far A allele and 0.339 for T allele, this way the population is in HWE. The FST, FIS and FIT values were 0.059, 0.285 and 0.328 respectively indicating a moderate genetic differentiation between subpopulations. The A-320T SNP showed significant effect on milk yield. Fat and protein percentage, calving interval and services per conception were not affected by these polymorphisms or their interaction. Conclusions. Phenotypic selection made on this population has not been strong enough to generate noticeable changes in allele frequencies of these polymorphisms or deviations from Hardy-Weinberg equilibrium. The interaction of these polymorphisms has no significant effect on the characteristics of zootechnical interest, so its use in programs of molecular marker assisted selection is not recommended.

  13. Reversible effects of oxygen partial pressure on genes associated with placental angiogenesis and differentiation in primary-term cytotrophoblast cell culture.

    Science.gov (United States)

    Debiève, F; Depoix, C; Gruson, D; Hubinont, C

    2013-09-01

    Timely regulated changes in oxygen partial pressure are important for placental formation. Disturbances could be responsible for pregnancy-related diseases like preeclampsia and intrauterine growth restriction. We aimed to (i) determine the effect of oxygen partial pressure on cytotrophoblast differentiation; (ii) measure mRNA expression and protein secretion from genes associated with placental angiogenesis; and (iii) determine the reversibility of these effects at different oxygen partial pressures. Term cytotrophoblasts were incubated at 21% and 2.5% O2 for 96 hr, or were switched between the two oxygen concentrations after 48 hr. Real-time PCR and enzyme-linked immunosorbent assays (ELISAs) were used to evaluate cell fusion and differentiation, measuring transcript levels for those genes involved in cell fusion and placental angiogenesis, including VEGF, PlGF, VEGFR1, sVEGFR1, sENG, INHA, and GCM1. Cytotrophoblasts underwent fusion and differentiation in 2.5% O2 . PlGF expression was inhibited while sVEGFR1 expression increased. VEGF and sENG mRNA expressions increased in 2.5% compared to 21% O2 , but no protein was detected in the cell supernatants. Finally, GCM1 mRNA expression increased during trophoblast differentiation at 21% O2 , but was inhibited at 2.5% O2 . These mRNA expression effects were reversed by returning the cells to 21% O2 . Thus, low-oxygen partial pressure does not inhibit term-cytotrophoblast cell fusion and differentiation in vitro. Lowering the oxygen partial pressure from 21% to 2.5% caused normal-term trophoblasts to reversibly modify their expression of genes associated with placental angiogenesis. This suggests that modifications observed in pregnancy diseases such as preeclampsia or growth retardation are probably due to an extrinsic effect on trophoblasts. Copyright © 2013 Wiley Periodicals, Inc.

  14. Writing about an experience of illness in medical students

    Directory of Open Access Journals (Sweden)

    Hwang K

    2013-08-01

    Full Text Available Kun Hwang,1 Huan Fan,1 Se Won Hwang2 1Department of Plastic Surgery, Inha University School of Medicine, Incheon, Korea; 2Peninsula Medical School, Exeter, UK Abstract: Pathography is defined as “historical biography from a medical, psychological, and psychiatric viewpoint.” We thought that writing about an experience of illness might help students understand patients’ experience and in turn grow in terms of self-understanding. Participants included 151 medical students. Students wrote about their own experience of illness and were asked to answer questions from the Likert scale. Most students wrote about themselves (79.2%; however, some students (20.8% wrote about the illness of others. Among the 149 pathographies, ecopathography was most frequent (30.9%, followed by testimonial pathography (25.5%; angry pathography (13.4% and alternative pathography (12.1% were relatively less frequent. Eighty-eight pathographies (59.1% showed 120 expressions of family relationship. Among the 120 cases, worrying about family members was most frequent (47.5%, followed by reliance on a family member (32.5%. All students wrote about the enlightenment experienced on returning to daily life. The sense of belonging together was most frequent (38.3%, followed by gratitude for living (20.8%, resolution to be a good doctor (18.1%, and a will to live and be healthy (12.1%. Answers on the Likert scale (total 5 for pathography beneficence were very high in understanding desirable doctor image (4.46, attaining morals and personality as a health care professional (4.49, and understanding basic communication skills (4.46. Writing about an experience of illness allows students to better understand patients’ experience and to grow in self-understanding. Keywords: writing, disease, patients, narration, pathography

  15. Significant adverse reactions to long-acting gonadotropin-releasing hormone agonists for the treatment of central precocious puberty and early onset puberty

    Directory of Open Access Journals (Sweden)

    Ji Woo Lee

    2014-09-01

    Full Text Available PurposeLong-acting gonadotropin-releasing hormone agonists (GnRHa are commonly used to treat central precocious puberty (CPP in Korea. Although rare, there have been reports on the characteristic of adverse reactions of GnRHa in CPP among the Korean population. This study was intended to report on our clinical experience regarding significant adverse reactions to long-acting GnRHa in CPP and early onset puberty and to evaluate the prevalence rate of serious side effects.MethodsThis retrospective study included children with CPP and early onset puberty, who were administered monthly with long-acting GnRHa (leuprolide acetate, triptorelin acetate at the outpatient clinic of Department of Pediatrics, at Inha University Hospital, between January 2011 and December 2013. We analyzed the clinical characteristics of patients who experienced significant adverse reactions and evaluated the prevalence rate.ResultsSix serious side effects (0.9% were observed among total of 621 CPP and early onset puberty children with GnRHa therapy. The number of sterile abscess formation was four in three patients (4 events of 621. Anaphylaxis occurred in only one patient, and unilateral slipped capital femoral epiphysis (SCFE in another one patient. Anaphylaxis occurred after the 6th administration of the monthly depot triptorelin acetate. Unilateral SCFE developed in GnRHa therapy.ConclusionSterile abscess formation occurred in 0.6% of CPP and early onset puberty patients from the administration of a monthly depot GnRHa therapy. The occurrences of anaphylaxis and SCFE are extremely rare, but can have serious implications on patients. Clinicians should be aware of these potential adverse effects related to GnRHa therapy in CPP.

  16. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. A role for Waldeyer's ring in immunological response to allergens.

    Science.gov (United States)

    Masieri, Simonetta; Trabattoni, Daria; Incorvaia, Cristoforo; De Luca, Maria Cristina; Dell'Albani, Ilaria; Leo, Gualtiero; Frati, Franco

    2014-02-01

    Adenoids, tubal tonsil, palatine tonsil, and lingual tonsil are immunological organs included in the Waldeyer's ring, the basic function of which is the antibody production to common environmental antigens. Adenoidal hypertrophy (AH) is a major medical issue in children, and adenoidectomy is still the most used treatment worldwide. The response of adenoids to allergens is a good model to evaluate their immunological function. This report assessed the immunological changes in adenoid tissues from children with allergic rhinitis (AR) undergoing sublingual immunotherapy (SLIT). Adenoid samples from 16 children (seven males, nine females, mean age 7.12 years) with AH and clinical indication to adenoidectomy were collected. Of them, five children were not allergic and 11 had house dust mite and grass pollen-induced AR. Among allergic children, in four AR was treated by antihistamines while in seven AR was treated by high-dose SLIT during 4-6 months. The evaluation addressed the T helper 1 (Th1), Th2, and Th3 cells by performing a PCR array on mRNA extracted from adenoid samples. In non-allergic children, a typical Th1 pattern was found. SLIT induced a strong down-regulation of genes involved in Th2 and Th1 activation and function. In particular, in SLIT-treated allergic children IL-4, CCR2, CCR3, and PTGDR2 (Th2 related genes) and CD28, IL-2, and INHA (Th1 related genes) expression was reduced, compared with children treated with antihistamines. These preliminary findings warrant investigation in trials including larger numbers of patients, but indicate that hypertrophic adenoids of allergic children have the typical response to the specific allergen administered by SLIT. This should suggest that one should reconsider the immunological role of adenoids.

  18. Harvesting energy wood in connection to young stand treatment; Energiapuun korjuu taimikon harvennuksen yhteydessae

    Energy Technology Data Exchange (ETDEWEB)

    Haemaelaeinen, J; Lilleberg, R; Poikela, A; Rieppo, K [Metsaeteho Oy, Helsinki (Finland)

    1997-12-01

    In the study felling-bunching and the Chipset chipharvester was tried in late thinning of a young stand. Also the impact of energy wood recovery in the young stand stage on the profitability of first thinning was monitored. On the study site the amount of trees to be cut was 5 300 - 22 000 trees/ha, mean height 2,7 - 5,0 m and the total biomass amounted to 26 - 75 m{sup 3}/ha. The felling-bunching was made with a chain-saw equipped with felling handles. The work consisted of opening of the strip roads, of thinning the stand between strip roads and of bunching the trees for the chip-harvester. The effective time expenditure of felling-bunching was on the different sites 8,5 - 27 in/ha or 0,24 - 0,64 h/m{sup 3}. The calculated costs of the work were 900 - 2 800 FIM/ha or 26 - 67 FIM/m{sup 3}. The density and volume of the trees strongly influenced work productivity. The Chipset chipping productivity was 5,7 - 8,7 m{sup 3} per gross effective hour. The chipping costs, when hauling distance was 250 meters, were 44 - 81 FIM/m{sup 3} or 21 - 43 FIM/MVVh. The total costs of energy wood procurement at the plant were 112 - 144 FIM/m{sup 3} or 56 - 73 FIM/MWh. The opening of strip roads during young stand treatment decreases net volume later in the first thinning. According to calculations made for the example sites the net volume decreased by approx. 9 m{sup 3}/ha. The first thinning costs thus increased by 4 FIM/m{sup 3} or ca 5 %. In the extension project the technical, economical and productional preconditions for combining young stand treatment, energy wood harvesting and first thinning will be monitored

  19. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  20. Phenotypic and genotypic analysis of anti-tuberculosis drug resistance in Mycobacterium tuberculosis isolates in Myanmar.

    Science.gov (United States)

    Aung, Wah Wah; Ei, Phyu Win; Nyunt, Wint Wint; Swe, Thyn Lei; Lwin, Thandar; Htwe, Mi Mi; Kim, Kyung Jun; Lee, Jong Seok; Kim, Chang Ki; Cho, Sang Nae; Song, Sun Dae; Chang, Chulhun L

    2015-09-01

    Tuberculosis (TB) is one of the most serious health problems in Myanmar. Because TB drug resistance is associated with genetic mutation(s) relevant to responses to each drug, genotypic methods for detecting these mutations have been proposed to overcome the limitations of classic phenotypic drug susceptibility testing (DST). We explored the current estimates of drug-resistant TB and evaluated the usefulness of genotypic DST in Myanmar. We determined the drug susceptibility of Mycobacterium tuberculosis isolated from sputum smear-positive patients with newly diagnosed pulmonary TB at two main TB centers in Myanmar during 2013 by using conventional phenotypic DST and the GenoType MTBDRplus assay (Hain Lifescience, Germany). Discrepant results were confirmed by sequencing the genes relevant to each type of resistance (rpoB for rifampicin; katG and inhA for isoniazid). Of 191 isolates, phenotypic DST showed that 27.7% (n=53) were resistant to at least one first-line drug and 20.9% (n=40) were resistant to two or more, including 18.3% (n=35) multidrug-resistant TB (MDR-TB) strains. Monoresistant strains accounted for 6.8% (n=13) of the samples. Genotypic assay of 189 isolates showed 17.5% (n=33) MDR-TB and 5.3% (n=10) isoniazid-monoresistant strains. Genotypic susceptibility results were 99.5% (n=188) concordant and agreed almost perfectly with phenotypic DST (kappa=0.99; 95% confidence interval 0.96-1.01). The results highlight the burden of TB drug resistance and prove the usefulness of the genotypic DST in Myanmar.

  1. Efficient differentiation of steroidogenic and germ-like cells from epigenetically-related iPSCs derived from ovarian granulosa cells.

    Directory of Open Access Journals (Sweden)

    Raymond Anchan

    Full Text Available To explore restoration of ovarian function using epigenetically-related, induced pluripotent stem cells (iPSCs, we functionally evaluated the epigenetic memory of novel iPSC lines, derived from mouse and human ovarian granulosa cells (GCs using c-Myc, Klf4, Sox2 and Oct4 retroviral vectors. The stem cell identity of the mouse and human GC-derived iPSCs (mGriPSCs, hGriPSCs was verified by demonstrating embryonic stem cell (ESC antigen expression using immunocytochemistry and RT-PCR analysis, as well as formation of embryoid bodies (EBs and teratomas that are capable of differentiating into cells from all three germ layers. GriPSCs' gene expression profiles associate more closely with those of ESCs than of the originating GCs as demonstrated by genome-wide analysis of mRNA and microRNA. A comparative analysis of EBs generated from three different mouse cell lines (mGriPSCs; fibroblast-derived iPSC, mFiPSCs; G4 embryonic stem cells, G4 mESCs revealed that differentiated mGriPSC-EBs synthesize 10-fold more estradiol (E2 than either differentiated FiPSC- or mESC-EBs under identical culture conditions. By contrast, mESC-EBs primarily synthesize progesterone (P4 and FiPSC-EBs produce neither E2 nor P4. Differentiated mGriPSC-EBs also express ovarian markers (AMHR, FSHR, Cyp19a1, ER and Inha as well as markers of early gametogenesis (Mvh, Dazl, Gdf9, Boule and Zp1 more frequently than EBs of the other cell lines. These results provide evidence of preferential homotypic differentiation of mGriPSCs into ovarian cell types. Collectively, our data support the hypothesis that generating iPSCs from the desired tissue type may prove advantageous due to the iPSCs' epigenetic memory.

  2. MOLECULAR CHARACTERIZATION OF MYCOBACTERIUM TUBERCULOSIS STRAINS CIRCULATING IN THE URAL REGION, RUSSIA

    Directory of Open Access Journals (Sweden)

    T. V. Umpeleva

    2013-01-01

    Full Text Available Abstract. Overall 178 Mycobacterium tuberculosis isolates recovered in 2009–2011 from newly diagnosed epidemiologically unlinked to TB patients in the Ural region of Russia have been studied. The absolute concentration method was used for drug susceptibility testing. Mutations katG, inhA and rpoB associated with resistance to isoniazid and rifampicin were detected by microchip technology («TB-Biochip». The isolates were genotyped by real-time PCR for the detection of Beijing/non-Beijing genotypes and 15-locus MIRU-VNTR typing according to «MIRU-VNTRplus» (http://www.miru-vntrplus.org. More than half (55.1% of 178 isolates belonged to the Beijing family, 58.7% of them were multiple drug resistant (MDR mostly due to rpoBSer531→Leu and katGSer315→Thr1 substitutions. Fifty VNTR profiles were found in 98 Beijing isolates; 57 of them grouped into 9 clusters. The largest VNTR cluster included 23 (23.5% Beijing isolates and 21 of them were MDR. The 80 non-Beijing isolates showed 64 distinct VNTR patterns which belonged to 6 genetic families: LAM, Ural, Haarlem, etc. Among LAM and Ural isolates 30.4% and 28.6% were MDR, respectively. The 5 of 7 MDR LAM isolates had specific mutation profile:  rpoBAsp516→Val substitution and mutations katGSer315→Thr1 and inhA_T15. The MDR Ural isolates showed the heterogeneity of mutations in rpoB gene compared to other genotypes. Taken together, these findings suggest the emergence and spread of MDR-TB in the Ural region which is characterized by circulation of MDR strains of different genotypes with the Beijing family genotype to be predominant.

  3. Detection of First-Line Drug Resistance Mutations and Drug-Protein Interaction Dynamics from Tuberculosis Patients in South India.

    Science.gov (United States)

    Nachappa, Somanna Ajjamada; Neelambike, Sumana M; Amruthavalli, Chokkanna; Ramachandra, Nallur B

    2018-05-01

    Diagnosis of drug-resistant tuberculosis predominantly relies on culture-based drug susceptibility testing, which take weeks to produce a result and a more time-efficient alternative method is multiplex allele-specific PCR (MAS-PCR). Also, understanding the role of mutations in causing resistance helps better drug designing. To evaluate the ability of MAS-PCR in the detection of drug resistance and to understand the mechanism of interaction of drugs with mutant proteins in Mycobacterium tuberculosis. Detection of drug-resistant mutations using MAS-PCR and validation through DNA sequencing. MAS-PCR targeted five loci on three genes, katG 315 and inhA -15 for the drug isoniazid (INH), and rpoB 516, 526, and 531 for rifampicin (RIF). Furthermore, the sequence data were analyzed to study the effect on interaction of the anti-TB drug molecule with the target protein using in silico docking. We identified drug-resistant mutations in 8 out of 114 isolates with 2 of them as multidrug-resistant TB using MAS-PCR. DNA sequencing confirmed only six of these, recording a sensitivity of 85.7% and specificity of 99.3% for MAS-PCR. Molecular docking showed estimated free energy of binding (ΔG) being higher for RIF binding with RpoB S531L mutant. Codon 315 in KatG does not directly interact with INH but blocks the drug access to active site. We propose DNA sequencing-based drug resistance detection for TB, which is more accurate than MAS-PCR. Understanding the action of resistant mutations in disrupting the normal drug-protein interaction aids in designing effective drug alternatives.

  4. Outcome analysis of sports-related multiple facial fractures.

    Science.gov (United States)

    Hwang, Kun; You, Sun Hye; Lee, Hong Sik

    2009-05-01

    In this paper, we report a retrospective study of 236 patients with facial bone fractures from various sports who were treated at the Department of Plastic and Reconstructive Surgery, Inha University Hospital, Incheon, South Korea, between February 1996 and April 2007. The medical records of these patients were reviewed and analyzed to determine the clinical characteristics and treatment of the sports-related facial bone fractures. The highest frequency of sports-related facial bone fractures was in the age group 11 to 20 years (40.3%); there was a significant male predominance in all age groups (13.75:1). The most common causes of the injury were soccer (38.1%), baseball (16.1%), basketball (12.7%), martial arts (6.4%), and skiing or snowboarding (11%). Fractures of the nasal bone were the most common in all sports; mandible fractures were common in soccer and martial arts, orbital bone fractures were common in baseball, basketball, and ice sports, and fractures of the zygoma were frequently seen in soccer and martial arts. The main causes of the sports injuries were direct body contact (50.8%), and the most commonly associated soft tissue injuries were found in the head and neck regions (92.3%). Nasal bone fractures were the most common (54.2%), and tripod fractures were the most common type of complex injuries (4.2%). The complication rate was 3.0%. Long-term epidemiological data regarding the natural history of sports-related facial bone fractures are important for the evaluation of existing preventative measures and for the development of new methods of injury prevention and treatment.

  5. Survival of civilian and prisoner drug-sensitive, multi- and extensive drug- resistant tuberculosis cohorts prospectively followed in Russia.

    Directory of Open Access Journals (Sweden)

    Yanina Balabanova

    Full Text Available OBJECTIVE AND METHODS: A long-term observational study was conducted in Samara, Russia to assess the survival and risk factors for death of a cohort of non-multidrug resistant tuberculosis (non-MDRTB and multidrug resistant tuberculosis (MDRTB civilian and prison patients and a civilian extensive drug-resistant tuberculosis (XDRTB cohort. RESULTS: MDRTB and XDRTB rates of 54.8% and 11.1% were identified in the region. Half (50% of MDRTB patients and the majority of non-MDRTB patients (71% were still alive at 5 years. Over half (58% of the patients died within two years of establishing a diagnosis of XDRTB. In the multivariate analysis, retreatment (HR = 1.61, 95%CI 1.04, 2.49 and MDRTB (HR = 1.67, 95%CI 1.17, 2.39 were significantly associated with death within the non-MDR/MDRTB cohort. The effect of age on survival was relatively small (HR = 1.01, 95%CI 1.00, 1.02. No specific factor affected survival of XDRTB patients although median survival time for HIV-infected versus HIV-negative patients from this group was shorter (185 versus 496 days. The majority of MDRTB and XDRTB strains (84% and 92% respectively strains belonged to the Beijing family. Mutations in the rpoB (codon 531 in 81/92; 88.8%, katG (mutation S315T in 91/92, 98.9% and inhA genes accounted for most rifampin and isoniazid resistance respectively, mutations in the QRDR region of gyrA for most fluroquinolone resistance (68/92; 73.5%. CONCLUSIONS: Alarmingly high rates of XDRTB exist. Previous TB treatment cycles and MDR were significant risk factors for mortality. XDRTB patients' survival is short especially for HIV-infected patients. Beijing family strains comprise the majority of drug-resistant strains.

  6. Is MTHFR polymorphism a risk factor for Alzheimer's disease like APOE? Polimorfismo da MTHFR é um fator de risco para demência de Alzheimer como APOE?

    Directory of Open Access Journals (Sweden)

    Liana Lisboa Fernandez

    2005-03-01

    Full Text Available BACKGROUND: The role of methylenetetrahydrofolate reductase (MTHFR gene polymorphisms as risk factors for the occurence of Alzheimer's disease (AD is still controversial: OBJECTIVE: To verify the association between MTHFR and apolipoprotein E (APOE polymorphisms and Alzheimer's disease. METHOD: This work was conducted as a case-control study. Cases included thirty patients with probable AD. Controls were constituted by 29 individuals without dementia according to neuropsychological tests paired to age, sex, race and educational level. DNA was isolated from peripheral leukocytes of anticoagulated venous blood. Genotyping of APOE and MTHFR were performed by DNA amplification and digestion. The frequences of APOE and MTHFR genotypes were submitted by chi-square test corrected by Fisher test; the APOE genotypes, to chi-square linear tendency test and the frequences of MTHFR mutant and AD, by stratificated anlysis adjust by Mantel-Haenszel method. RESULTS: There was significant difference about APOE4 and APOE2 in the groups. (p=0.002 The odds ratio increased exponentially with the increased number of E4 allele (chi2 linear tendency test. No significant difference was detected on MTHFR genotypes in both case and control groups. CONCLUSION: The APOE4 is a risk factor and demonstrated a dose-depenent effect while APOE2 allele conferred a protection to AD. The MTHFR mutation had no correlation with AD.INTRODUÇÃO: O papel do polimorfismo do gene da metilenotetrahidrofolato redutase (MTHFR como um fator de risco para demência de Alzheimer (DA é controverso ainda. OBJETIVO: Verificar a associação entre os polimorfismos da MTHFR e apolipoproteína E (APOE e DA. MÉTODO: O trabalho foi conduzido como um estudo caso-controle. Trinta pacientes com DA provável foram incluídos no grupo caso. Vinte e nove indivíduos sem demência comprovadas por testes neuropsicológicos, emparelhados pela idade, sexo, cor e nível educacional constituíram o grupo

  7. Prevalência dos fatores trombofílicos em mulheres com infertilidade Prevalence of thrombophilic factors in infertile women

    Directory of Open Access Journals (Sweden)

    Adriana de Góes e Silva Soligo

    2007-05-01

    Full Text Available OBJETIVO: determinar a prevalência dos fatores trombofílicos em mulheres inférteis. MÉTODOS: estudo de corte transversal, no qual foram admitidas mulheres inférteis atendidas em clínica privada e submetidas à investigação de trombofilia, conforme protocolo da referida clínica, no período de março de 2003 a março de 2005, após aprovação do Comitê de Ética e Pesquisa da Universidade Estadual de Campinas (UNICAMP. Foram incluídas mulheres com história de infertilidade, definida como um ano de coito desprotegido sem concepção. Foram excluídas mulheres com hepatopatia e dados incompletos em prontuário, obtendo-se uma amostra de 144 mulheres. Os fatores trombofílicos avaliados foram: o anticorpo anticardiolipina (ACL, o anticoagulante lúpico (ACGL, a deficiência de proteína C (DPC, a deficiência de proteína S (DPS, a deficiência de antitrombina III (DAT, a presença do fator V de Leiden, uma mutação no gene da protrombina e a mutação do metileno tetrahidrofolato redutase (MTHFR. Resultados: os valores de prevalência obtidos para ACL e ACGL foram de 2%. A prevalência dos fatores trombofílicos hereditários foram: DPC=4%, DPS=6%, DAT=5%, fator V de Leiden=3%, mutação da protrombina=3% e mutação MTHFR=57%. CONCLUSÕES: das 144 pacientes selecionadas, 105 mulheres, ou seja, 72,9% apresentavam pelo menos um fator trombofílico presente. Isto reforça a importância e justifica a necessidade da investigação destes fatores neste grupo de mulheres.PURPOSE: to establish the prevalence of thrombophilic factors in infertile women. METHODS: a cross-sectional study was performed, in which infertile women, seen in a private clinic with investigation for thrombophilia were included, according to the protocol of the clinic, between March 2003 and March 2005, after the approval of the Research Ethics Committee of the Universidade Estadual de Campinas (UNICAMP. One hundred and forty-four infertile women without any liver

  8. O carvedilol potencializa o efeito antioxidante das vitaminas E e C na cardiopatia chagásica crônica

    Directory of Open Access Journals (Sweden)

    Patrícia Budni

    2013-10-01

    Full Text Available FUNDAMENTO: A doença de Chagas continua a ser uma importante doença endêmica no país, sendo o acometimento cardíaco a sua manifestação mais grave. OBJETIVO: Verificar se o uso concomitante de carvedilol potencializará o efeito antioxidante das vitaminas E e C na atenuação do estresse oxidativo sistêmico na cardiopatia chagásica crônica. MÉTODOS: Foram estudados 42 pacientes com cardiopatia chagásica, agrupados de acordo com a classificação modificada de Los Andes, em quatro grupos: 10 pacientes no grupo IA (eletrocardiograma e ecocardiograma normais: sem envolvimento do coração, 20 pacientes do grupo IB (eletrocardiograma normal e ecocardiograma anormal: ligeiro envolvimento cardíaco, oito pacientes no grupo II (eletrocardiograma e ecocardiograma anormais, sem insuficiência cardíaca: moderado envolvimento cardíaco e quatro pacientes no grupo III (eletrocardiograma e ecocardiograma anormais com insuficiência cardíaca: grave envolvimento cardíaco. Os marcadores de estresse oxidativo foram medidos no sangue, antes e após um período de seis meses de tratamento com carvedilol e após seis meses de terapia combinada com vitaminas E e C. Os marcadores foram: atividades da superóxido dismutase, catalase, glutationa peroxidase, glutationa S-transferase e redutase, mieloperoxidase e adenosina deaminase, e os níveis de glutationa reduzida, de espécies reativas do ácido tiobarbitúrico, proteína carbonilada, vitamina E e óxido nítrico. RESULTADOS: Após o tratamento com carvedilol, todos os grupos apresentaram diminuições significativas dos níveis de proteína carbonilada e glutationa reduzida, enquanto os níveis de óxido nítrico e atividade da adenosina aumentaram significativamente apenas no grupo menos acometido (IA. Além disso, a maioria das enzimas antioxidantes mostrou atividades diminuídas nos grupos menos acometidos (IA e IB. Com a adição das vitaminas ao carvedilol houve diminuição dos danos em prote

  9. The pentose phosphate pathway in Trypanosoma cruzi: a potential target for the chemotherapy of Chagas disease

    Directory of Open Access Journals (Sweden)

    Mariana Igoillo-Esteve

    2007-12-01

    Full Text Available Trypanosoma cruzi is highly sensitive to oxidative stress caused by reactive oxygen species. Trypanothione, the parasite's major protection against oxidative stress, is kept reduced by trypanothione reductase, using NADPH; the major source of the reduced coenzyme seems to be the pentose phosphate pathway. Its seven enzymes are present in the four major stages in the parasite's biological cycle; we have cloned and expressed them in Escherichia coli as active proteins. Glucose 6-phosphate dehydrogenase, which controls glucose flux through the pathway by its response to the NADP/NADPH ratio, is encoded by a number of genes per haploid genome, and is induced up to 46-fold by hydrogen peroxide in metacyclic trypomastigotes. The genes encoding 6-phosphogluconolactonase, 6-phosphogluconate dehydrogenase, transaldolase and transketolase are present in the CL Brener clone as a single copy per haploid genome. 6-phosphogluconate dehydrogenase is very unstable, but was stabilized introducing two salt bridges by site-directed mutagenesis. Ribose-5-phosphate isomerase belongs to Type B; genes encoding Type A enzymes, present in mammals, are absent. Ribulose-5-phosphate epimerase is encoded by two genes. The enzymes of the pathway have a major cytosolic component, although several of them have a secondary glycosomal localization, and also minor localizations in other organelles.Trypanosoma cruzi é altamente sensível ao estresse oxidativo causado por espécies reativas do oxigênio. Tripanotiona, o principal protetor do parasita contra o estresse oxidativo, é mantido reduzido pela tripanotiona redutase, pela presença deNADPH; a principal fonte da coenzima reduzida parece ser a via da pentose fosfato. As sete enzimas dessa via estão presentes nos quatro principais estágios do ciclo biológico do parasita; nós clonamos e expressamos as enzimas em Escherichia coli como proteínas ativas. Glucose 6-fosfato desidrogenase, que controla o fluxo da glucose da

  10. Brazilian blood donation eligibility criteria for dermatologic patients Critérios brasileiros de elegibilidade à doação de sangue para pacientes dermatológicos

    Directory of Open Access Journals (Sweden)

    Carlos Gustavo Wambier

    2012-08-01

    determinado pela Portaria Ministerial no 1353/2011 do Ministério da Saúde e atuais normas internas do Hemocentro de Ribeirão Preto, um centro de referência regional em procedimentos hemoterápicos. Critérios para inaptidão definitiva: doenças autoimunes (>1 órgão comprometido, antecedente pessoal de câncer diferente de carcinoma basocelular, dermatite atópica ou psoríase graves, pênfigo foliáceo, porfirias, filariose, hanseníase, tuberculose ou paracoccidioidomicose extrapulmonares e uso prévio de etretinato. São condições de inelegibilidade temporária: uso de outros retinóides sistêmicos, corticoides sistêmicos, inibidores da 5-alfa-redutase, vacinas, metotrexato, betabloqueadores, minoxidil, anticonvulsivantes e antipsicóticos. Outras condições responsáveis por inaptidão temporária: acidente ocupacional com material biológico, "piercing", tatuagem, doenças sexualmente transmissíveis, herpes, infecções bacterianas, entre outras. Discussão: Talidomida atualmente não consta na lista de medicações teratogênicas. Apesar do uso da finasterida já ter sido considerada como critério para inaptidão definitiva, de acordo com sua meia-vida curta a restrição atual de 1 mês ainda é demasiadamente longa. Dermatologistas devem ser capazes de aconselhar seus pacientes sobre o momento adequado para doar sangue e discutir o impacto da suspensão de medicações nos resultados do tratamento de forma a respeitar os períodos de restrição designados.

  11. Potencial de Cajanus cajan e Crotalaria spectabilis parafitorremediação: absorção de arsênio e respostas antioxidativas Potential of Cajanus cajan and Crotalaria spectabilis for phytoremediation: arsenic absorption and antioxidative responses

    Directory of Open Access Journals (Sweden)

    Rafaella Teles Arantes Felipe

    2009-04-01

    Full Text Available Neste estudo, avaliaram-se os efeitos tóxicos do arsênio (As sobre o crescimento e atividade de enzimas antioxidativas dismutase do superóxido (SOD, catalase (CAT, peroxidases (POX, peroxidase do ascorbato peroxidase (APX e glutationa redutase (GR em plantas de Cajanus cajan e Crotalaria spectabili. Plantas das duas espécies foram expostas a diferentes concentrações de As, em solução nutritiva de Hoagland, pH 6,5. A taxa de crescimento relativo (TCR das duas espécies reduziu-se com o aumento da concentração de As na solução nutritiva, sendo de forma mais intensa em C. cajan. A concentração de As na solução capaz de reduzir em 50% a TCR de C. cajan foi de 0,93 mg L-1, enquanto em C. spectabilis foi de 4,80 mg L-1. As duas espécies apresentaram reduzida translocação de As para a parte aérea, sendo em raízes de C. spectabilis observada a maior concentração desse elemento. C. cajan exposto ao As teve as atividades das enzimas CAT, POX e APX reduzidas, ao contrário do que ocorreu em C. spectabilis. Esta espécie, quando submetida ao As, apresentou incremento na atividade de todas as enzimas avaliadas. A maior tolerância ao As observada em C. spectabilis pode estar relacionada à maior capacidade em reter o As nas raízes e à indução das enzimas SOD, CAT, POX, APX e GR. Dessa forma, C. spectabilis é uma espécie com potencial para utilização em programas de revegetação de áreas contaminadas com As.The toxic effects of Arsenic (As on the growth and activities of the antioxidative enzymes superoxide dismutase (SOD, catalase (CAT, peroxidase (POX, ascorbate peroxidase (APX and glutathione reductase (GR of Cajanus cajan and Crotalaria spectabilsi were studied. AQUI Plants of the two species were exposed to different As concentrations in Hoagland's nutrient solution, pH 6.5. The relative growth rate (RGR of the two species reduced with the increase in As concentration in the nutrient solution, especially in C. cajan

  12. Efeito do extrato aquoso de alecrim (Rosmarinus officinalis L. sobre o estresse oxidativo em ratos diabéticos Effect of aqueous rosemary extract (Rosmarinus officinalis L. on the oxidative stress of diabetic rats

    Directory of Open Access Journals (Sweden)

    Ana Mara de Oliveira e Silva

    2011-02-01

    Full Text Available OBJETIVO: Avaliar o efeito do extrato aquoso de alecrim sobre o estresse oxidativo em ratos diabéticos. MÉTODOS: O extrato aquoso de alecrim foi obtido por método sequencial. Os fenólicos totais foram determinados pelo método de Folin Ciocateau e a atividade antioxidante in vitro foi determinada através de três métodos: β-caroteno/ácido linoleico, varredura do radical 2,2 Difenil-1-Picril-hidrazil e oxigen radical absorbance capacity. Ratos Wistar machos foram distribuídos em 5 grupos: controle, diabético, e três grupos de animais diabéticos tratados com extrato aquoso de alecrim em concentrações diferentes: 25, 50 ou 100mg/kg por via oral durante 30 dias. O diabetes foi induzido por estreptozotocina e, no final do experimento, foi coletado sangue para avaliar o percentual de hemoglobina glicada e os tecidos hepático e cerebral para determinação das enzimas antioxidantes: superóxido dismutase, catalase, glutationa peroxidase e glutationa redutase. RESULTADOS: Constatou-se que o extrato aquoso de alecrim apresentou altos teores de compostos fenólicos totais e expressiva atividade antioxidante in vitro nos três métodos de avaliação. O extrato aquoso de alecrim na concentração de 50mg/kg diminuiu o percentual de hemoglobina glicada e aumentou a atividade das enzimas catalase e glutationa peroxidase no fígado, e da superóxido dismutase no cérebro de ratos diabéticos. No entanto, não foi observado efeito dose-resposta nas demais concentrações analisadas. CONCLUSÃO: O extrato aquoso de alecrim apresenta significativa capacidade antioxidante in vitro, atribuída à presença de compostos fenólicos em sua composição. E, quando administrado em ratos na concentração de 50mg/kg, demonstrou-se eficiente na atenuação do estresse oxidativo presente no diabetes experimental.OBJECTIVE: This study assessed the effect of aqueous rosemary extract on the oxidative stress of diabetic rats. METHODS: Aqueous rosemary extract

  13. Effects of ascorbic acid supplementation in ileum myenteric neurons of streptozotocin-induced diabetic rats Efeitos da suplementação do ácido ascórbico nos neurônios mientéricos do íleo de ratos diabéticos induzidos por estreptozootocina

    Directory of Open Access Journals (Sweden)

    Sonia M. Silverio

    2009-04-01

    Full Text Available The exacerbation of the oxidative stress and of the polyol pathway which impair damage myenteric plexus are metabolic characteristics of diabetes. The ascorbic acid (AA is an antioxidant and an aldose reductase inhibitor, which may act as neuroprotector. The effects of AA supplementation on the density and cellular body profile area (CP of myenteric neurons in STZ-induced diabetes in rats were assessed. Four groups with five animals each were formed: normoglycemic (C; diabetic (D; AA-treated diabetic (DS and AA-treated normoglycemic (CS. Dosagen of 50mg of AA were given, three times a week, for each animal (group DS and CS. Ninety days later and after euthanasia, the ileum was collected and processed for the NADPH-diaphorase technique. There were no differences (P>0.05 in the neuronal density among the groups. The CP area was lower (PA exacerbação do estresse oxidativo e da via do poliol que comprometem o plexo mioentérico são alterações metabólicas características do diabetes. O ácido ascórbico (AA é antioxidante e inibidor da aldose redutase, podendo atuar como neuroprotetor. Verificaram-se os efeitos da suplementação com AA sobre o número e a área do perfil do corpo celular (PC de neurônios mioentéricos em ratos diabéticos induzidos por estreptozootocina. Formaram-se quatro grupos com cinco animais cada: normoglicêmico (C; diabético (D; diabético tratado com AA (DS; e normoglicêmico tratado com AA (CS. Três vezes por semana administrou-se 50mg de AA para cada animal (grupos DS e CS. Após 90 dias e eutanásia com tiopental, o íleo foi coletado e processado para a técnica da NADPH-diaforase. Não se observaram diferenças (P>0,05 na densidade neuronal entre os grupos. A área do PC foi menor (P<0,05 para os grupos DS e CS, com incidência maior de neurônios com área do PC superior a 200µm² para os grupos C e D. Concluiu-se que o AA não influenciou a densidade neuronal do íleo, mas foi neuroprotetor prevenindo o

  14. Redução assimilatória de NO-3 em plantas de cajueiros cultivados em meio salinizado NO-3 assimilatory reduction in cashew plants grown in salinized medium

    Directory of Open Access Journals (Sweden)

    Ricardo A. Viégas

    2004-12-01

    Full Text Available Com o objetivo de se avaliar os efeitos e mecanismos iniciais da ação da salinidade sobre a redução de NO-3 e a acumulação de solutos nitrogenados, plantas de cajueiro (Anacardium occidentale L., CCP - 1001, com 42 dias de idade foram cultivadas em solução nutritiva contendo 100 mmol L-1 de NaCl, durante 8 dias, em casa de vegetação. A transpiração foi o principal fator de regulação da atividade de redutase de NO-3 (RN que foi fortemente reduzida nas folhas. Contrariamente, a atividade de glutamina sintetase (GS aumentou nas folhas em resposta à salinidade. Esta tendência de aumento da atividade de GS nas folhas foi acompanhada pelas concentrações de aminoácidos solúveis totais, particularmente prolina e proteínas solúveis totais. Por outro lado, o aumento nas concentrações das frações orgânicas de N, nas folhas, foi seguido por decréscimos nas concentrações de clorofilas e por acréscimos nas concentrações de NH+4 . É provável que o aumento da atividade de GS nas folhas de plantas de cajueiro, tenha sido induzido por um adicional suprimento de NH+4 e glutamato, a partir do catabolismo de aminoácidos e de proteínas e por aumentos na atividade fotorrespiratória.To evaluate the effects and initial-action mechanism of salinity on NO-3 reduction and N compounds accumulation, 42-day-old Anacardium occidentale (CCP-1001 plants were hydroponically grown in 100 mmol L-1 NaCl for 8 days (short-term experiment, in greenhouse. The results show that reduction in transpiration rates due to salinity had a relevant role in the regulation of NO-3 reductase (NR activity, which decreased considerably in leaf. On the contrary, glutamine sintetase (GS activity increased in leaf due to salinity. The increase in activity of GS in leaf was followed by the soluble amino acids concentration, in particular proline, and by the total soluble proteins content as well. On the other hand, increase in concentration of organic N fractions in

  15. Regulação da absorção e assimilação do nitrogênio nas plantas Regulation of nitrogen absortion and assimilation in plants

    Directory of Open Access Journals (Sweden)

    Christian Bredemeier

    2000-04-01

    Full Text Available A presente revisão tem por objetivo discutir os mecanismos de regulação da absorção e assimilação do nitrogênio nas plantas, de modo que a eficiência de uso desse nutriente seja aumentada. O nitrogênio é absorvido nas raízes sob a forma de NO3- ou NH4+, sendo então incorporado em aminoácidos na própria raiz ou na parte aérea. A taxa e a quantidade de nitrogênio absorvido e assimilado durante o ciclo da planta dependem da presença de carregadores específicos na membrana plasmática, da atividade das enzimas envolvidas no seu ciclo, da disponibilidade de energia necessária para os processos de absorção e assimilação e do estádio de desenvolvimento da planta. Inúmeros grupos de pesquisa têm centrado esforços na identificação dos pontos mais limitantes do metabolismo do nitrogênio nas plantas. Os limitadores têm sido relacionados com: a a afinidade dos carregadores pelo nitrato e amônio; b o suprimento de carboidratos às raízes; c o nível de aminoácidos no floema radicular; d a atividade das enzimas redutase do nitrato (RN, sintetase da glutamina (GS e sintase do glutamato (GOGAT; e a fonte de N suprida às plantas (NO3- ou NH4+; f o local de assimilação do N (raiz ou parte aérea. Esses estudos têm mostrado que o metabolismo do N é multiregulado e integrado ao metabolismo geral da planta. A identificação de pontos metabólicos específicos que são mais limitantes para o incremento da produtividade é complexa. A perspectiva é que a clonagem dos transportadores de N poderá auxiliar os programas de melhoramento genético na obtenção de plantas mais eficientes na absorção do nitrogênio.Nitrogen is absorbed as NO3- ou NH4+ and assimilated into aminoacids both in roots and shoots. Root absortion (rate and total amount at each plant developmental stage depends on specific plasma membrane carriers, enzyme activity for reduction and assimilation and energy availability for both processes. Several research

  16. Absorção e redução de nitrato em duas cultivares de arroz na presença de alumínio Uptake and reduction of nitrate in two rice cultivars in the presence of aluminum

    Directory of Open Access Journals (Sweden)

    Gilberto Costa Justino

    2006-08-01

    Full Text Available O objetivo deste trabalho foi estudar os efeitos do alumínio (Al sobre a absorção e a redução de nitrato, em duas cultivares de arroz: Fernandes (tolerante e Maravilha (sensível, expostas a 0 e 500 µM de Al. Depois de 21 dias de crescimento, foram determinados o comprimento, a produção de matéria seca, os teores de Al e de nitrato e a atividade in vitro da redutase do nitrato (RN, nas raízes e na parte aérea, bem como as constantes cinéticas de absorção de nitrato pelas raízes. O Al reduziu o crescimento em comprimento e a produção de matéria seca, nas duas partes das plantas, apenas da cultivar Maravilha. Os teores de Al aumentaram nas raízes e parte aérea das plantas nas duas cultivares, enquanto o teor de nitrato sofreu redução apenas nas raízes da cultivar Maravilha. A Vmax não se modificou, enquanto o Km da absorção de nitrato diminuiu cerca de 11% na cultivar Fernandes e aumentou 310% na Maravilha. Em presença de Al, houve redução na atividade da RN nas raízes das duas cultivares, e na parte aérea apenas da cultivar Maravilha. A cultivar tolerante foi mais eficiente na absorção e na redução de nitrato, o que indica que esses processos são importantes componentes da tolerância ao Al em arroz.The objective of this work was to evaluate the effects of Al on the nitrate uptake and reduction in two rice cultivars, Fernandes (Al tolerant and Maravilha (Al sensitive, exposed to 0 and 500 µM Al. After 21 days of Al treatment, growth in size and dry matter yield, Al and nitrate contents and in vitro nitrate reductase activity (NR in the tops and roots, and the kinetic constants of root nitrate uptake were determined. Aluminum reduced the growth and dry matter yield of both plant parts only in the Maravilha cultivar. Aluminum content increased in the tops and roots of both cultivars, while nitrate content decreased only in the roots of Maravilha cultivar. Vmax did not change, while Km of the nitrate uptake

  17. Efeitos neuromusculares in vitro e in vivo do atracúrio e do rocurônio em ratos submetidos a tratamento de sete dias com carbamazepina Efectos neuromusculares in vitro e in vivo del atracurio y del rocuronio en ratones sometidos a tratamiento de siete días con carbamazepina In vitro and in vivo neuromuscular effects of atracurium and rocuronium in rats treated with carbamazepine for seven days

    Directory of Open Access Journals (Sweden)

    Caroline Coutinho de Barcelos

    2008-04-01

    Full Text Available JUSTIFICATIVA E OBJETIVOS: Trata-se de um estudo experimental que investigou in vitro e in vivo o bloqueio neuromuscular produzido pelo rocurônio e atracúrio em ratos tratados com carbamazepina e determinou as concentrações de citocromo P450 e b5 redutase em microssomos hepáticos. MÉTODO: Ratos foram tratados por sete dias com carbamazepina (CBZ - 40 mg.kg-1 pelo método de gavagem e sacrificados no oitavo dia sob anestesia com uretana. As preparações in vitro e in vivo foram montadas de acordo com as técnicas de Bulbring e de Leeuwin e Wolters, respectivamente. As concentrações e doses utilizadas dos bloqueadores nas preparações in vitro e in vivo foram, respectivamente, 20 µg.mL-1 e 0,5 mg.kg-1 para atracúrio (ATC; 4 µg.mL-1 e 0,6 mg.kg-1 para rocurônio (ROC. Cada protocolo teve um n = 5 e as respostas foram observadas por 60 minutos. Os efeitos do ATC e ROC foram avaliados nas preparações de ratos tratados (Cbz t e comparados com os observados nas de ratos não-tratados (CBZst. As concentrações de citocromo P450 e b5 redutase foram determinadas em microssomos isolados de fígados de ratos tratados (CBZt e comparadas com as obtidas em ratos não tratados (CBZst. RESULTADOS: A carbamazepina não alterou a amplitude das respostas musculares; in vitro e in vivo, não houve diferença entre o bloqueio neuromuscular produzido pelo atracúrio nas preparações CBZt versus CBZst; o bloqueio neuromuscular produzido pelo rocurônio nas preparações CBZt foi potencializado in vitro. A carbamazepina não alterou as concentrações de citocromo P450 e b5. CONCLUSÕES: O tratamento por sete dias com carbamazepina não influenciou no bloqueio produzido pelo atracúrio, e alterou in vitro os efeitos do rocurônio. O tempo de tratamento não foi suficiente para causar indução enzimática e diminuir a sensibilidade ao rocurônio.JUSTIFICATIVA Y OBJETIVOS: Se trata de un estudio experimental que investigó in vitro e in vivo el bloqueo

  18. PSEN1 L226F mutation in a patient with early-onset Alzheimer’s disease in Korea

    Directory of Open Access Journals (Sweden)

    Bagyinszky E

    2016-10-01

    Full Text Available Eva Bagyinszky,1,* Sun Ah Park,2,* Hyung Jun Kim,2 Seong Hye Choi,3 Seong Soo A An,1 SangYun Kim4 1Department of BioNano Technology, Gachon University, Seongnam-si, 2Department of Neurology, Soonchunhyang University Bucheon Hospital, Bucheon, 3Department of Neurology, Inha University School of Medicine, Incheon, 4Department of Neurology, Seoul National University College of Medicine & Neurocognitive Behavior Center, Seoul National University Bundang Hospital, Seongnam-si, Republic of Korea *These authors contributed equally to this work Abstract: In this study, we report a first 226leucine (Leu mutation to phenylalanine (Phe in (PSEN1, CTC>TTC, L226F in Asia from a Korean early-onset Alzheimer’s disease (EOAD patient. Polymerase chain reaction (PCR–single strand conformation polymorphism, sequencing, and in silico predictions were performed. Previously, L226F was reported in EOAD patients by Zekanowski et al and Gómez-Tortosa et al. Disease phenotypes appeared in their thirties, and family history was positive in both cases. In our patient, age of onset was similar (37 years of age, but the mutation seemed to be de novo, since no affected family member was found. This leucine to phenylalanine substitution may cause additional stresses inside the transmembrane region due to large aromatic side chain and increased hydrophobic interactions with hydrocarbon chains in the membrane and its binding partners. Clinical phenotype of the mutation was aggressive progression into neurodegeneration, resulting in rapid cognitive decline. One of the patients was initially diagnosed with frontotemporal dementia, but the diagnosis was revised to AD upon postmortem studies in which Aβ plaques were seen. A second mutation, L226R, was found for the L226 residue. Similar to L226F, the patient with L226R also developed the first symptoms in his 30s, but EOAD was diagnosed in his 40s. These findings suggested that L226 might be an important residue in PSEN1

  19. FIND Tuberculosis Strain Bank: a Resource for Researchers and Developers Working on Tests To Detect Mycobacterium tuberculosis and Related Drug Resistance.

    Science.gov (United States)

    Tessema, Belay; Nabeta, Pamela; Valli, Eloise; Albertini, Audrey; Collantes, Jimena; Lan, Nguyen Huu; Romancenco, Elena; Tukavdze, Nestani; Denkinger, Claudia M; Dolinger, David L

    2017-04-01

    The spread of multidrug-resistant (MDR) tuberculosis (TB) and extensively drug-resistant (XDR) TB hampers global efforts in the fight against tuberculosis. To enhance the development and evaluation of diagnostic tests quickly and efficiently, well-characterized strains and samples from drug-resistant tuberculosis patients are necessary. In this project, the Foundation for Innovative New Diagnostics (FIND) has focused on the collection, characterization, and storage of such well-characterized reference materials and making them available to researchers and developers. The collection is being conducted at multiple centers in Southeast Asia, South America, Eastern Europe, and soon the sub-Saharan Africa regions. Strains are characterized for their phenotypic resistances and MICs to first-line drugs (FLDs) and second-line drugs (SLDs) using the automated MGIT 960 system following validated procedures and WHO criteria. Analysis of resistance-associated mutations is done by whole-genome sequencing (WGS) using the Illumina NextSeq system. Mycobacterial interspersed repetitive-unit-variable-number tandem-repeat analysis and WGS are used to determine strain lineages. All strains are maintained frozen at -80°C ± 10°C as distinct mother and daughter lots. All strains are extensively quality assured. The data presented here represent an analysis of the initial part of the collection. Currently, the bank contains 118 unique strains with extracted genomic DNA and matched sputum, serum, and plasma samples and will be expanded to a minimum of 1,000 unique strains over the next 3 years. Analysis of the current strains by phenotypic resistance testing shows 102 (86.4%), 10 (8.5%), and 6 (5.1%) MDR, XDR, and mono/poly resistant strains, respectively. Two of the strains are resistant to all 11 drugs that were phenotypically tested. WGS mutation analysis revealed FLD resistance-associated mutations in the rpoB , katG , inhA , embB , embA , and pncA genes; SLD resistance in the gyr

  20. Evaluation of usefulness of portal image using Electronic Portal Imaging Device (EPID) in the patients who received pelvic radiation therapy

    International Nuclear Information System (INIS)

    Kim, Woo Chul; Kim, Heon Jong; Park, Seong Young; Cho, Young Kap; Loh, John J. K.; Park, Won; Suh, Chang Ok; Kim, Gwi Eon

    1998-01-01

    To evaluate the usefulness of electronic portal imaging device through objective compare of the images acquired using an EPID and a conventional port film. From Apr. to Oct. 1997, a total of 150 sets of images from 20 patients who received radiation therapy in the pelvis area were evaluated in the Inha University Hospital and Severance Hospital. A dual image recording technique was devised to obtain both electronic portal images and port film images simultaneously with one treatment course. We did not perform double exposure. Five to ten images were acquired from each patient. All images were acquired from posteroanterior (PA) view except images from two patients. A dose rate of 100-300 MU/min and a 10-MV X-ray beam were used and 2-10 MUs were required to produce a verification image during treatment. Kodak diagnostic film with metal/film imaging cassette which was located on the top of the EPID detector was used for the port film. The source to detector distance was 140 cm. Eight anatomical landmarks (pelvic brim, sacrum, acetabulum, iliopectineal line, symphysis, ischium, obturator foramen, sacroiliac joint) were assessed. Four radiation oncologist joined to evaluate each image. The individual landmarks in the port film or in the EPID were rated-very clear (1), clear (2), visible (3), notclear (4), not visible (5). Using an video camera based EPID system, there was no difference of image quality between no enhanced EPID images and port film images. However, when we provided some change with window level for the portal image, the visibility of the sacrum and obturator foramen was improved in the portal images than in the port film images. All anatomical landmarks were more visible in the portal images than in the port film when we applied the CLAHE mode enhancement. The images acquired using an matrix ion chamber type EPID were also improved image quality after window level adjustment. The quality of image acquired using an electronic portal imaging device was

  1. Low-dose gamma-rays and simulated solar particle event protons modify splenocyte gene and cytokine expression patterns

    International Nuclear Information System (INIS)

    Rizvi, A.; Pecaut, M.J.; Gridley, D.S.

    2011-01-01

    The goal was to investigate the T helper (Th) response in splenocytes of mice exposed to low-dose/low-dose-rate (LDR) γ-rays, simulated solar particle event protons (sSPE), or combination of both. C57BL/6 mice were exposed to LDR γ-radiation ( 57 Co) to a total dose of 0.05 Gray (Gy) at 0.024 cGy/h, either with or without subsequent exposure to 2 Gy sSPE protons. Expression of genes related to Th cells was evaluated immediately after exposure (day 0). On day 21, intra- and extracellular cytokine production was assessed after activation with anti-CD3 monoclonal antibodies (mAb) or phorbol 12-myristate 13-acetate/ionophore (PMA/I). Five genes were significantly modulated on day 0 in one or more of the irradiated groups compared to controls (p<0.05): Ccl11, Ccr5, Cd80, Inha, and Il9. On day 21, numbers of cells positive for interferon-γ were high in the LDR + sSPE group versus 0 Gy and LDR γ-rays (p<0.05), but there was no difference in interleukin (IL)-2 and tumor necrosis factor (TNF)-α. Levels of secreted cytokines after anti-CD3 mAb activation were high for 5 (maximum intensity projection (MIP)-1α, GM-CSF, interferon (IFN)-γ, TNF-α, IL-13) and low for 2 (IL-7, IL-9) in all irradiated groups. Priming with LDR photons had a significant effect on IFN-γ and IL-17 compared to sSPE protons alone; IL-2 was low only in the LDR + sSPE group. The cytokine patterns after anti-phorbol myristate acetate (PMA)/ionomycin (I) activation were different compared to anti-CD3 mAb and with fewer differences among groups. The data show that total-body exposure to space-relevant radiation has profound effects on Th cell status and that priming with LDR γ-rays can in some cases modulate the response to sSPE. (author)

  2. Mycobacterium tuberculosis population in northwestern Russia: an update from Russian-EU/Latvian border region.

    Directory of Open Access Journals (Sweden)

    Igor Mokrousov

    Full Text Available This study aimed to characterize the population structure of Mycobacterium tuberculosis in Pskov oblast in northwestern Russia, to view it in the geographical context, to compare drug resistance properties across major genetic families. Ninety M. tuberculosis strains from tuberculosis (TB patients, permanent residents in Pskov oblast were subjected to LAM-specific IS6110-PCR and spoligotyping, followed by comparison with SITVITWEB and MIRU-VNTRplus databases. The Beijing genotype (n = 40 was found the most prevalent followed by LAM (n = 18, T (n = 13, Haarlem (n = 10, Ural (n = 5, and Manu2 (n = 1; the family status remained unknown for 3 isolates. The high rate of Beijing genotype and prevalence of LAM family are similar to those in the other Russian settings. A feature specific for M. tuberculosis population in Pskov is a relatively higher rate of Haarlem and T types. Beijing strains were further typed with 12-MIRU (followed by comparison with proprietary global database and 3 hypervariable loci QUB-3232, VNTR-3820, VNTR-4120. The 12-MIRU typing differentiated 40 Beijing strains into 14 types (HGI = 0.82 while two largest types were M2 (223325153533 prevalent throughout former USSR and M11 (223325173533 prevalent in Russia and East Asia. The use of 3 hypervariable loci increased a discrimination of the Beijing strains (18 profiles, HGI = 0.89. Both major families Beijing and LAM had similar rate of MDR strains (62.5 and 55.6%, respectively that was significantly higher than in other strains (21.9%; P = 0.001 and 0.03, respectively. The rpoB531 mutations were more frequently found in Beijing strains while LAM drug resistant strains mainly harbored rpoB516 and inhA -15 mutations. Taken together with a high rate of multidrug resistance among Beijing strains from new TB cases (79.3% versus 44.4% in LAM, these findings suggest the critical impact of the Beijing genotype on the current situation with MDR-TB in the

  3. Relationship between XRCC1 polymorphism and acute complication of chemoradiation therapy in the patients with colorectal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Woo Chul; Choi, Sun Keun [Inha University College of Medicine, Incheon (Korea, Republic of); Hong, Yun Chul [Seoul National University College of Medicine, Seoul (Korea, Republic of)] (and others)

    2006-03-15

    It is well known from clinical experience that acute complications of chemoradiation therapy vary from patients to patients. However, there are no known factors to predict these acute complications before treatment starts. The human XRCC1 gene is known as a DNA base excision repair gene. We investigated the possibilities of XRCC1 gene polymorphisms as a predictor for the acute complications of chemoradiation therapy in colorectal cancer patients. From July 1997 to June 2003, 86 colorectal cancer patients (71 rectal cancer, 13 sigmoid colon cancer and 2 colon cancer patients) were treated with chemoradiation therapy at the Department of Radiation Oncology, Inha University Hospital. Twenty-two patients were in stage B, 50 were in stage C, 8 were in stage D and 6 patients were unresectable cases. External radiation therapy was delivered with 10MV X-ray at a 1.8 Gy fraction per day for a total dose of radiation of 30.6 {approx} 59.4 Gy (median: 54 Gy). All the patients received 5-FU based chemotherapy regimen. We analyzed the acute complications of upper and lower gastrointestinal tract based on the RTOG complication scale. The initial and lowest WBC and platelet count were recorded during both the RT period and the whole treatment period. Allelic variants of the XRCC1 gene at codons 194, 280 and 399 were analyzed in the lymphocyte DNA by performing PCR-RFLP. Statistical analyses were carried out with the SAS (version 6.12) statistical package. When all the variables were assessed on the multivariate analysis, recurrent disease revealed the factors that significantly correlated with upper gastrointestinal acute complications. Arg399Gln polymorphisms of the XRCC1 gene, the radiation dose and the frequencies of chemotherapy during radiation therapy were significantly correlated with lower gastrointestinal complications. Arg399Gln polymorphisms also affected the decrease of the WBC and platelet count during radiation therapy. Although the present sample size was too small

  4. Relationship between XRCC1 polymorphism and acute complication of chemoradiation therapy in the patients with colorectal cancer

    International Nuclear Information System (INIS)

    Kim, Woo Chul; Choi, Sun Keun; Hong, Yun Chul

    2006-01-01

    It is well known from clinical experience that acute complications of chemoradiation therapy vary from patients to patients. However, there are no known factors to predict these acute complications before treatment starts. The human XRCC1 gene is known as a DNA base excision repair gene. We investigated the possibilities of XRCC1 gene polymorphisms as a predictor for the acute complications of chemoradiation therapy in colorectal cancer patients. From July 1997 to June 2003, 86 colorectal cancer patients (71 rectal cancer, 13 sigmoid colon cancer and 2 colon cancer patients) were treated with chemoradiation therapy at the Department of Radiation Oncology, Inha University Hospital. Twenty-two patients were in stage B, 50 were in stage C, 8 were in stage D and 6 patients were unresectable cases. External radiation therapy was delivered with 10MV X-ray at a 1.8 Gy fraction per day for a total dose of radiation of 30.6 ∼ 59.4 Gy (median: 54 Gy). All the patients received 5-FU based chemotherapy regimen. We analyzed the acute complications of upper and lower gastrointestinal tract based on the RTOG complication scale. The initial and lowest WBC and platelet count were recorded during both the RT period and the whole treatment period. Allelic variants of the XRCC1 gene at codons 194, 280 and 399 were analyzed in the lymphocyte DNA by performing PCR-RFLP. Statistical analyses were carried out with the SAS (version 6.12) statistical package. When all the variables were assessed on the multivariate analysis, recurrent disease revealed the factors that significantly correlated with upper gastrointestinal acute complications. Arg399Gln polymorphisms of the XRCC1 gene, the radiation dose and the frequencies of chemotherapy during radiation therapy were significantly correlated with lower gastrointestinal complications. Arg399Gln polymorphisms also affected the decrease of the WBC and platelet count during radiation therapy. Although the present sample size was too small for

  5. Whole genome sequencing-based characterization of extensively drug resistant (XDR) strains of Mycobacterium tuberculosis from Pakistan

    KAUST Repository

    Hasan, Zahra; Ali, Asho; McNerney, Ruth; Mallard, Kim; Hill-Cawthorne, Grant A.; Coll, Francesc; Nair, Mridul; Pain, Arnab; Clark, Taane G.; Hasan, Rumina

    2015-01-01

    Objectives: The global increase in drug resistance in Mycobacterium tuberculosis (MTB) strains increases the focus on improved molecular diagnostics for MTB. Extensively drug-resistant (XDR) - TB is caused by MTB strains resistant to rifampicin, isoniazid, fluoroquinolone and aminoglycoside antibiotics. Resistance to anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs), in particular MTB genes. However, there is regional variation between MTB lineages and the SNPs associated with resistance. Therefore, there is a need to identify common resistance conferring SNPs so that effective molecular-based diagnostic tests for MTB can be developed. This study investigated used whole genome sequencing (WGS) to characterize 37 XDR MTB isolates from Pakistan and investigated SNPs related to drug resistance. Methods: XDR-TB strains were selected. DNA was extracted from MTB strains, and samples underwent WGS with 76-base-paired end fragment sizes using Illumina paired end HiSeq2000 technology. Raw sequence data were mapped uniquely to H37Rv reference genome. The mappings allowed SNPs and small indels to be called using SAMtools/BCFtools. Results: This study found that in all XDR strains, rifampicin resistance was attributable to SNPs in the rpoB RDR region. Isoniazid resistance-associated mutations were primarily related to katG codon 315 followed by inhA S94A. Fluoroquinolone resistance was attributable to gyrA 91-94 codons in most strains, while one did not have SNPs in either gyrA or gyrB. Aminoglycoside resistance was mostly associated with SNPs in rrs, except in 6 strains. Ethambutol resistant strains had embB codon 306 mutations, but many strains did not have this present. The SNPs were compared with those present in commercial assays such as LiPA Hain MDRTBsl, and the sensitivity of the assays for these strains was evaluated. Conclusions: If common drug resistance associated with SNPs evaluated the concordance between phenotypic and

  6. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  7. Genetic sequencing for surveillance of drug resistance in tuberculosis in highly endemic countries: a multi-country population-based surveillance study.

    Science.gov (United States)

    Zignol, Matteo; Cabibbe, Andrea Maurizio; Dean, Anna S; Glaziou, Philippe; Alikhanova, Natavan; Ama, Cecilia; Andres, Sönke; Barbova, Anna; Borbe-Reyes, Angeli; Chin, Daniel P; Cirillo, Daniela Maria; Colvin, Charlotte; Dadu, Andrei; Dreyer, Andries; Driesen, Michèle; Gilpin, Christopher; Hasan, Rumina; Hasan, Zahra; Hoffner, Sven; Hussain, Alamdar; Ismail, Nazir; Kamal, S M Mostofa; Khanzada, Faisal Masood; Kimerling, Michael; Kohl, Thomas Andreas; Mansjö, Mikael; Miotto, Paolo; Mukadi, Ya Diul; Mvusi, Lindiwe; Niemann, Stefan; Omar, Shaheed V; Rigouts, Leen; Schito, Marco; Sela, Ivita; Seyfaddinova, Mehriban; Skenders, Girts; Skrahina, Alena; Tahseen, Sabira; Wells, William A; Zhurilo, Alexander; Weyer, Karin; Floyd, Katherine; Raviglione, Mario C

    2018-03-21

    In many countries, regular monitoring of the emergence of resistance to anti-tuberculosis drugs is hampered by the limitations of phenotypic testing for drug susceptibility. We therefore evaluated the use of genetic sequencing for surveillance of drug resistance in tuberculosis. Population-level surveys were done in hospitals and clinics in seven countries (Azerbaijan, Bangladesh, Belarus, Pakistan, Philippines, South Africa, and Ukraine) to evaluate the use of genetic sequencing to estimate the resistance of Mycobacterium tuberculosis isolates to rifampicin, isoniazid, ofloxacin, moxifloxacin, pyrazinamide, kanamycin, amikacin, and capreomycin. For each drug, we assessed the accuracy of genetic sequencing by a comparison of the adjusted prevalence of resistance, measured by genetic sequencing, with the true prevalence of resistance, determined by phenotypic testing. Isolates were taken from 7094 patients with tuberculosis who were enrolled in the study between November, 2009, and May, 2014. In all tuberculosis cases, the overall pooled sensitivity values for predicting resistance by genetic sequencing were 91% (95% CI 87-94) for rpoB (rifampicin resistance), 86% (74-93) for katG, inhA, and fabG promoter combined (isoniazid resistance), 54% (39-68) for pncA (pyrazinamide resistance), 85% (77-91) for gyrA and gyrB combined (ofloxacin resistance), and 88% (81-92) for gyrA and gyrB combined (moxifloxacin resistance). For nearly all drugs and in most settings, there was a large overlap in the estimated prevalence of drug resistance by genetic sequencing and the estimated prevalence by phenotypic testing. Genetic sequencing can be a valuable tool for surveillance of drug resistance, providing new opportunities to monitor drug resistance in tuberculosis in resource-poor countries. Before its widespread adoption for surveillance purposes, there is a need to standardise DNA extraction methods, recording and reporting nomenclature, and data interpretation. Bill & Melinda

  8. Whole genome sequencing-based characterization of extensively drug resistant (XDR) strains of Mycobacterium tuberculosis from Pakistan

    KAUST Repository

    Hasan, Zahra

    2015-03-01

    Objectives: The global increase in drug resistance in Mycobacterium tuberculosis (MTB) strains increases the focus on improved molecular diagnostics for MTB. Extensively drug-resistant (XDR) - TB is caused by MTB strains resistant to rifampicin, isoniazid, fluoroquinolone and aminoglycoside antibiotics. Resistance to anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs), in particular MTB genes. However, there is regional variation between MTB lineages and the SNPs associated with resistance. Therefore, there is a need to identify common resistance conferring SNPs so that effective molecular-based diagnostic tests for MTB can be developed. This study investigated used whole genome sequencing (WGS) to characterize 37 XDR MTB isolates from Pakistan and investigated SNPs related to drug resistance. Methods: XDR-TB strains were selected. DNA was extracted from MTB strains, and samples underwent WGS with 76-base-paired end fragment sizes using Illumina paired end HiSeq2000 technology. Raw sequence data were mapped uniquely to H37Rv reference genome. The mappings allowed SNPs and small indels to be called using SAMtools/BCFtools. Results: This study found that in all XDR strains, rifampicin resistance was attributable to SNPs in the rpoB RDR region. Isoniazid resistance-associated mutations were primarily related to katG codon 315 followed by inhA S94A. Fluoroquinolone resistance was attributable to gyrA 91-94 codons in most strains, while one did not have SNPs in either gyrA or gyrB. Aminoglycoside resistance was mostly associated with SNPs in rrs, except in 6 strains. Ethambutol resistant strains had embB codon 306 mutations, but many strains did not have this present. The SNPs were compared with those present in commercial assays such as LiPA Hain MDRTBsl, and the sensitivity of the assays for these strains was evaluated. Conclusions: If common drug resistance associated with SNPs evaluated the concordance between phenotypic and

  9. Nano-graphene oxide composite for in vivo imaging

    Directory of Open Access Journals (Sweden)

    Jang SC

    2018-01-01

    Full Text Available Sung-Chan Jang,1,2,* Sung-Min Kang,1,* Jun Young Lee,3,* Seo Yeong Oh,1 AT Ezhil Vilian,4 Ilsong Lee,1,2 Young-Kyu Han,4 Jeong Hoon Park,3 Wan-Seob Cho,5,* Changhyun Roh,2,6 Yun Suk Huh1 1Department of Biological Engineering, Biohybrid Systems Research Center (BSRC, Inha University, Incheon, 2Biotechnology Research Division, 3Radiation Instrumentation Research Division, Advanced Radiation Technology Institute (ARTI, Korea Atomic Energy Research Institute (KAERI, Jeongeup, 4Department of Energy and Materials Engineering, Dongguk University, Seoul, 5Laboratory of Toxicology, Department of Medicinal Biotechnology, College of Health Sciences, Dong-A University, Busan, 6Radiation Biotechnology and Applied Radioisotope Science, University of Science and Technology (UST, Daejeon, Republic of Korea *These authors contributed equally to this work Introduction: Positron emission tomography (PET tracers has the potential to revolutionize cancer imaging and diagnosis. PET tracers offer non-invasive quantitative imaging in biotechnology and biomedical applications, but it requires radioisotopes as radioactive imaging tracers or radiopharmaceuticals. Method: This paper reports the synthesis of 18F-nGO-PEG by covalently functionalizing PEG with nano-graphene oxide, and its excellent stability in physiological solutions. Using a green synthesis route, nGO is then functionalized with a biocompatible PEG polymer to acquire high stability in PBS and DMEM. Results and discussion: The radiochemical safety of 18F-nGO-PEG was measured by a reactive oxygen species and cell viability test. The biodistribution of 18F-nGO-PEG could be observed easily by PET, which suggested the significantly high sensitivity tumor uptake of 18F-nGO-PEG and in a tumor bearing CT-26 mouse compared to the control. 18F-nGO-PEG was applied successfully as an efficient radiotracer or drug agent in vivo using PET imaging. This article is expected to assist many researchers in the fabrication of

  10. EDITORIAL: Welcome to the 2012 volume Welcome to the 2012 volume

    Science.gov (United States)

    Garcia, Ephrahim

    2012-01-01

    articles last year, as well as our authors and contributors for submitting their high quality research. We very much look forward to your further involvement with the journal in 2012. Finally, I would like to extend a huge thank you to our diverse Board of Associate Editors who have devoted their time and energy giving invaluable advice on each submitted article, and have been dedicated ambassadors for SMS. A special welcome to Professor Kwang J Kim who joined the Board a few months ago. Professor D Abbott, University of Adelaide, Australia Professor G Akhras, Royal Military College of Canada, Ontario, Canada Professor C Boller, University of Saarland, Saarbrücken, Germany; Fraunhofer-Institut für Zerstörungsfreie Prüfverfahren, Dresden, Germany Professor Cagnol, École Centrale Paris, France Professor G Carman, University of California-Los Angeles, USA Professor S-B Choi, Inha University, Incheon, Korea Dr S H Choi, NASA Langley Research Center, Hampton, VA, USA Professor A Del Grosso, Università degli Studi di Genova, Italy Professor D Erickson, Cornell University, Ithaca, NY, USA Professor A Flatau, University of Maryland, College Park, USA Professor U Gabbert, Universität Magdeburg, Germany Professor A Güemes, Universidad Politecnica de Madrid, Spain Professor S Gopalakrishnan, Indian Institute of Science, Bangalore, India Professor J Kim, Inha University, Incheon, Korea Professor K J Kim, University of Nevada, Reno, USA Professor S J Kim, Seoul National University, Korea Professor D Lagoudas, Texas A&M University, College Station, USA Professor R Lammering, Helmut-Schmidt-Universität/Universität der Bundeswehr Hamburg, Hamburg, Germany Professor C K Lee, National Taiwan University, Taiwan Professor J Leng, Harbin Institute of Technology, China Professor W Li, University of Wollongong, Australia Professor W H Liao, Chinese University of Hong Kong, China Professor C S Lynch, University of California-Los Angeles, USA Dr S Masri, University of Southern California

  11. First evaluation in Argentina of the GenoType® MTBDRplus assay for multidrug-resistant Mycobacterium tuberculosis detection from clinical isolates and specimens Primera evaluación en Argentina de GenoType® MTBDRplus para la detección de Mycobacterium tuberculosis multidrogo-resistente desde aislamientos y especímenes clínicos

    Directory of Open Access Journals (Sweden)

    Belén R Imperiale

    2012-12-01

    Full Text Available Tuberculosis (TB and multidrug and extensively drug-resistant (DR TB are important public health problems that are spreading worldwide. The aims of this study were to determine the sensitivity and specificity of the GenoType® MT BDRplus assay from smear-positive clinical specimens and isolates and to explore its possible application in routine work. Clinical samples were previously decontaminated using NaOH-N-acetyl-L-cystein or NaOH-ClNa hypertonic solution for Ziehl-Neelsen staining and cultures. The leftover sediments of smear-positive samples were stored at -20 ºC, 70 of which were selected to be included in this study according to their DR profile. Thirty DR Mycobacterium tuberculosis isolates were also assessed. Sequencing was used as gold standard to detect mutations conferring isoniazid (INH and rifampicin (RIF resistance. Valid results were obtained in 94.0 % of the samples and 85.5 % (53/62 of the INH-R samples were properly identified. Mutations in the katGS315T gene and inhA C-15T gene promoter region were present in 59.7 % (37/62 and 25.8% (16/62 of the INH-R samples, respectively. The system could also identify 97.7 % (41/42 of the RIF-R samples; the mutations found were rpoBS531L (66.7 %, 28/42, D516V (19.0 %, 8/42, H526Y and S531P/W (4.8 %, 2/42 each one, and S522L/Q (2.4 %, 1/42. A 98.8 % concordance between the GenoType assay and sequencing was obtained. GenoType® MT BDRplus has demonstrated to be easy to implement and to perform in clinical laboratories and useful for a rapid detection of DR M. tuberculosis from decontaminated sputa and clinical isolates. Therefore, this assay could be applied as a rapid tool to predict INH-R and/or RIF-R in DR risk cases.La tuberculosis (TBC, y la TBC multi y extensivamente drogo-resistentes (DR son importantes problemas de salud pública mundial. El objetivo de este estudio fue determinar la sensibilidad y especificidad del sistema GenoType® MT BDRplus a partir de esputos (baciloscop

  12. Amenorréia primária e cariótipo XY: identificando pacientes em risco Primary amenorrhea and XY karyotype: identifying patients in risk

    Directory of Open Access Journals (Sweden)

    Rafael Fabiano Machado Rosa

    2008-11-01

    Full Text Available OBJETIVO: verificar a prevalência e as características clínicas de pacientes com amenorréia primária e cariótipo XY avaliadas em nosso Serviço com o intuito de identificar achados que possam auxiliar em seu reconhecimento. MÉTODOS: no período de Janeiro de 1975 a Novembro de 2007, foram avaliadas 104 pacientes com amenorréia primária. Para todos os casos foi realizada a análise pelo cariótipo por bandas GTG. Destas, 21 (20,2% apresentavam uma constituição 46,XY. Contudo, duas foram excluídas do estudo por terem prontuários incompletos. Das 19 pacientes que compuseram a amostra, a maior parte veio encaminhada pela ginecologia (63,2%. Suas idades variaram entre 16 e 41 anos (média de 22,1 anos. Realizou-se uma coleta de dados sobre sua história familiar e pregressa, exame físico e resultados de exames complementares. Para determinação dos seus diagnósticos levaram-se em consideração essas informações. RESULTADOS: a síndrome de resistência aos androgênios foi o diagnóstico predominante (n=12; 63,2%. Cinco pacientes (26,3% apresentavam disgenesia gonadal pura XY (DGP XY, uma (5,3% deficiência de 17-alfa hidroxilase e uma (5,3% deficiência de 5-alfa redutase. Achados clínicos freqüentemente observados nessas pacientes incluíram desenvolvimento anormal dos caracteres sexuais secundários (n=19, agenesia uterina com vagina em fundo de saco (n=14, história familiar de amenorréia (n=8 e gônadas palpáveis no canal inguinal (n=5. Duas delas apresentavam história de hérnia inguinal. Hipertensão arterial sistêmica foi diagnosticada somente na paciente com deficiência de 17-alfa hidroxilase, e malignização gonadal, naquela com DGP XY. CONCLUSÕES: a freqüência de pacientes com cariótipo XY (20% foi superior à usualmente descrita na literatura (3 a 11%. Acreditamos que isso tenha relação com a forma de encaminhamento das pacientes ao Serviço. Certos achados da história clínica e do exame físico deveriam

  13. Comportamento celular e resposta antioxidante diferenciados de Saccharomyces cerevisiae e de Saccharomyces chevalieri ao metavanadato de amónio Different cellular behaviour and antioxidant response of Saccharomyces cerevisiae and Saccharomyces chevalieri growing in presence of ammonium metavanadate

    Directory of Open Access Journals (Sweden)

    R. Ferreira

    2007-01-01

    Full Text Available A fermentação do vinho é um processo microbiológico complexo que requere a presença de leveduras adaptadas a condições de stresse. No ambiente celular de organismos aeróbios ocorrem naturalmente espécies reactivas de oxigénio (ROS como subprodutos da respiração mitocondrial. A elevada reactividade destas espécies químicas pode gerar danos moleculares que, em alguns casos, levam à morte celular. Em condições fisiológicas normais ou como resposta ao stresse oxidativo, a célula pode desencadear respostas adaptativas que envolvem mecanismos antioxidantes como os enzimas glutationo redutase (GR; EC 1.6.4.2 e catalases T (CAT T; EC 1.11.1.6 e A (CAT A; EC 1.11.1.6. O vanádio, um metal pesado presente em alguns fitofármacos, pode também com portar-se como um gerador de ROS, alterando o estado redox intracelular e exercendo efeitos nocivos em leveduras expostas a quantidade excessiva deste elemento. O principal objectivo deste trabalho foi comparar o efeito do metavanadato de amónio (NH4VO3, um sal pentavalente de vanádio, na viabilidade celular e nas actividades enzimáticas GR, CAT T e CAT A das leveduras vínicas Saccharomyces cerevisiae UE-ME3 e Saccharomyces chevalieri UE-ME1. Os resultados obtidos mostram que S. chevalieri UE-ME1 revelou menor tolerância ao NH4VO3 do que S. cerevisiae UE-ME3, uma vez que culturas de S. chevalieri não sobreviveram para valores de concentração do sal de vanádio superiores a 7,5 mM enquanto que células de S. cerevisiae mantiveram-se viáveis em presença de metavanadato de amónio 75 mM. As actividades enzimáticas estudadas apresentaram em S. chevalieri valores muito inferiores aos que foram determinados em S. cerevisiae embora em ambas as espécies de levedura o NH4VO3 pareça comportarse como um indutor de stresse oxidativo ao provocar um decréscimo significativo da actividade GR (PThe fermentation of wine is a complex microbiological process which requires yeast adaptation to stress

  14. Biosynthesis of secondary metabolites in sugarcane

    Directory of Open Access Journals (Sweden)

    S.C. França

    2001-12-01

    relacionados ao metabolismo secundário da cana de açúcar e investigar o padrão de expressão gênica de enzimas chaves reguladoras das principais vias biossintéticas ativas nos diferentes tipos de tecidos e situações de estresse físico-químico e biológico a que estão submetidas plantas cultivadas em casas de vegetação, campo ou in vitro. A estratégia de mineração dos dados da database de sequências expressas de cana de açúcar, SUCEST, usando ferramentas de bioinformática, focalizou classes de compostos como isoprenóides e fenilpropanóides que comprovadamente desempenham um papel na resposta de plantas a variações ambientais. Foram identificados e caracterizados genes que codificam enzimas chaves para a síntese de terpenóides, como a sesquiterpeno ciclase (SC; (CHS para síntese de flavonóides; isoflavona sintase (IFS envolvida na biossíntese de isoflavonóides que desempenharm importante papel na defesa de plantas e nodulação de raízes; isoflavona redutases (IFR enzimas chaves para a síntese de fenilpropanóide fitoalexinas, bem como enzimas relacionadas à síntese de precursores de lignina, como a enzima ácido caféico- O- metiltransferase. O efeito do estresse causado por bactérias como Herbaspirillum rubri e Gluconacetobacter diazotroficans também foi avaliado tendo sido constatada a indução da expressão de chalcona sintase (CHS em plântulas infectadas com esses agentes, sugerindo a ativação da via de flavonóides em resposta a este estresse biológico. Esses resultados apontam para o fato de que as vias do metabolismo de isopropanóides e de fenilpropanóides em cana de açúcar são ativadas de acordo com o estágio de desenvolvimento, especificidade de tecidos e em resposta a situações de estresse. Essas observações deverão ser confirmadas por meio de experimentação genética e bioquímica.

  15. Efeito renoprotetor da estatina: modelo animal de isquemia-reperfusão Renoprotective effect of statin: a ischemia-reperfusion animal model

    Directory of Open Access Journals (Sweden)

    Claudia Akemi Shibuya Teshima

    2010-09-01

    Full Text Available OBJETIVO: A lesão renal aguda isquêmica, de causa multifatorial, apresenta morbidade e mortalidade alarmantes. A estatina, inibidor de HMG-CoA redutase, tem demonstrado papel renoprotetor, com componente antioxidante, antiinflamatório e vascular. A atividade de heme oxigenase-1 pode ser mediadora desses efeitos pleitrópicos da estatina sobre o rim, ou seja, independente da ação de redução de lipídio. Esse estudo visou avaliar se o efeito renoprotetor da estatina pode ter mecanismo heme de proteção em ratos. MÉTODOS: O modelo isquêmico foi obtido por meio do clampeamento dos pedículos renais bilaterais por 30 minutos, seguido de reperfusão. Foram utilizados ratos Wistar, machos, pesando entre 250-300g, distribuídos nos seguintes grupos: SHAM (controle, sem clampeamento renal; Isquemia; Iquemia+Estatina (sinvastatina 0,5 mg/kg, via oral por 3 dias; Isquemia+Hemin (indutor de HO-1, 1 mg/100g, intraperitoneal 24h antes da cirurgia; Isquemia+SnPP (inibidor de HO-1, 2μmol/kg intraperitoneal 24h antes da cirurgia; Isquemia+Estatina+Hemin e Isquemia+Estatina+SnPP. Foram avaliados a função renal (clearance de creatinina, Jaffé, osmolalidade urinária, peróxidos urinários e a imunohistoquímica para ED-1. RESULTADOS: Os resultados mostraram que a estatina melhorou a função renal, a osmolalidade urinária, reduziu a excreção de peróxidos urinários e a infiltração de macrófagos em rins de animais submetidos à isquemia renal. O indutor da heme oxigenase-1 e a sua associação com sinvastatina reproduziram o padrão de melhora determinado pela sinvastatina. CONCLUSÃO: O estudo confirmou o efeito renoprotetor da estatina, com ação antioxidante e antiinflamatória, e sugere que esse efeito tenha interface com o sistema heme de proteção renal.OBJECTIVE: Ischemic acute kidney injury (iLRA, with multifatorial cause, presents alarming morbidity and mortality. Statin, HMG-CoA inhibition reductase has shown a renoprotective effect

  16. Estrutura arbórea da Floresta Ombrófila Densa Altomontana de serras do Sul do Brasil Tree component structure of tropical upper montane rain forests in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Maurício Bergamini Scheer

    2011-12-01

    tree individuals (perimeter at breast height - PBH > 10 cm were sampled, which included 28 families, 43 genera and 78 species. The cloud forest sampled in Serra Gigante showed the highest richness (41 species, followed by Serra da Prata (37, Serra da Igreja (34 and Serra do Ibitiraquire (26. The mean tree height was 4.8 m, the PBH was 22.9 cm, the tree abundance was 4779 in/ha, the basal area was 33.5 m²/ha and the Shannon diversity index was 2.68 nats/ind. Combining our data with the published data on the Serra do Mar region, resulting in a total of 11 surveys and 204 plots (10200 m², a matrix with 75 identified species was obtained. In this matrix, the five most important species in the structure of the forest were Ilex microdonta, Siphoneugena reitzii, Drimys angustifolia, Ocotea porosa and Ilex chamaedrifolia. The cloud forests sampled in Serra do Mar showed lower richness and diversity indexes than the cloud forests in Serra da Mantiqueira (Southeast and higher richness and diversity than cloud forests in Aparados da Serra Geral (South. These differences are possibly related to the anthropic influences, geographic distances, different centers of endemism, the tropical and subtropical surroundings, and geomorphology, among other factors.

  17. A genetic screen of the mutations in the Korean patients with early-onset Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    An SS

    2016-12-01

    Full Text Available Seong Soo An,1,* Sun Ah Park,2,* Eva Bagyinszky,1 Sun Oh Bae,1 Yoon-Jeong Kim,2 Ji Young Im,2 Kyung Won Park,3 Kee Hyung Park,4 Eun-Joo Kim,5 Jee Hyang Jeong,6 Jong Hun Kim,7 Hyun Jeong Han,8 Seong Hye Choi,9 SangYun Kim10 1Department of Bionano Technology, Gachon University, Seongnam-si, 2Department of Neurology, Soonchunhyang University Bucheon Hospital, Bucheon, 3Department of Neurology, Dong-A University College of Medicine and Institute of Convergence Bio-Health, Busan, 4Department of Neurology, Gachon University Gil Medical Center, Incheon, 5Department of Neurology, Pusan National University Hospital, Busan, 6Department of Neurology, Ewha Womans University Mokdong Hospital, Seoul, 7Department of Neurology, Ilsan Hospital, National Health Insurance Corporation, 8Department of Neurology, Myongii Hospital, Goyang, 9Department of Neurology, Inha University School of Medicine, Incheon, 10Department of Neurology, Seoul National University College of Medicine & Neurocognitive Behavior Center, Seoul National University Bundang Hospital, Seongnam-si, Republic of Korea *These authors contributed equally to this work Abstract: Early-onset Alzheimer’s disease (EOAD has distinct clinical characteristics in comparison to late-onset Alzheimer’s disease (LOAD. The genetic contribution is suggested to be more potent in EOAD. However, the frequency of causative mutations in EOAD could be variable depending on studies. Moreover, no mutation screening study has been performed yet employing large population in Korea. Previously, we reported that the rate of family history of dementia in EOAD patients was 18.7% in a nationwide hospital-based cohort study, the Clinical Research Center for Dementia of South Korea (CREDOS study. This rate is much lower than in other countries and is even comparable to the frequency of LOAD patients in our country. To understand the genetic characteristics of EOAD in Korea, we screened the common Alzheimer’s disease (AD

  18. Factors associated with appropriate inhaler use in patients with COPD – lessons from the REAL survey

    Directory of Open Access Journals (Sweden)

    Price D

    2018-02-01

    Full Text Available David Price,1,2 Dorothy L Keininger,3 Boomi Viswanad,4 Matthias Gasser,5 Susann Walda,5 Florian S Gutzwiller3 1Division of Applied Health Sciences, Academic Primary Care, University of Aberdeen, Aberdeen, UK; 2Observational and Pragmatic Research Institute, Singapore; 3Novartis Pharma AG, Basel, Switzerland; 4Novartis Healthcare Pvt. Ltd., Hyderabad, India; 5GfK Switzerland AG, Basel, Switzerland Background: Nonadherence to medication and incorrect use of inhalers represent significant barriers to optimal disease management of patients with chronic obstructive pulmonary disease (COPD. Thus, health care professionals (HCPs play a critical role in educating their patients on appropriate inhaler use and in ensuring medication adherence. However, many patients do not receive appropriate inhaler training or have not had their inhaler technique checked.Methods: The Real-life Experience and Accuracy of inhaLer use (REAL survey was a computer-assisted, telephonic survey consisting of 23 questions gathering real-world information on correct inhaler use, inhalation technique, device attributes, adherence, dosing accuracy, training, correct device use, ease of use, and factors that influence patient adherence in commercially available inhalers delivering COPD maintenance therapy. All results are based on patient-reported data.Results: The survey was conducted between January 4, 2016 and February 2, 2016. A total of 764 patients using various inhalers (Breezhaler® =186; Ellipta® =191; Genuair® =194; Respimat® =201 with mild to very severe COPD, with a mean ± SD age 56±9.8 years, completed the survey. Patient self-reported adherence was significantly lower in younger patients compared to older patients (p=0.020. Eighty-three percent of patients indicated that a demonstration (in-person was “very helpful” versus 58% for video. Patient preferences for training methods were as follows: demonstration of inhaler use (83%, video (58%, instructions for

  19. PREFACE: 13th International Conference on Electrorheological Fluids and Magnetorheological Suspensions (ERMR2012)

    Science.gov (United States)

    Unal, Halil Ibrahim

    2013-02-01

    China) gave plenary talks on novel MR shear thickening fluids, MR rubber composites and MR plastomers, respectively. H J Choi (INHA University, Korea), X Zhao (Northwestern Polytechnical University, China) and R Tao (Temple University, USA) delivered plenary lectures on issues relating to the area of electrorheological (ER) fluids. In their talks, Choi and Zhao covered novel ER materials with core-shell structured microspheres and micro/nano hierarchical structured titania particles, respectively, and Tao focused on the reduction of the viscosity of liquid suspensions for energy applications in transporting crude oil via pipelines. Attendance of the presentations was exceptionally high. Poster presentations were divided into two sessions and held in the afternoons after the close of the sessions, which were filled with stimulating discussions. The award for the best student research in the area of electrorheological fluids, sponsored by the Winslow family, was given to Y D Liu of INHA University, Korea on research entitled 'Copolyaniline coated monodisperse polystyrene microparticles and their electrorheological response'. The award for the best student research on magnetorheological suspensions, sponsored by the LORD Corporation, was given to S Kaneko of Keio University, Japan on research entitled 'Effect of a magnetic field on sloshing pressure in a magnetic fluid'. Besides the purely scientific program during the five days, some special events were also organized. A guided tour of the old city and some important landmarks of the capital city of Ankara were organized before the Gala Dinner. Special samples of Turkish classical music and folk dancing were performed by a group from the Republic of Turkey Ministry of Culture and Tourism to exhibit Turkish culture to the delegates at Gala Night, which was truly appreciated. Following the conclusion of this successful meeting, the next conference is expected to be organized at the University of Granada, Spain by Professor

  20. Welcome to the 2014 volume of Smart Materials and Structures

    Science.gov (United States)

    Garcia, Ephrahim

    2014-01-01

    last year after many years in service as Associate Editors. Associate Editors in 2013: Professor G Akhras, Royal Military College of Canada, Ontario, Canada Professor C Boller, University of Saarland, Saarbrücken, Germany Fraunhofer-Institut für Zerstörungsfreie Prüfverfahren, Dresden, Germany Professor J Cagnol, École Centrale Paris, France Professor G Carman, University of California-Los Angeles, USA Professor S-B Choi, Inha University, Incheon, Korea Professor S H Choi, NASA Langley Research Center, Hampton, VA, USA Professor A Del Grosso, Università degli Studi di Genova, Italy Professor A Erturk, Georgia Institute of Technology, GA, USA Professor U Gabbert, Universität Magdeburg, Germany Professor A Güemes, Universidad Politecnica de Madrid, Spain Professor S Gopalakrishnan, Indian Institute of Science, Bangalore, India Professor J Kim, Inha University, Incheon, Korea Professor K J Kim, University of Nevada, Reno, USA Professor S J Kim, Seoul National University, Korea Professor D Lagoudas, Texas A&M University, College Station, USA Professor R Lammering, Helmut-Schmidt-Universität/Universität der Bundeswehr Hamburg, Hamburg, Germany Professor C K Lee, National Taiwan University, Taiwan Professor W Li, University of Wollongong, Australia Professor W H Liao, Chinese University of Hong Kong, China Professor Y Liu, Harbin Institute of Technology, China Professor C S Lynch, University of California-Los Angeles, USA Professor S Masri, University of Southern California, Los Angeles, USA Professor W M Ostachowicz, Polish Academy of Sciences, Gdansk, Poland Professor K Peters, North Carolina State University, Raleigh, USA Professor M Shahinpoor, University of Maine, Orono, USA Professor H Sodano, University of Florida, Gainsville, USA Professor G Song, University of Houston, TX, USA Professor W J Staszewski, AGH University of Science and Technology, Kraków, Poland Professor N Takeda, University of Tokyo, Japan Professor D-H Wang, Chongqing University, China

  1. EDITORIAL: Welcome to the 2013 volume Welcome to the 2013 volume

    Science.gov (United States)

    Garcia, Ephrahim

    2013-01-01

    Professor Derek Abbott, Professor Alison Flatau, Professor Jinsong Leng and Professor Yuji Matsuzaki who have retired from the Board. Professor Matsuzaki worked on the journal for almost two decades. Associate Editors Professor G Akhras, Royal Military College of Canada, Ontario, Canada Professor C Boller, University of Saarland, Saarbrücken, Germany; Fraunhofer-Institut für Zerstörungsfreie Prüfverfahren, Dresden, Germany Professor Cagnol, École Centrale Paris, France Professor G Carman, University of California-Los Angeles, USA Professor S-B Choi, Inha University, Incheon, Korea Professor S H Choi, NASA Langley Research Center, Hampton, VA, USA Professor A Del Grosso, Università degli Studi di Genova, Italy Professor D Erickson, Cornell University, Ithaca, NY, USA Professor U Gabbert, Universität Magdeburg, Germany Professor A Güemes, Universidad Politecnica de Madrid, Spain Professor S Gopalakrishnan, Indian Institute of Science, Bangalore, India Professor J Kim, Inha University, Incheon, Korea Professor K J Kim, University of Nevada, Reno, USA Professor S J Kim, Seoul National University, Korea Professor D Lagoudas, Texas A&M University, College Station, USA Professor R Lammering, Helmut-Schmidt-Universität/Universität der Bundeswehr Hamburg, Hamburg, Germany Professor C K Lee, National Taiwan University, Taiwan Professor W Li, University of Wollongong, Australia Professor W H Liao, Chinese University of Hong Kong, China Professor Y Liu, Harbin Institute of Technology, China Professor C S Lynch, University of California-Los Angeles, USA Professor S Masri, University of Southern California, Los Angeles, USA Professor W M Ostachowicz, Polish Academy of Sciences, Gdansk, Poland Professor K Peters, North Carolina State University, Raleigh, USA Professor M Shahinpoor, University of New Mexico, Albuquerque, USA Professor H Sodano, Arizona State University, Tempe, USA Professor G Song, University of Houston, TX, USA Professor W J Staszewski, AGH University of Science

  2. Prospecção hidrobiológica da Baía de Sepetiba Color and transparence of waters of Sepetiba Bay, in Rio de Janeiro State

    Directory of Open Access Journals (Sweden)

    Lejeune P. H. de Oliveira

    1971-01-01

    green in the localities with blooms of the diatom Coscinodiscus. The central portion of the bay, 150 Km[squared] hole-green, full of larvae of shrimps Penaeus schmidti; some shoals of shrimps moves its pleopods and by displacement of botton with diatoms and reddish sediment produces a rust color spot in surface of waters seen by fishermen. The estuaries are Isabell color, and caramel. That is a preliminar survey, to future comparison, because to day Sepetiba Bay is not polluted. But futurelly, it will be polluted by an harbour for 3.000,000 tons of iron ore, and by a quay for cargo boats, and siderurgy mills, airports, and other industries. Several polluted waters of Guanabara Bay are black and asphalt color, and cub color. That colors are not found in Sepetiba Bay to day. In 1965, we do not find the "red waters" and "red tides" with blooms of dinoflagellates in Sepetiba Bay, that they are present sometimes in Guanabara Bay with mortalities of fishes. Sepetiba Bay is not biologic problem, to day, is not polluted. The fig. 3 shows a map of transparence of waters by the disc of Secchi and a relation is given of color and transparence, in Sepetiba: Forel color 5: transparence 2.8 m to 2.9 m; Forel n. 6: 2.0 m; Forel color n. 7: 1.0 m to 1.5 m. Moss green waters: 0.6 to 1.5 m; hellebore green waters: 0.9 to 1.5 m; emerald green waters: 2.0 m to 2.2 m; In Guanabara Bay, into the polluted Enseada de Inhaúma: asphalt color waters: 0.02 - 0.05 m; and in black waters: trasnparence of 1 cm. The extintion koeficient of light is indicated in explanation of the fig. 3.

  3. Bilateral lung masses: The same aetiology?

    Directory of Open Access Journals (Sweden)

    C. Damas

    2007-03-01

    de pulmão do tipo pequenas células. No estadiamento da doença foram identificadas lesões hepáticas secundárias, motivo porque a doença foi considerada como disseminada, dada a existência de lesões hepáticas e pulmonares contra-laterais. Foi, nesta fase, iniciada quimioterapia com carboplatinum e etoposídeo. Seis meses mais tarde, a lesão direita inha diminuído, mas a lesão esquerda apresentava aumento das suas dimensões. A biópsia desta lesão mostrou uma citologia compatível com adenocarcinoma do pulmão, motivo porque inicia novo ciclo de quimioterapia com vinorelbina e gencitabina. Aos quatro ciclos e por não se evidenciar nenhuma resposta ao tratamento, foi realizada radioterapia da lesão esquerda. Durante este período (28 meses mantém-se assintomática, mantendo a sua actividade diária habitual.De acordo com o momento do diagnóstico as neoplasias do pulmão podem ser consideradas síncronas ou metácronas. Estas últimas são mais frequentes, representando cerca de 50–70% dos casos, sendo o padrão histológico mais frequente o adenocarcinoma.No caso apresentado, a situação parecia ser uma doença disseminada, o que afastou a hipótese de tumores síncronos. Apesar de a doença se apresentar num estádio avançado aquando do diagnóstico e do mau prognóstico associado, a evolução dos dois tipos de tumor não pareceu comprometer a actividade diária da doente. Key-words: Primitive lung tumor, synchronous lung tumor, metachronous lung tumour, Palavras-chave: Tumor primitivo do pulmão, tumores síncronos do pulmão, tumores metácronos do pulmão

  4. Massas pulmonares bilaterais. Mesma etiologia?

    Directory of Open Access Journals (Sweden)

    C. Damas

    2007-03-01

    Full Text Available Resumo: Os autores descrevem o caso de uma mulher de 50 anos, fumadora. Assintomática até Setembro de 2003, altura em que refere o aparecimento de tosse seca, cansaço e perda de peso. Na radiografia do tórax eram evidentes duas massas, uma no lobo superior direito e outra no lobo lingular. A doente foi submetida a biópsia aspirativa transtorácica e a citologia obtida foi compatível com carcinoma de pulmão do tipo pequenas células. No estadiamento da doença foram identificadas lesões hepáticas secundárias, motivo porque a doença foi considerada como disseminada, dada a existência de lesões hepáticas e pulmonares contra-laterais. Foi, nesta fase, iniciada quimioterapia com carboplatinum e etoposídeo. Seis meses mais tarde, a lesão direita inha diminuído, mas a lesão esquerda apresentava aumento das suas dimensões. A biópsia desta lesão mos-trou uma citologia compatível com adenocarcinoma do pulmão, motivo porque inicia novo ciclo de quimioterapia com vinorelbina e gencitabina. Aos quatro ciclos e por não se evidenciar nenhuma resposta ao tratamento, foi realizada radioterapia da lesão esquerda. Durante este período (28 meses mantém-se assintomática, mantendo a sua actividade diária habitual.De acordo com o momento do diagnóstico as neo-plasias do pulmão podem ser consideradas síncronas ou metácronas. Estas últimas são mais frequentes, re-presentando cerca de 50-70% dos casos, sendo o pa-drão histológico mais frequente o adenocarcinoma.No caso apresentado, a situação parecia ser uma doença disseminada, o que afastou a hipótese de tumores síncronos. Apesar de a doença se apresentar num estádio avançado aquando do diagnóstico e do mau prognósti-co associado, a evolução dos dois tipos de tumor não pareceu comprometer a actividade diária da doente.Rev Port Pneumol 2007; XIII (2: 287

  5. Bilateral lung masses: The same aetiology? Massas pulmonares bilaterais: Mesma etiologia?

    Directory of Open Access Journals (Sweden)

    C Damas

    2007-03-01

    pequenas células. No estadiamento da doença foram identificadas lesões hepáticas secundárias, motivo porque a doença foi considerada como disseminada, dada a existência de lesões hepáticas e pulmonares contra-laterais. Foi, nesta fase, iniciada quimioterapia com carboplatinum e etoposídeo. Seis meses mais tarde, a lesão direita inha diminuído, mas a lesão esquerda apresentava aumento das suas dimensões. A biópsia desta lesão mostrou uma citologia compatível com adenocarcinoma do pulmão, motivo porque inicia novo ciclo de quimioterapia com vinorelbina e gencitabina. Aos quatro ciclos e por não se evidenciar nenhuma resposta ao tratamento, foi realizada radioterapia da lesão esquerda. Durante este período (28 meses mantém-se assintomática, mantendo a sua actividade diária habitual. De acordo com o momento do diagnóstico as neoplasias do pulmão podem ser consideradas síncronas ou metácronas. Estas últimas são mais frequentes, representando cerca de 50-70% dos casos, sendo o padrão histológico mais frequente o adenocarcinoma. No caso apresentado, a situação parecia ser uma doença disseminada, o que afastou a hipótese de tumores síncronos. Apesar de a doença se apresentar num estádio avançado aquando do diagnóstico e do mau prognóstico associado, a evolução dos dois tipos de tumor não pareceu comprometer a actividade diária da doente.

  6. Committees

    Science.gov (United States)

    2012-11-01

    Quebec IREQ, Varennes Canada Etienne PARKINSON Andritz Hydro Ltd. Switzerland B V S S S PRASAD Indian Institute of Technology Madras India Stefan RIEDELBAUCH Stuttgart University Germany Michel SABOURIN Alstom Hydro Canada Inc Canada Bruno SCHIAVELLO Flowserve Corporation USA Katsumasa SHIMMEI Hitachi Ltd Japan Christoph SINGRTüN VDMA Germany Ale? SKOTAK CKD Blansko Engineering, a s Czech Republic Toshiaki SUZUKI Toshiba Corporation Japan Andy C C TAN Queensland University of Technology Australia Geraldo TIAGO FILHO Universidade Federal de Itajuba Brazi Thi C VU Andritz Hydro Ltd Canada Satoshi WATANABE Kyushu University Japan S H WINOTO National University of Singapore Singapore Woo-Seong WOO STX Institute of Technology Korea International Technical Committee François AVELLAN (principal) EPFL-LMH Switzerland Xingqi LUO (principal) Xi'an University of Technology China Martin BÖHLE Kaiserslautern University Germany Gerard BOIS ENSAM France Young-Seok CHOI KITECH Korea Luca d'AGOSTINO University of Pisa Italy Eduard EGUSQUIZA Polytechnical University Catalonia Spain Arpad FAY University of Miskolcz Hungary Richard FISHER Voith Hydro Inc USA Regiane FORTES-PATELLA Institute Polytechnique de Grenoble France Aleksandar GAJIC University of Belgrade Serbia José GONZÁLEZ Universidad de Oviedo Spain François GUIBAULT Ecole Polytechnique de Montreal Canada Toshiaki IKOHAGI Tohoku University Japan Chisachi KATO University of Tokyo Japan Kwang-Yong KIM Inha University Korea Youn-Jea KIM Sungkyunkwan University Korea Smaine KOUIDRI Université Pierre et Marie Curie (Paris 6) France Shengcai LI Warwick University UK Adrian LUNGU Dunarea de Jos University of Galati Romania Torbjøm K NIELSEN NTNU Norway Michihiro NISHI Tsinghua University China Peter PELZ Darmstadt University Germany Frantisek POCHYLY Brno University Czech Republic Albert RUPRECHT University of Stuttgart Germany Rudolf SCHILLING Technische University München Germany Wei SHYY HKUST Hong Kong,China Romeo SUSAN

  7. PREFACE: International Conference on Inverse Problems 2010

    Science.gov (United States)

    Hon, Yiu-Chung; Ling, Leevan

    2011-03-01

    Conference 2010, we wish to express our cordial thanks to all the keynote, plenary, and invited speakers and members of the Advisory Board. We would like to thank the City University of Hong Kong, the Hong Kong Mathematical Society, the K C Wong Education Foundation, the Lee Hysan Foundation, and the Wei Lun Foundation for their generous financial support. Particularly, we wish to thank Miss Lonn Chan for her excellent administrative work in making all the arrangements for the conference. March 2011Yiu-Chung Hon, City University of Hong Kong, HKSARLeevan Ling, Hong Kong Baptist University, HKSAR Invited Keynote SpeakerH Thomas Banks, North Carolina State University, USA Invited Plenary SpeakersRyuichi Ashino, Osaka Kyoiku University, JapanAndrea Caponnetto, City University of Hong Kong, HKSARJeng-Tzong Chen, National Taiwan Ocean University, TaiwanHiromichi Itou, Gunma University, JapanHyeonbae Kang, Inha University, South KoreaMichael Klibanov, University of North Carolina at Charlotte, USAKim Knudsen, Technical University of Denmark, DenmarkRainer Kress, Georg-August-Universität Göttingen, GermanyJérôme Le Rousseau, University of Orleans, FranceChang-Ock Lee, Korea Advanced Institute of Science and Technology (KAIST), South KoreaGui-Rong Liu, University of Cincinnati, USAShuai Lu, Fudan University, ChinaFadil Santosa, University of Minnesota, USATomoya Takeuchi, North Carolina State University, USAXiang Xu, Zhejiang University, ChinaJun Zou, The Chinese University of Hong Kong, HKSAR Invited SpeakersMohamed Abdel-Mooty, The American University in Cairo, EgyptKrishna Agarwal, National University of Singapore, SingaporeHui Cao, Sun Yat-sen University, ChinaWen Chen, Hohai University, ChinaJin Cheng, Fudan University, ChinaLian Duan, University of Oxford, UKMeibao Ge, Zhejiang Sci-Tech University, ChinaRalf Hielscher, TU Chemnitz, GermanyGuanghui Hu, Weierstrass Institute for Applied Analysis and Stochastics (WIAS), GermanyKiwan Jeon, National Institute for Mathematical