WorldWideScience

Sample records for industrial research development

  1. Research and development and industrial informatization

    International Nuclear Information System (INIS)

    1995-08-01

    This book deals with research and development and industrial informatization with development of technology international trend, the present conditions of scientific technology in the major nations, politics of technical development and trend, process of national research and development, research for industrial research and development, strengthen cooperation for scientific technology among nations, current situation and development of technology by field such as energy, software and system, and technology for industrial informatization.

  2. Industry Participation in Defence Research and Development,

    Science.gov (United States)

    1983-12-01

    Research and Development: Proposals for Additional Incentives. ASTEC , 1990. K . Interaction between Industry, Higher Education and Government Laboratories...Incentives for Innovation in Australian Industry. ASTEC , 1983. P. Bibliography. Distribution Document Control Data Sheet AWA I A& I 14l2 p/O)OIP (02... ASTEC and the Senate Committee on Science and the Environment. My Department is already preparing advice for me in this regard and I shall ask them to

  3. Sports Nutrition Food Industry Chain Development Research

    OpenAIRE

    Jie Yin

    2015-01-01

    Through the study of Henan sports nutrition food industry chain optimization, the study analyses development advantage and competitive advantage of Henan in sports nutrition food industry chain and existing problems and challenges in Henan sports nutrition food industry chain and at the same time introduces the theory of supply chain management to the development of sports nutrition food industry chain, clearly optimizes countermeasures of sports nutrition food industry chain. Pointing out sp...

  4. Categories And Utilization Of Industrial Research And Development ...

    African Journals Online (AJOL)

    Research and Development outputs from scientific institutes and utilization of such outputs have been examin-ed. The data and information were drawn from 3 industry-based research Institutes of the Council for Scientific and Industrial Research (CSIR-Ghana), and also from users of the research outputs (such as ...

  5. Research of Talent Development Policy of Online Game Industry

    Directory of Open Access Journals (Sweden)

    Yun-Che Yang

    2003-12-01

    Full Text Available Due to the progress of information technology and the development of Internet, the digital content industry has become one of the most promising industries in the 21st century. The rapid growth of the online gaming industry at the turn of the century does not only catch the eyes of the whole world, but also reshape the entire information-related industry. The purpose of this study is to explore issue of the talent development policy of the domestic online game industry. The method of in-depth interview is used in this study, and the research target is chosen to be qualified of speaking for the government, the education institutes, and the private sectors in the industry. The findings of this research suggest that Taiwan's government should take up a more vigorous responsibility. Following the government's leadership, both education institutes and industry private sectors must actively participate in the collaboration and feed back the up-dated information, such as the market trend and most wanted human resources, to the policy makers.[Article content in Chinese

  6. Developing and Managing University-Industry Research Collaborations through a Process Methodology/Industrial Sector Approach

    Science.gov (United States)

    Philbin, Simon P.

    2010-01-01

    A management framework has been successfully utilized at Imperial College London in the United Kingdom to improve the process for developing and managing university-industry research collaborations. The framework has been part of a systematic approach to increase the level of research contracts from industrial sources, to strengthen the…

  7. [Example of product development by industry and research solidarity].

    Science.gov (United States)

    Seki, Masayoshi

    2014-01-01

    When the industrial firms develop the product, the research result from research institutions is used or to reflect the ideas from users on the developed product would be significant in order to improve the product. To state the software product which developed jointly as an example to describe the adopted development technique and its result, and to consider the modality of the industry solidarity seen from the company side and joint development. The software development methods have the merit and demerit and necessary to choose the optimal development technique by the system which develops. We have been jointly developed the dose distribution browsing software. As the software development method, we adopted the prototype model. In order to display the dose distribution information, it is necessary to load four objects which are CT-Image, Structure Set, RT-Plan, and RT-Dose, are displayed in a composite manner. The prototype model which is the development technique was adopted by this joint development was optimal especially to develop the dose distribution browsing software. In a prototype model, since the detail design was created based on the program source code after the program was finally completed, there was merit on the period shortening of document written and consist in design and implementation. This software eventually opened to the public as an open source. Based on this developed prototype software, the release version of the dose distribution browsing software was developed. Developing this type of novelty software, it normally takes two to three years, but since the joint development was adopted, it shortens the development period to one year. Shortening the development period was able to hold down to the minimum development cost for a company and thus, this will be reflected to the product price. The specialists make requests on the product from user's point of view are important, but increase in specialists as professionals for product

  8. Federal laboratory nondestructive testing research and development applicable to industry

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S.A.; Moore, N.L.

    1987-02-01

    This document presents the results of a survey of nondestructive testing (NDT) and related sensor technology research and development (R and D) at selected federal laboratories. Objective was to identify and characterize NDT activities that could be applied to improving energy efficiency and overall productivity in US manufacturing. Numerous federally supported R and D programs were identified in areas such as acoustic emissions, eddy current, radiography, computer tomography and ultrasonics. A Preliminary Findings Report was sent to industry representatives, which generated considerable interest.

  9. A research on industrial development of radiation sterilization in Sichuan

    International Nuclear Information System (INIS)

    Chen Xun; Zhu Rong; Chen Jigang

    2010-01-01

    Radiation sterilization is widely applied in food processing, Pharmaceutical Manufacturing and medical instrumentation producing. As this industry offers service to related corporations, its development depends largely on the market scale of the relevant industries. This article mainly discusses the balance point between the capacity of radiation sterilization and the requirement of its market. There are less than 1% of the companies in Sichuan which using radiation sterilization for its products, broad prospects has shown in this field. The output value of radiation sterilization industry reached 0.1% of the GDP in some advanced countries (America and Japan...), under this standard, its output value in Sichuan province would be RMB1.2 hundred million, but now our capacity and scale of this industry is less than RMB40million.Research shows: there are 3 key points to make its output value reach 0.1% of the GDP in Sichuan: 1. Breaking the 'bottleneck' restrictions of capacity and Inappropriate resources distribution. 2. Promoting the technique of radiation sterilization, guiding corporation to reduce their dependence on food additive from the perspective of food safety, make effective implantation of radiation sterilization into their manufacture processes. 3. Increasing publicity for radiation sterilization, eliminating scared mentality among customer on nuclear technology, helping manufacturing corporations to establish green environmental protection brand, directing our customer to a more healthy awareness. (authors)

  10. Nanotechnology research and development for military and industrial applications

    Science.gov (United States)

    Ruffin, Paul B.; Brantley, Christina L.; Edwards, Eugene; Roberts, J. Keith; Chew, William; Warren, Larry C.; Ashley, Paul R.; Everitt, Henry O.; Webster, Eric; Foreman, John V.; Sanghadasa, Mohan; Crutcher, Sihon H.; Temmen, Mark G.; Varadan, Vijay; Hayduke, Devlin; Wu, Pae C.; Khoury, Christopher G.; Yang, Yang; Kim, Tong-Ho; Vo-Dinh, Tuan; Brown, April S.; Callahan, John

    2011-04-01

    Researchers at the Army Aviation and Missile Research, Development, and Engineering Center (AMRDEC) have initiated multidiscipline efforts to develop nano-based structures and components for insertion into advanced missile, aviation, and autonomous air and ground systems. The objective of the research is to exploit unique phenomena for the development of novel technology to enhance warfighter capabilities and produce precision weapons. The key technology areas that the authors are exploring include nano-based microsensors, nano-energetics, nano-batteries, nano-composites, and nano-plasmonics. By integrating nano-based devices, structures, and materials into weaponry, the Army can revolutionize existing (and future) missile systems by significantly reducing the size, weight and cost. The major research thrust areas include the development of chemical sensors to detect rocket motor off-gassing and toxic industrial chemicals; the development of highly sensitive/selective, self-powered miniaturized acoustic sensors for battlefield surveillance and reconnaissance; the development of a minimum signature solid propellant with increased ballistic and physical properties that meet insensitive munitions requirements; the development of nano-structured material for higher voltage thermal batteries and higher energy density storage; the development of advanced composite materials that provide high frequency damping for inertial measurement units' packaging; and the development of metallic nanostructures for ultraviolet surface enhanced Raman spectroscopy. The current status of the overall AMRDEC Nanotechnology research efforts is disclosed in this paper. Critical technical challenges, for the various technologies, are presented. The authors' approach for overcoming technical barriers and achieving required performance is also discussed. Finally, the roadmap for each technology, as well as the overall program, is presented.

  11. Integrated design optimization research and development in an industrial environment

    Science.gov (United States)

    Kumar, V.; German, Marjorie D.; Lee, S.-J.

    1989-01-01

    An overview is given of a design optimization project that is in progress at the GE Research and Development Center for the past few years. The objective of this project is to develop a methodology and a software system for design automation and optimization of structural/mechanical components and systems. The effort focuses on research and development issues and also on optimization applications that can be related to real-life industrial design problems. The overall technical approach is based on integration of numerical optimization techniques, finite element methods, CAE and software engineering, and artificial intelligence/expert systems (AI/ES) concepts. The role of each of these engineering technologies in the development of a unified design methodology is illustrated. A software system DESIGN-OPT has been developed for both size and shape optimization of structural components subjected to static as well as dynamic loadings. By integrating this software with an automatic mesh generator, a geometric modeler and an attribute specification computer code, a software module SHAPE-OPT has been developed for shape optimization. Details of these software packages together with their applications to some 2- and 3-dimensional design problems are described.

  12. Assessment of industry needs for oil shale research and development

    Energy Technology Data Exchange (ETDEWEB)

    Hackworth, J.H.

    1987-05-01

    Thirty-one industry people were contacted to provide input on oil shale in three subject areas. The first area of discussion dealt with industry's view of the shape of the future oil shale industry; the technology, the costs, the participants, the resources used, etc. It assessed the types and scale of the technologies that will form the industry, and how the US resource will be used. The second subject examined oil shale R D needs and priorities and potential new areas of research. The third area of discussion sought industry comments on what they felt should be the role of the DOE (and in a larger sense the US government) in fostering activities that will lead to a future commercial US oil shale shale industry.

  13. Research and development of zirconium industry in China

    International Nuclear Information System (INIS)

    Liu Jianzhang; Tian Zhenye

    2001-01-01

    The development of uranium material for nuclear power and silicon material for information industry represents two revolutionary changes in the material field in 20-th century. The development of these kinds of materials not only brings about great revolution of technology in the material field, but also promotes the great advancement of the world economy. Zirconium or its alloy, as one of the most important material in atomic age, just as the same as foreign countries has been developed under promotion of nuclear submarine project in China, and building of civil nuclear power reactor then has been laid a solid foundation for zirconium industry and provide a broad market for zirconium material

  14. WAMAS: an event to develop synergies between research and industry

    CERN Multimedia

    Rosaria Marraffino

    2013-01-01

    On 19-20 November, CERN hosted the first Workshop on Advanced Materials and Surfaces (WAMAS) in the framework of EIROforum, a network of Europe’s largest inter-governmental research organisations.     “The intent of the workshop was to promote the importance of materials and surfaces technology in the research programmes of European organisations,” explains Enrico Chesta, CERN’s Technology Transfer Section Leader and chairman of the EIROforum Working Group on Innovation Management. “Events like WAMAS help support the involvement of industry with scientific institutions because they facilitate the translation of the available expertise into commercial applications.” The event was organised with the support of EuCARD-2 and Enterprise Europe Network (EEN) through the Rhône-Alpes Chamber of Commerce and Industry. “More than 160 participants came together at the workshop; there was a good balance between ind...

  15. Overview of Gas Research Institute's industrial utilization research and development program

    Energy Technology Data Exchange (ETDEWEB)

    Tabb, E S

    1982-05-01

    A combination of technical, economic, political, and environmental constraints hamper industry's ability to use natural gas efficiently. Although the industrial sector has the best potential to absorb the current surplus of natural gas, many industrial users are disenchanged with the high cost, low efficiency, and environmental problems associated with the existing inventory of gas-fired process systems. Consequently, it is essential for an organization like Gas Research Institute (GRI), which has a national scope and a mandate to generate energy end-use benefits for the industrial gas consumer, to assume a leadership role in the development program aimed, not only at upgrading the energy efficiency of industrial process equipment, but at increasing its production capability while meeting environmental standards.

  16. Industrial workshop on LASL semiconductor radiation-detector research and development

    International Nuclear Information System (INIS)

    Endebrock, M.

    1978-11-01

    An Industrial Workshop on LASL Semiconductor Radiation Detector Research and Development was held at the Los Alamos Scientific Laboratory (LASL) in the spring of 1977. The purpose was to initiate communication between our detector research and development program and industry. LASL research programs were discussed with special emphasis on detector problems. Industrial needs and capabilities in detector research and development were also presented. Questions of technology transfer were addressed. The notes presented here are meant to be informal, as were the presentations

  17. The Research of Scrapped Automobiles Recycling and Disassembling Industry Development Based on Auto Industry Chain

    Directory of Open Access Journals (Sweden)

    linhua Pang

    2015-01-01

    Full Text Available The number of China’s scrapped car is on an explosively growing trend, and the development of scrapped car recycling industry has a golden prospect. The current scrapped car recycling system is not perfect in our country, because related industries driven by market develop slowly, and there are some outstanding problems such as potential safety risks, environmental pollution and resource waste. The paper analyzes and studies the existing problems and countermeasures to investigate the development strategy of scrapped car recycling industry according to the whole automobile industry chain construction, technology and equipment conditions, policy guidance, etc. and at last explore the new industrial development pattern of serving automobile reverse design.

  18. Research on industrial development of radiation sterilization in Sichuan

    International Nuclear Information System (INIS)

    Chen Xun; Zhu Rong; Chen Jigang; Ouyang Qiongli

    2010-01-01

    Radiation sterilization is widely applied in food processing, pharmaceutical manufacturing and medical instrumentation producing. As this industry offers service to related corporations, its development depends largely on the market scale of the relevant industries. This article mainly discusses the balance point between the capacity of radiation sterilization and the requirement of its market. There are less than 1% of the companies in Sichuan which using radiation sterilization for its products, broad prospects has shown in this field. There are 3 key points to make its output value reach 0.1% of the GDP in Sichuan: 1. Breaking the restrictions of capacity and inappropriate resources distribution. 2. Promoting the technique of radiation sterilization, guiding corporation to reduce their dependence on food additive from the perspective of food safety, make effective implantation of radiation sterilization into their manufacture processes. 3. Increasing publicity, eliminating scared mentality among customer on nuclear technology, helping manufacturing corporations to establish green environmental protection brand, directing our customer to a more healthy awareness. (authors)

  19. Technology transfer from research and development to European industry

    International Nuclear Information System (INIS)

    Conrads, H.; Theenhaus, R.

    1989-01-01

    This paper gives an overview of technology transfer, i.e. the transfer of knowledge, insights and technologies from research and development to practical application, especially in the Federal Republic of Germany. Some examples and perspectives of technology transfer for nuclear fusion are given. (author). 7 refs.; 5 figs

  20. Research on the development for emerging industries in Nantong under the national strategy

    Science.gov (United States)

    Li, Zhongnian; Qin, Yan; Zhang, Lijuan; Li, Tianying; Wang, Qing

    2017-08-01

    In this paper, according to the relevant national strategic emerging industry planning and policy, conducted in-depth research on the development of emerging industries in Nantong, and believes that current economic social development in Nantong has been entered into a new normal period, in the new period to “innovation” as the core characteristics, strategic emerging industry opportunities and challenges facing the industry. Therefore, Nantong should persist in innovation driven, focus on the cultivation and development of new industries, to provide new impetus to Nantong’s economic vitality and development. According to the development and upgrading of traditional industries, and expand the advantages of industry, cultivate new industries, for each kind of industry to come up with specific development strategies and suggestions: Nantong municipal government will be the seven emerging industries four in the industry (i.e., new material industry, new energy industry, new information technology industry, high-end equipment manufacturing industry) as the development object, further “bigger and stronger”, and strive to enhance the industrial scale and the formation of local characteristics as soon as possible.

  1. Advances in research and development of mango industry

    Directory of Open Access Journals (Sweden)

    Ian S. E. Bally

    2011-10-01

    Full Text Available World mango production is spread over 100 countries that produce over 34.3 million tons of fruit annually. Eighty percent of this production is based in the top nine producing nations that also consume upward of 90% of their production domestically. One to 2 percent of fruit is traded internationally in to markets in the European Community, USA, Arabian Peninsula and Asia. This paper outlines some of the recent research and development advances in mango breeding and genomics, rootstock development, disease management and harvest technologies that are influencing the production and quality of mango fruit traded domestically and internationally.

  2. Microbiological research and development for the food industry

    National Research Council Canada - National Science Library

    Taormina, Peter J

    2013-01-01

    "This book serves as a primer and reference for industrial food microbiologists who typically gain the information provided through on-the-job experience or from a consultant instead of in the classroom...

  3. Research on Dongguan Mobile Phone Industry Development Status from the Patent Perspective

    OpenAIRE

    Qiu Yu

    2017-01-01

    [Purpose/significance] Through the analysis of the patent of five Dongguan mobile phone industries, this paper aims at providing information references for the development of Dongguan mobile phone industry. [Method/process] This paper first introduced the basic information of the mobile phone industry in our country, selected Dongguan mobile phone industry patents as the research object, and analyzed overall development trend--the general situation and the trend of applicants, inventors and I...

  4. Research and development in the electricity supply industry conference

    International Nuclear Information System (INIS)

    1995-01-01

    This document summarizes the views expressed in the conference papers. These are grouped into fuels for the future, coal fired powers stations, renewables, use of heat as a by-product of electricity generation, fuel cells, electric vehicles, and environmental issues in the electricity supply industry. The points and ideas from the two workshops held in conjunction with the conference are also summarized

  5. Research and Development Financing in the Renewable Energy Industry in Brazil

    Directory of Open Access Journals (Sweden)

    Muriel de Oliveira Gavira

    2014-09-01

    Full Text Available In the last decades, the Brazilian government has put many public policies in place in order to create a favourable environment to promote energy efficiency and clean energy. In this paper we discuss the use of research and development financing support by the clean energy industry in Brazil. To do so, we carried out an empirical research analysing secondary data from legislation, literature case studies, and public and industry reports in order to determine if the companies of the clean energy industry have public financial support to research and development. Our ongoing research shows that, despite incentives to stimulate the dissemination of clean energy, the participation of some of the clean energy is very small (especially solar. We believe that the contributions of this study will assist policy makers, and the whole industry, to improve clean energy research and development investments in Brazil.

  6. 77 FR 36606 - Pipeline Safety: Government/Industry Pipeline Research and Development Forum, Public Meeting

    Science.gov (United States)

    2012-06-19

    ...: Threat Prevention --Working Group 2: Leak Detection/Mitigation & Storage --Working Group 3: Anomaly... DEPARTMENT OF TRANSPORTATION Pipeline and Hazardous Materials Safety Administration [Docket ID PHMSA-2012-0146] Pipeline Safety: Government/Industry Pipeline Research and Development Forum, Public...

  7. Industrial developments challenging planning and research endeavours around Songkla Lake

    DEFF Research Database (Denmark)

    Jørgensen, Ulrik; Lauridsen, Erik Hagelskjær

    2004-01-01

    had several broad committees engaged in supporting these planning issues and resolve the conflicts be-tween different stakeholder interests in the regions development. The paper gives an overview over the types of problems that have been addressed in these major plans and studies and the types......, but the specific outcomes of the planning and the scientific result seem to be rather limited. In an attempt to find an explanation to this gap between planning and advice on one hand and the implementation on the other, it is important not only to look for policy answers. These would typically be ‘lack...

  8. Research on the path of synergetic development between logistics industry and the leading industry in Fujian province

    Directory of Open Access Journals (Sweden)

    Mei Qiaoping

    2017-01-01

    Full Text Available Logistics industry is closely related to other industry, the synergetic development between logistics industry and leading industry is benefit for leading industry to reduce costs, improve efficiency and promote industrial upgrading. This book analyzes the association of logistics industry and leading industry on the basis of the input-output tables of Fujian and proposes advises to promote their synergetic development based on the calculation.

  9. 48 CFR 206.302-3 - Industrial mobilization; or engineering, development, or research capability.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Industrial mobilization; or engineering, development, or research capability. 206.302-3 Section 206.302-3 Federal Acquisition... COMPETITION REQUIREMENTS Other Than Full and Open Competition 206.302-3 Industrial mobilization; or...

  10. Federal agencies active in chemical industry-related research and development

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-29

    The Energy Policy Act of 1992 calls for a program to further the commercialization of renewable energy and energy efficient technologies for the industrial sector.. The primary objective of the Office of Industrial Technologies Chemical Industry Team is to work in partnership with the US chemical industry to maximize economic, energy, and environmental benefits through research and development of innovative technologies. This document was developed to inventory organizations within the federal government on current chemical industry-related research and development. While an amount of funding or number of projects specifically relating to chemical industry research and development was not defined in all organizations, identified were about 60 distinct organizations representing 7 cabinet-level departments and 4 independent agencies, with research efforts exceeding $3.5 billion in fiscal year 1995. Effort were found to range from less than $500 thousand per year at the Departments of Agriculture and the Interior to over $100 million per year at the Departments of Commerce, Defense, Energy, and Health and Human Services and the National Aeronautics and Space Administration. The total number of projects in these programs exceeded 10,000. This document is complete to the extent that agencies volunteered information. Additions, corrections, and changes are encouraged and will be incorporated in future revisions.

  11. FY2000 survey report research and development internationalization in industrial sector among APEC economies

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    A survey is conducted and a database is constructed on internationalization of research and development activities in the industrial sectors of APEC (Asia-Pacific Economic Cooperation Conference) countries, namely, on research and development support systems, research and development appropriations, research and development personnel, research VISA granting procedures and control over foreign funds, trends of research and development among private sector businesses, main research and development organizations, evaluation by private sector businesses of the research and development environments of their countries, and the like. Incorporated into the database are Australia, Brunei, Canada, Chile, China, Hong Kong, Indonesia, Japan, Korea, Malaysia, Mexico, New Zealand, Papua New Guinea, Peru, Philippines, Russia, Singapore, Chinese Taipei, Thailand, United States, and Vietnam. The database, compiled for Internet web pages, CD-ROMs, and publications, covers the industrial technology related policies of all the countries and helps understand the research and development systems, and enables access to main research organizations. The database comprises a general section dealing with the background, system constitution, and internationalization trend and a countries section collecting information on the respective countries. (NEDO)

  12. Research on the competitiveness and development strategy of china's modern coal chemical industry

    Science.gov (United States)

    Wang, Q.; Han, Y. J.; Yu, Z. F.

    2016-08-01

    China's modern coal chemical industry has grown into a certain scale after over a decade of development, and remarkable progress has been made in key technologies. But as oil price collapsed since 2015, the economic benefit of the industry also slumped, with loud controversies in China over the necessity of modern coal chemical industry. The research believes that the modern coal chemical industry plays a positive role in the clean and sustainable exploitation of coal in China. It makes profit when oil price is no lower than 60/bbl, and outperforms petrochemical in terms of cost effectiveness when the price is between 60/bbl and 80/bbl. Given the low oil price and challenges posed by environmental protection and water restraints, we suggest that the state announce a guideline quickly, with adjusted tax policies and an encouragement to technological innovation, so that the modern coal chemical industry in China can grow sound and stable.

  13. Managing between science and industrie: An historical analysis of the Philips Research and Development Department's management

    NARCIS (Netherlands)

    Boersma, F.K.

    2007-01-01

    Purpose This paper seeks to deal with the history of Research and Development (R&D) management. It takes the history of the R&D Department of the Royal Philips Electronics of The Netherlands as an example to unravel the dynamics behind industrial R&D management. Designomethodologyoapproach This

  14. Wind power - research and development. The wind turbine industry's view of the promotion of state-supported research and development

    International Nuclear Information System (INIS)

    Kroh, S.

    1995-10-01

    The windmill industry in Denmark is currently confronted with making a choice between competing technologies so that the role of the stimulus of state subsidies for research has lately increased in importance. The Ministry of Energy, it is claimed, must be aware of this as possibilities for making use of research results are dictated by the market and competition. The industry is not sympathetic to the idea of state research contracts with specified goals for which manufacturers must produce a technical solution. Consultancy firms should work towards solving general problems which could help the industry as a whole. Wind turbines which are cheap to produce and operate are of more interest to industry than those which are technologically advanced or of a lighter construction. It is not thought to be advantageous to concentrate the allocation of subsidies on one key project chosen by the Ministry itself, such as the current intense interest in turbine blades. Aerodynamics, noise pollution and materials are considered as more vital areas for research. A special interest in smaller windmills is not currently relevant. Evaluations of the quality of research projects demanding subsidies should be more critical. A detailed list of subjects within this field which are considered as being relevant for research is given. The Danish windmill industry advises a centralized wind power research institution and a gradual shift of the test station at Risoe National Laboratory to Jutland as wind conditions at Risoe are not considered satisfactory. A better communication between Risoe test station and the wind power industry is recommended. (AB)

  15. The EC Maritime Industries Forum 1992: Marine resources and research and development

    International Nuclear Information System (INIS)

    Jenisch, U.K.

    1993-01-01

    The Maritime Industries Forum (MIF) of the European Community has prepared a comprehensive report covering all the EC maritime industries. The report, published on October 29, 1992, addresses maritime activities such as shipbuilding, shipping, fishing, energy, marine resources and environmental protection. Focal points are research and development measures and strategies. A major objective is to strengthen the competitiveness of the maritime industries via a global and horizontal approach. This paper briefly analyses the M.I.F. Report and concentrates on the EC interests in the field of marine resources such as oil and gas, potable water, aquaculture and fishing, minerals, OTEC/DOWA as well as the environmentally sound technology that is required to allow for a future oriented and sustainable exploitation. Export opportunities for such new technologies and cooperation with third states are an important objective. The proposals of the M.I.F. Report are of a positive, future-oriented nature, appropriate to replace many of the hitherto defensive policies in the maritime area. The industries recognize the responsibility for the revitalization of their industrial sectors. The method of this broad sectoral approach for a new industrial policy in Europe is innovative and a model in itself. With the installation of three specialized new industrial panels in January 1993 the work continues

  16. Association between Local Illumination and Visual Fatigue among the Research and Development Staffs of Industry

    Directory of Open Access Journals (Sweden)

    A.R. Mashkoori

    2016-12-01

    Full Text Available Abstract Aims: Work proper lighting means a safe, healthy and comfort conditions for work under a lighting system that includes qualitative and quantitative features. This study aimed to evaluate the surface local lighting of works and eye fatigue among research and development staffs of an automotive industry. Instrument & Methods: In this descriptive study in Research and Development Department of an automotive industry in 2015, 126 official staffs were selected randomly. A demographic questionnaire and the Visual Fatigue Questionnaire (Persian Version were used for data gathering. Hagner EC1 Luxmeter was used to measure the local lighting. Data were analyzed by SPSS 20 software, through descriptive statistics. Findings: The lighting in 382 stations (75.8% was improper and less than standard. The minimum and maximum intensity of light was between 22.4lux in station 2 (inventory department and 581lux in station 4 (systems and methods department. The overall intensity in more than 50% units, except the Systems and Methods Department, were less than the standard (300lux. 40.4% of the participants had severe eye fatigue, 28.6% had moderate visual fatigue, 28.6% had low visual fatigue and only 2.4% had no visual fatigue. The average of visual fatigue was 3.50±1.97. Conclusion: The workplace lighting and the eye fatigue of computer users in the Research and Development Department of the studied automotive industry are not in an acceptable condition.

  17. Recomendations concerning technical research and development with the purpose to industrially exploit marine algae

    Energy Technology Data Exchange (ETDEWEB)

    Hahn-Haegerdal, B.

    1980-10-01

    This report formulates a proposal for a program for technical research and development concerning use of Marine algae.The report is based on a retrospective literature search, an inquiry to potential algae users and producers in Sweden, visits to and correspondence with scientists and industries in Sweden and abroad. Technical research and development concerning marine algae is needed within the following fields: -Development of new sorts of algae offering resistance to parasite and disease adoptation to cultivation and har- vesting systems,and high-yielding concerning technically interesting components. -Development of suitable cultivation systems for Swedish conditions. -Co-cultivation of fish, mussels, oysters and crustaceans with algae. -Development of harvesting systems. -Methane rotting. -Fatty acid/hydrocarbon production as an alternative to methane rotting. -Physical-chemical properties of marine polysaccharides in relation to their technical properties. -Marine algae as fodder supplement.

  18. Derivative Process Model of Development Power in Industry: Empirical Research and Forecast for Chinese Software Industry and US Economy

    OpenAIRE

    Feng Dai; Bao- hua Sun; Jie Sun

    2004-01-01

    Based on concept and theory of Development Power [1], this paper analyzes the transferability and the diffusibility of industrial development power, points out that the chaos is the extreme of DP releasing and order is the highest degree of DP accumulating, puts forward A-C strength, the index of adjusting and controlling strength, and sets up the derivative process model for industrial development power on the Partial Distribution [2]-[4]. By the derivative process model, a kind of time seri...

  19. University of Tennessee - Industry collaborative research and development in preventive maintenance technology

    International Nuclear Information System (INIS)

    Upadhyaya, B.R.

    1992-01-01

    The Preventive Maintenance Engineering Laboratory (PMEL) was inaugurated at the University of Tennessee Nuclear Engineering Department in September 1989. The startup funding was provided by Gilbert/Commonwealth, Inc. The purpose of PMEL is to identify maintenance-related problems in the power and process industries and to find their solutions through the development and application of emerging technologies. These include advanced digital signal processing, applied artificial intelligence (AI), artificial neural networks, and reliability based methods. The Laboratory activities are being expanded by the formation of an industrial consortium within the Measurement and Control Engineering Center at the University of Tennessee. Several research and development projects in preventive maintenance are being carried out. These include condition monitoring of air operated valves, automated diagnostics of motor operated valves, instrument calibration, verification, and estimation of expected residual life of electric motors using applied AI technology and reliability-based methods. The new methodology will be applied to other industrial subsystems. A long-term research and development project is being sponsored by the T.V.A. Nuclear Maintenance Department. The overall objective of the research program is to develop and apply advanced artificial intelligence and information processing methods to the problems of plant performance monitoring and preventive maintenance. The program includes the development of a workstation/PC-based, networking of plant information for easy access to operational and management personnel, implementation of a sensor verification system, monitoring of feedwater flow venturi fouling and heat rate balance, and integration of signal validation, command validation, and fault-tolerant control strategies

  20. TELEMAN - an European community research and development programme on robotics in the nuclear industry

    International Nuclear Information System (INIS)

    Tolley, B.; Robertson, B.

    1991-01-01

    The TELEMAN Programme is a five year cost-shared research programme covering remote handling in hazardous and disordered nuclear environments. It is supported within the current research and development of the European Communities. TELEMAN's strategic objective is to develop advanced teleoperators that respond to the needs of the nuclear industry. Its technical objective is to strengthen the scientific and engineering bases upon which the design of teleoperators for use throughout the nuclear industry rests. This will be done by providing new solutions to problems of manipulation, material transport and mobile surveillance in nuclear environments and by demonstrating their feasibility. Motivation for such a programme lies in the potential teleoperators have to improve the separation of workers from radioactive equipment. This technology will also enable plant operators and public authorities to deal more effectively with nuclear abnormal incidents and increase gains in productivity, mainly in the repair and maintenance area. Community support is justified by the cost of the reliability and autonomy required for the nuclear teleoperator, the need to rationalise R and D investment in an area of increasing industrial potential and a common interest in coherent responses to emergencies. (author)

  1. The Impact of Foreign Ownership on Research and Development Intensity and Technology Acquisition in Indian Industries

    DEFF Research Database (Denmark)

    Aggarwal, Aradhna

    2018-01-01

    of the Center for Monitoring Indian Economy. Foreign ownership is categorized according to the level of control exercised by foreign firms as defined under the Companies Act of India. A comparative analysis of domestic and different categories of foreign firms was conducted for two time periods: (i) the global...... boom period of 2004–2008, and (ii) the post global financial crisis period of 2008–2014. A horizontal cluster analysis of 3-digit, industry-level data shows that foreign firms cluster in high-technology industries. The propensity score matching analysis, however, reveals that in a matched sample...... of foreign and domestic firms, majority-owned foreign firms spend less on research and development and more on technology transfers than their local counterparts, demonstrating that the level of equity holdings by a foreign firm matters. There is little evidence of the global financial crisis affecting...

  2. Trends in Food Research and Development: A Survey of the Commercial Food Industry

    Science.gov (United States)

    1987-09-01

    top priority of research and development in the food industry; however, the consumer market has chanqed dramatically since the beginning of this decade...Canned & Preserved Fruits & Vegetables 45.6 204 Grain Mill Products 32.4 205 Bakery Products 33.8 206 Sugar & Confectionery Products 32.4 207 Fats & Oils...15.6 40.6 39.1 Aseptic Packaging of Particulates 0.0 0.0 14.5 36.0 49.5 Genetic Engineering 1.5 7.6 21.2 36.4 33.3 The market share of frozen foods is

  3. Assessment of industry needs for oil shale research and development. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hackworth, J.H.

    1987-05-01

    Thirty-one industry people were contacted to provide input on oil shale in three subject areas. The first area of discussion dealt with industry`s view of the shape of the future oil shale industry; the technology, the costs, the participants, the resources used, etc. It assessed the types and scale of the technologies that will form the industry, and how the US resource will be used. The second subject examined oil shale R&D needs and priorities and potential new areas of research. The third area of discussion sought industry comments on what they felt should be the role of the DOE (and in a larger sense the US government) in fostering activities that will lead to a future commercial US oil shale shale industry.

  4. Necessity for Industry-Academic Economic Geology Collaborations for Energy Critical Minerals Research and Development

    Science.gov (United States)

    Hitzman, M.

    2012-12-01

    Economic geology is a highly interdisciplinary field utilizing a diverse set of petrologic, geochemical, geophysical, and tectonic data for improved scientific understanding of element migration and concentration in the crust (ore formation). A number of elements that were once laboratory curiosities now figure prominently in new energy technologies (e.g. wind turbines, solar energy collectors). If widely deployed, such technologies have the capacity to transform the way we produce, transmit, store, and conserve energy. To meet domestic and worldwide renewable energy needs these systems must be scaled from laboratory, to demonstration, to widespread deployment. Such technologies are materials intensive. If widely deployed, the elements required by these technologies will be needed in significant quantities and shortage of these "energy critical elements" could significantly inhibit the adoption of otherwise game changing energy technologies. It is imperative to better understand the geology, metallurgy, and mining engineering of critical mineral deposits if we are to sustainably develop these new technologies. There is currently no consensus among federal and state agencies, the national and international mining industry, the public, and the U.S. academic community regarding the importance of economic geology to secure sufficient energy critical elements to undertake large-scale renewable energy development. Available federal funding for critical elements focuses on downstream areas such as metallurgy, substitutions, and recycling rather than primary deposits. Undertaking the required research to discover and mine critical element deposits in an environmentally friendly manner will require significant partnering with industry due to the current lack of federal research support.

  5. [Incentives and disincentives for research and development of new drugs by the pharmaceutical industry].

    Science.gov (United States)

    Curcio, Pasqualina Curcio

    2008-10-01

    The authors present a model with factors that influence research and development decisions by the pharmaceutical industry: risk of disease transmission and possibility of control; case-fatality and the presence of cure or treatments; income; number of persons who demand the medicine; and opportunity costs for the company. Companies tend to invest in markets with inelastic demand (highly contagious diseases with no possibility of controlling transmission and/or very lethal diseases without treatment) and/or where there is a large population or high per capita income. Companies tend not to invest in markets where marginal costs exceed marginal income, particularly when costs increase permanently as a consequence of rising opportunity costs generated by foregoing profit in other markets. In such cases, policies to subsidize R&D are not effective, and policies must be orientated towards strengthening basic and applied research by public institutions.

  6. CSIR research, development and innovation initiatives for the medical device and diagnostic industry

    CSIR Research Space (South Africa)

    Vilakazi, Busisiwe

    2017-10-01

    Full Text Available This presentation is focused on development and innovation initiatives in the medical device and diagnostic industry. It is presented by Dr Busisiwe Vilakasi at The 6th CSIR Conference: Ideas that work for industrial development, 5-6 October 2017...

  7. Research, Commercialization, & Workforce Development in the Polymer/Electronics Recycling Industry

    Energy Technology Data Exchange (ETDEWEB)

    Carl Irwin; Rakesh Gupta; Richard Turton; GangaRao Hota; Cyril Logar; Tom Ponzurick; Buddy Graham; Walter Alcorn; Jeff Tucker

    2006-02-01

    The Mid-Atlantic Recycling Center for End-of-Life Electronics (MARCEE) was set up in 1999 in response to a call from Congressman Alan Mollohan, who had a strong interest in this subject. A consortium was put together which included the Polymer Alliance Zone (PAZ) of West Virginia, West Virginia University (WVU), DN American and Ecolibrium. The consortium developed a set of objectives and task plans, which included both the research issues of setting up facilities to demanufacture End-of-Life Electronics (EoLE), the economics of the demanufacturing process, and the infrastructure development necessary for a sustainable recycling industry to be established in West Virginia. This report discusses the work of the MARCEE Project Consortium from November 1999 through March 2005. While the body of the report is distributed in hard-copy form the Appendices are being distributed on CD's.

  8. Research advances in industrial engineering

    CERN Document Server

    2015-01-01

    This book provides discussions and the exchange of information on principles, strategies, models, techniques, methodologies and applications of industrial engineering. It communicates the latest developments and research activity on industrial engineering and is useful for all those interested in the technological challenges in the field.

  9. ACCELERATING CONSTRUCTION INDUSTRY DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    Mohan M. Kumaraswamy

    2006-06-01

    Full Text Available The needs for construction industry development are initially viewed from the broader perspectives of imperatives for infrastructure development and national development. All these are clearly more critical in developing countries. A non-exhaustive set of potential drivers and common barriers to construction industry development is identified from previous research. These suggest the usefulness of consolidating a cluster of recent proposals and exercises aiming at (a construction organization development in terms of an over-arching management support system model, as well as improved information and knowledge management; and (b project team development in the context of relationally integrated teams and supply chains, joint risk management and ‘technology and knowledge exchange’ in joint ventures, as well as longer term public private partnerships. These apparently disparate research thrusts are threaded together into a pattern that may inspire, if not feed, specific research and development (R & D agendas for construction industry development in different countries according to their own priorities, constraints and stages of infrastructure and national development.

  10. Research partnerships between business researchers and industry

    NARCIS (Netherlands)

    Zalewska-Kurek, Katarzyna; Janßen, Björn; Harms, Rainer

    2016-01-01

    We study the strategic behaviour of management researchers when establishing research partnerships with industry. To this end we developed a framework distinguishing ‘strategic planned’ and ‘opportunity-driven’ behaviour in the process of establishing and managing research partnerships. We also

  11. Therapeutic Ultrasound Research And Development From An Industrial And Commercial Perspective

    Science.gov (United States)

    Seip, Ralf

    2009-04-01

    The objective of this paper is to share the challenges and opportunities as viewed from an industrial and commercial perspective that one encounters when performing therapeutic ultrasound research, development, manufacturing, and sales activities. Research in therapeutic ultrasound has become an active field in the last decade, spurred by technological advances in the areas of transducer materials, control electronics, treatment monitoring techniques, an ever increasing number of clinical applications, and private and governmental funding opportunities. The development of devices and methods utilizing therapeutic ultrasound to cure or manage disease is being pursued by startup companies and large established companies alike, driven by the promise of profiting at many levels from this new and disruptive technology. Widespread penetration within the clinical community remains elusive, with current approaches focusing on very specific applications and niche markets. Challenges include difficulties in securing capital to develop the technology and undertake costly clinical trials, a regulatory landscape that varies from country to country, resistance from established practitioners, and difficulties in assembling a team with the right mix of technological savvy and business expertise. Success is possible and increasing, however, as evidenced by several companies, initiatives, and products with measurable benefits to the patient, clinician, and companies alike.

  12. Therapeutic Ultrasound Research And Development From An Industrial And Commercial Perspective

    International Nuclear Information System (INIS)

    Seip, Ralf

    2009-01-01

    The objective of this paper is to share the challenges and opportunities as viewed from an industrial and commercial perspective that one encounters when performing therapeutic ultrasound research, development, manufacturing, and sales activities. Research in therapeutic ultrasound has become an active field in the last decade, spurred by technological advances in the areas of transducer materials, control electronics, treatment monitoring techniques, an ever increasing number of clinical applications, and private and governmental funding opportunities. The development of devices and methods utilizing therapeutic ultrasound to cure or manage disease is being pursued by startup companies and large established companies alike, driven by the promise of profiting at many levels from this new and disruptive technology. Widespread penetration within the clinical community remains elusive, with current approaches focusing on very specific applications and niche markets. Challenges include difficulties in securing capital to develop the technology and undertake costly clinical trials, a regulatory landscape that varies from country to country, resistance from established practitioners, and difficulties in assembling a team with the right mix of technological savvy and business expertise. Success is possible and increasing, however, as evidenced by several companies, initiatives, and products with measurable benefits to the patient, clinician, and companies alike.

  13. A national laboratory/private industry cooperative research and development agreement (CRADA)

    International Nuclear Information System (INIS)

    Pritchard, D.A.

    1996-01-01

    This paper provides an overview of the history and process of establishing a cooperative research and development agreement (CRADA) between Sandia National Laboratories and Magnavox Electronic Systems Company for the design, development, and testing of a 360-degree scanning, imaging, intrusion detection sensor. The subject of the CRADA is the Advanced Exterior Sensor (AES). It is intended for exterior use at ranges from 50 to 1,500 meters and uses a combination of three sensing technologies (infrared, visible, and radar) and a new data processing method to provide low false-alarm intrusion detection and tracking combined with immediate visual assessment. The establishment of this CRADA represents a new paradigm in the cooperation between the Department of Defense, the Department of Energy, the National Laboratories and Private Industry. Although a formal document has now been executed, a CRADA is, nonetheless, primarily an agreement to work with each other to achieve goals that might otherwise be unattainable. For the DoD, a program continues in the face of uncertain funding. For the DOE, a CRADA is in place that meets congressionally mandated guidelines. For Sandia, sponsors are in agreement on requirements and synergistic funding. And for Magnavox, an opportunity is in hand to work with researchers in developing advanced security technology

  14. INNOVATIVE AND INDUSTRIAL-PERFORMANCE IN PHARMACEUTICAL RESEARCH-AND-DEVELOPMENT, A MANAGEMENT CONTROL PERSPECTIVE

    NARCIS (Netherlands)

    OMTA, SWF; BOUTER, LM; VANENGELEN, JML

    In this paper management control is related to innovative and industrial performance in 14 non-biotech pharmaceutical companies. The study consisted of questionnaires, sent to the heads of the different research departments of European research laboratories of leading pharmaceutical companies,

  15. The Research on International Development Path of China’s Marine Biopharmaceutical Industry

    Directory of Open Access Journals (Sweden)

    Xiu-Mei Fu

    2018-02-01

    Full Text Available Under the backdrop of the Maritime Silk Road Initiative, the study on the international development of China’s marine biopharmaceutical industry based on factor allocation is of great practical significance for industrial sustainability and building the industry into a leading international player in the global market. In this paper, we first identify the leading factors that influence the development of the marine biopharmaceutical industry, namely, resources, technologies, talents, investments and policies. Furthermore, the hierarchical structure model of these factors was established and analyzed using the analytic hierarchy process (AHP. The importance ranking of these constraints was identified, as follows: technologies > talents > resources > policies > investments. Then, based on the theory of comparative advantage and game theory, we analyzed the necessity of China’s marine biopharmaceutical industry going global, that is, international cooperation may lay a solid foundation for the win-win outcome of this industry in countries along the Maritime Silk Road. According to the status quo of China’s marine biopharmaceutical industry, based on these findings, an international factor–allocation cooperation path was designed, and the path chart of the international development of the marine biopharmaceutical industry was drawn. Finally, methods for the development of China’s marine biopharmaceutical industry were proposed, which covers efforts to protect marine resources, promote R&D for core technologies, establish a strong talent pool, encourage more investments, provide policy support and promote worldwide cooperation. It is the first report to investigate the path of the sustainable exploitation of the marine biopharmaceutical industry from the perspective of factor allocation amidst the backdrop of the Maritime Silk Road Initiative.

  16. Developing Research Skills for Undergraduate Business Students: Experiential Learning on Introduction to Personnel Administration and Industrial Relations Course

    Science.gov (United States)

    Figueroa, Carmen I.; González, Cándida

    2014-01-01

    This paper reports on research into developing research skills in human resources management of apprentices through experiential learning. The target groups were undergraduate business students registered in the Introduction to Personnel and Industrial Relations course. The research identified the appreciation level of importance and satisfaction…

  17. Intervention development in occupational research: an example from the printing industry.

    Science.gov (United States)

    Brown, T P; Rushton, L; Williams, H C; English, J S C

    2006-04-01

    Intervention development research is an essential prerequisite of any study that attempts to determine whether specific interventions work to prevent work related injury and illness. Focus groups (n = 5) and direct observational studies (n = 21) of printers were used to elicit key issues that would aid the development of subsequent interventions. Transcripts from these were analysed by standard qualitative methods to identify common and related themes. The views of managers differed significantly from those of print workers in a number of areas, and working practices did not always follow policy. The majority of printers did not perceive dermatitis to be a major problem, although many complained of dry hands. Other key results included: the lack of skin care policy in most companies; poor understanding of the nature, causes, and treatment of dermatitis; low priority of dermatitis within health and safety concerns; little or no provision of occupational health services, particularly skin checks; variability in provision of and access to appropriate skin protection; and lack of accessible washing facilities. As a result it was decided to evaluate the implementation of four provision of (1) skin checks and treatment advice; (2) gloves of the correct type and size, and use of an after-work cream; (3) information on dermatitis within the printing industry; and (4) development of best practice skin care policy.

  18. The National Nanotechnology Initiative: Research and Development Leading to a Revolution in Technology and Industry

    Science.gov (United States)

    2010-02-01

    dual-use deliveries to entice commercial interest at the earliest stages. NRO transition goals aim to create commercial “ pull ” to enable rapid... GOALI ), Partnerships for Innovation (PFI) , and Industry-University Cooperative Research Centers (IUCRC) • Partnership with small businesses and large

  19. Presentation of a Novel Model for Evaluation of Commercialization of Research and Development: Case Study of the Pharmaceutical Biotechnology Industry.

    Science.gov (United States)

    Emami, Hassan; Radfar, Reza

    2017-01-01

    The current situation in Iran suggests an appropriate basis for developing biotechnology industries, because the patents for the majority of hi-tech medicines registered in developed countries are ending. Biosimilar and technology-oriented companies which do not have patents will have the opportunity to enter the biosimilar market and move toward innovative initiatives. The present research proposed a model by which one can evaluate commercialization of achievements obtained from research with a focus on the pharmaceutical biotechnology industry. This is a descriptive-analytic study where mixed methodology is followed by a heuristic approach. The statistical population was pharmaceutical biotechnology experts at universities and research centers in Iran. Structural equations were employed in this research. The results indicate that there are three effective layers within commercialization in the proposed model. These are a general layer (factors associated with management, human capital, legal infrastructure, communication infrastructure, a technical and executive infrastructures, and financial factors), industrial layer (internal industrial factors and pharmaceutical industry factors), and a third layer that included national and international aspects. These layers comprise 6 domains, 21 indices, 41 dimensions, and 126 components. Compilation of these layers (general layer, industrial layer, and national and international aspects) can serve commercialization of research and development as an effective evaluation package.

  20. Localisation for industrial development

    CSIR Research Space (South Africa)

    Bhugwandin, Ashley

    2017-10-01

    Full Text Available This presentation focuses on localisation for industrial development, and is presented by Ashley Bhugwandin at The 6th CSIR Conference: Ideas that work for industrial development, 5-6 October 2017, CSIR International Convention Centre, Pretoria...

  1. Impact of Corporate Governance on Research and Development Investment in the Pharmaceutical Industry in South Korea.

    Science.gov (United States)

    Lee, Munjae

    2015-08-01

    The purpose of this study is to analyze the influence of the corporate governance of pharmaceutical companies on research and development (R&D) investment. The period of the empirical analysis is from 2000 to 2012. Financial statements and comments in general, and internal transactions were extracted from TS-2000 of the Korea Listed Company Association. Sample firms were those that belong to the medical substance and drug manufacturing industries. Ultimately, 786 firm-year data of 81 firms were included in the sample (unbalanced panel data). The shareholding ratio of major shareholders and foreigners turned out to have a statistically significant influence on R&D investment (p ratio of institutional investors and the ratio of outside directors. The higher the shareholding ratio of the major shareholders, the greater the R&D investment. There will be a need to establish (or switch to) a holding company structure. Holding companies can directly manage R&D in fields with high initial risks, and they can diversify these risks. The larger the number of foreign investors, the greater the R&D investment, indicating that foreigners directly or indirectly impose pressure on a manager to make R&D investments that bring long-term benefits.

  2. Strengthening industry-research linkage for small scale industrial ...

    African Journals Online (AJOL)

    Strengthening industry-research linkage for small scale industrial development in Ghana - the relevance of scientific and technological information. ... Journal of Applied Science and Technology. Journal Home · ABOUT · Advanced Search ...

  3. Integrating ergonomic aspects into research and development projects as a preventive strategy in the food industries

    DEFF Research Database (Denmark)

    Hansen, Iben Posniak; Broberg, Ole

    1997-01-01

    As part of a national research and development programme for food technology it was formulated as a demand to applicants to describe the potential ergonomics impact of the research and development (R&D) projects. As the primary purpose of the research programme was to strengthen the Danish food...

  4. Continuation of Research, Commercialization, and Workforce Development in the Polymer/Electronics Recycling Industry

    Energy Technology Data Exchange (ETDEWEB)

    Mel Croucher; Rakesh Gupta; Hota GangaRao; Darran Cairns; Jinzing Wang; Xiaodong Shi; Jason Linnell; Karen Facemyer; Doug Ritchie; Jeff Tucker

    2009-09-30

    The MARCEE Project was established to understand the problems associated with electronics recycling and to develop solutions that would allow an electronics recycling industry to emerge. While not all of the activities have been funded by MARCEE, but through private investment, they would not have occurred had the MARCEE Project not been undertaken. The problems tackled and the results obtained using MARCEE funds are discussed in detail in this report.

  5. An action research study of a leadership development programme in the hotel industry

    OpenAIRE

    Cooke, Hilary

    2016-01-01

    Many organisations view leadership as a feature of competitive advantage and competent leaders as instrumental in achieving organisational performance and productivity. \\ud \\ud In the hotel industry, there is a strong relationship between leadership culture and leader behaviour with employee satisfaction, loyalty, and productivity that has a subsequent impact on service quality, profitability and growth. Consequently, many hospitality organisations invest significantly in the development of t...

  6. Mass market development strategies of software industries: Case study based research

    Directory of Open Access Journals (Sweden)

    Varun Gupta

    2016-09-01

    Full Text Available The success in competitive mass market software development depends on the quality of software development and market segments targeted. Market segments are categorized by uncertainties contributed by “Newness” and “turbulences”, making the software success stochastic in nature. Selecting good market segments, delivering high quality software versions in the lowest time than competitors, result in increasing demand in markets and ultimately revenues. Enhanced customer base is beneficial for current product as well as for future products of industry in the form of increased reputation and increased involvement of customers in future development. The case study was conducted with 13 representatives drawing experiences of 14 mass market projects. Results indicate that software solutions are delivered to few investors or in highly competitive markets, as per the survey's findings of the marketing departments. The software organizations are reluctant to deliver relatively complex solutions in new markets unless and until strongly convinced with the probable success. The method for selection of market segments belonging to new and existing markets for undertaking the software delivery is also proposed in this paper. The model will help software industry decide the market segments and high abstract level features that could increase probability of software success. Poor selection of markets or targeting markets of “improper” size affects the market share of the industry to a great extend.

  7. Design research and industrial applicability

    DEFF Research Database (Denmark)

    Andreasen, Mogens Myrup

    1997-01-01

    Imprinted paper (copies of overheads in English) on the nature of design research, the transformation process for industrial utilization and the challenges of ENDREA from industry.......Imprinted paper (copies of overheads in English) on the nature of design research, the transformation process for industrial utilization and the challenges of ENDREA from industry....

  8. Research on the development strategy of Pingdingshan iron and steel industry cluster with Wugang Company as the core

    Directory of Open Access Journals (Sweden)

    Wang Shuai

    2017-01-01

    Full Text Available Arouse the great potential of the industrial clusters will play a significant role in promoting the development of local WuGang company. The article takes the Pingdingshan City as the research object, who is a typical resource-based city and develops on the basis of the local resources of coal and iron ore, the core enterprise WuGang Company is a large state-owned enterprise based on the wide and thick steel plate production. Many problems also exit in the cluster innovation, company network construction, company cooperation. The article is from the perspective of steel industry cluster and cluster innovation. Firstly, the article introduces the correlation theory about the steel industry cluster and the basic development information of Pingdingshan steel industry cluster, and promotes the research purpose and meaning.The article will give the analysis to the problems from the Pingdingshan steel industry cluster and develop the reform proposals and development strategy according to the actual situation.

  9. Forest industries energy research

    Energy Technology Data Exchange (ETDEWEB)

    Scott, G. C.

    1977-10-15

    Data on energy use in the manufacturing process of the wood products industry in 1974 are tabulated. The forest industries contributed 10% of New Zealand's factory production and consumed 25% of all industrial energy (including that produced from self-generated sources such as waste heat liquors and wood wastes) in that year. An evaluation of the potential for savings in process heat systems in existing production levels is shown to be 3% in the short, medium, and long-term time periods. The industry has a high potential for fuel substitution in all sectors. The payback periods for the implementation of the conservation measures are indicated.

  10. Eco-friendly Development Of Industry

    International Nuclear Information System (INIS)

    An, Gi Cheol; Park, Hun; Lee, Dong Jin; Ryu, Sang Hui

    1998-02-01

    This book reports eco-friendly development of industry, which has summary on bring up the issue and research way and system of research. It deals with current state of affairs on eco-friendly development of industry and the case of developed countries such as necessity and meaning of eco-friendly development industry, prospect and change of the tendency, environmental issue by field in Korea like the steel industry, nonferrous metal industry, auto industry, and cement industry and general policy for eco-friendly development of industry.

  11. Lunar Industry & Research Base Concept

    Science.gov (United States)

    Lysenko, J.; Kaliapin, M.; Osinovyy, G.

    2017-09-01

    Currently, all main space industry players, such as Europe, USA, Russia, China, etc., are looking back again at the idea of Moon exploration building there a manned lunar base. Alongside with other world spacefaring nations, Yuzhnoye State Design Office with its long-time development experience, technological and intellectual potential, organized its own conceptual work on development of the Lunar Industry & Research Base. In the frames of conceptual project "Lunar Industrial & Research Base" were formed its appearance, preliminary configuration and infrastructure at different stages of operation, trajectory and flight scheme to the Moon, as well as terms of the project's realization, and main technical characteristics of the systems under development, such as space transportation system for crew and cargo delivery to lunar surface and return to Earth, standardized designs of lunar modules, lunar surface vehicles, etc. The "Lunar Industrial & Research Base" project's preliminary risk assessment has shown a high value of its overall risk due to the lack of reliable information about the Moon, technical risks, long-term development of its elements, very high financial costs and dependence on state support. This points to the fact that it is reasonable to create such a global project in cooperation with other countries. International cooperation will expand the capabilities of any nation, reduce risks and increase the success probability of automated or manned space missions. It is necessary to create and bring into operation practical mechanisms for long-term space exploration on a global scale. One of the ways to do this is to create a multinational agency which would include both state enterprises and private companies.

  12. Technologies development for environmental restoration and waste management: International university and research institution and industry partnerships

    International Nuclear Information System (INIS)

    Herndon, R.C.; Moerlins, J.E.; Kuperberg, J.M.

    1996-01-01

    The Institute for Central and Eastern European Cooperative Environmental Research (ICEECER) at Florida State University was formed in 1990 soon after the end of the Cold War. ICEECER consists of a number of joint centers which link FSU, and US as well as international funding agencies, to academic and research institutions in Hungary, Poland, the Czech Republic, Russia, and the other countries of Central and Eastern Europe and the Newly Independent States. Areas of interest include risk assessment, toxicology, contaminated site remediation/characterization, waste management, emergency response, environmental technology development/demonstration/transfer, and some specialized areas of research (e.g., advanced chemical separations). Through ICEECER, numerous international conferences, symposia, training courses, and workshops have also been conducted on a variety of environmental topics. This paper summarizes the mission, structure, and administration of ICEECER and provides information on the projects conducted through this program at FSU

  13. Digital control in Finnish power industry applications and some research and development activities

    International Nuclear Information System (INIS)

    Haapanen, P.; Winter, M.

    1986-01-01

    First applications of digital control systems in Finnish power plants stem from a few years time. There are at present in operation two conventional peat fuelled district heating power plants and two others are under construction. In existing nuclear power plants digital control systems are not used. Feasibility studies of a new fifth nuclear power plant have been carried out and also preliminary design exercises on its control systems has been done. It seems that the use of a digital control system in this plant is an alternative worthy of consideration. The existing digital control applications and future plans for their use in the Finnish power industry are described. The rest of the paper is devoted to the reliability questions. Software reliability is a new problem area emanating from the use of programmable digital systems. A description of a cooperative project on these questions between VTT and OECD Halden Project is given. VTT has also developed an interactive computer program, RELVEC, for plant and control system reliability analysis. The structure and use of this system is described

  14. Geothermal industry position paper: EPA regulatory options and research and development information needs

    Energy Technology Data Exchange (ETDEWEB)

    D' Alessio, G.

    1977-08-01

    The environmental impact of geothermal energy development may be less intense or widespread than that of some other energy sources; however, it is the first example of a number of emerging energy technologies that must be dealt with by EPA. EPA may consider a spectrum of options ranging from a posutre of business as usual to one of immediate setting of standards, as favored by ERDA. The paper discusses the regulatory approaches and the potential problems that geothermal energy may present in the areas of air quality, water quality, and other impacts. It is recommended that a coordinated program of research be drawn up, comprised of specific research projects, the types of geothermal resource to which they apply, and the date by which the information is required.

  15. Geothermal Industry Position Paper: EPA Regulatory Options and Research and Development Information Needs

    Energy Technology Data Exchange (ETDEWEB)

    Swetnam, G.F.

    1976-11-01

    The environmental impact of geothermal energy development may be less intense or widespread than that of some other energy sources; however, it is the first example of a number of emerging energy technologies that must be dealt with by EPA. EPA may consider a spectrum of options ranging from a posture of business as usual to one of immediate setting of standards, as favored by ERDA. The paper discusses the regulatory approaches and the potential problems that geothermal energy may present in the areas of air quality, water quality, and other impacts. It is recommended that a coordinated program of research be drawn up, comprised of specific research projects, the types of geothermal resource to which they apply, and the date by which the information is required.

  16. Avenues for research and technology development for industrial applications using electron beam facilities and their exploitation through BRNS schemes

    International Nuclear Information System (INIS)

    Markandeya, S.G.

    2013-01-01

    BARC has been responsible to establish indigenously designed state-of-the-art electron accelerator facilities at its Electron Beam Centre at Kharghar, Navi Mumbai. The centre offers two versatile machines namely, (i) 3 MeV, 30 kW Parallel Coupled Self Capacitance type Multiplier (Dynamitron) DC accelerator and (ii) 10 MeV, 10 kW RF Electron Linac. While these machines are being used by scientists and engineers from within DAE, there is tremendous scope for exploiting their use by researchers in the country for basic research as well as by technologists and entrepreneurs for exploiting its potential for industrial applications. However, due to lack of adequate information about the facilities and due to paucity of research funds for the academia in the country, there is always a gap which researchers seldom look forward to be filled up appropriately. The present talk will give a glimpse of some opportunities to exploit the facilities at EBC, Kharghar for variety of applications followed by a brief presentation on provisions under BRNS to carry out sponsored research activities for basic research as well as for technology development for the industrial applications. (author)

  17. Progress of the research and development on the geological disposal technology of HLW with aid of the industry/university collaboration system and fixed term researcher system

    International Nuclear Information System (INIS)

    Yamada, Fumitaka; Sonobe, Hitoshi; Igarashi, Hiroshi

    2008-02-01

    In Japan Atomic Energy Agency (JAEA), various systems associated with the collaboration with industries and universities on the Nuclear Fuel Cycle and the Postdoctoral Fellow system, etc. are enacted. These systems have been operated considering the needs of JAEA's program, industry and academia, resultantly contributed, for example, to basic research and the project development. The activities under these collaboration systems contain personal exchanges, the publication of the accomplishments and utilization of those, in research and development concerning geological disposal technology of high-level radioactive waste (HLW). These activities have progressed in Power Reactor and Nuclear Fuel Development Corporation (PNC) and Japan Nuclear Cycle Development Institute (JNC), which are the successive predecessors of JAEA, through JAEA. The accomplishments from these systems have been not only published as papers in journals and individual technical reports but also integrated into the project reports, accordingly contributed to the advancement of the national program on the geological disposal of HLW. In this report, the progress of the research and development under these systems was investigated from the beginning of the operation of the systems. The contribution to the research and development on geological disposal technology of HLW was also studied. On the basis of these studies, the future utilization of the systems of the collaboration was also discussed from the view point of the management of research and development program. A CD-ROM is attached as an appendix. (J.P.N.)

  18. Development of a discussion document on the safety related research needs of the coal industry.

    CSIR Research Space (South Africa)

    Phillips, HR

    1994-03-01

    Full Text Available was prepared analysing accidents statistics for the South African coal mining industry for a ten year period to the end of 1992. This has recently been updated to include data to the end of 1993 and this analysis forms the first part of this report. The second...

  19. Recent Research and Development in Solving Atmospheric Corrosion Problems of Steel Industries in Japan

    International Nuclear Information System (INIS)

    Yamashita, M.; Uchida, H.

    2002-01-01

    A rust layer, so called 'protective' rust layer, on a weathering low-alloy steel has strong protective ability for atmospheric corrosion of the steel. We have recently found through a large number of spectroscopic studies including Moessbauer spectroscopy that the protective rust layer forms after long-term phase transformation. The phase and structure of the rust definitely control the protective ability of the rust layer. From this recent knowledge, some new technologies have been developed. One is the surface-treatment technique that provides a possibility for obtaining the protective rust layer in a relatively short period even in the severe environments such as in marine and chloride (de-icing salts) containing environments. Others are based on selection of effective alloying elements for steel materials. These are particularly important for application in areas where protective rust layer formation may be hindered or prevented. In this paper, we mention recent progress in research and development on rusting protection by rust for atmospheric corrosion of steels in Japan.

  20. Federal Research and Development Contract Trends and the Supporting Industrial Base, 2000-2014

    Science.gov (United States)

    2016-04-30

    Homeland Security, and government-wide services contracting trends; sourcing policy and cost estimation methodologies; and recent U.S. Army modernization ...been fears that the sharp downturn in federal contract obligations would disproportionately impact the R&D contracting portfolios within individual...329 - contracting portfolios , and the industrial base that supports those efforts, within each R&D contracting agency. The main finding of this

  1. Reports on research achievements in developing high-performance industrial furnaces in fiscal 1998 (Research and development of high-performance industrial furnaces). Volume 1; 1998 nendo koseino kogyoro nado ni kansuru kenkyu kaihatsu seika hokokusho. 1

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    From the reports on research achievements in developing high-performance industrial furnaces in fiscal 1998, the report volume 1 was prepared as a research achievement report of each working group, detailing fundamental researches, heating furnaces, and heat treatment furnaces. The fundamental researches have researched combustion evaluating technology, characteristics of the area in the vicinity of a combustor, characteristics of combustion of high-temperature air, heating characteristics of a furnace to investigate effect of local heat absorption, and combustion evaluation. For the heating furnaces, the following subjects were studied: development of an in-furnace combustion model, summary of an experiment for evaluating high-temperature air combustion, furnace height relative to combustion heat transfer characteristics, heat loss minimizing technology, combustion heat transfer characteristics of liquid fuels, optimal operation of the high-temperature air combustion, basic control in heating control, and steel piece heating control. Studies were performed for the heat treatment furnaces on the case of a direct firing furnace in evaluating the heat transfer characteristics, the case of a radiant tube furnace, application of thermal fluid simulation technology, furnace averaging technology, soot reducing technology, control technology, and trial design on a high-performance heat treatment furnace. (NEDO)

  2. Office of Industrial Technologies research in progress

    Energy Technology Data Exchange (ETDEWEB)

    1993-05-01

    The US Department of Energy (DOE) Office of Industrial Technologies (OIT) conducts research and development activities which focus on improving energy efficiency and providing for fuel flexibility within US industry in the area of industrial conservation. The mission of OIT is to increase the utilization of existing energy-efficient equipment and to find and promote new, cost-effective ways for industrial facilities to improve their energy efficiency and minimize waste products. To ensure advancement of the technological leadership of the United States and to improve the competitiveness of American industrial products in world markets, OIT works closely with industrial partners, the staffs of the national laboratories, and universities to identify research and development needs and to solve technological challenges. This report contains summaries of the currently active projects supported by the Office of Industrial Technologies.

  3. Recent developments: Industry briefs

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This is the February 1992 'Industry Briefs' portion of the 'Recent Developments' section. Issues mentioned are: (1) closure of San Onofre Unit 1, (2) start-up of Penly Unit 2, (3) signing of a safeguards agreement with North Korea, (4) Canadian nuclear activities in Romania, and (5) the merger of two Japanese fuel cycle companies

  4. Recent developments: Industry briefs

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This article is the 'Industry Briefs' portion of Nuexco's July 1992 'Recent Developments' section. Specific items mentioned include: (1) the merger of Entergy and Gulf States Utilities, (2) restart of the Sequoyah Fuels facility in Oklahoma, (3) development of the 7th and 8th nuclear units in Taiwan, (4) purchase of interest in Rio Algom, Ltd, and (5) acquisition of the Italian firm AGIP by a Canadian company

  5. Industry sponsorship and research outcome

    DEFF Research Database (Denmark)

    Lundh, Andreas; Sismondo, Sergio; Lexchin, Joel

    2012-01-01

    Clinical research affecting how doctors practice medicine is increasingly sponsored by companies that make drugs and medical devices. Previous systematic reviews have found that pharmaceutical industry sponsored studies are more often favorable to the sponsor's product compared with studies...

  6. Addressing Responsible Research and Innovation to Industry

    DEFF Research Database (Denmark)

    Yaghmaei, Emad

    2015-01-01

    Responsible research and innovation (RRI) is taking a role to assist all types of stakeholders including industry to move research and innovation initiatives to responsible manner for tackling grand challenges. The literature on RRI focuses little on how industry can implement RRI principles...... models of corporate social responsibility (CSR) literature. Drawing on these models, this study develops stages and dimensions of RRI for discussing why industry should become engaged in RRI, how industry can embed RRI principles into research and innovation processes, how companies progress from one RRI....... In solving such gap in the literature, this article constructs a solid framework that provides a conceptual starting point for future research on levels of RRI. It draws a fundamental path to align industrial activities with environmental and societal needs. The framework develops a normatively grounded...

  7. The development of computer industry and applications of its relevant techniques in nuclear research laboratories

    International Nuclear Information System (INIS)

    Dai Guiliang

    1988-01-01

    The increasing needs for computers in the area of nuclear science and technology are described. The current status of commerical availabe computer products of different scale in world market are briefly reviewed. A survey of some noticeable techniques is given from the view point of computer applications in nuclear science research laboratories

  8. Industrialized Information Systems Development

    DEFF Research Database (Denmark)

    Havn, Erling; Bansler, Jørgen P.

    1996-01-01

    The production of application software is rapidly being industrialized. Computer manufacturers and software houses produce a rapidly growing number of generic software applications and systems, and more and more user companies choose to build their computer-based information systems...... with such generic products, instead of custom made software. We discuss how the move away from traditional in-house development and the increasing use of generic software is likely to transform IS development in the near future. We conclude that these developments will make new demands on the information systems...

  9. Forum Notes: The 1999 environmental research and technology development forum for the upstream oil and gas industry

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-02-04

    This conference provided an opportunity to exchange information on current research and development projects regarding the environment and the petroleum industry. In addition to summaries of the various sessions, the booklet also includes a list of registrants and poster session participants. The conference was divided into the following three sessions: (1) site remediation, site restoration and groundwater, (2) ecological health, cumulative effects and agriculture, and (3) flaring, odour and greenhouse gas emissions. The session on site remediation heard papers that dealt with feedback on existing projects including soil quality guidelines for crude oil in agricultural soils, hydrophobicity, assessment of phytoremediation as an in-situ technique for cleaning sites polluted by oil, remediation using wetlands, land application of bioremediated soils, and flare pit characterization. The session on ecological health was treated to presentations describing research and development projects including the Eastern Slopes Grizzly Bear Project, the Native Prairie Revegetation Project, and the Caroline Livestock Study. The session on flaring and greenhouse gas emissions described research and development projects on dehydrator benzene emissions, monitoring of odour causing compounds, flare speciation, flare performance, improved liquid separation, alternate technologies, improved measurement of methane fugitive emissions from gas operations, and methane emissions from heavy oil operations.

  10. Forum Notes: The 1999 environmental research and technology development forum for the upstream oil and gas industry

    International Nuclear Information System (INIS)

    1999-01-01

    This conference provided an opportunity to exchange information on current research and development projects regarding the environment and the petroleum industry. In addition to summaries of the various sessions, the booklet also includes a list of registrants and poster session participants. The conference was divided into the following three sessions: (1) site remediation, site restoration and groundwater, (2) ecological health, cumulative effects and agriculture, and (3) flaring, odour and greenhouse gas emissions. The session on site remediation heard papers that dealt with feedback on existing projects including soil quality guidelines for crude oil in agricultural soils, hydrophobicity, assessment of phytoremediation as an in-situ technique for cleaning sites polluted by oil, remediation using wetlands, land application of bioremediated soils, and flare pit characterization. The session on ecological health was treated to presentations describing research and development projects including the Eastern Slopes Grizzly Bear Project, the Native Prairie Revegetation Project, and the Caroline Livestock Study. The session on flaring and greenhouse gas emissions described research and development projects on dehydrator benzene emissions, monitoring of odour causing compounds, flare speciation, flare performance, improved liquid separation, alternate technologies, improved measurement of methane fugitive emissions from gas operations, and methane emissions from heavy oil operations

  11. Empirical Research on Ecological Development Level of Resource-based Industries-Base on the data of the Silk Road Economic Belt Core Zone

    Science.gov (United States)

    Wang, Lei; Yan, Min

    2017-11-01

    Industrial ecology is the epitome of sustainable development in industry level, is one effective gateway to realizing green transformation. On the basis of industrial ecology development, including resource efficiency and environmental efficiency of ecological evaluation index system, this paper evaluates the level of industrial ecology development of resource-based industries in Xinjiang using entropy method. Research shows that the overall ecological development level of resource-based industries has remained at continuous improved trend with slow improvement in resource efficiency, and relative faster improvement in environmental efficiency. With economic development entering into the period of new normal at the end of the “twelfth five year plan”, the resource efficiency of ecological development of resource-based industries demonstrated a downward trend. The overall level of industrial ecology also faced with certain fluctuations, various ecological development level of resource-based industries also presented a downward trend. To promote ecological development of resource-based industries in Xinjiang, countermeasures and suggestions are initiated.

  12. The Determinants of Research and Development Investment in the Pharmaceutical Industry: Focus on Financial Structures

    OpenAIRE

    Lee, Munjae; Choi, Mankyu

    2015-01-01

    Objectives This study analyzes the influence of the financial structure of pharmaceutical companies on R&D investment to create a next-generation profit source or develop relatively cost-effective drugs to maximize enterprise value. Methods The period of the empirical analysis is from 2000 to 2012. Financial statements and comments in general and internal transactions were extracted from TS-2000 of the Korea Listed Company Association (KLCA), and data related to stock price is extracted from ...

  13. Government-industry-uUniversity and rResearch lLaboratories cCoordination for new product development: Session 2. Government research laboratory perspective

    International Nuclear Information System (INIS)

    Kuzay, T.M.

    1997-01-01

    This talk is the second in an expanded series of presentations on the Government-Industry-University and Research Laboratories Coordination for new product development, which is a timely and important public policy issue. Such interactions have become particularly timely in light of the present decline in funding for research and development (R ampersand D) in the nation''s budget and in the private sector. These interactions, at least in principle, provide a means to maximize benefits for the greater good of the nation by pooling the diminishing resources. National laboratories, which traditionally interacted closely with the universities in educational training, now are able to also participate closely with industry in joint R ampersand D thanks to a number of public laws legislated since the early 80s. A review of the experiences with such interactions at Argonne National Laboratory, which exemplifies the national laboratories, shows that, despite differences in their traditions and the missions, the national laboratory-industry-university triangle can work together

  14. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  15. Strategic research on the sustainable development cost of manufacturing industry under the background of carbon allowance and trade policy

    Science.gov (United States)

    Ma, Zhongmin; Cheng, Mengting; Wang, Mei

    2017-08-01

    The important subjects of energy consumption and carbon emission are manufacturing enterprises, with the deepening of international cooperation, and the implementation of carbon limit and trade policy, costs of manufacturing industry will rise sharply. How can the manufacturing industry survive in this reform, and it has to be a problem that the managers of the manufacturing industry need to solve. This paper analyses sustainable development cost connotation and value basis on the basis of sustainable development concept, discusses the influence of carbon allowance and trade policy for cost strategy of manufacturing industry, thinks that manufacturing industry should highlight social responsibility and realize maximization of social value, implement cost strategy the sustainable development, and pointed out the implementation way.

  16. National Nanotechnology Initiative. Research and Development Supporting the Next Industrial Revolution. Supplement to the President’s 2004 Budget

    Science.gov (United States)

    2004-01-01

    and Development Supporting the Next Industrial Revolution Supplement to the President’s FY 2004 Budget National Science and Technology Council...potential to profoundly change our economy, to improve our standard of living, and to bring about the next industrial revolution . Nanotechnology: From

  17. The Determinants of Research and Development Investment in the Pharmaceutical Industry: Focus on Financial Structures

    Science.gov (United States)

    Lee, Munjae; Choi, Mankyu

    2015-01-01

    Objectives This study analyzes the influence of the financial structure of pharmaceutical companies on R&D investment to create a next-generation profit source or develop relatively cost-effective drugs to maximize enterprise value. Methods The period of the empirical analysis is from 2000 to 2012. Financial statements and comments in general and internal transactions were extracted from TS-2000 of the Korea Listed Company Association (KLCA), and data related to stock price is extracted from KISVALUE-Ⅲ of NICE Information Service Co., Ltd. Stata 12.0 was used as the statistical package for panel analysis. Results The current ratio had a positive influence on R&D investment, the debt ratio had a negative influence on R&D investment, and return on investment and net sales growth rate did not have a significant influence on R&D investment. Conclusion It was found in this study that the higher liquidity ratio, the greater the R&D investment. The stability of pharmaceutical companies has a negative influence on R&D investment. This finding is consistent with the prediction that if a company faces a financial risk, it will be passive in R&D investment due to its financial difficulties. PMID:26730355

  18. The Determinants of Research and Development Investment in the Pharmaceutical Industry: Focus on Financial Structures.

    Science.gov (United States)

    Lee, Munjae; Choi, Mankyu

    2015-10-01

    This study analyzes the influence of the financial structure of pharmaceutical companies on R&D investment to create a next-generation profit source or develop relatively cost-effective drugs to maximize enterprise value. The period of the empirical analysis is from 2000 to 2012. Financial statements and comments in general and internal transactions were extracted from TS-2000 of the Korea Listed Company Association (KLCA), and data related to stock price is extracted from KISVALUE-Ⅲ of NICE Information Service Co., Ltd. Stata 12.0 was used as the statistical package for panel analysis. The current ratio had a positive influence on R&D investment, the debt ratio had a negative influence on R&D investment, and return on investment and net sales growth rate did not have a significant influence on R&D investment. It was found in this study that the higher liquidity ratio, the greater the R&D investment. The stability of pharmaceutical companies has a negative influence on R&D investment. This finding is consistent with the prediction that if a company faces a financial risk, it will be passive in R&D investment due to its financial difficulties.

  19. Industry sponsorship and research outcome

    DEFF Research Database (Denmark)

    Lundh, Andreas; Lexchin, Joel; Mintzes, Barbara

    2017-01-01

    BACKGROUND: Clinical research affecting how doctors practice medicine is increasingly sponsored by companies that make drugs and medical devices. Previous systematic reviews have found that pharmaceutical-industry sponsored studies are more often favorable to the sponsor's product compared...... on the association between sponsorship and research outcome. OBJECTIVES: To investigate whether industry sponsored drug and device studies have more favorable outcomes and differ in risk of bias, compared with studies having other sources of sponsorship. SEARCH METHODS: In this update we searched MEDLINE (2010......, systematic reviews and meta-analyses that quantitatively compared primary research studies of drugs or medical devices sponsored by industry with studies with other sources of sponsorship. We had no language restrictions. DATA COLLECTION AND ANALYSIS: Two assessors screened abstracts and identified...

  20. A lesson from Japan: research and development efficiency is a key element of pharmaceutical industry consolidation process.

    Science.gov (United States)

    Shimura, Hirohisa; Masuda, Sachiko; Kimura, Hiromichi

    2014-02-01

    Scholarly attention to pharmaceutical companies' ability to sustain research and development (R&D) productivity has increased as they increasingly handle business challenges. Furthermore, the deterioration of R&D productivity has long been considered a major cause of mergers and acquisitions (M&As). This study attempts to investigate quantitatively the possible causes of the deterioration and the relationship between the deterioration and M&As by examining the Japanese pharmaceutical industry. Japan from 1980 to 1997 is an ideal case because of the availability of official data, but more importantly the significant changes in its business environment at the time. Using the Malmquist Index and data envelopment analysis, we measured the deterioration of R&D productivity from 1980 to 1997 based on a sample of 15 Japanese companies. Two lessons can be learned from Japan's case. First, to sustain R&D productivity over the long term, companies should use licensing activities and focus on the dominant therapeutic franchises. Second, if a company fails significantly to catch up with the benchmark, it is likely to pursue an M&A or seek an alternative way to improve R&D productivity. These findings appear similar to the current situation of the global pharmaceutical industry, although Japan pursued more licensing activities than M&A to improve R&D productivity.

  1. Knowledge sharing in industrial research

    NARCIS (Netherlands)

    Berends, J.J.

    2003-01-01

    Over the past decade, the field of organization studies has increasingly focused on knowledge and knowledge processes in organizations. This thesis describes a study of one of those processes, knowledge sharing, in the context of industrial research. Though the attention for knowledge in

  2. Special number issued in commemoration of 10th anniversary of NEDO's industrial technology research and development department; NEDO sangyo gijutsu kenkyu kaihatsu bumon 10 shunenshi

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-09-01

    This special number is issued in commemoration of 10th anniversary of NEDO's industrial technology research and development department, to look back its R and D activity results and help the future projects. This department was established in 1988, based on the Law of Establishment of the Industrial Technology Research and Development System, and started its activities as the central institute for positively promoting the R and D of the industrial technologies, centered by the basic and advanced areas, while in closely cooperation with oversea institutes. During this period, the department has been pursuing various projects, including large-scale industrial technology R and D projects transferred from the Agency of Industrial Science and Technology; R and D projects for technologies for the industrial bases of the next generation and medical/welfare equipment technologies; projects for assistance to international cooperative research teams; projects for establishing facilities as research bases necessary for promoting R and D of advanced industrial technologies; and, more recently, projects for establishing measures to cope with global environmental problems. NEDO has been playing a role of managing and controlling various large-size R and D projects, both in name and reality, taking over the projects which had been promoted by the Agency of Industrial Science and Technology. This special number outlines the R and D projects NEDO has pursued in the past 10 years. (NEDO)

  3. Superconducting analogue electronics for research and industry

    International Nuclear Information System (INIS)

    Winkler, D

    2003-01-01

    This paper gives a brief review of superconducting electronics in research and industry. Examples will show how science benefits from the development and how superconducting devices have found their way into industry and to some commercial products. Impact in terms of enabling new research in other fields (e.g. radio astronomy, medicine), in industry (certification, safety, metrology, etc) and in terms of market will be addressed. From the examples, two fields will be emphasized: superconducting detectors for astronomy and the superconducting quantum interference devices (SQUIDs) employed for different applications

  4. Research and chemical industry in 90's

    International Nuclear Information System (INIS)

    Trapasso, I.

    1992-01-01

    This paper examines the importance of research with respect to changes taking place within the chemical industry. Specific areas having a significant impact on the future evolution of the industry are identified. The chemical industry is highly R ampersand D intensive with respect to its overall sales volume, as well as, to R ampersand D levels in other industries; and R ampersand D has been a dominant factor influencing the restructuring, on a global scale, of this industry. In the 90's, the industry is expected to have a supply model which is based on the production of marketable high-technology products and integrated systems, developed through coordinated research in multi-disciplinary scientific fields. The optimum strategic and organizational strategies which are to be adopted by the industry during this decade are discussed with reference to the directions being taken by a large multi-national firm in developing strategies in various areas, e.g., new prime materials, environmental protection, pharmacology, and biotechnology. A look is given at recent developments in the sector of advanced polymers, with attention given to processes involving polymer genetics, new products with a wide range of applications and those offering a high level of environmental compatibility. A review of new materials development includes an assessment of prospects for biodegradable plastics based on natural carbohydrates

  5. Scenario research: The food industry in 2010

    DEFF Research Database (Denmark)

    Stacey, Julia; Sonne, Anne-Mette; Jensen, Birger Boutrup

    2001-01-01

    What kind of foods will the consumers choose to buy in 2010? Will they be buying organic foods, functional foods or go for the cheapest products? Nobody can predict the future. However, by using scenario techniques qualified indications on future developments can be put together. Researchers...... at MAPP and the Department of Manufacturing Engineering and Management, The Technical University of Denmark have constructed three scenarios about the Danish food industry in 2010. The aim has been to identify the demands the food industry can expect to meet in the future plus which research areas...... the public research should prioritise in order to support the development of competences within the food industry. The scenarios are isolated developments. In practise, the future is likely to be a combination of the different tendencies within the scenarios. The first scenario 'Naturalness' has focus...

  6. Social capital for industrial development: operationalizing the concept

    NARCIS (Netherlands)

    P. Knorringa (Peter); I.P. van Staveren (Irene)

    2006-01-01

    textabstractThe present report on Social capital for industrial development: operationalizing the concept is part of the broader Combating Marginalization and Poverty through Industrial Development (COMPID), research programme of the United Nations Industrial Development Organization (UNIDO),

  7. Eastern Canada offshore report/Nordco (Newfoundland Ocean Research and Development Corp. Ltd. ) offers technical expertise to industry through applied R and D (research and development)

    Energy Technology Data Exchange (ETDEWEB)

    Jones, G

    1979-07-02

    Nordco's role in offshore R and D emphasizes aspects dealing with sea ice, icebergs, oceanography, including the possible movements of pollutants in an estuary in Labrador, submarine geology, meteorology, and remote sensing, and their impact on the Newfoundland petroleum and fishing industries. Its marine transportation division, with the Bedford Institute of Oceanography, has been studying the possible use of LORAN-C as a navigation aid for offshore eastern Canada, and has been researching ice-caused problems in the Bridport Inlet area, where a northern LNG terminal is planned on Melville Island, and icebreaking techniques, Arctic navigation, and oil and LNG transport. Nordco has also been cooperating with the Geonautics Ltd. consortium, which is involved in pipeline and cable routing and other studies. According to G. Jones (Nordco), the Eastcoast Petroleum Operators Association has also been studying offshore problems, and has set up a project to provide $2 million for oil spill equipment and dispersants where needed. This project is operated by Esso Resources Canada Ltd. and involves eight to ten participants.

  8. Quantitative phase analysis in industrial research

    International Nuclear Information System (INIS)

    Ahmad Monshi

    1996-01-01

    X-Ray Diffraction (XRD) is the only technique able to identify phase and all the other analytical techniques give information about the elements. Quantitative phase analysis of minerals and industrial products is logically the next step after a qualitative examination and is of great importance in industrial research. Since the application of XRD in industry, early in this century, workers were trying to develop quantitative XRD methods. In this paper some of the important methods are briefly discussed and partly compared. These methods are Internal Standard, Known Additions, Double Dilution, External Standard, Direct Comparison, Diffraction Absorption and Ratio of Slopes

  9. Prospect of French industrial technology research and development under President Chirac`s political power; Shiraku seikenka ni okeru Futsu sangyo gijutsu kenkyu kaihatsu seisaku no mitoshi

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-02-01

    This paper describes a prospect of French industrial technology research and development under President Chirac`s political power. The research and development in France is characterized by the national leadership. It depends greatly on the system and organization as well as the economical factors. The policy concentrates on the reformation of development organization rather than the research and development itself. It is required to provide the cultural and social tradition and environment that can bring up people bearing it, the system that can supply the methods of research and development, and the force of technology and market development that can industrialize and commercialize its results. The national leadership in France basically relates to all of these three factors. The actors of framework for the financing and enforcement of research and development are illustrated in a scheme by dividing them into government and companies. The actors for the enforcement of research and development are also divided into governmental public organizations and companies. This paper also provides the defense development in the private companies having a large finance of research and development from the government. The finance of research and development for public welfare from the government is roughly divided into the large-scale projects with determined usage by the government, and the supports for proposals by the companies. 13 refs., 4 figs., 40 tabs.

  10. Chemical process research and development in the 21st century: challenges, strategies, and solutions from a pharmaceutical industry perspective.

    Science.gov (United States)

    Federsel, Hans-Jürgen

    2009-05-19

    In process research and development (PR&D), the generation and manipulation of small-molecule drugs ranges from bench-scale (laboratory) chemistry to pilot plant manufacture to commercial production. A broad range of disciplines, including process chemistry (organic synthesis), analytical chemistry, process engineering (mass and heat transfer, unit operations), process safety (chemical risk assessment), regulatory compliance, and plant operation, must be effectively applied. In the critical handover between medicinal chemistry and PR&D, compound production is typically scaled up from a few hundred grams to several kilograms. Can the methodologies applied to the former also satisfy the technical, safety, and scalability aspects that come into play in the latter? Occasionally, the transition might occur smoothly, but more often the situation is the opposite: much work and resources must be invested to design a process that is feasible for manufacturing on pilot scale and, eventually, for commercial production. Authentic examples provide enlightening illustrations of dos and don'ts for developing syntheses designed for round-flask operation into production-scale processes. Factors that are easily underestimated or even neglected in the laboratory, such as method robustness, chemical hazards, safety concerns, environmental impact, availability of starting materials and building blocks in bulk quantities, intellectual property (IP) issues, and the final cost of the product, will come into play and need to be addressed appropriately. The decision on which route will be the best for further development is a crucial event and should come into focus early on the R&D timeline. In addition to scientific and technical concerns, the parameter of speed has come to the forefront in the pharmaceutical arena. Although historically the drug industry has tolerated a total time investment of far more than 10 years from idea to market, the current worldwide paradigm requires a

  11. Research and development of basic technologies for the next generation industries, 'recombinant DNA utilizing technology'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'kumikae DNA riyo gijutsu'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to the recombinant DNA utilizing technology to create new microorganisms for processes in the chemical industry. The major achievements of the present research and development include establishment of the P450 gene manifestation system attributed from microsomes and mitochondria, and the success of the world's first simultaneous manifestation of P450 and reduction enzyme. Furthermore, the fused enzyme combining P450 and the reduction enzyme genetically was successfully manufactured ahead of the other countries, opening the way to industrializing the recombinant enzymes for use in bio-processes in the chemical industry. In creating a high-efficiency secretion recombinant bacillus subtilis stock, a bacillus subtilis host whose protease activity has been noticeably decreased was created. As an achievement of the research on the 'basic recombinant DNA technology', high-efficiency manifestation vector of medium level thermophile was created, and its usefulness was demonstrated. In addition, a host and vector system for high level thermophile was developed for the first time in the world. These achievements have opened the way to industrial utilization of the thermophilic bacteria. (NEDO)

  12. INDUSTRIAL TECHNOLOGICAL RESEARCH «DEVELOPMENT OF RUSSIAN MARKET OF NANOTECHNOLOGICAL PRODUCTS IN CONSTRUCTION UNTIL 2020». PART 2. ANALYSIS OF THE WORLD MARKET

    Directory of Open Access Journals (Sweden)

    GUSEV Boris Vladimirovich

    2013-04-01

    Full Text Available Some results of the industrial research «Development of Russian market of nanotechnological products in construction until 2020» have been published. Authors invite all interested specialists and specialized organization to take part in the broad public discussion.

  13. OCP TECD Report - TARDEC Blast Mitigation Program (BMP) and National Defense Industrial Association (NDIA) Michigan (MI) Chapter Cooperative Research and Development Agreement (CRADA) Summary

    Science.gov (United States)

    2017-09-26

    Standard, MIL-STD-3058, Occupant-Centric Protection for Military Ground Vehicles. 15. SUBJECT TERMS Occupant Centric Platform Technology-Enabled...Capability Demonstration (OCP TECD), Occupant-centric, Occupant Protection , Underbody Blast, National Defense Industrial Association (NDIA...Cooperative Research and Development Agreement (CRADA) 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF

  14. Washington State Biofuels Industry Development

    Energy Technology Data Exchange (ETDEWEB)

    Gustafson, Richard [Univ. of Washington, Seattle, WA (United States)

    2017-04-09

    The funding from this research grant enabled us to design, renovate, and equip laboratories to support University of Washington biofuels research program. The research that is being done with the equipment from this grant will facilitate the establishment of a biofuels industry in the Pacific Northwest and enable the University of Washington to launch a substantial biofuels and bio-based product research program.

  15. Recent developments: Industry briefs

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    Recent nuclear industry briefs are presented. These briefs include: Swiss voters reject phaseout; EdF confirms order for Civaux 1; NDP surprise victor in Ontario; Czechoslovakia joins Foratom; Poland abandons Zarnowiec; Cogema's UP3 facility operationa; Wismut to clsoe mining operations; court rules in favor of US government in Yucca Mountain waste site; Italian government ratifies ENEL reactor shutdowns; and Seabrook enters commercial operation

  16. Research report for fiscal 1998. Researches on the history and inheritance of industrial technologies (Researches of domestic industrial technologies that greatly contributed to the development of industry); 1998 nendo chosa hokokusho. Sangyo gijutsu rekishi keisho chosa (sangyo no hatten ni okiku kiyoshita kokunai sangyo gijutsu no chosa hen)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    As the contribution increases of Japan's industrial technologies to the development of scientific and economic activities in Japan and abroad, it is of paramount importance to clarify the significance as seen from the historical point of view and to utilize the achievement for the development of Japan's industrial technologies in the future. Researches are conducted into some processes of Japanese origin now enjoying high evaluation as global achievements are reviewed, which involve the separation and purification of butadiene, production of concentrated nitric acid, disproportionation of toluene, polymerization of vinyl chloride in a large reactor, development and practical application of lithium ion secondary batteries, and the enzymatic production of the D-amino acid. As examples of development of chemical technologies, furthermore, researches are undertaken into the ammonia synthesizing technology, production of resorcinol, and coal liquefaction. Also reviewed are data on the history of industries accommodated in museums, and numerous articles of scientific literature written in the period of Shogunate-end through Meiji-beginning to constitute the foundation on which Japan's scientific technologies would make rapid progress. The result gives suggestions for opening a new way toward creative and unique technologies. (NEDO)

  17. Recent developments: Industry briefs

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The January 1992 Industry Briefs includes brief articles on: (1) the startup of Chinese and Indian nuclear units, (2) agreements between China and Pakistan for the construction of a nuclear unit, (3) international safeguards agreements, (4) restart of a nuclear unit in Armenia, (5) closure of a German nuclear waste site, (6) restructuring of the Hungarian state-owned utility MVMT, (7) requests for bids for Wolsong Units 3 and 4, (8) signing of the European Energy charter, (9) continued operation of the MAGNOX reactors, and (10) changing Canadian requirements on uranium

  18. Construction industry in developing countries

    Energy Technology Data Exchange (ETDEWEB)

    Moavenzadeh, F

    1978-01-01

    This paper provides a review of the construction capability available in the developing countries to meet the demand for shelter. It discusses the role of construction in the process of development and its importance to economic growth. It considers the issue facing the growth of a viable indigenous construction industry in the developing world within the context of the activities involved in the creation of constructed facilities--planning, design, contruction and maintenance; it also examines the environment within which the industry has developed. For each construction activity the paper reviews available capabilities, the various resources needed for the development of an indigenous industry, and some possible means of accommodating these needs.

  19. Research on the recycling industry development model for typical exterior plastic components of end-of-life passenger vehicle based on the SWOT method.

    Science.gov (United States)

    Zhang, Hongshen; Chen, Ming

    2013-11-01

    In-depth studies on the recycling of typical automotive exterior plastic parts are significant and beneficial for environmental protection, energy conservation, and sustainable development of China. In the current study, several methods were used to analyze the recycling industry model for typical exterior parts of passenger vehicles in China. The strengths, weaknesses, opportunities, and challenges of the current recycling industry for typical exterior parts of passenger vehicles were analyzed comprehensively based on the SWOT method. The internal factor evaluation matrix and external factor evaluation matrix were used to evaluate the internal and external factors of the recycling industry. The recycling industry was found to respond well to all the factors and it was found to face good developing opportunities. Then, the cross-link strategies analysis for the typical exterior parts of the passenger car industry of China was conducted based on the SWOT analysis strategies and established SWOT matrix. Finally, based on the aforementioned research, the recycling industry model led by automobile manufacturers was promoted. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Cooperative Research and Development Agreements (CRADA) with Industry as a Value Enhancing Asset in the Academic/Research Environment. A Case Study at the Naval Postgraduate School (NPS)

    National Research Council Canada - National Science Library

    Ferraris, Guillermo L

    2005-01-01

    .... Although not technically a research laboratory, the Naval Postgraduate School (NPS) is a federally funded research university that has developed an extensive sponsored program of Technology Transfer (T2...

  1. Rural development policy and food industry development

    DEFF Research Database (Denmark)

    Baker, Derek; Abildtrup, Jens; Hedetoft, Anders

    2007-01-01

    Food industry firms in remote areas face a set of constraints, which have motivated the form and function of assistance instruments under various regional and rural development programmes. Recent food industry developments present new challenges to these firms, for which available assistance may...... be less appropriate. This paper employs telephone interviews and workshop discussions with firms in isolated locations to investigate their satisfaction with assistance programmes, their ability to innovate (through product introductions) and respond to challenges in the food industry (the emergence...

  2. Review: 1991 industry developments

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This is NUEXCO's annual summary of the previous year's (1991) events. There are reviews of major nuclear developments in each continent, as well as international developments. Specific topics include fuels, waste management, new facilities, and decommissioning. Nuclear activities in the following countries are noted: South Africa, Yemen, Lithuania, Latvia, Estonia, Namibia, France, Japan, Taiwan, China, Korea, India, Pakistan, Federal Republic of Germany, Spain, Hungary, Kazakhstan, Italy, Czechoslovakia, United Kingdom, Switzerland, Canada, USA, Argentina, Brazil, and Uraguay

  3. Scenario research: The food industry in 2010

    OpenAIRE

    Stacey, Julia; Sonne, Anne-Mette; Jensen, Birger Boutrup

    2001-01-01

    What kind of foods will the consumers choose to buy in 2010? Will they be buying organic foods, functional foods or go for the cheapest products? Nobody can predict the future. However, by using scenario techniques qualified indications on future developments can be put together. Researchers at MAPP and the Department of Manufacturing Engineering and Management, The Technical University of Denmark have constructed three scenarios about the Danish food industry in 2010. The aim has been to ide...

  4. GAS INDUSTRY GROUNDWATER RESEARCH PROGRAM

    Energy Technology Data Exchange (ETDEWEB)

    James A. Sorensen; John R. Gallagher; Steven B. Hawthorne; Ted R. Aulich

    2000-10-01

    The objective of the research described in this report was to provide data and insights that will enable the natural gas industry to (1) significantly improve the assessment of subsurface glycol-related contamination at sites where it is known or suspected to have occurred and (2) make scientifically valid decisions concerning the management and/or remediation of that contamination. The described research was focused on subsurface transport and fate issues related to triethylene glycol (TEG), diethylene glycol (DEG), and ethylene glycol (EG). TEG and DEG were selected for examination because they are used in a vast majority of gas dehydration units, and EG was chosen because it is currently under regulatory scrutiny as a drinking water pollutant. Because benzene, toluene, ethylbenzene, and xylenes (collectively referred to as BTEX) compounds are often very closely associated with glycols used in dehydration processes, the research necessarily included assessing cocontaminant effects on waste mobility and biodegradation. BTEX hydrocarbons are relatively water-soluble and, because of their toxicity, are of regulatory concern. Although numerous studies have investigated the fate of BTEX, and significant evidence exists to indicate the potential biodegradability of BTEX in both aerobic and anaerobic environments (Kazumi and others, 1997; Krumholz and others, 1996; Lovely and others, 1995; Gibson and Subramanian, 1984), relatively few investigations have convincingly demonstrated in situ biodegradation of these hydrocarbons (Gieg and others, 1999), and less work has been done on investigating the fate of BTEX species in combination with miscible glycols. To achieve the research objectives, laboratory studies were conducted to (1) characterize glycol related dehydration wastes, with emphasis on identification and quantitation of coconstituent organics associated with TEG and EG wastes obtained from dehydration units located in the United States and Canada, (2) evaluate

  5. Measurement Method and Empirical Research on the Sustainable Development Capability of a Regional Industrial System Based on Ecological Niche Theory in China

    Directory of Open Access Journals (Sweden)

    Hang Yin

    2014-11-01

    Full Text Available From the analytical view of a recycling economy, the regional system achieves the goal of sustainable development through improving resource utilization efficiency, reducing energy consumption and ameliorating the quality of water and air. The regional economic system’s potential for sustainable development is significantly influenced by regional industrial operational efficiency, which measures the cost of ecology, environment, energy and resources accompanying the economic growth. It is vital for national and regional governments to accelerate harmonious development between products of industrial department, consumption of energy and pollutants discharged. Under the guidance of ecological niche theory and recycling economy theory, the theoretical analysis on efficient relations between regional industrial growth, energy consumption, resources utilization and environmental carrying capacity has been carried out from horizontal and vertical respects. Industrial operational efficiency and the sensitivity coefficient in response to the change of every input and output index can be calculated and critical factors, which restrict sustainable development capability, can be found out so that quantitative references could be provided for administrative decisions. As for the measurement method, a super efficiency mixed data envelopment analysis model, which wipes off self-limited condition and either contains both meeting cone characteristic indexes or not, has been established and applied. Statistics from 1993 to 2012 in China are collected to carry out empirical research. On the basis of further analysis, an adjustment strategy can be constituted to improve the capability for sustainable development.

  6. What do pharmaceutical industry professionals in Europe believe about involving patients and the public in research and development of medicines? A qualitative interview study.

    Science.gov (United States)

    Parsons, Suzanne; Starling, Bella; Mullan-Jensen, Christine; Tham, Su-Gwan; Warner, Kay; Wever, Kim

    2016-01-07

    To explore European-based pharmaceutical industry professionals' beliefs about patient and public involvement (PPI) in medicines research and development (R&D). Pharmaceutical companies in the UK, Poland and Spain. 21 pharmaceutical industry professionals, four based in the UK, five with pan-European roles, four based in Spain and eight based in Poland. Qualitative interview study (telephone and face-to-face, semistructured interviews). All interviews were audio taped, translated (where appropriate) and transcribed for analysis using the Framework approach. 21 pharmaceutical industry professionals participated. Key themes were: beliefs about (1) whether patients and the public should be involved in medicines R&D; (2) the barriers and facilitators to PPI in medicines R&D and (3) how the current relationships between the pharmaceutical industry, patient organisations and patients influence PPI in medicines R&D. Although interviewees appeared positive about PPI, many were uncertain about when, how and which patients to involve. Patients and the public's lack of knowledge and interest in medicines R&D, and the pharmaceutical industry's lack of knowledge, interest and receptivity to PPI were believed to be key challenges to increasing PPI. Interviewees also believed that relationships between the pharmaceutical industry, patient organisations, patients and the public needed to change to facilitate PPI in medicines R&D. Existing pharmaceutical industry codes of practice and negative media reporting of the pharmaceutical industry were also seen as negative influences on these relationships. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  7. Research on Risks and Forecasting Countermeasures of Hainan Banana Industry

    OpenAIRE

    Liu, Yan-qun; Zeng, Xiao-hong; Fang, Jia

    2011-01-01

    Based on the overviews of the current conditions of Hainan banana industry, the research makes an analysis of the risks faced by Hainan banana industry. They are respectively marketing risks, natural risks, information risks and production risks. In order to promote a sustainable and rapid development of Hainan banana industry, Countermeasures are proposed in the research. The first is to strengthen the leading organization of forecasting mechanisms on banana industry. The second is to establ...

  8. Research and development

    Energy Technology Data Exchange (ETDEWEB)

    Harlow, Jr, J G

    1977-09-01

    The need for increased research and development programs to provide technological advances to meet future energy demands, particularly electric power demands, is discussed. It is concluded that the future energy needs of the world can only be supplied through technological improvements. The cost of these technological improvements can be minimized by cooperative, unified research and development programs. The financial support of the energy industry, the equipment manufacturing industry and the consumer will be required to finance these vital developments. The energy problems of the world can be solved by an adequately financed unified R and D effort. The U.S. must assume a major role of leadership in this world-wide effort. (LCL)

  9. Innovation, Procurement and Construction Industry Development

    Directory of Open Access Journals (Sweden)

    Geard de Valence

    2010-12-01

    Full Text Available The implications for analysis of innovation in construction of theoretical developments in industrial organisation are considered in this research, as an attempt to outline a new approach to construction innovation incorporating the ideas found in knowledge based, technology centred models. The paper firstly summarises characteristics of the construction industry, focusing on their effects on innovation, before surveying some of the ideas about the sources of innovation and the expansion and application of knowledge. Construction can be seen as an industry with limited scope for knowledge externalities, where the procurement methods used by the industry’s clients do not pay for innovation. The following discussion uses recent developments in the research on the economics of innovation and industrial organization theory, such as research intensity and the endogenous sunk costs in competitive, fragmented, low research intensity industries. The effects on R&D of procurement methods and on industry structure are discussed, with a focus on the appropriability of innovations and the role of the client on the Heathrow Terminal 5 project. The paper concludes that the procurement methods used for building and construction projects appears to be a determining factor in the level of innovation in the construction industry

  10. Isotopes in research and industry

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1961-01-15

    A comprehensive review of the present state of the use of radioisotopes in the physical sciences and industry was made at a major international conference in Copenhagen from 6 to 16 September 1960. The conference covers the use of radioisotopes in geophysics, metallurgy, solid state physics and nuclear physics, industrial applications of radioisotopes, which were divided into two groups, namely applications based on the tracer function of isotopes and those based on the penetration, absorption or scattering of radiation, use of isotopes in various branches of chemistry - from analysis to determine extremely small amounts of material to a study of the mechanism of various chemical reactions.

  11. Industrial research enhancement program at the National Synchrotron Light Source

    International Nuclear Information System (INIS)

    Wang Jun; Nasta, Kathleen; Kao, Chi-Chang

    2011-01-01

    Industrial research has attracted more and more attention recently at synchrotron facilities. Bringing the state-of-the-art research capabilities provided by these facilities to the industrial user community will help this community to improve their products and processing methods, to foster competition and build the economy. The National Synchrotron Light Source (NSLS) has a long and celebrated history in research partnerships with industry since its inception more than 25 years ago, and both industry and the facility have benefited tremendously from these partnerships. Over the years, the ways in which industrial research is conducted at synchrotron facilities have evolved significantly, and a new paradigm of collaboration between industry and facilities is clearly needed to address this changing situation. In this presentation, the discussion will focus on an enhancement plan recently implemented at the NSLS to address industrial users' concerns and needs. The goal of NSLS Industrial Program Enhancement plan is to encourage greater use of synchrotron tools by industry researchers, improve access to NSLS beamlines by industrial researchers and facilitate research collaborations between industrial researchers and NSLS staff as well as researchers from university and government laboratories. Examples of recent developments in these areas will be presented.

  12. Research and development project in fiscal 1988 for fundamental technologies for next generation industries. Achievement report on research and development on high-efficiency polymer separating film materials; 1988 nendo kokoritsu kobunshi bunrimaku zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    In order to achieve improvements in efficiency and energy conservation in the separating processes used in the chemical industries, research and development has been performed on liquid separating films, air separating films, and their related technologies. This paper summarizes the achievement in fiscal 1988. In the research of high-level molecule recognizing film in the air selecting and separating films, researches were made on the elementary technologies for the mechanism of reaction of O{sub 2} carrier with O{sub 2}, reversible reactivity of CO carrier with CO, and carrier fixation. In the research of high-density metallic complex fixing thin films, investigations were made on the oxygen affinity and temperature characteristics of active type CoVPH complex involved in carrier transportation in the polymeric complex interface film. In the research of high-function complex films, development was performed on a new carrier that can be dispersed stably and finely without making association even under high concentrations. Conditions for compounding into hollow fibers were discussed, and the film forming conditions for composite films having no pinholes were discovered. With regard to the liquid selecting and separating films, researches were made on the alcohol condensing film, water-polar organics separating fluorine-based polymer film, structural control on water selective permeation film, and water-acetic acid separating film. (NEDO)

  13. The future of scientific, technical and industrial information to Third World users - A donors view. The experience of the International Development Research Centre (IDRC), Canada

    International Nuclear Information System (INIS)

    Broadbent, K.P.; Lafond, R.

    1990-05-01

    Access to scientific information by poorer countries, sometimes referred to as the ''South'', is limited in contrast to the countries in the ''North''. The South lacks the infrastructure, management and technical expertise to develop and support the range of services now commonplace in the information rich industrial countries of the ''North''. The programme of support to information systems and services in poorer countries by the International Development Research Centre (IDRC) is described with specific examples drawn from its industry and technology information programme. Third world countries are in a difficult position and need help to keep on the cutting edge of new information-communication technologies. Any help, however must focus on such factors as persistence, impact and sustainability of information systems and services. (author). 5 refs

  14. The future of scientific, technical and industrial information to Third World users - A donors view. The experience of the International Development Research Centre (IDRC), Canada

    Energy Technology Data Exchange (ETDEWEB)

    Broadbent, K P [International Development Research Centre, Ottawa (Canada). Science and Technology Information; Lafond, R [International Development Research Centre, Ottawa (Canada). Industry and Technology Programme

    1990-05-01

    Access to scientific information by poorer countries, sometimes referred to as the ``South``, is limited in contrast to the countries in the ``North``. The South lacks the infrastructure, management and technical expertise to develop and support the range of services now commonplace in the information rich industrial countries of the ``North``. The programme of support to information systems and services in poorer countries by the International Development Research Centre (IDRC) is described with specific examples drawn from its industry and technology information programme. Third world countries are in a difficult position and need help to keep on the cutting edge of new information-communication technologies. Any help, however must focus on such factors as persistence, impact and sustainability of information systems and services. (author). 5 refs.

  15. Industrial Technologies Program Research Plan for Energy-Intensive Process Industries

    Energy Technology Data Exchange (ETDEWEB)

    Chapas, Richard B. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Colwell, Jeffery A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2007-10-01

    In this plan, the Industrial Technologies Program (ITP) identifies the objectives of its cross-cutting strategy for conducting research in collaboration with industry and U.S. Department of Energy national laboratories to develop technologies that improve the efficiencies of energy-intensive process industries.

  16. Industry X.0 : Reimaging industrial development

    CSIR Research Space (South Africa)

    Zachar, H

    2017-10-01

    Full Text Available Quantum Mainframe Client-server & PCs Web 1.0 ecommerce Web 2.0, cloud, mobile Big data, analytics, visualization IoT & smart machines Artificial intelligence Quantum computing 6 T o d a y 1950 1960 1970 1980 1990 2000 2010 2020... NEW SET OF CORE CAPABILITIES TO SUCCEED INDUSTRY X.0 INDUSTRY 4.0 EFFICIENCIES HYPER-PERSONALIZED EXPERIENCES & NEW SOURCES OF GROWTH SOCIAL MEDIA CLOUD ANALYTICS MOBILITY WEB 1.0/E-COMMERCE PCS, SERVERS AND DEDICATED HARDWARE PCS...

  17. Industry X.0 : Reimaging industrial development.

    CSIR Research Space (South Africa)

    Zachar, H

    2017-10-01

    Full Text Available Quantum Mainframe Client-server & PCs Web 1.0 ecommerce Web 2.0, cloud, mobile Big data, analytics, visualization IoT & smart machines Artificial intelligence Quantum computing 6 T o d a y 1950 1960 1970 1980 1990 2000 2010 2020... NEW SET OF CORE CAPABILITIES TO SUCCEED INDUSTRY X.0 INDUSTRY 4.0 EFFICIENCIES HYPER-PERSONALIZED EXPERIENCES & NEW SOURCES OF GROWTH SOCIAL MEDIA CLOUD ANALYTICS MOBILITY WEB 1.0/E-COMMERCE PCS, SERVERS AND DEDICATED HARDWARE PCS...

  18. Fiscal 1998 research report on development of the advanced industrial furnace (R and D on the advanced industrial furnace). Volume 3; 1998 nendo koseino kogyoro no kaihatsu ni kansuru kenkyu seika hokokusho. Koseino kogyoro nado ni kansuru kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    This report summarizes the research results of the chapter 4 and 5 (experimental database) from the research report on development of the advanced industrial furnace. The chapter 4 summarizes functions of the temperature performance evaluation simulator of the advanced continuous heating furnace for the database system, and various research results obtained by the simulator. This chapter also summarizes the research result on the applicability of high-temperature air combustion to other industries, the patent research result on heat storage combustion technology, the basic technology research result, and the reaction analysis result by FLUENT. The chapter 5 summarizes the combustion experiment data collection by developing self-completion high-temperature high-radiation heating technology. As for R and D on technology optimizing the profile of heating furnaces, the following data are summarized: measurement data of heat transfer in furnaces and heat flux data at right overhead furnace temperature under cold air and preheated air combustion in conventional furnaces, and heat storage combustion. (NEDO)

  19. Fiscal 1999 achievement report on interuniversity coordination type research and development of industrial technology. Research and development of highly functional material designing platform; 1999 nendo kokino zairyo sekkei platform no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    For the purpose of enabling prediction of structures and properties of polymeric materials by computer-assisted experiments, studies were conducted for putting new simulation technologies to practical application. Simulation technologies underwent research and development with working groups respectively dealing with the coarse-graining molecular dynamic method, dynamic mean field method, dispersed structure simulation, study of verification, and platform. The Faculty of Engineering, Yamagata University, succeeded in the development of a device enabling direct observation of crystallization under shear flow, which was for the construction of a material property database. The Graduate School of Frontier Sciences, University of Tokyo, developed a device for measuring dielectric relaxation under shear flow, by which findings were obtained concerning ion fluctuation and diffusion in a micellar system. The Institute of Industrial Science, University of Tokyo, studied pattern formation dynamics which involved viscoelastic phase separation in a polymeric solution whose composition was near critical. (NEDO)

  20. Research and development regarding the retaining mechanism of lead ions in industrial wastewaters using natural matter with remarkable properties

    Science.gov (United States)

    Pop, A.; Iepure, G.

    2017-05-01

    The paper shows the studying of the retaining mechanism of lead ions in industrial wastewaters through static and dynamic ion exchange mechanisms. In the experimental determinations of the lead metallic ion retention, metallurgical industry wastewaters have been used on samples of volcanic zeolite tuff (from Barsana, Maramures), samples that show a high concentration of lead ions and an acidic pH. The results showed that both the static and the dynamic ion exchanges ended with good results and they were consistent with other studies conducted on clinoptilolite zeolite tuff. Knowing that the industrial sector is an important source of environment pollution and degradation and being aware of what a serious threat the heavy metal pollution is, due to their high toxicity and stability, the experiment may find applicability in different aspects, both in the Maramures mining basing as well as in the worldwide controlling and directing of the polluting processes.

  1. Analysis on Time-Lag Effect of Research and Development Investment in the Pharmaceutical Industry in Korea.

    Science.gov (United States)

    Lee, Munjae; Choi, Mankyu

    2015-08-01

    The aim of this study is to analyze the influence of the research and development (R&D) investment of pharmaceutical companies on enterprise value. The period of the empirical analysis is from 2000 to 2012, considering the period after the influence of the financial crisis. Financial statements and comments in general and internal transactions were extracted from TS-2000 of the Korea Listed Company Association, and data related to stock price were extracted from KISVALUE-III of National Information and Credit Evaluation Information Service Co., Ltd. STATA 12.0 was used as the statistical package for panel analysis. In the pharmaceutical firms, the influence of the R&D intensity with regard to Tobin's q was found to be positive. However, only the R&D expenditure intensities of previous years 2 and 5 (t-2 and t-5, respectively) were statistically significant (p company, such as generic, incrementally modified drugs, and biosimilar products.

  2. Economic corridor of industrial development in Indonesia

    Science.gov (United States)

    Berawi, M. A.; Miraj, P.; Sidqi, H.

    2017-12-01

    Indonesia as an archipelago country categorize its regional development into six corridors from Sumatra, Java, Kalimantan, Sulawesi, Bali-Nusa Tenggara and Papua-Maluku. Currently, industrial development becomes one of the highest contributing factors to the national economic growth. However, each region in the nation experience inequality of development mainly related to the infrastructure sector. Thus, the research aims to develop a sustainable economic corridor by considering the characteristics and its potential. The research uses a qualitative approach through a desk study, benchmarking and in-depth interview. Location Quotient is used for the method of the analysis tool. The results show each characteristic of every corridor in the country. Sumatera as national plantation and processing industry corridor, Java as cyber technology innovation and services center, Kalimantan as national energy reserves and processing, Sulawesi as national aquaculture and processing industry, Bali - Nusa Tenggara as national eco-tourism center, and Papua - Maluku as national ore mining and processing.

  3. CONFERENCE CHEVREUL Nutrition research: the industrial approach

    Directory of Open Access Journals (Sweden)

    Korver Onno

    2000-01-01

    Full Text Available The goal of nutrition research in an industrial setting is the marketing of products. Since consumers cannot see from the product whether it is healthy, communication to the consumer about the nutritional and health values of the products is essential. Industrial nutrition research therefore has to provide the scientific dossier to underpin the claims and other communication on and around the product as well as the scientific basis for the communication. These two lines are illustrated in figure 1. For scientific audiences the steps to collect the scientific evidence are obvious: first screening for new ideas on the basis of scientific developments and business options, then identifying ingredients that can deliver the health benefit, followed by mechanistic and bioavailability studies and finally human intervention trials. The communication line is less obvious for most scientifically oriented audiences. Experience has shown that an information cascade has to be followed: during the execution of the research work close contact with academic experts (a true dialogue is essential, when the research data are available information of a wide selection of health professionals (e.g. physicians, dieticians, science journalists is taking place and only after this step communication to the consumer starts. The communication with the scientific experts (the first step of the cascade obviously has to be in the hands of the nutrition research group of the industry involved. In Unilever this is the Unilever Nutrition Centre based in Vlaardingen in the Netherlands. Their role in the scientific dialogue is outlined in figure 2. The fact that the “Medaille Chevreul” has been awarded twice to members of the Unilever Nutrition Centre in the last two decades, illustrates that the UNC is considered to be a group with a truly scientific tradition.

  4. Orthopaedic research and education foundation and industry.

    Science.gov (United States)

    Wurth, Gene R; Sherr, Judy H; Coffman, Thomas M

    2003-07-01

    Members of orthopaedic industry commit a significant amount of funds each year to support research and education programs that are directly related to their product(s). In addition, industry supports organizations such as the Orthopaedic Research and Education Foundation. The relationship between the Orthopaedic Research and Education Foundation and industry began in the early 1980s. The support to the Orthopaedic Research and Education Foundation from industry primarily has come in the form of unrestricted grants. These grants best can be looked at as an investment rather than a contribution. This form of giving, once called corporate philanthropy is more accurately referred to as strategic philanthropy. Members of industry make these investments to enhance their reputations, build brand awareness, market their products and services, improve employee morale, increase customer loyalty, and establish strategic alliances. The specialty of orthopaedics is among the leaders in medicine in the amount of funding raised within the specialty for research and education programs. This is because of the amount of support from members of industry and the surgeons. During the past 15 years, 40% of the annual support to the Orthopaedic Research and Education Foundation has come from industry and the balance has come from surgeons and members of lay public. Future industry support of the Orthopaedic Research and Education Foundation and other organizations within the specialty of orthopaedics will be dependent on the continued demonstration of tangible returns in areas described.

  5. Industry-identified combustion research needs: Special study

    Energy Technology Data Exchange (ETDEWEB)

    Keller, J.G.; Soelberg, N.R.; Kessinger, G.F.

    1995-11-01

    This report discusses the development and demonstration of innovative combustion technologies that improve energy conservation and environmental practices in the US industrial sector. The report includes recommendations by industry on R&D needed to resolve current combustion-related problems. Both fundamental and applied R&D needs are presented. The report assesses combustion needs and suggests research ideas for seven major industries, which consume about 78% of all energy used by industry. Included are the glass, pulp and paper, refinery, steel, metal casting, chemicals, and aluminum industries. Information has been collected from manufacturers, industrial operators, trade organizations, and various funding organizations and has been supplemented with expertise at the Idaho National Engineering Laboratory to develop a list of suggested research and development needed for each of the seven industries.

  6. Aspects regarding the efficiency of technology transfer from the national research institutes towards the industry in order to accelerate the development of Romanian economy

    Directory of Open Access Journals (Sweden)

    Diana Felicia Nicoara

    2012-08-01

    Full Text Available Currently, Romania is faced with problems regarding closing the deep economic gap between it and the rest of the EU members. In addition, Romania is concerned with overcoming the difficulties generated by the current economic crisis. The technology transfer of the research results from the scientific field towards the industry is one of the main leverages for the economic development, the innovation development and the competitiveness of the companies. At this point, Romania marks a very low transfer rate of technology between the research institutions and the economy. This is why, increasing and accelerating this rate becomes a vital element for the Romanian economy. The national research institutes are one of the most representative institutions of the national research and development system. With a high capacity of generating scientific results specific to certain national areas of expertise, their potential of transfering technology should be exploited and made more efficient. This paper presents a synthesis of the written works regarding the technology transfer, its role in the economic growth and the factors influencing its efficiency. The paper performs an analysis the current state of the national research institutes and formulates hypotheses regarding the causes leading to the low technology transfer rate, making suggestions on further research studies on how to turn this important process into a more efficient one

  7. Industrial science and technology research and development institutions in fiscal 1999. Report on achievements in research and development of human media; 1999 nendo sangyo kagaku gijutsu kenkyu kaihatsu seido. Human media no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    In order to give the society with the full picture of human media at an early time, actual problems in industries were taken up. This paper summarizes the sensitivity agent to support sensitivity of individuals, the human media database, the urban environment human media aiming at symbiosis of nature with artificial environment, and the achievements of comprehensive investigations and researches in fiscals 1999 and 2000. Activities were taken in the following four areas: 1) research and development of the sensitivity agent and human media database, 2) research and development of the urban environment human media, 3) comprehensive investigations and researches, and 4) investigations on technological trends in foreign countries. In Item 1), discussions were given on the technology to present full-color images at high accuracy, the image sensitivity retrieval technology, and the multi-dimensional interface technology for the human media database. In studying the basic human media technology, discussions were given on the basic sensitivity modeling technology, and the sensitivity agent mechanism. (NEDO)

  8. Synchrotron radiation and industrial research

    International Nuclear Information System (INIS)

    Townsend, R.P.

    1995-01-01

    Fundamental studies on the properties of many different materials are of prime importance to most industrial concerns. For Unilever, solids (crystalline and amorphous), soft solids and complex fluids are the materials of primary interest. Synchrotron radiation has proved of great value for the analysis of a variety of such materials, because the intense and highly collimated radiation source has enabled us to obtain structural information rapidly as well as in time-resolved mode. In this paper are outlined the types of materials problems faced, and how we use different techniques to elucidate structure (both short and long range order) in zeolites, amorphous solids, as well as in biomaterials such as skin and hair containing lipid phases. Both equilibrium and time-resolved studies are described. (orig.)

  9. Council of Scientific & Industrial Research

    Indian Academy of Sciences (India)

    KalyanNetti

    2007-09-26

    Sep 26, 2007 ... gene in Deccani breed of sheep, to increase lamb production and ... higher productivity called 'NARI Suwarna' has thus been developed. ... and business of innovation for rural development in the country not only to accelerate.

  10. Analyzing the development of Indonesia shrimp industry

    Science.gov (United States)

    Wati, L. A.

    2018-04-01

    This research aimed to analyze the development of shrimp industry in Indonesia. Porter’s Diamond Theory was used for analysis. The Porter’s Diamond theory is one of framework for industry analysis and business strategy development. The Porter’s Diamond theory has five forces that determine the competitive intensity in an industry, namely (1) the threat of substitute products, (2) the threat of competition, (3) the threat of new entrants, (4) bargaining power of suppliers, and (5) bargaining power of consumers. The development of Indonesian shrimp industry pretty good, explained by Porter Diamond Theory analysis. Analysis of Porter Diamond Theory through four main components namely factor conditions; demand condition; related and supporting industries; and firm strategy, structure and rivalry coupled with a two-component supporting (regulatory the government and the factor of chance). Based on the result of this research show that two-component supporting (regulatory the government and the factor of chance) have positive. Related and supporting industries have negative, firm and structure strategy have negative, rivalry has positive, factor condition have positive (except science and technology resources).

  11. Research and development experience

    International Nuclear Information System (INIS)

    Slater, J.B.

    1980-06-01

    In the early 1950s, Atomic Energy of Canada Limited (AECL), in collaboration with Canadian industry and the power utilities, started on the task of developing and establishing the CANDU power reactor system and the necessary industrial infrastructure. While international activity provided a useful background and information to support Canadian activities, there were several unique features of the CANDU reactor which demanded specific programs of research and development work with a physics orientation. The four major areas were basic reactor physics, reactor control, heavy water and tritium monitoring and instruments and, finally, the potential of alternative fuel cycles. These four topics are discussed with the objective of providing an overview of what has been accomplished and what remains to be done. (auth)

  12. PTAC 2002 annual report : creating value through innovation : facilitating innovation, technology transfer, and collaborative research and development in the upstream oil and gas industry

    International Nuclear Information System (INIS)

    2003-01-01

    Petroleum Technology Alliance Canada (PTAC) is Canada's leading organization that helps in the development and transfer of petroleum technology. This annual report listed the key accomplishments of PTAC in 2002. These include a record participation in PTAC workshops and conferences, the co-hosting of the world's largest unconventional gas and coalbed methane conference with the Canadian Society for Unconventional Gas, and the co-hosting of a conference on climate change and greenhouse gas technology with Climate Change Central. In 2002 PTAC launched an Industrial Energy Audit Incentive with Natural Resources Canada. It also proposed an extension to its mandate to help energy efficiency and greenhouse gas technologies for the hydrocarbon energy industry. In addition, PTAC helped launch 32 research and development projects in 2002. PTAC expects that 2003 will see a shift in focus to sustainable, eco-efficiency and greenhouse gas-reducing technologies for the hydrocarbon energy industry. This annual report includes an auditor's report of PTAC's financial statements. The report includes summarized balance sheet of assets, liabilities/surplus and net assets. It also includes summarized statements of revenues, expenses and surplus for the year ended December 31, 2002 with comparative figures for 2001. 1 tab., 2 figs

  13. Hydropower research and development

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    This report is a compilation of information on hydropower research and development (R and D) activities of the Federal government and hydropower industry. The report includes descriptions of on-going and planned R and D activities, 1996 funding, and anticipated future funding. Summary information on R and D projects and funding is classified into eight categories: fish passage, behavior, and response; turbine-related; monitoring tool development; hydrology; water quality; dam safety; operations and maintenance; and water resources management. Several issues in hydropower R and D are briefly discussed: duplication; priorities; coordination; technical/peer review; and technology transfer/commercialization. Project information sheets from contributors are included as an appendix.

  14. Industrial science and technology frontier program progress reports for fiscal 1998. Research and development of synergy ceramics; 1998 nendo synergy ceramics no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    In relation with research and development of 'synergy ceramics' which have begun since fiscal 1994 under a joint organization of the industries, Government and academic circles, reports were given on the achievement status of the whole of the first stage of the project, together with the results of researches made in fiscal 1998. With regard to high-order structure control technologies, reports were given on the following subjects: precursor design, structure formation design, nano-structure process and structuring reaction process as the basic technologies for structure creation, and inter-hierarchy deposition reaction control, phase boundary formation control, anisotropic particle interface control and high-order space production control as the structural element control technologies. With respect to analysis and evaluation technologies, reports were given on research achievements in fundamental technologies for analysis and evaluation, and property developing element evaluation technologies. In the field of overall survey and study, various committees and study meetings were held, research projects were planned, and technological trends were surveyed, whose results were reported. In the joint researches, reports were given on the survey and study on new material creation by means of high-order structure control, and the research on high-order structure control of ceramics by means of structuring reaction process control. (NEDO)

  15. Industrial science and technology frontier program progress reports for fiscal 1998. Research and development of synergy ceramics; 1998 nendo synergy ceramics no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    In relation with research and development of 'synergy ceramics' which have begun since fiscal 1994 under a joint organization of the industries, Government and academic circles, reports were given on the achievement status of the whole of the first stage of the project, together with the results of researches made in fiscal 1998. With regard to high-order structure control technologies, reports were given on the following subjects: precursor design, structure formation design, nano-structure process and structuring reaction process as the basic technologies for structure creation, and inter-hierarchy deposition reaction control, phase boundary formation control, anisotropic particle interface control and high-order space production control as the structural element control technologies. With respect to analysis and evaluation technologies, reports were given on research achievements in fundamental technologies for analysis and evaluation, and property developing element evaluation technologies. In the field of overall survey and study, various committees and study meetings were held, research projects were planned, and technological trends were surveyed, whose results were reported. In the joint researches, reports were given on the survey and study on new material creation by means of high-order structure control, and the research on high-order structure control of ceramics by means of structuring reaction process control. (NEDO)

  16. State, Institutions and Industrial Development

    DEFF Research Database (Denmark)

    Lauridsen, Laurids Sandager

    perspectives on the state and the economy (Chapter 5), from the perspective of policy networks and collaborative advantages between the private and public sectors, and from a politico-institutional and politics perspective (Chapter 8). Chapter 6 develops the notion of strategic industrial policy, while Chapter......      What happens when developing countries can no longer grow by simply exploiting their existing comparative advantages in natural resources or cheap labour? Many middle income countries are situated in a sandwiched position between on the one hand competitive pressure from lower-wage countries...... and on the other hand competition from innovators in the advanced capitalist countries. To climb onwards to higher income levels they must deepen and upgrade their industries. The dissertation is based on the assumption that this transition from low to high value-added activities does not take place ‘automatically...

  17. New Zealand’s Drug Development Industry

    Directory of Open Access Journals (Sweden)

    Christopher Carswell

    2013-09-01

    Full Text Available The pharmaceutical industry’s profitability depends on identifying and successfully developing new drug candidates while trying to contain the increasing costs of drug development. It is actively searching for new sources of innovative compounds and for mechanisms to reduce the enormous costs of developing new drug candidates. There is an opportunity for academia to further develop as a source of drug discovery. The rising levels of industry outsourcing also provide prospects for organisations that can reduce the costs of drug development. We explored the potential returns to New Zealand (NZ from its drug discovery expertise by assuming a drug development candidate is out-licensed without clinical data and has anticipated peak global sales of $350 million. We also estimated the revenue from NZ’s clinical research industry based on a standard per participant payment to study sites and the number of industry-sponsored clinical trials approved each year. Our analyses found that NZ’s clinical research industry has generated increasing foreign revenue and appropriate policy support could ensure that this continues to grow. In addition the probability-based revenue from the out-licensing of a drug development candidate could be important for NZ if provided with appropriate policy and financial support.

  18. Labor development strategy in the bag industry

    Directory of Open Access Journals (Sweden)

    Dyah Maya Nihayah

    2016-04-01

    Full Text Available The research aims to formulate strategies for improving the labor competencies in the bag industry in Kudus Regency. The data comprise business players, which will be analyzed using the Strength, Weaknesses, Opportunities, and Threats (SWOT analysis. The results reveal that the proper strategy for improving employment in the bag industry is growth and build strategy. Growth and development strategy are intensive actions undertaken through the development of labor competencies to improve the quality of output. It can be made with creating learning resources by designing methods and trainings refer to the Competency Based Training (CBT.

  19. Energy efficient industrialized housing research program

    Energy Technology Data Exchange (ETDEWEB)

    Berg, R.; Brown, G.Z.; Finrow, J.; Kellett, R.; McDonald, M.; McGinn, B.; Ryan, P.; Sekiguchi, Tomoko (Oregon Univ., Eugene, OR (USA). Center for Housing Innovation); Chandra, S.; Elshennawy, A.K.; Fairey, P.; Harrison, J.; Mazwell, L.; Roland, J.; Swart, W. (Florida Solar Energy Center, Cape Canaveral, FL (USA))

    1989-12-01

    This document describes the research work completed in five areas in fiscal year 1989. (1) The analysis of the US industrialized housing industry includes statistics, definitions, a case study, and a code analysis. (2) The assessment of foreign technology reviews the current status of design, manufacturing, marketing, and installation of industrialized housing primarily in Sweden and Japan. (3) Assessment of industrialization applications reviews housing production by climate zone, has a cost and energy comparison of Swedish and US housing, and discusses future manufacturing processes and emerging components. (4) The state of computer use in the industry is described and a prototype design tool is discussed. (5) Side by side testing of industrialized housing systems is discussed.

  20. The National Nanotechnology Initiative: Research and Development Leading to a Revolution in Technology and Industry. Supplement to the President’s 2011 Budget

    Science.gov (United States)

    2010-02-01

    commercial “ pull ” to enable rapid establishment of domestic 21st century manufacturing and to rapidly reduce product cost. CNT electronics...Opportunities for Academic Liaison with Industry ( GOALI ), Partnerships for Innovation (PFI) , and Industry-University Cooperative Research Centers (IUCRC

  1. Energy from wastewater - a feasibility study and guide for: Technology developers and researchers, industry and wastewater generators and policy makers

    CSIR Research Space (South Africa)

    Burton, S

    2012-07-01

    Full Text Available recommendations relevant to the R&D sector regarding recovery of energy from wastewater. It also seeks to provide information about directions which would be useful to South Africa’s research community by identifying areas where R&D are needed, and by highlighting...

  2. Review of 1992 industry developments

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The year 1992 was remarkable for a number of major events that affected the market. The key developments can be categorized in areas such as supply restrictions, legislative and political events, industry consolidations, reactor and mine closures as well as start-ups, and achievements at assorted fuel cycle operations. Clearly, the most influential event was the US uranium anti-dumping investigation, but other significant developments included Euratom's actions restricting imports of CIS-origin uranium into the European Community, continuing upheaval and evolution of the market-based economies of the CIS and central Europe, the second-most active year ever in the uranium spot market, the formation of ConverDyn and the indefinite shutdown of Sequoyah Fuels, Cogema's purchase of Urangesellschaft, passage of a US Energy Bill, China's signing of the Non-Proliferation Treaty, renewed progress on Taiwan's fourth nuclear station, formation of the Japanese fuel cycle corporation JNFL, premature closure of three US reactors for economic reasons, and several mergers and acquisitions that further consolidated the uranium and nuclear industries. As a whole, the past year will be looked back on by market participants as a year of turning point, both good and bad, in the evolution of the industry

  3. State, Institutions and Industrial Development

    DEFF Research Database (Denmark)

    Lauridsen, Laurids Sandager

    ' as a result of the working of market forces or of the choices and activities of transnational companies. Hence it examines the role of the state in such late-industrial transformation processes in Taiwan and Thailand. Most scholars have dealt with this issue from the perspective of trade and have studied......What happens when developing countries can no longer grow by simply exploiting their existing comparative advantages in natural resources or cheap labour? Many middle income countries are situated in a sandwiched position between on the one hand competitive pressure from lower-wage countries...... and on the other hand competition from innovators in the advanced capitalist countries. To climb onwards to higher income levels they must deepen and upgrade their industries. The dissertation is based on the assumption that this transition from low to high value-added activities does not take place ‘automatically...

  4. State, Institutions and Industrial Development

    DEFF Research Database (Denmark)

    Lauridsen, Laurids Sandager

    ’ as a result of the working of market forces or of the choices and activities of transnational companies. Hence it examines the role of the state in such late-industrial transformation processes in Taiwan and Thailand. Most scholars have dealt with this issue from the perspective of trade and have studied......      What happens when developing countries can no longer grow by simply exploiting their existing comparative advantages in natural resources or cheap labour? Many middle income countries are situated in a sandwiched position between on the one hand competitive pressure from lower-wage countries...... and on the other hand competition from innovators in the advanced capitalist countries. To climb onwards to higher income levels they must deepen and upgrade their industries. The dissertation is based on the assumption that this transition from low to high value-added activities does not take place ‘automatically...

  5. The Defense Department’s Support of Industry’s Independent Research and Development (IR&D). Analyses and Evaluation

    Science.gov (United States)

    1989-04-01

    Hill and Susan Bodilly were incorporated into this report. Todd Porter, a RAND Summer Intern, contributed to the data development, statistical...5Bailey and Lawrence , 1987, pp. 19-20. The R&D tax credit allowed a 25 percent credit for R&D expenditures in excess of the average amount spent...See J. A. Hausman , ’Specificaticn Tests in Econometrics,"Econormetrica, Vol, 46, No. 6, November 1978. 61 (7) and (8) report the results of this

  6. PTAC 2003 annual report : creating value through innovation : facilitating innovation, technology transfer, and collaborative research and development in the upstream oil and gas industry

    International Nuclear Information System (INIS)

    2004-01-01

    Petroleum Technology Alliance Canada (PTAC) is Canada's leading organization that helps in the development and transfer of petroleum technology. This annual report listed the key achievements in 2003, and presented an outlook for 2004. PTAC hosted 16 forums, workshops and conferences in 2003 which focused on specific needs or technical areas. The organization also facilitated 18 Technology Information Sessions in 2003 for members to promote interest, feedback and participation or funding for new research and development projects and to find industry partners. The projects launched in 2003 focused on the following issues: driving safety, e-business, emission reduction, eco-efficiency, environment, heavy oil, and innovation. In 2003, PTAC conducted a web survey and sent out two questionnaires to gain industry feedback on various topics. This annual report includes an auditor's report of PTAC's financial statements. The report includes summarized balance sheet of assets, liabilities/surplus and net assets. It also includes summarized statements of revenues, expenses and surplus for the year ended December 31, 2003 with comparative figures for 2002. 1 tab

  7. Research achievement report for fiscal 1998 on the development of high-performance industrial furnaces. Research and development of high-performance industrial furnaces and the like (2); 1998 nendo koseino kogyoro no kaihatsu ni kansuru kenkyu seika hokokusho. Koseino kogyoro nado ni kansuru kenkyu kaihatsu (2)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    Volume 2 named above contains part of research achievement reports and individual research achievement reports. The aluminum melting furnace working group research achievement report covers aluminum melting furnace operating patterns, concentrated impinging flame mode and dispersed impinging flame mode, and honeycomb and ball structures in heat storing bodies. The tubular heater working group report mentions the application of this facility to oil heating furnaces, studies and investigations for the embodiment of real systems using the tubular heater, and tests conducted in a furnace with plural heating tube lines. The individual research achievement reports elaborate on the development of technologies of heat transfer optimization under unsteady conditions in the steel material heating process, research and development of high-efficiency heat transfer technologies, development of heating furnace geometry optimization technologies, research and development of a high-performance controlled atmosphere heat treatment furnace, development of high-efficiency heat transfer technologies in high-temperature jet flame heating, development of heat uniformity improvement technologies for example for the steel material heating process, construction of optimum combustion control technologies for the regenerative burner furnace, research concerning laser-aided measurement in industrial furnaces, etc. (NEDO)

  8. A new context for the nuclear research and industry

    International Nuclear Information System (INIS)

    2000-01-01

    Pascal Colombani, general administrator of the CEA, develops in this presentation the situation of the nuclear industry to introduce the new orientations of the CEA group. The energy context, the deregulation impacts, the energy dependence and the greenhouse effect project are discussed before the presentation of the research programs and the necessary reorganizing of the nuclear industry. (A.L.B.)

  9. Industry-Government-University Cooperative Research Program for the Development of Structural Materials from Sulfate-Rich FGD Scrubber Sludge

    Energy Technology Data Exchange (ETDEWEB)

    V. M. Malhotra; Y. P. Chugh

    2003-08-31

    The main aim of our project was to develop technology, which converts flue gas desulfurization (FGD) sulfate-rich scrubber sludge into value-added decorative materials. Specifically, we were to establish technology for fabricating cost effective but marketable materials, like countertops and decorative tiles from the sludge. In addition, we were to explore the feasibility of forming siding material from the sludge. At the end of the project, we were to establish the potential of our products by generating 64 countertop pieces and 64 tiles of various colors. In pursuit of our above-mentioned goals, we conducted Fourier transform infrared (FTIR) and differential scanning calorimetry (DSC) measurements of the binders and co-processed binders to identify their curing behavior. Using our 6-inch x 6-inch and 4-inch x 4-inch high pressure and high temperature hardened stainless steel dies, we developed procedures to fabricate countertop and decorative tile materials. The composites, fabricated from sulfate-rich scrubber sludge, were subjected to mechanical tests using a three-point bending machine and a dynamic mechanical analyzer (DMA). We compared our material's mechanical performance against commercially obtained countertops. We successfully established the procedures for the development of countertop and tile composites from scrubber sludge by mounting our materials on commercial boards. We fabricated more than 64 pieces of countertop material in at least 11 different colors having different patterns. In addition, more than 100 tiles in six different colors were fabricated. We also developed procedures by which the fabrication waste, up to 30-weight %, could be recycled in the manufacturing of our countertops and decorative tiles. Our experimental results indicated that our countertops had mechanical strength, which was comparable to high-end commercial countertop materials and contained substantially larger inorganic content than the commercial products. Our

  10. University-Industry Collaboration in IS Research

    DEFF Research Database (Denmark)

    Schubert, Petra; Bjørn-Andersen, Niels

    2012-01-01

    of successful modes of collaboration. In this paper, we present the findings of the first qualitative in‐depth phase, in which we inter‐ viewed nine experienced researchers in order to understand the phenomenon of university‐ industry collaboration in the context of different research backgrounds. The findings...... from the preliminary interviews show that researchers have very differing individual preferences regarding the ideal setup of such collaborative research projects. They also show that design research and case study are the most common research methods in such projects. While peer‐ reviewed conference...... papers and journal articles are the most popular forms of academic output, reports and sessions with managers are the prevalent output for industry partners. This work is a precursor to a larger survey, which will allow us to study correlations between characteristics of researcher/project type...

  11. FY 1993 Report on the industrial science and technology research and development project results. Research and development of non-linear photoelectronic materials; 1993 nendo hisenkei hikari denshi zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-11-01

    Described herein are the results of the industrial science and technology research and development project for nonlinear optoelectronic materials. The more functional chiral and pi-conjugated compounds are investigated as the organic, low-molecular-weight materials. The technologies for the orientation-controlled crystal growth are continuously investigated. Polyacetylene is investigated as the conjugated pi-electron system. The glass-dispersed systems, prepared by the sol-gel, superlow-melting glass and super-cooling methods, are investigated. In order to elucidate the relationship between the organic superlattice and properties (e.g., photoelectronic properties), the intramolecular interactions under the superlattice conditions are estimated by the theoretical chemical calculations, and the optimum structures deduced from the measured properties are proposed. The thin, composite films of fine metallic particles and glass are prepared by the multi-dimensional sputtering, to explore the constituent materials suitable for the three-dimensional superstructures, and their properties are analyzed. The thin semiconductor films of superlattices are prepared by the molecular beam epitaxy method, to investigate the optimization of the structures and compositions. The basic aspects of the three-dimensional superstructures, prepared by the superfine machining, are investigated. The results of the comprehensive investigations and researches are also described. (NEDO)

  12. Utility of radiotracer methodology in scientific research of industrial relevancy

    International Nuclear Information System (INIS)

    Kolar, Z.I.

    1990-01-01

    Utilization of radiotracer methodology in industrial research provides substantial scientific rather than directly demonstrable economic benefits. These benefits include better understanding of industrial processes and subsequently the development of new ones. Examples are given of the use of radiotracers in technological studies and the significance of the obtained results is put down. Creative application of radiotracer methodology may contribute to the economic development and technological advancement of all countries including the developing ones. (orig.) [de

  13. Paradigmatic Shifts in Exploration Process: The Role of Industry-Academia Collaborative Research and Development in Discovering the Next Generation of Uranium Ore Deposits

    Energy Technology Data Exchange (ETDEWEB)

    Marlatt, J., E-mail: jmarlatt5@cogeco.ca [Raven Minerals Corp.,Toronto (Canada); Kyser, K. [Queen’s Facility for Isotope Research, Queen’s University, Kingston (Canada)

    2014-05-15

    innovation exploration’ where a paradigmatic shift in the exploration approach will take the industry toward new discoveries by leveraging research and technology development. Effective engagement within the ‘innovation exploration’ paradigm will require that exploration organizations adopt industry-academia research, development, and technology transfer as a priority long-term, systematic strategy. Leadership and management strengths need to be co-opted to bring the academic and industry team systems together for success, through the use of informational, relational and reflective learning strategies. (author)

  14. CAREER DEVELOPMENT OF TEXTILE INDUSTRY EMPLOYEES

    Directory of Open Access Journals (Sweden)

    UROŠEVIĆ Snežana

    2017-05-01

    Full Text Available Textile industry is a very important industrial branch because it produces clothes for nearly seven billion people and textile materials for technical usage. It employs a huge number of competitive and qualified, mostly female work force. It is also technologically and technically challenging. Thus, it is vital to employ qualified and well trained employees with certain competences, knowledge and skills in order to respond to rapid technological and market changes. Here, we will consider the influence of the career development on doing business in the textile industry while acquiring the competitive advantage. Career development is a lifelong process and it is includes knowledge management. The term career has several meanings while nowadays it can mean advancement. The career usually reflects the professional development path of an individual during his or her working career. The career is that concept which connects and unifies most strongly and explicitly individual and organizational interests and needs. The theoretical part explains terms such as career development, importance and improvement of employees for an organization, the possibility for career development within the textile industry. The second part of the paper deals with research conducted among the employees of the textile sector in Leskovac, the town in Serbia with a long-lasting textile tradition.

  15. Technology research and development

    International Nuclear Information System (INIS)

    Haas, G.M.; Abdov, M.A.; Baker, C.C.; Beuligmann, R.F.

    1985-01-01

    The U.S. Dept. of Energy discusses the new program plan, the parameters of which are a broad scientific and technology knowledge base, an attractive plasma configuration to be determined, and other issues concerning uncertainty as to what constitutes attractive fusion options to be determined in the future, and increased collaboration. Tables show changing directions in magnetic fusion energy, two examples of boundary condition impacts on long-term technology development, and priority classes of the latter. The Argonne National Laboratory comments on the relationship between science, technology and the engineering aspects of the fusion program. UCLA remarks on the role of fusion technology in the fusion program plan, particularly on results from the recent studies of FINESSE. General Dynamics offers commentary on the issues of a reduced budget, and new emphasis on science which creates an image of the program. A table illustrates technology research and development in the program plan from an industrial perspective

  16. Technical development of industry for 30 years

    International Nuclear Information System (INIS)

    2009-01-01

    This book mentions the history for 30 years since 1979 on industrial technology, which records change of system and environment of industrial technology development, like economical and social environment, industrial technology policy, support system on technical development and enterprise institute, assignment for future and product of industrial technology by field such as electric electronic, information and communications, machine material and fiber chemistry, and the way which Korea industrial technology association walked on.

  17. Achievement report for fiscal 1988 on research and development of basic technologies for next-generation industry. Researches into organisms for biological device (information processing in organisms); 1988 nendo bio soshi seibutsu chosa kenkyu seika hokokusho. Seibutsu no joho shori

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-09-01

    Researches into organisms for their information processing, conducted in fiscal 1988 as part of a 'biological device research and development' project under the research and development system for basic technologies for the next-generation industry, are compiled into an article entitled 'information processing in neurons, and calcium ions.' The level of neuronal activity depends on changes in the level of nerve-membrane ion channel activity. Some kinds of ion channels are chemically activated (or inactivated) within the membrane. The phosphorylation of a protein ion channel is a typical case where an ion channel level is regulated chemically. In the muscarinic response of a neuron, a chemically operated ion channel plays an important roll relative to neuronal functions. In this response, a second messenger system in the neuron transmits extracellular information to the chemically operated ion channel. In this system, a calcium ion is one of important second messengers. (NEDO)

  18. Industrial structure at research reactor suppliers

    International Nuclear Information System (INIS)

    Roegler, H.-J.; Bogusch, E.; Friebe, T.

    2001-01-01

    Due to the recent joining of the forces of Framatome S. A. from France and the Nuclear Division of Siemens AG Power Generation (KWU) from Germany to a Joint Venture named Framatome Advanced Nuclear Power S.A.S., the issue of the necessary and of the optimal industrial structure for nuclear projects as a research reactor is, was discussed internally often and intensively. That discussion took place also in the other technical fields such as Services for NPPs but also in the field of interest here, i. e. Research Reactors. In summarizing the statements of this presentation one can about state that: Research Reactors are easier to build than NPPs, but not standardised; Research Reactors need a wide spectrum of skills and experiences; to design and build Research Reactors needs an experienced team especially in terms of management and interfaces; Research Reactors need background from built reference plants more than from operating plants; Research Reactors need knowledge of suitable experienced subsuppliers. Two more essential conclusions as industry involved in constructing and upgrading research reactors are: Research Reactors by far are more than a suitable core that generates a high neutron flux; every institution that designs and builds a Research Reactor lacks quality or causes safety problems, damages the reputation of the entire community

  19. Government-University-Industry-Research Roundtable

    Energy Technology Data Exchange (ETDEWEB)

    1995-02-01

    Roundtable projects active during 1993 are described in this section. Projects completed in prior years are not included here, but publications resulting from them are included in the list of publications which are attached. Such prior projects include nurturing science and engineering talent, research facility financing, multidisciplinary research and education, university-industry-federal laboratory partnerships, and federal-state cooperation in science and technology.

  20. Supporting developers in addressing maintenance aspects: an empirical study in the industrial equipment manufacturing industry

    NARCIS (Netherlands)

    Mulder, W.

    2016-01-01

    Addressing maintenance aspects has become increasingly important in development projects of industrial equipment. Developers of such equipment need to address the maintenance aspects in order to achieve competitive equipment and service offerings. This research focuses on the identification of the

  1. Strategic research field no.4, industrial innovations

    International Nuclear Information System (INIS)

    Kato, Chisachi

    2011-01-01

    'Kei'-supercomputer is planned to start its full-scale operation in about one year and a half. With this, High Performance Computing (HPC) is most likely to contribute not only to further progress in basic and applied sciences, but also to bringing about innovations in various fields of industries. It is expected to substantially shorten design time, drastically improve performance and/or liability of various industrial products, and greatly enhance safety of large-scale power plants. In this particle, six research themes, which are currently being prepared in this strategic research field, 'industrial innovations' so as to use 'Kei'-supercomputer as soon as it starts operations, will be briefly described regarding their specific goals and break-through that they are expected to bring about in industries. It is also explained how we have determined these themes. We are also planning several measures in order to promote widespread use of HPC including 'Kei'-supercomputer in industries, which will also be elaborated in this article. (author)

  2. Achievement report on commissioned research and development of basic technologies for the next generation industries in fiscal 1981. Research and development of a voluminous cell incubation technology; 1981 nendo jisedai sangyo kiban gijutsu itaku kenkyu kaihatsu seika hokokusho. Saibo tairyo baiyo gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    Achievements were compiled on the research and development in fiscal 1981 on the 'voluminous cell incubation technology', which has been performed according to the 'institution for research and development of basic technologies for the next generation industries'. In the research of a method for producing industrial materials using cells originated from lymph-based trunk cells, researches were performed on selection and breeding of cells, development of serum-free media, and establishment of the optimal culture method with regard to the method for producing industrial materials using stocks producing virus induced interferon. Regarding the method for producing industrial materials using idio-interferon producing mutable stocks, research and development was made on selection and breeding of superior cell stocks and serum-free media. With regard to the method for producing industrial materials using marrow originated cells, such researches were carried out as technological investigations, collection of cells, establishment of the proliferating condition for myeloid leukemia cells, discussions on the assay method for differentiation inducing factors, and search for cells producing useful substances. Other activities include research of the method for producing industrial materials using cells originated from epithelium cells, information exchange on voluminous cell incubation technologies, and investigations on literatures and patents. (NEDO)

  3. Achievement report on commissioned research and development of basic technologies for the next generation industries in fiscal 1981. Research and development of a voluminous cell incubation technology; 1981 nendo jisedai sangyo kiban gijutsu itaku kenkyu kaihatsu seika hokokusho. Saibo tairyo baiyo gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    Achievements were compiled on the research and development in fiscal 1981 on the 'voluminous cell incubation technology', which has been performed according to the 'institution for research and development of basic technologies for the next generation industries'. In the research of a method for producing industrial materials using cells originated from lymph-based trunk cells, researches were performed on selection and breeding of cells, development of serum-free media, and establishment of the optimal culture method with regard to the method for producing industrial materials using stocks producing virus induced interferon. Regarding the method for producing industrial materials using idio-interferon producing mutable stocks, research and development was made on selection and breeding of superior cell stocks and serum-free media. With regard to the method for producing industrial materials using marrow originated cells, such researches were carried out as technological investigations, collection of cells, establishment of the proliferating condition for myeloid leukemia cells, discussions on the assay method for differentiation inducing factors, and search for cells producing useful substances. Other activities include research of the method for producing industrial materials using cells originated from epithelium cells, information exchange on voluminous cell incubation technologies, and investigations on literatures and patents. (NEDO)

  4. Gas industry development in Egypt

    International Nuclear Information System (INIS)

    Roze, J.; Longueville, P.

    2000-01-01

    Egypt is a country with major gas potential and its gas industry has grown rapidly over the last ten years. Proven natural gas reserves total an estimated 1,050 billion m 3 . According to the re-evaluation of reserves made in January 2000, probable reserves stand at 3,400 billion m 3 , placing Egypt in ninth position as a potential world producer. These reserves are contained in 120 fields located mainly in the Nile Delta and Mediterranean regions and, to a lesser extent, in the Western Desert and the Gulf of Suez. Over the last two years, 54 new gas field have been discovered and registered. Consumption of oil, Egypt's main primary energy source, has declined steadily since the early 1980's in favour of natural gas, which has enjoyed steady growth. The penetration of natural gas is due to the growth of industries consuming large quantities of gas (chemical, fertilizers, etc), the development of new gas fields and the use of gas as a substitute for oil and coal, especially in the power industry which accounts for a major share of energy consumption, i.e., two-thirds of production in 1997. However, as Egypt is currently neither an importer or exporter of natural gas, the growth in consumption has naturally followed that of production, and the lack of infrastructure explains the limited penetration of gas in the residential sector (less than 2 % in 1997). According to the gas development plan drawn up by the Egyptian authorities, internal consumption should increase from 13.5 billion m 3 per year in 1998 to around 45.5 billion m 3 per year in 2017. This consumption increase will be accelerated to respond to domestic needs and, in particular, to favour the implementation of the national redevelopment plan (distribution of the population over 25% of the country by 2020, compared to 4% day). The energy vector of this urban policy is gas. Moreover, this policy should offset the drop in income resulting from declining oil production. The Egyptian authorities, via a range

  5. Sustainable Development as Concern for Industrial Companies

    DEFF Research Database (Denmark)

    Bundgaard, Hans

    Today, the industrial company has responsibilities towards the environment, the society, and the owners. From a theoretical base of social theory and social science, this industry research has considered the preconditions for a more proactive industrial response towards sustainability. A new conc...

  6. Fiscal 1998 achievement report on regional consortium research and development project. Venture business fostering regional consortium research and development--Creation of key industries (Consortium research on photonics for sensing); 1998 nendo photonics sensing ni kansuru consortium kenkyu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    For the purpose of developing photonic sensors capable of ultrawide-range, ultrahigh-sensitivity, and high-speed processing, studies are conducted about organic nonlinear optical crystals. DAST (4-dimethylamino-N-methyl-4-stilbazolium p-toluenesulfonate) is taken up, which is an organic pigment capable of nonlinear optical performance superior to that of lithium niobate. In the research on {pi}-conjugate systems of DAST, more than 20 kinds of novel cations are synthesized, and some molecular species are found to be superior to DAST in performance. An etching technique is contrived, applicable to the processing of optical waveguides of DAST which is soluble in water or organic solvents, and waveguides of the multiple or single mode are manufactured. In the effort to make DAST crystals larger in size and higher in quality, a new crystallization method is employed, and a crystal larger than 15 times 15 times 2mm{sup 3} and equipped with a very flat surface is obtained. Furthermore, a DAST-aided electric field sensor is built, capable of detecting a high-frequency field of 60GH. To assist the designing and synthesizing of novel chemicals, the dipole moment and others are calculated for monomolecular DAST. (NEDO)

  7. Fiscal 1998 project for research and development of industrial and scientific technologies. Report on the achievements of the 'research and development of an ultimate atom and molecule manipulation technology' (Research and development of an ultimate atom and molecule manipulation technology); 1998 nendo genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho. Genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    This paper reports the achievements in fiscal 1998 on the 'research and development of an ultimate atom and molecule manipulation technology' having been performed by the concentrated research institution established jointly with the National Institute for Advanced Inter-disciplinary Research of the Agency of Industrial Science and Technology, referred to as the 'atom-technology research body'. In improving the calculation methods, development has been launched on a method capable of executing calculations in more realistic time period, substituting the Green function method that consumes a huge amount of time. The research trend survey was performed by visiting and participating with various organizations and academic societies in America and Britain. Development was attempted on a small spin detector for use in a spin polarization scanning electron microscope for high-resolution magnetized section observation. In the development, investigation was made on the relationship between accelerated voltage and the spin detector to obtain the detection efficiency equivalent to or better than that of the conventional mott-spin detector, while aiming at reducing the operation voltage and reducing the dimensions. As a result, it was disclosed that sufficient efficiency may be obtained if such a condition as thickness of the thin gold film is adjusted even at low accelerated voltage. In addition, with an objective to reduce the operation voltage of the small spin detector, an MCP was employed in the detector. (NEDO)

  8. Systems strategies for developing industrial microbial strains

    DEFF Research Database (Denmark)

    Lee, Sang Yup; Kim, Hyun Uk

    2015-01-01

    Industrial strain development requires system-wide engineering and optimization of cellular metabolism while considering industrially relevant fermentation and recovery processes. It can be conceptualized as several strategies, which may be implemented in an iterative fashion and in different...

  9. 507 Developing Industrial and Technological Manpower via ...

    African Journals Online (AJOL)

    sustainable industrial and technological advancement and security for national development. ... industrial/technological manpower for Nigeria is the technical vocational education and ..... Business and Social Sciences, 2 (2), 71-77. Retrieved ...

  10. From powerful research platform for industrial EUV photoresist development, to world record resolution by photolithography: EUV interference lithography at the Paul Scherrer Institute

    Science.gov (United States)

    Buitrago, Elizabeth; Fallica, Roberto; Fan, Daniel; Karim, Waiz; Vockenhuber, Michaela; van Bokhoven, Jeroen A.; Ekinci, Yasin

    2016-09-01

    Extreme ultraviolet interference lithography (EUV-IL, λ = 13.5 nm) has been shown to be a powerful technique not only for academic, but also for industrial research and development of EUV materials due to its relative simplicity yet record high-resolution patterning capabilities. With EUV-IL, it is possible to pattern high-resolution periodic images to create highly ordered nanostructures that are difficult or time consuming to pattern by electron beam lithography (EBL) yet interesting for a wide range of applications such as catalysis, electronic and photonic devices, and fundamental materials analysis, among others. Here, we will show state-of the-art research performed using the EUV-IL tool at the Swiss Light Source (SLS) synchrotron facility in the Paul Scherrer Institute (PSI). For example, using a grating period doubling method, a diffraction mask capable of patterning a world record in photolithography of 6 nm half-pitch (HP), was produced. In addition to the description of the method, we will give a few examples of applications of the technique. Well-ordered arrays of suspended silicon nanowires down to 6.5 nm linewidths have been fabricated and are to be studied as field effect transistors (FETs) or biosensors, for instance. EUV achromatic Talbot lithography (ATL), another interference scheme that utilizes a single grating, was shown to yield well-defined nanoparticles over large-areas with high uniformity presenting great opportunities in the field of nanocatalysis. EUV-IL is in addition, playing a key role in the future introduction of EUV lithography into high volume manufacturing (HVM) of semiconductor devices for the 7 and 5 nm logic node (16 nm and 13 nm HP, respectively) and beyond while the availability of commercial EUV-tools is still very much limited for research.

  11. Photonics Research and Development

    Energy Technology Data Exchange (ETDEWEB)

    Dickson, Elizabeth [UNLV Research Foundation, Las Vegas, NV (United States)

    2010-01-15

    energy efficiency and lower costs for display and lighting applications (UNLV College of Engineering); (2) advancing green LED technology based on the Indium-Gallium-Nitride system (BU), thus improving conversion efficiencies; (3) employing unique state-of-the-art X-ray, electron and optical spectroscopies with microscopic techniques to learn more about the electronic structure of materials and contacts in LED devices (UNLV College of Science); (4) establishing a UNLV Display Lighting Laboratory staffed with a specialized team of academic researchers, students and industrial partners focused on identifying and implementing engineering solutions for lighting display-related problems; and (5) conducting research, development and demonstration for HSL essential to the resolution of technological barriers to commercialization.

  12. Research and development and management of technology

    International Nuclear Information System (INIS)

    Kim, Yeong Gil

    1989-04-01

    This book mentions current state of affairs on research and development and prospect : activity of business, field like information and materials, energy and resource, public welfare, general industry technology. It introduces policy on promotion of research and development such as propel of special research and development business, propel strategy for 10 priority tasks, reinforcement of basic research, promotion of information industry and propel for technical development of business.

  13. Industry and forest wetlands: Cooperative research initiatives

    International Nuclear Information System (INIS)

    Shepard, J.P.; Lucier, A.A.; Haines, L.W.

    1993-01-01

    In 1989 the forest products industry responded to a challenge of the National Wetlands Policy Forum to initiate a cooperative research program on forest wetlands management organized through the National Council of the Paper Industry for Air and Stream Improvement (NCASI). The objective is to determine how forest landowners can manage wetlands for timber production while protecting other wetland functions such as flood storage, water purification, and food chain/wildlife habitat support. Studies supported by the NCASI in 9 states are summarized. Technical support on wetland regulatory issues to member companies is part of the research program. Since guidelines for recognizing wetlands for regulatory proposed have changed frequently, the NCASI has recommend an explicit link between wetland delineation and a classification system that considers difference among wetland types in vegetation, soils, hydrology, appearance, landscape position, and other factors. 16 refs

  14. Research and development project in fiscal 1989 for fundamental technologies for next generation industries. Achievement report on research and development on high-efficiency polymer separating film materials; 1989 nendo kokoritsu kobunshi bunrimaku zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    With an objective to improve efficiency and energy conservation in separation processes used in the chemical industry, researches have been performed on high-efficiency liquid separating film and air separating film materials. This paper summarizes the achievements in fiscal 1989. With regard to molecule recognizing films, researches were made on oxygen and carbon monoxide carriers, and on the elementary technology for fabricating the carrier films. In the research of metal complex fixing thin films, discussions were given on causes for deactivation in complex films. In the research of high-functional complex films, discussions were given on the structure of polymer ligand/carrier complex system solid films, and on oxygen adsorption and desorption properties. Solid film structures were selected that suit the oxygen separating films. In the research of alcohol condensation films, discussions were given on polydimethylsiloxane constituent that shows ethanol selectivity and permeability, and a multi-phase system polymeric film composed of one other constituent. In the research of water-acetic acid separating films, the basic performance of polyurea film was discussed, and evaluation was given by means of a durability test. In the research of particle separation method utilizing liquid films, a prototype continuous particle separating device was fabricated. (NEDO)

  15. Canberra semiconductor, an industrial partner for physics research

    International Nuclear Information System (INIS)

    Verplancke, J.; Burger, P.; Schoenmaekers, W.

    1990-01-01

    Canberra semiconductor produces germanium and silicon solid state detectors for nuclear radiation. Its business domain covers the production of standard detectors on an industrial basis, for industrial and applied physics applications, as well as the development of special detectors and electronics, tailored to the needs of a particular application, in science and research. There exists an important and beneficial interaction between these two activities. (orig.)

  16. OPPORTUNITIES OF DEVELOPING TOURISM INDUSTRY IN BANGLADESH

    Directory of Open Access Journals (Sweden)

    Tayub CHOWDHURY

    2009-12-01

    Full Text Available Tourism appeal includes natural places like beaches, eco-parks, lakes, valleys, rivers, islands etc., archeological sites, historic mosques and monuments, resorts, picnic spots, forest and wildlife. Bangladesh is a riverine country having attractive panoramic beauty. There are hills, valley, canals, lake, eco-park and mangrove forests, rivers, so many islands and the longest beach in the world. In this country, the scope of nature based tourism, resource based tourism, culture based tourism and eco-tourism is quite evident. Bangladesh is trying hard to develop its tourism industry. Therefore the whole situation deserves to be seen from right perspectives. Role of government is positive since the last twenty years both private and public organizations have come forwarded to attract the local and foreign tourists. The cracks of problem could not identify accurately because of the paucity number of researches and investigations in our country. Developed and organized tourism industry could change the economic condition and contribute a big share in the GDP of Bangladesh. This study will impede the opportunities of developing tourism industry in the light of existing resources.

  17. Catalysts development for Venezuelan oil industry

    International Nuclear Information System (INIS)

    1999-01-01

    Since the beginning of technical activities at PDVSA Intevep, Catalysis became a fact. As the technological affiliate of the Venezuelan Oil Industry, its rol in this area has been oriented towards the refining and petrochemical needs of that industry. In doing so, the whole set of activities dealing with basic research, development and consulting has lead to keep in force such a topic along our history. This work describes these activities, the infrastructure which supported it and the most relevant results, both those which have reached commercial level together with those holding that potential through a valid patent. As can be seen, this country relay on a corporation capable of generating catalytic technologies to satisfy its needs, within a wide range of applications. PDVSA Intevep has been exhaustively working with that orientation from the knowledge creation through the technology transfer of our products to the operational units

  18. Sustainable urban development and industrial pollution

    Directory of Open Access Journals (Sweden)

    Petrović Julka

    2016-01-01

    Full Text Available Sustainable development of cities is highly connected with the pollution generated from industrial facilities and power plants. Both affect quality of air, weather, health and quality of life. The main goal of this paper is to determine the impact of selected weather parameters on the pollution from mentioned plants. From the research results, it can be concluded that sustainable urban development and welfare of citizens are dependent on causal relationship between pollution and weather. The greatest level of impact was recorded for nitric dioxide. In the case of carbon monoxide, the level of impact is the middle. The lowest level was recorded for particulate matter. The biggest impact on the carbon monoxide emission and particulate matter is that of air pressure, whereas temperature has the biggest impact on nitrogen dioxide emission. The research shows that air humidity and wind speed do not have a significant impact on the emission of pollutants from the plants. Research shows need for further studies in the field of impact of pollution from industry on urban weather and human health.

  19. Chaos theory perspective for industry clusters development

    Science.gov (United States)

    Yu, Haiying; Jiang, Minghui; Li, Chengzhang

    2016-03-01

    Industry clusters have outperformed in economic development in most developing countries. The contributions of industrial clusters have been recognized as promotion of regional business and the alleviation of economic and social costs. It is no doubt globalization is rendering clusters in accelerating the competitiveness of economic activities. In accordance, many ideas and concepts involve in illustrating evolution tendency, stimulating the clusters development, meanwhile, avoiding industrial clusters recession. The term chaos theory is introduced to explain inherent relationship of features within industry clusters. A preferred life cycle approach is proposed for industrial cluster recessive theory analysis. Lyapunov exponents and Wolf model are presented for chaotic identification and examination. A case study of Tianjin, China has verified the model effectiveness. The investigations indicate that the approaches outperform in explaining chaos properties in industrial clusters, which demonstrates industrial clusters evolution, solves empirical issues and generates corresponding strategies.

  20. Ways of Light Industry Development

    Institute of Scientific and Technical Information of China (English)

    Tang Jintao

    2009-01-01

    @@ "The planning of the right industry restructuring and revitalization" was officially released on May 18th this year. This planning mainly includes food, cereals, oil, batteries, leather, paper, fermentation, brewing, sugar refining and home electrical appliances. As a response to a comprehensive action plan, the planning period is from 2009 to 2011.

  1. Theoretical-methodical Fundamentals of industrial marketing research

    OpenAIRE

    Butenko, N.

    2009-01-01

    The article proves the necessity to research theoretical and methodical fundamentals of industrial marketing and defines main key aspects of relationship management with the customers on industrial market.

  2. Research and development of basic technologies for next-generation industries. Evaluation of 2nd phase research and development of technologies of mass culture of cells; Jisedai sangyo kiban gijutsu kenkyu kaihatsu saibo tairyo baiyo gijutsu. Dainiki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1987-03-30

    The project aims to establish basic technologies for the mass culture of cells which will enable a large, stable supply of fine chemical products whose industrial production the conventional technique of synthesis has failed to realize. In the 1st phase, cell stains were selected, a serumless medium was developed, basic culturing conditions were established, and substances production rates were improved, and the 2nd phase stands succeeding these 1st phase achievements. Toward the ultimate goal of establishing basic technologies for serumless high-density cultures for industrial use and technologies for isolating and refining useful substances, a small-scale optimum culture technique and a serumless culture technique are developed. Serumless cultures are developed for strains of man's lymphoid cells, cells deriving from bone marrow, epithelial cells, and hybridomas of man and mouse, all these sampled during the 1st phase endeavors. Success is attained in growing each cell strain on a scale of 1-10L to increase to 10{sup 7} cells/ml or more in population density. It is found that each cell strain produces useful substances, such as man's monoclonal antibodies and elements involved in the multiplication or differentiation of new cells. (NEDO)

  3. Research and development of basic technologies for next-generation industries. Evaluation of 2nd phase research and development of technologies of mass culture of cells; Jisedai sangyo kiban gijutsu kenkyu kaihatsu saibo tairyo baiyo gijutsu. Dainiki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1987-03-30

    The project aims to establish basic technologies for the mass culture of cells which will enable a large, stable supply of fine chemical products whose industrial production the conventional technique of synthesis has failed to realize. In the 1st phase, cell stains were selected, a serumless medium was developed, basic culturing conditions were established, and substances production rates were improved, and the 2nd phase stands succeeding these 1st phase achievements. Toward the ultimate goal of establishing basic technologies for serumless high-density cultures for industrial use and technologies for isolating and refining useful substances, a small-scale optimum culture technique and a serumless culture technique are developed. Serumless cultures are developed for strains of man's lymphoid cells, cells deriving from bone marrow, epithelial cells, and hybridomas of man and mouse, all these sampled during the 1st phase endeavors. Success is attained in growing each cell strain on a scale of 1-10L to increase to 10{sup 7} cells/ml or more in population density. It is found that each cell strain produces useful substances, such as man's monoclonal antibodies and elements involved in the multiplication or differentiation of new cells. (NEDO)

  4. Physics and Industrial Development - Proceedings of the 2nd International Conference on Physics and Industrial Development

    Science.gov (United States)

    Gazzinelli, R.; Moreira, R. L.; Rodrigues, W. N.

    1997-04-01

    The Table of Contents for the full book PDF is as follows: * Preface * Sponsors * Committees * Opening Lecture * Relations between Science and Industry in Brazil * Technological Change and Economic Development * Science and Economic Development * Recent Technological Change and Industrial Dynamics * Technology and Economic Development: Suitability of the Institutional System of Minais Gerais * Bridging the Gap * Transfer of Scientific Results into Industry: A Controversial Problem in Central and Eastern Europe * Bridging the Gap Between Basic Research and Industrial Development at the J. STEFAN Institute * Liquid Crystals: A Case Study of the Interaction Between Science and Application * Role of Physics in the Modern Industrialization Process of Korea * Research in Industry * A Theoretical Physicist's 21-Year Experience in the Argentine Industry * Four Characters in Search of a Profession * Status and Prospects for the Use of Renewable Sources of Energy in Minas Gerais State-Brazil * University-Industry Cooperation I * Development and Industrialization of Fiber Optics Metrology Equipment * Finnish Experiences on University-Industry Collaboration in Materials Science and Physical Metallurgy * A Conceptual Framework for Understanding the Interaction between Academic Research and Industry * Technological Modernization of the Alkaline Cooking Process for the Production of Masa and Tortilla * The Fapergs Program on University Versus Private Enterprise * Integral Development Centers: Tying Mexican Industry With the National Polytechnic Institute * Materials Characterization and Applied Physics * Imaging Manganese Sulfide Inclusions in Grain Oriented Silicon Steels * Electrical Resistivity Changes Associated to Static Strain Aging in High Carbon Steel * PVD Hard Coatings for Wear Applications * Scanning Acoustic Microscopy: Application to Porous Materials * Indentation Testing of Thennal Sprayed WC-Co * Applications of Capillary Electrophoresis with Laserinduced

  5. US Energy Industry Financial Developments

    International Nuclear Information System (INIS)

    1992-09-01

    In the second quarter of 1992, the financial performance of the US petroleum industry continued to deteriorate, as weakening domestic economic growth slowed the demand for refined petroleum products. Net income for 119 petroleum companies--including 19 major oil and gas producers--declined 2 percent between the second quarter of 1991 and the second quarter of 1992, and was down 35 percent for the first 6 months of 1992. Unless otherwise stated, all quarterly comparisons relate to the second quarter of 1992 versus the second quarter of 1991. Weak margins reduce downstream earnings; higher prices increase oil and gas production earnings; industry downsizing improves financial results; oil and gas drilling remains depressed; cool spring helps gas companies but disappoints electric utilities

  6. CREATIV: Research-based innovation for industry energy efficiency

    International Nuclear Information System (INIS)

    Tangen, Grethe; Hemmingsen, Anne Karin T.; Neksa, Petter

    2011-01-01

    Improved energy efficiency is imperative to minimise the greenhouse gas emissions and to ensure future energy security. It is also a key to continued profitability in energy consuming industry. The project CREATIV is a research initiative for industry energy efficiency focusing on utilisation of surplus heat and efficient heating and cooling. In CREATIV, international research groups work together with key vendors of energy efficiency equipment and an industry consortium including the areas metallurgy, pulp and paper, food and fishery, and commercial refrigeration supermarkets. The ambition of CREATIV is to bring forward technology and solutions enabling Norway to reduce both energy consumption and greenhouse gas emissions by 25% within 2020. The main research topics are electricity production from low temperature heat sources in supercritical CO 2 cycles, energy efficient end-user technology for heating and cooling based on natural working fluids and system optimisation, and efficient utilisation of low temperature heat by developing new sorption systems and compact compressor-expander units. A defined innovation strategy in the project will ensure exploitation of research results and promote implementation in industry processes. CREATIV will contribute to the recruitment of competent personnel to industry and academia by educating PhD and post doc candidates and several MSc students. The paper presents the CREATIV project, discusses its scientific achievements so far, and outlines how the project results can contribute to reducing industry energy consumption. - Highlights: → New technology for improved energy efficiency relevant across several industries. → Surplus heat exploitation and efficient heating and cooling are important means. → Focus on power production from low temperature heat and heat pumping technologies. → Education and competence building are given priority. → The project consortium includes 20 international industry companies and

  7. Regional competitiveness and territorial industrial development in Serbia

    Directory of Open Access Journals (Sweden)

    Zeković Slavka

    2009-01-01

    Full Text Available In the paper are investigated the regional competitiveness and the territorial aspects of industry in Serbia. There are analyzed the key recent movement in industrial development of Serbia and macrolocational factors and territorial organization of industry. The research of possible structural changes of industry and identification of its key development sectors is the important component of territorial development analysis in Serbia. This paper points to the kinds and types of industrial zones and industrial parks as fundamental models of regional and urban development of that activity with critical retrospection on the industrial zones in Serbia (greenfield and brownfield industrial locations. There are shown results of evaluation the regional competitiveness from a stand-point of possibilities of industrial development on the regional level (NUTS 3 by comparative analyses and Spider method. Results are used as one of the bases for making preliminary draft of territorial development scenario of this activity in Serbia and for the possible alocation of the future industrial zones and industrial parks in region level.

  8. Research and development project in fiscal 1990 for large industrial technologies. Achievement report on research and development of ultra-advanced processing systems (Research and development of ultra-advanced processing systems); 1990 nendo chosentan kako system no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research and development has been performed with an objective to establish the processing technology using excitation beam required for the advanced industries, and the ultra-precision machining technology to realize the nano-technology. This paper summarizes the achievements in fiscal 1990. In the research on the ultra-precision machining elements, experimental discussions were given on positioning and movement characteristics of static pressure feed screws in an NC equipment, wherein the intermediate target was achieved on rigidity improvement in rotating devices and accuracy in the ultra-precision positioning device. In the research on the thin film forming and laminating technology, a low temperature forming method was completed to form a diamond film at temperatures lower than 400 degrees C on such a substrate as aluminum. In the research of the ion beam surface modifying technology, researches were performed to laminate a silicon nitride layer and a phosphoric glass layer on the glass surface layer, having obtained a result that the modification can be executed in 57 minutes. A method was established to evaluate performance of Si films by measuring movement characteristics of an Si thin film transistor formed on the modified substrate, having achieved the intermediate target. (NEDO)

  9. Non clinical research at CENTIS supporting biotechnological and pharmaceutical industry

    International Nuclear Information System (INIS)

    Hernandez Gonzalez, Ignacio

    2012-01-01

    Drugs production is a highly demanding industry because the rigor of legislations and guidelines. Standards are applied to manufacturing facilities and also to research and development stage. Our national biotechnological industry is developing and producing important medications for diseases like cancer, some of them in the national and international market. Isotopes Centre is an institution supporting such development by means of a work platform to carry out researches in the field of pharmacokinetic and biodistribution in experimental models. Accumulated experience allows us to contribute to research and development of different kind of molecules as pharmaceuticals, specially the biotechnological ones. We are evolving in direction to new technologies and methodologies more suitable to current standards. Radiolabeling is still a convenient choice considering present and new imaging technologies to investigate distribution and kinetic in living subjects. With the techniques we have and the ones to incorporate in a near future, new and more demanding investigations will be affordable. (author)

  10. Global research and development budget

    Energy Technology Data Exchange (ETDEWEB)

    Norman, C

    1980-03-01

    The future political and economic relationships between industrial countries and between the industrial and developing countries will be influenced by the investments now being made for research and development (R and D). There is little public understanding of this $150 billion global investment, 25 percent of which is spent on military programs, 15 percent on basic research, and nearly 10 percent on space exploration, while the most-pressing world problems are receiving relatively little attention. A breakdown of geographic distribution of research and a comparison of government expenditures for different areas of R and D reveals a situation that could be corrected. National and corporate priorities need to be revised and political and institutional barriers must give way to new international and cooperative arrangements. 3 tables, 27 references. (DCK)

  11. Report for fiscal 2000 on surveys on foundation to establish industrial technology strategy. Surveys on foundation to assist activation of research and development; 2000 nendo sangyo gijutsu senryaku sakutei kiban chosa hokokusho. Kenkyu kaihatsu kasseika shien kiso chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    In order to help discuss the measures to activate researches and developments in private corporations, surveys were made on barriers and factors related to industrial technology research and development by fields, and discussions were given on structuring research and development models. Factors impeding research and development processes relate to a case of each phase in the fundamental research, applied research, and product development, and a case of human resources, funds and information. A policy of structuring models was determined to make quantitative the effects of different aiding systems of the government for researches and developments in private corporations. Case analyses were conducted by using a pilot model. In the present research, a questionnaire survey was carried out to acquire such data as R and D time lag, and to identify the effects of the policies. Surveys were also performed on research and development programs in North America, by making interviews to concerned corporations. As a result of the surveys, such problems were extracted as research and development fund, freer flow of human resources, research and development systems, handling of results of researches performed by consortiums, accounting systems, and sale of the government owned patents. (NEDO)

  12. Research and development of basic technologies for next generation industries, 'high-performance crystalline controlled alloys'. Evaluation on final research and development (first report); Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Koseino kessho seigyo gokin (saishu kenkyu kaihatsu hyoka 1)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-05-01

    The present research work has been performing research and development of the following alloys: (1) 'single crystalline alloy' , the entire alloy being composed of one crystal eliminating crystalline boundaries as an ultra heat resistant alloy with emphasis placed on improvement in particularly the creep properties, and 'particle dispersion strengthened alloy', in which ultrafine particles of oxides are dispersed uniformly; and (2) 'ultra heat resistant and tough alloy' targeted at high-temperature toughness by using Ni-group allowing ultra plasticity forging processing by micronizing crystal particles, as an ultra plastic and highly tough alloy having better processibility than conventional alloys, and 'light-weight highly tough alloy' aimed at achieving light weight and high toughness by using Ti-group. Achievements derived from the present research and development may be summarized as follows: in alloy development, alloys having performance of the world's highest level or equivalent have been developed; a manufacturing technology to make products with complex shapes has been established by using the alloy material manufacturing technology and the alloy materials developed therefrom, where prototype components of such shapes as turbine blades and turbine disks for jet engines were fabricated successfully; and the big fruit obtained was that a large number of technological experiences were acquired from this research and development. (NEDO)

  13. Promotional operation for developing industrial technologies for global environment in fiscal 1998. International research exchange operation; 1998 nendo chikyu kankyo sangyo gijutsu kaihatsu suishin jigyo. Kokusai kenkyu koryu jigyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    With an objective of creating a new scope of study intended of solving global environment problems and structuring a new technical system, exchanges with overseas researchers and research institutions have been carried out subsequent to those in last year. In fiscal 1998, six researchers from different countries were invited to implement joint researches, and two overseas researchers were invited to an international conference on industrial technologies for global environment. In addition, in order to identify trends of research and development in overseas countries, two researchers were sent to universities in Germany and the U.S.A., and three researchers to international conferences and symposiums on the industrial technologies for global environment. It was intended to exchange technological information between overseas researchers and Japanese researchers who are performing the advanced researches on the industrial technologies for global environment, and to proliferate the latest items of technological information. Therefore, seven international seminars have been held, including the '98 Japan-China Global Environment Protection Symposium, 'substance migration and carbon circulation in coral reefs', 'plant bio-technologies in the 21st century', and the Fourth International Forum for Environmental Catalysts. (NEDO)

  14. Promotional operation for developing industrial technologies for global environment in fiscal 1998. International research exchange operation; 1998 nendo chikyu kankyo sangyo gijutsu kaihatsu suishin jigyo. Kokusai kenkyu koryu jigyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    With an objective of creating a new scope of study intended of solving global environment problems and structuring a new technical system, exchanges with overseas researchers and research institutions have been carried out subsequent to those in last year. In fiscal 1998, six researchers from different countries were invited to implement joint researches, and two overseas researchers were invited to an international conference on industrial technologies for global environment. In addition, in order to identify trends of research and development in overseas countries, two researchers were sent to universities in Germany and the U.S.A., and three researchers to international conferences and symposiums on the industrial technologies for global environment. It was intended to exchange technological information between overseas researchers and Japanese researchers who are performing the advanced researches on the industrial technologies for global environment, and to proliferate the latest items of technological information. Therefore, seven international seminars have been held, including the '98 Japan-China Global Environment Protection Symposium, 'substance migration and carbon circulation in coral reefs', 'plant bio-technologies in the 21st century', and the Fourth International Forum for Environmental Catalysts. (NEDO)

  15. Research and development of CRIEPI

    International Nuclear Information System (INIS)

    Akita, Shirabe

    2008-01-01

    Central Research Institute of Electric Power Industry (CRIEPI) reported its R and D of nuclear power technologies. The research results of light water reactor aging deterioration contain the estimation method of irradiation embrittlement of pressure vessel, stress corrosion cracking of piping and core internal structure, and pipe thinning. The backend project support researches include transpiration and storage of recycle fuel, the high-level radioactive waste disposal and low-level radioactive waste disposal. Safety of concrete cask storage was confirmed by the falling test, SCC test and vibration test. The researches for the next generation nuclear technologies have developed the pyrochemical reprocessing process for the metal fuel and oxide fuel, and development of metal fuel with U, Pu and Zr. Assist management of development of fast reactor is proceeding. One of researches of radiation safety is on low dose X-ray bystander effect on the diabetes mellitus of model mouse. (S.Y.)

  16. The industrial development of atomic energy

    International Nuclear Information System (INIS)

    Kowarski, L.

    1955-01-01

    Countries with large stock of fissile material and producing large quantity of nuclear pure 235 U and 239 Pu are able to allocate part of the stock to non military research. For countries with low stock of fissile material, all the stock is allocated to military research. An economical and technical solution has to be find to dedicate a part of fissile material to non military research and develop the atomic energy industry. It stated the industrial and economical problems and in particular the choice between the use of enriched fuel with high refining cost or depleted fuel with low production cost. It discusses of four possible utilizations of the natural resources: reactors functioning with pure fissile material ( 235 U or 239 Pu) or concentrated material ( 235 U mixed with small quantities of 238 U after an incomplete isotopic separation), breeder reactors functioning with enriched material mixed with 238 U or Thorium placed in an appropriate spatial distribution to allow neutrons beam to activate 238 U or Thorium with the regeneration of fissile material in 239 Pu, reactors using natural uranium or low enriched uranium can also produce Plutonium with less efficiency than breeder reactors and the last solution being the use of natural uranium with the only scope of energy production and no production of secondary fissile material. The first class using pure fissile material has a low energy efficiency and is used only by large fissile material stock countries to accumulate energy in small size fuel for nuclear engines researches for submarines and warships. The advantage of the second class of reactors, breeder reactors, is that they produce energy and plutonium. Two type of breeder reactor are considered: breeder reactor using pure fissile material and 238 U or breeder reactor using the promising mixture of pure fissile material and Thorium. Different projects are in phase of development in United States, England and Scotland. The third class of reactor using

  17. How Researchers Use Social Media to Promote their Research and Network with Industry

    Directory of Open Access Journals (Sweden)

    Päivi Jaring

    2017-08-01

    Full Text Available Social media is now an essential information and interaction channel. Companies advertise and sell their products and services through social media, but this channel has not been so commonly applied to the task of selling knowledge and research work. This article studies the use of social media by researchers to promote their research and network with product developers in industry, and it presents a model of the use of social media by researchers. The data for this research was obtained by interviewing individual researchers of a research organization and surveying product developers from industry. The findings show that social media is seen as a good source of new information and contacts, and it is suitable for promoting awareness of research services and results. The results show that the speed and intensity of social media present challenges for researchers, but by being active in posting content and participating in discussions, researchers can derive benefits and enhance their personal reputations.

  18. FY 1992 Report on the results of the research and development project for the industrial base technologies of the next generation. Research and development of nonlinear optoelectronic materials; 1992 nendo hisenkei hikari denshi zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1993-03-01

    Described herein are the FY 1992 results of the research and development project for the optoelectronic materials. The FY 1992 is the last year for the phase-I project of the basic plan, and the results are evaluated mainly viewed from extent of attainment of the interim targets. For the organic materials, the highly unique chiral nonlinear compounds are further developed, and direction for the investigations of the conjugated low-molecular-weight compounds is established. The excellent high-molecular-weight films are developed. For the dispersed materials, those developed include CuCl-dispersed glass, CdTe laminated glass developed by the laser evaporation method, glass dispersed with semiconductors at high concentrations, and dispersed materials with high-molecular-weight materials as the matrices. For the material development, those technologies investigated are orientation controlling of the crystals for thin organic films, and development of superlattices. A total of 9 research themes are recommissioned to 9 enterprises. They include organic, low-molecular-weight materials, growth of orientation-controlled crystals, films of high-molecular-weight organic conjugated compounds, glass-dispersed materials (prepared by the vapor-phase, impregnation of porous glass, sol-gel, superlow-melting glass and super-cooling methods), organic dispersed materials, development of the organic superlattices, and development of the three-dimensional superstructures. (NEDO)

  19. Research and development of the industrial basic technologies of the next generation, 'composite materials (resin-based)'. Evaluation of the first phase research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'fukugo zairyo (jushikei)'. Daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1984-03-30

    The results of the first phase research and development project for developing the resin-based composite materials as the basic technologies of the next generation are evaluated. This project is aimed at development of the resin-based composite materials as light, high-strength and high-rigidity structural materials. Development of the basic techniques for these materials is of high significance, and highly rated. The first R and D phase efforts are directed to synthesis of new skeleton and terminal compounds, and their introduction into the matrices; application/combination of various fiber surface modification techniques; development of the basic techniques for intermediate materials for three-dimensional fabrics, triaxial fabrics and hybrid materials; improvement of the main techniques for a series of molding/processing steps; adoption of new methods; and development of design programs and elementary design techniques. The technical targets of improving functions of each item have been achieved, or bright prospects have been obtained therefor, each involving potentials of functional improvements by developing new functions. It is also considered that the parallel, competitive development and promotion of 7 routes in researches on the matrix resins have brought great effects. (NEDO)

  20. Industrial development in Indonesia - key data

    International Nuclear Information System (INIS)

    Gocht, W.

    1993-01-01

    In the case of Indonesia 3 goals in particular were linked to the industrial process: to improve the balance of payments, to reduce unemployment and to develop remote regions. Thus, development plans and official development policy have not adopted merely one strategic approach to industrialization, but have combined several: export diversification, promition of labour-intensive, small-scale and large-scale enterprises, and industrial production linked to basic needs. In 1991 the KfW gave financial support to the following projects: transformer plant and Suralaya, railway investment programme, electricity transmission system Krian-Paiton, supply of 3 ferries, staff development fund III. (BWI) [de

  1. Technology Roadmap Research Program for the Steel Industry

    Energy Technology Data Exchange (ETDEWEB)

    Joseph R. Vehec

    2010-12-30

    The steel industry's Technology Roadmap Program (TRP) is a collaborative R&D effort jointly sponsored by the steel industry and the United States Department of Energy. The TRP program was designed to develop new technologies to save energy , increase competitiveness, and improve the environment. TRP ran from July, 1997 to December, 2008, with a total program budget of $38 million dollars. During that period 47 R&D projects were performed by 28 unique research organizations; co-funding was provided by DOE and 60 industry partners. The projects benefited all areas of steelmaking and much know-how was developed and transferred to industry. The American Iron and Steel Institute is the owner of all intellectual property developed under TRP and licenses it at commercial rates to all steelmakers. TRP technologies are in widespread use in the steel industry as participants received royalty-free use of intellectual property in return for taking the risk of funding this research.

  2. Report on achievement in the preceding research related to global industry technologies for the global industry technology research and development project. Research on gas systems substituting global warming gases such as PFC used in manufacturing semiconductors; 1998 nendo chikyu kankyo sangyo gijutsu ni kakawaru sendo kenkyu. Handotai seizo nado ni shiyosuru PFC nado no chikyu ondanka gas no daitai gas system no kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    The present semiconductor manufacturing process uses a great amount of PFC having large global warming coefficients and extremely long atmospheric life. A research was made particularly on reduction of its emission from etching processes. After introducing how the semiconductor industry has been working conventionally on protection of the global environment, this paper makes clear the purpose and positioning of this preceding research, as well as how it is moved forward. The paper also reports the results of analyzing and discussing the exhaust gases from etching devices using several kinds of substitute PFC gases. Survey results are reported on the possibilities of new substitute gases, plasma decomposition and treatment of exhaust gases, reaction process simulation, and in-situ analyzing and evaluating technologies. Investigations were made on the possibility of using no PFC in wiring processes which consume greater amount of PFC, as well as on wiring techniques using inter-layer insulation film with low dielectric rate, a new wiring structure forming technology, new functional elements, circuits and systems in a wide range. Proposals were given on specific research and development themes and plans that begin in fiscal 1999. (NEDO)

  3. FY 1990 Report on the results of the research and development project for the industrial base technologies of the next generation. Research and development of nonlinear optoelectronic materials; 1990 nendo hisenkei hikari denshi zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Described herein are the FY 1990 results of the research and development project for the optoelectronic materials, implemented to cope with the highly information-oriented societies. The FY 1990 is the second year for the phase-I project of the basic plan, and the R and D efforts are directed to elucidation of the mechanisms involved in the nonlinear phenomena, exploration and designs of various materials, and investigations of the technologies for, e.g., the material synthesis and evaluation. The themes to be investigated by the long-term project include exploration and preparation of the superfine particles and base materials for the organic materials; and crystal growth, dispersion of the fine particles and development of the superlattices for development of the materials. The comprehensive investigation and research program investigates the trends of the related technologies, both domestic and foreign. A total of 9 research themes are recommissioned to 9 enterprises. They include organic, low-molecular-weight materials, growth of orientation-controlled crystals, films of high-molecular-weight organic conjugated compounds, glass-dispersed materials (prepared by the vapor-phase, impregnation of porous glass, sol-gel, superlow-melting glass and super-cooling methods), organic dispersed materials, development of the organic superlattices, and development of the three-dimensional superstructures. (NEDO)

  4. FY1999 annual report on the research and development on practical industrial cogeneration technology; 1999 nendo sangyoyo cogeneration jitsuyo gijutsu kaihatsu kenkyu seika

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    The basic plan aims to quicken the practical application of the industrial HBGT (hybrid gas turbine) cogeneration technology and thereby to realize high-efficiency energy utilization for reduction in CO2 emission. For this purpose, a medium-scale HBGT, expected to be high in efficiency and low in polluting, and its components are subjected to assessment tests and endurance tests to prove that there are reliability and soundness in HBGT. Ceramic members are developed which are high in strength at elevated temperatures and in resistance to oxidation, and are subjected to assessment so that they will be further improved in reliability and durability. An HBGT is designed, fabricated, and operated. The engine system is tested for performance, and the performance is improved. It is put to a long-term operation, which is to confirm the presence of soundness and reliability in HBGT as an industrial cogeneration system. Industrial fields in which HBGT will be useful are selected and surveys are conducted to find out how it will function in such selected fields. Problems which HBGT will encounter upon practical application are extracted, and measures for solving them are clarified. Such an HBGT will have a shaft output of approximately 8,000kW, engine thermal efficiency of not less than 34%, and a turbine inlet temperature of approximately 1,250 degrees C. (NEDO)

  5. Research and development of basic technologies for next-generation industry. Ultimate evaluation report on research and development of highly efficient polymeric separation membrane material; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Kokoritsu kobunshi bunrimaku zairyo saishu kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-05-01

    For the enhancement of separation process efficiency and energy efficiency in the chemical industry, etc., basic technologies are developed involving high-performance separation membrane materials which are excellent in durability and usable in the field where separation by membranes has been impractical. The liquid mixtures subjected to separation are a neutral organic compound/water system, an acidic organic compound/water system, and a polar organic compound/water system; the gas mixtures subjected to separation are an oxygen/nitrogen system and a carbon monoxide/nitrogen system. After a 10-year/3-phase development endeavors, the initially intended goals are sufficiently achieved. Among those that have to be mentioned is the development of a nonaqueous separation membrane, a supported liquid membrane with amino acid optically active high performance separation capability, a high-precision evaluation unit for gas separation membrane characteristics, a selective permeation membrane with high-level oxygen and carbon monoxide carriers and reactivation technology, a high-performance ethanol separation membrane, a water/polar organic compound separation membrane, and a water/acetic acid separation membrane and stability providing technology. In particular, the water selective permeation membrane for a mixture of water and alcohol has already arrived at the stage of bench plant demonstration. (NEDO)

  6. Research and development project in fiscal 1988 for fundamental technologies for next generation industries. Achievement report on research and development on electrically conductive polymeric materials; 1988 nendo dodensei kobunshi zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    With an objective to develop electric and electronic materials characterized by light weight, high corrosion resistance and easy-to-process performance, and having functions different from those of electricity conduction mechanism of metals, research and development has been performed on fundamental technologies related to electrically conductive polymeric materials. This paper summarizes the achievement in fiscal 1988. In the research of the new hydrocarbon conjugate system polymers, fabrication was performed on the LB film mixed with different dopant molecules and photo-polymerized LB molecules. Discussions were given on their effects on the order and electric conductivity of the film cumulative structure. In the research on the vehicular conjugate system conductive materials, conduction improvement was advanced on PPV and PTV by purification of the primary structure and by identification of the effects of the higher-order structure. Basic knowledge was obtained on continuous manufacture of the graphite film. In the research on thin graphite film synthesized at low temperatures, entire design was made on the thin graphite film low-temperature synthesizing device, whereas the synthesized sections were completed excepting the laser assisted section. In the research of hetero aromatic system polymers, investigation was executed on polypyrrole as to its correlation with gegen ions, higher-order structure, and conductivity. (NEDO)

  7. Research and development project in fiscal 1989 for fundamental technologies for next generation industries. Achievement report on research and development on electrically conductive polymeric materials; 1989 nendo dodensei kobunshi zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    With an objective to develop electric and electronic materials characterized by light weight, high corrosion resistance, and easy-to-process performance, and by having functions different from electricity conduction mechanism of metals, researches have been performed on fundamental technologies for electrically conductive polymeric materials. This paper summarizes the achievements in fiscal 1989. In new hydrocarbon conjugate polymers, researches were performed for the purpose of fabricating the conjugate system polymer and dopant complex system conductive thin films, and polyacene system polymer thin films. In developing the vehicular conjugate conductive materials, discussions were given on enhancing the molecular weight dependence and the conductivity by cross-linking the conjugate system, with regard to hydrocarbon system polymers that go through vehicular polymeric intermediates. In the research of vehicular graphite materials, it was discovered that mono-axial mono-plane PPV films and PTV films are graphitized. In developing the hetero aromatic system polymers, researches were advanced on the correlation among the gegen ions, high-order structures, and electric conductivity, mainly on polypyrrole. (NEDO)

  8. Achievement report on research and development of the industrial basic technologies of the next generation in fiscal 1981. Research and development of composite materials; 1981 nendo jisedai sangyo kiban gijutsu itaku kenkyu kaihatsu seika hokokusho. Fukugo zairyo no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    Described herein are the results of the FY 1981 research and development for composite materials, established by the R and D system for the basic technologies of the next generation. The R and D project for resin-based composite materials involves basic researches on the matrix resins, and surface modification of the reinforcing fibers. The investigations and basic tests are conducted for monolithic molding, other types of molding, and cutting and boring by, e.g., laser beams and water jet. The other related efforts include researches on analysis theories for optimization of strength and rigidity of the composite structures, and development of the optimization programs. For the R and D project for the metal-based composite materials, the efforts are directed to understanding wettability and reactivity of the reinforcing fibers with metals, and development of the techniques for producing various types of preforms and compositing methods. The basic researches are conducted for hot pressing/rolling molding, extrusion/withdrawal, powder molding and melt molding of the composite materials with aluminum alloys as the matrices. The other R and D items include investigations on methods for evaluating qualities for the steps form the stock preparation to production of the final products. (NEDO)

  9. Project to promote the technical development of global environmental industries. International research exchange project; Chikyu kankyo sangyo gijutsu kaihatsu suishin jigyo. Kokusai kenkyu koryu jigyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    Exchanges with researchers/research institutes in overseas countries have an important meaning in promoting the research and development toward the creation of new research fields where the solution to the environmental problem is aimed at and toward the construction of new technological systems. Therefore, under the cooperation of Research Institute of Innovative Technology for the Earth (RITE), and RITE related researchers and societies, given were invitation and dispatch of researchers to international conferences and symposia involved in the global environment related technology, and exchanges with major overseas research institutes/universities. At the same time, based on the short-term invitation and dispatch so far given, a system was established for medium- and long-term dispatch/invitation of researchers who are thought to hold an important position in the future research activities. From the results obtained, domestic and foreign exchanges relating to the latest research could be promoted. In addition, researches in the basic domain related to the global environmental technology were advanced in a variety of fields overseas. The numbers of invitation and dispatch given in fiscal 1995 were 12 and 13, respectively, the results of which were included in this paper. 121 refs., 74 figs., 11 tabs.

  10. Industry Switching in Developing Countries

    DEFF Research Database (Denmark)

    Newman, Carol; Rand, John; Tarp, Finn

    Firm turnover (i.e. firm entry and exit) is a well-recognized source of sectorlevel productivity growth across developing and developed countries. In contrast, the role and importance of firms switching activities from one sector to another is little understood. Firm switchers are likely...

  11. Tobacco industry consumer research on socially acceptable cigarettes.

    Science.gov (United States)

    Ling, P M; Glantz, S A

    2005-10-01

    To describe tobacco industry consumer research to inform the development of more "socially acceptable" cigarette products since the 1970s. Analysis of previously secret tobacco industry documents. 28 projects to develop more socially acceptable cigarettes were identified from Philip Morris, RJ Reynolds, British American Tobacco, and Lorillard tobacco companies. Consumer research and concept testing consistently demonstrated that many smokers feel strong social pressure not to smoke, and this pressure increased with exposure to smoking restrictions. Tobacco companies attempted to develop more socially acceptable cigarettes with less visible sidestream smoke or less odour. When presented in theory, these product concepts were very attractive to important segments of the smoking population. However, almost every product developed was unacceptable in actual product tests or test markets. Smokers reported the complete elimination of secondhand smoke was necessary to satisfy non-smokers. Smokers have also been generally unwilling to sacrifice their own smoking satisfaction for the benefit of others. Many smokers prefer smoke-free environments to cigarettes that produce less secondhand smoke. Concerns about secondhand smoke and clean indoor air policies have a powerful effect on the social acceptability of smoking. Historically, the tobacco industry has been unable to counter these effects by developing more socially acceptable cigarettes. These data suggest that educating smokers about the health dangers of secondhand smoke and promoting clean indoor air policies has been difficult for the tobacco industry to counter with new products, and that every effort should be made to pursue these strategies.

  12. Research and development of the industrial basic technologies of the next generation, 'composite materials (metal-based)'. Evaluation of the first phase research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'fukugo zairyo (kinzokukei)'. Daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1983-03-31

    The results of the first phase research and development project for developing the metal-based composite materials as the basic technologies of the next generation are evaluated. For development of highly functional materials, the efforts are directed to understanding the basic characteristics regarding wettability and reactivity of PAN-based carbon fibers and PCS-based silicon carbide fibers with metals, in which aluminum-based matrices are considered; preliminary tests for various composting methods; and development of wire preforms as the intermediate materials. Bright prospects have been obtained for improving problems involved in each technique. For development of molding/processing techniques, basic researches have been conducted for hot pressing/rolling, extrusion/withdrawal, powder molding and melt molding, using various reinforcing fibers. Bright prospects have been also obtained for combinations of adequate molding processes for individual materials. For development of design techniques, the basic data regarding mechanical characteristics of FRMs, both domestic and foreign, are collected, and analyzed by the trace tests with specimens, to set up the targets for FRM function improvements, viewed from the designs. (NEDO)

  13. Research and development of the industrial basic technologies of the next generation, 'composite materials (quality evaluation techniques)'. Evaluation of the first phase research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'fukugo zairyo (hinshitsu hyoka gijutsu)'. Zenki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-03-30

    The results of the first phase research and development project for developing composite materials as the basic technologies of the next generation are evaluated, and the directions of the R and D evaluation for the second phase are set up. The efforts in the first-phase R and D project are aimed at development of methods for measuring carbon fiber surface structure elements; confirmation of the relationship between adhesive shear strength and active surface area; development of methods for determining fracture toughness by standard specimens; estimation of allowable void fraction for inter-layer shear strength; defect detection and quality evaluation by electromagnetic, ultrasonic, laser holography and AE methods; development of methods for detecting resin setting reactions during the molding processes; and understanding deteriorated mechanical characteristics of the resin-based composites by environmental factors, among others. The objectives of the first-phase project have been almost achieved. It is decided that the second-phase R and D project are directed to investigations on the relationship between surface properties of the fibers in the composites and fiber/matrix adhesion; researches on mechanical characteristics involved in fracture of the structural elements; evaluation of mechanical properties of the metal-based composites and investigations on detecting their defects; elucidation of the effects of environmental factors on their strength; and development of the techniques for integrating detection of molding-induced cracking and that of setting reactivity, among others. (NEDO)

  14. Oil and gas industry, exploration and development

    International Nuclear Information System (INIS)

    Appert, O.

    1998-01-01

    A consistent investment boost on exploration and development, the favourable prospects connected with technological improvement, the opening of virgin areas of exploration are all factors granting extraordinary opportunities for the oil and gas industry. However, environmental constraints relevant to emission standards and products quality are also growing and will be increasingly binding upon both oil and car industries [it

  15. Development of tungsten collimators for industrial radiography

    International Nuclear Information System (INIS)

    Varkey, P.A.; Verma, P.B.; Jayakumar, T.K.; Mammachan, M.K.

    2001-01-01

    Collimators are essential components of industrial radiography set up as it provides radiation safety to persons involved in the radiography work. A collimator with optimum design features also helps in reducing the scattered radiation which in turn results in radiographs having better sensitivity. This papers describes the salient design features of the tungsten collimators developed by the BRIT, for industrial radiography. (author)

  16. Evolution of civil aircraft industry development

    Directory of Open Access Journals (Sweden)

    Aram I. Afyan

    2017-01-01

    Full Text Available Civil aircraft industry market is а complex multistage system of manufacturers and consumers, which affects countries all over the world. The globalization and world economic growth caused inevitable merger of national markets into one system where the key role belongs to few corporations. In the article the author analyze peculiarities of civil aircraft industry global market shaping. Main reasons of aircraft industry centers appearance are considered through socio political and economic development of the industry. Factors that caused national specialization of manufacturing countries are examined along with peculiarities of Boeing leadership. The main stages of the industry development are described starting from the beginning of the 20th century up to the present day. The author highlights specific characters of European manufacturers development and their merger into one multinational conglomerate. Besides, modern market status is examined through benchmark study of the main competitors. Main tendencies of the industry are segmentation and new aviation industry clusters appearance. Key actors of regional aviation are described, which are Embraer and Bombardier. Reasons of their appearance and development are analyzed. Main pretenders for the aviation industry global market entrance are outlined.

  17. Project in fiscal 1988 for research and development of basic technologies in next generation industries. Achievement report on research and development of bio-reactors; 1988 nendo bio reactor no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    Research and development has been performed on bio-reactors to substitute the oxidizing reaction process, and on reduction reacting bio-reactors to fix the coenzyme regeneration system. This paper summarizes the achievements in fiscal 1988. In the research of a bio-reactor using bacteria that produce muconic acid from benzoic acid, stable productivity of 60 g/L/day or more was obtained. In the research of a multi-phase based bio-reactor composed of air, oil, water and biomass, discussions were given on the phase inverting film permeation type reactor. In the research of a bio-reactor to produce acetic acid from carbon dioxide and hydrogen, productivity of 149 g/L/day as maximum was achieved by enhancing the production speed by means of pressurization. In the research of a bio-reactor to produce hydroquinone from phenol, up-keeping the duration for 100 hours or longer has become possible at the hydroquinone production speed of 3 g/L/h. In the research of a reduction-based bio-reactor incorporating the regeneration system of coenzyme NAD(P)H, discussions were given on optimizing the continuous enzymatic reaction in the production of sorbitol. (NEDO)

  18. Research and development of the industrial basic technologies of the next generation, 'composite materials (metal-based)'. Evaluation of the second phase research and development; Jisedai sdangyo kiban gijutsu kenkyu kaihatsu 'fukugo zairyo (kinzoukei)'. Dainiki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1986-03-31

    The results of the second phase research and development project for developing the metal-based composite materials as the basic technologies of the next generation are evaluated. For development of highly functional materials, the efforts are directed to modification of PAN-based high-strength carbon fibers for aluminum-based FRMs, and also to development of the methods for controlling interfacial reactions at high temperature by modification of the base materials for titanium-based FRMs. For development of carbon fiber-based intermediate materials, the techniques are developed for continuous production of wire preforms of aluminum. For development of molding/processing techniques, the press molding and powder HIP molding techniques are developed to give a planar product of the FRM of titanium alloy reinforced with evaporated filaments of silicon carbide, which shows an average tensile strength exceeding the target level. Also developed are the press and roll molding techniques for the wire preforms of aluminum reinforced with silicon carbide fibers, the planar product therefrom showing a tensile strength of at least 99% of the base material. It is concluded that the objectives of the second-phase project are almost achieved. (NEDO)

  19. Sustainable Development of Geothermal Industry in China: An Overview

    Directory of Open Access Journals (Sweden)

    Xu Bang

    2016-01-01

    Full Text Available With a wide distribution, large reserves, low cost, sustainable energy use and environmental protection and other unparalleled advantages, geothermal energy resources is important for China’s energy structure adjustment, energy conservation and environment improvement. Currently, geothermal utilization in China is still in its infancy, and Sustainable Development of the geothermal industry is also having a lot of problems. In this paper, the current research on sustainable development of geothermal industry focuses on two aspects: 1. the current situation of geothermal industry development and existing problems, 2. the current situation of sustainable development of the geothermal industry. On the basis of the review, some suggestions for further study on the sustainable development of geothermal industry are put forward.

  20. Industrie 4.0 - from the perspective of applied research

    OpenAIRE

    Neugebauer, R.; Hippmann, S.; Leis, M.; Landherr, M.

    2016-01-01

    Industrie 4.0 is the German description for the 4th industrial revolution. While in Germany "Industrie 4.0" aims at putting the strong German manufacturing industry in a position of future readiness through integrated digitization, for the ICT-dominant USA, "Smart Manufacturing" is ought to revive the country's re-industrialization. Fraunhofer, a major European Research and Technology Organization (RTO), has a strong focus on Industrie 4.0 technologies throughout the whole production value ch...

  1. FY 1999 Report on research and development project results of industrial science and technology. Research and development of quantum functional devices; 1999 nendo ryoshika kino soshi no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Described herein are the FY 1999 research and development results of quantum functional devices. This project is aimed at establishment of the basic technologies related to quantum functional devices, which utilize various quantum mechanical effects appearing in superfine regions, for development of the microelectronics technologies serving as the bases for superhigh-speed, superhigh-function information processing. The technologies are developed for advancing the elementary devices by quantum functions and development of integrated devices. The results include development, on a trial basis, of the world smallest MOS transistor with a gate length of 10 nm or less and analysis of its behavior, improved characteristics of the tunnel devices, and development, on a trial basis, of a semiconductor memory working based on the principle of single electron capturing/releasing and evaluation thereof. The device-building techniques are developed. The results include demonstration of the logic circuit which controls a small number of electrons, and development of an opto-electronic device on a trial basis, which are the world first results. Progresses are noted in confirmation of behavior of the 3-value basic logic circuit which uses an InGaAs-based tunnel device, demonstration of behavior of the SRAM circuit which uses ME-RHET device, confirmation of possibility of terabit-size memory integration, advancing performance of the quantum MMIC, and designs of the single electron-CMOS integrated circuit. (NEDO)

  2. Research and development of basic technologies for the next generation industries, 'three-dimensional circuit elements'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'sanjigen kairo soshi'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-04-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to three-dimensional circuit elements that integrate functions at ultra-high density. For the basic technology of lamination, the SOI technology suitable for the three-dimensional circuit elements was developed, and it has become possible to manufacture high-quality multi-layered crystalline structure by means of annealing that uses laser and electron beam. In addition, a lateral epitaxial technology for solid phase was developed, and the base to be applied to the three-dimensional circuit elements was established. Furthermore, the technology to put thin film circuits together would be useful for high-density integration in the future. The three-dimensional circuit makes parallel processing in each segment possible, whereas a possibility was shown that the processing can be performed at much higher speed than before. Actually a prototype three-dimensional circuit equipped with functions for parallel processing and judgment processing was fabricated. The image pre-processing which has been impossible on the real time basis in the conventional two-dimensional integrated circuit was realized in a speed as fast as milli-second order. These achievements lead to a belief that the targets for the present research and development have been achieved. (NEDO)

  3. Fiscal 1990 achievement report on next-generation industrial structure technology. Research and development of advanced materials for extreme environments (Research and development of advanced materials for extreme environments); 1990 nendo chotaikankyosei senshin zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research and development went on for coal pitch derived and PAN (polyacrylonitrile) based carbon fiber/carbon matrix composite materials for use under high temperature environments, and a comprehensive survey was also conducted on the said materials. For the development of C/C (carbon/carbon) composite materials using coal pitch derived or PAN based carbon fibers, the carbonization process and the like were studied for improvement on carbon based matrix material performance, and basic studies were conducted for the compounding and molding of C/C composite materials under ultrahigh temperature/pressure circumstances. Oxidation resistant coatings were fabricated by use of candidate materials expected to present excellent oxidation resistance, and technical problems were isolated and studied for the optimization of the technology of surface coating. In the comprehensive survey, the latest technical trends inside and outside Japan were investigated, and technical issues were studied for the development of materials usable under extreme environments such as ultrahigh temperatures. (NEDO)

  4. Research of Innovation Diffusion on Industrial Networks

    Directory of Open Access Journals (Sweden)

    Yongtai Chen

    2014-01-01

    Full Text Available The real value of innovation consists in its diffusion on industrial network. The factors which affect the diffusion of innovation on industrial network are the topology of industrial network and rules of diffusion. Industrial network is a complex network which has scale-free and small-world characters; its structure has some affection on threshold, length of path, enterprise’s status, and information share of innovation diffusion. Based on the cost and attitude to risk of technical innovation, we present the “avalanche” diffusing model of technical innovation on industrial network.

  5. Developing finance to meet energy industry challenge

    International Nuclear Information System (INIS)

    Morphett, C.

    1994-01-01

    The role of commercial financial institutions in the development of the world's oil and gas industry are charted in this article. Banks and other institutions have been lending money to the oil industry since the late 1920s. In the early days loans were short-term, but as the oil and gas industries have developed, using deeper wells and more complex technology, financial needs too have expanded. Better forecasting of future recovery levels, and a better understanding of reservoir characteristics has meant that lending institutions have advanced funds against projected oil revenues, with repayments due only as oil production comes on-line. (UK)

  6. Research and Application of Autodesk Fusion360 in Industrial Design

    Science.gov (United States)

    Song, P. P.; Qi, Y. M.; Cai, D. C.

    2018-05-01

    In 2016, Fusion 360, a productintroduced byAutodesk and integrating industrial design, structural design, mechanical simulation, and CAM, turns out a design platform supportingcollaboration and sharing both cross-platform and via the cloud. In previous products, design and manufacturing use to be isolated. In the course of design, research and development, the communication between designers and engineers used to go on through different software products, tool commands, and even industry terms. Moreover, difficulty also lies with the communication between design thoughts and machining strategies. Naturally, a difficult product design and R & D process would trigger a noticeable gap between the design model and the actual product. A complete product development process tends to cover several major areas, such as industrial design, mechanical design, rendering and animation, computer aided emulation (CAE), and computer aided manufacturing (CAM). Fusion 360, a perfect design solving the technical problems of cross-platform data exchange, realizes the effective control of cross-regional collaboration and presents an overview of collaboration and breaks the barriers between art and manufacturing, andblocks between design and processing. The “Eco-development of Fusion360 Industrial Chain” is both a significant means to and an inevitable trend forthe manufacturers and industrial designers to carry out innovation in China.

  7. Research and development of the industrial basic technologies of the next generation, 'composite materials (fine ceramics)'. Evaluation of the first phase research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'fine ceramics'. Daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1984-03-30

    The results of the first phase research and development project for developing fine ceramics as the basic technologies of the next generation are evaluated. The R and D themes are selected to develop fine ceramics of high strength, corrosion resistance, precision and wear resistance, noting their excellent characteristics. Development of the basic techniques for these materials is of high significance, and highly rated. The efforts in the first-phase R and D project are aimed at development of silicon nitride and silicon carbide for synthesis of the stock materials; explosive forming/treating the stock powders; forming, sintering and processing/joining; evaluation of the characteristics; non-destructive testing methods; designs; and evaluation of the parts, among others, as the elementary techniques for production, evaluation and application of the fine ceramic materials. The technical targets of improving functions have been achieved, or bright prospects have been obtained therefor in development of the techniques for synthesis of the stock materials, forming/sintering and processing/joining. The silica reduction for stock synthesis, basic techniques for molding/sintering, and rheological considerations for the molding/sintering techniques represent the techniques of the next generation, because they break through the limitations of the conventional techniques. (NEDO)

  8. [Thinking on development of Shanxi Astragali Radix industry].

    Science.gov (United States)

    Qin, Xue-Mei; Li, Ai-Ping; Li, Ke; Li, An-Ping; Ning, Lu-Hong

    2016-12-01

    Shanxi, a traditional production area to produce genuine Astragali Radix of high quality, has experienced major changes in the pattern of resources. This area once accounted for half of Astragali Radix industry, but now only serves as the largest supply area of traditional wild Astragali Radix. Furthermore, the strategic position of Shanxi Astragali Radix industry will become more prominent and more important to economic and social development in face of the diversity of market demands, especially for the strong demands of high-end Astragali Radix. In addition, Astragalus industry involves the simultaneous development of the first, second and tertiary industries in many areas, and it is typical and representative in the traditional Chinese medicine industry development. However, the application and industrial development of Shanxi Astragali Radix have been restricted due to the problems such as blind promotion of transplanting cultivation technology, and lack of science and technology including efficacy investigation, safety evaluation, standardization and controllability studies. Therefore, we would analyze the production history, resource structure, the current situation and progress of industry development, scientific research foundation and existing problem in this paper, and put forward countermeasures for development and technical innovation in order to make Astragali Radix industry bigger and stronger through innovation-driven and make benefits for demos. This thought provides a reference for the exploratory development of other large varieties of Chinese medicinal materials. Copyright© by the Chinese Pharmaceutical Association.

  9. Strategy for developing of small medium industry to creative industry in special culinary, Sarolangun Regency

    Directory of Open Access Journals (Sweden)

    Fitriaty Fitriaty

    2018-03-01

    Full Text Available This study aims to obtain a description of small and medium industries in the area of regional culinary Sarolangun, internal and external factors and formulate strategies to develop the industry to become a creative industry. The method that is used SWOT analysis,  descriptive and qualitative analysis. Based on the research result found that the culinary that can be developed is coconut bread, dodol, kipang cake and curry fish curry fish. The weakness of internal factors lies in working capital, human resources, and external factors lie in marketing and institutional. The recommended strategy is to turn around. Keywords: SME’s, Culinary, SWOT Analysis, Turn around

  10. Research and development of basic technologies for the next generation industries, 'bio-elements'. Evaluation on the first term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihtsu 'bio soshi'. Daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research, development and evaluation were performed in order to establish basic technologies to realize new information processing incorporating high-order functions of living organisms, and bio-elements equipped with high-order functions. In the field of developing technical means to measure directly the information processing function of living organisms, detailed analysis has become possible for the first time on spatial operation of nerve activities by using two-dimensional beam measurement operation on the nerve activities. In the field of aiming at modeling, a system to realize functions effective in terms of engineering was structured by incorporating into the model the functions specific to nervous systems of visual sense and motion. In the field of element technologies, a large progress was seen in the basic technology and evaluation technology such as design and fabrication of molecules added with different functions in the LB membrane. Membranes having simple but different functions such as light beam and scent detection were manufactured, whereas a possibility of having them manifest functions as elements was verified. Furthermore, possibilities were discovered in manufacturing functional membranes by using self-organizing capability as a result of using basic properties possessed by polymers, and in realizing functions simulating plasticity of nerves. These achievements would lead to a belief that the targets of the first term research and development have been achieved nearly completely. (NEDO)

  11. Research and development of basic technologies for the next generation industries, 'bio-elements'. Evaluation on the first term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihtsu 'bio soshi'. Daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research, development and evaluation were performed in order to establish basic technologies to realize new information processing incorporating high-order functions of living organisms, and bio-elements equipped with high-order functions. In the field of developing technical means to measure directly the information processing function of living organisms, detailed analysis has become possible for the first time on spatial operation of nerve activities by using two-dimensional beam measurement operation on the nerve activities. In the field of aiming at modeling, a system to realize functions effective in terms of engineering was structured by incorporating into the model the functions specific to nervous systems of visual sense and motion. In the field of element technologies, a large progress was seen in the basic technology and evaluation technology such as design and fabrication of molecules added with different functions in the LB membrane. Membranes having simple but different functions such as light beam and scent detection were manufactured, whereas a possibility of having them manifest functions as elements was verified. Furthermore, possibilities were discovered in manufacturing functional membranes by using self-organizing capability as a result of using basic properties possessed by polymers, and in realizing functions simulating plasticity of nerves. These achievements would lead to a belief that the targets of the first term research and development have been achieved nearly completely. (NEDO)

  12. Sustainable development and the mineral industry

    International Nuclear Information System (INIS)

    Cain, D.

    2000-01-01

    There is a perception in some quarters that the continued development of the coal and minerals industries is incompatible with sustainability. Yet a future without mining is clearly a very long way off. This article outlines some of the initiatives being taken by the coal industry to overcome the adverse perceptions and demonstrate that coal has an important future to play. Industries in the future will be assessed not only on their economic performance, as in the past, but also on their environmental and social performance - that is, their contribution to sustainable development. In this context, sustainable development is now part of mainstream business thinking in many major corporations. Apart from identifying improvement opportunities, the process should also result in a better understanding of mining industry role by non-mining stake holders. Copyright (2000) CSIRO Energy Technology and Exploration and Mining

  13. Research and development of the industrial basic technologies of the next generation, 'composite materials (resin-based)'. Evaluation of the second phase research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'fukugo zairyo (jushikei). Dainiki hyoka hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1987-03-31

    The results of the second phase research and development project for developing the resin-based composite materials as the basic technologies of the next generation are evaluated. The second phase (FY 1983 to 1986) project is carried out to achieve the objectives, which are set up based on the objectives for the basic designs and the results of the first phase project. As a result, the concrete (promotion objectives), including those related to mechanical characteristics, have been almost achieved. For development of the highly functional FRP materials, the R and D efforts are directed to improvement of their moldability while satisfying the requirements of high functions, e.g., resistance to heat, leading to development of the basic techniques for epoxy resin-based intermediate materials. These results indicate possibility of commercialization of highly heat-resistant polyimde resin-based and novel resin-based intermediate materials. The results of the novel molding/processing methods, taken up in the second phase project as the ones which use no autoclave, are rated that they are developed to suggest possibility of the eventual commercialization, although the products they give are not always showing sufficient mechanical properties. (NEDO)

  14. Research and development of basic technologies for next generation industries, 'high crystalline polymeric material'. Evaluation on second term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Kokesshosei kobunshi zairyo (dainiki kenkyu kaihatsu kenkyu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1988-03-01

    This research and development is intended to establish a basic technology related to high crystalline polymeric material that has dynamic properties comparable to metallic materials by single polymeric material as a structural material. Thick and large high-elasticity molded forms were obtained by searching poly-arylate material, and by developing such processing technologies as high-pressure injection molding, composite injection molding, and elongation fluidity molding. High-elasticity molded forms with uniform internal orientation were obtained by heating and molding liquid crystal polymers under high magnetic field. Solution molding was performed on a molecular composite consisting of rigid chains and soft chains, which was laminated and bonded to have obtained an isotropic form with as high elasticity as 54 GPa. In addition, high pressure powder formation of cross-linked polymers of di-acetylene system provided an isotropic form with sound wave elasticity of 23 GPa.

  15. LIDAR Research & Development Lab

    Data.gov (United States)

    Federal Laboratory Consortium — The LIDAR Research and Development labs are used to investigate and improve LIDAR components such as laser sources, optical signal detectors and optical filters. The...

  16. Wind energy development as a part of Poland's industrial development

    DEFF Research Database (Denmark)

    Stoerring, Dagmara; Hvelplund, Frede Kloster

    2003-01-01

    The paper concludes with recommendations on how to make wind energy development a part of the industrial development in Poland by introducing renewable energy support mechanisms to improve the conditions for companies to develop wind technology in Poland....

  17. Photovoltaic research and development

    CSIR Research Space (South Africa)

    Cummings, F

    2009-09-01

    Full Text Available Photovoltaic (PV) is the direct conversion of sunlight into electrical energy through a solar cell. This presentation consists of an introduction to photovoltaics, the South African PV research roadmap, a look at the CSIR PV research and development...

  18. Energy efficient industrialized housing research program

    Energy Technology Data Exchange (ETDEWEB)

    Berg, R.; Brown, G.Z.; Finrow, J.; Kellett, R.; Mc Donald, M.; McGinn, B.; Ryan, P.; Sekiguchi, T. (Oregon Univ., Eugene, OR (USA). Center for Housing Innovation); Chandra, S.; Elshennawy, A.K.; Fairey, P.; Harrison, J.; Maxwell, L.; Roland, J.; Swart, W. (Florida Solar Energy Center, Cape Canaveral, FL (USA))

    1989-01-01

    This is the second volume of a two volume report on energy efficient industrialized housing. Volume II contains support documentation for Volume I. The following items are included: individual trip reports; software bibliography; industry contacts in the US, Denmark, and Japan; Cost comparison of industrialized housing in the US and Denmark; draft of the final report on the systems analysis for Fleetwood Mobile Home Manufacturers. (SM)

  19. Supplementing Resident Research Funding Through a Partnership With Local Industry.

    Science.gov (United States)

    Skube, Steven J; Arsoniadis, Elliot G; Jahansouz, Cyrus; Novitsky, Sherri; Chipman, Jeffrey G

    2018-01-17

    To develop a model for the supplementation of resident research funding through a resident-hosted clinical immersion with local industry. Designated research residents hosted multiple groups of engineers and business professionals from local industry in general surgery-focused clinical immersion weeks. The participants in these week-long programs are educated about general surgery and brought to the operating room to observe a variety of surgeries. This study was performed at the University of Minnesota, in Minneapolis, Minnesota, at a tertiary medical center. Ten designated research residents hosted general surgery immersion programs. Fifty-seven engineers and business professionals from 5 different local biomedical firms have participated in this program. General surgery research residents (in collaboration with the University of Minnesota's Institute for Engineering in Medicine) have hosted 9 clinical immersion programs since starting the collaborative in 2015. Immersion participant response to the experiences was very positive. Two full-time resident research positions can be funded annually through participation in this program. With decreasing funding available for surgical research, particularly resident research, innovative ways to fund resident research are needed. The general surgery clinical immersion program at the University of Minnesota has proven its value as a supplement for resident research funding and may be a sustainable model for the future. Copyright © 2018 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

  20. Research and development project in fiscal 1988 for fundamental technologies for next generation industries. Achievement report on research and development on high crystallinity polymeric materials; 1988 nendo kokesshosei kobunshi zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    With an objective to realize structural materials characterized by light weight, high corrosion resistance and easy-to-process performance, research and development has been performed on high crystallinity polymeric materials. This paper summarizes the achievement in fiscal 1988. With regard to monophyletic materials, using thermotropic liquid crystal polyallylate as the object, researches were performed on optimization, polymerization, and elongation fluid orientation processing of the polymer chemical structures. In the polyphyletic materials, discussions were given on aromatic heterocyclic polymers as to the synthesizing process for PIBO expected of higher elasticity rate than with PIBT. Discussions were given on the phase transfer transient film making process for molecular composites for an attempt of enhancing performance of tapes and laminates. With regard to cross-linking materials, forming and improvements were discussed on heat hardening molecular composites of ionic/inorganic hybrid cross-linking polymer, modified ion cross-linking polymer, poly-ion complex, and diacetylene polymer. In addition, researches were performed on the high-density three-dimensional cross-linking process and inter-molecular reinforcement of mono-axially and highly oriented substances to obtain high elasticity forms. (NEDO)

  1. Strategies for Developing China's Software Industry

    OpenAIRE

    Mingzhi Li; Ming Gao

    2003-01-01

    The software industry is deemed an ideal target for a developing country to integrate into the world information and communications technology (ICT) market. On the one hand the industry is labor intensive, and the developing countries have a large labor surplus; on the other hand, it is a worldwide trend for developed countries to outsource a vast amount of low-end, software-related tasks to the low-cost countries and regions, which fits into some developing countries’ caliber nicely. India h...

  2. Research and development of basic technologies for the next generation industries, 'environment resistance strengthened elements'. Evaluation on the second term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'Taikankyo kyoka soshi'. Dainiki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1986-03-31

    In the research and development of the environment resistance strengthened elements with emphasis placed respectively on radiation resistance, heat resistance, and integration degree according to specific requirements in the using environments, the second term has developed an integration technology and its evaluation technology based on the achievements in the first term. In developing the heat resistant element technology, the technology to grow {beta}-SiC crystals was expanded to obtaining thin film crystals with high migratory performance by using higher temperatures. At the same time, development was performed on a technology to manufacture multiple number of transistors on one substrate, such as the doping technology and etching technology. Using this technology, schottky diodes and p-n junction elements being the basic structures of MES-FET and bipolar transistors were fabricated. In the evaluation and testing technology, the {gamma} dose measuring method using TLD was improved, the traceability of {gamma} ray irradiation amount was assured, the simplified irradiation testing method using X-ray was established, and the heat resistance testing technology for electronic parts was established. Furthermore, attempts were made on enhancing radiation resistance of the elements, such as in MOS silicon integrated circuit, bipolar silicon integrated circuit, and compound semiconductor integrated circuit. (NEDO)

  3. Fiscal 1999 achievement report on research and development of industrial technologies. Research and development of synergy ceramics; 1999 nendo sangyo kagaku gijutsu kenkyu kaihatsu seika hokokusho. Synergy ceramics no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    Efforts are conducted in the two fields of (1) survey and research and (2) development of technology for evaluating high temperature dynamic corrosion characteristics of heat resistant ceramics. In field (1), a comprehensive survey is conducted, an application study is conducted about high temperature gas separating ceramic membranes, and efforts are made to put to practical use ceramic parts manufactured by a low cost production process. In the application study of ceramic membranes, technologies are developed for a process of manufacturing high temperature gas separating porous ceramic membranes capable of separating and purifying gas emissions and gas ingredients, which involves the development of technologies for improving on gas separation and purification functions, development of technology of providing catalyst support function, technology of porous membrane formation, evaluation of separation characteristics, and so forth. In an application study for ceramic parts manufactured by a low cost manufacturing process, which involves structural ceramics, optimization is accomplished for materials synthesizing technologies by means of mechanical alloying, and cylinder liners are fabricated and evaluated for a natural gas engine made of silicon nitride based ceramics. In field (2), a high temperature dynamic corrosion testing device is built for heat shield coatings. (NEDO)

  4. Research and development of basic technologies for the next generation industries, 'recombinant DNA utilizing technology'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'kumikae DNA riyo gijutsu'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to the recombinant DNA utilizing technology to create new microorganisms for processes in the chemical industry. The major achievements of the present research and development include establishment of the P450 gene manifestation system attributed from microsomes and mitochondria, and the success of the world's first simultaneous manifestation of P450 and reduction enzyme. Furthermore, the fused enzyme combining P450 and the reduction enzyme genetically was successfully manufactured ahead of the other countries, opening the way to industrializing the recombinant enzymes for use in bio-processes in the chemical industry. In creating a high-efficiency secretion recombinant bacillus subtilis stock, a bacillus subtilis host whose protease activity has been noticeably decreased was created. As an achievement of the research on the 'basic recombinant DNA technology', high-efficiency manifestation vector of medium level thermophile was created, and its usefulness was demonstrated. In addition, a host and vector system for high level thermophile was developed for the first time in the world. These achievements have opened the way to industrial utilization of the thermophilic bacteria. (NEDO)

  5. Survey report of FY 1997 on the global environmental industry technology development promotion project. International research exchange project; 1997 nendo chosa hokokusho. Chikyu kankyo sangyo gijutsu kaihatsu suishin jigyo (kokusai kenkyu koryu jigyo)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    Exchange of personnel among foreign research organizations is significant for promoting research and development to create new research fields and to build new technological systems for the purpose of solving global environmental problems. For this purpose, researchers were sent/invited to/from international conferences and international symposiums related to global environmental technology and exchange of personnel with major foreign research organizations and universities was conducted under the cooperation of RITE and RITE-related researchers and related academic societies. Based on short-term invitation and sending of researchers as well as the feasibility study of researcher exchange, researchers were sent/invited on long- and mid-terms. As a result, exchange of personnel engaged in the latest research in Japan and overseas could be promoted. It was found that various researches are being conducted abroad in basic areas of global environmental technology. Since they are closely related to the research and development of industrial technology contributing to global environmental preservation promoted by RITE, it is important to establish a more efficient exchange system of researchers in the future. 91 refs., 38 figs., 14 tabs.

  6. Development of Eco-Industry Sector

    OpenAIRE

    Mariana Ioviţu

    2012-01-01

    Measures to encourage development of Eco-industries represent an important part of the programs of many countries; analyses of different international organisms reveal a series of advantages of this sector for economy. According to OCDE “The environmental goods and services industry consists of activities which produce goods and services to measure, prevent, limit, minimize or correct environmental damage to water, air and soil, as well as problems related to waste, noise and Eco-systems”. Th...

  7. Development of Industrial Yeast Platform Strains

    DEFF Research Database (Denmark)

    Bergdahl, Basti; Dato, Laura; Förster, Jochen

    2014-01-01

    Most of the current metabolic engineering projects are carried out using laboratory strains as the starting host. Although such strains are easily manipulated genetically, their robustness does not always meet the requirements set by industrial fermentation conditions. In such conditions, the cells...... screening of the 36 industrial and laboratory yeast strains. In addition, progress in the development of molecular biology methods for generating the new strains will be presented....

  8. Research and development of basic technologies for next generation industries, 'composite materials'. Evaluation on final research and development (interim report); Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Fukugo zairyo (saishu kenkyu kaihatsu hyoka 2)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-05-01

    Development was made on a technology to evaluate quality of composite materials. Few data are available for environmental resistance of composite materials, whereas identification of environmental deterioration behavior and establishment of a environmental resistance evaluating technology are a significant issue in utilizing these materials as new materials for space, aeronautics, and marine applications in the future. The present research was taken up with objectives to elucidate deterioration behavior of composite materials exposed to special environment in the atmosphere and space and to establish methods for acceleration tests and environmental performance evaluation by using simulated environments equivalent to the natural environment exposure. The former period (fiscal 1982 through 1984) has investigated environmental conditions in the atmosphere and space, prepared standard test specimens, performed design on environmental devices simulating the environmental elements, as well as tests on deterioration due to environmental elements, and systematized the deterioration characteristics to establish composite test conditions. The latter period (fiscal 1985 through 1988) has developed the composite environment testing device based on the result achieved in the former period, elucidated the deterioration behavior under the composite environmental conditions, and performed evaluation tests on the developed composite materials (FRP). (NEDO)

  9. Research and development of the industrial basic techniques of the next generation. Composite materials (Final research and development evaluation / Part 1); Jisedai dangyo kiban gijutsu kenkyu kaihatsu. Fukugo zairyo (Saishu kenkyu kaihatsu hyoka 1)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-05-01

    This R and D project is aimed at development of highly functional materials for aerospace devices, bringing into focus research and development of resin-based composite materials (FRPs), metal-based composite materials (FRMs), and evaluation of their properties and their design techniques. The basic target properties are heat resistance temperature of 250 degrees C or higher and tensile strength of 240 kg/mm{sup 2} or more for the FRPs, and heat resistance temperature of 450 degrees C or higher and tensile strength of 150 kgf/mm{sup 2} or more for the FRMs. This R and D program has been implemented for 8 years for development of raw materials, molding/processing techniques, quality evaluation and designs through information exchange and discussions of the experts in each area under integrated, close cooperation from raw materials to molding/processing. Most of the data indicate that the target properties and objects are satisfied or exceeded. It is therefore concluded that this project for the composite materials, extending for 8 years in 3 phases, has sufficiently achieved the initial objects. The unique techniques are incorporated in the raw materials, molding/processing processes, quality evaluation and designs. These efforts have produced the FRPs and FRMs of the world highest qualities. (NEDO)

  10. Research and development of basic technologies for next generation industries, 'electrically conductive polymeric material'. Evaluation on first term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Dodensei kobunshi zairyo (daiikki kenkyu kaihatsu hyoka)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-03-30

    The research and development in the first term has searched widely different kinds of raw materials, elucidated electricity conduction mechanism, discussed processing technologies and evaluation methods. It also included molecule designing to develop new raw materials. A method for growing good single crystals of charge migrating complexes was developed, and (BEDT-TTF){sub 2}I{sub 3} crystals were found to manifest superconductivity at 8K under pressure of 1.3 kbar. In addition, elucidation was made on conduction characteristics of (TMTSF){sub 2}ClO{sub 4} being an induction superconductor, and on its superconduction mechanism. Polyacetylene films oriented at a high level by epitaxial polymerization were synthesized, the carrier hopping mechanism of polyacetylene was proposed, and the direction of increasing the conductivity was shown. It was discovered that cyanoacetylene is thermally polymerized at a relatively low temperature, turning into polymer with good orientation and easily into graphite. Polymeric intermediates soluble to polyparaphenylene vinylene (PPV) were synthesized, whereas these intermediates were found to have shaping and stretching properties, and conductivity of 2.8 times 10{sup 3}s/cm was obtained in PPV doped after the stretching. (NEDO)

  11. Research and development of basic technologies for next generation industries, 'electrically conductive polymeric material'. Evaluation on second term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Dodensei kobunshi zairyo (dainiki kenkyu kaihatsu hyoka)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1988-03-01

    The research and development in the second term included development of raw materials, elucidation of electricity conduction mechanism, and development of methods to improve stability and a new processing method. Crystals of a large number of charge migrating complexes were grown to elucidate their electron properties and structures. A theoretical model was structured for the superconduction mechanism in the charge migrating complexes. Poly-p-phenylene vinylene-based polymers achieved {sigma}=1.1 times 10{sup 4}s/cm as a result of extension of soluble reaction intermediates. Poly-2, 5-phenylene vinylene doped with FeCl{sub 3} retained 10{sup 3}s/m for 165 days in nitrogen. Polypyrrole achieved 3.0 times 10{sup 3}s/cm in constant potential electrolytically oxidizing polymerization and extension at low temperatures. Polypyrrole doped with ClO{sub 4}{sup -} retained electric conductivity of 85% for 400 days in nitrogen. Electric conductivity of higher than 10{sup 5}s/cm was obtained by applying different kinds of doping into thin film and fiber formed graphite. The world's highest conductivity of 9 times 10{sup 5}s/cm was achieved particularly with discharge laminated and polymerized graphite doped with AsF{sub 5}. (NEDO)

  12. Research and development of basic technologies for next generation industries, 'electrically conductive polymeric material'. Evaluation on first term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Dodensei kobunshi zairyo (daiikki kenkyu kaihatsu hyoka)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-03-30

    The research and development in the first term has searched widely different kinds of raw materials, elucidated electricity conduction mechanism, discussed processing technologies and evaluation methods. It also included molecule designing to develop new raw materials. A method for growing good single crystals of charge migrating complexes was developed, and (BEDT-TTF){sub 2}I{sub 3} crystals were found to manifest superconductivity at 8K under pressure of 1.3 kbar. In addition, elucidation was made on conduction characteristics of (TMTSF){sub 2}ClO{sub 4} being an induction superconductor, and on its superconduction mechanism. Polyacetylene films oriented at a high level by epitaxial polymerization were synthesized, the carrier hopping mechanism of polyacetylene was proposed, and the direction of increasing the conductivity was shown. It was discovered that cyanoacetylene is thermally polymerized at a relatively low temperature, turning into polymer with good orientation and easily into graphite. Polymeric intermediates soluble to polyparaphenylene vinylene (PPV) were synthesized, whereas these intermediates were found to have shaping and stretching properties, and conductivity of 2.8 times 10{sup 3}s/cm was obtained in PPV doped after the stretching. (NEDO)

  13. Research and development of basic technologies for the next generation industries, 'environment resistance strengthened elements'. Evaluation on the first term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'taikankyo kyoka soshi'. Daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1984-03-30

    Research, development and evaluation were performed with an objective of developing environment resistance strengthened elements, with emphasis placed respectively on radiation resistance, heat resistance, and integration degree according to specific requirements in the using environments. The objective for the first term is to develop the basic technology on element structures required to raise the environment resistance, and the methods of testing them. With regard to heat resistant elements, {beta}-SiC single crystal thin films were formed, and a prospect was obtained on using them as the elements. Regarding MOS integrated circuit, bipolar integrated circuit, and GaAs element, points presenting the largest issue in radiation resistance were noticed according to respective elements. Thus, temperature for gate oxide film formation was lowered, element structures were improved, and gate lengths were decreased to enhance the radiation resistance. For the evaluation test technology, a provisional testing method was prepared for the radiation resistance, a prototype in-situ irradiation testing device was fabricated and so was a prototype high-temperature testing device usable up to 500 degrees C. These achievements lead to a belief that the targets for the first term have been achieved. (NEDO)

  14. From research to industry - the establishment of a radiation processing industry in South Africa

    International Nuclear Information System (INIS)

    Du Plessis, T.A.; Stevens, R.C.B.

    1983-01-01

    In the late sixties the South African Atomic Energy Board in pursuing its objectives to promote the peaceful application of nuclear energy in general, established a research group with the specific purpose of investigating and developing radiation processing as a new technique. During the early years it was realised that the economic and technological facets of establishing a new industry were equally important and, in addition to fundamental research, strong emphasis was placed on the necessity of marketing this new technology. Although the initial emphasis was put on gamma sterilization, and today still forms the backbone of the radiation processing industry, the promising fields of polymer modification and food irradiation hold a lot of promise in the radiation processing industry. Following ten years of successfully introducing and providing a radiation service, the South African Atomic Energy Board in 1980 decided to transfer its service to the private sector. These developments in South Africa are a good sample of how a small country, through initial government involvement, can acquire a sophisticated new private industry. (author)

  15. Student involvement and research for the nuclear industry

    International Nuclear Information System (INIS)

    Ginniff, M.E.

    1980-01-01

    Nuclear engineering is one of the modern and rapidly advancing technologies. Those already involved in it are continually updating their knowledge to keep abreast of the developments. Of course the sound basic principles of engineering still apply but the scene of application can be transformed in a few years. In fact, because of this, many engineers from more traditional industries often express the view that presently the total range of nuclear engineering is research and development. How can students be trained for such a rapidly advancing technology. Is not the answer early involvement. Effective early involvement for students can only come about by the close co-operation and involvement of the staff of universities and industry. The theme is developed. (author)

  16. Space biology research development

    Science.gov (United States)

    Bonting, Sjoerd L.

    1993-01-01

    The purpose of the Search for Extraterrestrial Intelligence (SETI) Institute is to conduct and promote research related activities regarding the search for extraterrestrial life, particularly intelligent life. Such research encompasses the broad discipline of 'Life in the Universe', including all scientific and technological aspects of astronomy and the planetary sciences, chemical evolution, the origin of life, biological evolution, and cultural evolution. The primary purpose was to provide funding for the Principal Investigator to collaborate with the personnel of the SETI Institute and the NASA-Ames Research center in order to plan and develop space biology research on and in connection with Space Station Freedom; to promote cooperation with the international partners in the space station; to conduct a study on the use of biosensors in space biology research and life support system operation; and to promote space biology research through the initiation of an annual publication 'Advances in Space Biology and Medicine'.

  17. Research and development of basic technologies for the next generation industries, 'ultra-grid elements'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'chokoshi soshi'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-04-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to ultra-grid elements. With regard to the process technology to search materials suitable for the targets of ultra-grid elements and manufacture ultra-grid element structure, a technology has been completed, by which crystalline growth is performed while controlling AlAs and GaAs at atom layer levels by using the MBE process and MOCVD process. This has allowed the understanding to be progressed on behavior of electrons in hetero interface or very thin films. It has also become possible to acquire new crystals that have band gaps and grid constants matching the performance of the elements. Regarding ultra-grid functional elements, new functional elements with the HET and RHET structures were made by utilizing the characteristics of the ultra grids, and performances of normal temperature operation and high speed operation were investigated. The ultra-grid structured elements have made it possible to embed ultra fine electrode structure into crystals by means of double hetero growth, and a possibility of Si-based PBT was demonstrated. These achievements lead to a belief that the targets intended at the beginning of the present research have been achieved. (NEDO)

  18. Research and development of basic technologies for the next generation industries, 'ultra-grid elements'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'chokoshi soshi'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-04-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to ultra-grid elements. With regard to the process technology to search materials suitable for the targets of ultra-grid elements and manufacture ultra-grid element structure, a technology has been completed, by which crystalline growth is performed while controlling AlAs and GaAs at atom layer levels by using the MBE process and MOCVD process. This has allowed the understanding to be progressed on behavior of electrons in hetero interface or very thin films. It has also become possible to acquire new crystals that have band gaps and grid constants matching the performance of the elements. Regarding ultra-grid functional elements, new functional elements with the HET and RHET structures were made by utilizing the characteristics of the ultra grids, and performances of normal temperature operation and high speed operation were investigated. The ultra-grid structured elements have made it possible to embed ultra fine electrode structure into crystals by means of double hetero growth, and a possibility of Si-based PBT was demonstrated. These achievements lead to a belief that the targets intended at the beginning of the present research have been achieved. (NEDO)

  19. Aspect on Research Works of Late Years Contributed to the Industrial Development of a New Trend in Chilling and Freezing Technology of Meat in Oversea Countries

    Science.gov (United States)

    Kato, Shunro

    Author presents his review paper on a noticeable trend of late years in meat refrigeration characterizing in three technological concerns such as increase of operation efficiency in chilling and freezing which result in substantial reduction of energy consumption, improvement in meat tenderness and re-examination of the currently available T. T. T. data for frozen meat storage. He considers from industrial point of view that the new trend has been much encouraged by many research papers so far published treating three topics as follows ;1) removal of meat from unchilled carcass (hot boning) which saves time and energy used for operation and helps a concomitant reasonable reduction of refrigeration facilities, 2) electrical stimulation of carcass in order to protect meat from adverse toughening due to cold shortening and 3) processing-induced changes in frozen storage life of meat. And he makes a brief comment on each topic to elucidate its technological or economical significance and gives a review of relevant studies abroad, citing abstracts of many papers from IIR Bulletin and International Journal of Refrigeration issued in last two or three years.

  20. Government Research and Development Policy for Telecommunications.

    Science.gov (United States)

    Cohen, Linda

    This paper investigates how recent changes in the telecommunications industry are likely to affect government research and development policies by analyzing how changes in the market structure--in particular, increased competition in the industry due to domestic deregulation and international competition--change the political economy of government…

  1. SPECIFICITY IN DEVELOPMENT OF CONSTRUCTION INDUSTRY

    Directory of Open Access Journals (Sweden)

    O. S. Golubova

    2012-01-01

    Full Text Available Specificity in development of construction industry of the Republic of Belarus determines  character of competition on the construction market, forms a pricing, marketing and product policy of building companies. Construction represents itself as a highly developed complex where interaction of business entities is of rather complicated multilateral character.

  2. Engineering research, development and technology

    International Nuclear Information System (INIS)

    1994-05-01

    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the technical staff, tools, and facilities needed to support current and future LLNL programs. The efforts are guided by a dual-benefit research and development strategy that supports Department of Energy missions, such as national security through nuclear deterrence and economic competitiveness through partnerships with U.S. industry. This annual report, organized by thrust area, describes the activities for the fiscal year 1993. The report provides timely summaries of objectives, methods, and results from nine thrust areas for this fiscal year: Computational Electronics and Electromagnetics; Computational Mechanics; Diagnostics and Microelectronics; Fabrication Technology; Materials Science and Engineering; Power Conversion Technologies; Nondestructive Evaluation; Remote Sensing, Imaging, and Signal Engineering; and Emerging Technologies. Separate abstracts were prepared for 47 papers in this report

  3. Development Strategy of Lanting Small Industry

    Directory of Open Access Journals (Sweden)

    Atika Tri Puspitasari

    2015-12-01

    Full Text Available This research aims to describe and analyze the strategy of production, marketing, human resources (labor, and capital. The technique of collecting data used observation, interviews, documentation, questionnaires, and triangulation. The technique of sampling was purposive sampling. Findings show that the strategy of production, marketing strategies by the way of increased order coupled with the trademark shows as well as various flavors of innovation development, adjustment of the selling price with the price of raw materials production, the cooperation of manufacturers and suppliers in the distribution of lanting, promotional activities by means of cooperation with the agency and related service trade off products online. The strategy of human resources is with the formation groups of industry in the village of Lemahduwur (but not running smoothly. Strategy capital with the initial capital comes from its own capital and profit as capital accumulation, additional capital when many party and by feast day; increased access to capital, financial administration and against accounting in a simple and routine. The advice given is the government and manufacturers improve HR, technology development, marketing and capital. Manufacturer improves collaboration with suppliers of raw materials, maintaining the typical features and making a trademark.

  4. Research and development of basic technologies for next generation industries, 'high-efficiency polymeric separation membrane material'. Evaluation on first term final research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Kokoritsu kobunshi bunrimaku zairyo (daiikki kenkyu kaihatsu hyoka)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-03-30

    The first term has performed research and development placing emphasis on that 'the basic study on membrane separation is to be performed systematically to elucidate governing factors in membrane separation'. With respect to water/ethanol separation by using the penetration gasifying method, it was indicated that excellent separation performance can be exhibited by using natural polymers having sugar chain skeleton as a raw material, and by controlling the membrane structure by means of membrane manufacturing methods. For enhancement of performance in water selective permeation type separation membrane, it was shown experimentally that it is important to select a membrane suitable for the object of separation and a separation method that uses the selected membrane. Regarding the water/ethanol separation, it was shown theoretically that the penetration gasifying method can save more energy than the conventional distillation method, where the development target was presented. It was recognized that impregnation type liquid membrane using crown ether can separate amino acid optical isomers. High separation performance was obtained in carbon monoxide/nitrogen separation by using fluid carrier that uses cuprous iodine/1-methyl imidazole. (NEDO)

  5. Research and development of basic technologies for the next generation industries, 'light-reactive materials'. Evaluation on the second term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'hikari hanno zairyo'. Dainiki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research and evaluation was performed with an objective of establishing the basic technology related to light-reactive materials that control the structures and status of aggregation of molecules by using actions of light, and can be used for ultra-high density recording, high resolution indication and light switches. In elucidating the basic characteristics of photochromic materials, a non-destructively readable recording system was proposed and demonstrated, highly durable and high-functional photochromic compounds were developed, and a number of material design guidelines were accumulated to realize characteristics required in light-beam recording. With regard to development of the photochromic materials, realization of photochromic thin films that can record wavelengths in multiplex manner has become more realistic. For elucidating basic characteristics of PHB materials, a method for evaluation from a number of directions including the time method for photon echo was established in addition to the conventional frequency recording characteristics. Regarding the elucidation of the PHB phenomenon, demonstration was carried out on intermediate zone structure control in diversified material systems including living organism substances, where a large number of findings were accumulated. (NEDO)

  6. Research and development project in fiscal 1990 for large industrial technologies. Achievement report on research and development of ultra-advanced processing systems (Development of high-level processing devices for electric power generation facility members); 1990 nendo chosentan kako system no kenkyu kaihatsu seika hokokusho. Hatsuden shisetsuyo buzai kodo kako sochi kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research and development has been performed with an objective to establish the processing technology using excitation beam required for the advanced technology industries, and the ultra-precision machining technology to realize the nano-technology. This paper summarizes the achievements in fiscal 1990. In the research on the large output and long life technology for excimer laser, an average output of 500 W or more was demonstrated achieving the intermediate target by developing and improving the technologies for low electric power gas circulation, high efficiency discharge and excitation, and large output oscillation control. In the research on intensity resistant optical element technology, a prototype device was fabricated to create and process axially symmetrical aspherical shapes, whereas SiC aspherical shape creation and processing were demonstrated at the shape accuracy of three microns or better, and surface roughness of 20 nanometers or less, having achieved the intermediate target. Regarding the large current ion beam, a demonstration device was completed based on improvements and test results on the sheet plasma generator. In the research and development of the high-level processing technology, low-temperature forming technology was developed for oxide ceramic thin films by using the excimer laser abrasion method. (NEDO)

  7. Active solar heating industry development study

    International Nuclear Information System (INIS)

    1995-01-01

    Despite the fact that solar water heating systems are technologically viable and commercially available, this Energy Technology Support Unit report shows that there is no established market in the United Kingdom. The Solar Trade Association (STA) has undertaken an Active Solar Heating Industry Development Study which is reported here. The data is derived from a questionnaire survey completed by companies, organizations and individuals operating within the industry. Information was also gathered from utility companies, and STAs elsewhere in Europe. Barriers which need to be overcome include lack of public awareness, especially in the construction industry, lack of capital investment and other financial disincentives, little or no government support, and lack of organization and quality monitoring and assurance within the industry itself. (UK)

  8. Problem continuity in discontinuity of development of Serbian industry

    Directory of Open Access Journals (Sweden)

    Šljukić Marica

    2017-01-01

    Full Text Available In this paper the author uses a comparative analysis in order to show the discontinuity in the process of the industrial development of the Serbian society, as well as to point out the fact that the almost same problems have not been mastered throughout the whole process of industrialization. Besides the historical data, the data of the empirical research are used. The goal of the empirical research was to determine the real and the possible degree and intensity of the influence of the structural social changes to the organizing of industrial work. The research had been done from 2011 to 2013 using the multiple case study method, and it included six organizations from different sectors of industry. By comparison of different phases of the industrial development in Serbia the author concludes the continuity of the following problems: accumulation of capital, technical and technological underdevelopment and dependence, raw materials dependence, and the deficit of the competent work force (especially managers. The biggest and the basic problem, which encompasses all four problems mentioned above, has been the absence of the strategy of the industrial development throughout the whole process of this development.

  9. Creative Industries: Development Processes Under Contemporary Conditions of Globalization

    Directory of Open Access Journals (Sweden)

    Valerija Kontrimienė

    2017-06-01

    Full Text Available The article deals with the processes of developing creative industries under conditions of a growth in the worldwide economy and globalization, discloses the role of the sector of creative industries and shows its place in the system of the modern global economy. The paper presents a comparative analysis of theories and theoretical approaches intended for the sector of creative industries and its development as well as defines regularities and specificities characteristic of the development of creative industries. Particular attention is shifted on the growth and development of creative industries considering the current challenges of globalization and on the most important specificities of the developing sector in the context of the challenges of economic globalization. The paper examines the trends reflecting the place of the sector of creative industries in the economy of the modern world, including the tendencies indicating changes in the export of the products created in this sector. The article considers the issues of developing creative industries and reveals priorities of future research.

  10. Industry Research and Recommendations for New Commercial Buildings

    Energy Technology Data Exchange (ETDEWEB)

    Hendron, B.; Leach, M.; Gregory, N.; Pless, S.; Selkowitz, S.; Matthew, P.

    2014-05-01

    Researchers evaluated industry needs and developed logic models to support possible future commercial new construction research and deployment efforts that could be led or supported by DOE's Commercial Building Integration program or other national initiatives. The authors believe that these recommendations support a proposed course of action from the current state of commercial building energy efficiency to a possible long-term goal of achieving significant market penetration of cost-effective NZE buildings in all building sectors and climates by 2030.

  11. 75 FR 45130 - Guidance for Industry and Researchers on the Radioactive Drug Research Committee: Human Research...

    Science.gov (United States)

    2010-08-02

    ... and Research, Food and Drug Administration, 10903 New Hampshire Ave., Bldg. 51, rm. 2201, Silver... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2009-D-0125] Guidance for Industry and Researchers on the Radioactive Drug Research Committee: Human Research Without an...

  12. Development of Bulk Nanocrystalline Cemented Tungsten Carbide for Industrial Applicaitons

    Energy Technology Data Exchange (ETDEWEB)

    Z. Zak Fang, H. Y. Sohn

    2009-03-10

    This report contains detailed information of the research program entitled "Development of Bulk Nanocrystalline Cemented Tungsten Carbide Materials for Industrial Applications". The report include the processes that were developed for producing nanosized WC/Co composite powders, and an ultrahigh pressure rapid hot consolidation process for sintering of nanosized powders. The mechanical properties of consolidated materials using the nanosized powders are also reported.

  13. Fiscal 2000 survey report. Survey of long-term energy technology strategy and the like (Research on actualities of Japanese industries' research and development potential); 2000 nendo choki energy gijutsu senryaku nado ni kansuru chosa hokokusho. Sangyo gijutsu senryaku sakutei kiban chosa (Nippon kigyo no kenkyu kaihatsuryoku no jittai ni kansuru chosa kenkyu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    For working out propositions on what the country should do and on what improvement industries should make for the strengthening of industries' competitive power on the market, analyses were conducted into the objects of research and development, organizations engaged in research and development activities, methods of evaluation, and the like. In concrete terms, studies were made on industries' roles in research and development activities and on the actualities of basic research and development potential, and then a survey was conducted through questionnaires and interviews about (1) tasks relating to corporation management and research and development potential, (2) development of research dedicated talent and its fluidity, and (3) problems feared to get worse in the future. Questionnaires were sent to 217 corporations or 577 people of whom 37.6% responded. Each item is described below. Under item (1), it is pointed out that basic research has shrunk as a whole, that pressure is on the increase urging that research directly increase profit, and that theme selection is made to match the business model. Under item (2), it is stated that post-doctorate researchers' knowledge is respected but that recruitment is another matter, and that fluidity of researchers between corporations will increase. Under item (3), it is pointed out that researchers are increasingly inferior in quality and that brain drain out of Japan is feared. (NEDO)

  14. Product Platform Development in Industrial Networks

    DEFF Research Database (Denmark)

    Karlsson, Christer; Skold, Martin

    2011-01-01

    The article examines the strategic issues involved in the deployment of product platform development in an industrial network. The move entails identifying the types and characteristics of generically different product platform strategies and clarifying strategic motives and differences. Number o...... of platforms and product brands serve as the key dimensions when distinguishing the different strategies. Each strategy has its own challenges and raises various issues to deal with.......The article examines the strategic issues involved in the deployment of product platform development in an industrial network. The move entails identifying the types and characteristics of generically different product platform strategies and clarifying strategic motives and differences. Number...

  15. GELCASTING: From laboratory development toward industrial production

    Energy Technology Data Exchange (ETDEWEB)

    Omatete, O.O.; Janney, M.A.; Nunn, S.D.

    1995-07-01

    Gelcasting, a ceramic forming process, was developed to overcome some of the limitations of other complex-shape forming techniques such as injection molding and slip casting. In gelcasting, a concentrated slurry of ceramic powder in a solution of organic monomers is poured into a mold and then polymerized in-situ to form a green body in the shape of the mold cavity. Thus, it is a combination of polymer chemistry with slip processing and represents minimal departure from standard ceramic processing. The simplicity of the process has attracted industrial partners and by collaboration between them and the developers, the process is being advanced from the laboratory toward industrial production.

  16. Research and development on chemical reactors made of industrial structural materials and hydriodic acid concentration technique for thermochemical hydrogen production IS process

    International Nuclear Information System (INIS)

    Kubo, Shinji; Iwatsuki, Jin; Takegami, Hiroaki; Kasahara, Seiji; Tanaka, Nobuyuki; Noguchi, Hiroki; Kamiji, Yu; Onuki, Kaoru

    2015-10-01

    Japan Atomic Energy Agency has been conducting a study on IS process for thermochemical hydrogen production in order to develop massive hydrogen production technology for hydrogen society. Integrity of the chemical reactors and concentration technology of hydrogen iodide in HIx solution were studied. In the former study, the chemical reactors were trial-fabricated using industrial materials. A test of 30 times of thermal cycle test under circulating condition of the Bunsen reaction solution showed integrity of the Bunsen reactor made of fluororesin lined steel. Also, 100 hours of reaction tests showed integrity of the sulfuric acid decomposer made of silicon carbide and of the hydrogen iodide decomposer made of Hastelloy C-276. In the latter study, concerning electro-electrodialysis using cation-exchange membrane, sulfuric acid in the anolyte had little influence on the concentration performance. These results suggest the purification system of HIx solution can be simplified. Based on the Nernst-Planck equation and the Smoluchowski equation, proton transport number, water permeance, and IR drop of the cation exchange membrane were formulated. The derived equations enable quantitative estimation for the performance indexes of Nafion ® membrane and, also, of ETFE-St membranes made by radiation-induced graft polymerization method. (author)

  17. FY 1998 annual report on the results of new industry creation type industrial science and technology research and development on the research and development of supermetals. Development of techniques for controlling structures of nano-amorphous materials; 1998 nendo super metal no gijutsu kaihatsu. Nano amorphous kozo seigyo zairyo no gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    Described herein are the FY 1998 results of the development of techniques for controlling structures of nano-amorphous materials. For the development of techniques for finely dispersing fine particles, mechanical alloying (MA) and mechanical milling (MM) are investigated, to structure nano-crystals in common steel, for which hot isostatic pressing is evaluated as a consolidation process for the MA- and MM-prepared powders in the FY 1998. For researches on high-speed particle deposition and super plastic forming, an Al-Ni, Al-Fe and Al-Ti alloy are selected as the nano-structure materials to be prepared by evaporation, and various compositions of these systems are evaporated, in order to investigate their microstructures, mechanical properties and thermal stabilities. For researches on techniques for controlling phases with the aid of high-density energy, the R and D efforts are directed to exploration of composition of high resistance to corrosion by acid at dew point, preparation of non-equilibrium (e.g., amorphous) powders, and development of solidification and forming techniques, with the target of creation of an amorphous alloy showing corrosion resistance at least twice as high as that of the commercial corrosion-resistance material and formable into a bulk shape having a thickness of at least 1 mm. For researches on controlled cooling techniques, the basic data are collected. (NEDO)

  18. International Collaboration Tools for Industrial Development

    CSIR Research Space (South Africa)

    Dan, Nagy

    2017-10-01

    Full Text Available - EU Horizon 2020 RISE program Goal: A great challenge for the future lies in the transfer of Industry 4.0 expertise and technologies in small and medium sized enterprises (SME). Although the high potential of Industry 4.0 in SMEs, the main limit... lies in a lack of concrete models for its implementation and application in small and medium enterprises. Thus, this research project titled “SME 4.0 - Smart Manufacturing and Logistics for SMEs in an X-to-order and Mass Customization Environment...

  19. FY 1999 report on the results of the research and development project for new industry creating type industrial science and technology. Innovated casting simulation technology (Development project for commercialization of technologies related to rational use of energy); 1999 nendo kakushinteki chuzo simulation gijutsu seika hokokusho. Energy shiyo gorika kankei gijutsu jitsuyoka kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Described herein are the results of the FY1999 research and development project, implemented for development of the casting process simulation technologies, with the objectives to improve efficiency and energy-saving for the various industrial areas, e.g., industrial machines, aircraft, automobiles and vehicles, and power generation plants. For development of the mold filling and solidification process simulation programs, the efforts are directed to development of the fundamental algorithms for simulation of unidirectional solidification casting used for, e.g., turbine blades, and also to the basic works for validation of the programs. For development of the solidification structures and defect formation simulation programs, the fundamental works are done for simulation of solidification structures and channel-type segregation, which are the main problems for columnar blades, to predict the defects formed in, e.g., turbines. For development of the related measurement techniques, investigations are made for evaluation of the levitation characteristics of nickel alloys by the electromagnetically levitated droplet method and problems involved therein, prior to the tests in the the underground microgravity test center. (NEDO)

  20. An agenda for research on the relationships between industrial design and performance

    NARCIS (Netherlands)

    Candi, M.; Gemser, G.

    2010-01-01

    This article proposes a research agenda for studying the relationships between industrial design and performance in the context of new product/service development. A review of existing research on relationships between industrial design and performance is used as a basis for identifying research

  1. Research and development of basic technologies for the next generation industries, 'light-reactive materials'. Evaluation on the first term research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'hikari hanno zairyo'. Daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to light-reactive materials that control the structures and status of aggregation of molecules by using actions of light, and can be used for ultra-high density recording, high resolution indication and light switches. In elucidating the mechanism of light deterioration reaction of photochromic molecules, it was disclosed that 6-nitrospirobenzopyran has the light deterioration caused from the excitation triplet state. This disclosure presents a possibility of preventing the light deterioration. New derivatives that show photochromism were synthesized, and thin films were produced by using the LB process. This indicates a possibility of producing the photochromic materials as the high multiplex recording material. With regard to PHB materials, an evaluation technology having spectrum resolution of the world's highest level was established and measurements were performed. Hole formation was verified for the first time in the world at the temperature higher than the liquid nitrogen temperature by using a PHB material of ionic porphin/polyvinyl alcohol systems. This verification indicates a feasibility of practically usable PHB materials. (NEDO)

  2. West African Journal of Industrial and Academic Research ...

    African Journals Online (AJOL)

    Computer networks, Satellite & communications Engineering ResearchIndustrial Computer applications ... Information Assurance & Network Security: The African Dilemma ... E-Waste Management Environmental Protection • Management ...

  3. Continuing Professional Development Build on Industry-Academia Partnerships

    DEFF Research Database (Denmark)

    Fink, Flemming K.

    2007-01-01

    A challenge for university - industry partnerships is to combine productive engineering and academic learning, to combine industrial engineering tasks with their tasks in Continuing Professional Development (CPD). The rather new methodology Facilitated Work Based Learning (FWBL) can be defined...... as a CPD method based on a partnership between the university and the enterprise with the purpose of transferring research based knowledge thus making it an integral part of the daily business. Scientific staff from the university is facilitating a research based learning process and competence development...

  4. FY 1999 report on the results of the research and development project for new industry creating type industrial science and technology. Innovated casting simulation technology; 1999 nendo kakushinteki chuzo simulation gijutsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Described herein are the results of the FY1999 research and development project, implemented for development of the casting process simulation technologies, with the objectives to improve productivity, reduce cost, reduce the development periods, and so on for casting. For development of the mold filling and solidification process simulation programs, the fundamental algorithm and basic designs of the three-dimensional programs are developed, and the two-dimensional programs are made on a trial basis. For the analysis of the two-dimensional mold filling models, it is found that gas entrapment may occur even in the case of sand mold casting with low permeability. For development of the solidification structure and defect formation simulation programs, the basic investigations are done for the fundamental algorithms to simulate the solidification structures and porosity defects, and for the mechanisms involved in formation of these defects. These efforts lead to adoption of the CA method, and development of the algorithms for reducing CPU time and computational memory requirements by the active block method. For development of the related measurement techniques, the construction plans and specifications of an electromagnetic levitation furnace are investigated for the underground microgravity test center. (NEDO)

  5. West African Journal of Industrial and Academic Research: Editorial ...

    African Journals Online (AJOL)

    ... communications, state-of-the-art developments in Information and communications technology, ... physics, industrial electronics, management sciences and engineering, industry chemistry, general technology rocketry, space and ... application of communications and information technology to these fields of importance.

  6. West African Journal of Industrial and Academic Research

    African Journals Online (AJOL)

    ... communications, state-of-the-art developments in Information and communications technology, ... physics, industrial electronics, management sciences and engineering, industry chemistry, general technology rocketry, space and ... application of communications and information technology to these fields of importance.

  7. Improved Industrial Development In Nigeria Through Proper ...

    African Journals Online (AJOL)

    The paper noted that most industrial development strategies in Nigeria did not give attention to technology education. And that technology education as recognized by few of the strategies were not only properly articulated for the tertiary institutions, but also poorly implemented. Therefore, to put technology and thus ...

  8. Social Upgrading in Developing Country Industrial Clusters

    DEFF Research Database (Denmark)

    Pyke, Frank; Lund-Thomsen, Peter

    2016-01-01

    In this article, we examine the role of social upgrading in developing country industrial clusters. We argue that while economic growth and productivity enhancement matter, social conditions within clusters are influenced by state monetary, fiscal, and labour policies and regulations, as well...

  9. Industrial Clusters and CSR in Developing Countries

    DEFF Research Database (Denmark)

    Fayyaz, Anjum; Lund-Thomsen, Peter; Lindgreen, Adam

    2017-01-01

    - and medium-sized enterprises (SMEs). A case study of the Sialkot football-manufacturing cluster in Pakistan indicates that donor-funded support of CSR initiatives in industrial clusters in developing countries may be short-lived, due to the political economy of aid, the national context of CSR implementation...

  10. Development of Radiotracer Techniques in Industry

    International Nuclear Information System (INIS)

    Wardono

    2000-01-01

    Contribution of radiotracer techniques to solve problems in industrial process plants have been recognized since a long time. Radiotracer application was governed by three main components, namely radioisotopes, radiation detection and data interpretation of an experiment. The three main components mentioned above have been continually developed to overcome problems relating to the operation of industrial process plants. The availability of isotope generator is one of the development aspect in radiotracer technique. Radiation hazard in radiotracer experiment may be reduced by applying isotope generator and on the other hand the delivery of radiotracer to the plant site from the radioisotopes producer was made easier. The development of microprocessor in computer system has facilitated data recording, storing and retrieving. Development in mathematical model supported by radiotracer experiment enhance data interpretation and shed light on various phenomena of flow process. Generally a flow dynamic in a process plant in all kind of industries can be studied using radiotracer technique. However the main challenge coming from petroleum, petrochemical and mineral processing industries

  11. Low Impact Development for Industrial Areas

    Science.gov (United States)

    2015-07-01

    copper gutters can also be significant sources of metal pollutants. Other studies indicate that vehicle disc brake pads and car tires can be a...industrial areas to develop the performance criteria for LID systems that specifically targeted these areas. Areas targeted include scrap metal recycling

  12. Achievement report for fiscal 1988 on fundamental technologies for next generation industries. Research and development on composite materials; 1988 nendo fukugo zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    With an objective to realize structural materials with light weight, high strength and high rigidity, research has been performed on composite materials. This paper reports the achievements in fiscal 1988. In the development on resin-based composite materials, the results of the evaluation tests on forming plates for epoxy-based resins were analyzed and summarized. On the polyimide-based resins, attempts were made on enhancement of formability of the terminal type and main chain type high heat resistant resins. Evaluations were executed on the resin characteristics by using the impact test, and heat deformation and heat reaction analyzing tests. Furthermore, experimental discussions were given on the heat transfer forming process, prefabrication forming process, microwave forming process, and hybrid forming process. In developing the metallic composite materials, the characteristics evaluation tests and manufacturing technologies were summarized on intermediate materials of the carbon fiber system and silicon carbide system. In addition, researches were performed on trial fabrication and formation of wire preforms. In the forming processes, discussions were given on the press forming process, roll forming process, HIP forming process, and thin wall thickness forming process. (NEDO)

  13. Research proposal: Industry convergence - Driving forces, factors and consequences

    OpenAIRE

    Weaver, Benjamin

    2007-01-01

    Industry convergence – the merger of hitherto separate industries – is a phenomenon that has had a profound effect on several industries and received considerable interest among practitioners and business press over the past decades. Despite this, industry con- vergence has only received limited attention from the academic management field, al- though an emergent discussion on convergence can be identified. Prior research is limited by a lack of coherent theoretical definitions of convergence...

  14. Sugar Industry and Coronary Heart Disease Research: A Historical Analysis of Internal Industry Documents.

    Science.gov (United States)

    Kearns, Cristin E; Schmidt, Laura A; Glantz, Stanton A

    2016-11-01

    Early warning signals of the coronary heart disease (CHD) risk of sugar (sucrose) emerged in the 1950s. We examined Sugar Research Foundation (SRF) internal documents, historical reports, and statements relevant to early debates about the dietary causes of CHD and assembled findings chronologically into a narrative case study. The SRF sponsored its first CHD research project in 1965, a literature review published in the New England Journal of Medicine, which singled out fat and cholesterol as the dietary causes of CHD and downplayed evidence that sucrose consumption was also a risk factor. The SRF set the review's objective, contributed articles for inclusion, and received drafts. The SRF's funding and role was not disclosed. Together with other recent analyses of sugar industry documents, our findings suggest the industry sponsored a research program in the 1960s and 1970s that successfully cast doubt about the hazards of sucrose while promoting fat as the dietary culprit in CHD. Policymaking committees should consider giving less weight to food industry-funded studies and include mechanistic and animal studies as well as studies appraising the effect of added sugars on multiple CHD biomarkers and disease development.

  15. Creative research in the chemical industry

    Indian Academy of Sciences (India)

    These efforts have involved several collaborators including many from other institutions and offered multitudinous challenges calling for continuous creativity in industrial setups. I was fortunate to have had a conducive environment to be able to respond to these challenges. I attempt to offer the readers in the ensuing pages ...

  16. Development and application of industrial radioisotope instruments in China

    International Nuclear Information System (INIS)

    Lu Yanxiao

    1994-09-01

    Industrial radioisotope instruments are emerging as advanced monitoring, controlling and automation tools for industries in China. Especially the on-line analysis systems based on radioisotope instruments, referred to as nucleonic control systems (NCS), have more and more important role in the modernization and optimization of industrial processes. Over nearly four decades significant progress has been made in the development and application of radioisotope instruments in China. After a brief review of the history of radioisotope instruments, the state of the art of this kind of instruments and recent examples of their applications are given. Technical and economic benefits have resulted from the industrial applications of radioisotope instruments and the sales of products of their own in marketing. It is expected that along with the high speed growth of national economy, there will be greater demand for radioisotope instruments and nucleonic control systems in Chinese industry to promote the technological transformation and progress of traditional industries and to establish high-tech industries with technology-intensive products. Sustained efforts for the research and development of radioisotope instrument should be made to up-grade domestic instruments and to satisfy the needs of the smaller scale industries more common in China for low cost systems. (1 fig., 2 tabs.)

  17. Current Situations and Countermeasures of Development of Kiwifruit Industry in Guizhou Province

    OpenAIRE

    Huang, Wei; Wan, Ming-chang; Yang, Sheng-jun; Zhang, Xue; Qiao, Rong

    2012-01-01

    On the basis of current development situations of planting, scientific research and processing of kiwifruit industry in Guizhou Province, the paper analyzes main factors restricting development of kiwifruit industry, including lack of unified planning, standardized planting specifications, and backward management of kiwifruit orchard. In accordance with current development situations and restricting factors, the paper presents some countermeasures for development of kiwifruit industry in Guiz...

  18. MANAGING THE DEVELOPMENT OF AGRO-INDUSTRIAL CLUSTERS

    Directory of Open Access Journals (Sweden)

    D. V. Zavyalov

    2018-01-01

    Full Text Available Purpose: the purpose of the research is to design a concept of management system for agro-industrial clusters as self-organizing systems. The transition to a new technological way was marked not only by breakthrough solutions in the organization of production of goods, works and services, but also by the emergence of new (in some cases unique forms of inter-firm cooperation and interaction of economic agents in the real and financial sector of the economy. The concept of "digital economy" becomes the most important in economic research, and moreover - from a practical point of view, modern digitalization technologies in managing the activities of economic entities form new information and communication platforms for economic and scientific exchange. The penetration of digital technologies into life is one of the characteristic features of the future world. Not an exception is the agro-industrial sector, which is both strategically important for ensuring food security and has a high export potential. The article presents the concept of managing the development of agro-industrial clusters as self-organizing systems capable of integrating the activities of small and medium-sized businesses into the value-added chain based on modern information technologies. The obligatory and providing tools, mechanisms for implementing the concept, aimed at eliminating existing problems on the way of forming agro-industrial clusters, are disclosed.Methods: the agro-industrial cluster management model is developed using the methods of economic analysis and synthesis, and functional modelling.Results: conceptual model of cluster development management is presented to be used for the nascent clusters and the development of existing agro-industrial clusters.Conclusions and Relevance: as a result of the conducted research the reasons interfering development of cluster approach in the agroindustrial sector of economy are defined. Among them the main are: lack of

  19. Australian Industry Development Corporation annual report 1984

    Energy Technology Data Exchange (ETDEWEB)

    1984-01-01

    AIDC is a statutory corporation wholly owned and guaranteed by the Commonwealth of Australia. Its objects are to promote Australian industry and Australian ownership in industry. The corporation is a financial enterprise operating on commercial principles. It is engaged in the business of borrowing money, making loans and making equity investments. It also provides related financial advisory and other services, including lead management of syndicated project financings. This annual report looks at the highlights of 1983/84; a five year summary of operations; lists the Board of Directors; some executives; includes a Directors report on development finance, industry and funds management; a management structure; statistical tables; executives and a 22 page financial statement.

  20. Bioenergy industries development in China. Dilemma and solution

    International Nuclear Information System (INIS)

    Peidong, Zhang; Yanli, Yang; Xutong, Yang; Yonghong, Zheng; Lisheng, Wang; Yongsheng, Tian; Yongkai, Zhang

    2009-01-01

    Having 2.8 x 10 8 -3.0 x 10 8 t/a of wood energy, 4.0 x 10 6 t/a of oil seeds, 7.7 x 10 8 t/a of crops straw, 3.97 x 10 9 t/a of poultry and livestock manure, 1.48 x 10 8 t/a of municipal waste, and 4.37 x 10 10 t/a of organic wastewater, China is in possession of good resource condition for the development of bioenergy industries. Until the end of 2007, China has popularized 2.65 x 10 7 rural household biogas, established 8318 large and middle-scale biogas projects, and produced 1.08 x 10 10 m 3 /a of biogas; the production of bioethanol, biodiesel, biomass briquettes fuel and biomass power generation reached to 1.5 x 10 6 t/a, 3.0 x 10 5 t/a, 6.0 x 10 4 t/a and 6.42 x 10 9 kWh, respectively. In recent years, bioenergy industries developed increasingly fast in China. However, the industrial base was weak with some dilemma existing in raw material supply, technological capability, industry standards, policy and regulation, and follow-up services, etc. From the viewpoint of long-term effective development system for bioenergy industries in China, a series of policy suggestions have been offered, such as strengthening strategy research, improving bioenergy industries development policies and plan, enhancing scientific research input, persisting in technology innovation, establishing product quality standard, improving industrial standard system, opening market and accelerating commercialization, etc. It is expected that the advices mentioned above could be helpful for the improvement of bioenergy industries development. (author)

  1. Eco industrial Development: As a Way of Enhancing Sustainable Development

    Directory of Open Access Journals (Sweden)

    Begum Sertyesilisik

    2016-03-01

    Full Text Available The world’s habitat is being deteriorated especially due to the unsustainable production. The need for sustainable development and reducing humanities’ environmental footprint have been addressed in various international frameworks, meetings and reports (e.g. Kyoto protocol, the Resource Efficiency and Cleaner Production Program, the Ten Year Framework of Programs on Sustainable Consumption and Production, the UN Resource Panel, and the Green Economy Initiative, Rio+20, green building certificates, “UNEP Green Economy” in 2011, “Green New Deal” in 2012, the Intergovernmental Panel on Climate Change’s report etc.. EIDs (the eco industrial development can act as catalysts in sustainable development and in reducing environmental footprint of the production processes. Based on an in-depth literature review, this paper aims to analyze how EID can be supported so that environmental footprint of the production processes can be reduced contributing sustainable development. With this aim, the objectives include: analysis of the need for the EID; need for the sustainable development enhanced by sustainable production and sustainable products; key success factors for, barriers against and drivers for the EID. The policy makers, companies, and researchers are expected to get benefit from this paper.

  2. Directory of French photovoltaic research and industry 2011

    International Nuclear Information System (INIS)

    Poubeau, Romain; Simmonet, Raphael; Canals, Jonathan

    2011-05-01

    After an overview of what is at stake in terms of industrial employment in the photovoltaic sector, a presentation of competitiveness clusters, a description of the value chain (cell manufacturers, arrays manufacturers, power inverter manufacturers, electric equipment manufacturers, structure component manufacturers, fabrication steps, etc.) in the photovoltaic sector, this document proposes a directory (addresses, activity descriptions) of research and industrial actors of the photovoltaic sector in France: research centres, manufacturers, industrial projects

  3. Applications of synchrotron X-rays in microelectronics industry research

    International Nuclear Information System (INIS)

    Jordan-Sweet, Jean L.; Detavernier, Christophe; Lavoie, Christian; Mooney, Patricia M.; Toney, Michael F.

    2005-01-01

    The high flux and density of X-rays produced at synchrotrons provide the microelectronics industry with a powerful probe of the structure and behavior of a wide array of solid materials that are being developed for use in devices of the future. They also are of great use in determining why currently-used materials and processes sometimes fail. This paper describes the X20 X-ray beamline facility operated by IBM at the National Synchrotron Light Source, and presents a series of three industry challenges and results that illustrate the variety of techniques used and problems addressed. The value of this research ranges from solving short-term, technically specific problems to increasing our academic understanding of materials in general. Techniques discussed include high-resolution diffraction, time-resolved diffraction, texture measurements, and grazing-incidence diffraction

  4. Challenges in industrial fermentation technology research

    DEFF Research Database (Denmark)

    Formenti, Luca Riccardo; Nørregaard, Anders; Bolic, Andrijana

    2014-01-01

    Industrial fermentation processes are increasingly popular, and are considered an important technological asset for reducing our dependence on chemicals and products produced from fossil fuels. However, despite their increasing popularity, fermentation processes have not yet reached the same...... engineering challenges: scaling up and scaling down fermentation processes, the influence of morphology on broth rheology and mass transfer, and establishing novel sensors to measure and control insightful process parameters. The greatest emphasis is on the challenges posed by filamentous fungi, because...

  5. Fiscal 1997 Project related to research and development of global environment industrial technologies. Report on the results of works commissioned for research and development of technology for reducing carbon dioxide emissions; 1997 nendo chikyu kankyo sangyo gijutsu kenkyu kaihatsu kanren jigyo. Nisanka tanso nado haishutsu teigen gijutsu kenkyu kaihatsu itaku gyomu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    With an objective of achieving reduction in emission of carbon dioxide and fluorocarbons, the `research and development on technologies to reduce emission of carbon dioxide and other substances` consisting of eight projects were conducted. In research and development of waste water treatment technologies using submerged combustion, studies were performed on removal by combustion of such pollutants as organic compounds, nitrogen compounds, and sulfur compounds. The development targets were achieved on each item. In research and development related with thermal electric power generation elements, semiconductor single crystals were fabricated in order to acquire technical knowledge on thermal power generation elements intended of utilizing industrial waste heat, whereas a simulation technology for designing was developed. In other projects, research and development works were carried out on high-performance heat insulating materials, and a movable methanol reformer for fuel cells. Developments were conducted on a large pressure reducing valve, and a cooling and heating turbo heat pump for regional air conditioning facilities. Research and development were made on Peltier elements, all efforts having achieved results respectively. 134 figs., 65 tabs.

  6. The development of sports industry in Russia

    Directory of Open Access Journals (Sweden)

    Sergeev A.A.

    2016-12-01

    Full Text Available the authors believe that Russia today loses the strategic directions of sports development: effective interaction between the state and business, management of sports industry, sport propaganda, attraction of investments and innovative technologies, at the same time, the state is realistic about the sport today and is moving in the direction of changes for the better. According to the authors, an example of this can be the implementation of the strategy of development of physical culture and sport for the period up to 2020. The article notes that the state should increasingly focus on creating favorable conditions in the direction of decentralization of management activities, preferential tax treatment, to give place to business in the sports industry, promote healthy lifestyles and to strengthen control over the fulfillment of social functions of sport development.

  7. Research on optical applications in nuclear industry

    International Nuclear Information System (INIS)

    Kim, Cheol Jung; Shin, Jang Soo; Lee, Sang Mock; Baik, Sung Hoon; Kwon, Seong Ouk; Hong, Suc Kyoung; Kim, Duk Hyeon

    1988-12-01

    The laser fluorometer developed in 1987 has been modified to compensate the inner filter and quenching effects. The signal processing electronic circuit was redesigned and a computer interface was introduced for data processing. It has been already used in routine chemical analysis in the chemical analysis division. Its application to uranium monitoring in conversion plant is being investigated. Also, we found that it can be used in trace analysis of samarium and europium with detection limit of 1 ppb and 0.1 ppb, respectively. The IRMPA/D process of CDF 3 and CHF 3 have been studied. The pressure effects of CDF 3 ,CHF 3 and added buffer gas were investigated. Mainly, the change in reaction rate was examined while varying the pressure of CDF 3 , CHF 3 and buffer gas. The IRMPD reaction ratio of CDF 3 and CHF 3 from below 0.1 torr up to a few torr was studied and the buffer gas pressure effect was investigated at constant pressure of CDF 3 or CHF 3 of 1 torr. Several kinds of buffer gas, Ar, N 2 , and SF 6 , were used to investigate the buffer gas pressure effect. We applied double exposure holographic interferometry, and analyzed qualitatively the distortion due to thermal heat and vibration. The research on holographic remote inspection will be achieved to apply this technique to the nuclear fuel cycle facilities. (Author)

  8. MANAGING INDUSTRIAL PHARMACEUTICAL RESEARCH-AND-DEVELOPMENT - A COMPARATIVE-STUDY OF MANAGEMENT CONTROL AND INNOVATIVE EFFECTIVENESS IN EUROPEAN AND ANGLO-AMERICAN COMPANIES

    NARCIS (Netherlands)

    OMTA, SWF; BOUTER, LM; VANENGELEN, JML

    1994-01-01

    Drug regulation and pricing have put strong pressure on the cost-benefit ratio of the innovative pharmaceutical industry. Therefore a study has been conducted in fourteen large and medium sized companies to determine some important organisational and managerial factors influencing success in

  9. Industrial Ecology and Regional Development: Eco-Industrial Development as Cluster Policy

    OpenAIRE

    Deutz, Pauline; Gibbs, David

    2008-01-01

    Abstract Aspects of industrial ecology fit closely with work in regional development investigating clustering, networking, and local economic development. However, there has been limited cross fertilisation between these bodies of literature. This paper uses an empirical focus on eco-industrial developments in the USA to postulate that IS can be viewed as a distinct cluster concept and to consider the implications of this for both IE and RD policies. (Deutz,...

  10. Regional characteristics relevant to advanced technology cogeneration development. [industrial energy

    Science.gov (United States)

    Manvi, R.

    1981-01-01

    To assist DOE in establishing research and development funding priorities in the area of advanced energy conversion technoloy, researchers at the Jet Propulsion Laboratory studied those specific factors within various regions of the country that may influence cogeneration with advanced energy conversion systems. Regional characteristics of advanced technology cogeneration possibilities are discussed, with primary emphasis given to coal derived fuels. Factors considered for the study were regional industry concentration, purchased fuel and electricity prices, environmental constraints, and other data of interest to industrial cogeneration.

  11. Research and development project in fiscal 1989 for fundamental technologies for next generation industries. Achievement report on research and development on high-crystalline polymeric materials; 1989 nendo kokesshosei kobunshi zairyo no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    With an objective to expand applications of polymeric materials having features of light weight, high corrosion resistance, and easy-to-process performance, researches have been performed on fundamental technologies for high-crystalline polymeric materials. This paper summarizes the achievements in fiscal 1989. In monophyletic system materials, thermotropic liquid crystal polyarylate was taken as the object to study optimization of the polymeric chemical structure, and elongation and fluid orientation processing. In the research of polyphyletic materials by means of special dissolution forming, researches were carried out on elastic modules manifestation factors of poly-PIBO, and the relationship between the melting viscosity and the orientation performance of polyazomethine. For molecular composite formed polyphyletic materials, a tape with tensile modulus of elasticity of 142 GPa using aromatic copolyamide as matrix, and laminates with bending modules of elasticity of 110 GPa were obtained. Regarding cross-linking system materials, synthesizing, forming, and improvements were discussed on hybrid cross-linking polymers containing multiple number of cross-linking functional groups. In addition, research was performed on a poly-functional diacetylene based material as a three-dimensional cross-linking material with high elasticity modulus of new conception having covalent linkage. (NEDO)

  12. Research and development of basic technologies for next-generation industry. Evaluation of 1st-phase research and development of 3-dimensional circuit devices; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Sanjigen kairo soshi daiikki kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-03-30

    The aim is to develop basic technologies relating to 3-dimensional circuit devices with an ultrahigh-density accumulation of functions therein for the embodiment of ultra-small high-performance data processing devices or artificial brain-like multiple-function data processing devices. To be developed are laminate-structure devices which have an ultrahigh-density accumulation of logic and memory functions or a complex accumulation of functions including signal and sensor functions. In the 1st phase, importance is attached to the development of a multilayer crystalline structure, which is the most elementary in the development of 3-dimensional circuit devices, and of processing technologies for them. Propositions are made and analyses are conducted relating to the enlargement of exposure region in synchrotron radiation lithography, development of a maskless beam process of a resolution of 0.1{mu}m, development of a focused ion beam device, etc. Recrystallization methods using a laser beam or a linear electron beam are developed for the growth of multilayer crystals, and are proved to be effective. The application feasibility of a flat deposition dry process etc. to laminate processing technologies is demonstrated. Concerning integration technologies, some laminated circuit devices are experimentally fabricated, and their behavior is determined. The goals of the 1st phase are found achieved. (NEDO)

  13. OpenFOAM: Open source CFD in research and industry

    Science.gov (United States)

    Jasak, Hrvoje

    2009-12-01

    The current focus of development in industrial Computational Fluid Dynamics (CFD) is integration of CFD into Computer-Aided product development, geometrical optimisation, robust design and similar. On the other hand, in CFD research aims to extend the boundaries ofpractical engineering use in "non-traditional " areas. Requirements of computational flexibility and code integration are contradictory: a change of coding paradigm, with object orientation, library components, equation mimicking is proposed as a way forward. This paper describes OpenFOAM, a C++ object oriented library for Computational Continuum Mechanics (CCM) developed by the author. Efficient and flexible implementation of complex physical models is achieved by mimicking the form ofpartial differential equation in software, with code functionality provided in library form. Open Source deployment and development model allows the user to achieve desired versatility in physical modeling without the sacrifice of complex geometry support and execution efficiency.

  14. OpenFOAM: Open source CFD in research and industry

    Directory of Open Access Journals (Sweden)

    Hrvoje Jasak

    2009-12-01

    Full Text Available The current focus of development in industrial Computational Fluid Dynamics (CFD is integration of CFD into Computer-Aided product development, geometrical optimisation, robust design and similar. On the other hand, in CFD research aims to extend the boundaries of practical engineering use in “non-traditional” areas. Requirements of computational flexibility and code integration are contradictory: a change of coding paradigm, with object orientation, library components, equation mimicking is proposed as a way forward. This paper describes OpenFOAM, a C++ object oriented library for Computational Continuum Mechanics (CCM developed by the author. Efficient and flexible implementation of complex physical models is achieved by mimicking the form of partial differential equation in software, with code functionality provided in library form. Open Source deployment and development model allows the user to achieve desired versatility in physical modeling without the sacrifice of complex geometry support and execution efficiency.

  15. Contemporary trends in the hotel industry development

    Directory of Open Access Journals (Sweden)

    Barjaktarović Dragan

    2016-01-01

    Full Text Available International tourism has a leading position in the world's economy at the end of the 20th century and at the beginning of the 21st century. The number of participants in international tourism is near one billion tourists. Tourism FX income is above USD 1.260 billion, globally. More than 2/3 of total tourism turn over is provided by hospitality and restaurants business, which is the best indicator of relevance of those industries, for further development of total economic development and the tourism. Projections of different relevant world's institutions go in direction that tourism will have dynamic developing trend which will provide its' stronger position in the world's industry development. In accordance with UNWTO's estimations, number of foreign tourists will increase up to 1.8 million and FX tourist income is expected to reach USD 2.000 billion at the end of 2030. In order to meet the sophisticated requests of the modern tourists and provide an answer to contemporary market trends, hotel industry, as the base part of tourism, will respond with the new qualitative, technology based facilities and services.

  16. Achievement report on research and development of basic technologies for the next generation industries in fiscal 1981. Research and development of a recombinant DNA utilizing technology; 1981 nendo jisedai sangyo kiban gijutsu itaku kenkyu kaihatsu seika hokokusho. Kumikae DNA riyo gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    Achievements were compiled on the research in fiscal 1981 on the 'research and development of a recombinant DNA utilizing technology', which has been performed according to the 'institution for research and development of basic technologies for the next generation industries'. For the method to create energy saving type bacteria stocks for processes centering around the escherichia coli, refinement was carried out on cytochrome P-450 and NADPH-cytochrome P-450 reduction enzyme respectively from hepatic microsome of rats administered with induction agents. Attempts were made to prepare antibodies working on them. For the method to create high-efficiency secreting bacteria stocks centering around bacillus subtilis, activity measurement and quantification were performed on enzymes external to the bacillus sutilis, and research was executed on introduction of neutral protease gene sensitive to bacillus subtilis temperatures into the NA20-S17 stock. For the method to create bacteria stocks to substitute raw materials used in the chemical industry, studies were performed on separation of enzymes and corresponding genes, and incorporation of the genes into the escherichia coli. In the comprehensive investigation and research on the recombinant DNA utilizing technology, information exchange and discussions meetings were held, and investigations were made on literatures and patents. (NEDO)

  17. Achievement report on research and development of basic technologies for the next generation industries in fiscal 1981. Research and development of a recombinant DNA utilizing technology; 1981 nendo jisedai sangyo kiban gijutsu itaku kenkyu kaihatsu seika hokokusho. Kumikae DNA riyo gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1982-03-01

    Achievements were compiled on the research in fiscal 1981 on the 'research and development of a recombinant DNA utilizing technology', which has been performed according to the 'institution for research and development of basic technologies for the next generation industries'. For the method to create energy saving type bacteria stocks for processes centering around the escherichia coli, refinement was carried out on cytochrome P-450 and NADPH-cytochrome P-450 reduction enzyme respectively from hepatic microsome of rats administered with induction agents. Attempts were made to prepare antibodies working on them. For the method to create high-efficiency secreting bacteria stocks centering around bacillus subtilis, activity measurement and quantification were performed on enzymes external to the bacillus sutilis, and research was executed on introduction of neutral protease gene sensitive to bacillus subtilis temperatures into the NA20-S17 stock. For the method to create bacteria stocks to substitute raw materials used in the chemical industry, studies were performed on separation of enzymes and corresponding genes, and incorporation of the genes into the escherichia coli. In the comprehensive investigation and research on the recombinant DNA utilizing technology, information exchange and discussions meetings were held, and investigations were made on literatures and patents. (NEDO)

  18. Strategies for Developing China's Software Industry

    Directory of Open Access Journals (Sweden)

    Mingzhi Li

    2003-01-01

    Full Text Available The software industry is deemed an ideal target for a developing country to integrate into the world information and communications technology (ICT market. On the one hand the industry is labor intensive, and the developing countries have a large labor surplus; on the other hand, it is a worldwide trend for developed countries to outsource a vast amount of low-end, software-related tasks to the low-cost countries and regions, which fits into some developing countries’ caliber nicely. India has often been cited as the role model for a developing country to tap into the world software market for its continuous success in the software export sector. In comparison, China’s software industry is still negligible in the world despite its sustained high economic growth rate since the economic reform took off in the late 1970s.This paper aims at examining strategies for developing China’s software industry. We use India as a reference because of the similarities of the two countries’ stages of economic development and the clear divergence in their ICT structures and development paths. Although the language barrier has often been singled out as the major obstacle for China’s software exports, we believe the major reasons for its underdevelopment can be ascribed to the following factors. On the national level, the government attention has been skewed toward the hardware sector in the ICT industry, and there is no clear national vision for the strategic direction for the software industry.On the industry and ªrm level, software development has been regarded as the art of individual creativity rather than an engineering process. As a result, the importance of quality and standards, the two important critical factors in software development, have been largely neglected. Perhaps an even more fundamental factor lies in the deeply rooted notion that software is an attachment to the hardware and should be a free product. The lack of intellectual

  19. Research and Exploration for Operational Research Education in Industry and Engineering Subject

    Science.gov (United States)

    Wu, Yu-hua; Wang, Feng-ming; Du, Gang

    2007-01-01

    On the basic of exploring the relationship of industry engineering and operational research technique, the thesis analyzes the location and utility of the operational research education in the whole industry engineering subject education. It brings forward the system design about operational research and relative class among industry engineering…

  20. Cluster development in the SA tooling industry

    Directory of Open Access Journals (Sweden)

    Von Leipzig, Konrad

    2015-11-01

    Full Text Available This paper explores the concept of clustering in general, analysing research and experiences in different countries and regions, and summarising factors leading to success or contributing to failure of specific cluster initiatives. Based on this, requirements for the establishment of clusters are summarised. Next, initiatives especially in the South African tool and die making (TDM industry are considered. Through a benchmarking approach, the strengths and weaknesses of individual local tool rooms are analysed, and conclusions are drawn particularly about South African characteristics of the industry. From these results, and from structured interviews with individual tool room owners, difficulties in the establishment of a South African tooling cluster are explored, and specific areas of concern are pointed out.

  1. STUDY OF TRENDS AND PERSPECTIVES OF INDUSTRIAL ENGINEERING RESEARCH

    Directory of Open Access Journals (Sweden)

    H. Dastkhan

    2012-01-01

    Full Text Available

    ENGLISH ABSTRACT: Industrial engineering is an engineering discipline which, because of its multi-disciplinary nature, has played an important role in the development and optimization of different systems at macro and micro levels. In this paper, the results of a research to study the position and trend of Industrial Engineering research in recent years are described. The data from a sample of 7 114 IE-related articles from international journals during the last 27 years were used for the analysis. The results showed that the development of IE in many countries has a strong correlation with their industrial and economic development. However, IE research topics are spreading in other management and engineering departments and so there is a need to redefine the discipline and its specific areas of interest. According to the prediction made using time series analysis, the most favorite fields of IE research in future will be on subjects related to information technology, intelligent systems, optimization, quality, and supply chain management.

    AFRIKAANSE OPSOMMING: Bedryfsingenieurswese is 'n ingenieursdissipline wat vanweë die multi-dissiplinêre aard daarvan 'n belangrike rol gespeel het in die optimisering van verskillende sisteme op makroen mikrovlak. Hierdie artikel hou die resultate voor van 'n navorsingsprojek wat onderneem is om die posisie en rigting van Bedryfsingenieursnavorsing in onlangse jare te bepaal. Die data van 'n monster van 7 114 Bedryfsingenieursverwante artikels wat verskyn het in internasionale joernale oor die afgelope 27 jaar is gebruik vir die ontleding. Die resultate toon dat die groei van Bedryfsingenieurswese in verskeie lande sterk korreleer met industriële en ekonomiese ontwikkeling. Tog blyk dit dat die navorsingsonderwerpe van Bedryfsingenieurswese sprei na ander bestuurs- en ingenieursdepartemente en dus bestaan daar ‘n nodigheid om die dissipline en die spesifieke belangstellingsvelde te herdefinieer

  2. University-Industry Research Collaboration: A Model to Assess University Capability

    Science.gov (United States)

    Abramo, Giovanni; D'Angelo, Ciriaco Andrea; Di Costa, Flavia

    2011-01-01

    Scholars and policy makers recognize that collaboration between industry and the public research institutions is a necessity for innovation and national economic development. This work presents an econometric model which expresses the university capability for collaboration with industry as a function of size, location and research quality. The…

  3. Ecotribology research developments

    CERN Document Server

    2016-01-01

    This book presents resent research advances in the area of eco-triobology. In the last years, eco-tribology or environmentally friendly tribology has gained increasing importance in sustainable engineering. Environmentally acceptable tribological practices save resources by optimizing product usage and reducing energy. This book covers current developments in all areas covered by the term eco-tribology, including biomimetics surfaces, control of friction and wear, environmental aspects of lubrication and surface modification techniques as well as tribological aspects of green applications, such wind-power turbines or solar panels.

  4. Fiscal 1999 achievement report on interuniversity coordination type research and development of industrial technology. Research and development of highly functional material designing platform; 1999 nendo kokino zairyo sekkei platform no kenkyu kaihatsu seika hokokusho. Energy shiyo gorika gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    For the purpose of enabling prediction of structures and properties of polymeric materials by computer-assisted experiments, studies were conducted for putting new simulation technologies to practical application. With the coarse-graining molecular dynamic method working group, a coarse-graining molecular dynamic engine high in generality and augmentability was developed so that an optimum coarse-graining model might be chosen and constructed to achieve any given purpose, and its installation was almost completed. The dynamic mean field method working group fabricated a new general-purpose simulator with its interface simplified and function improved. A simulation technique was also developed, which would be incorporated into the general-purpose simulator. The dispersed structure simulation working group developed a group of class libraries for use in continuum simulation. The platform working group, making use of Java excellent in general-purpose feature, worked out a function verification platform to run on Windows95/98/NT. (NEDO)

  5. Market structure, industrial organisation and technological development: the case of the Japanese electronics-based nc-machine tool industry.

    OpenAIRE

    Watanabe, S

    1983-01-01

    ILO pub-WEP pub. Working paper on the impact of market structure and business organization on technological change in the automatic control machine tool industry in Japan - based on a 1982 sample survey of 40 industrial enterprises, discusses research and development trends, demand, production, subcontracting, competition, etc.; investigates the impact of electronics Innovation on small scale industry, the international division of labour and on developing countries. Bibliography and graphs.

  6. Development of industrial utilization of metallic sodium

    International Nuclear Information System (INIS)

    Yuhara, Shunichi

    1995-01-01

    Sodium exists in large quantity, being ranked to 6th in the existence proportion of elements, and takes 2.83% of the matters composing earth crust. Sodium is an alkali metal which is light weight, chemically very active and a strong reducing substance. It is excellent in the compatibility with iron and steel materials, and it possesses good heat conduction and flow characteristics and stable nuclear characteristics. Since the industrial production of sodium became practical, its utilization was developed as the reducing agent and catalyst in chemical industry, the core coolant and heat transport medium for nuclear reactors, the material composing the secondary batteries for storing electric power, and the auxiliaries for metal refining and so on. The industrial production of metallic sodium is carried out by the electrolysis of melted salt, namely Downs process. The production of metallic sodium in Japan is 3000-6000 t yearly, and its import is 300-350 t. Its main use is for organic chemical industry including dye production. The grades of metallic sodium products and their uses are shown. The utilization of sodium for large fast reactors, the utilization of NaK as the heat transport and cooling medium for space use nuclear reactors and deep sea fast reactor system, and the utilization of sodium as the catalyst in dye production, for silicon carbide fiber production and for agricultural and medical chemical production are reported. (K.I.)

  7. Development of the production of special steels for nuclear industries

    International Nuclear Information System (INIS)

    Vieillard-Baron, B.

    1977-01-01

    The development of electro-nuclear industries has a powerful impact on the production of special steels, although the quantity of material applied to the non-conventional parts of nuclear power plants is quite small as compared to the total production requirements in this industrial field. Evolution bears on the product research, development and testing methods, on the technical and marketing services - in particular the establishment of quality control teams and assurance manuals - and the implementation of high performance production equipments. Manufacturing must however take place under normal work load and productivity conditions of production tools, and thus ensure a satisfactory profitability on investments entailed [fr

  8. DEVELOPMENT OF THE STATE SUPPORT FORMS PROJECTS IN INDUSTRIAL BUILDING

    Directory of Open Access Journals (Sweden)

    I. M. Meilanov

    2016-01-01

    Full Text Available Aim. The topicality of the research is stipulated by the objective necessity of the organizational and economic mechanism improvement of the state support projects of the industrial building. The aim of the research is the development of conceptual provisions and methodological foundations of financial projects creating conditions for economic growth of Russia based on the construction and putting into effect industrial objects.Methods. In the course of the research the system, subject-functional and structural approaches were implemented to solve the problems set widening the scope of the complex approach to assessment of the current operating mechanism of the state financial support of the projects and financial volume; to criteria stipulation of the most effective projects contest selection: to the search of the investment resources accumulation instrument into industrial building.Results. It is stipulated that state investment policy in industrial building mechanism oriented to define rational investment volumes and their branch, reproductive, technological and territorial structure; option of the building branch development priority; increase of the investment projects efficiency realization. The dynamics of the state support in the form of subsidies and budget investments into creation of the industrial building objects is analytically summarized. It is determined that the peculiarity of the modern state support projects of industrial building is transition from budget allocations distribution between branches and regions to selective and partial financing of specific investment projects on competitive basis. Some tactics of state and private partnership attracting private capital without losing strategic state control under systems and objects are defined. As an effective form of the industrial building support projects it is proposed to use a concession model form: projecting - building- financing- ownership - exploitation

  9. Report on research results of the development of high efficient boilers in fiscal 1996. Research development of high efficient industrial furnaces, etc; Koseino boiler no kaihatsu ni kansuru kenkyu seika hokokusho. Koseino kogyoro nado ni kansuru kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    Out of the developments of high efficient boilers which have been continued since fiscal 1993, the paper reported the result of the development conducted in fiscal 1996. The oxygen combustion (the oxygen enrichment combustion including 100% oxygen combustion) decreases the amount of flue gas and reduces heat loss of the flue gas, and is also effective as NOx reduction measures. The experiment was conducted using testing furnace. The boiler efficiency rapidly increased with the increasing concentration of oxygen enrichment. In the pure oxygen combustion, the overall boiler efficiency of a 106% level (low heating value standard) is expected. Since the boiler wet flue gas is decreased, the NOx emission is reduced. The boiler can raise the combustion temperature with no fear of NOx and can be reduced in size. CO2 decreases in proportion to the energy saving effect. The development of a condensation flue gas heat exchanger is aimed at recovering heat down to the low temperature. Prediction of heat transfer in the steam condensation region becomes possible, and the size reduction can be expected. Dew point corrosion resistant materials were also selected. As to the high speed combustion control, a simple type using micro-processor was developed. Obtained were high speed, compactness, electric power saving, and high controllability. 14 refs., 306 figs., 88 tabs.

  10. Development of ion/proton beam equipment for industrial uses

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Byung Ho; Lee, J. H.; Cho, Y. S.; Joo, P. K.; Kang, S. S.; Song, W. S.; Kim, H. J.; Chang, G. H.; Bang, S. W

    1999-12-01

    KAERI has possessed design and fabrication technologies of various ion sources including Duoplasmatron and DuoPiGatron developed by R and D projects of the long-term nuclear technology development program. In order to industrialize ion beam equipments utilizing these ion sources, a technology transfer project for a technology transfer project for a domestic firm has been performed. Under this project, engineers of the firm have been trained through classroom lectures of ion beam principles and OJT, an ion/proton beam equipment (DEMO equipment) has been designed, assembled and commissioned jointly with the engineers. Quality of the ion sources has been quantified, and technologies for ion beam equipment construction, functional test and application research have been developed. The DEMO equipment, which consists of an ion source, power supplies, vacuum, cooling and target systems, has been fabricated and tested to secure stability and reliability for industrial uses. Various characteristic tests including high voltage insulation, beam extraction, beam current measuring, etc. have been performed. This DEMO can be utilized for ion sources development as well as ion beam process development for various industrial products. Engineers of the firm have been trained for the industrialization of ion beam equipment and joined in beam application technology development to create industrial needs of beam equipment. (author)

  11. Industry's demand for the BESSY synchrotron radiation (SR): approaches towards interlinking basic scientific research activities and industry

    International Nuclear Information System (INIS)

    Bierhals, R.; Schmoch, U.; Nick, D.; Pilorget, L.; Ritschel, C.; Walter, G.H.

    1994-08-01

    In Germany, industry's demand for synchrotron radiation (SR) is very limited, due to the current macroeconomic situation and the corporate strategy of potential SR users in industry. This is in contrast to the conditions in the USA (and Japan), where industrial enterprises more readily invest in and run their own long-term basic research projects for exploration of potential commercial applications according to their demands, with research goals pursued there and in Germany overlapping to a large extent. It cannot be expected that demand for SR from industry in Germany will ever come up to the level seen in the USA. In Germany, non-university research institutes are most likely to become an important group of potential users of SR. Substantially boosting the demand for SR from industry will need a change of macroeconomic framework conditions affecting the corporate strategy to the effect that industry will more strongly commit itself to and take up responsibility for application-oriented fundamental research and the corresponding technology transfer. This can be achieved by a policy providing both for institutional means and financial incentives. As to near-market, strategic technological developments, establishment of structures allowing direct cooperation of science and technology, for instance in the form of joint ventures, or underwriting agreements and corresponding supervisory boards, seem to be promising. As to basic-research-oriented promotion of research, a technology screening might lead to the selection of technology-relevant research goals, and corresponding financial support from a special fund. Such incentives for cooperative action by technology, science and the government will create novel types of research-industry interfaces in Germany between ''historical'' spheres of autonomy of research of industry and the scientific community. (orig.) [de

  12. Industrial oriented research at Ljubljana Tandetron Facility

    International Nuclear Information System (INIS)

    Pelicon, P.; Simcic, J.; Razpet, A.; Budnar, M.

    2001-01-01

    Full text: Galvanization is the cheapest and the most frequently used industrial coating technique. The diagnostics of usually thick deposited layers is rather time consuming and expensive, when surface layers have to be removed to obtain depth concentration profiles. Proton- impact RBS exhibits both large range and sufficient depth resolution for efficient and cost-effective depth profiling. Several galvanic coatings, composed of Sn/Cu/Ni/Graphite layers were analyzed by current-normalized RBS. 3 MeV protons were used to enable detection range of up to 25 micrometers. SIMNRA code was used to analyze the spectra. The depth concentration profiles obtained enable the control of annealing to obtain proper concentration mixing at the interfaces. In this way, the melting point of the upper layer for contact welding and wear hardness could be optimized. (author)

  13. Research tools | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Through training materials and guides, we aim to build skills and knowledge to enhance the quality of development research. We also offer free access to our database of funded research projects, known as IDRIS+, and our digital library. Our research tools include. Guide to research databases at IDRC: How to access and ...

  14. Changing Research Practices and Research Infrastructure Development

    Science.gov (United States)

    Houghton, John W.

    2005-01-01

    This paper examines changing research practices in the digital environment and draws out implications for the development of research infrastructure. Reviews of the literature, quantitative indicators of research activities and our own field research in Australia suggest that there is a new mode of knowledge production emerging, changing research…

  15. Basic research on energy conservation in developing countries. Joint research on oil conservation (research report on the industrial basis of Socialist Republic of Vietnam); Hatten tojokoku energy shohi koritsuka kiso chosanado jigyo sekiyu shohi koritsuka kyoryoku chosa. Betonamu shakai shugi kyowakoku sangyo kiso chosa hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    The field research of oil conservation was conducted in developing countries, in particular, Vietnam where a steep increase in oil consumption is anticipated in the future. Energy conservation is the most effective direct measures to control combustion of fossil fuels, and an important issue to be promoted by all countries in the world to prevent global warming and reserve energy resources. In fiscal 1994, main industries in the northern part of Vietnam were researched. In fiscal 1995, the report meeting of plant survey results in the northern part and the technical seminar of energy-saving in industrial field were held, and plants around Ho Chi Minh City in the southern part of Vietnam were researched. Although Vietnam has recently acquired membership in ASEAN and is undergoing dramatic economic growth, has many problems in environmental measures. Japan has top-ranking results on energy-saving in industrial field, and the transfer of such superior technologies and techniques will greatly contribute to resource and global warming problems as well as pollution control measures in Vietnam. 13 refs., 25 figs., 26 tabs.

  16. Cooperation in research and development

    International Nuclear Information System (INIS)

    Ramanna, R.

    1977-01-01

    In planning scientific programs for rapid and extensive peaceful applications of atomic energy in any developing country, it is not fully realized that one of the most important inputs is a strong research and development (R and D) base with a well-oriented training program. The paper discusses the various ways in which R and D is required to assist in both indigenous and turnkey projects. The R and D organization should be broad based; i.e., it should have physicists, chemists (particularly specialists in water chemistry), health physicists, and engineers (particularly metallurgists for materials development, study of corrosion problems, etc.). The role of electronic engineers is also very significant from the viewpoint of designing reactor control systems. Another important advantage of having an R and D program is its general technological fallout, which aids the entire industrial structure of the country. The concept of regional cooperation is very important, particularly for atomic energy programs in developing countries that have similar conditions and levels of technological skills. This cooperation can be bilateral or multilateral under the auspices of the International Atomic Energy Agency. Scientists from several countries have been trained in our Center, and we also had a very successful India-Philippines-Agency Project in which scientists from many countries in the region participated in cooperative research programs

  17. Industry-university collaboration for research and education

    International Nuclear Information System (INIS)

    Shalaby, B.A.; Snell, V.G.; Rouben, B.

    2015-01-01

    University Network for Excellence in Nuclear Engineering also known as UNENE is a joint partnership between the nuclear industry and thirteen universities. UNENE has been legally registered as of 2002 as a not for profit organization. The establishment of this network was prompted by industry to address anticipated retirement of a large number of professionals from industry starting in early 2000 onwards and thus the loss of nuclear knowledge and experience within industry. UNENE was created to provide a sustainable supply of highly qualified personnel to industry, support nuclear research within various universities and provide a course based Master's Degree in nuclear engineering to enhance the knowledge of young professionals within the industry in the science and technology of the CANDU nuclear power system. The paper describes the current UNENE, its research objectives, key outcomes of research programs to date and its contribution to industry needs in maintaining an economic and safe power plant performance of its nuclear fleet. The paper addresses achievements within the education program and the new 4-course diploma program recently introduced to enhance core expertise of young industry professionals. Also publications and national and international collaborations in various aspects of research have significantly contributed to Canada's position in nuclear science and research worldwide. Such collaborations are also addressed. (author)

  18. Industry-university collaboration for research and education

    Energy Technology Data Exchange (ETDEWEB)

    Shalaby, B.A.; Snell, V.G.; Rouben, B. [Univ. Network of Excellence in Nuclear Energy (UNENE), Ontario (Canada)

    2015-09-15

    University Network for Excellence in Nuclear Engineering also known as UNENE is a joint partnership between the nuclear industry and thirteen universities. UNENE has been legally registered as of 2002 as a not for profit organization. The establishment of this network was prompted by industry to address anticipated retirement of a large number of professionals from industry starting in early 2000 onwards and thus the loss of nuclear knowledge and experience within industry. UNENE was created to provide a sustainable supply of highly qualified personnel to industry, support nuclear research within various universities and provide a course based Master's Degree in nuclear engineering to enhance the knowledge of young professionals within the industry in the science and technology of the CANDU nuclear power system. The paper describes the current UNENE, its research objectives, key outcomes of research programs to date and its contribution to industry needs in maintaining an economic and safe power plant performance of its nuclear fleet. The paper addresses achievements within the education program and the new 4-course diploma program recently introduced to enhance core expertise of young industry professionals. Also publications and national and international collaborations in various aspects of research have significantly contributed to Canada's position in nuclear science and research worldwide. Such collaborations are also addressed. (author)

  19. Industry-university collaboration for research and education

    Energy Technology Data Exchange (ETDEWEB)

    Shalaby, B.A.; Snell, V.G.; Rouben, B., E-mail: basma.shalaby@rogers.com [University Network of Excellence in Nuclear Energy, Hamilton, ON (Canada)

    2015-07-01

    University Network for Excellence in Nuclear Engineering also known as UNENE is a joint partnership between the nuclear industry and thirteen universities. UNENE has been legally registered as of 2002 as a not for profit organization. The establishment of this network was prompted by industry to address anticipated retirement of a large number of professionals from industry starting in early 2000 onwards and thus the loss of nuclear knowledge and experience within industry. UNENE was created to provide a sustainable supply of highly qualified personnel to industry, support nuclear research within various universities and provide a course based Master's Degree in nuclear engineering to enhance the knowledge of young professionals within the industry in the science and technology of the CANDU nuclear power system. The paper describes the current UNENE, its research objectives, key outcomes of research programs to date and its contribution to industry needs in maintaining an economic and safe power plant performance of its nuclear fleet. The paper addresses achievements within the education program and the new 4-course diploma program recently introduced to enhance core expertise of young industry professionals. Also publications and national and international collaborations in various aspects of research have significantly contributed to Canada's position in nuclear science and research worldwide. Such collaborations are also addressed. (author)

  20. Promotion project to develop the global environment related industrial technology. Investigation on the possibility of research exchange; Chikyu kankyo sangyo gijutsu kaihatsu suishin jigyo. Kenkyu koryu kanosei chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-03-01

    Through visits to US universities and research institutes, investigation was made on the trend of global environment-related research and possibility of their exchanging the result of research with the RITE (Research Institute of Innovative Technology for the Earth). To investigate the process technology to utilize microbes harmoniously with the environment, the visit was paid to Cornell University, Battelle Memorial Institute and Risk Reduction Engineering Laboratory, where the investigation was made on the environmental bioremediation with microbial functions and clean process production without by-producing substances to load the environment. To investigate the technical measures against the global warming, the visit was paid to Brookhaven National Laboratory, Massachusetts Institute of Technology, California University, Hawaii University and Pacific International Center for High Technology Research, where the investigation was made, through discussion and exchange of research information and opinion with researchers and engineers, on the possibility of their exchanging the result of research with the RITE. Judging from the investigation of this time, the research which is mutually complementary between Japan and USA is easy to promote, because their respective advanced fields do not overlap with each other. 88 refs., 11 figs., 6 tabs.

  1. The Design of Integrated Tapioca Agro-Industries Development Model

    Directory of Open Access Journals (Sweden)

    Azmi Alvian Gabriel

    2014-05-01

    Full Text Available Tapioca is an agro-industries product with high consumption level that reached 1.132 million tons per year. However, that potential was not balanced with the productivity levels of tapioca industries due to weak capacity and production period. This research aims to design the development model of tapioca agro-industries which can produce in a sustainable way in terms of quality as well as quantity of product. Study of research location was in the Kaur Regency of Bengkulu Province. This research consists of three stages. The first study was conducted to know the projection of the raw materials availability and product demand using regression and quadratic equation smallest method. The result of calculation projections showed the availability of raw cassava achieved an average of 10 million tons per year and the demand for tapioca 1.36 million tons per year. The second study was done to determine the partnership patterns between company and farmers using pairwise comparison and rating scale methods. From the results of the research note that "Inti-plasma" was the most efficient partnership patterns applied to tapioca agro-industries. The third study was conducted to determine the feasibility of the planned development model. The calculation result of feasibility analysis show the value of benefit cost ratio of 1.23; payback period amounted to 1 year 2 months; net present value of IDR 143,285,734,440.98; internal rate of return 43.55%; and the profitability index 3.56. Based on the overall feasibility criteria, then the model development of tapioca agro-industries can be said to deserve to be realized.   Keywords: agro-industries, financial analyses, factory design, partnership patterns

  2. Innovative industry alignment at RMIT to develop skills for uranium industries

    International Nuclear Information System (INIS)

    Bhargava, S.K.

    2010-01-01

    'Full text:' RMIT University has recently introduced new teaching and research training programs on uranium processing technology at both undergraduate and postgraduate level. These programs have been implemented to improve young scientists and engineers' awareness of Australia's uranium processing industry, and to help provide future employees with improved background knowledge to the industry. The teaching program involves joint course development and lectures delivered by the leading scientists from ANSTO (Dr Suzanne Burling and Dr Chris Griffith) and Rio Tinto (Dr Stephen Grocott). This lecture series, which is offered to final year applied science and chemical engineering students, covers a range of topics and issues related to uranium processing including uranium mining, methods for chracterising uranium ores, extraction of uranium, the nuclear fuel cycle, waste and safety. The research training program involves honours and PhD students undertaking research projects on uranium mineralogy and uranium extraction. Research students are also provided with extensive training on how to conduct research safely using radioactive materials. The research programs are undertaken in RMIT's new EPA approved, low level radiation laboratory which has been dedicated to research projects on uranium processing. An extended overview of both of these new programs will be presented. This program is unique in Australia and is designed to address the issue of skill shortage in the ever growing Uranium industry world wide. International collaborators in this program will be most welcomed. (author)

  3. Advanced Energy Industries, Inc. SEGIS developments.

    Energy Technology Data Exchange (ETDEWEB)

    Scharf, Mesa P. (Advanced Energy Industries, Inc., Bend, OR); Bower, Ward Isaac; Mills-Price, Michael A. (Advanced Energy Industries, Inc., Bend, OR); Sena-Henderson, Lisa; David, Carolyn; Akhil, Abbas Ali; Kuszmaul, Scott S.; Gonzalez, Sigifredo

    2012-03-01

    The Solar Energy Grid Integration Systems (SEGIS) initiative is a three-year, three-stage project that includes conceptual design and market analysis (Stage 1), prototype development/testing (Stage 2), and commercialization (Stage 3). Projects focus on system development of solar technologies, expansion of intelligent renewable energy applications, and connecting large-scale photovoltaic (PV) installations into the electric grid. As documented in this report, Advanced Energy Industries, Inc. (AE), its partners, and Sandia National Laboratories (SNL) successfully collaborated to complete the final stage of the SEGIS initiative, which has guided new technology development and development of methodologies for unification of PV and smart-grid technologies. The combined team met all deliverables throughout the three-year program and commercialized a broad set of the developed technologies.

  4. Research and development of basic technologies for next-generation industry. Ultimate evaluation report on research and development of highly crystalline polymeric material; Jisedai sangyo kiban gijutsu kenkyu kaihatsu. Kokesshosei kobunshi zairyo saishu kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-05-01

    Basic technologies are developed involving highly crystalline polymeric materials comparable to metals in dynamic property even when used singly. The aim is to expand the application scope of polymeric materials including those designed as structural materials so that their light weight, high resistance to corrosion, and excellent machinability may be utilized in various fields. Target performance includes an elastic modulus under bending force of 100GPa or more in anisotropic materials and 50GPa or more in isotropic materials, a linear expansion coefficient of 5 times 10{sup -5}/degrees C or less, and a thermal deformation temperature of 180 degrees C or more. Tasks faced in relation to film or molded articles of anisotropic materials are the rigid molecular design, molding method including molecular orientation control, and molecular complex technology; and, in isotropic materials, the strengthening of interaction between molecules, establishment of molding methods, and equipping materials with high machinability. After a 10-year/3-phase development endeavors, the initially intended goals are sufficiently achieved. To be mentioned are achievements involving the generation of multidimensionally bound diacetylene polymeric crystals, higher elastic modulus and moldability provided to polyarylate materials, magnetic field orientation, ultrahigh-elasticity layered body, and organic-inorganic ionically bonded complex material, etc. (NEDO)

  5. Industrial technology research and development project for global environment in fiscal 1998. Report on achievements in research and development of technologies for environment friendly catalysts; 1998 nendo kankyo chowagata shokubai gijutsu kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    This paper describes the achievements in fiscal 1998 in developing environment friendly catalyst technologies. Development was proceeded in a water decomposing hydrogen production system of double tank system utilizing visible lights. The system connects combination of visible light responding type semiconductor powders with an oxidation and reduction mediator via a membrane (consisting of a hydrogen ion permeating membrane and an electric conductor). Discovery was made on two sets of semiconductor-mediator combinations (to produce hydrogen and oxygen) that meet the requirements. A composite oxide powder catalyst of nano structure was also realized. Verification was made on water decomposing hydrogen production by using multi-layered membranes composed of a hydrogen producing catalytic membrane, a semiconductor membrane, and an oxygen producing catalytic membrane. By using selective oxidation that uses trace amount of nitrogen dioxide as a gaseous phase catalyst, such good results were obtained as conversion rate of 10%, and selection rate of 27% in methanol and 23% in formaldehyde. Selective oxidation mechanisms in iron carried silica and oxidized tin were elucidated theoretically and experimentally. It was elucidated by calculating chemistry that effect of adding nitrogen dioxide lies in draw-out of hydrogen, NO is involved in draw-out of O from CH3OO, and NOx is involved in synthesizing formaldehyde from CH3O. (NEDO)

  6. Between science and industry-applied yeast research.

    Science.gov (United States)

    Korhola, Matti

    2018-03-01

    I was fortunate to enter yeast research at the Alko Research Laboratories with a strong tradition in yeast biochemistry and physiology studies. At the same time in the 1980s there was a fundamental or paradigm change in molecular biology research with discoveries in DNA sequencing and other analytical and physical techniques for studying macromolecules and cells. Since that time biotechnological research has expanded the traditional fermentation industries to efficient production of industrial and other enzymes and specialty chemicals. Our efforts were directed towards improving the industrial production organisms: minerals enriched yeasts (Se, Cr, Zn) and high glutathione content yeast, baker´s, distiller´s, sour dough and wine yeasts, and the fungal Trichoderma reesei platform for enzyme production. I am grateful for the trust of my colleagues in several leadership positions at the Alko Research Laboratories, Yeast Industry Platform and at the international yeast community.

  7. Developing the east coast gas industry

    International Nuclear Information System (INIS)

    Stedman, C.

    1998-01-01

    Development of a natural gas industry on Canada's east coast was discussed. The various stages of near-term and long-term development were outlined. Opportunities were identified in the areas of Grand Banks gas utilization, third party gas and natural gas liquids transportation and processing, cogeneration, petrochemicals and in energy marketing and services. As an example of this industry development, a corporate review of Novagas Canada Ltd., was presented. The company was formed in January 1994 and is wholly owned by Nova Gas International. Novagas Canada has ultimate resources of 62.9 Tcf of natural gas of which 48.9 Tcf remains to be discovered. The company focuses on non-regulated mid-stream operations of the natural gas/natural gas liquid value chain. Some 800 million dollars have been invested so far in gas processing, liquids and olefins businesses in Nova Scotia and the Grand Banks/Labrador area. The pending Nova/TCPL merger will combine Novagas Canada's and TransCanada Gas Services' midstream assets. The general conclusion was that the resource base is large enough to support development throughout the gas and natural gas liquids value chain, and that a critical mass is required to support development of the necessary gas infrastructure. A sizeable challenge remains in encouraging gas utilization, and in encouraging competition, open access and unbundling of energy services. 2 tabs., 2 figs

  8. North Dakota Senior High Industrial Arts Program of Studies--Level II. Research Series No. 80.

    Science.gov (United States)

    North Dakota State Board for Vocational Education, Bismarck. Research Coordinating Unit.

    This industrial arts program of a studies guide is the product of a research project designed to (1) ascertain programs and curricula trends of senior high school industrial arts in the fifty states, (2) develop a philosophical rationale for senior high schools in North Dakota secondary schools, and (3) develop a master plan and program of study…

  9. Improving industrial designers work process by involving user research

    DEFF Research Database (Denmark)

    Dai, Zheng; Ómarsson, Ólafur

    2011-01-01

    With changing times, new technologies and more opinionated consumers, the modern industrial designer has found himself in need of fresher and more up to date approaches in his daily work. In a fast moving industry, the designer needs to keep a thinking process of dynamic and subjective attitude...... will give the grounding for believing that the industrial designer needs to adopt user research methods to a level where he can still continue to work under the very nature of industrial design that has made it a successful practice for the last century. The combing of the approaches and attitude will help....... User research is part of user centered design (UCD). UCD has a reputation for subjective and reflective practice. In this paper there are two example cases. One is conducted by a classical industrial design process, and another is costing half of energy and time in user research. These examples...

  10. Challenges in industrial fermentation technology research.

    Science.gov (United States)

    Formenti, Luca Riccardo; Nørregaard, Anders; Bolic, Andrijana; Hernandez, Daniela Quintanilla; Hagemann, Timo; Heins, Anna-Lena; Larsson, Hilde; Mears, Lisa; Mauricio-Iglesias, Miguel; Krühne, Ulrich; Gernaey, Krist V

    2014-06-01

    Industrial fermentation processes are increasingly popular, and are considered an important technological asset for reducing our dependence on chemicals and products produced from fossil fuels. However, despite their increasing popularity, fermentation processes have not yet reached the same maturity as traditional chemical processes, particularly when it comes to using engineering tools such as mathematical models and optimization techniques. This perspective starts with a brief overview of these engineering tools. However, the main focus is on a description of some of the most important engineering challenges: scaling up and scaling down fermentation processes, the influence of morphology on broth rheology and mass transfer, and establishing novel sensors to measure and control insightful process parameters. The greatest emphasis is on the challenges posed by filamentous fungi, because of their wide applications as cell factories and therefore their relevance in a White Biotechnology context. Computational fluid dynamics (CFD) is introduced as a promising tool that can be used to support the scaling up and scaling down of bioreactors, and for studying mixing and the potential occurrence of gradients in a tank. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Developing e-learning solutions in the automotive industry

    Directory of Open Access Journals (Sweden)

    Razvan Virgil Bogdan

    2016-07-01

    Full Text Available In the rapid developing market of automotive industry, cutting-edge technologies are being introduced. One such example is the AUTOSAR standard. Companies are investing a large amount of finances for the training of their employees into the intricacies of such technologies. In order to face such an increase of the training costs, automotive corporation have started lately switching their approach to e-Learning systems. This paper presents an e-Learning approach developed in the automotive industry in order to address the demands of teaching AUTOSAR standard. The developed e-Learning project is called Academy. In order to develop the e-Learning solution we focused on the Software Development part of automotive industry. Therefore we had to gather the ideas from different trainers, come with a common approach and use specific techniques so that the trainee should get a real feeling of the material. It is presented the design, implementation and evaluation of this e-Learning solution, but more than that faced issues and learned lessons. Developing this solution has offered different insights into how to approach such a task which are useful for the further expansion of the project, but also for future researchers who might encounter such a challenge of developing e-Learning solutions for the automotive industry. These are all grouped in a set of guidelines related to following a model of implementation, getting track of participants, user interaction with the AUTOSAR standard, test and production development and so on.

  12. Sustainable Development of Geothermal Industry in China: An Overview

    OpenAIRE

    Xu Bang; Li Menggang; Pi Xiyu

    2016-01-01

    With a wide distribution, large reserves, low cost, sustainable energy use and environmental protection and other unparalleled advantages, geothermal energy resources is important for China’s energy structure adjustment, energy conservation and environment improvement. Currently, geothermal utilization in China is still in its infancy, and Sustainable Development of the geothermal industry is also having a lot of problems. In this paper, the current research on sustainable development of geot...

  13. Industry evolution in developing countries : the Indonesian pulp and paper industry

    NARCIS (Netherlands)

    Dijk, van M.

    2003-01-01

    Almost all empirical research on industry evolution has been conducted on high or medium technology industries in industrialised countries. In this paper, a detailed analysis of the life cycle of Indonesia's pulp and paper industry is presented as case study to investigate industry evolution in

  14. The development of the UK landfill gas industry: an overview

    International Nuclear Information System (INIS)

    Moss, H.

    1996-01-01

    The UK's landfill gas research started in 1978 and led to the first commercial scheme in 1981 where the gas was used to fire a brick kiln. Electricity generation followed in 1984. Although by 1990 there were nearly two dozen operational schemes, the real impetus to usage was given by the NFFO. Here all electricity generated could be sold irrespective of the demand. Although the Department of Energy - and latterly the Department of Trade and Industry - invested substantial monies in the early research and development, the greatest factor in the success of the industry has been willingness to take its own risks. The industry must now learn to live with lower revenues and heightened environmental requirements. (Author)

  15. MATWIN: bridging the gap between academic research and industry.

    Science.gov (United States)

    Reiffers, Josy; Robert, Lucia

    2015-09-16

    MATWIN (Maturation and Accelerating Translation With INdustry) is part of the nationwide effort to support cancer innovation. This unique program is willing to support innovative research projects providing tools, resources, and staff dedicated to project leaders wishing to optimize the industrial attractiveness of their project. The overall objective is clear: fight cancer always more effectively.

  16. Visual Narrative Research Methods as Performance in Industrial Design Education

    Science.gov (United States)

    Campbell, Laurel H.; McDonagh, Deana

    2009-01-01

    This article discusses teaching empathic research methodology as performance. The authors describe their collaboration in an activity to help undergraduate industrial design students learn empathy for others when designing products for use by diverse or underrepresented people. The authors propose that an industrial design curriculum would benefit…

  17. Development of radiopharmaceuticals and industrial constraints

    International Nuclear Information System (INIS)

    Zimmermann, R.

    2005-01-01

    The development process of a diagnostic or therapeutic radiopharmaceutical does not really differ from the development of a classical drug. Some specific properties of these nuclear medicine tools mainly linked to the ease to follow their distribution in the human body allow to save a couple of years out of the dozen of years required to bring a drug on the market. Overall development costs can be significantly reduced for the same reason. An industrial who wants to invest in such a business bases its analysis on other criteria that need to evaluate the medical, safety and regulatory environment at the time of drug launching. Competition is obviously a major decision criteria, but in order to evaluate the market potential, other data must be available such as the analysis of the medical landscape, the reimbursement issues, the technology evolution, the investment needs or the development of other imaging modalities, among others. In fact all these parameters concentrate toward a common criteria, the profitability of the project. Nuclear medicine moved from an art and crafts era towards the industrial era and hence plunged from the twentieth to the twenty first century in the economic reality with all its constraints and consequences. (author)

  18. New Product Development (NPD) Process - An Example of Industrial Sector

    Science.gov (United States)

    Kazimierska, Marianna; Grębosz-Krawczyk, Magdalena

    2017-12-01

    This aim of this article is to present the process of new product introduction on example of industrial sector in context of new product development (NPD) concept. In the article, the concept of new product development is discussed and the different stages of the process of new electric motor development are analysed taking into account its objectives, implemented procedures, functions and responsibilities division. In the article, information from secondary sources and the results of empirical research - conducted in an international manufacturing company - are used. The research results show the significance of project leader and regular cooperation with final client in the NPD process.

  19. Eltron Research & Development

    Energy Technology Data Exchange (ETDEWEB)

    Evenson, Carl; Mackay, Richard; Faull, John

    2014-03-01

    This topical report covers technical work conducted under contract DE-FC26-05NT42469 between FY06 Q1 through FY14 Q2. The project evolved through several budget periods, budget revisions and continuation applications. This report covers work performed under the “base” program. In 2010 ARRA funding was added to the project. A separate report covering the ARRA portion of the project was submitted to DOE. The original project was focused on research and development for scale-up of hydrogen separation membrane for a FutureGen type power plant. The work included membrane testing and evaluation of metal alloy flat plates vs. tubes and metal membranes vs. cermet membranes. In addition, economic analysis and process modeling was performed. The original project team included CoorsTek, NORAM, and Praxair. In FY10Q2 a continuation application was filed for conducting a scale-up test at Eastman Chemical. In this part of the project a Subscale Engineering Prototype (SEP) membrane skid was designed, fabricated, and operated on a gasified coal slip-stream on Eastman’s site in Kingsport, TN. Following operation, the project was reorganized and a second continuation application with a new statement of work was initiated in FY12Q1. Finally, based on DOE’s decision not to proceed with a Process Development Unit (PDU) field test, a third continuation application and statement of work was initiated in FY13Q1 to close out the project.

  20. Resources of Mongolian beef industry development

    Directory of Open Access Journals (Sweden)

    Damdinsuren L.

    2011-12-01

    Full Text Available This paper reviews the historical aspect of grazing in Mongolia. The data on changes in the structure of animal species in the general population is presented. The level of main types of foods security of the population of Mongolia based on the findings of the actual meat and meat products consumption ratio to the recommended standard in accordance with national standards is analyzed. In absolute terms, the number of livestock is growing steadily, so by the conditions for ensuring full meat and meat products security for the population. Estimation of the technological level of the country's meat industry and export performance of meat products, including the Russian Federation, is given. A model of technological strategy of meat processing is suggested. It is noted that the main directions of development of meat industry in the country are increased production and safety of meat in agriculture and waste-free deep treatment of cattle in the meat industry, as well as improvement of the export potential of different kinds of meat.

  1. Petroleum industry: Development strategies to year 2000

    International Nuclear Information System (INIS)

    Curcio, E.

    1993-01-01

    During the last two years, the petroleum industry has undergone a period of modest demand increase on the international market, normal consumption rates by consuming countries and, faced with a growing supply base, a progressive per barrel unit price depreciation. In the refinery sector, margins have been reduced due to strong petroleum products price reductions. New anti-pollution laws have necessitated substantial investment in the development of cleaner fuels and pollution control technologies. The reorganization of the former USSR petroleum and gas sector should give rise to technology transfer opportunities for Western nations and spur gradual production increases especially in natural gas. Petroleum and gas demand increases are expected due to the modernization of China's industries. While it is clear that for the next decade their won't be any shortages in supply, forecasting petroleum prices to the year 2000 will remain clouded with uncertainty until such time as the national European petroleum industries decide to go ahead with their long awaited privatization and adjustments are made to current government and private sector energy strategies

  2. Risk Management for New Product Development Projects in Food Industry

    Directory of Open Access Journals (Sweden)

    Porananond, D.

    2014-07-01

    Full Text Available Project risk management provides a guideline for decision making in new product development (NPD projects, reducing uncertainty and increasing success rate. However, the acceptance of formal risk management applications in industry, especially for NPD projects is still in question. A study of a food conglomerate in Thailand found that only 9% of NPD projects used a systematic approach for managing risk. 61% of the projects realised the importance of risk management, while the remaining 30% did not involve risk management at all. This study aims to develop a risk management model for NPD projects in the food industry. The first section of this paper reviews the literature on risk management theory, including international standards for risk and project management (ISO31000 and ISO21500, publications for the Project Management Body of Knowledge (PMBOK, by a professional organisation the Project Management Institute (PMI, and also academic research. 182 academic papers, published between January 2002 and August 2012 were selected. The second part interviews conducted with eight NPD experts from five of the major food manufacturers in Thailand to examine their risk management practices and problems. Conclusions are made on five topics : classification of research method, project type and industrial segment, distribution of articles by region, tools & techniques for risk management and risk factors in projects. Specific requirements of risk management for NPD projects in the food industry are identified. A risk management model and the concept of risk management applications for the food industry are proposed.

  3. Achievement report for fiscal 1987 on the entrusted research and development of basic technologies for next-generation industries. Research and development of technologies of mass culture of cells; 1987 nendo jisedai sangyo kiban gijutsu kenkyu kaihatsu seika hokokusho. Saibo tairyo baiyo gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1988-03-01

    The aim is to add value to the chemical industry by establishing technologies for realizing a large and stable supply of fine chemical products whose industrial production is difficult when conventional techniques are applied, the products including various useful substances yielded by animal cells including those of man. To fulfill the aim, efforts are exerted to complete basic technologies involving the mass culture of cells through conducting researches into animal biofunctions. This report covers the endeavors made in fiscal 1987 under the above-named project created in fiscal 1981. All the subject matters are for the development of substance production methods for industrial use, and include the studies of use of optimal cultivation methods mainly for serumless cultures and cultivation engineering, studies centering on the high-density cultivation of cells and serumless cultures, studies using suspended and quasi-suspended cell lines, studies using cells deriving from bone marrow, and studies using epithelial cells. Furthermore, the results are outlined of the comprehensive researches conducted into technologies of mass cultivation of cells. (NEDO)

  4. Project to promote the development of global environmental industry technology. Feasibility study of research exchanges; Chikyu kankyo sangyo gijutsu kaihatsu suishin jigyo. Kenkyu koryu kanosei chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    In fiscal 1995, three teams were organized to study the following subjects: plant genetic and cellular engineering in relation to drought stress; simulation models of global environment for accurate assessment and prediction; the APEC Virtual Center for environmental technology exchange. The team studying plant genetic and cellular engineering in relation to drought stress visited the Department of Botany, Hebrew University of Jerusalem, Israel, the Jacob Blaustein Institute for Desert Research, Ben-Grunion University, Israel, the Department of Biochemistry and the Office of Arid Lands Studies, Arizona University, the U.S. to survey the present and future trend of the study and feasibility of research exchanges. The team studying simulation models of global environment for accurate assessment and prediction visited Yale University, Massachusetts Institute of Technology, Electric Power Research Institute, and Battle Research Institute in the U.S. to survey feasibility of research exchanges. The team studying the APEC Virtual Center for environmental technology exchange visited institutes in ASEAN countries to survey needs for the Virtual Center. 312 refs., 74 figs., 17 tabs.

  5. West African Journal of Industrial and Academic Research ...

    African Journals Online (AJOL)

    Prof. Osuagwwu

    West African Journal of Industrial and Academic Research December 2016 v0l. ... 1Civil Engineering Department, Collage of Science and Engineering .... P.K. Guha (2009) maintenance and Repairs of Buildings published by new central Book ...

  6. West African Journal of Industrial and Academic Research - Vol 4 ...

    African Journals Online (AJOL)

    West African Journal of Industrial and Academic Research - Vol 4, No 1 (2012) ... Open Access DOWNLOAD FULL TEXT Subscription or Fee Access ... on Gas Turbine Engine Data · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  7. West African Journal of Industrial and Academic Research - Vol 17 ...

    African Journals Online (AJOL)

    West African Journal of Industrial and Academic Research - Vol 17, No 1 (2017) ... Open Access DOWNLOAD FULL TEXT Subscription or Fee Access ... The effect of electricity and gas losses on Nigeria`s Gross Domestic Product · EMAIL ...

  8. Development of industrial minerals in Colorado

    Science.gov (United States)

    Arbogast, Belinda F.; Knepper, Daniel H.; Langer, William H.; Cappa, James A.; Keller, John W.; Widmann, Beth L.; Ellefsen, Karl J.; Klein, Terry L.; Lucius, Jeffrey E.; Dersch, John S.

    2011-01-01

    Technology and engineering have helped make mining safer and cleaner for both humans and the environment. Inevitably, mineral development entails costs as well as benefits. Developing a mine is an environmental, engineering, and planning challenge that must conform to many Federal, State, and local regulations. Community collaboration, creative design, and best management practices of sustainability and biodiversity can be positive indicators for the mining industry. A better understanding of aesthetics, culture, economics, geology, climate, vegetation and wildlife, topography, historical significance, and regional land planning is important in resolving land-use issues and managing mineral resources wisely. Ultimately, the consuming public makes choices about product use (including water, food, highways, housing, and thousands of other items) that influence operations of the mineral industry. Land planners, resource managers, earth scientists, designers, and public groups have a responsibility to consider sound scientific information, society's needs, and community appeals in making smart decisions concerning resource use and how complex landscapes should change. An effort to provide comprehensive geosciences data for land management agencies in central Colorado was undertaken in 2003 by scientists of the U.S. Geological Survey and the Colorado Geological Survey. This effort, the Central Colorado Assessment Project, addressed a variety of land-use issues: an understanding of the availability of industrial and metallic rocks and minerals, the geochemical and environmental effects of historic mining activity on surface water and groundwater, and the geologic controls on the availability and quality of groundwater. The USDA Forest Service and other land management agencies have the opportunity to contribute to the sustainable management of natural aggregate and other mineral resources through the identification and selective development of mineral resources and the

  9. Research and development project for industrial and scientific technologies in fiscal 1999. An achievement report on research and development of quantization functioning elements (surveys and studies on technological trends); 1999 nendo ryoshika kino soshi no kenkyu kaihatsu seika hokokusho. Gijutsu doko chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    In order to serve for research and development of quantization functioning elements, surveys have been made on research activities related to ancillary technologies and related technologies for the quantization functioning element project. This paper summarizes the status of researches in each field and the technological trends therein with regard to theoretical and experimental development activities on new silicon-based and compound-based elements in the quantization functioning element project, generalization of the current status of the project as a whole, and the prospects thereon. Regarding the current status and future of the quantization functioning elements, the paper describes the causes for the decline of the Japanese semiconductor industry, and discussions on strategies for revitalization of the semiconductor industry. The paper also describes the followings: the current status of the compound-based quantization functioning element project, design methods for quantization functioning elements using silicon as the base and the ultimate single electron integrated circuits, the current status and problems of the compound-based quantization functioning elements, circuit and system technologies related to quantization functioning elements, proposals on silicon nano-devices and neo-silicon, and the future prospects on silicon- based quantum effect devices and single electron devices, and compound semiconductor devices. (NEDO)

  10. Engaging local industry in the development of basic research infrastructure and instrumentation - The case of HIE-ISOLDE and ESS Scandinavia

    Science.gov (United States)

    Fahlander, Claes

    2016-07-01

    Two world-class research facilities, the European Spallation Source, ESS, and the light-source facility MAX-IV, are being built in southern Sweden. They will primarily, when completed, be used for research in the fields of material sciences, life sciences, medicine and pharmacology. Their construction and the operation and maintenance of them for many years will create new business opportunities for companies in Europe in general and in Sweden, Denmark and Norway in particular in many different sectors. A project, CATE, Cluster for Accelerator Technology, was set up with the aim to strengthen the skills of companies in the Öresund-Kattegat-Skagerrak region in Scandinavia in the field of accelerator technology such that they will become competitive and be able to take advantage of the potential of these two research facilities. CATE was strategically important and has helped to create partnerships between companies and new business opportunities in the region.

  11. Engaging local industry in the development of basic research infrastructure and instrumentation – The case of HIE-ISOLDE and ESS Scandinavia

    Energy Technology Data Exchange (ETDEWEB)

    Fahlander, Claes, E-mail: claes.fahlander@nuclear.lu.se [Department of Physics, Lund University, Box 118, SE-22100, Lund (Sweden)

    2016-07-07

    Two world-class research facilities, the European Spallation Source, ESS, and the light-source facility MAX-IV, are being built in southern Sweden. They will primarily, when completed, be used for research in the fields of material sciences, life sciences, medicine and pharmacology. Their construction and the operation and maintenance of them for many years will create new business opportunities for companies in Europe in general and in Sweden, Denmark and Norway in particular in many different sectors. A project, CATE, Cluster for Accelerator Technology, was set up with the aim to strengthen the skills of companies in the Öresund-Kattegat-Skagerrak region in Scandinavia in the field of accelerator technology such that they will become competitive and be able to take advantage of the potential of these two research facilities. CATE was strategically important and has helped to create partnerships between companies and new business opportunities in the region.

  12. Engaging local industry in the development of basic research infrastructure and instrumentation – The case of HIE-ISOLDE and ESS Scandinavia

    International Nuclear Information System (INIS)

    Fahlander, Claes

    2016-01-01

    Two world-class research facilities, the European Spallation Source, ESS, and the light-source facility MAX-IV, are being built in southern Sweden. They will primarily, when completed, be used for research in the fields of material sciences, life sciences, medicine and pharmacology. Their construction and the operation and maintenance of them for many years will create new business opportunities for companies in Europe in general and in Sweden, Denmark and Norway in particular in many different sectors. A project, CATE, Cluster for Accelerator Technology, was set up with the aim to strengthen the skills of companies in the Öresund-Kattegat-Skagerrak region in Scandinavia in the field of accelerator technology such that they will become competitive and be able to take advantage of the potential of these two research facilities. CATE was strategically important and has helped to create partnerships between companies and new business opportunities in the region.

  13. Survey on utilization of database for research and development of global environmental industry technology; Chikyu kankyo sangyo gijutsu kenkyu kaihatsu no tame no database nado no riyo ni kansuru chosa

    Energy Technology Data Exchange (ETDEWEB)

    1993-03-01

    To optimize networks and database systems for promotion of the industry technology development contributing to the solution of the global environmental problem, studies are made on reusable information resource and its utilization methods. As reusable information resource, there are external database and network system for researchers` information exchange and for computer use. The external database includes commercial database and academic database. As commercial database, 6 agents and 13 service systems are selected. As academic database, there are NACSIS-IR and the database which is connected with INTERNET in the U.S. These are used in connection with the UNIX academic research network called INTERNET. For connection with INTERNET, a commercial UNIX network service called IIJ which starts service in April 1993 can be used. However, personal computer communication network is used for the time being. 6 figs., 4 tabs.

  14. Research by industry at the National Synchrotron Light Source

    International Nuclear Information System (INIS)

    1995-05-01

    The world's foremost facility for research using x-rays and ultraviolet and infrared radiation, is operated by the National Synchrotron Light Source dept. This pamphlet described the participating research teams that built most of the beam lines, various techniques for studying materials, treatment of materials, and various industrial research (catalysis, pharmaceuticals, etc.)

  15. New Technologies and Sustainable Development of Industry

    International Nuclear Information System (INIS)

    Muggli, Christoph; Baumgartner, Walter; Werner, Frank

    1996-08-01

    The present technology assessment study examines the effects of three technology scenarios on future energy consumption and the energy-related emissions by industrial manufacturing in Switzerland. The three paths of development (Trend, High-Tech, Alternative) can be represented as follows: After a reduction until 2015, the Trend development entails a slight increase in consumption of energy. Until then consumption is some 10 percent lower in both the High-Tech and the Alternative Scenarios. Consumption of electricity increases in all scenarios, the proportion is highest in 20 year's time under the High-Tech scenario. SO 2 and CO 2 emissions decrease in all scenarios until 2000 and then level out at a low level. The emissions are lowest in the High-Tech scenario. In contrast the NO x and the VOC emissions diminish until 2000 and then rise again continuously. At this juncture important bases are still not yet available for a definitive evaluation with respect to the sustainable development. Sustainability objectives are currently being compiled for Switzerland in the wake of the Berlin Climate Conference and the Rio Conference. In the political lobbies the Green factions are making demands, such as those currently under discussion internationally (e.g. CO 2 reductions on a scale of some 80 percent by 2050), whereas conservative and industrial circle representatives support the objective of sustainable development but reject a quantification of objectives. The official objectives of the Swiss Energy 2000 programme can be achieved with all scenarios. With the High-Tech and Alternative scenarios, concepts of a reduction in CO 2 by 20 percent by 2015 (as currently under discussion in Switzerland), are realistic. However, further energy-relevant efficiency potentials in industrial production can be activated by energy-policy motivated measures. More extensive objectives, such as e.g. a CO 2 reduction of 50 percent, are hardly attainable, even in the long-term, without

  16. Developing scenarios for the Norwegian travel industry 2025

    Directory of Open Access Journals (Sweden)

    Anniken Enger

    2015-03-01

    Full Text Available Purpose – The Norwegian travel industry faces decline in important international tourism segments and needs an industry wide and future‐oriented strategy to face these challenges. Accordingly, a common understanding of future drivers and different scenarios for the industry is needed. The paper aims to discuss these issues. Design/methodology/approach – Using the process of scenario analysis and drawing upon the involvement of the tourism industry, this paper describes the method, drivers, scenarios, and implications. Findings – The research identified six important drivers with predictable outcomes: uneven global economic development, digitalization, climate change, consumer demand – return on time, centralization, and demography. The Norwegian economy and Norwegian politics were the two drivers that stood out as the most significant for the tourism industry, with a very uncertain outcome, and constituted the two axes of the scenarios. This resulted in four scenarios: Money Rules, The Urban Diamond, Opportunities for All, and Master Plan. Practical implications – The four scenarios represent different economic value of international tourism in Norway. The Opportunities for All and Master Plan scenarios represent the greatest economic value for Norwegian tourism. They indicate great opportunities for tourism to become the “new oil” in Norway if the oil economy declines. The two scenarios differ with respect to the degree of governance control vs market liberalization. The scenarios will be used to identify implications and risks for different parts of the tourism industry, and to further explore how governance control and market liberalization may be combined. Originality/value – The research identified six drivers which are significant for the Norwegian tourism industry. This resulted in four scenarios which are used to identify implications and risks for different parts of the industry.

  17. THE ROLE OF RESEARCH IN RESHAPING TEXTILE INDUSTRY

    Directory of Open Access Journals (Sweden)

    Adriana UNGUREANU

    2017-06-01

    Full Text Available Apparently, the international competition seems to be moved to the area of investments in new technologies waiting for results in the near future. Nanotechnology is by far the most wanted by investors. The last twenty years the investments in nanotechnology became the priority for all the developed states and this trend was followed by the less developed countries. At the opposite side, there are countries as Romania that seem to lose the start in front of those very active in this field. This paper tries to present the role of the Romanian Research and Development activity to reshape the textile industry through new technologies and nanotechnologies especially. To gather the proper information, the in-depth interview method was used. The conclusions reveal that state keeps the key for a good research activity by offering stable and consistent support. At the same time, a lot of measures or recommendations could be a pragmatic solution to take seriously the role of the research activity to bring its contribution for this big challenge.

  18. Expenditures of the federation as well as the provinces and the industry for energy research, development and demonstration in Austria: inquiry 1996

    International Nuclear Information System (INIS)

    Faninger, G.

    1997-03-01

    The government (state and federal) energy RD and D budget in Austria was 137.6 Mio ATS in 1990, 245.0 Mio ATS in 1991, 210.7 Mio ATS in 1992, 286.9 Mio ATS in 1993, 324.6 Mio ATS in 1994, 332.1 Mio, ATS in 1995 and 334.3 Mio ATS in 1996. The expenditures of the Austrian private industry for energy RD and D are estimated to be about 89 Mio ATS for the year 1990, about 122 Mio ATS for the year 1991, about 98 Mio ATS for the year 1992, about 124 Mio AS for 1993, about 170 Mio ATS for 1994, about 128 Mio ATS for 1995 and about 116 Mio ATS for 1996. The energy RD and D budget of the Austrian Electricity Companies was 133.3 Mio ATS for 1991, 181.1 Mio ATS for 1992, 192.4 Mio, ATS for 1993, 126.6 Mio ATS for 1994, 191.0 Mio ATS for 1995 and 207.3 Mio ATS for 1996. (author)

  19. The Research and Development of COM-PLY Lumber

    Science.gov (United States)

    Robert H. McAlister

    1989-01-01

    Between 1974 and 1986, a Southeastern Station Research Work Unit developed standards for composite studs, joists, and truss lumber and manufactured and demonstrated the materials. Economic feasibility was considered in every stage of research. Further development is left to industry.

  20. Development present situation analysis of nuclear power industry in China and South Korea

    International Nuclear Information System (INIS)

    Huang Gang

    2011-01-01

    This paper introduces the present state and primary development experiences of South Korean nuclear power industry and the present state of Chinese nuclear power industry development, and comparatively analyzes and researches the differences between China and South Korea in nuclear power industry. At last, we come up with some suggestions and ideas to refer the follow-up development of Chinese nuclear power industry. (author)

  1. Determination of effective university-industry joint research for photovoltaic technology transfer (UIJRPTT) in Thailand

    International Nuclear Information System (INIS)

    Sugandhavanija, Pornpimol; Sukchai, Sukruedee; Ketjoy, Nipon; Klongboonjit, Sakol

    2011-01-01

    Most of the literatures related to university-industry (U-I) and technology transfer assume that the collaboration particularly the U-I joint research is beneficial to both university and industry which as a result underpins the sustainable development of economics and living standards of developed and developing countries. The U-I joint research for photovoltaic technology transfer in a developing country like Thailand should have been increased considering the fact that (i) the government implemented various strategies to support the renewable energy research and market development, (ii) the university aimed to be ''research-based university and (iii) the Thai photovoltaic industry struggle for competitiveness and survival in the global market. However, evidence revealed that the university and industry conducted little number of U-I joint projects. In this paper, we investigate the factors influencing the effective U-I joint research for photovoltaic technology transfer (UIJRPTT). In an attempt to better understand the influence of the factors, the path model with factors related to characteristics and perspectives of the university and the industry as well as joint research mechanism and their linkages to higher growth and improved economic and quality performance of the U-I joint research is developed and validated. The developed model empirically explains interaction between the factors and the outcome factors and can assist the government, the university and the industry to devise target strategies to improve the growth and performance of UIJRPTT. (author)

  2. Industry

    Energy Technology Data Exchange (ETDEWEB)

    Bernstein, Lenny; Roy, Joyashree; Delhotal, K. Casey; Harnisch, Jochen; Matsuhashi, Ryuji; Price, Lynn; Tanaka, Kanako; Worrell, Ernst; Yamba, Francis; Fengqi, Zhou; de la Rue du Can, Stephane; Gielen, Dolf; Joosen, Suzanne; Konar, Manaswita; Matysek, Anna; Miner, Reid; Okazaki, Teruo; Sanders, Johan; Sheinbaum Parado, Claudia

    2007-12-01

    industrial mitigation for sustainable development is discussed in Section 7.7. Section 7.8 discusses the sector's vulnerability to climate change and options for adaptation. A number of policies have been designed either to encourage voluntary GHG emission reductions from the industrial sector or to mandate such reductions. Section 7.9 describes these policies and the experience gained to date. Co-benefits of reducing GHG emissions from the industrial sector are discussed in Section 7.10. Development of new technology is key to the cost-effective control of industrial GHG emissions. Section 7.11 discusses research, development, deployment and diffusion in the industrial sector and Section 7.12, the long-term (post-2030) technologies for GHG emissions reduction from the industrial sector. Section 7.13 summarizes gaps in knowledge.

  3. The Aeronautics Education, Research, and Industry Alliance (AERIAL) 2002 Report

    Science.gov (United States)

    Bowen, Brent D.; Fink, Mary M.; Nickerson, Jocelyn S.

    2002-01-01

    This report presents and overview of the Aeronautics Education, Research, and Industry Alliance (AERIAL). It covers the University of Nebraska's areas of research, and its outreach to students at Native American schools as part of AERIAL. The report contains three papers: "Airborne Remote Sensing (ARS) for Agricultural Research and Commercialization Application" (White Paper), "Validated Numerical Models for the Convective Extinction of Fuel Droplets (CEFD)", and "The Small Aircraft Transportation System (SATS): Research Collaborations with the NASA Langley Research Center".

  4. Aeronautics Education, Research, and Industry Alliance (AERIAL) Year 2 Report and Year 3 Proposal

    Science.gov (United States)

    Bowen, Brent D.; Box, Richard C.; Fink, Mary M.; Gogos, Geroge; Lehrer, Henry R.; Narayanan, Ram M.; Nickerson, Jocelyn S.; Tarry, Scott E.; Vlasek, Karisa D.

    2003-01-01

    The Aeronautics Education, Research, and Industry Alliance (AERIAL): a comprehensive, multi-faceted NASA EPSCoR 2000 initiative, contributes to the strategic research and technology priorities of NASA while intensifying Nebraska s rapidly growing aeronautics research and development endeavors. AERIAL enables Nebraska researchers to: (a) continue strengthening their collaborative relationships with NASA Field Centers, Codes, and Enterprises; (b) increase the capacity of higher education throughout Nebraska to invigorate and expand aeronautics research; and (c) expedite the development of aeronautics-related research infrastructure and industry in the state. This report contains a summary of AERIAL's activities and accomplishments during the second year of implementation. The AERIAL Year 3 proposal is also included.

  5. The Information System on Occupational Exposure in Medicine, Industry and Research (ISEMIR): Industrial Radiography

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2014-08-15

    for radiation protection and safety provided by the IAEA to its Member States. This publication was developed under the IAEA’s statutory responsibility to provide for the worldwide application of safety standards for the protection of people against exposure to ionizing radiation. It details the results of the Information System on Occupational Exposure in Medicine, Industry and Research (ISEMIR) project during 2009–2012 and, in particular, the activities of the Working Group on Industrial Radiography (WGIR). The ISEMIR project arose from the Occupational Radiation Protection International Action Plan (approved by the IAEA Board of Governors in September 2003), which identified in Action 7 the need to establish networks for the exchange of information on experience and lessons learned between interested parties.

  6. The Information System on Occupational Exposure in Medicine, Industry and Research (ISEMIR): Industrial Radiography

    International Nuclear Information System (INIS)

    2014-08-01

    for radiation protection and safety provided by the IAEA to its Member States. This publication was developed under the IAEA’s statutory responsibility to provide for the worldwide application of safety standards for the protection of people against exposure to ionizing radiation. It details the results of the Information System on Occupational Exposure in Medicine, Industry and Research (ISEMIR) project during 2009–2012 and, in particular, the activities of the Working Group on Industrial Radiography (WGIR). The ISEMIR project arose from the Occupational Radiation Protection International Action Plan (approved by the IAEA Board of Governors in September 2003), which identified in Action 7 the need to establish networks for the exchange of information on experience and lessons learned between interested parties

  7. Research report for fiscal 1998. Research into the feasibility of exchange of studies for the development and promotion of global environment-related industrial technologies; 1998 nendo chikyu kankyo sangyo gijutsu kaihatsu suishin jigyo. Kenkyu koryu kanosei chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    The above was conducted by Research Institute of Innovative Technology for the Earth (RITE). Worldwide collaboration is mandatory for the settlement of environmental problems for the earth, and RITE is positively promoting its interaction with research institutes abroad. In fiscal 1998, it sent research teams to government organizations and research institutes in Europe and America for studies there. A study in Europe involved the preparation of chemicals from CO2 by virtue of novel biotic reactions, and RITE's microbial molecular function laboratory plans to start a leading study in fiscal 1999. In relation with environmental impact reducing technologies using sunlight-aided photocatalysts, visits were paid to three research institutes in America. RITE itself has developed a powdered semiconductor catalyst and is engaged in the study of producing hydrogen by decomposition of water using solar energy. Concerning the production of saccharides out of farm wastes remaining unused, researches were made into the feasibility of joint studies with some advanced research institutes in America. Discussions were made about the performance- and stability-related improvement of enzymes usable for the decomposition of biomass, the analysis of biological environmental circumstances that substance yielding microbes find themselves in under anaerobic conditions, etc. (NEDO)

  8. The National Nanotechnology Initiative. Research and Development Leading to a Revolution in Technology and Industry. Supplement to the President's 2006 Budget

    National Research Council Canada - National Science Library

    2005-01-01

    The National Nanotechnology Initiative (NNI) is a multi-agency U.S. Government program aimed at accelerating the discovery, development, and deployment of nanoscale science, engineering, and technology...

  9. [Food industry funding and epidemiologic research in public health nutrition].

    Science.gov (United States)

    Navarrete-Muñoz, Eva María; Tardón, Adonina; Romaguera, Dora; Martínez-González, Miguel Ángel; Vioque, Jesús

    The interests of the food industry to fund nutrition and health research are not limited to promoting scientific advances. Recently, several systematic reviews conducted about the effect of sugar-sweetened beverages and health outcomes have shown some biased conclusions in studies that acknowledge industry sponsorship. In this context, the Nutrition Working Group of the Spanish Epidemiology Society presented a scientific session entitled Food industry and epidemiologic research at its annual meeting. In a round table, four experts in nutrition research presented their points of view about whether the food industry should fund nutrition-related research and the related potential conflicts of interest of the food industry. All the experts agreed not only on defending independence in nutritional epidemiology regarding the design, interpretation and conclusion of their studies but also on the crucial need for guaranteed scientific rigor, scientific quality of the results and measures to protect studies against potential biases related to the conflicts of interest of funding by the food industry. Drs Pérez-Farinós and Romaguera believe that the most effective way to prevent conflicts of interest would be not to allow the food industry to fund nutrition research; Drs Marcos and Martínez-González suggested the need to establish mechanisms and strategies to prevent the potential influences of the food industry in selecting researchers or institutional sponsorship and in the analysis and results of the studies, to ensure maximum independence for researchers, as well as their professional ethics. Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.

  10. Development status of liquefied natural gas industry in China

    International Nuclear Information System (INIS)

    Shi Guohua; Jing Youyin; Wang Songling; Zhang Xutao

    2010-01-01

    With the significant economic growth in China, energy related environmental issues become more and more serious. Most of air pollutants are produced by burning coal. In order to achieve a sustainable balance between economic growth and environmental protection, China has been taking measures to expand the role played by natural gas, especially since the beginning of the 21st century. As the liquid form of natural gas, liquefied natural gas (LNG) has also been paid more attention in the country. This paper explores main motives for the fast development of China's LNG industry. An overview of the industry is also described, covering LNG receiving terminals, plants and transportation. Despite a relatively short development history of LNG industry in China, there are many remarkable successes. City-gas supply by LNG is widely applied in many small to medium cities, and LNG vehicles and cold energy utilization are growing rapidly with governmental supports. At the end, the developmental trends of China's LNG industry are introduced. All the discussions show that LNG is strategically important in China's future energy infrastructure. - Research highlights: →Explore main momentums for the fast development of China's LNG industry→Analyze detailedly current states and future prospects of LNG infrastructure in China→Introduce and analyze the wide application of LNG-based gas supply mode in China→Discuss new developmental trends in China's LNG industry

  11. Research and development on university-collaboration type industrial and scientific technologies in fiscal 1999. Achievement report on research and development of the next generation ferroelectric thin film memory (research and development of the next generation ferroelectric memory); 1999 nendo jisedai kyoyudentai memory no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    With an objective to realize the next generation ferroelectric memory, research and development has been carried out on quality improvement in ferroelectric thin films. This paper summarizes the achievements in fiscal 1999. In the search and research on new ferroelectric materials, discussions were given on such new materials as Bi{sub 3.25}La{sub 0.75}Ti{sub 3}O{sub 12} in addition to the conventional PLZT and SBT. In the research on film forming processes, the sol-gel method, the organic metal gaseous phase growth method and the sputtering method were used. In improving the quality of buffer layers, research was performed to use as a buffer layer the STA/SiON laminated structure in which silicon substrates were nitrided, and a film of SrTa{sub 2}O{sub 6} (STA) being a high ferroelectric material was formed. As a result of the research, a buffer layer having thin films with thickness of 3.7 to 4.8 nm as converted to SiO{sub 2} was obtained, wherein a leak current smaller than the tunnel current of the SiO{sub 2} film having the same thickness was shown. In the search for materials and research on film forming technologies to develop function separated type memory, such pure metals as Pt, Ir and Ru and their conductive oxides were used to evaluate properties as a floating gate electrode. (NEDO)

  12. Integrating developing country manufacturing industries into global supply chain

    Directory of Open Access Journals (Sweden)

    Fasika Bete Georgise

    2014-01-01

    Full Text Available Purpose: Due to globalization of manufacturing activities, the arena of competition and competitiveness advantage is moving from firms towards supply chains and networks. With the recent advancement of information and communication technologies this participation are becoming as common business practice in developed countries firms. Companies were more integrated into the world market for the global nature of the sourcing, manufacturing and distribution. These changes create both challenges and opportunities for the manufacturing industries in developing countries. The objective of this paper is to examine the level of inter-organizational and intra-organizational supply chain integration practices in developing country, Ethiopia.Design/methodology/approach: An industrial questionnaires survey was used to collect the current practices of the manufacturing industries in Ethiopia as an example of the developing countries. Descriptive statistics is primarily used for the analysis.Findings: Results show a low level of supply chain relationship both in intra and inter organizational supply chain integration level among members. Accordingly, such issues require much attention to facilitate a greater integration within the supply chains in the Ethiopian manufacturing industries.Research limitations/implications: The paper focuses on examining the practices of Ethiopian manufacturing industries empirical data. The interpretation of results should be taken with prudence.Originality/Value: The manufacturing industry in developing countries (MIDC has been a part of the global supply chains for long time as a supplier of raw material and manufacturer of primary products. Currently, the MIDC is trying to access the different markets segment of the world even with new products starting from their local market to the complex and dynamic international market. Nevertheless, their supply chains are inefficient and hence, their competitiveness level far from the

  13. SUSTAINABLE DEVELOPMENT OF INDUSTRIAL ENTERPRISES IN CONDITIONS OF ECONOMIC INSTABILITY

    Directory of Open Access Journals (Sweden)

    M. Ya. Veselovsky

    2015-01-01

    Full Text Available In article the perspective of a sustainable development of the industrial enterprises is investigated, the factors infl uencing stability of development of the enterprises are analyzed, defi nition of different types of economic stability in the period of economic instability is given, internal and external factors of stability of the enterprises are allocated, is underlined that economic stability, first of all, is distinguished from the major factors infl uencing stability of development of the industrial enterprises. At the same time, authors consider factors of the available instability and their infl uence on rates of development of the industrial enterprises. Change of the current situation requires weakening of a number of the factors resulting in economic instability.Purposes. The purpose of article is the analysis of factors of the industrial enterprises infl uencing a sustainable development in the conditions of economic instability and development of the off ers providing on their sustainable development. Article tasks: to investigate and allocate factors, in the conditions of the worsening economic situation which are expedient for considering at a solution of the problem of a sustainable development of the industrial enterprises.Methodology. When carrying out the real research materials of the state statistics were the main sources of basic data. Comparative methods of the analysis are the basis for methodical development.Results. The concept is given and types of economic stability of the industrial enterprises are given. Infl uence of internal and external factors of the enterprises infl uencing stability is shown. Infl uence of an economic situation on a role of these factors is allocated. For achievement of a sustainable development of the industrial enterprises it is off ered to realize measures for weakening of the factors resulting in economic instability.Conclusions / importance. In the conditions of new economic

  14. Research and industrial application of x-ray photoelectron spectroscopy (XPS) in Malaysia

    International Nuclear Information System (INIS)

    Mohd Ambar Yarmo; Abd Razak Daud; Abdul Kariem Arof

    2000-01-01

    As a developing country, Malaysia is fully committed to research and development especially for industrial development. One of priority fields is advanced materials and surface analysis of such materials is an important aspect in research. Among the tools for surface science analysis is x-ray photoelectron spectroscopy (XPS) which can be considered new to this country. The industrial sector is also keen to solve their problems and developing their products using XPS. The microelectronic and electrical industries are interested in solving problems related to metal-metal joining , gold silica peeling, surface corrosion and surface coating. The glove industry uses XPS to solve problems due to staining and color fading of their products. Research conducted in universities and research institutes that mainly deal with catalysis, membranes for fuel cells, sensors, batteries, corrosion phenomena and interface interaction in coating finds XPS a useful technique for surface studies. Specific examples from various sectors will be presented in this paper. (Author)

  15. Positioning and Priorities of Growth Management in Construction Industrialization: Chinese Firm-Level Empirical Research

    Directory of Open Access Journals (Sweden)

    Jingxiao Zhang

    2017-06-01

    Full Text Available The purpose of this research is to quantitatively evaluate the growth phase, position, and priorities of the industrialization policy management of the construction industry at firm level. The goal is to integrate quantitative dynamics into the policy-making process for sustainable policy development in future China. This research proposes an integrated framework, including growth management model and industrial policy evaluation method, to identify the challenges of construction industrialization and policy management. The research applies the mixed system method, which includes entropy method and average score method, to analyze the growth stage and major impact indexes targeting 327 survey samples. The empirical results show that the proposed conceptual framework and policy evaluation method could effectively determine the growth position and directions of the construction industrialization. For verification purpose, the study uses the local industry data from Shaanxi Province, China. The calculation results substantiate that the construction industry is in the middle section of the third growth phase. The comparison of the results from statistical methods shows that the local construction industry still needs substantial effort in policy management to improve its sustainable industrialization level. As countermeasures, the policy priorities should concentrate on: (1 enhancing effective cooperation among universities, research institutions and enterprises; (2 improving actions towards technology transfer into productivity; and (3 encouraging market acceptance of construction industrialization. This research complements the existing literature of policy evaluation of construction industrialization. Moreover, it provides theoretical and operational steps on industry policy evaluation and growth management framework, with accurate and ample data analysis on firm-level survey. Researchers and policy makers can use this research for further

  16. Fiscal 1997 report on the results of the research on the development of high-performance industrial furnaces. Volume 2; 1997 nendo seika hokokusho (koseino kogyoro no kaihatsu ni kansuru kenkyu seika hokokusto)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    A R and D was conducted for the purpose of developing remarkable energy conservation/CO2 reduction technologies. In fiscal 1997, the five working groups about the following were formed to have animated discussions: the basic research, heating furnace, heat treatment furnace, melting furnace, and tubular heating furnace. The research subjects are the pursuit/deepening of the base study on flame structures in high temperature air combustion, critical heat recovery of the system in high temperature air combustion, examination of the basic common technology on the ultimate optimization of the material heat transfer, construction of general-purpose experimental database, setting-up of design standards for general-purpose high-performance industrial furnaces, presentation of examples of the actual trial design based on the design standards and feasibility study of the practical application, preparatory support of the field test project on high-performance industrial furnaces for commercialization/diffusion/spread, etc. Further, how to arrange the developmental results was studied to make the results of the project useful for study of the prompt commercialization. 442 refs., 1444 figs., 311 tabs

  17. Fiscal 1997 report on the results of the research on the development of high-performance industrial furnaces. Volume 3; 1997 nendo seika hokokusho (koseino kogyoro no kaihatsu ni kansuru kenkyu seika hokokusto)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    A R and D was conducted for the purpose of developing remarkable energy conservation/CO2 reduction technologies. In fiscal 1997, the five working groups about the following were formed to have animated discussions: the basic research, heating furnace, heat treatment furnace, melting furnace, and tubular heating furnace. The research subjects are the pursuit/deepening of the base study on flame structures in high temperature air combustion, critical heat recovery of the system in high temperature air combustion, examination of the basic common technology on the ultimate optimization of the material heat transfer, construction of general-purpose experimental database, setting-up of design standards for general-purpose high-performance industrial furnaces, presentation of examples of the actual trial design based on the design standards and feasibility study of the practical application, preparatory support of the field test project on high-performance industrial furnaces for commercialization/diffusion/spread, etc. Further, how to arrange the developmental results was studied to make the results of the project useful for study of the prompt commercialization. 442 refs., 1444 figs., 311 tabs.

  18. Development of industrial variant specification systems

    DEFF Research Database (Denmark)

    Hansen, Benjamin Loer

    be developed from a holistic and strategically anchored point of view. Another assumption is that this is a challenge for many industrial companies. Even though the literature presents many considerations on general issues covering new information technology, little work is found on the business perspectives...... are discussed. A list of structural variables and solution components has been created. These are related to four design aspects in the holistic system design covering the aspects of process design, selection of resources (such as hardware, software and humans), the design of information structures...... solution elements and structural variables to be used in the design of variant specification systems. The thesis presents a “top-down” procedure to be used to develop variant specification systems from a strategically anchored and holistic point of view. A methodology and related task variables...

  19. Quality Culture Development in the Industrial Enterprise

    Directory of Open Access Journals (Sweden)

    Renata Baravska

    2016-04-01

    Full Text Available This article examines the theoretical viewpoint of quality culture, its formation in industrial plants. Here is discussed cultural ap-proach to quality. It is determined that quality based on a cultural perspective is implemented not only by using tools and methods, but it is the result of cultural factors – exactly the company's values and practices. The values that affect a successful quality culture's integration into entire company's activity are overviewed. This article presents the study of key factors influencing the quality culture's development and it is proposed a conceptual model. The conclusions of performed empirical studies confirm that leadership and company's culture are of paramount im-portance and are the main success factors in developing of the quality culture in the company. The connection between leader-ship and empowerment certifies that each company itself is re-sponsible for the formation of the quality culture.

  20. Sustainable development and construction industry in Malaysia

    Directory of Open Access Journals (Sweden)

    Suliman L. Kh. M.

    2009-12-01

    Full Text Available Sustainable construction is a way for the building and infrastructure industry to move towards achieving sustainable development, taking into account environmental, socioeconomic and cultural issues. Differing approaches and differing economic markets lead to different priorities. This paper presents the construction scenario of Malaysia and the developments in sustainable construction taking place in this country. Barriers to the implementation of sustainable construction are discussed. A list of recommendation was proposed to drive sustainable construction in this country. In conclusion, the status of sustainable construction in Malaysia is still in its infancy. The lack of awareness, training and education, ineffective procurement systems, existing public policies and regulatory frameworks are among the major barriers for sustainable construction in Malaysia. Besides the needs for capacities, technologies and tools, total and ardent commitment by all players in the construction sectors including the governments and the public atlarge are required in order to achieve sustainable construction in Malaysia.

  1. Modelling system development of risky industry on world experience base

    Directory of Open Access Journals (Sweden)

    O.T. Polishchuk

    2017-12-01

    Full Text Available The paper researches the tendencies and dynamic characteristics of risky business. The means of development stimulation in risky business in the USA are examined. The factors for insurance companies, banks, retirement funds of their investors’ function inability are explained. The multichoice model of economy structure transformation according to the innovative changes and regulatory policy is developed. The authors systematize the factors, which determine the branch attraction for risky investment. Four scenarios for the development of risky industry in Ukraine are studied and the matrix of their development is formed.

  2. Development of laser spectroscopic technology in nuclear industry

    International Nuclear Information System (INIS)

    Lee, Jong Min; Cha, Byung Heon; Kim, Seong Ho; Cha, Hyung Ki; Lim, Chang Hwan; Song, Kye Seok; Kim, Jung Bok; Rho, Si Pyo; Han, Jae Min; Jeong, Do Yung; Lee, Jong Hoon; Choi, Hwa Lim; Yoo, Byung Duk; Choi, An Sung; Lee, Byung Chul; Kim, Chul Jung

    1992-05-01

    The goal of this project is to carry out the fundamental researches for the selective photoionization process of heavy atoms as well as the development of experimentally related instruments. Main research results carried out in this year are (1) multi-step photoionization spectroscopy of Hg atom by 3-color 3-step ionization scheme, (2) selective photoionization using polarization spectroscopy, (3) design and construction of ion separator chamber, and (4) theoretical study for spectroscopic parameters of mercury. This technology can be applied to several area of nuclear industry such as the utilization of radioactive waste, the development of new materials, high sensitive analysis of heavy atomic elements. (Author)

  3. Valuing and Managing Diversity in Business and Industry: Literature Review and Models. Training and Development Research Center Project Number Fifty-Nine.

    Science.gov (United States)

    Johnson, Sandra J.

    An increasingly diverse work force is a definite trend in the United States, and a number of companies have linked valuing and managing diversity to increased productivity. Equal employment opportunity and affirmative action are pointed to as foundational to the development of formal programs for valuing or managing diversity in the workplace. The…

  4. Exploring the Driving Factors of Construction Industrialization Development in China

    Directory of Open Access Journals (Sweden)

    Xiaer Xiahou

    2018-03-01

    Full Text Available Construction industrialization (CI has been adopted worldwide because of its potential benefits. However, current research shows the incentives for adopting CI may differ in different regions. While the promotion of CI in China is still at the initial stage, a systematical analysis of the driving factors would help decision makers get a comprehensive understanding of CI development and select proper strategies to promote CI. This research combines qualitative and quantitative methods to explore the construction industrialization driving factors (CIDFs in China. The grounded theory method (GTM was employed to explore CI concepts among 182 CI-related articles published in 10 top-tier journals from 2000 to 2017. A total of 15 CIDFs were identified, including one suggested by professionals during a pre-test questionnaire survey. The analysis showed that the development of CI in China is pushed by macrodevelopment and pulled by the government and is also a self-driven process. The major driving factors for CI adoption in China are the transformation and upgrade of the conventional construction industry and the solution of development dilemmas. Our study also suggests that pilot programs are, currently, the most effective method to promote CI in China and to accumulate experience so to gain recognition by the society. This research is also of value for CI promotion in other developing countries.

  5. Exploring the Driving Factors of Construction Industrialization Development in China

    Science.gov (United States)

    Xiahou, Xiaer; Yuan, Jingfeng; Tang, Yuchun; Li, Qiming

    2018-01-01

    Construction industrialization (CI) has been adopted worldwide because of its potential benefits. However, current research shows the incentives for adopting CI may differ in different regions. While the promotion of CI in China is still at the initial stage, a systematical analysis of the driving factors would help decision makers get a comprehensive understanding of CI development and select proper strategies to promote CI. This research combines qualitative and quantitative methods to explore the construction industrialization driving factors (CIDFs) in China. The grounded theory method (GTM) was employed to explore CI concepts among 182 CI-related articles published in 10 top-tier journals from 2000 to 2017. A total of 15 CIDFs were identified, including one suggested by professionals during a pre-test questionnaire survey. The analysis showed that the development of CI in China is pushed by macrodevelopment and pulled by the government and is also a self-driven process. The major driving factors for CI adoption in China are the transformation and upgrade of the conventional construction industry and the solution of development dilemmas. Our study also suggests that pilot programs are, currently, the most effective method to promote CI in China and to accumulate experience so to gain recognition by the society. This research is also of value for CI promotion in other developing countries. PMID:29510507

  6. International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... development. Learn moreArtificial intelligence and human development ... New initiative will match climate knowledge to developing country needs. Aminata Camara ... Shadow Libraries: Access to Knowledge in Global Higher Education.

  7. Towards preventative eco-industrial development: an industrial and urban symbiosis case in one typical industrial city in China

    DEFF Research Database (Denmark)

    Dong, Liang; Fujita, Tsuyoshi; Dai, Ming

    2016-01-01

    situation. In order to investigate the eco-benefits of eco-industrial development in China, this study focused on an industrial and urban symbiosis case of Guiyang city in which process synergy, municipal solid wastes recycling and waste energy utilization were incorporated in this typical industrial city...... policy implications to address the barriers of promoting industrial and urban symbiosis were proposed. This study is critical for future industrial and urban planning policy making and shed a light on innovative eco-industrial development in China....

  8. Coal chemical industry and its sustainable development in China

    International Nuclear Information System (INIS)

    Xie, Kechang; Li, Wenying; Zhao, Wei

    2010-01-01

    China is rich in coal resource, which is vital for energy security in this country. In early 21st century, the coal chemical industry in China will be oriented to the development of high efficiency, safety, cleanliness, and optimum utilization. In this review, the authors present an introduction to the utilization status of primary energy production and consumption in China. Since 2005, fundamental research studies, supported by the Ministry of Science and Technology of Chinese National Basic Research Program, have been carried out at Taiyuan University of Technology. The Ministry stresses that the new coal chemical industry should be developed in a sustainable manner to realize effective utilization of energy. Moreover, upgrading the high technology to improve actively the recycling processes of coal chemical engineering is of strategic importance to realize the modern coal chemical engineering.

  9. FY 1998 Report on development of technologies for commercialization of industrial solar systems. Summary of the abstracts (Research and development management); 1998 nendo sangyoyonado solar system jitsuyoka gijutsu kaihatsu seika gaiyo sogoban. Kenkyu kaihatsu kanri

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    The FY 1998 programs for development of technologies for commercialization of industrial solar systems include those for freezing/refrigeration systems utilizing solar heat, and international joint programs for development of technologies for the solar heat-utilizing systems. The studies are also conducted to draw the technological development programs for the solar heat-utilizing systems to be developed in the future. For development of the solar heat-utilizing freezing/refrigeration systems, the efforts are directed to extending service life of hydrogen occluding alloy to at least 10 years, which is one of the final targets. High reversibility up to 1,000 cycles is confirmed with the alloy working at low temperature for generating low-temperature heat. The international joint programs for technological development include technology evaluation of lumber drying by solar heat by operating the pilot plant, training of engineers and study on commercialization of the concept in Republic of Indonesia. The studies on technological development of solar heat-utilizing systems include those on classification of the solar heat-utilizing systems by area and utilization type, and evaluation of operating temperature levels and the merits and themes/problems. (NEDO)

  10. Infrastructure development to support the hydrocarbon industry

    International Nuclear Information System (INIS)

    Mack, T.

    1993-01-01

    Tengiz and Jubail represent areas in which the exploitation of oil and gas resources have, and are, providing enormous opportunities for regional development. Each has required a vision of the future and an understanding that infrastructure input is very broadly defined. Tengiz and Jubail are extreme examples. There are probably no cases in the Americas that will exactly mirror these. But opportunities for oil and gas development here may share some of these projects characteristics - extraction from remote areas, challenging transportatoin needs, and perhaps most importantly, opportunities for related industrial and economic development. Just as Jubail's master plan was part of a larger Saudi vision, oil and gas infrastructure planning can support Latin and North American countries individual visions of their nation's future. Where regional economic integration and interaction is increasing, there are even greater opportunities for good infrastructure planning. In some cases, such economic integration will provide the key which will unlock oil and gas development. Once these keys are provided - be it through the intangible innovations of creative project finance or tangible links through roadways, pipeline and rail - the opening will provide real chances to develop the infrastructure of the entire region

  11. Industrial science and technology research and development institutions in fiscal 2000. Research and development of human media (Report on achievements in research and development of high-level information system for petroleum plant); 2000 nendo sangyo kagaku gijutsu kenkyu kaihatsu seido. Human media no kenkyu kaihatsu seika hokokusho (sekiyu plant kodo johoka system gijutsu kenkyu kaihatsu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    Having selected a petroleum refining plant as a large and complex system, a system was developed, that is capable of operating safely and efficiently a plant even by young operators by utilizing the human media technology that realizes information environment having a sense of unity with humans. With this system, if an anomaly is detected in the plant condition, the agent and the operator talk with each other freely, and necessary items of information are displayed on a large screen from moment to moment according to the priority thereof. Activities were taken in the following nine areas: 1) the total system, 2) research on an interface agent, 3) research on hypothetic plant indication interface, 4) research on a discrete cooperative treatment technology, 5) research on plant models and interface systems, 6) research on plant ontology, 7) research on significance indication interface, 8) improvement of tools to structure a large-screen integrated indication system, and 9) investigations on technological trends in foreign countries. (NEDO)

  12. Industrial Innovation and Environmental Regulation: Developing ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2007-03-01

    Mar 1, 2007 ... Book cover Industrial Innovation and Environmental Regulation: ... in steering the behaviour of economic agents in industrial production. ... IDRC congratulates first cohort of Women in Climate Change Science Fellows.

  13. New development stage of China's uranium industry

    International Nuclear Information System (INIS)

    Zhang Rong

    2001-01-01

    From the early 1980s China adjusted its uranium industry to better meet the market economy requirements. Until 1997, the adjustment has been completed. The technical and managerial improvements result in a more efficient uranium production. In 1996 a series of events related to the nuclear power development of China manifests very favorable situation for the uranium industry. The first two nuclear power plants with a total installed capacity of 2100 MW in the mainland of China have been operating safely and steadily for several years. The additional nuclear power projects to be constructed for the rest of this century are implemented in an all-round way. Four plants with eight reactors of a total of 6900 MW have entered their construction period in succession. In 1996 a commercial ISL mine in Xinjiang with annual capacity 100 tU was completed, and the larger scale of ISL mine is expected to be constructed by 2000. The Benxi uranium mine in northeast China was put into production. It applies some new mining and processing technologies and improved management, which might serve as a new model of uranium mines in China. (author)

  14. MOX fuel fabrication: Technical and industrial developments

    International Nuclear Information System (INIS)

    Lebastard, G.; Bairiot, H.

    1990-01-01

    The plutonium available in the near future is generally estimated rather precisely on the basis of the reprocessing contracts and the performance of the reprocessing plants. A few years ago, decision makers were convinced that a significant share of this fissile material would be used as the feed material for fast breeder reactors (FBRs) or other advanced reactors. The facts today are that large reprocessing plants are coming into commercial operations: UP3 and soon UP2-800 and THORP, but that FBR deployment is delayed worldwide. As a consequence, large quantities of plutonium will be recycled in light water reactors as mixed oxide (MOX) fuels. MOX fuel technology has been properly demonstrated in the past 25 years. All specific problems have been addressed, efficient fabrication processes and engineering background have been implemented to a level of maturity which makes MOX fuel behaving as well as Uranium fuel. The paper concentrates on todays MOX fabrication expertise and presents the technical and industrial developments prepared by the MOX fuel fabrication industry for this last decade of the century

  15. Competitive Research Grants and Industry Collaboration: A Challenge for Universities in the 1990s.

    Science.gov (United States)

    Johnson, Peter

    1993-01-01

    The reasons for increased collaboration between Australian universities and industry are examined, focusing on competitive research grant programs developed by the government in the last decade. University and industry response to these opportunities and to issues such as intellectual property rights and publication rights are discussed. (MSE)

  16. Gender | Page 212 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Research evidence is supporting the notion that involving women, along with ... The Centre has long valued industry, trade, and commerce as engines of economic growth. From its own practical support for private sector development, IDRC has ... du rôle joué par l'agriculture dans cette ville dynamique d'Afrique de l'Est.

  17. Developing Technological Capabilities in Agro-Industry

    DEFF Research Database (Denmark)

    Whitfield, Lindsay

    2012-01-01

    This article examines the emergence and trajectory of a new agro-industry in Ghana, the pineapple export industry, using the technological capabilities approach. It explains the limited expansion of the industry and its declining competitiveness in the face of new competition by looking at how...

  18. Development of an ergonomics guideline for the furniture manufacturing industry.

    Science.gov (United States)

    Mirka, Gary A

    2005-03-01

    Industry-specific ergonomics guidelines are an important component in the four-pronged approach to workplace ergonomics currently pursued by the United States Occupational Safety and Health Administration. The American Furniture Manufacturers Association has taken the initiative of developing such a guideline for its members. The result of this effort is the "AFMA Voluntary Ergonomics Guideline for the Furniture Manufacturing Industry", a document that includes basic information about ergonomics program components as well as a compilation of work-proven, ergonomics best practices as submitted by members of the furniture manufacturing community. This guideline was developed through an industry-research-government partnership and made strategic use of the unique attributes that each sector brought to this effort. Outlined in this paper are some of the characteristics of this partnership including, the roles played by each, the different motivations for pursuing the guideline, the challenges faced during the development of the document, the successes experienced in this process, as well as a proposed outline for measuring the effectiveness of this effort. The hope is that this summary, and some of the lessons learned contained herein, would be helpful to others considering the prospect of developing such a guideline for their industry.

  19. Renewable Energy Research & Development

    Energy Technology Data Exchange (ETDEWEB)

    Jicarilla Apache Tribe

    2003-04-01

    The Jicarilla Apache Nation is in Rio Arriba County in North Central New Mexico. The photovoltaic project was installed at the Dulce High School in the town of Dulce. Dulce is in the most northern part of the reservation near the New Mexico/Colorado boundary and can be reached from the New Mexico State Capitol in Santa Fe, hence to the town of Chama along U.S. Highway 84 to the junction of U.S. Highway 64. Dulce is about 12 miles west of the junction along U.S. Highway 64. Dulce community is in the mountainous part of the Nation with a population of about 4000. No industry exists in the community, however, a few commercial sites do exist such as a motel, restaurants, gas stations, food and liquor stores.

  20. Fiscal 1999 achievement report on research and development of industrial technology of new industry creation type. Research and development of intelligent material and structural system (Development of energy use rationalization technology); 1999 nendo chiteki zairyo kozo system no kenkyu kaihatsu seika hokokusho. Energy shiyo gorika gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Fiber or foil shaped sensor materials and actuator devices were integrated with composite materials and composite material structures for processing and controlling information, and then studies were conducted about materials and structural systems for enabling real-time detection of damage in materials and structures, examination of soundness, control of noise and vibration, and the like. Concerning optical fiber sensors in the development of smart manufacturing technologies, the impact imposed on composite materials by sensors embedded therein was investigated, and the scope of their applicability was determined. In the development of actuator materials and devices, ceramic actuators were fabricated by microwave sintering, and it was found that they were higher in performance by 30% than actuators of the conventional design. In the testing of demonstrators, molded body monitor basic tests using optical fiber sensors were conducted for jet engine static vane models, and temperature dependence of optical intensity was understood. (NEDO)

  1. Research on the Countermeasures for High-end Talent Development in the New Material Industry from the Perspective of Four-dimensional Subject-With Hunan Province as an Example

    Science.gov (United States)

    Wen, Qiong

    2018-03-01

    In the context of the increasingly severe international economic situation, the new material industry is as one of the seven strategic emerging industries, and its development has become a major strategic decision of China that should be insisted at present and in the future. The implementation of this strategic decision cannot be achieved without talents. Based on the actual situation of Hunan Province, this paper points out the four major problems in high-end talent development of Hunan Province, namely, immaturity of industry development, unreasonable talent structure, imperfect training mechanism and unscientific incentive measures, and purposes the countermeasures in the perspective of four-dimensional subject involving government, enterprises, schools and students.

  2. Research Librarian | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Job Summary The Research Librarian is a key member of a team responsible for the delivery of comprehensive research information services which contribute strategic value to the work of clients. Intermediated search services at the expert level, the development and delivery of orientations, training/coaching, ...

  3. Analysis of territorial and industrial development

    Directory of Open Access Journals (Sweden)

    Zhul'kova Yuliya Nikolaevna

    2014-07-01

    Full Text Available At present a territory is considered as the basis for effective socio-economical development of the region. However, special attention should be paid to the presence of available resources on the territory under consideration, as well as the conditions of their future development. The availability and/or the possibility of creating/upgrading the existing resources encourage today the accumulated potential of the territory. Potential of the area is a set of capabilities and different levels of impact on the total potential of the area and includes such resources as natural, human, investment, innovation, employment, scientific and technological, demographic, urban development, tourism, tax, financial, recreational, marketing, cluster and infrastructure, as well as other kinds of potentials. The prospects for the development of enterprises or their complexes determine the capacities of the territory, the basis of their operation being the location. In this connection it is necessary to consider the basic types of potential undertakings, which the article refer to: marketing, investment, innovation, employment, tax, industrial, economic, resources. For more exact information and accurate prediction each primary resource must include a group of elements. The number of analyzed resources, as well as their elements, is not limited. However an obligatory demand for including the resources or their elements in the list is their exceptional importance for the development of the subject. For efficient operation of enterprises or their complexes in a certain area it is necessary to identify the sources of coordinated development of land and property of the complex, the purpose of which is to obtain maximum benefit from the combination of "territory↔enterprise (s". For this aim we suggest assessing the possibility of long-term development according to the following scenario: establishment of a list of core resources, having impact on businesses

  4. Carbon sequestration research and development

    Energy Technology Data Exchange (ETDEWEB)

    Reichle, Dave; Houghton, John; Kane, Bob; Ekmann, Jim; and others

    1999-12-31

    Predictions of global energy use in the next century suggest a continued increase in carbon emissions and rising concentrations of carbon dioxide (CO{sub 2}) in the atmosphere unless major changes are made in the way we produce and use energy--in particular, how we manage carbon. For example, the Intergovernmental Panel on Climate Change (IPCC) predicts in its 1995 ''business as usual'' energy scenario that future global emissions of CO{sub 2} to the atmosphere will increase from 7.4 billion tonnes of carbon (GtC) per year in 1997 to approximately 26 GtC/year by 2100. IPCC also projects a doubling of atmospheric CO{sub 2} concentration by the middle of next century and growing rates of increase beyond. Although the effects of increased CO{sub 2} levels on global climate are uncertain, many scientists agree that a doubling of atmospheric CO{sub 2} concentrations could have a variety of serious environmental consequences. The goal of this report is to identify key areas for research and development (R&D) that could lead to an understanding of the potential for future use of carbon sequestration as a major tool for managing carbon emissions. Under the leadership of DOE, researchers from universities, industry, other government agencies, and DOE national laboratories were brought together to develop the technical basis for conceiving a science and technology road map. That effort has resulted in this report, which develops much of the information needed for the road map.

  5. Industrialization development of food irradiation in China

    International Nuclear Information System (INIS)

    Chen Dianhua

    2004-01-01

    This report introduces present status on food irradiation at home and abroad in detail. It also introduces the scientific research and application in reducing diseases caused by food borne pathogens, quarantine control of import and export products, grain store and killing insects in traditional Chinese medicine. The report also analyzes the problems in developing food irradiation in China and gives some suggestions

  6. Project in fiscal 1988 for research and development of basic technologies in next generation industries. Research and development of superconducting materials and superconducting elements (Achievement report on research and development of high-temperature superconducting elements); 1988 nendo koon chodendo soshi no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-03-01

    With an objective of engineering utilization of superconducting materials in the electronics field, research and development has been inaugurated on superconducting elements having new functions. This paper summarizes the achievements in fiscal 1988. In the research of a superconducting element technology, researches were inaugurated on the four themes of the electric field effect type and charge injection type elements in the proximity effect type tri-terminal element, and low energy electron type and high energy electron type elements in the superconduction base type tri-terminal element. In bonding superconductors with semiconductors, discussions were given on a method to form both conductors by controlling oxygen concentrations of oxides having the same composition, and a method to laminate the superconductors on the semiconductors under super-high vacuum atmosphere. In the research of a new functional element technology, researches were inaugurated on the two themes of a single electron tunneling type tri-terminal element and a local potential tunneling type tri-terminal element. In addition, works were performed on epitaxial growth of high-quality superconducting films as a common basic technology, and such an assignment has been made clear as the necessity of controlling the crystalline azimuth. (NEDO)

  7. Research and photovoltaic industry at the United States

    International Nuclear Information System (INIS)

    Lerouge, Ch.; Herino, R.; Delville, R.; Allegre, R.

    2006-06-01

    For a big country as the United States, the solar energy can be a solution for the air quality improvement, the greenhouse gases fight and the reduction of the dependence to the imported petroleum and also for the economic growth by the increase of the employment in the solar industry sector. This document takes stock on the photovoltaic in the United States in the industrial and research domains. The american photovoltaic industry is the third behind the Japan and the Germany. (A.L.B.)

  8. Development of Transportation Package for Medical and Industrial Radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Seo, K. S.; Lee, J. C.; Bang, K. S. (and others)

    2007-06-15

    The objective of this project is development of RI transport package and establishment of transportation system. This report describes the objective of project, necessaries, state of related technology, scope and results, proposal for application etc. The scope of the project consist of establishment of performance test system for type-A package for medical use, development of type-B package for industrial use and development of casting technology for DU shield and evaluation of shielding efficiency. The research results obtained from this project are expected to be utilized as a basic data for design, analysis, test and license of transport package.

  9. Strategy and business development practices in Danish constrution industry SMEs

    DEFF Research Database (Denmark)

    Thuesen, Christian Langhoff; Koch, Christian; Nielsen, Jesper Salling

    2010-01-01

    practices. 19 qualitative interviews have been conducted in total representing architects, engineering companies, contractors and subcontractors. Based on an in-depth analysis of this empirical material, the study finds: (1) he market is characterized by a typical “red ocean” environment, where...... the companies compete on their overhead rather than their ability to reduce production cost and create value. (2) the companies have a reactive practice towards development, where they try to follow the development in the market rather than shaping their own market. (3) their approach towards strategy...... development represents an important but unacknowledged practice for innovation of the building industry and suggests that strategy processes should be facilitated and subject to more detailed research in order to escape the present unhealthy market practices in the construction industry....

  10. Materials design and development of functional materials for industry

    International Nuclear Information System (INIS)

    Asahi, Ryoji; Morikawa, Takeshi; Hazama, Hirofumi; Matsubara, Masato

    2008-01-01

    It is now well recognized that we are witnessing a golden age of innovation with novel materials, with discoveries that are important for both basic science and industry. With the development of theory along with computing power, quantum materials design-the synthesis of materials with the desired properties in a controlled way via materials engineering on the atomic scale-is becoming a major component of materials research. Computational prediction based on first-principles calculations has helped to find an efficient way to develop materials that are much needed for industry, as we have seen in the successful development of visible-light sensitized photocatalysts and thermoelectric materials. Close collaboration between theory and experiment is emphasized as an essential for success

  11. 7 CFR 1980.488 - Guaranteed industrial development bond issues.

    Science.gov (United States)

    2010-01-01

    ... industrial plants for lease to private businesses engaged in industrial manufacturing and does not provide... 7 Agriculture 14 2010-01-01 2009-01-01 true Guaranteed industrial development bond issues. 1980..., DEPARTMENT OF AGRICULTURE (CONTINUED) PROGRAM REGULATIONS (CONTINUED) GENERAL Business and Industrial Loan...

  12. The first IEC fusion industrial neutron generator and developments

    Science.gov (United States)

    Sved, John

    1999-06-01

    Inertial Electrostatic Confinement fusion grade plasma containment has been sporadically researched since the early 1960's. In the 1990's the work of G. H. Miley and his team at the University of Illinios, Fusion Studies Laboratory, Champaign-Urbana has stimulated a collaboration with industry. The development and test program for the first industrial IEC neutron generator has progressed to the point where an endurance test is under way to demonstrate at least 10,000 hours of operational life of the sealed chamber device without servicing. The market entry goals of steady 107 D-D n/s CW output with an air-cooled system have been achieved. DASA has invested in the development of the industrial product and the continuing basic research at the UI-FSL. The complete DASA FusionStar IEC-PS1 point source neutron generator set is described with emphasis on the interfaces to user NAA systems. The next product developments are pulsed neutron operations and higher fusion reaction rates of up to 1010 by means of affordable add-ons to the basic IEC-PS system. The production engineering experience gained will next be applied to a more challenging line source variant of the IEC. Beyond neutron and proton sources, several other IEC applications are being developed.

  13. Sustainable Development - An Oil Industry View

    Energy Technology Data Exchange (ETDEWEB)

    Langcake, Peter [Shell International BV, (Netherlands)

    1997-12-31

    For Shell companies, according to this presentation, sustainable development is an umbrella concept that they have been dealing with for many years and that has recently been given increased focus. Over the years, concern about the depletion of non-renewable resources has been overshadowed by concern about the depletion of renewable sources such as fisheries, forests etc. and climate changes. The primary contribution that Shell can make to sustainable development now and in the foreseeable future is in the economic sphere. Some examples of the involvement of Shell are given: (1) Shell companies have for many years invested considerably in forestry projects and recently some have developed businesses in biomass to power generation projects. Some have projects in photovoltaics. (2) In the Camisea project in Peru, a Shell company is putting the sustainability principle to work by integrating economic, environmental and social aspects. Two large oil reserves lie on either side of the Camisea River. The area is home to several indigenous peoples; it borders a national park and is rich in biodiversity. (3) In Malaysia, Shell is exploiting rich offshore gas fields. These projects are examples of technology cooperation and capability building that contribute to Malaysia`s plans for becoming fully industrialized by 2020

  14. Analysed with Shanghai international fashion the development of creative industry

    Directory of Open Access Journals (Sweden)

    Jinjin Ma

    2017-05-01

    Full Text Available Rapid development of economy, and promote people to enter the era of knowledge economy. Under this background, the global economy especially the economic model of developed countries began to industrial restructuring and structural adjustment, and fashion creative industry economy is the product of the change. It embodies a nation in such aspects as culture, science and technology and creative design of soft power, to some extent, also represents a national industry's international competitiveness, is one of the most important industry in the development of leading industry. In the globalization trend of strengthening, today, the increasingly fierce competition in the international fashion scale and degree, the development of creative industry has become a measure of a country or a city comprehensive competitiveness of one of the important symbol. Therefore, many countries and regions all over the industry as a strategic industry and pillar industry to develop. Along with the rapid economic and social development as well as the consumer demand is rising, fashion creative industry gradually become Shanghai currently one of the most promising new industries. Especially in the face of the global economic downturn, China's transformation of the mode of development environment, development fashion creative industry will help speed up the Shanghai industrial structure transformation, beneficial to stimulate consumer demand, to improve the Shanghai international influence, for the Shanghai a new round of development, the construction of "four centers" and one of the breach of the international metropolis.

  15. The Aeronautics Education, Research, and Industry Alliance (AERIAL) 2002 Report. UNO Aviation Monograph Series. UNOAI Report.

    Science.gov (United States)

    Bowen, Brent D.; Box, Richard C.; Fink, Mary M.; Gogos, George; Lehrer, Henry R.; Narayanan, Ram M.; Nickerson, Jocelyn S.; O'Neil, Patrick D.; Tarry, Scott E.; Vlasek, Karisa D.

    This document contains four papers on aeronautics education, research, and partnerships that partly supported through the Aeronautics Education, Research, and Industry Alliance (AERIAL). The paper "2002 AERIAL Monograph" (Brent D. Bowen, Jocelyn S. Nickerson, Mary M. Fink, et al.) presents an overview of research and development in the…

  16. Social management in traditional, industrial and post-industrial society: the prospects for management systems development

    Directory of Open Access Journals (Sweden)

    V S Mukhametzhanova

    2010-09-01

    Full Text Available The article is devoted to social management development at different stages of society's evolution - traditional, industrial and post-industrial. The historical types of social management are highlighted.

  17. Decommissioning of Medical, Industrial and Research Facilities. Safety Guide

    International Nuclear Information System (INIS)

    2010-01-01

    Radioactive waste is produced in the generation of nuclear power and the use of radioactive materials in industry, research and medicine. The importance of the safe management of radioactive waste for the protection of human health and the environment has long been recognized, and considerable experience has been gained in this field. The IAEA's Radioactive Waste Safety Standards Programme aimed at establishing a coherent and comprehensive set of principles and requirements for the safe management of waste and formulating the guidelines necessary for their application. This is accomplished within the IAEA Safety Standards Series in an internally consistent set of publications that reflect an international consensus. The publications will provide Member States with a comprehensive series of internationally agreed publications to assist in the derivation of, and to complement, national criteria, standards and practices. The Safety Standards Series consists of three categories of publications: Safety Fundamentals, Safety Requirements and Safety Guides. With respect to the Radioactive Waste Safety Standards Programme, the set of publications is currently undergoing review to ensure a harmonized approach throughout the Safety Standards Series. This Safety Guide addresses the subject of decommissioning of medical, industrial and research facilities where radioactive materials and sources are produced, received, used and stored. It is intended to provide guidance to national authorities and operating organizations, particularly to those in developing countries (as such facilities are predominant in these countries), for the planning and safe management of the decommissioning of such facilities. The Safety Guide has been prepared through a series of Consultants meetings and a Technical Committee meeting

  18. Decommissioning of medical, industrial and research facilities. Safety guide

    International Nuclear Information System (INIS)

    2005-01-01

    Radioactive waste is produced in the generation of nuclear power and the use of radioactive materials in industry, research and medicine. The importance of the safe management of radioactive waste for the protection of human health and the environment has long been recognized, and considerable experience has been gained in this field. The IAEA's Radioactive Waste Safety Standards Programme aimed at establishing a coherent and comprehensive set of principles and requirements for the safe management of waste and formulating the guidelines necessary for their application. This is accomplished within the IAEA Safety Standards Series in an internally consistent set of publications that reflect an international consensus. The publications will provide Member States with a comprehensive series of internationally agreed publications to assist in the derivation of, and to complement, national criteria, standards and practices. The Safety Standards Series consists of three categories of publications: Safety Fundamentals, Safety Requirements and Safety Guides. With respect to the Radioactive Waste Safety Standards Programme, the set of publications is currently undergoing review to ensure a harmonized approach throughout the Safety Standards Series. This Safety Guide addresses the subject of decommissioning of medical, industrial and research facilities where radioactive materials and sources are produced, received, used and stored. It is intended to provide guidance to national authorities and operating organizations, particularly to those in developing countries (as such facilities are predominant in these countries), for the planning and safe management of the decommissioning of such facilities. The Safety Guide has been prepared through a series of Consultants meetings and a Technical Committee meeting

  19. Emerging trends in contract research industry in India.

    Science.gov (United States)

    Drabu, Sushma; Gupta, Alka; Bhadauria, Anupama

    2010-09-01

    A Contract Research Organization (CRO) is a service organization that provides support to the pharmaceutical industry and offers a wide range of "outsourced" pharmaceutical research services to aid in R&D process and is thus an essential tool for undertaking clinical trials in the present scenario when high stakes are involved in the drug discovery process. This industry also offers a safe option of investment as the industry is largely recession-proof, with a significant upscale growth. Presently India occupies a very small pie of the global market share in the Clinical Trials Industry but it is estimated to conduct nearly 5% of global clinical trials by 2012. The global CRO industry valued $18 bn in 2008 and the market is expected to grow at an annual rate of 14% between 2009 and 13. Top multinational pharmaceuticals companies are venturing into the Indian business, in collaboration with the Indian Drug Companies. According to a recent study by Mckinsey & Company, the Indian Clinical Research Industry can attract $1.5 bn of revenue from US and EU by 2010. Such an increase in outsourcing from the western countries has led the global pharma companies and Indian entrepreneurs to set up Contract Research Organizations (CROs) in India. To bring this into realization and fulfil the market demand, while simultaneously aiding in improving the country's economical standards and market position, joint and well-coordinated efforts on part of the government, industry, and working professionals are needed in terms of regulatory affairs, audits, transparency in work affairs, garnering patient confidence, and pharmacovigilance. Copyright 2010 Elsevier Inc. All rights reserved.

  20. Council for Scientific and Industrial Research annual report 1987

    Energy Technology Data Exchange (ETDEWEB)

    1988-01-01

    The CSIR undertakes and manages broadly based scientific research, development and technology transfer in South Africa. The organisation is divided into four groups: Corporate Finance Management; Research Development and Implementation; Foundation for Research Development and Corporate Support Services. Research on coal is carried out by the Energy Technology Division which is part of the Research, Development and Implementation Group. This annual report reviews the work of the CSIR during 1987.

  1. Geographical Research Model of the Relation Between Tourism and Industry on the Framework of Pula

    Directory of Open Access Journals (Sweden)

    Nikola Vojnović

    2002-01-01

    Full Text Available The research gives a proposal of a theoretical research model, and can be the basis of geographical research of the relation between tourism and industry as two opposite human activities and branches of economy. The accent is set on the consideration of their relation in major urban areas, which show a parallel development of tourism and industry of the Second Industrial Revolution, typical for Croatian coastline region. The proposal of the research scheme, from the analysis of the present structure and the quantity, harmony and disharmony of both branches, to the possibility of creating an industrial-tourism region are analyzed in the first part of the work, whereas the results of the initial research are presented in the second part.

  2. International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ann Gregory

    further development of scientific agriculture and technology. Already, however ..... sent, starting in the north, to Galilee and the regions adjoining, Lebanon and Syria, and working my ... the water, grow crops, and flocks of sheep and goats.” He says ... I served in 30 or 40 different countries throughout Asia and Africa, South.

  3. Offshore wind development research.

    Science.gov (United States)

    2014-04-01

    Offshore wind (OSW) development is a new undertaking in the US. This project is a response to : New Jerseys 2011 Energy Master Plan that envisions procuring 22.5% of the states power : originating from renewable sources by 2021. The Offshore Wi...

  4. Report on achievements in fiscal 1999 on research and development of human media under the industrial and scientific technology research and development institution. Research and development of a high-level petroleum plant information system technology; 1999 nendo human media no kenkyu kaighatsu seika hokokusho. Sekiyu plant kodo johoka system gijutsu kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    This paper describes the achievements in fiscal 1999 on development of a high-level petroleum plant information system technology as part of the research and development of human media. Structuring has been performed on a prototype system comprising two stages: the phase 1 system of the single-element concentration and control type and the phase 2 system of the multi-agent type for the original fusing purpose. Relative to the interface agent, development has been made on a function for fusing, voice interactive function was realized, and personifying agent function was operated on a trial basis. In addition, a database server for large-scale cases was developed. Coordination with other agents and interactive operation were realized by making autonomic the hypothetical plant display interface. Dynamic task sharing was realized by means of discrete coordination processing. A server and a message producing system were completed, by which the processing can be progressed in coordination by having multiple number of agents share the ontology and the object models based thereon. The definition display interface was mounted for the discretely coordinating environment. (NEDO)

  5. Creative Industries in Ukraine: Analysis and Prospects of the Development

    Directory of Open Access Journals (Sweden)

    Iryna V. Skavronska

    2017-06-01

    Full Text Available This paper provides a snapshot of the role and importance of the creative industries for the Ukrainian economy. The economic dimension of the creative sector in Ukraine is becoming of higher interest for policy-makers taking into account its increasing contribution to international trade and great potential for further development. Correspondingly, this research is aimed at determining the importance and efficiency of the creative industries for the Ukrainian economy. The methodology of the study is founded on exploring the impact of the creative sector on an economic milieu in Ukraine. The paper proposes a strategy how the creative industries can transform Ukraine into a creative economy. This approach identifies four primary targets, which may result in economic, social, creative and cultural benefits, including keeping and development the creative talent, encouragement of the Ukrainian creative businesses, promoting “culture of openness,” and shaping the creative ecosystem. This study provides a unique and vital contribution to ongoing discussions about the significance of the creative industries for national economies highlighting the universalized assumptions concerning the position of this sector in the Ukrainian economy.

  6. Industrial Innovation and Environmental Regulation: Developing ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    What role should governments play in protecting the environment and controlling the environmental impacts of industry? Do regulations benefit the environment, and how do they affect industrial innovation? Since the modern era of environmental management began in the early 1970s, regulations have been used with ...

  7. New Product Development in Traditional Industries: Decision-Making Revised

    Directory of Open Access Journals (Sweden)

    Jon Mikel Zabala-Iturriagagoitia

    2012-02-01

    Full Text Available This paper investigates whether decisions considered as common in new product development literature are also valid in a region characterized by traditional industries. The research is grounded on innovative companies in the Valencian Region (Spain. Using the statistical tool of factor analysis, we test if the groups of decisions identified by the literature can be confirmed in our empirical sample. Therewith, we aim to link the theoretical and empirical fields in the context of new product development and product innovation management.

  8. Alberta immigrant integration into the petroleum industry : final research report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2008-02-15

    Alberta is in the midst of a labour shortage, especially in the petroleum industry. Traditionally, the petroleum industry has secured employees by hiring them away from competitors, service providers, other geographic locations, or other industries, mostly by escalating worker compensation. However, this is no longer seen to be a sustainable solution due to higher industry costs and inflation. A good opportunity exists for Alberta's oil and gas industry to address worker demand and minimize the negative impacts associated with current and future labour concerns by increasing the participation of workers who are under-represented in the workforce, such as Aboriginals, women, and internationally trained workers. This report presented the details of a project called the Alberta immigrant integration into the petroleum industry project in order to determine the tools, resources and support processes needed by petroleum industry employers to increase the employment and retention of internationally trained workers already living in Alberta into the upstream petroleum industry. The report outlined the gaps in information, tools, resources and services that were preventing the petroleum industry from taking advantage of the skills and experience offered by Alberta's labour pool of internationally trained workers in any significant way. The report also presented an overview of strategic priorities and recommended activities, duly endorsed by stakeholders, in order to improve the recruitment and integration of internationally trained workers into the petroleum industry workforce. It was concluded that employers who develop the skills and capability to effectively recruit and integrate internationally trained workers into their workforce will have a clear advantage in the competition for skilled employees. 3 refs., 2 figs.

  9. Design of a technology centre: A Vehicle for Industrial Development ...

    African Journals Online (AJOL)

    This paper deals with the design of a Technology Centre to meet the needs of industries and enhance the industrial development activities in Ethiopia. The article addresses problems and constraints of industries in developing countries with regards to raw materials, skills, technology master plan, R&D, maintenance and ...

  10. Industrial development - consequences about the implantation of Brazilian Nuclear Program

    International Nuclear Information System (INIS)

    Syllus, C.

    1987-07-01

    The strategy to promote the growing industry participation in the Brazilian Nuclear Program, the difficulties, the measurements adopted for overcoming and the results obtained in terms of industrial development, are presented. (M.C.K.) [pt

  11. Development of industrial ion implantation technology

    International Nuclear Information System (INIS)

    Choi, Byung Hoh; Jung, Kee Suk; Kim, Wan; Song, Woo Sub; Hwang, Chul Kyoo

    1994-02-01

    We developed an ion implanter fitted for the treatment of 12 inch or larger wafers to make 256 or higher Mega D-Ram wafers. Design features are dual usage of gas/solid for the ion source loading, production of multi-balanced ions, and the possible oxygen ion implantation. BOSII program was used for the ion optics calculation. Beams are triangularly scanned to wafers for the even implantation by a proper magnetic field application. More than 10 mA ion current is produced. For the efficient implantation to be made, target is made to rotate with tilted angle at a displaced axis. High speed tools, diamond tools, precision dies, and razor blades were implanted and the performance was evaluated after two or three times of line application. Of those materials studied, PCB drills and end mills are on the commercial treatment stages. Industrial materials as SKD-11, WC-Co, NAK-55 was compositely treated with ion beam and coating. Resultant properties were analyzed using AES, XRD, and TEM. For the case of xenon ions, excellent TiN coating resulted and its application to microcircuit lead frame increased the performance to more than 30 percent. 94 figs, 29 pix, 19 tabs, 50 refs. (Author)

  12. Development of industrial ion implantation technology

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Byung Hoh; Jung, Kee Suk; Kim, Wan; Song, Woo Sub; Hwang, Chul Kyoo [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1994-02-01

    We developed an ion implanter fitted for the treatment of 12 inch or larger wafers to make 256 or higher Mega D-Ram wafers. Design features are dual usage of gas/solid for the ion source loading, production of multi-balanced ions, and the possible oxygen ion implantation. BOSII program was used for the ion optics calculation. Beams are triangularly scanned to wafers for the even implantation by a proper magnetic field application. More than 10 mA ion current is produced. For the efficient implantation to be made, target is made to rotate with tilted angle at a displaced axis. High speed tools, diamond tools, precision dies, and razor blades were implanted and the performance was evaluated after two or three times of line application. Of those materials studied, PCB drills and end mills are on the commercial treatment stages. Industrial materials as SKD-11, WC-Co, NAK-55 was compositely treated with ion beam and coating. Resultant properties were analyzed using AES, XRD, and TEM. For the case of xenon ions, excellent TiN coating resulted and its application to microcircuit lead frame increased the performance to more than 30 percent. 94 figs, 29 pix, 19 tabs, 50 refs. (Author).

  13. Fiscal 1998 achievement report on regional consortium research and development project. Venture business fostering regional consortium--Creation of key industries (Development of trace pollutant measuring device); 1998 nendo biryo kankyo busshitsu sokutei device no kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    For measuring trace pollutants and for establishing a simplified high-speed method of assessing their impacts, research and development efforts are exerted to build measuring devices to meet the purpose. In relation with air pollutants, researches are conducted to develop a passive sampler technology-aided measuring devices capable of on-site analyses of trace pollutants. For the development of microchips to be the nuclei of such devices, studies are conducted about a gas absorbing chip consisting of porous quartz glass and a passive sampler installed thereon, a chemical reaction chip on which absorbed NO{sub 2} ions react with a fluorescent reagent, and an optical detection chip capable of high-sensitivity detection of a fluorescent substance generated by an ultraviolet emission device. As the result, an A4 size prototype of a trace NO{sub 2} measuring device is developed using a fluorescence detecting microchip system. In addition, a simplified measuring device is developed, in which gas absorbed at a polymer film flows in a very thin plastic-formed channel to reach an electrochemical detection system for measurement, and the device is found to work effectively. (NEDO)

  14. Fiscal 1999 technical achievement report. Development project on international standards for developing new industry (Comprehensive research); 1999 nendo shinki sangyo shiengata kokusai hyojun kaihatsu jigyo seika hokokusho. Sogo chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Research and development of 13 individual subjects whose achievements are expected to come into use on the international scale was started in fiscal 1998, to be completed in three years. Progress is reviewed for each of the subjects, and the findings are mentioned below. Research and development is progressing smoothly, specifications to be internationalized have been narrowed down, and it is now foreseen that the main points of the specifications to be presented will be successfully prepared. There are some subjects, however, about which it is difficult to specify to which technical committees they are to be submitted. Assistance, for instance supply of information, by technical committees involved is indispensable. The attitude toward international standardization taken by European and American business corporations visited for study by Japanese researchers is to be disseminated to Japanese business corporations since the information thus collected will help them. Although 75% of the 13 subjects have reached a level where they may be presented as specifications for international standardization, yet they need active support by organizations concerned and research of trends of internationalization-related institutions before they are actually accepted as international standards. (NEDO)

  15. Research, development, and evaluation of basic technologies for next-generation industries. Technologies of mass culture of cells; Jisedai sangyo kiban gijutsu kenkyu kaihatsu hyoka. Saibo tairyo baiyo gijutsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    The project aims to establish basic technologies for the mass culture of cells by utilizing the features of animal cells, which will enable a large, stable supply of fine chemicals such as highly functional physiologically active proteins whose industrial production the conventional technique of synthesis fails to realize. For this purpose, efforts are exerted to select cells which are capable of producing target substances, to breed highly productive strains, to develop a serumless medium that satisfies demands for an all-purpose feature and heat sterilization, and to develop technologies of high-density culture and effective refining, etc. Some DNA (deoxyribonucleic acid) recombination technologies are also resorted to. As the result, a high-density culture of 2 times 10{sup 8} cells/ml has become available. Production is now feasible of various differentiation-inducing elements such as monoclonal antibodies with anti-HB virus activity, DIF, etc. Furthermore, cooperation with the Tsukuba University leads to the discovery of a novel vasopressor peptide (endothelin). The heat sterilization accepting serumless medium, which is put to practical use as the first of the kind in the world under this research and development project, contributes to the advancement of basic studies about cell biology. (NEDO)

  16. Achievement report for fiscal 1998 on research and development of industrial science technologies. Research and development on synergy ceramics (research and development of ultra-high temperature gas turbines for electric power generation); 1998 nendo shinaji ceramics no kenkyu kaihatsu. Hatsuden'yo koon gas turbine no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    This paper describes development of synergy ceramics. In developing a technology to design property fusion processes, studies were made on control of nano-structures by using a high-order nano-structure process, and on evaluation of micro region properties. Such nanocomposite bodies were selected for the object as piezoelectric ceramics PZT group (which increases mechanical characteristics and durability without impeding electric characteristics) and alumina-group YAG (which enhances high-temperature strength). Three-dimensional analyses were performed on particle morphology and crack structures by using focusing ion beams as a study on destruction behavior by means of microscopic and macroscopic particle morphology control. This paper reports the achievements of research and development on control of continuous small pore morphology (uni-directionally pierced pores on a new-type low expansion material used as matrix), intra-particle interface (discusses methods to micronize silicon nitride ceramics tissues), intra-layer interface (oxide-based ceramics are laminated on surface to improve oxidation and heat resistance without impeding high-temperature mechanical properties of non-oxide-based ceramics), intra-layer boundary (Pb-based double composition piezoelectric body having stable layer interface), and boundaries between inorganic and organic matters. (NEDO)

  17. Logistics research report : Framework in the healthcare industry

    NARCIS (Netherlands)

    Willems, A.; Hajdasinski, A.K.; Willems, J.

    2009-01-01

    The research report takes the perspective of Information Logistics and investigates relating concepts like Knowledge Management, Information Systems and Context Awareness in the context of the healthcare industry. The aim of Information Logistics is to deliver the right information product, in the

  18. Specific features of occupational medicine in nuclear research and industry

    International Nuclear Information System (INIS)

    Giraud, J.M.; Quesne, B.

    2003-01-01

    Measures to prevent the exposure of personnel to ionising radiation were taken as soon as the first nuclear laboratories were set up. This branch of occupational preventive medicine has since kept pace with advances in research and in the industrial applications of nuclear energy. (authors)

  19. Development of uranium industry in Romania

    International Nuclear Information System (INIS)

    Iuhas, Tiberiu

    2000-01-01

    The management of the uranium resources is performed in Romania by the National Uranium Company. The tasks to be done are: 1. management and protection of rare and radioactive metal ores in the exploitation areas; 2. mining, preparation, refining and trading the radioactive ores, as well as reprocessing the uranium stock from the uranium concentrate in the national reserve; 3. performing geologic and technologic studies in the exploitation areas; 4. performing studies and projects concerning the maintenance of the present facilities and unearthing new ores; 5. building industrial facilities; 6. carrying out technological transport; 7. importation-exportation operations; 8. performing micro-production activity in experimental research units; 9. personnel training; 10. medical assistance for the personnel; 11. environment protection. The company is organized as follows: 1.three branches for uranium ore mining, located at Suceava, Bihor and Banat; 2. one branch for geologic survey, located at Magurele; 3. one branch for uranium ore preparation and concentration and for refining uranium concentrates, located at Feldioara; 4. One group for mine conservation, closure and ecology, located at Bucuresti. The final product, sintered powder of UO 2 produced at Feldioara plant, was tested in 1994 by the Canadian partner and met successfully the required standards. The Feldioara plant was certified as supplier of raw material for CANDU nuclear fuel production and as such, Romania is the only authorized producer of CANDU nuclear fuel in Europe and the second in the world, after Canada. Maintaining the uranium production in Romania is justified by the existence of uranium ore resources, the declining of natural gas resources, lower costs per kWh for electric nuclear power as compared to fossil-fuel power production, the possibility for Romania to become an important supplier of CANDU nuclear fuel, the low environmental impact and high costs for total shutdown of activity, high

  20. Report on research achievement in relation with developing fundamental combustion control technologies in fiscal 1998. Research and development of high-performance industrial furnaces; 1998 nendo nensho seigyo kiban gijutsu no kaihatsu ni kansuru kenkyu seika hokokusho. Koseino kogyoro nado ni kansuru kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    Development is intended to be made on fundamental combustion control technologies applicable to high-performance industrial furnaces that can reduce energy consumption and respond to environment preservation requirements. With an intention to achieve reduction in combustion exhaust gases such as carbon dioxide and nitrogen oxides, fundamental studies will be made on factors to decide flame shapes as represented by high-temperature combustion and flame shape control by utilizing microgravity environment, and researches will be made on combustion systems. Devices required for the experiments were fabricated to evaluate critical combustion characteristics of flames in furnaces including industrial furnaces, analyze and evaluate flame control parameters, and study low-pollution combustion technologies. Experimental methods acquired by 1997 were used for the experiments under the microgravity environment. Evaluation experiments were performed on flame shape control technologies and flame radiation characteristics, and basic experiments on the low-pollution combustion technologies. With these experiments, elucidation of the combustion mechanisms was launched by analyzing and evaluating the acquired data. A flame experimenting device for high-temperature preheated air completed by fiscal 1997 was used to acquire such combustion characteristics data as NOx discharge characteristics when the high-temperature preheated air is used. Based on the result thereof, verification was carried out on simulation models. (NEDO)

  1. Fiscal 1991 research report. Research trend survey for next-generation industrial structure technology research and development project - Research and development of advanced materials for extreme environments; 1991 nendo jisedai sangyo kiban gijutsu kenkyu kaihatsu project ni kakawaru kenkyu doko chosa hokokusho. Chotaikankyosei senshin zairyo no kenkyu kaihatsu (sekitoku daiene)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1992-03-01

    Efforts were exerted to develop intermetallic compounds and C/C (carbon/carbon) composites to serve as advanced materials for extreme environments. In relation with advanced materials, especially with intermetallic compounds and fiber reinforced intermetallic compound composite materials, a technical research survey was conducted covering the three fields of (1) summarization of activities conducted up to fiscal 1991, (2) contents of associated aerospace projects, and (3) aeroengine components. In Field (1), the ground on which the project was created and the project's basic plans, goals, and systems, and its ripple effects are discussed, and the fruits produced so far are summarized. In Field (2), aeroengine component related projects of America, Britain, France, Germany, and Japan are investigated. In Field (3), aluminum alloys, titanium alloys, alloy steel, superalloys, intermetallic compounds, and intermetallic compound composite materials are discussed with attention paid to their current status and future trend, characteristics they are supposed to finally assume, and technical tasks to discharge for the development of technologies concerned. (NEDO)

  2. THE DEVELOPMENT STRATEGIES OF CASHEW INDUSTRY IN KENDARI CITY, SOUTHEAST SULAWESI

    Directory of Open Access Journals (Sweden)

    Asriani Asriani

    2015-09-01

    Full Text Available The economic development of a region should refer to the agroindustry approach. An industry is not well developed due to the constraints of internal and external factors. This research aimed to identify the internal and external factors which could affect the development of cashew industry and determine the most effective alternative strategies applied in developing the cashew industry in Kendari Southeast Sulawesi Province. The data analysis technique used  Strength, Weakness, Opportuny and Threat (SWOT methods. The results showed that the internal factors that most influenced the development of the cashew industry were availability of adequate labor and limited capital investment funds while the external factors that influence the development included the government support and limited access to markets. The alternative strategies of the cashew industry development in Kendari Southeast Sulawesi Province  include improving the marketing, maintaining the product quality and increasing the working capital.Keyword: development, strategy, cashew industry, SWOT

  3. Shiraz Medical Tourism Industry: Development Strategies

    OpenAIRE

    Mohammad Kazem RahimiZarchi; Tahereh Shafaghat; Nahid Hatam

    2017-01-01

    Background: Medical tourism industry with global revenue of around 20 billion dollars in 2005 is one of the largest industries in the world. Absorbing a percentage of this amount can have a significant impact on medical tourism economy of Asian countries, including Iran. The aim of this study was to provide solutions for attracting medical tourists in Shiraz. Methods: This qualitative study was carried out on health care management specialists, hospital administrators, statistics and medic...

  4. Research and development project for a large-scale industrial technology in fiscal 1992. Research and development of an advanced function creating and processing technology /Development of an advanced function creating and processing technology (Report on work achievements); 1992 nend senshin kino soshutsu kako gijutsu no kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-01-01

    A joint research has been performed between the Material Engineering Technology Research Institute of the National Institute of Materials and Chemical Research of the Ministry of International Trade and Industry and the Advanced Function Creating and Processing Technology Research Association. The research themes are the 'identification of the basic conditions for production of ultra fine ceramics particles by using the hybrid high-frequency plasma process' and the 'establishment of non-destructive analysis technology for inclination functional materials'. This paper reports the achievements in fiscal 1992. The research on the inclination functional materials has performed hybridization of high-frequency plasmas and fabrication of ultra fine alumina particles, trial fabrication and evaluation on alumina-titanium mixed ultra fine particles by using the high-frequency plasma process, spraying of hydroxyapatite by using high-frequency plasma, evaluation on thick film bulk made of ultra fine particles, and trial fabrication of an ultra fine particle injection device. It was intended to evaluate quantitatively crystalline deficiency and composition distribution in the inclination functional materials for which continuous composition control is important. Therefore, a Rutherford wake scattering device was introduced and installed newly at the Material Engineering Technology Research Institute, which has improved the evaluation and experiment system at the institute. (NEDO)

  5. A primer on industrial ecosystems : a strategy for sustainable industrial development

    Energy Technology Data Exchange (ETDEWEB)

    Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies

    2003-07-01

    Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.

  6. A Study of Factor Affecting the Software Application Development in Indonesian Creative Industry

    Directory of Open Access Journals (Sweden)

    Adhi Nugroho Chandra

    2015-06-01

    Full Text Available The creative industries promising opportunities, especially the interactive game business. creative industries is still undeveloped, but lately has been showing its contribution to the economic development of Indonesia. Implementation of the Information and Communication Technology (ICT strategy is a new discourse that can provide great opportunities for the entrepreneurial. This study aims to reveal the level of implementation of ICT strategies, the role of government influence on the development of business, industry conditions as well as the existing value chain in the interactive games industry. Type of research conducted by descriptive research, qualitative analysis was based on the findings of desk research / literature, interviewsources, and the researcher's own knowledge. Level of subjectivity can be minimized with the help of quantitative analysis and the selection of competent resource persons in the field interviews. Secondary dataobtained from the creative economy planning books in 2025, which was published by the Ministry of Commerce of the Republic of Indonesia. Based on the research results, it is concluded that the implementation of ICTstrategies by entrepreneurs in the interactive games industry is still less, and this is partly because in general the industry is still small-scale and micro enterprises, mash the industry is relatively new in the world of business,and entrepreneurs are still concentrating the creation, production, and distributio, commercialization are being developed. In general, interactive games industry is growing. In the future, need to research business model and business strategy, so it would complement the models developing strategy in the game interactive industry.

  7. Atoms in Industry: Rays of hope for development

    International Nuclear Information System (INIS)

    Viegas, Luciana

    2015-01-01

    What are the uses of radiation technology, and what benefits does it bring to our lives? The public has little awareness of how widespread the use of nuclear techniques is beyond the generation of power and cancer therapy. This year’s Scientific Forum, to be held on 14 and 15 September 2015 on the margins of the 59th IAEA General Conference, will showcase how radiation technologies are used in a broad range of industries. Entitled ‘Atoms in Industry — Radiation Technology for Development’ and bringing together experts, industry leaders and researchers, the Forum will examine best industry practices from around the globe and serve as a platform to exchange ideas on how these technologies can be applied to propel development efforts. “Helping countries to benefit from the peaceful use of nuclear technology is a central area of the IAEA’s work. Our assistance covers areas including human and animal health, food security, water management, electricity generation, and environmental protection — to name just a few,” said IAEA Director General Yukiya Amano. In 2014, over 130 countries received support through the IAEA’s technical cooperation programme, and while nuclear technology is often equated with nuclear power in the eyes of the general public, 80% of IAEA Member States are in fact non-nuclear power countries.

  8. Fiscal 1998 achievement report on regional consortium research and development project. Venture business fostering regional consortium--Creation of key industries (Research and development of next-generation die manufacturing process); 1998 nendo jisedai kanagata seizo process ni kansuru kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Utilizing element technologies provided by Iwate University, Tohoku University, and Iwate Industrial Research Institute concerning the manufacture of dies, studies are conducted about designing techniques, ultrahigh-precision machining technology, anti-corrosion technology, molding releasing lubricants, dies, and the systematization of the process of manufacturing press-formed plastic compacts. In the development of technology of simulating coagulation in a molding die, a comparison is made between the result of a software-aided analysis and experimentally manufactured compacts in terms of tendency toward deformation, and a technique for reducing the amount of deformation is proposed. In the high-precision truing of grinding stones, the tip radius of the wheel can be 20{mu}m, and this suggests possible commercialization. In relation to direct cutting by an end mill, an experiment is conducted by means of CAD (computer-aided design)/CAM (computer-aided manufacture)-aided manufacture, and a comparison is made between 2.5-dimensional CAD/CAM and 3-dimensional CAD/CAM. It is then found that they are both effective. In the research and development of anti-corrosion technology for dies, it is made clear that the corrosion of real discharge-aided cutting-wire machine tools results from a trace of sulphate ions present in the working fluid. (NEDO)

  9. Achievement report on commissioned research and development of basic technologies for the next generation industries in fiscal 1982. Research and development of a recombinant DNA utilizing technology; 1982 nendo jisedai sangyo kiban gijutsu itaku kenkyu kaihatsu seika hokokusho. Kumikae DNA riyo gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1983-03-01

    Achievements were compiled on the research and development in fiscal 1982 on the 'recombinant DNA utilizing technology', which has been performed according to the 'institution for research and development of basic technologies for the next generation industries'. With regard to refined cytochrome P-450 molecular species, a material was obtained that has further higher specific content than those having been discovered in fiscal 1981. Refinement was carried out on antibodies against P-450 and NADPH-cytochrome P-450 reduction enzyme to raise the antibody values. Identification was made on the refined cytochrome P-450 molecular species. The P-450 in the mRNA products prepared in fiscal 1981 was quantified successfully by means of the immuno sedimentation process using protein A-sepharose. In fabrication of cytochrome P-450cDNA, detailed discussions were given on the cDNA fabrication and reaction conditions, where double-chain cDNA was obtained. In refining the enzymatic cytochrome P-450, discussions on culture conditions of the enzyme discovered a condition in which the P-450 content increases. (NEDO)

  10. Achievement report on commissioned research and development of basic technologies for the next generation industries in fiscal 1982. Research and development of a recombinant DNA utilizing technology; 1982 nendo jisedai sangyo kiban gijutsu itaku kenkyu kaihatsu seika hokokusho. Kumikae DNA riyo gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1983-03-01

    Achievements were compiled on the research and development in fiscal 1982 on the 'recombinant DNA utilizing technology', which has been performed according to the 'institution for research and development of basic technologies for the next generation industries'. With regard to refined cytochrome P-450 molecular species, a material was obtained that has further higher specific content than those having been discovered in fiscal 1981. Refinement was carried out on antibodies against P-450 and NADPH-cytochrome P-450 reduction enzyme to raise the antibody values. Identification was made on the refined cytochrome P-450 molecular species. The P-450 in the mRNA products prepared in fiscal 1981 was quantified successfully by means of the immuno sedimentation process using protein A-sepharose. In fabrication of cytochrome P-450cDNA, detailed discussions were given on the cDNA fabrication and reaction conditions, where double-chain cDNA was obtained. In refining the enzymatic cytochrome P-450, discussions on culture conditions of the enzyme discovered a condition in which the P-450 content increases. (NEDO)

  11. Research activities of Samsung Heavy Industries in the conservation of the environment

    International Nuclear Information System (INIS)

    Han, B.; Kim, D.K.; Pikaev, A.K.

    1998-01-01

    Research activities for accelerator fields at Samsung Heavy Industries could be categorized into the accelerator development and its industrial applications. As the initial step of the efforts, high voltage industrial electron accelerators are developed, and development of synchrotron light source and other accelerators are also investigated. The research activities for the applications of accelerator include wastewater treatment, combustion flue gas purification, semiconductor treatment, and other radio-chemical processing. For wastewater treatment, an electron beam pilot plant for treating 1,000m 3 /day of wastewater from 60,000m 3 /day of total dyeing wastewater is under construction in Taegu Dyeing Industrial Complex. A commercial plant for re-circulation of wastewater from papermill company is also under construction in S-paper Co. in Cheongwon city, and after the successful installation, up to 80% of wastewater could be re-used in paper producing process

  12. Fiscal 1996 research report. Basic research on energy consumption efficiency improvement for developing countries (Industry related survey for energy analysis); 1996 nendo hatten tojokoku energy shohi koritsuka kiso chosa jigyo hokokusho. Energy bunsekiyo sangyo renkan chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-05-01

    Inter-industry relations tables and energy statistics are combined for Asian countries for the preparation of energy analysis oriented inter-industry relations tables, which are used to metrically analyze Aisan nations' industrial structures and energy consumption structures for the ultimate purpose of grasping the magnitude of each industry's demand for energy. The tables prepared this year cover Korea, Indonesia, Thailand, and the Philippines. In Korea, the self-sufficiency rate of mineral fuels is low at 23.1%, which is due to its import of crude oil from abroad. It consumes 177.92-million tons (in terms of oil) of energy for its economic activities, with energy saving measures expected to work effectively here. Indonesia's mineral fuel self-sufficiency rate is high at 84.3% because it is an oil producing country. The energy it consumes for its economic activities is 179.37-million tons (in terms of oil), and energy saving measures will work effectively here. Thailand is a crude oil importing country. Its mineral fuel self-sufficiency rate is 33.4% and the energy its economic activities consume is 53.08-million tons (in terms of oil), and energy saving measures will work effectively in this country. The Philippines is a crude oil importing country and its mineral fuel self-sufficiency rate is as low as 4.8%. It consumes 22.71-million tons of energy (in terms of oil) for its economic activities, and energy-saving measures are expected to take effect here. (NEDO)

  13. Research and development of utilization technology of solar thermal energy system for industrial and other use. International joint technology development for solar energy utilization systems; Sangyoyo nado solar system jitsuyoka gijutsu kaihatsu. Taiyo energy riyo system kokusai kyodo gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Takita, M [New Energy and Industrial Technology Development Organization, Tokyo (Japan)

    1994-12-01

    Described herein are the results of the FY1994 research program for international joint technology development for solar energy utilization systems. The joint study with an Indonesian research institute takes a model of lumber drying plant for the design and feasibility study. All the parts it needs are technically available in Indonesia, except carbon fiber sheets and electronic devices for controlling purposes. The drying cost is higher than that of a plant which procures charge-free wood fuel, but lower than that of a plant which procures fuel at 30$/t. A cacao drying plant model is also studied. The feasibility study shows that the initial investment for the blowing-up model is much higher by 60% to 100% than that for the conventional plant. Its fuel cost is lower by 11% than that of residual oil but 27% higher than that of wood. 4 figs.

  14. Relationship Marketing Stage of Development in Romanian Banking Industry

    Directory of Open Access Journals (Sweden)

    Alina Filip

    2016-02-01

    Full Text Available The paper emphasizes the relationship marketing stage of development within the banking industry in Romania, by identifying the extent to which business objectives and marketing strategies of companies are customer oriented. In order to achieve this aim a qualitative marketing research was conducted, by applying in-depth semi-structured interviews. The target group of the research consisted of nine banking companies, selected according to the market share, while the research participants were employees responsible for marketing, sales and customer relationship management activities. Due to respondents’ expertise, during the interviews could be applied mixed research methods in the process of data collection and subsequently, in data analysis. According to research objectives and results, although there is an increase in the importance of customer orientation within banking policies, the integration of relationship marketing optics at the institutional management level is facing a number of deficiencies, especially with regard to the concerns about employees’ satisfaction and loyalty or to the development of relationships with other stakeholders. The degree of satisfaction with the adoption of customer relationship management technology is relatively high among banks, being appreciated mainly those banking performance achieved in terms of retention rate, cross-selling and customer satisfaction. Most banks use the gross customer retention index as the main indicator of customer portfolio stability, although retention objectives tend to be set differently depending on customer value. Internal marketing strategies are developed around staff training processes, while performance evaluation criteria are rather specific to a transactional marketing approach. Results of the research provide clues on the relationship marketing processes and activities that need to be improved, in order to strengthen the current customer base and the competitive

  15. Government and industry roles in heavy oil resource development

    International Nuclear Information System (INIS)

    Sharp, D.A.

    1994-01-01

    Developing a heavy oil deposit in Canada requires proper reservoir selection and ongoing resrvoir management. The number of unexploited heavy oil reservoirs whch can be economically produced through primary methods is rapidly declining. In addition, primary recoveries of 5-10% of the heavy oil in place are unacceptable and recovery rates of over 50% are needed. Enhanced thermal recovery projects are therefore needed, but these entail significant technical and commodity pricing risks. It is suggested that provincial governments recognize those risks and offer incentives by not encumbering such projects with up-front royalties. If industry is to assume the risks, governments must develop a fiscal regime that allows for a satisfactory return on capital and acceptable sharing of profits. At the federal level, it is suggested to broaden the interpretation of research and development activity to include enhanced recovery projects, making the tax breaks available to scientific research also available to heavy oil development. Government policies favoring heavy oil in Saskatchewan and Alberta are cited as good examples of ways to encourage the heavy oil industry

  16. Rational Thoughts on the Development of Chinese Auto Industry

    Institute of Scientific and Technical Information of China (English)

    Shao Qihui

    2004-01-01

    @@ In order to keep the steady, fast and sustainable development of auto industry, we should have an overall knowledge of the history and current situation of the world auto industry, and have a correct strategic planning and scientific measures towards the Chinese auto industry.

  17. Nanoscience and nanotechnologies in food industries: opportunities and research trends

    Science.gov (United States)

    Ranjan, Shivendu; Dasgupta, Nandita; Chakraborty, Arkadyuti Roy; Melvin Samuel, S.; Ramalingam, Chidambaram; Shanker, Rishi; Kumar, Ashutosh

    2014-06-01

    Nanomaterials have gained importance in various fields of science, technology, medicine, colloid technologies, diagnostics, drug delivery, personal care applications and others due to their small size and unique physico-chemical characteristic. Apart from above mentioned area, it is also extensively being used in food sector specifically in preservation and packaging. The future applications in food can also be extended to improve the shelf life, food quality, safety, fortification and biosensors for contaminated or spoiled food or food packaging. Different types and shapes of nanomaterials are being employed depending upon the need and nature of the food. Characterisation of these nanomaterials is essential to understand the interaction with the food matrix and also with biological compartment. This review is focused on application of nanotechnology in food industries. It also gives insight on commercial products in market with usage of nanomaterials, current research and future aspects in these areas. Currently, they are being incorporated into commercial products at a faster rate than the development of knowledge and regulations to mitigate potential health and environmental impacts associated with their manufacturing, application and disposal. As nanomaterials are finding new application every day, care should be taken about their potential toxic effects.

  18. Research on development trend of key areas of equipment manufacturing industry at home and abroad%国内外装备制造业重点领域发展趋势研究

    Institute of Scientific and Technical Information of China (English)

    孟卫东; 司林波

    2015-01-01

    The overall developments of equipment manufacturing industry was reviewed firstly in the world′s major economies, and then an detailed analysis on the key industry areas of the equipment manufacturing industry was given, which include CNC machine tools, industrial robots, construction machinery, new energy vehicles, advanced communication equipment, 3D printing equipment, etc.It can be found that the development of world equipment manufacturing industry has appeared two characteristics:one is the development of industry appears two-way transfer situation, the other is the key technology will affect the future development and the competitive landscape of each country. Intelligent, high-end, energy saving and service has become a trend of the development of equipment manufacturing industry. In order to achieve the revitalization and development of China′s equipment manufacturing industry, the two drive elements of policies and technological innovation are proposed, to accelerate the transformation and upgrading of industry structure, and enhance the capability of independent innovation.%首先对世界主要经济体在装备制造业领域的总体发展动态进行了综述,在此基础上选取数控机床、工业机器人、工程机械、新能源汽车、先进通信设备、3D打印设备等装备制造业的重点行业领域进行详细分析,可以发现世界装备制造业产业双向转移态势显现,关键技术将影响各国装备制造业的未来发展和竞争格局,智能化、高端化、节能化和服务化已成为世界装备制造业的发展趋势. 中国装备制造业的振兴发展,必须充分借助产业政策和技术创新两个驱动要素的互动牵引作用,加速推进产业结构转型升级和自主创新能力提升.

  19. Achievement report on industrial science and technology research and development in fiscal 2000. Research and development of synergy ceramics (Research and development of technology to prevent corrosion in petroleum production systems); 2000 nendo sangyo kagaku gijutsu kenkyu kaihatsu seika hokokusho. Synergy ceramics no kenkyu kaihatsu (sekiyu seisan system fushoku boshi gijutsu kenkyu kaihatsu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    Achievements in fiscal 2000 were put into order for research and development of synergy ceramics aimed at completion of high temperature energy materials and ultra-precision materials. Activities were taken in the following four areas: 1) materialization technologies and advanced assessment and design technologies, 2) application technologies, 3) common basic technologies, and 4) assessment on composite function manifestation process. In Item 1), discussions were given on ultra-precision materials, high temperature energy materials, member designing basic technologies, materials to detect stress and microfine destruction, pore pattern controlling porous materials, and self-restoration and self-lubrication functioning materials. In Item 2), discussions were given on material and light selection functioning materials, high abrasion resistant and easy-to-process materials, high performance resistance materials for electric power devices, and flexible sliding materials. In the material and light selection functioning materials, their material selecting function was manifested by controlling micro pores through xerogelation on inorganic and organic hybrids. In the assessment of the composite function manifesting process, the wet type forming process was assessed, that uses microfine powder for model parts assuming cut members. (NEDO)

  20. Report on achievements in fiscal 1998 on research and development of the genome infomatics technology in the industrial and scientific technology research and development project. Research and development of the genome infomatics technology; 1998 nendo genome infomatics gijutsu kenkyu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    This paper describes the achievements in fiscal 1998 on research and development of the genome infomatics technology. First, plasmid DNA was prepared that becomes a mold for sequence reaction; primers were prepared based on the base sequence of terminal groups, which were used to perform the sequence reaction for the next step; and determination was made on the base sequence following the terminal sequence that has been determined previously. This primer walking process was repeated, whereas the obtained data for each base sequence piece were unified to have determined the base sequence in the complete-length cDNA300 clone. The complete-length cDNA853 for homo-sapiens was analyzed by using the primer walking process. The Sanger's sequencing method was used for the reaction. The resultant sequence data was verified to be of a complete-length cDNA containing the actual protein codon from the N terminal to the C terminal. A cDNA database was newly structured. The complete-length cDNA can be retrieved by using as the retrieval condition each organ originating the sequence, the manifestation frequency therein, and the keyword representing the function. (NEDO)