WorldWideScience

Sample records for individual dna molecules

  1. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  2. DNA-psoralen interaction: a single molecule experiment.

    Science.gov (United States)

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  3. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  4. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  5. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  6. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    Science.gov (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  7. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  8. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  9. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  10. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    OpenAIRE

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

  11. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  12. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    Science.gov (United States)

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  13. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  14. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

    2009-01-01

    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  15. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  16. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  17. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  18. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

    Science.gov (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  19. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  20. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  2. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  3. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  4. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  5. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  6. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  7. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  8. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  9. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  10. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  11. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  12. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  13. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  14. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel

    1980-01-01

    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  15. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  16. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

    2014-01-01

    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  17. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  19. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  20. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  1. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    Science.gov (United States)

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

    2003-01-01

    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  3. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  4. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  5. How to read and write mechanical information in DNA molecules

    Science.gov (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  6. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

    2009-01-01

    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  7. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  8. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  9. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    Science.gov (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  10. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

    Science.gov (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M

    2017-12-01

    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  11. Studying DNA looping by single-molecule FRET.

    Science.gov (United States)

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  12. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  13. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  14. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  15. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

    2009-01-01

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  16. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

    2009-01-21

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  17. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  18. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  19. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  20. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

    2011-01-01

    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  1. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  2. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  3. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  4. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  5. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  6. Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

    Science.gov (United States)

    Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

    2012-03-14

    We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

  7. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van

    2014-01-01

    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  8. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  9. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  10. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  11. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  12. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  13. Detection of Individual Molecules and Ions by Carbon Nanotube-Based Differential Resistive Pulse Sensor.

    Science.gov (United States)

    Peng, Ran; Tang, Xiaowu Shirley; Li, Dongqing

    2018-04-01

    This paper presents a new method of sensing single molecules and cations by a carbon nanotube (CNT)-based differential resistive pulse sensing (RPS) technique on a nanofluidic chip. A mathematical model for multichannel RPS systems is developed to evaluate the CNT-based RPS signals. Individual cations, rhodamine B dye molecules, and ssDNAs are detected successfully with high resolution and high signal-to-noise ratio. Differentiating ssDNAs with 15 and 30 nucleotides are achieved. The experimental results also show that translocation of negatively charged ssDNAs through a CNT decreases the electrical resistance of the CNT channel, while translocation of positively charged cations and rhodamine B molecules increases the electrical resistance of the CNT. The CNT-based nanofluidic device developed in this work provides a new avenue for single-molecule/ion detection and offers a potential strategy for DNA sequencing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  15. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  16. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

    Science.gov (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  17. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  19. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  20. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    Science.gov (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  2. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    Science.gov (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  3. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    Science.gov (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  4. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

    OpenAIRE

    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

    2018-01-01

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  5. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    Science.gov (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  6. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  7. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park

    2010-11-01

    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  8. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  9. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  10. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

    2010-01-01

    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  11. Application of DNA fingerprints for cell-line individualization.

    OpenAIRE

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-01-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

  12. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  14. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  15. Application of DNA fingerprints for cell-line individualization.

    Science.gov (United States)

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-09-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.

  16. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  17. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    Science.gov (United States)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  18. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  19. A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

    NARCIS (Netherlands)

    Moayed, F.; Mashaghi, A.; Tans, S.J.

    2013-01-01

    Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

  20. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

    2015-12-01

    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  1. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

    2012-01-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  2. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C

    2011-01-01

    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  3. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.

    2016-01-01

    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  4. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  5. Watching individual molecules flex within lipid membranes using SERS

    Science.gov (United States)

    Taylor, Richard W.; Benz, Felix; Sigle, Daniel O.; Bowman, Richard W.; Bao, Peng; Roth, Johannes S.; Heath, George R.; Evans, Stephen D.; Baumberg, Jeremy J.

    2014-08-01

    Interrogating individual molecules within bio-membranes is key to deepening our understanding of biological processes essential for life. Using Raman spectroscopy to map molecular vibrations is ideal to non-destructively `fingerprint' biomolecules for dynamic information on their molecular structure, composition and conformation. Such tag-free tracking of molecules within lipid bio-membranes can directly connect structure and function. In this paper, stable co-assembly with gold nano-components in a `nanoparticle-on-mirror' geometry strongly enhances the local optical field and reduces the volume probed to a few nm3, enabling repeated measurements for many tens of minutes on the same molecules. The intense gap plasmons are assembled around model bio-membranes providing molecular identification of the diffusing lipids. Our experiments clearly evidence measurement of individual lipids flexing through telltale rapid correlated vibrational shifts and intensity fluctuations in the Raman spectrum. These track molecules that undergo bending and conformational changes within the probe volume, through their interactions with the environment. This technique allows for in situ high-speed single-molecule investigations of the molecules embedded within lipid bio-membranes. It thus offers a new way to investigate the hidden dynamics of cell membranes important to a myriad of life processes.

  6. Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Science.gov (United States)

    Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

    2016-01-01

    Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

  7. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  8. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  9. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav

    2001-01-01

    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  10. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

    2012-01-01

    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  11. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  12. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

    2016-01-01

    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  13. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  14. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

    1979-01-01

    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  15. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    Science.gov (United States)

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  16. Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

    International Nuclear Information System (INIS)

    Yamamoto, Takatoki; Fujii, Teruo

    2010-01-01

    Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

  17. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

    Science.gov (United States)

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

    2014-01-01

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  18. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    Science.gov (United States)

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  19. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  20. Detection of DNA hybridizations using solid-state nanopores

    International Nuclear Information System (INIS)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng

    2010-01-01

    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  1. Detection of DNA hybridizations using solid-state nanopores

    Energy Technology Data Exchange (ETDEWEB)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)

    2010-08-20

    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  2. A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

    Directory of Open Access Journals (Sweden)

    Fatemeh Moayed

    Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

  3. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  4. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    Science.gov (United States)

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

  5. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  6. Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

    International Nuclear Information System (INIS)

    Pham, Quang Trung

    2014-01-01

    The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

  7. Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

    Science.gov (United States)

    Paximadis, M; Rey, M E

    2001-12-01

    The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

  8. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  9. Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

    Science.gov (United States)

    Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

    2014-10-21

    Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

  10. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  12. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  13. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

    2008-01-01

    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  14. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  15. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  16. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

    Science.gov (United States)

    Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

    2007-12-15

    The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

  17. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.

    1980-01-01

    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  18. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NARCIS (Netherlands)

    Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

    2016-01-01

    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

  19. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

    Directory of Open Access Journals (Sweden)

    Mengyi Yang

    2018-01-01

    Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

  20. DNA adsorption characteristics of hollow spherule allophane nano-particles

    International Nuclear Information System (INIS)

    Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; John, Baiju; Okamoto, Masami; Hayashi, Hidetomo

    2013-01-01

    To understand the propensity of natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against natural allophane (AK70), using single-stranded DNA (ss-DNA) and adenosine 5′-monophosphate (5′-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5′-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al–OH groups on the wall perforations through deprotonating, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the clustered allophane particle were observed successfully through transmission electron microscopy analysis. - Highlights: • The interaction between phosphate groups of ss-DNA and Al–OH groups • Higher energy barrier for the adsorption of ss-DNA • The individual ss-DNA with mono-layer coverage of the allophane clustered particle

  1. Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

    Science.gov (United States)

    Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

    2017-11-01

    The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer

    2017-09-14

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  3. A general approach to break the concentration barrier in single-molecule imaging

    KAUST Repository

    Loveland, Anna B.

    2012-09-09

    Single-molecule fluorescence imaging is often incompatible with physiological protein concentrations, as fluorescence background overwhelms an individual molecule\\'s signal. We solve this problem with a new imaging approach called PhADE (PhotoActivation, Diffusion and Excitation). A protein of interest is fused to a photoactivatable protein (mKikGR) and introduced to its surface-immobilized substrate. After photoactivation of mKikGR near the surface, rapid diffusion of the unbound mKikGR fusion out of the detection volume eliminates background fluorescence, whereupon the bound molecules are imaged. We labeled the eukaryotic DNA replication protein flap endonuclease 1 with mKikGR and added it to replication-competent Xenopus laevis egg extracts. PhADE imaging of high concentrations of the fusion construct revealed its dynamics and micrometer-scale movements on individual, replicating DNA molecules. Because PhADE imaging is in principle compatible with any photoactivatable fluorophore, it should have broad applicability in revealing single-molecule dynamics and stoichiometry of macromolecular protein complexes at previously inaccessible fluorophore concentrations. © 2012 Nature America, Inc. All rights reserved.

  4. Circulating DNA as Potential Biomarker for Cancer Individualized Therapy

    Directory of Open Access Journals (Sweden)

    Shaorong Yu

    2013-09-01

    Full Text Available Cancer individualized therapy often requires for gene mutation analysis of tumor tissue. However, tumor tissue is not always available in clinical practice, particularly from patients with refractory and recurrence disease. Even if patients have sufficient tumor tissue for detection, as development of cancer, the gene status and drug sensitivity of tumor tissues could also change. Hence, screening mutations from primary tumor tissues becomes useless, it’s necessary to find a surrogate tumor tissue for individualized gene screening. Circulating DNA is digested rapidly from blood, which could provide real-time information of the released fragment and make the real-time detection possible. Therefore, it’s expected that circulating DNA could be a potential tumor biomarker for cancer individualized therapy. This review focuses on the biology and clinical utility of circulating DNA mainly on gene mutation detection. Besides, its current status and possible direction in this research area is summarized and discussed objectively.

  5. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

    Science.gov (United States)

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

    2017-08-04

    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

    Energy Technology Data Exchange (ETDEWEB)

    Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

  7. Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

    Science.gov (United States)

    Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

    2004-01-30

    A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

  8. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald

    2014-09-01

    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  9. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  10. Electrostatic force microscopy: imaging DNA and protein polarizations one by one

    International Nuclear Information System (INIS)

    Mikamo-Satoh, Eriko; Yamada, Fumihiko; Takagi, Akihiko; Matsumoto, Takuya; Kawai, Tomoji

    2009-01-01

    We present electrostatic force microscopy images of double-stranded DNA and transcription complex on an insulating mica substrate obtained with molecular resolution using a frequency-mode noncontact atomic force microscope. The electrostatic potential images show that both DNA and transcription complexes are polarized with an upward dipole moment. Potential differences of these molecules from the mica substrate enabled us to estimate dipole moments of isolated DNA and transcription complex in zero external field to be 0.027 D/base and 0.16 D/molecule, respectively. Scanning capacitance microscopy demonstrates characteristic contrast inversion between DNA and transcription complex images, indicating the difference in electric polarizability of these molecules. These findings indicate that the electrostatic properties of individual biological molecules can be imaged on an insulator substrate while retaining complex formation.

  11. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  12. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  13. Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

    Science.gov (United States)

    Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-01

    Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

  14. Dynamic translocation of ligand-complexed DNA through solid-state nanopores with optical tweezers

    International Nuclear Information System (INIS)

    Sischka, Andy; Spiering, Andre; Anselmetti, Dario; Khaksar, Maryam; Laxa, Miriam; Koenig, Janine; Dietz, Karl-Josef

    2010-01-01

    We investigated the threading and controlled translocation of individual lambda-DNA (λ-DNA) molecules through solid-state nanopores with piconewton force sensitivity, millisecond time resolution and picoampere ionic current sensitivity with a set-up combining quantitative 3D optical tweezers (OT) with electrophysiology. With our virtually interference-free OT set-up the binding of RecA and single peroxiredoxin protein molecules to λ-DNA was quantitatively investigated during dynamic translocation experiments where effective forces and respective ionic currents of the threaded DNA molecule through the nanopore were measured during inward and outward sliding. Membrane voltage-dependent experiments of reversible single protein/DNA translocation scans yield hysteresis-free, asymmetric single-molecule fingerprints in the measured force and conductance signals that can be attributed to the interplay of optical trap and electrostatic nanopore potentials. These experiments allow an exact localization of the bound protein along the DNA strand and open fascinating applications for label-free detection of DNA-binding ligands, where structural and positional binding phenomena can be investigated at a single-molecule level.

  15. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  16. Mitochondrial DNA (mtDNA haplogroups in 1526 unrelated individuals from 11 Departments of Colombia

    Directory of Open Access Journals (Sweden)

    Juan J. Yunis

    2013-01-01

    Full Text Available The frequencies of four mitochondrial Native American DNA haplogroups were determined in 1526 unrelated individuals from 11 Departments of Colombia and compared to the frequencies previously obtained for Amerindian and Afro-Colombian populations. Amerindian mtDNA haplogroups ranged from 74% to 97%. The lowest frequencies were found in Departments on the Caribbean coast and in the Pacific region, where the frequency of Afro-Colombians is higher, while the highest mtDNA Amerindian haplogroup frequencies were found in Departments that historically have a strong Amerindian heritage. Interestingly, all four mtDNA haplogroups were found in all Departments, in contrast to the complete absence of haplogroup D and high frequencies of haplogroup A in Amerindian populations in the Caribbean region of Colombia. Our results indicate that all four Native American mtDNA haplogroups were widely distributed in Colombia at the time of the Spanish conquest.

  17. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  18. Single DNA imaging and length quantification through a mobile phone microscope

    Science.gov (United States)

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2016-03-01

    The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

  19. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

    2017-01-01

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  20. Single-molecule electronics: Cooling individual vibrational modes by the tunneling current.

    Science.gov (United States)

    Lykkebo, Jacob; Romano, Giuseppe; Gagliardi, Alessio; Pecchia, Alessandro; Solomon, Gemma C

    2016-03-21

    Electronic devices composed of single molecules constitute the ultimate limit in the continued downscaling of electronic components. A key challenge for single-molecule electronics is to control the temperature of these junctions. Controlling heating and cooling effects in individual vibrational modes can, in principle, be utilized to increase stability of single-molecule junctions under bias, to pump energy into particular vibrational modes to perform current-induced reactions, or to increase the resolution in inelastic electron tunneling spectroscopy by controlling the life-times of phonons in a molecule by suppressing absorption and external dissipation processes. Under bias the current and the molecule exchange energy, which typically results in heating of the molecule. However, the opposite process is also possible, where energy is extracted from the molecule by the tunneling current. Designing a molecular "heat sink" where a particular vibrational mode funnels heat out of the molecule and into the leads would be very desirable. It is even possible to imagine how the vibrational energy of the other vibrational modes could be funneled into the "cooling mode," given the right molecular design. Previous efforts to understand heating and cooling mechanisms in single molecule junctions have primarily been concerned with small models, where it is unclear which molecular systems they correspond to. In this paper, our focus is on suppressing heating and obtaining current-induced cooling in certain vibrational modes. Strategies for cooling vibrational modes in single-molecule junctions are presented, together with atomistic calculations based on those strategies. Cooling and reduced heating are observed for two different cooling schemes in calculations of atomistic single-molecule junctions.

  1. DNA Damage Observed in Unaffected Individuals with Family History of T2DM

    Science.gov (United States)

    Ramesh, Nikhila; Abilash, V. G.

    2017-11-01

    Diabetes has been documented to cause high levels of DNA fragmentation in some cases. As diabetes is inheritable and influenced by both genetic and environmental factors, an investigation into the genomic stability of individuals who are strongly at risk of inheriting diabetes was conducted by inducing oxidative stress, as DNA damage in unaffected individuals could be a sign of onset of the disease or the presence of genetic alterations that reduce cellular defences against reactive oxygen species. In this study, alkaline comet assay was performed on isolated human leukocytes to determine whether individuals with a family history of Type 2 Diabetes Mellitus (T2DM) are more prone to DNA damage under oxidative stress. Visual scoring of comets showed that these individuals have higher degree of DNA damage compared to a control individual with no family history of Type 2 Diabetes Mellitus. Further studies with large sample could determine the presence of disabled cellular defences against oxidative stress in unaffected individuals and intervention with antioxidants could prevent or manage Type 2 Diabetes Mellitus and its complications.

  2. Self-DNA inhibitory effects: Underlying mechanisms and ecological implications.

    Science.gov (United States)

    Cartenì, Fabrizio; Bonanomi, Giuliano; Giannino, Francesco; Incerti, Guido; Vincenot, Christian Ernest; Chiusano, Maria Luisa; Mazzoleni, Stefano

    2016-01-01

    DNA is usually known as the molecule that carries the instructions necessary for cell functioning and genetic inheritance. A recent discovery reported a new functional role for extracellular DNA. After fragmentation, either by natural or artificial decomposition, small DNA molecules (between ∼50 and ∼2000 bp) exert a species specific inhibitory effect on individuals of the same species. Evidence shows that such effect occurs for a wide range of organisms, suggesting a general biological process. In this paper we explore the possible molecular mechanisms behind those findings and discuss the ecological implications, specifically those related to plant species coexistence.

  3. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    Science.gov (United States)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  4. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  5. Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

    Directory of Open Access Journals (Sweden)

    Haowei Wang

    Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

  6. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  7. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  8. The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

    International Nuclear Information System (INIS)

    Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

    2008-01-01

    We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

  9. DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki

    1980-09-19

    Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.

  10. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  11. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  12. Studying DNA Looping by Single-Molecule FRET

    OpenAIRE

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  13. Central dogma at the single-molecule level in living cells.

    Science.gov (United States)

    Li, Gene-Wei; Xie, X Sunney

    2011-07-20

    Gene expression originates from individual DNA molecules within living cells. Like many single-molecule processes, gene expression and regulation are stochastic, that is, sporadic in time. This leads to heterogeneity in the messenger-RNA and protein copy numbers in a population of cells with identical genomes. With advanced single-cell fluorescence microscopy, it is now possible to quantify transcriptomes and proteomes with single-molecule sensitivity. Dynamic processes such as transcription-factor binding, transcription and translation can be monitored in real time, providing quantitative descriptions of the central dogma of molecular biology and the demonstration that a stochastic single-molecule event can determine the phenotype of a cell.

  14. Estimates of Continental Ancestry Vary Widely among Individuals with the Same mtDNA Haplogroup

    Science.gov (United States)

    Emery, Leslie S.; Magnaye, Kevin M.; Bigham, Abigail W.; Akey, Joshua M.; Bamshad, Michael J.

    2015-01-01

    The association between a geographical region and an mtDNA haplogroup(s) has provided the basis for using mtDNA haplogroups to infer an individual’s place of origin and genetic ancestry. Although it is well known that ancestry inferences using mtDNA haplogroups and those using genome-wide markers are frequently discrepant, little empirical information exists on the magnitude and scope of such discrepancies between multiple mtDNA haplogroups and worldwide populations. We compared genetic-ancestry inferences made by mtDNA-haplogroup membership to those made by autosomal SNPs in ∼940 samples of the Human Genome Diversity Panel and recently admixed populations from the 1000 Genomes Project. Continental-ancestry proportions often varied widely among individuals sharing the same mtDNA haplogroup. For only half of mtDNA haplogroups did the highest average continental-ancestry proportion match the highest continental-ancestry proportion of a majority of individuals with that haplogroup. Prediction of an individual’s mtDNA haplogroup from his or her continental-ancestry proportions was often incorrect. Collectively, these results indicate that for most individuals in the worldwide populations sampled, mtDNA-haplogroup membership provides limited information about either continental ancestry or continental region of origin. PMID:25620206

  15. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  16. The atypical presence of the paternal mitochondrial DNA in somatic tissues of male and female individuals of the blue mussel species Mytilus galloprovincialis

    Directory of Open Access Journals (Sweden)

    Rodakis George C

    2010-08-01

    Full Text Available Abstract Background In animals mtDNA inheritance is maternal except in certain molluscan bivalve species which have a paternally inherited mitochondrial genome (genome M along with the standard maternal one (genome F. Normally, the paternal genome occurs in the male gonad, but it can be often found, as a minority, in somatic tissues of males and females. This may happen in two ways. One is through "sperm mtDNA leakage" into somatic tissues, a deviation from the normal situation in which the sperm mtDNA vanishes in females or ends up exclusively in the germ line of males. The other is through "egg heteroplasmy", when the egg contains, in small quantities, the paternal genome in addition to maternal genome. Findings To test the two hypotheses, we compared the sequences of one of the most variable domains of the M molecule in a somatic tissue (foot and in the sperm of ten male and in the foot of ten female individuals of M. galloprovincialis. Presence of the M genome was rarer in the foot of females than males. The M genome in the sperm and in the foot of males was identical. Conclusions Given that the surveyed region differs from individual to individual, the identity of the M genome in the foot and the sperm of males supports strongly the hypothesis that, at least for the tissue examined, the presence of the M genome is due to sperm mtDNA leakage.

  17. Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

    Science.gov (United States)

    Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

    2015-04-01

    DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

  18. Going Vertical To Improve the Accuracy of Atomic Force Microscopy Based Single-Molecule Force Spectroscopy.

    Science.gov (United States)

    Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T

    2018-01-23

    Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.

  19. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  20. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    Energy Technology Data Exchange (ETDEWEB)

    Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

  1. Individual Magnetic Molecules on Ultrathin Insulating Surfaces

    Science.gov (United States)

    El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus

    2012-02-01

    Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.

  2. Privacy rules for DNA databanks. Protecting coded 'future diaries'.

    Science.gov (United States)

    Annas, G J

    1993-11-17

    In privacy terms, genetic information is like medical information. But the information contained in the DNA molecule itself is more sensitive because it contains an individual's probabilistic "future diary," is written in a code that has only partially been broken, and contains information about an individual's parents, siblings, and children. Current rules for protecting the privacy of medical information cannot protect either genetic information or identifiable DNA samples stored in DNA databanks. A review of the legal and public policy rationales for protecting genetic privacy suggests that specific enforceable privacy rules for DNA databanks are needed. Four preliminary rules are proposed to govern the creation of DNA databanks, the collection of DNA samples for storage, limits on the use of information derived from the samples, and continuing obligations to those whose DNA samples are in the databanks.

  3. Direct observation of hindered eccentric rotation of an individual molecule : Cu-phthalocyanine on C60

    NARCIS (Netherlands)

    Stöhr, Meike; Wagner, T; Gabriel, M; Weyers, B; Moller, R

    2002-01-01

    Individual Cu-phthalocyanine molecules have been investigated by scanning tunnel microscopy on a closed packed film of C-60 at various temperatures. The molecules are found to bind asymmetrically to one C-60. While they remain in one position at low temperature, they can hop between six equivalent

  4. Radiation-induced DNA damage as a function of DNA hydration

    International Nuclear Information System (INIS)

    Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.

    1995-01-01

    Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage

  5. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  6. DNA-templated synthesis of Pt nanoparticles on single-walled carbon nanotubes.

    Science.gov (United States)

    Dong, Lifeng

    2009-11-18

    A series of electron microscopy characterizations demonstrate that single-stranded deoxyribonucleic acid (ssDNA) can bind to nanotube surfaces and disperse bundled single-walled carbon nanotubes (SWCNTs) into individual tubes. The ssDNA molecules on the nanotube surfaces demonstrate various morphologies, such as aggregated clusters and spiral wrapping around a nanotube with different pitches and spaces, indicating that the morphology of the SWCNT/DNA hybrids is not related solely to the base sequence of the ssDNA or the chirality or the diameter of the nanotubes. In addition to serving as a non-covalent dispersion agent, the ssDNA molecules bonded to the nanotube surface can provide addresses for localizing Pt(II) complexes along the nanotubes. The Pt nanoparticles obtained by a reduction of the Pt2+-DNA adducts are crystals with a size of direct ethanol/methanol fuel cells and nanoscale electronics.

  7. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  8. DNA: The Molecule of Life. A Multimedia CD-ROM. [CD-ROM].

    Science.gov (United States)

    2001

    This CD-ROM is designed for classroom and individual use to teach and learn about DNA. Integrated animations, custom graphics, three-dimensional representations, photographs, and sound are featured for use in user-controlled activities. Interactive lessons are available to reinforce the subject material. Pre- and post-testing sections are also…

  9. How to Measure Load-Dependent Kinetics of Individual Motor Molecules Without a Force-Clamp

    DEFF Research Database (Denmark)

    Sung, Jongmin; Mortensen, Kim; Spudich, James A.

    Molecular motors are responsible for numerous cellular processes from cargo transport to heart contraction. Their interactions with other cellular components are often transient and exhibit kinetics that depend on load. Here, we measure such interactions using a new method, Harmonic Force...... and efficient. The protocol accumulates statistics fast enough to deliver single-molecule results from single-molecule experiments. We demonstrate the method's performance by measuring the force-dependent kinetics of individual human beta-cardiac myosin molecules interacting with an actin filament...... at physiological ATP concentration. We show that a molecule's ADP release rate depends exponentially on the applied load. This points to Kramer's Brownian diffusion model of chemical reactions as explanation why muscle contracts with a velocity inversely proportional to external load....

  10. In silico single-molecule manipulation of DNA with rigid body dynamics.

    Directory of Open Access Journals (Sweden)

    Pascal Carrivain

    2014-02-01

    Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

  11. Fabrication of Low Noise Borosilicate Glass Nanopores for Single Molecule Sensing.

    Directory of Open Access Journals (Sweden)

    Jayesh A Bafna

    Full Text Available We show low-cost fabrication and characterization of borosilicate glass nanopores for single molecule sensing. Nanopores with diameters of ~100 nm were fabricated in borosilicate glass capillaries using laser assisted glass puller. We further achieve controlled reduction and nanometer-size control in pore diameter by sculpting them under constant electron beam exposure. We successfully fabricate pore diameters down to 6 nm. We next show electrical characterization and low-noise behavior of these borosilicate nanopores and compare their taper geometries. We show, for the first time, a comprehensive characterization of glass nanopore conductance across six-orders of magnitude (1M-1μM of salt conditions, highlighting the role of buffer conditions. Finally, we demonstrate single molecule sensing capabilities of these devices with real-time translocation experiments of individual λ-DNA molecules. We observe distinct current blockage signatures of linear as well as folded DNA molecules as they undergo voltage-driven translocation through the glass nanopores. We find increased signal to noise for single molecule detection for higher trans-nanopore driving voltages. We propose these nanopores will expand the realm of applications for nanopore platform.

  12. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    Science.gov (United States)

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  13. PDB4DNA: Implementation of DNA geometry from the Protein Data Bank (PDB) description for Geant4-DNA Monte-Carlo simulations

    Science.gov (United States)

    Delage, E.; Pham, Q. T.; Karamitros, M.; Payno, H.; Stepan, V.; Incerti, S.; Maigne, L.; Perrot, Y.

    2015-07-01

    This paper describes PDB4DNA, a new Geant4 user application, based on an independent, cross-platform, free and open source C++ library, so-called PDBlib, which enables use of atomic level description of DNA molecule in Geant4 Monte Carlo particle transport simulations. For the evaluation of direct damage induced on the DNA molecule by ionizing particles, the application makes use of an algorithm able to determine the closest atom in the DNA molecule to energy depositions. Both the PDB4DNA application and the PDBlib library are available as free and open source under the Geant4 license.

  14. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  15. Automated imaging system for single molecules

    Science.gov (United States)

    Schwartz, David Charles; Runnheim, Rodney; Forrest, Daniel

    2012-09-18

    There is provided a high throughput automated single molecule image collection and processing system that requires minimal initial user input. The unique features embodied in the present disclosure allow automated collection and initial processing of optical images of single molecules and their assemblies. Correct focus may be automatically maintained while images are collected. Uneven illumination in fluorescence microscopy is accounted for, and an overall robust imaging operation is provided yielding individual images prepared for further processing in external systems. Embodiments described herein are useful in studies of any macromolecules such as DNA, RNA, peptides and proteins. The automated image collection and processing system and method of same may be implemented and deployed over a computer network, and may be ergonomically optimized to facilitate user interaction.

  16. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  17. Structural stability of DNA origami nanostructures in the presence of chaotropic agents.

    Science.gov (United States)

    Ramakrishnan, Saminathan; Krainer, Georg; Grundmeier, Guido; Schlierf, Michael; Keller, Adrian

    2016-05-21

    DNA origami represent powerful platforms for single-molecule investigations of biomolecular processes. The required structural integrity of the DNA origami may, however, pose significant limitations regarding their applicability, for instance in protein folding studies that require strongly denaturing conditions. Here, we therefore report a detailed study on the stability of 2D DNA origami triangles in the presence of the strong chaotropic denaturing agents urea and guanidinium chloride (GdmCl) and its dependence on concentration and temperature. At room temperature, the DNA origami triangles are stable up to at least 24 h in both denaturants at concentrations as high as 6 M. At elevated temperatures, however, structural stability is governed by variations in the melting temperature of the individual staple strands. Therefore, the global melting temperature of the DNA origami does not represent an accurate measure of their structural stability. Although GdmCl has a stronger effect on the global melting temperature, its attack results in less structural damage than observed for urea under equivalent conditions. This enhanced structural stability most likely originates from the ionic nature of GdmCl. By rational design of the arrangement and lengths of the individual staple strands used for the folding of a particular shape, however, the structural stability of DNA origami may be enhanced even further to meet individual experimental requirements. Overall, their high stability renders DNA origami promising platforms for biomolecular studies in the presence of chaotropic agents, including single-molecule protein folding or structural switching.

  18. Genome-Wide DNA Methylation in Mixed Ancestry Individuals with Diabetes and Prediabetes from South Africa

    Science.gov (United States)

    Pheiffer, Carmen; Humphries, Stephen E.; Gamieldien, Junaid; Erasmus, Rajiv T.

    2016-01-01

    Aims. To conduct a genome-wide DNA methylation in individuals with type 2 diabetes, individuals with prediabetes, and control mixed ancestry individuals from South Africa. Methods. We used peripheral blood to perform genome-wide DNA methylation analysis in 3 individuals with screen detected diabetes, 3 individuals with prediabetes, and 3 individuals with normoglycaemia from the Bellville South Community, Cape Town, South Africa, who were age-, gender-, body mass index-, and duration of residency-matched. Methylated DNA immunoprecipitation (MeDIP) was performed by Arraystar Inc. (Rockville, MD, USA). Results. Hypermethylated DMRs were 1160 (81.97%) and 124 (43.20%), respectively, in individuals with diabetes and prediabetes when both were compared to subjects with normoglycaemia. Our data shows that genes related to the immune system, signal transduction, glucose transport, and pancreas development have altered DNA methylation in subjects with prediabetes and diabetes. Pathway analysis based on the functional analysis mapping of genes to KEGG pathways suggested that the linoleic acid metabolism and arachidonic acid metabolism pathways are hypomethylated in prediabetes and diabetes. Conclusions. Our study suggests that epigenetic changes are likely to be an early process that occurs before the onset of overt diabetes. Detailed analysis of DMRs that shows gradual methylation differences from control versus prediabetes to prediabetes versus diabetes in a larger sample size is required to confirm these findings. PMID:27555869

  19. Direct Atomic Force Microscopy Observation of DNA Tile Crystal Growth at the Single-Molecule Level

    OpenAIRE

    Evans, Constantine G.; Hariadi, Rizal F.; Winfree, Erik

    2012-01-01

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detach...

  20. Applications of a single-molecule detection in early disease diagnosis and enzymatic reaction study

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jiangwei [Iowa State Univ., Ames, IA (United States)

    2008-01-01

    Various single-molecule techniques were utilized for ultra-sensitive early diagnosis of viral DNA and antigen and basic mechanism study of enzymatic reactions. DNA of human papilloma virus (HPV) served as the screening target in a flow system. Alexa Fluor 532 (AF532) labeled single-stranded DNA probes were hybridized to the target HPV-16 DNA in solution. The individual hybridized molecules were imaged with an intensified charge-coupled device (ICCD) in two ways. In the single-color mode, target molecules were detected via fluorescence from hybridized probes only. This system could detect HPV-16 DNA in the presence of human genomic DNA down to 0.7 copy/cell and had a linear dynamic range of over 6 orders of magnitude. In the dual-color mode, fluorescence resonance energy transfer (FRET) was employed to achieve zero false-positive count. We also showed that DNA extracts from Pap test specimens did not interfere with the system. A surface-based method was used to improve the throughput of the flow system. HPV-16 DNA was hybridized to probes on a glass surface and detected with a total internal reflection fluorescence (TIRF) microscope. In the single-probe mode, the whole genome and target DNA were fluorescently labeled before hybridization, and the detection limit is similar to the flow system. In the dual-probe mode, a second probe was introduced. The linear dynamic range covers 1.44-7000 copies/cell, which is typical of early infection to near-cancer stages. The dual-probe method was tested with a crudely prepared sample. Even with reduced hybridization efficiency caused by the interference of cellular materials, we were still able to differentiate infected cells from healthy cells. Detection and quantification of viral antigen with a novel single-molecule immunosorbent assay (SMISA) was achieved. Antigen from human immunodeficiency virus type 1(HIV-1) was chosen to be the target in this study. The target was sandwiched between a monoclonal capture antibody and a

  1. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria

    2012-01-01

    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  2. Manipulating individual dichlorotin phthalocyanine molecules on Cu(100) surface at room temperature by scanning tunneling microscopy

    International Nuclear Information System (INIS)

    Li, Chao; Xiang, Feifei; Wang, Zhongping; Liu, Xiaoqing; Jiang, Danfeng; Wang, Li; Wang, Guang; Zhang, Xueao; Chen, Wei

    2014-01-01

    Single molecule manipulations have been achieved on dichlorotin phthalocyanine(SnCl 2 Pc) molecules adsorbed on Cu (100) at room temperature. Scanning tunneling microscopy observations directly demonstrate that the individual SnCl 2 Pc molecules can be moved along the [100] direction on Cu(100) surface by employing a scanning tunneling microscope tip fixed at the special position of the molecules. The orientation of the molecule can be switched between two angles of ±28° with respect to the [011] surface direction in the same way. Dependences of the probability of molecular motion on the distances between the tip and the molecules reveal that the mechanism for such manipulation of a SnCl 2 Pc molecule is dominated by the repulsive interactions between the tip and the molecules. With the assistance of this manipulation process, a prototype molecular storage array with molecular orientation as information carrier and an artificial hydrogen bonded supramolecular structure have been constructed on the surface. (paper)

  3. The demise of chloroplast DNA in Arabidopsis.

    Science.gov (United States)

    Rowan, Beth A; Oldenburg, Delene J; Bendich, Arnold J

    2004-09-01

    Although it might be expected that chloroplast DNA (cpDNA) would be stably maintained in mature leaves, we report the surprising observation that cpDNA levels decline during plastid development in Arabidopsis thaliana (Col.) until most of the leaves contain little or no DNA long before the onset of senescence. We measured the cpDNA content in developing cotyledons, rosette leaves, and cauline leaves. The amount of cpDNA per chloroplast decreases as the chloroplasts develop, reaching undetectable levels in mature leaves. In young cauline leaves, most individual molecules of cpDNA are found in complex, branched forms. In expanded cauline leaves, cpDNA is present in smaller branched forms only at the base of the leaf and is virtually absent in the distal part of the leaf. We conclude that photosynthetic activity may persist long after the demise of the cpDNA. Copyright 2004 Springer-Verlag

  4. DNA nanotechnology-enabled biosensors.

    Science.gov (United States)

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

    Science.gov (United States)

    Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

  6. Influence of an individual's age on the amount and interpretability of DNA left on touched items.

    Science.gov (United States)

    Poetsch, Micaela; Bajanowski, Thomas; Kamphausen, Thomas

    2013-11-01

    In crime scene investigations, DNA left by touch on an object can be found frequently and the significant improvements in short tandem repeat (STR) amplification in recent years built up a high expectation to identify the individual(s) who touched the object by their DNA profile. Nevertheless, the percentage of reliably analysable samples varies considerably between different crime scenes even if the nature of the stains appears to be very similar. Here, it has been proposed that the amount and quality of DNA left at a crime scene may be influenced by external factors (like nature of the surface) and/or individual factors (like skin conditions). In this study, the influence of the age of an individual who left his DNA on an object is investigated. Handprints from 213 individuals (1 to 89 years old) left on a plastic syringe were analysed for DNA amount and STR alleles using Quantifiler® and PowerPlex® ESX 17. A full profile of the individual could be found in 75 % of all children up to 10 years, 9 % of adolescents (11 to 20 years), 25 % of adults (21 to 60 years) and 8 % of elderly people (older than 60 years). No person older than 80 years displayed a full profile. Drop-in and drop-out artefacts occurred frequently throughout the age groups. A dependency of quantity and quality of the DNA left on a touched object on the age of the individual could be clearly demonstrated at least for children and elderly people. An epithelial abrasion unexpectedly good to interpret may be derived from a child, whereas the suspected skin contact of an elderly person with an object may be impossible to prove.

  7. DNA Open states and DNA hydratation

    International Nuclear Information System (INIS)

    Lema-Larre, B. de; Martin-Landrove, M

    1995-01-01

    It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es

  8. Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

    Science.gov (United States)

    Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

    2018-01-23

    Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

  9. DNA damage by Auger emitters

    International Nuclear Information System (INIS)

    Martin, R.F.; d'Cunha, Glenn; Gibbs, Richard; Murray, Vincent; Pardee, Marshall; Allen, B.J.

    1988-01-01

    125 I atoms can be introduced at specific locations along a defined DNA target molecule, either by site-directed incorporation of an 125 I-labelled deoxynucleotide or by binding of an 125 I-labelled sequence-selective DNA ligand. After allowing accumulation of 125 I decay-induced damage to the DNA, application of DNA sequencing techniques enables positions of strand breaks to be located relative to the site of decay, at a resolution corresponding to the distance between adjacent nucleotides [0.34 nm]. Thus, DNA provides a molecular framework to analyse the extent of damage following [averaged] individual decay events. Results can be compared with energy deposition data generated by computer-simulation methods developed by Charlton et al. The DNA sequencing technique also provides information about the chemical nature of the termini of the DNA chains produced following Auger decay-induced damage. In addition to reviewing the application of this approach to the analysis of 125 I decay induced DNA damage, some more recent results obtained by using 67 Ga are also presented. (author)

  10. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

    Science.gov (United States)

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

    2018-01-09

    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  12. What is DNA damage? Risk of double-strand break and its individual variation

    International Nuclear Information System (INIS)

    Hanaoka, Fumio

    2011-01-01

    The author discusses about the title subject in an aspect of possible spreading of Fukushima radioactive substances mainly in eastern north area of Japan where carcinogenic incidence may be increased as the ionizing radiation injures the gene (DNA). At first, explained is that cancer is a disease of genes with infinitive proliferation of cells, there are systems to prevent it by repairing the damaged DNA and by other mechanisms like exclusion of cells damaged too much or killing cancer cells with immunity, and individual difference of the repairing capability exists. DNA is always damaged even under ordinary living conditions by sunlight UV ray, cosmic radiation and chemicals externally and by active oxygen species and thermal water movement internally. Concomitantly, DNA damaged by many mechanisms like deletion, dimmer formation, chemical modification of bases, single and double strand breaks is always repaired by concerned enzymes. Double-strand damage by high-energy radiation like gamma ray is quite risky because its repair sometimes accompanies error as concerned enzymes are from more multiple genes. There are many syndromes derived from gene deficit of those repairing enzymes. The diseases concerned with repair of the double-strand damage teach that fetus and infant are more sensitive to radiation than adult as their young body cells are more actively synthesizing DNA, during which, if DNA is injured by radiation, risk of repairing error is higher as the double strand break more frequently occurs. It cannot be simply said that a certain radiation dose limit is generally permissible. There is an individual difference of radiation sensitivity and a possible method to find out an individual weak to radiation is the lymphocyte screening in vitro using anticancer bleomycin which breaks the double strand. (T.T.)

  13. Fluorescence Microscopy of Nanochannel-Confined DNA.

    Science.gov (United States)

    Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

    2018-01-01

    Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

  14. Routing of individual polymers in designed patterns

    DEFF Research Database (Denmark)

    Knudsen, Jakob Bach; Liu, Lei; Kodal, Anne Louise Bank

    2015-01-01

    Synthetic polymers are ubiquitous in the modern world, but our ability to exert control over the molecular conformation of individual polymers is very limited. In particular, although the programmable self-assembly of oligonucleotides and proteins into artificial nanostructures has been...... demonstrated, we currently lack the tools to handle other types of synthetic polymers individually and thus the ability to utilize and study their single-molecule properties. Here we show that synthetic polymer wires containing short oligonucleotides that extend from each repeat can be made to assemble...... into arbitrary routings. The wires, which can be more than 200 nm in length, are soft and bendable, and the DNA strands allow individual polymers to self-assemble into predesigned routings on both two- and three-dimensional DNA origami templates. The polymers are conjugated and potentially conducting, and could...

  15. Direct atomic force microscopy observation of DNA tile crystal growth at the single-molecule level.

    Science.gov (United States)

    Evans, Constantine G; Hariadi, Rizal F; Winfree, Erik

    2012-06-27

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detachments. We show that these statistics fit the widely used kinetic Tile Assembly Model and demonstrate AFM movies as a viable technique for directly investigating DNA tile systems during growth rather than after assembly.

  16. How to measure load-dependent kinetics of individual motor molecules without a force clamp

    DEFF Research Database (Denmark)

    Sung, J.; Mortensen, Kim; Spudich, J.A.

    2017-01-01

    Single-molecule force spectroscopy techniques, including optical trapping, magnetic trapping, and atomic force microscopy, have provided unprecedented opportunities to understand biological processes at the smallest biological length scales. For example, they have been used to elucidate the molec......Single-molecule force spectroscopy techniques, including optical trapping, magnetic trapping, and atomic force microscopy, have provided unprecedented opportunities to understand biological processes at the smallest biological length scales. For example, they have been used to elucidate...... functions at the single molecule level, such as conformational changes and force-generation of individual motor proteins or force-dependent kinetics in molecular interactions. Here, we describe a new method, “Harmonic Force Spectroscopy (HFS).” With a conventional dual-beam optical trap and a simple...... concepts, experimental setup, step-by-step experimental protocol, theory, data analysis, and results....

  17. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  18. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-01-01

    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  19. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  20. Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

    Science.gov (United States)

    Nayak, Alpana; Suresh, K. A.

    2008-08-01

    We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

  1. Close encounters with DNA

    Science.gov (United States)

    Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

    2014-01-01

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

  2. Close encounters with DNA.

    Science.gov (United States)

    Maffeo, C; Yoo, J; Comer, J; Wells, D B; Luan, B; Aksimentiev, A

    2014-10-15

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field.

  3. Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

    Science.gov (United States)

    Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

    2017-01-01

    The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

  4. ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

    Energy Technology Data Exchange (ETDEWEB)

    Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

    2015-06-01

    Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

  5. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    Science.gov (United States)

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  6. Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

    International Nuclear Information System (INIS)

    Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

    1999-01-01

    The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

  7. Routing of individual polymers in designed patterns

    Science.gov (United States)

    Knudsen, Jakob Bach; Liu, Lei; Bank Kodal, Anne Louise; Madsen, Mikael; Li, Qiang; Song, Jie; Woehrstein, Johannes B.; Wickham, Shelley F. J.; Strauss, Maximilian T.; Schueder, Florian; Vinther, Jesper; Krissanaprasit, Abhichart; Gudnason, Daniel; Smith, Anton Allen Abbotsford; Ogaki, Ryosuke; Zelikin, Alexander N.; Besenbacher, Flemming; Birkedal, Victoria; Yin, Peng; Shih, William M.; Jungmann, Ralf; Dong, Mingdong; Gothelf, Kurt V.

    2015-10-01

    Synthetic polymers are ubiquitous in the modern world, but our ability to exert control over the molecular conformation of individual polymers is very limited. In particular, although the programmable self-assembly of oligonucleotides and proteins into artificial nanostructures has been demonstrated, we currently lack the tools to handle other types of synthetic polymers individually and thus the ability to utilize and study their single-molecule properties. Here we show that synthetic polymer wires containing short oligonucleotides that extend from each repeat can be made to assemble into arbitrary routings. The wires, which can be more than 200 nm in length, are soft and bendable, and the DNA strands allow individual polymers to self-assemble into predesigned routings on both two- and three-dimensional DNA origami templates. The polymers are conjugated and potentially conducting, and could therefore be used to create molecular-scale electronic or optical wires in arbitrary geometries.

  8. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  9. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  10. Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

  11. Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    International Nuclear Information System (INIS)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

    2017-01-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

  12. Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    Science.gov (United States)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

    2017-03-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

  13. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  14. Interaction of carbon nano tubes with DNA segments; Interacao de nanotubos de carbono com segmentos de DNA

    Energy Technology Data Exchange (ETDEWEB)

    Peressinotto, Valdirene Sullas Teixeira

    2007-07-01

    Single- and double-stranded DNA (deoxyribonucleic acid) molecules can strongly bind to single-walled carbon nanotubes (SWNT) via non-covalent interactions. Under certain conditions, the DNA molecule spontaneously self-assembles into a helical wrapping around the tubular structure of the carbon nanotubes to form DNA/SWNT hybrids, which are both stable and soluble in water. This system has recently received extensive attention, since, besides rendering SWNTs dispersible in water as individual tubes, the DNA hybrids are very promising candidates for many applications in nanotechnology and molecular biology. All the possible applications for DNA-SWNT hybrids require, however, a fully understanding of DNA-nanotube wrapping mechanism which is still lacking in the literature. In this context, the aim of this work was to investigate the non-covalent interaction in aqueous medium between SWNTs and synthetic DNA segments having a known nucleotide sequence. Initially, the study was focused on poly d(GT)n sequences (n = 10, 30 and 45) that contain a sequence of alternating guanine and thymine bases and for which the efficiency to disperse and separate carbon nanotubes has already been demonstrated. Besides the size of GT sequences, the effects of ionic strength and pH in the interaction were also investigated. Afterwards, we studied the interaction of SWNT with DNA molecules that contain only a single type of nitrogenous base (DNA homopolymers), which has not been reported in details in the literature. We investigated homopolymers of poly dA{sub 20}, poly dT{sub 20}, poly dC{sub 20} and the duplex poly dA{sub 20}:dT{sub 20}. Most of the study was carried out with small-diameter HiPco SWNTs (with diameters between 0.7 and 1.2 nm). In some studies, SWNTs with diameter around 1.4 nm, synthesized via laser ablation and arc-discharge methods, were also investigated. The arc-discharge nanotubes used in this study were functionalized with carboxylic groups (-COOH) due to their

  15. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  16. Vegetables and PUFA-rich plant oil reduce DNA strand breaks in individuals with type 2 diabetes

    DEFF Research Database (Denmark)

    Müllner, Elisabeth; Brath, Helmut; Pleifer, Simone

    2013-01-01

    SCOPE: Type 2 diabetes is a multifactorial disease associated with increased oxidative stress, which may lead to increased DNA damage. The aim of this study was to investigate the effect of a healthy diet on DNA oxidation in diabetics and nondiabetics. METHODS AND RESULTS: Seventy-six diabetic...... and 21 nondiabetic individuals participated in this study. All subjects received information about the benefits of a healthy diet, while subjects randomly assigned to the intervention group received additionally 300 g of vegetables and 25 mL PUFA-rich plant oil per day. DNA damage in mononuclear cells...... increase in plasma antioxidant concentrations. Diabetic individuals of the intervention group showed a significant reduction in HbA1c and DNA strand breaks. Levels of HbA1c were also improved in diabetics of the information group, but oxidative damage to DNA was not altered. Urinary 8-oxodG and 8-oxo...

  17. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  18. Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

    KAUST Repository

    Serag, Maged F.

    2014-10-06

    Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

  19. Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

    KAUST Repository

    Serag, Maged F.; Abadi, Maram; Habuchi, Satoshi

    2014-01-01

    Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

  20. Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles.

    Science.gov (United States)

    Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil; Brown, Stanley; Oddershede, Lene B

    2014-09-01

    This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less supercoiling results in more movement, and more supercoiling results in less movement. In contrast to other single-molecule methodologies, the current methodology allows for studying DNA in its naturally supercoiled state with constant linking number and constant writhe. The protocol has potential for use in studying the influence of supercoils on the dynamics of DNA and its associated proteins, e.g., topoisomerase. The procedure takes ~4 weeks.

  1. DNA maintenance in plastids and mitochondria of plants

    Directory of Open Access Journals (Sweden)

    Delene J Oldenburg

    2015-10-01

    Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.

  2. Single Molecule Nano-Metronome

    Science.gov (United States)

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  3. Forensic individual age estimation with DNA: From initial approaches to methylation tests.

    Science.gov (United States)

    Freire-Aradas, A; Phillips, C; Lareu, M V

    2017-07-01

    Individual age estimation is a key factor in forensic science analysis that can provide very useful information applicable to criminal, legal, and anthropological investigations. Forensic age inference was initially based on morphological inspection or radiography and only later began to adopt molecular approaches. However, a lack of accuracy or technical problems hampered the introduction of these DNA-based methodologies in casework analysis. A turning point occurred when the epigenetic signature of DNA methylation was observed to gradually change during an individual´s lifespan. In the last four years, the number of publications reporting DNA methylation age-correlated changes has gradually risen and the forensic community now has a range of age methylation tests applicable to forensic casework. Most forensic age predictor models have been developed based on blood DNA samples, but additional tissues are now also being explored. This review assesses the most widely adopted genes harboring methylation sites, detection technologies, statistical age-predictive analyses, and potential causes of variation in age estimates. Despite the need for further work to improve predictive accuracy and establishing a broader range of tissues for which tests can analyze the most appropriate methylation sites, several forensic age predictors have now been reported that provide consistency in their prediction accuracies (predictive error of ±4 years); this makes them compelling tools with the potential to contribute key information to help guide criminal investigations. Copyright © 2017 Central Police University.

  4. DNA Repair Systems

    Indian Academy of Sciences (India)

    DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

  5. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    Science.gov (United States)

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

  7. Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles

    DEFF Research Database (Denmark)

    Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil

    2014-01-01

    This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation...... of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti......-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less...

  8. Diffracted X-ray tracking for monitoring intramolecular motion in individual protein molecules using broad band X-ray

    Energy Technology Data Exchange (ETDEWEB)

    Ichiyanagi, Kouhei; Sasaki, Yuji C. [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan); Japan Science and Technology Agency, CREST, CREST, Sasaki-Team, 609 Kiban Building, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Sekiguchi, Hiroshi; Hoshino, Masato; Kajiwara, Kentaro; Senba, Yasunori; Ohashi, Haruhiko; Ohta, Noboru [Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan); Hoshisashi, Kentaro; Jae-won, Chang; Tokue, Maki; Matsushita, Yufuku [Department of Advanced Materials Science, Graduate School of Frontier Sciences, The University of Tokyo, 609 Kiban Building 5-1-5 Kashiwanoha, Kahiwashi, Chiba 277-8561 (Japan); Nishijima, Masaki; Inoue, Yoshihisa [Department of Applied Chemistry and Office for University-Industry Collaboration, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yagi, Naoto [Japan Science and Technology Agency, CREST, CREST, Sasaki-Team, 609 Kiban Building, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Japan Synchrotron Radiation Research Institute, SPring-8, 1-1-1 Kouto, Sayo, Hyogo 679-5198 (Japan)

    2013-10-15

    Diffracted X-ray tracking (DXT) enables the tilting and twisting motions of single protein molecules to be monitored with micro- to milliradian resolution using a highly brilliant X-ray source with a wide energy bandwidth. We have developed a technique to monitor single molecules using gold nanocrystals attached to individual protein molecules using the BL28B2 beamline at SPring-8. In this paper we present the installation of a single toroidal X-ray mirror at BL28B2 to focus X-rays in an energy range of 10–20 keV (△E/E = 82% for an X-ray with a wide energy bandwidth). With this beamline we tracked diffraction spots from gold nanocrystals over a wide angle range than that using quasi-monochromatic X-rays. Application of the wide angle DXT technique to biological systems enabled us to observe the on-site motions of single protein molecules that have been functionalized in vivo. We further extend the capability of DXT by observing the fractional tilting and twisting motions of inner proteins under various conditions. As a proof of this methodology and to determine instrumental performance the intramolecular motions of a human serum albumin complex with 2-anthracenecarboxylic acid was investigated using the BL28B2 beamline. The random tilting and twisting intramolecular motions are shown to be directly linked to the movement of individual protein molecules in the buffer solution.

  9. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  10. Single molecule conductance

    NARCIS (Netherlands)

    Willems, R.

    2008-01-01

    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  11. Structural Transitions in Supercoiled Stretched DNA

    Science.gov (United States)

    v, Croquette

    1998-03-01

    Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

  12. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  13. [DNA complexes, formed on aqueous phase surfaces: new planar polymeric and composite nanostructures].

    Science.gov (United States)

    Antipina, M N; Gaĭnutdinov, R V; Rakhnianskaia, A A; Sergeev-Cherenkov, A N; Tolstikhina, A L; Iurova, T V; Kislov, V V; Khomutov, G B

    2003-01-01

    The formation of DNA complexes with Langmuir monolayers of the cationic lipid octadecylamine (ODA) and the new amphiphilic polycation poly-4-vinylpyridine with 16% of cetylpyridinium groups (PVP-16) on the surface of an aqueous solution of native DNA of low ionic strength was studied. Topographic images of Langmuir-Blodgett films of DNA/ODA and DNA/PVP-16 complexes applied to micaceous substrates were investigated by the method of atomic force microscopy. It was found that films of the amphiphilic polycation have an ordered planar polycrystalline structure. The morphology of planar DNA complexes with the amphiphilic cation substantially depended on the incubation time and the phase state of the monolayer on the surface of the aqueous DNA solution. Complex structures and individual DNA molecules were observed on the surface of the amphiphilic monolayer. Along with quasi-linear individual bound DNA molecules, characteristic extended net-like structures and quasi-circular toroidal condensed conformations of planar DNA complexes were detected. Mono- and multilayer films of DNA/PVP-16 complexes were used as templates and nanoreactors for the synthesis of inorganic nanostructures via the binding of metal cations from the solution and subsequent generation of the inorganic phase. As a result, ultrathin polymeric composite films with integrated DNA building blocks and quasi-linear arrays of inorganic semiconductor (CdS) and iron oxide nanoparticles and nanowires were obtained. The nanostructures obtained were characterized by scanning probe microscopy and transmission electron microscopy techniques. The methods developed are promising for investigating the mechanisms of structural organization and transformation in DNA and polyelectrolyte complexes at the gas-liquid interface and for the design of new extremely thin highly ordered planar polymeric and composite materials, films, and coatings with controlled ultrastructure for applications in nanoelectronics and

  14. Single Molecule Nano-Metronome

    OpenAIRE

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2006-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

  15. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  16. Two simple techniques for the safe Sarcoptes collection and individual mite DNA extraction.

    Science.gov (United States)

    Soglia, Dominga; Rambozzi, Luisa; Maione, Sandra; Spalenza, Veronica; Sartore, Stefano; Alasaad, Samer; Sacchi, Paola; Rossi, Luca

    2009-10-01

    Availability of mites is a recognized limiting factor of biological and genetic investigations of the genus Sarcoptes. Current methods of deoxyribonucleic acid (DNA) extraction from individual mites also need substantial improvement in efficiency and operator friendliness. We have first developed a technique for efficient and safe extraction of living mites from scabietic skin samples (crusts or deep skin scrapings). Its core device is a large plastic syringe connected with a 1.5-ml Eppendorf tube. The source material is introduced in the syringe and the device in a shoe box with the tip half of the tube emerging. Mites migrate towards a heat source during a minimum of 36 h. Then, the tube is detached and the mites utilized without risks for the operators. A second technique allows operator-friendly manipulation of individual mites for DNA extraction. Fixed mites are isolated by adhesion to a small strip of polyvinyl chloride (PVC) adhesive tape operated with tweezers. Then, mite and strip are plunged in the lyses buffer and the sample twice submitted to thermal shock for disruption of the chitinous exoskeleton. Data show that the tape does not interfere with successive DNA extraction with a commercial kit. The corresponding protocol, that we briefly name "PVC adhesive tape + thermal shock + kit DNA extraction," compares favorably with the available ones.

  17. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  18. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  19. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  20. Biofunctionalization of zinc oxide nanowires for DNA sensory applications

    Directory of Open Access Journals (Sweden)

    Rudolph Bettina

    2011-01-01

    Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.

  1. Concentrating and labeling genomic DNA in a nanofluidic array

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

    2018-01-01

    , however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

  2. Chronic radiation exposure: possibility of studying mutation process in generations based on the established DNA bank of exposed individuals and their offspring

    International Nuclear Information System (INIS)

    Rusinova, Galina G.; Adamova, Galina V.; Dudchenko, Natalya N.; Azizova, Tamara V.; Kurbatov, Andrey V.

    2002-01-01

    Data were summarized on the DNA Bank establishment for workers of the Mayak nuclear facility in Southern Ural, who were exposed to different doses of chronic radiation from γ -rays during the first years of the enterprise operations (1948-1958) and their families. Some workers were exposed to combined radiation (external + internal radiation from incorporated 239 Pu). The DNA Bank was established to store the unique genetic material from these individuals and their offspring for future risk estimation of the late consequences of radiation exposure using modern molecular-genetic technologies. Today, DNA Bank contains genetic material from 1,500 individuals and 218 families. The computer database was generated for the DNA Bank. It included individual medical-demographic, occupational descriptions and doses, quantitative and qualitative DNA data. Literature data on radiation-induced genome instability (variability of hypervariable areas) were also analyzed. Prospects of the DNA Bank establishment are also presented. The work is carried out on extension of the DNA Bank of exposed individuals and their offspring

  3. Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2018-04-01

    Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

  4. Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

    International Nuclear Information System (INIS)

    Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

    2014-01-01

    The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

  5. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

    Directory of Open Access Journals (Sweden)

    Lindy L. Esterhuizen

    2012-09-01

    Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

  6. The effect of soy protein beverages on serum cell adhesion molecule concentrations in prehypertensive/stage 1 hypertensive individuals.

    Science.gov (United States)

    Dettmer, Michelle; Alekel, D Lee; Lasrado, Joanne A; Messina, Mark; Carriquiry, Alicia; Heiberger, Kevin; Stewart, Jeanne W; Franke, Warren

    2012-04-01

    Prehypertensive and hypertensive individuals are at increased risk of atherosclerotic cardiovascular disease (CVD), in part because hypertension contributes to endothelial dysfunction and increased cell adhesion molecule expression. Soy protein and isoflavones may favorably alter CVD risk factors, and hence the aim of this study was to determine whether intake of cow's milk compared with soy beverage prepared from whole soy bean (WSB) or soy protein isolate (SPI) would lower soluble cell adhesion molecule concentrations as a means of decreasing CVD risk. We enrolled healthy prehypertensive/stage 1 hypertensive men (n = 60; 18-63 years) and premenopausal women (n = 8; 20-48 years). Participants were randomized to 1 of 3 groups for 8 weeks: cow's milk (600 mL/d), SPI beverage (840 mL/d; 30.1 mg total isoflavones/d), or WSB beverage (840 mL/d; 91.4 mg total isoflavones/d). We measured soluble vascular cell adhesion molecule-1 (VCAM-1), intercellular cell adhesion molecule-1 (ICAM-1), and endothelial-leukocyte adhesion molecule-1 (E-selectin) concentrations at baseline and week 8. Soluble CAM concentrations were not altered by treatment and did not differ between prehypertensive and hypertensive participants. However, analysis of variance indicated a treatment × gender interaction (gender effect) for ICAM-1 (p = 0.0037) but not for E-selectin (p = 0.067) or VCAM-1 (p = 0.16). Men had higher concentrations of ICAM-1 and E-selectin, respectively, at baseline (p = 0.0071, p = 0.049) and week 8 (p = 0.0054, p = 0.038) than women did. Neither intake of cow's milk nor soy beverage for 8 weeks altered soluble CAM concentrations in prehypertensive/stage 1 hypertensive individuals, suggesting that neither type of beverage diminished atherosclerotic CVD risk in mildly hypertensive individuals by way of improving circulating CAM concentrations.

  7. 3D DNA Crystals and Nanotechnology

    Directory of Open Access Journals (Sweden)

    Paul J. Paukstelis

    2016-08-01

    Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

  8. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  9. Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

    International Nuclear Information System (INIS)

    An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

    2007-01-01

    We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

  10. The structure of DNA by direct imaging

    KAUST Repository

    Marini, Monica

    2015-08-28

    The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

  11. The structure of DNA by direct imaging

    KAUST Repository

    Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo M.

    2015-01-01

    The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

  12. Evidence of animal mtDNA recombination between divergent populations of the potato cyst nematode Globodera pallida.

    Science.gov (United States)

    Hoolahan, Angelique H; Blok, Vivian C; Gibson, Tracey; Dowton, Mark

    2012-03-01

    Recombination is typically assumed to be absent in animal mitochondrial genomes (mtDNA). However, the maternal mode of inheritance means that recombinant products are indistinguishable from their progenitor molecules. The majority of studies of mtDNA recombination assess past recombination events, where patterns of recombination are inferred by comparing the mtDNA of different individuals. Few studies assess contemporary mtDNA recombination, where recombinant molecules are observed as direct mosaics of known progenitor molecules. Here we use the potato cyst nematode, Globodera pallida, to investigate past and contemporary recombination. Past recombination was assessed within and between populations of G. pallida, and contemporary recombination was assessed in the progeny of experimental crosses of these populations. Breeding of genetically divergent organisms may cause paternal mtDNA leakage, resulting in heteroplasmy and facilitating the detection of recombination. To assess contemporary recombination we looked for evidence of recombination between the mtDNA of the parental populations within the mtDNA of progeny. Past recombination was detected between a South American population and several UK populations of G. pallida, as well as between two South American populations. This suggests that these populations may have interbred, paternal mtDNA leakage occurred, and the mtDNA of these populations subsequently recombined. This evidence challenges two dogmas of animal mtDNA evolution; no recombination and maternal inheritance. No contemporary recombination between the parental populations was detected in the progeny of the experimental crosses. This supports current arguments that mtDNA recombination events are rare. More sensitive detection methods may be required to adequately assess contemporary mtDNA recombination in animals.

  13. The effects of electric fields on charged molecules and particles in individual microenvironments

    Science.gov (United States)

    Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.

    Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.

  14. Interaction of carbon nano tubes with DNA segments

    International Nuclear Information System (INIS)

    Peressinotto, Valdirene Sullas Teixeira

    2007-01-01

    Single- and double-stranded DNA (deoxyribonucleic acid) molecules can strongly bind to single-walled carbon nanotubes (SWNT) via non-covalent interactions. Under certain conditions, the DNA molecule spontaneously self-assembles into a helical wrapping around the tubular structure of the carbon nanotubes to form DNA/SWNT hybrids, which are both stable and soluble in water. This system has recently received extensive attention, since, besides rendering SWNTs dispersible in water as individual tubes, the DNA hybrids are very promising candidates for many applications in nanotechnology and molecular biology. All the possible applications for DNA-SWNT hybrids require, however, a fully understanding of DNA-nanotube wrapping mechanism which is still lacking in the literature. In this context, the aim of this work was to investigate the non-covalent interaction in aqueous medium between SWNTs and synthetic DNA segments having a known nucleotide sequence. Initially, the study was focused on poly d(GT)n sequences (n = 10, 30 and 45) that contain a sequence of alternating guanine and thymine bases and for which the efficiency to disperse and separate carbon nanotubes has already been demonstrated. Besides the size of GT sequences, the effects of ionic strength and pH in the interaction were also investigated. Afterwards, we studied the interaction of SWNT with DNA molecules that contain only a single type of nitrogenous base (DNA homopolymers), which has not been reported in details in the literature. We investigated homopolymers of poly dA 20 , poly dT 20 , poly dC 20 and the duplex poly dA 20 :dT 20 . Most of the study was carried out with small-diameter HiPco SWNTs (with diameters between 0.7 and 1.2 nm). In some studies, SWNTs with diameter around 1.4 nm, synthesized via laser ablation and arc-discharge methods, were also investigated. The arc-discharge nanotubes used in this study were functionalized with carboxylic groups (-COOH) due to their purification using strong

  15. Design and Assembly of DNA Nano-Objects and 2D DNA Origami Arrays

    Science.gov (United States)

    Liu, Wenyan

    DNA, which plays a central role in biology as the carrier of genetic information, is also an excellent candidate for structural nanotechnology. Researches have proven that a variety of complicated DNA assemblies, such as objects, 2D & 3D crystals, and nanomechanical devices, can be fabricated through the combination of robust branched DNA motifs and sticky ends. This dissertation focuses on the design and construction of DNA nano--objects and 2D DNA origami arrays. In this dissertation, we first describe the formation of a triangular species that has four strands per edge, held together by PX interactions. We demonstrate by nondenaturing gel electrophoresis and by atomic force microscopy (AFM) that we can combine a partial triangle with other strands to form a robust four--stranded molecule. By combining them with a novel three--domain molecule, we also demonstrate by AFM that these triangles can be self--assembled into a linear array. Second, we demonstrate our attempts to design and self--assemble 2D DNA origami arrays using several different strategies. Specifically, we introduce the self--assembly of 2D DNA origami lattices using a symmetric cross--like design. This design strategy resulted in a well--ordered woven latticework array with edge dimensions of 2--3 mum. This size is likely to be large enough to connect bottom-up methods of patterning with top--down approaches. Third, we illustrate the design and construction of DNA nano--objects for exploring the substrate preferences of topoisomerase (topo) II. We designed and fabricated four double rhombus--like DNA molecules, each of which contains a different conformation of crossover in the middle, as possible substrates to establish the structural preferences for topo II. We characterized the formation of each substrate molecule by gel electrophoresis. Finally, we study the effect of M13 DNA knotting on the formation of the DNA origami tiles. We demonstrate by atomic force microscopy (AFM) that knotted M13

  16. An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

    Science.gov (United States)

    Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

    2006-10-01

    In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

  17. DNA-Based Applications in Nanobiotechnology

    Directory of Open Access Journals (Sweden)

    Khalid M. Abu-Salah

    2010-01-01

    Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

  18. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  19. Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

    NARCIS (Netherlands)

    Geertsema, Hylkje

    2014-01-01

    De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

  20. The re-entrant cholesteric phase of DNA

    Science.gov (United States)

    Yevdokimov, Yu. M.; Skuridin, S. G.; Salyanov, V. I.; Semenov, S. V.; Shtykova, E. V.; Dadinova, L. A.; Kompanets, O. N.; Kats, E. I.

    2017-07-01

    The character of packing of double-stranded DNA molecules in particles of liquid-crystal dispersions formed as a result of the phase exclusion of DNA molecules from aqueous salt polyethylene glycol solutions has been estimated by comparing the circular dichroism (CD) spectra of these dispersions recorded at different osmotic pressures and temperatures. It is shown that the first cycle of heating of dispersion particles with hexagonally packed double-stranded DNA molecules leads to the occurrence of abnormal optical activity of these particles, which manifests itself in the form of a strong negative CD band, characteristic of DNA cholesterics. Moreover, subsequent cooling is accompanied by a further increase in the abnormal optical activity, which indicates the existence of the "hexagonal → cholesteric packing" phase transition, controlled by both the osmotic pressure of the solution and its temperature. The result obtained can be described in terms of "quasi-nematic" layers composed of orientationally ordered DNA molecules in the structure of dispersion particles. There are two possible ways of packing for these layers, which determine their hexagonal or cholesteric spatial structure. The second heating → cooling cycle confirms these results and is indicative of possible differences in the packing of double-stranded DNA molecules in the hexagonal phase, which depend on the osmotic pressure of the solution.

  1. Raman Spectroscopy of DNA Packaging in Individual Human Sperm Cells distinguishes Normal from Abnormal Cells

    Energy Technology Data Exchange (ETDEWEB)

    Huser, T; Orme, C; Hollars, C; Corzett, M; Balhorn, R

    2009-03-09

    Healthy human males produce sperm cells of which about 25-40% have abnormal head shapes. Increases in the percentage of sperm exhibiting aberrant sperm head morphologies have been correlated with male infertility, and biochemical studies of pooled sperm have suggested that sperm with abnormal shape may contain DNA that has not been properly repackaged by protamine during spermatid development. We have used micro-Raman spectroscopy to obtain Raman spectra from individual human sperm cells and examined how differences in the Raman spectra of sperm chromatin correlate with cell shape. We show that Raman spectra of individual sperm cells contain vibrational marker modes that can be used to assess the efficiency of DNA-packaging for each cell. Raman spectra obtained from sperm cells with normal shape provide evidence that DNA in these sperm is very efficiently packaged. We find, however, that the relative protein content per cell and DNA packaging efficiencies are distributed over a relatively wide range for sperm cells with both normal and abnormal shape. These findings indicate that single cell Raman spectroscopy should be a valuable tool in assessing the quality of sperm cells for in-vitro fertilization.

  2. Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

    2003-01-01

    Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

  3. DNA binding and aggregation by carbon nanoparticles

    International Nuclear Information System (INIS)

    An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo

    2010-01-01

    Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.

  4. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  5. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

    1978-01-01

    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  6. DNA adsorption and desorption on mica surface studied by atomic force microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sun Lanlan [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhao Dongxu [Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhang Yue; Xu Fugang [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Li Zhuang, E-mail: zli@ciac.jl.cn [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China)

    2011-05-15

    The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/{mu}L. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

  7. DNA adsorption and desorption on mica surface studied by atomic force microscopy

    International Nuclear Information System (INIS)

    Sun Lanlan; Zhao Dongxu; Zhang Yue; Xu Fugang; Li Zhuang

    2011-01-01

    The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/μL. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

  8. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  9. CEBPG transcription factor correlates with antioxidant and DNA repair genes in normal bronchial epithelial cells but not in individuals with bronchogenic carcinoma

    International Nuclear Information System (INIS)

    Mullins, D'Anna N; Crawford, Erin L; Khuder, Sadik A; Hernandez, Dawn-Alita; Yoon, Youngsook; Willey, James C

    2005-01-01

    Cigarette smoking is the primary cause of bronchogenic carcinoma (BC), yet only 10–15% of heavy smokers develop BC and it is likely that this variation in risk is, in part, genetically determined. We previously reported a set of antioxidant genes for which transcript abundance was lower in normal bronchial epithelial cells (NBEC) of BC individuals compared to non-BC individuals. In unpublished studies of the same NBEC samples, transcript abundance values for several DNA repair genes were correlated with these antioxidant genes. From these data, we hypothesized that antioxidant and DNA repair genes are co-regulated by one or more transcription factors and that inter-individual variation in expression and/or function of one or more of these transcription factors is responsible for inter-individual variation in risk for BC. The putative transcription factor recognition sites common to six of the antioxidant genes were identified through in silico DNA sequence analysis. The transcript abundance values of these transcription factors (n = 6) and an expanded group of antioxidant and DNA repair genes (n = 16) were measured simultaneously by quantitative PCR in NBEC of 24 non-BC and 25 BC individuals. CEBPG transcription factor was significantly (p < 0.01) correlated with eight of the antioxidant or DNA repair genes in non-BC individuals but not in BC individuals. In BC individuals the correlation with CEBPG was significantly (p < 0.01) lower than that of non-BC individuals for four of the genes (XRCC1, ERCC5, GSTP1, and SOD1) and the difference was nearly significant for GPX1. The only other transcription factor correlated with any of these five target genes in non-BC individuals was E2F1. E2F1 was correlated with GSTP1 among non-BC individuals, but in contrast to CEBPG, there was no significant difference in this correlation in non-BC individuals compared to BC individuals. We conclude that CEBPG is the transcription factor primarily responsible for regulating

  10. Single-molecule experiments in biological physics: methods and applications.

    Science.gov (United States)

    Ritort, F

    2006-08-16

    I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives.

  11. Single-molecule experiments in biological physics: methods and applications

    International Nuclear Information System (INIS)

    Ritort, F

    2006-01-01

    I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives. (topical review)

  12. Preparation and self-folding of amphiphilic DNA origami.

    Science.gov (United States)

    Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng

    2015-03-01

    Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. DNA under Force: Mechanics, Electrostatics, and Hydration

    Directory of Open Access Journals (Sweden)

    Jingqiang Li

    2015-02-01

    Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

  14. The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

    NARCIS (Netherlands)

    van den Berg, A.A.

    2017-01-01

    During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

  15. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  16. Real-time monitoring and manipulation of single bio-molecules in free solution

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hung-Wing [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    The observation and manipulation of single biomolecules allow their dynamic behaviors to be studied to provide insight into molecular genetics, biochip assembly, biosensor design, DNA biophysics. In a PDMS/glass microchannel, a nonuniform electroosmotic flow (EOF) was created. By using a scanning confocal fluorescence microscope and total internal-reflection fluorescence microscope (TIRFM), we demonstrated that negatively charged DNA molecules were focused by the nonuniform EOF into a thin layer at the glass surface. This phenomenon was applied to selectively detect target DNA molecules without requiring the separation of excessive probes and can be applied continuously to achieve high throughput. A variable-angle-TIRFM was constructed for imaging single DNA molecule dynamics at a solid/liquid interface. Implications we have are that the measured intensities cannot be used directly to determine the distances of molecules from the surface and the experimental counting results depict the distance-dependent dynamics of molecules near the surface; Molecules at low ionic strengths experience electrostatic repulsion at distances much further away from the surface than the calculated thickness of the electrical double layer. {delta}-DNA was employed as a nanoprobe for different functionalized surfaces to elucidate adsorption in chromatography. The 12-base unpaired ends of this DNA provide exposed purine and pyrimidine groups for adsorption. Patterns of self-assembled monolayers (SAMs) and patterns of metal oxides are generated. By recording the real-time dynamic motion of DNA molecules at the SAMs/aqueous interface, the various parameters governing the retention of an analyte during chromatographic separation can be studied. Even subtle differences among adsorptive forces can be revealed. Dynamic conformational changes of the prosthetic group, flavin adenine dinucleotide (FAD), in flavoprotein NADH peroxidase, in thioredoxin reductase, and in free solution were monitored

  17. Mitochondrial DNA copy number threshold in mtDNA depletion myopathy.

    Science.gov (United States)

    Durham, S E; Bonilla, E; Samuels, D C; DiMauro, S; Chinnery, P F

    2005-08-09

    The authors measured the absolute amount of mitochondrial DNA (mtDNA) within single muscle fibers from two patients with thymidine kinase 2 (TK2) deficiency and two healthy controls. TK2 deficient fibers containing more than 0.01 mtDNA/microm3 had residual cytochrome c oxidase (COX) activity. This defines the minimum amount of wild-type mtDNA molecules required to maintain COX activity in skeletal muscle and provides an explanation for the mosaic histochemical pattern seen in patients with mtDNA depletion syndrome.

  18. DNA-FET using carbon nanotube electrodes

    International Nuclear Information System (INIS)

    Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y

    2006-01-01

    We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages

  19. Simple technique for quantitation of low levels of DNA damage in individual cells

    International Nuclear Information System (INIS)

    Singh, N.P.; McCoy, M.T.; Tice, R.R.; Schneider, E.L.

    1988-01-01

    Human lymphocytes were either exposed to X-irradiation (25 to 200 rads) or treated with H 2 O 2 (9.1 to 291 microM) at 4 degrees C and the extent of DNA migration was measured using a single-cell microgel electrophoresis technique under alkaline conditions. Both agents induced a significant increase in DNA migration, beginning at the lowest dose evaluated. Migration patterns were relatively homogeneous among cells exposed to X-rays but heterogeneous among cells treated with H 2 O 2 . An analysis of repair kinetics following exposure to 200 rads X-rays was conducted with lymphocytes obtained from three individuals. The bulk of the DNA repair occurred within the first 15 min, while all of the repair was essentially complete by 120 min after exposure. However, some cells demonstrated no repair during this incubation period while other cells demonstrated DNA migration patterns indicative of more damage than that induced by the initial irradiation with X-rays. This technique appears to be sensitive and useful for detecting damage and repair in single cells

  20. Large branched self-assembled DNA complexes

    International Nuclear Information System (INIS)

    Tosch, Paul; Waelti, Christoph; Middelberg, Anton P J; Davies, A Giles

    2007-01-01

    Many biological molecules have been demonstrated to self-assemble into complex structures and networks by using their very efficient and selective molecular recognition processes. The use of biological molecules as scaffolds for the construction of functional devices by self-assembling nanoscale complexes onto the scaffolds has recently attracted significant attention and many different applications in this field have emerged. In particular DNA, owing to its inherent sophisticated self-organization and molecular recognition properties, has served widely as a scaffold for various nanotechnological self-assembly applications, with metallic and semiconducting nanoparticles, proteins, macromolecular complexes, inter alia, being assembled onto designed DNA scaffolds. Such scaffolds may typically contain multiple branch-points and comprise a number of DNA molecules selfassembled into the desired configuration. Previously, several studies have used synthetic methods to produce the constituent DNA of the scaffolds, but this typically constrains the size of the complexes. For applications that require larger self-assembling DNA complexes, several tens of nanometers or more, other techniques need to be employed. In this article, we discuss a generic technique to generate large branched DNA macromolecular complexes

  1. Solvated protein–DNA docking using HADDOCK

    International Nuclear Information System (INIS)

    Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J.

    2013-01-01

    Interfacial water molecules play an important role in many aspects of protein–DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein–DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein–DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein–DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein–DNA complexes.

  2. Solvated protein-DNA docking using HADDOCK

    Energy Technology Data Exchange (ETDEWEB)

    Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J., E-mail: a.m.j.j.bonvin@uu.nl [Utrecht University, Bijvoet Center for Biomolecular Research, Faculty of Science-Chemistry (Netherlands)

    2013-05-15

    Interfacial water molecules play an important role in many aspects of protein-DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein-DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein-DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein-DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein-DNA complexes.

  3. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    International Nuclear Information System (INIS)

    Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

    2011-01-01

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  4. Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

    Science.gov (United States)

    Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

    2018-01-01

    Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

  5. Non-sticky translocation of bio-molecules through Tween 20-coated solid-state nanopores in a wide pH range

    Science.gov (United States)

    Li, Xiaoqing; Hu, Rui; Li, Ji; Tong, Xin; Diao, J. J.; Yu, Dapeng; Zhao, Qing

    2016-10-01

    Nanopore-based sensing technology is considered high-throughput and low-cost for single molecule detection, but solid-state nanopores have suffered from pore clogging issues. A simple Tween 20 coating method is applied to ensure long-term (several hours) non-sticky translocation of various types of bio-molecules through SiN nanopores in a wide pH range (4.0-13.0). We also emphasize the importance of choosing appropriate concentration of Tween 20 coating buffer for desired effect. By coating nanopores with a Tween 20 layer, we are able to differentiate between single-stranded DNA and double-stranded DNA, to identify drift-dominated domain for single-stranded DNA, to estimate BSA volume and to observe the shape of individual nucleosome translocation event without non-specific adsorption. The wide pH endurance from 4.0 to 13.0 and the broad types of detection analytes including nucleic acids, proteins, and biological complexes highlight the great application potential of Tween 20-coated solid-state nanopores.

  6. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  7. DNA-protein crosslinks in peripheral lymphocytes of individuals exposed to hexavalent chromium compounds.

    Science.gov (United States)

    Zhitkovich, A; Lukanova, A; Popov, T; Taioli, E; Cohen, H; Costa, M; Toniolo, P

    1996-01-01

    Abstract DNA-protein crosslinks were measured in peripheral blood lymphocytes of chrome-platers and controls from Bulgaria in order to evaluate a genotoxic effect of human exposure to carcinogenic Cr(VI) compounds. Chrome-platers and most of the unexposed controls were from the industrial city of Jambol; some additional controls were recruited from the seaside town of Burgas. The chrome-platers had significantly elevated levels of chromium in pre- and post-shift urine, erythrocytes and lymphocytes compared with the control subjects. The largest differences between the two groups were found in erythrocyte chromium concentrations which are considered to be indicative of Cr(VI) exposure. Despite the significant differences in internal chromium doses, levels of DNA-protein crosslinks were not significantly different between the combined controls and exposed workers. Individual DNA-protein crosslinks, however, correlated strongly with chromium in erythrocytes at low and moderate doses but at high exposures, such as among the majority of chrome-platers, these DNA adducts were saturated at maximum levels. The saturation of DNA-protein crosslinks seems to occur at 7-8 μg I-(1) chromium in erythrocytes whereas a mean erythrocyte chromium among the chrome platers was as high as 22.8 μg l(-1). Occupationally unexposed subjects exhibited a significant variability with respect to the erythrocyte chromium concentration, however erythrocyte chromium levels correlated closely with DNA-protein crosslinks in lymphocytes. The controls from Jambol had higher chromium concentrations in erythrocytes and elevated levels of DNA-protein crosslinks compared with Burgas controls. Occupational exposure to formaldehyde among furniture factory workers did not change levels of DNA-protein crosslinks in peripheral lymphocytes. DNA-protein crosslink measurements showed a low intraindividual variability and their levels among both controls and exposed indivduals were not affected by smoking, age

  8. A patch-clamp ASIC for nanopore-based DNA analysis.

    Science.gov (United States)

    Kim, Jungsuk; Maitra, Raj; Pedrotti, Kenneth D; Dunbar, William B

    2013-06-01

    In this paper, a fully integrated high-sensitivity patch-clamp system is proposed for single-molecule deoxyribonucleic acid (DNA) analysis using a nanopore sensor. This system is composed of two main blocks for amplification and compensation. The amplification block is composed of three stages: 1) a headstage, 2) a voltage-gain difference amplifier, and 3) a track-and-hold circuit, that amplify a minute ionic current variation sensed by the nanopore while the compensation block avoids the headstage saturation caused by the input parasitic capacitances during sensing. By employing design techniques novel for this application, such as an instrumentation--amplifier topology and a compensation switch, we minimize the deleterious effects of the input-offset voltage and the input parasitic capacitances while attaining hardware simplicity. This system is fabricated in a 0.35 μm 4M2P CMOS process and is demonstrated using an α-hemolysin protein nanopore for detection of individual molecules of single-stranded DNA that pass through the 1.5 nm-diameter pore. In future work, the refined system will functionalize single and multiple solid-state nanopores formed in integrated microfluidic devices for advanced DNA analysis, in scientific and diagnostic applications.

  9. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.

    2017-06-06

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  10. Conserved linear dynamics of single-molecule Brownian motion

    Science.gov (United States)

    Serag, Maged F.; Habuchi, Satoshi

    2017-06-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  11. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.; Habuchi, Satoshi

    2017-01-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  12. Synthesis and detection of 3'-OH terminal biotin-labeled DNA probes

    International Nuclear Information System (INIS)

    Brakel, C.L.; Engelhardt, D.L.

    1985-01-01

    Nick translation has been used to prepare biotin-dUTP-containing DNA probes. These stable DNA probes have been identified, following hybridization to target DNA, by fluorescence using antibiotin antibodies or by enzyme reactions in which the enzyme has been linked to avidin or streptavidin. It is probable that this technology will be applicable to certain diagnostic determinations and that, with sufficient sensitivity, this technology might provide a system for obtaining rapid and specific diagnoses in situations presently requiring time-consuming growth assays. The sensitivity of this assay can be increased in two ways: (1) by increasing the amount of biotin contained in the DNA probes, and (2) by increasing the response to individual biotin molecules in the DNA probes. This report demonstrates that terminal deoxynucleotide transferase can be employed to increase the biotin content of DNA probes. We also introduce a new streptavidin-linked enzyme system that produces a greater response to biotinylated DNA probes than does streptavidin-linked horseradish peroxidase

  13. The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

    Science.gov (United States)

    Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

    2011-01-25

    DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

  14. Conformation-dependent DNA attraction.

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-06-21

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

  15. Supercoiled circular DNA of an insect granulosis virus.

    Science.gov (United States)

    Tweeten, K A; Bulla, L A; Consigli, R A

    1977-08-01

    The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.

  16. Supercoil Formation During DNA Melting

    Science.gov (United States)

    Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

    2009-03-01

    Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

  17. DNA confinement in nanochannels: physics and biological applications

    DEFF Research Database (Denmark)

    Reisner, Walter; Pedersen, Jonas Nyvold; Austin, Robert H

    2012-01-01

    in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense...... direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined...... biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100μm range. (Some...

  18. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura

    2016-10-01

    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  19. Control of electrical conduction in DNA using hole doping

    Science.gov (United States)

    Lee, Hea-Yeon; Taniguchi, Masateru; Yoo, K. H.; Otsuka, Youichi; Tanaka, Hidekazu; Kawai, Tomoji

    2002-03-01

    Control of electrical conduction in DNA using hole doping H.Y.Lee1, M.Taniguchi1, K.H.Yoo2, Y.Otsuka1 H.Tanaka1 and T.Kawai1 1The Institute of Scientific and Industrial Research(ISIR), Osaka University, Osaka, Japan. 2Department of Physics, Younsei University, Seoul, Korea Possible applications of DNA molecules in electronic devices and biosensors were suggested almost ten years ago A DNA structure containing a single type of base pair appears to be a good candidate for conduction along the \\x81E-electron clouds of the stacked bases. There have been lots of investigations on conduction mechanisms of the DNA molecules. However, it is not still clear whether the observed conductions of some DNA molecules come from motions of either ionic charges or other carriers. Although the basic mechanism for DNA-mediated charge transport should be understood for electronic applications, there have been divergent reports on its nature. And I will be present the research for the charge carrier conduction of DNA film under oxygen and iodine gas by using 10¡V100 nm gap. The doping studies using oxygen and iodine gas can provide a definite answer for the carrier conduction mechanism and also a possible method to control the carrier concentration in DNA molecules. Using oxygen and iodine adsorption experiments on the poly (dG)-poly (dC) DNA molecules, we will show that their conductance becomes increased easily by several orders of magnitudes due to the hole doping, which is a characteristic behavior of a p-type semiconductor. On the other hand, we will also show that the poly (dA) - poly (dT) DNA molecules behave as an n-type semiconductor. Our works indicate that the concentration and the type of carriers in the DNA molecules could be controlled using proper doping methods. We expect that this would be a major breakthrough in DNA-based nano-electronics, similar to the fact that the doped conductive has polyacetylene opened up a new field of electronics with exciting implications

  20. Micropatterning stretched and aligned DNA for sequence-specific nanolithography

    Science.gov (United States)

    Petit, Cecilia Anna Paulette

    Techniques for fabricating nanostructured materials can be categorized as either "top-down" or "bottom-up". Top-down techniques use lithography and contact printing to create patterned surfaces and microfluidic channels that can corral and organize nanoscale structures, such as molecules and nanorods in contrast; bottom-up techniques use self-assembly or molecular recognition to direct the organization of materials. A central goal in nanotechnology is the integration of bottom-up and top-down assembly strategies for materials development, device design; and process integration. With this goal in mind, we have developed strategies that will allow this integration by using DNA as a template for nanofabrication; two top-down approaches allow the placement of these templates, while the bottom-up technique uses the specific sequence of bases to pattern materials along each strand of DNA. Our first top-down approach, termed combing of molecules in microchannels (COMMIC), produces microscopic patterns of stretched and aligned molecules of DNA on surfaces. This process consists of passing an air-water interface over end adsorbed molecules inside microfabricated channels. The geometry of the microchannel directs the placement of the DNA molecules, while the geometry of the airwater interface directs the local orientation and curvature of the molecules. We developed another top-down strategy for creating micropatterns of stretched and aligned DNA using surface chemistry. Because DNA stretching occurs on hydrophobic surfaces, this technique uses photolithography to pattern vinyl-terminated silanes on glass When these surface-, are immersed in DNA solution, molecules adhere preferentially to the silanized areas. This approach has also proven useful in patterning protein for cell adhesion studies. Finally, we describe the use of these stretched and aligned molecules of DNA as templates for the subsequent bottom-up construction of hetero-structures through hybridization

  1. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  2. On the electrostatics of DNA in chromatin

    Directory of Open Access Journals (Sweden)

    Klemen Bohinc

    2016-02-01

    Full Text Available We examine the interaction between DNA molecules immersed in an aqueous solution of oppositely charged, trivalent spermidine molecules. The DNA molecules are modeled as planar, likecharged surfaces immersed in an aqueous solution of multivalent, rod-like ions consisting of rigidly bonded point charges. An approximate field theory is used to determine the properties of this system from the weak to the intermediate through to the strong coupling regimes. In the weak coupling limit, the interaction between the charged surfaces is only repulsive, whereas in the intermediate coupling regime, the rod-like ions with spatial charge distribution can induce attractive force between the charged surfaces. In the strong coupling limit, the inter-ionic charge correlations induce attractive interaction at short separations between the surfaces. This theoretical study can give new insights in the problem of interaction between DNA molecules mediated by trivalent spermidine molecules.

  3. Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.

    Science.gov (United States)

    Yang, Darren; Wong, Wesley P

    2018-01-01

    We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.

  4. Counting molecules in cell-free DNA and single cells RNA

    OpenAIRE

    Karlsson, Kasper

    2016-01-01

    The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...

  5. DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

    Science.gov (United States)

    Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R

    2017-01-11

    DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

  6. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process

    Science.gov (United States)

    Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.

    2011-01-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589

  7. Combining crystallography and EPR: crystal and solution structures of the multidomain cochaperone DnaJ

    Energy Technology Data Exchange (ETDEWEB)

    Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de [MPI for Medical Research, Heidelberg (Germany); Brosi, Richard W. W. [Freie Universitat Berlin, Berlin (Germany); Steinmetz, Andrea; Scherer, Anna; Hartmann, Elisabeth; Eschenbach, Jessica; Lorenz, Thorsten [MPI for Medical Research, Heidelberg (Germany); Seidel, Ralf [MPI for Molecular Physiology, Dortmund (Germany); Shoeman, Robert L.; Zimmermann, Sabine [MPI for Medical Research, Heidelberg (Germany); Bittl, Robert [Freie Universitat Berlin, Berlin (Germany); Schlichting, Ilme; Reinstein, Jochen [MPI for Medical Research, Heidelberg (Germany)

    2013-08-01

    The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein, but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.

  8. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2011-01-24

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  9. Procedure for normalization of cDNA libraries

    Science.gov (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  10. Loading dynamics of a sliding DNA clamp.

    KAUST Repository

    Cho, Won-Ki

    2014-05-22

    Sliding DNA clamps are loaded at a ss/dsDNA junction by a clamp loader that depends on ATP binding for clamp opening. Sequential ATP hydrolysis results in closure of the clamp so that it completely encircles and diffuses on dsDNA. We followed events during loading of an E. coli β clamp in real time by using single-molecule FRET (smFRET). Three successive FRET states were retained for 0.3 s, 0.7 s, and 9 min: Hydrolysis of the first ATP molecule by the γ clamp loader resulted in closure of the clamp in 0.3 s, and after 0.7 s in the closed conformation, the clamp was released to diffuse on the dsDNA for at least 9 min. An additional single-molecule polarization study revealed that the interfacial domain of the clamp rotated in plane by approximately 8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.

  11. DNA conformation on surfaces measured by fluorescence self-interference.

    Science.gov (United States)

    Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R

    2006-02-21

    The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

  12. Distribution of distances between DNA barcode labels in nanochannels close to the persistence length

    Science.gov (United States)

    Reinhart, Wesley F.; Reifenberger, Jeff G.; Gupta, Damini; Muralidhar, Abhiram; Sheats, Julian; Cao, Han; Dorfman, Kevin D.

    2015-02-01

    We obtained experimental extension data for barcoded E. coli genomic DNA molecules confined in nanochannels from 40 nm to 51 nm in width. The resulting data set consists of 1 627 779 measurements of the distance between fluorescent probes on 25 407 individual molecules. The probability density for the extension between labels is negatively skewed, and the magnitude of the skewness is relatively insensitive to the distance between labels. The two Odijk theories for DNA confinement bracket the mean extension and its variance, consistent with the scaling arguments underlying the theories. We also find that a harmonic approximation to the free energy, obtained directly from the probability density for the distance between barcode labels, leads to substantial quantitative error in the variance of the extension data. These results suggest that a theory for DNA confinement in such channels must account for the anharmonic nature of the free energy as a function of chain extension.

  13. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  14. Proceedings of the workshop. Recognition of DNA damage as onset of successful repair. Computational and experimental approaches

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2002-03-01

    This was held at The Tokai Research Establishment, Japan Atomic Energy Research Institute, on the 18th and 19th of December 2001. The Laboratory of Radiation Risk Analysis of JAERI organized the workshop. The main subject of the workshop was the DNA damage and its repair. Presented works described the leading experimental as well computational approaches, focusing mainly on the formation of DNA damage, its proliferation, enzymatic recognition and repair, and finally imaging and detection of lesions on a DNA molecule. The 19 of the presented papers are indexed individually. (J.P.N.)

  15. Alternative end-joining of DNA breaks

    NARCIS (Netherlands)

    Schendel, Robin van

    2016-01-01

    DNA is arguably the most important molecule found in any organism, as it contains all information to perform cellular functions and enables continuity of species. It is continuously exposed to DNA-damaging agents both from endogenous and exogenous sources. To protect DNA against these sources of DNA

  16. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  17. Development of novel vaccines using DNA shuffling and screening strategies.

    Science.gov (United States)

    Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

    2004-02-01

    DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

  18. A novel small molecule inhibitor of the DNA repair protein Ku70/80.

    Science.gov (United States)

    Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka

    2016-07-01

    Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All

  19. Single DNA denaturation and bubble dynamics

    International Nuclear Information System (INIS)

    Metzler, Ralf; Ambjoernsson, Tobias; Hanke, Andreas; Fogedby, Hans C

    2009-01-01

    While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation bubbles and selectively single-stranded DNA binding proteins.

  20. Electron Paramagnetic Resonance of a Single NV Nanodiamond Attached to an Individual Biomolecule.

    Science.gov (United States)

    Teeling-Smith, Richelle M; Jung, Young Woo; Scozzaro, Nicolas; Cardellino, Jeremy; Rampersaud, Isaac; North, Justin A; Šimon, Marek; Bhallamudi, Vidya P; Rampersaud, Arfaan; Johnston-Halperin, Ezekiel; Poirier, Michael G; Hammel, P Chris

    2016-05-10

    Electron paramagnetic resonance (EPR), an established and powerful methodology for studying atomic-scale biomolecular structure and dynamics, typically requires in excess of 10(12) labeled biomolecules. Single-molecule measurements provide improved insights into heterogeneous behaviors that can be masked in ensemble measurements and are often essential for illuminating the molecular mechanisms behind the function of a biomolecule. Here, we report EPR measurements of a single labeled biomolecule. We selectively label an individual double-stranded DNA molecule with a single nanodiamond containing nitrogen-vacancy centers, and optically detect the paramagnetic resonance of nitrogen-vacancy spins in the nanodiamond probe. Analysis of the spectrum reveals that the nanodiamond probe has complete rotational freedom and that the characteristic timescale for reorientation of the nanodiamond probe is slow compared with the transverse spin relaxation time. This demonstration of EPR spectroscopy of a single nanodiamond-labeled DNA provides the foundation for the development of single-molecule magnetic resonance studies of complex biomolecular systems. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  1. Use of DNA from bite marks can determine species and individual animals that attack humans

    Science.gov (United States)

    Farley, Sean; Talbot, Sandra L.; Sage, George K.; Sinnott, Rick; Coltrane, Jessica

    2014-01-01

    During the summer of 2008, 6 documented attacks and close encounters with brown bears (Ursus arctos) occurred in the greater Anchorage, Alaska (USA) area. We discuss findings from 2 incidents in which people were mauled within 2 km of each other over a 6-week period and in which it was assumed that a single animal was responsible. To ensure public safety, authorities killed a brown bear implicated in the attacks by circumstantial evidence, though it was not known a priori that the animal was responsible. We extracted DNA from hairs and bite sites on the clothing of both victims and determined species and individual identity of the animal(s) involved in both incidents. Genetic data indicated the brown bear killed by authorities was responsible for one of the maulings, but not both. This research demonstrates that DNA-based techniques, with appropriate sampling, can provide unambiguous identification of animals involved in attacks, as well as provide reasonable justification for excluding others. Because DNA-based techniques can unequivocally identify individual bears carrying out attacks, they should be considered a standard method employed in wildlife attack investigations.

  2. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  3. Single DNA denaturation and bubble dynamics

    DEFF Research Database (Denmark)

    Metzler, Ralf; Ambjörnsson, Tobias; Hanke, Andreas

    2009-01-01

    While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration......, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments...... for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation...

  4. Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

    International Nuclear Information System (INIS)

    Tabet, J.

    2007-11-01

    The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

  5. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin; Wang, Mei; Rhein, Andreas; Weier, Jingly; Weier, Heinz-Ulli

    2008-12-16

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-?B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  6. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin M.; Wang, Mei; Rhein, Andreas P.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-12-04

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-{kappa}B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  7. mtDNA copy number in oocytes of different sizes from individual pre- and post-pubertal pigs

    DEFF Research Database (Denmark)

    Pedersen, Hanne Skovsgaard; Løvendahl, Peter; Larsen, Knud Erik

    2014-01-01

    from ovaries of 10 pre- and 10 post-pubertal pigs. Cumulus cells were removed and the oocytes were measured (inside-ZP-diameter). Oocytes were transferred to DNAase-free tubes, snap-frozen, and stored at –80°C. The genes ND1 and COX1 were used to determine the mtDNA copy number. Plasmid preparations...... Reproduction 131, 233–245). However, the correlation between size and mtDNA copy number in single oocytes has not been determined. This study describes the relation between oocytes of defined diameters from individual pre- and postpubertal pigs and mtDNA copy number. Cumulus-oocyte complexes were aspirated...

  8. Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA

    Science.gov (United States)

    Altiparmak, Melek; Nakiboglu Tezer, Mahmure

    2009-01-01

    Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

  9. TOPICAL REVIEW: Single-molecule experiments in biological physics: methods and applications

    Science.gov (United States)

    Ritort, F.

    2006-08-01

    I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives.

  10. Early models of DNA damage formation

    International Nuclear Information System (INIS)

    Śmiałek, Małgorzata A

    2012-01-01

    Quantification of DNA damage, induced by various types of incident radiation as well as chemical agents, has been the subject of many theoretical and experimental studies, supporting the development of modern cancer therapy. The primary observations showed that many factors can lead to damage of DNA molecules. It became clear that the development of experimental techniques for exploring this phenomenon is required. Another problem was simultaneously dealt with, anticipating on how the damage is distributed within the double helix of the DNA molecule and how the single strand break formation and accumulation can influence the lethal double strand break formation. In this work the most important probabilistic models for DNA strand breakage and damage propagation are summarized and compared.

  11. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  12. A wireless centrifuge force microscope (CFM) enables multiplexed single-molecule experiments in a commercial centrifuge.

    Science.gov (United States)

    Hoang, Tony; Patel, Dhruv S; Halvorsen, Ken

    2016-08-01

    The centrifuge force microscope (CFM) was recently introduced as a platform for massively parallel single-molecule manipulation and analysis. Here we developed a low-cost and self-contained CFM module that works directly within a commercial centrifuge, greatly improving accessibility and ease of use. Our instrument incorporates research grade video microscopy, a power source, a computer, and wireless transmission capability to simultaneously monitor many individually tethered microspheres. We validated the instrument by performing single-molecule force shearing of short DNA duplexes. For a 7 bp duplex, we observed over 1000 dissociation events due to force dependent shearing from 2 pN to 12 pN with dissociation times in the range of 10-100 s. We extended the measurement to a 10 bp duplex, applying a 12 pN force clamp and directly observing single-molecule dissociation over an 85 min experiment. Our new CFM module facilitates simple and inexpensive experiments that dramatically improve access to single-molecule analysis.

  13. Model of biological quantum logic in DNA.

    Science.gov (United States)

    Mihelic, F Matthew

    2013-08-02

    The DNA molecule has properties that allow it to act as a quantum logic processor. It has been demonstrated that there is coherent conduction of electrons longitudinally along the DNA molecule through pi stacking interactions of the aromatic nucleotide bases, and it has also been demonstrated that electrons moving longitudinally along the DNA molecule are subject to a very efficient electron spin filtering effect as the helicity of the DNA molecule interacts with the spin of the electron. This means that, in DNA, electrons are coherently conducted along a very efficient spin filter. Coherent electron spin is held in a logically and thermodynamically reversible chiral symmetry between the C2-endo and C3-endo enantiomers of the deoxyribose moiety in each nucleotide, which enables each nucleotide to function as a quantum gate. The symmetry break that provides for quantum decision in the system is determined by the spin direction of an electron that has an orbital angular momentum that is sufficient to overcome the energy barrier of the double well potential separating the C2-endo and C3-endo enantiomers, and that enantiomeric energy barrier is appropriate to the Landauer limit of the energy necessary to randomize one bit of information.

  14. Multiplexed single-molecule force spectroscopy using a centrifuge.

    Science.gov (United States)

    Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P

    2016-03-17

    We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.

  15. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen

    2005-01-01

    Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed...... in a denaturation bubble are shown to involve an interesting competition of time scales, varying between kinetic blocking of protein binding up to full binding protein-induced denaturation of the DNA. We will also address the potential to use DNA physics for the design of nanosensors. Finally, we report recent...

  16. Enzyme Molecules in Solitary Confinement

    Directory of Open Access Journals (Sweden)

    Raphaela B. Liebherr

    2014-09-01

    Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  17. Co-Immobilization of Proteins and DNA Origami Nanoplates to Produce High-Contrast Biomolecular Nanoarrays.

    Science.gov (United States)

    Hager, Roland; Burns, Jonathan R; Grydlik, Martyna J; Halilovic, Alma; Haselgrübler, Thomas; Schäffler, Friedrich; Howorka, Stefan

    2016-06-01

    The biofunctionalization of nanopatterned surfaces with DNA origami nanostructures is an important topic in nanobiotechnology. An unexplored challenge is, however, to co-immobilize proteins with DNA origami at pre-determined substrate sites in high contrast relative to the nontarget areas. The immobilization should, in addition, preferably be achieved on a transparent substrate to allow ultrasensitive optical detection. If successful, specific co-binding would be a step towards stoichiometrically defined arrays with few to individual protein molecules per site. Here, we successfully immobilize with high specificity positively charged avidin proteins and negatively charged DNA origami nanoplates on 100 nm-wide carbon nanoislands while suppressing undesired adsorption to surrounding nontarget areas. The arrays on glass slides achieve unprecedented selectivity factors of up to 4000 and allow ultrasensitive fluorescence read-out. The co-immobilization onto the nanoislands leads to layered biomolecular architectures, which are functional because bound DNA origami influences the number of capturing sites on the nanopatches for other proteins. The novel hybrid DNA origami-protein nanoarrays allow the fabrication of versatile research platforms for applications in biosensing, biophysics, and cell biology, and, in addition, represent an important step towards single-molecule protein arrays. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Modeling inhomogeneous DNA replication kinetics.

    Directory of Open Access Journals (Sweden)

    Michel G Gauthier

    Full Text Available In eukaryotic organisms, DNA replication is initiated at a series of chromosomal locations called origins, where replication forks are assembled proceeding bidirectionally to replicate the genome. The distribution and firing rate of these origins, in conjunction with the velocity at which forks progress, dictate the program of the replication process. Previous attempts at modeling DNA replication in eukaryotes have focused on cases where the firing rate and the velocity of replication forks are homogeneous, or uniform, across the genome. However, it is now known that there are large variations in origin activity along the genome and variations in fork velocities can also take place. Here, we generalize previous approaches to modeling replication, to allow for arbitrary spatial variation of initiation rates and fork velocities. We derive rate equations for left- and right-moving forks and for replication probability over time that can be solved numerically to obtain the mean-field replication program. This method accurately reproduces the results of DNA replication simulation. We also successfully adapted our approach to the inverse problem of fitting measurements of DNA replication performed on single DNA molecules. Since such measurements are performed on specified portion of the genome, the examined DNA molecules may be replicated by forks that originate either within the studied molecule or outside of it. This problem was solved by using an effective flux of incoming replication forks at the model boundaries to represent the origin activity outside the studied region. Using this approach, we show that reliable inferences can be made about the replication of specific portions of the genome even if the amount of data that can be obtained from single-molecule experiments is generally limited.

  19. Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.

    Science.gov (United States)

    Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V

    2011-12-01

    A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.

  20. Fluorescence correlation spectroscopy analysis for accurate determination of proportion of doubly labeled DNA in fluorescent DNA pool for quantitative biochemical assays.

    Science.gov (United States)

    Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert

    2014-01-15

    Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Precise Coating of a Wide Range of DNA Templates by a Protein Polymer with a DNA Binding Domain

    NARCIS (Netherlands)

    Hernandez-Garcia, Armando; Estrich, Nicole A.; Werten, Marc W.T.; Maarel, van der Johan R.C.; Labean, Thomas H.; Wolf, de Frits A.; Cohen Stuart, Martien A.; Vries, de Renko

    2017-01-01

    Emerging DNA-based nanotechnologies would benefit from the ability to modulate the properties (e.g., solubility, melting temperature, chemical stability) of diverse DNA templates (single molecules or origami nanostructures) through controlled, self-assembling coatings. We here introduce a DNA

  2. Simple Laboratory methods to measure cell proliferation using DNA synthesis property

    Directory of Open Access Journals (Sweden)

    Madhavan H N

    2007-01-01

    Full Text Available This is a mini-review on the techniques to measure proliferation of cells by estimation of DNA synthesis. This is not an exhaustive review of literature, but a bird’s eye view of a few selected articles which may provide the technical details to the readers.The nucleus of a cell occupies about 10-30% of the cells space, depends on the type of genetic material (DNA -DeoxyriboNucleic Acid. DNA is a long, double-stranded, helical molecule which carries the genetic information. Duplication of the DNA takes place by the phenomena of replication. One copy of double-stranded DNA molecule forms two double-stranded DNA molecules. DNA replication is the fundamental process used in all living organisms as it is the basis for biological inheritance. This process is known also as Mitosis in somatic cells. In Mitosis, the duplication process results in two genetically identical "daughter" cells from a single "parent" cell. The resulting double-stranded DNA molecules are identical; proof reading and error-checking mechanisms exist to ensure near perfect pair. Mitosis is divided into six phases: prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis.

  3. Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

    Science.gov (United States)

    Huschka, Ryan

    Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on

  4. DNA damage in plant herbarium tissue.

    Science.gov (United States)

    Staats, Martijn; Cuenca, Argelia; Richardson, James E; Vrielink-van Ginkel, Ria; Petersen, Gitte; Seberg, Ole; Bakker, Freek T

    2011-01-01

    Dried plant herbarium specimens are potentially a valuable source of DNA. Efforts to obtain genetic information from this source are often hindered by an inability to obtain amplifiable DNA as herbarium DNA is typically highly degraded. DNA post-mortem damage may not only reduce the number of amplifiable template molecules, but may also lead to the generation of erroneous sequence information. A qualitative and quantitative assessment of DNA post-mortem damage is essential to determine the accuracy of molecular data from herbarium specimens. In this study we present an assessment of DNA damage as miscoding lesions in herbarium specimens using 454-sequencing of amplicons derived from plastid, mitochondrial, and nuclear DNA. In addition, we assess DNA degradation as a result of strand breaks and other types of polymerase non-bypassable damage by quantitative real-time PCR. Comparing four pairs of fresh and herbarium specimens of the same individuals we quantitatively assess post-mortem DNA damage, directly after specimen preparation, as well as after long-term herbarium storage. After specimen preparation we estimate the proportion of gene copy numbers of plastid, mitochondrial, and nuclear DNA to be 2.4-3.8% of fresh control DNA and 1.0-1.3% after long-term herbarium storage, indicating that nearly all DNA damage occurs on specimen preparation. In addition, there is no evidence of preferential degradation of organelle versus nuclear genomes. Increased levels of C→T/G→A transitions were observed in old herbarium plastid DNA, representing 21.8% of observed miscoding lesions. We interpret this type of post-mortem DNA damage-derived modification to have arisen from the hydrolytic deamination of cytosine during long-term herbarium storage. Our results suggest that reliable sequence data can be obtained from herbarium specimens.

  5. LEGO-like DNA Structures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager

    2012-01-01

    -dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...

  6. Ribosomal DNA-binding proteins in the nucleolus of Physarum polycephalum

    International Nuclear Information System (INIS)

    Graham-Lorence, S.E.

    1987-01-01

    In Physarum polycephalum, the nucleoli are extra chromosomal structures containing 200 to 400 copies of a linear 60 kilobase palindromic rDNA molecule. These rDNA molecules are organized into minichromosomes which apparently are held within a nucleolar protein matrix. To obtained evidence for attachment of the rDNA to such a matrix, both intact and lithium diiodosalicylate/NaCl-extracted nucleoli were digested for various lengths of time with micrococcal nuclease, so that portions of the rDNA molecules not attached within the nucleolar structure would be released. Nucleolar DNA-binding proteins were determined by blotting electrophoretically separated proteins from SDS-polyacrylamide gels onto nitrocellulose paper and probing them with radiolabeled DNA. In addition to the histones and lexosome proteins, eight DNA-binding proteins were identified having molecular weights of 25, 38, 47, 53, 55, 67, and 70 kD, with the 47, 53, 67, and 70 kD proteins requiring Ca 2+ for binding

  7. Nanopore sensors for DNA analysis

    DEFF Research Database (Denmark)

    Solovyeva, Vita; Venkatesan, B.M.; Shim, Jeong

    2012-01-01

    Solid-state nanopore sensors are promising devices for single DNA molecule detection and sequencing. This paper presents a review of our work on solid-state nanopores performed over the last decade. In particular, here we discuss atomic-layer-deposited (ALD)-based, graphene-based, and functionali......Solid-state nanopore sensors are promising devices for single DNA molecule detection and sequencing. This paper presents a review of our work on solid-state nanopores performed over the last decade. In particular, here we discuss atomic-layer-deposited (ALD)-based, graphene...

  8. DNA Electronic Fingerprints by Local Spectroscopy on Graphene

    Science.gov (United States)

    Balatsky, Alexander

    2013-03-01

    Working and scalable alternatives to the conventional chemical methods of DNA sequencing that are based on electronic/ionic signatures would revolutionize the field of sequencing. The approach of a single molecule imaging and spectroscopy with unprecedented resolution, achieved by Scanning Tunneling Spectroscopy (STS) and nanopore electronics could enable this revolution. We use the data from our group and others in applying this local scanning tunneling microscopy and illustrate possibilities of electronic sequencing of freeze dried deposits on graphene. We will present two types of calculated fingerprints: first in Local Density of States (LDOS) of DNA nucleotide bases (A,C,G,T) deposited on graphene. Significant base-dependent features in the LDOS in an energy range within few eV of the Fermi level were found in our calculations. These features can serve as electronic fingerprints for the identification of individual bases in STS. In the second approach we present calculated base dependent electronic transverse conductance as DNA translocates through the graphene nanopore. Thus we argue that the fingerprints of DNA-graphene hybrid structures may provide an alternative route to DNA sequencing using STS. Work supported by US DOE, NORDITA.

  9. Metallization of DNA on silicon surface

    International Nuclear Information System (INIS)

    Puchkova, Anastasiya Olegovna; Sokolov, Petr; Petrov, Yuri Vladimirovich; Kasyanenko, Nina Anatolievna

    2011-01-01

    New simple way for silver deoxyribonucleic acid (DNA)-based nanowires preparation on silicon surface was developed. The electrochemical reduction of silver ions fixed on DNA molecule provides the forming of tightly matched zonate silver clusters. Highly homogeneous metallic clusters have a size about 30 nm. So the thickness of nanowires does not exceed 30–50 nm. The surface of n-type silicon monocrystal is the most convenient substrate for this procedure. The comparative analysis of DNA metallization on of n-type silicon with a similar way for nanowires fabrication on p-type silicon, freshly cleaved mica, and glass surface shows the advantage of n-type silicon, which is not only the substrate for DNA fixation but also the source of electrons for silver reduction. Images of bound DNA molecules and fabricated nanowires have been obtained using an atomic force microscope and a scanning ion helium microscope. DNA interaction with silver ions in a solution was examined by the methods of ultraviolet spectroscopy and circular dichroism.

  10. Ligation bias in Illumina next-generation DNA libraries

    DEFF Research Database (Denmark)

    Seguin-Orlando, Andaine; Schubert, Mikkel; Clary, Joel

    2013-01-01

    Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products,...... for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries.......Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by......-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate...

  11. Low energy electron-initiated ion-molecule reactions of ribose analogues

    International Nuclear Information System (INIS)

    Mozejko, P.

    2003-01-01

    Recent experiments in which plasmid DNA samples were bombarded with low energy ( 2 O, DNA bases, and sugar-phosphate backbone analogues. To this end, the cyclic molecule tetrahydrofuran, and its derivatives, provide useful models for the sugar-like molecules contained in the backbone of DNA. In addition to LEE induced dissociation by processes such as dissociative electron attachment (DEA), molecules may be damaged by ions and neutral species of non-thermal energies created by LEE in the surrounding environment. In this contribution, we investigate with electron stimulated desorption techniques, LEE damage to films of desoxy-ribose analogues in the presence of various molecular coadsorbates, that simulate changes in local molecular environment. In one type of experiments tetrahydrofuran is deposited onto multilayer O2. A desorbed signal of OH - indicates ion-molecule reactions of the type O - + C 4 H 8 O -> OH - + C 4 H 7 O, where the O - was formed initially by DEA to O 2 . Further electron stimulated desorption measurements for tetrahydrofuran and derivatives adsorbed on H 2 O, Kr, N 2 O and CH 3 OH will be presented and discussed

  12. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  13. Pros and cons of methylation-based enrichment methods for ancient DNA

    Science.gov (United States)

    Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic

    2015-01-01

    The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828

  14. DNA: Polymer and molecular code

    Science.gov (United States)

    Shivashankar, G. V.

    1999-10-01

    The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes

  15. Probe DNA-Cisplatin Interaction with Solid-State Nanopores

    Science.gov (United States)

    Zhou, Zhi; Hu, Ying; Li, Wei; Xu, Zhi; Wang, Pengye; Bai, Xuedong; Shan, Xinyan; Lu, Xinghua; Nanopore Collaboration

    2014-03-01

    Understanding the mechanism of DNA-cisplatin interaction is essential for clinical application and novel drug design. As an emerging single-molecule technology, solid-state nanopore has been employed in biomolecule detection and probing DNA-molecule interactions. Herein, we reported a real-time monitoring of DNA-cisplatin interaction by employing solid-state SiN nanopores. The DNA-cisplatin interacting process is clearly classified into three stages by measuring the capture rate of DNA-cisplatin adducts. In the first stage, the negative charged DNA molecules were partially discharged due to the bonding of positive charged cisplatin and forming of mono-adducts. In the second stage, forming of DNA-cisplatin di-adducts with the adjacent bases results in DNA bending and softening. The capture rate increases since the softened bi-adducts experience a lower barrier to thread into the nanopores. In the third stage, complex structures, such as micro-loop, are formed and the DNA-cisplatin adducts are aggregated. The capture rate decreases to zero as the aggregated adduct grows to the size of the pore. The characteristic time of this stage was found to be linear with the diameter of the nanopore and this dynamic process can be described with a second-order reaction model. We are grateful to Laboratory of Microfabrication, Dr. Y. Yao, and Prof. R.C. Yu (Institute of Physics, Chinese Academy of Sciences) for technical assistance.

  16. Hysteresis in pressure-driven DNA denaturation.

    Directory of Open Access Journals (Sweden)

    Enrique Hernández-Lemus

    Full Text Available In the past, a great deal of attention has been drawn to thermal driven denaturation processes. In recent years, however, the discovery of stress-induced denaturation, observed at the one-molecule level, has revealed new insights into the complex phenomena involved in the thermo-mechanics of DNA function. Understanding the effect of local pressure variations in DNA stability is thus an appealing topic. Such processes as cellular stress, dehydration, and changes in the ionic strength of the medium could explain local pressure changes that will affect the molecular mechanics of DNA and hence its stability. In this work, a theory that accounts for hysteresis in pressure-driven DNA denaturation is proposed. We here combine an irreversible thermodynamic approach with an equation of state based on the Poisson-Boltzmann cell model. The latter one provides a good description of the osmotic pressure over a wide range of DNA concentrations. The resulting theoretical framework predicts, in general, the process of denaturation and, in particular, hysteresis curves for a DNA sequence in terms of system parameters such as salt concentration, density of DNA molecules and temperature in addition to structural and configurational states of DNA. Furthermore, this formalism can be naturally extended to more complex situations, for example, in cases where the host medium is made up of asymmetric salts or in the description of the (helical-like charge distribution along the DNA molecule. Moreover, since this study incorporates the effect of pressure through a thermodynamic analysis, much of what is known from temperature-driven experiments will shed light on the pressure-induced melting issue.

  17. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  18. Tumor‐associated DNA mutation detection in individuals undergoing colonoscopy

    OpenAIRE

    Fleshner, Phillip; Braunstein, Glenn D.; Ovsepyan, Gayane; Tonozzi, Theresa R.; Kammesheidt, Anja

    2017-01-01

    Abstract The majority of colorectal cancers (CRC) harbor somatic mutations and epigenetic modifications in the tumor tissue, and some of these mutations can be detected in plasma as circulating tumor DNA (ctDNA). Precancerous colorectal lesions also contain many of these same mutations. This study examined plasma for ctDNA from patients undergoing a screening or diagnostic colonoscopy to determine the sensitivity and specificity of the ctDNA panel for detecting CRC and precancerous lesions. T...

  19. Single-molecule dynamics in nanofabricated traps

    Science.gov (United States)

    Cohen, Adam

    2009-03-01

    The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

  20. Nucleic Acids as Information Molecules.

    Science.gov (United States)

    McInerney, Joseph D.

    1996-01-01

    Presents an activity that aims at enabling students to recognize that DNA and RNA are information molecules whose function is to store, copy, and make available the information in biological systems, without feeling overwhelmed by the specialized vocabulary and the minutia of the central dogma. (JRH)

  1. DNA profiling of trace DNA recovered from bedding.

    Science.gov (United States)

    Petricevic, Susan F; Bright, Jo-Anne; Cockerton, Sarah L

    2006-05-25

    Trace DNA is often detected on handled items and worn clothing examined in forensic laboratories. In this study, the potential transfer of trace DNA to bedding by normal contact, when an individual sleeps in a bed, is examined. Volunteers slept one night on a new, lower bed sheet in their own bed and one night in a bed foreign to them. Samples from the sheets were collected and analysed by DNA profiling. The results indicate that the DNA profile of an individual can be obtained from bedding after one night of sleeping in a bed. The DNA profile of the owner of the bed could also be detected in the foreign bed experiments. Since mixed DNA profiles can be obtained from trace DNA on bedding, caution should be exercised when drawing conclusions from DNA profiling results obtained from such samples. This transfer may have important repercussions in sexual assault investigations.

  2. Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.

    Science.gov (United States)

    Cao, Chan; Long, Yi-Tao

    2018-02-20

    Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis

  3. Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry

    DEFF Research Database (Denmark)

    Vranken, Charlotte; Deen, Jochem; Dirix, Lieve

    2014-01-01

    We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore...... to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay...... the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes...

  4. Static and Dynamic Properties of DNA Confined in Nanochannels

    Science.gov (United States)

    Gupta, Damini

    Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain

  5. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  6. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  7. Counterion effects on nano-confined metal–drug–DNA complexes

    Directory of Open Access Journals (Sweden)

    Nupur Biswas

    2016-01-01

    Full Text Available We have explored morphology of DNA molecules bound with Cu complexes of piroxicam (a non-steroidal anti-inflammatory drug molecules under one-dimensional confinement of thin films and have studied the effect of counterions present in a buffer. X-ray reflectivity at and away from the Cu K absorption edge and atomic force microscopy studies reveal that confinement segregates the drug molecules preferentially in a top layer of the DNA film, and counterions enhance this segregation.

  8. Decreased stability of DNA in cells treated with alkylating agents

    Energy Technology Data Exchange (ETDEWEB)

    Frankfurt, O.S. (Cedars Medical Center, Miami, FL (United States))

    1990-12-01

    A modified highly sensitive procedure for the evaluation of DNA damage in individual cells treated with alkylating agents is reported. The new methodology is based on the amplification of single-strandedness in alkylated DNA by heating in the presence of Mg{sup 2+}. Human ovarian carcinoma cells A2780 were treated with nitrogen mustard (HN2), fixed in methanol, and stained with monoclonal antibody (MOAB) F7-26 generated against HN2-treated DNA. Binding of MOAB was measured by flow cytometry with indirect immunofluorescence. Intensive binding of MOAB to control and drug-treated cells was observed after heating in Tris buffer supplemented with MgCl{sub 2}. Thus, the presence of phosphates and MgCl{sub 2} during heating was necessary for the detection of HN2-induced changes in DNA stability. Fluorescence of HN2-treated cells decreased to background levels after treatment with single-strand-specific S{sub 1} nuclease. MOAB F7-26 interacted with single-stranded regions in DNA and did not bind to dsDNA or other cellular antigens. It is suggested that alkylation of guanines decreased the stability of the DNA molecule and increased the access of MOAB F7-26 to deoxycytidines on the opposite DNA strand.

  9. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

    2009-05-11

    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  10. Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie

    1981-01-01

    Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.

  11. Recent Development of Nano-Materials Used in DNA Biosensors

    Directory of Open Access Journals (Sweden)

    Yibin Ying

    2009-07-01

    Full Text Available As knowledge of the structure and function of nucleic acid molecules has increased, sequence-specific DNA detection has gained increased importance. DNA biosensors based on nucleic acid hybridization have been actively developed because of their specificity, speed, portability, and low cost. Recently, there has been considerable interest in using nano-materials for DNA biosensors. Because of their high surface-to-volume ratios and excellent biological compatibilities, nano-materials could be used to increase the amount of DNA immobilization; moreover, DNA bound to nano-materials can maintain its biological activity. Alternatively, signal amplification by labeling a targeted analyte with nano-materials has also been reported for DNA biosensors in many papers. This review summarizes the applications of various nano-materials for DNA biosensors during past five years. We found that nano-materials of small sizes were advantageous as substrates for DNA attachment or as labels for signal amplification; and use of two or more types of nano-materials in the biosensors could improve their overall quality and to overcome the deficiencies of the individual nano-components. Most current DNA biosensors require the use of polymerase chain reaction (PCR in their protocols. However, further development of nano-materials with smaller size and/or with improved biological and chemical properties would substantially enhance the accuracy, selectivity and sensitivity of DNA biosensors. Thus, DNA biosensors without PCR amplification may become a reality in the foreseeable future.

  12. Mixed DNA/Oligo(ethylene glycol) Functionalized Gold Surface Improve DNA Hybridization in Complex Media

    International Nuclear Information System (INIS)

    Lee, C.; Gamble, L.; Grainger, D.; Castner, D.

    2006-01-01

    Reliable, direct 'sample-to-answer' capture of nucleic acid targets from complex media would greatly improve existing capabilities of DNA microarrays and biosensors. This goal has proven elusive for many current nucleic acid detection technologies attempting to produce assay results directly from complex real-world samples, including food, tissue, and environmental materials. In this study, we have investigated mixed self-assembled thiolated single-strand DNA (ssDNA) monolayers containing a short thiolated oligo(ethylene glycol) (OEG) surface diluent on gold surfaces to improve the specific capture of DNA targets from complex media. Both surface composition and orientation of these mixed DNA monolayers were characterized with x-ray photoelectron spectroscopy (XPS) and near-edge x-ray absorption fine structure (NEXAFS). XPS results from sequentially adsorbed ssDNA/OEG monolayers on gold indicate that thiolated OEG diluent molecules first incorporate into the thiolated ssDNA monolayer and, upon longer OEG exposures, competitively displace adsorbed ssDNA molecules from the gold surface. NEXAFS polarization dependence results (followed by monitoring the N 1s→π* transition) indicate that adsorbed thiolated ssDNA nucleotide base-ring structures in the mixed ssDNA monolayers are oriented more parallel to the gold surface compared to DNA bases in pure ssDNA monolayers. This supports ssDNA oligomer reorientation towards a more upright position upon OEG mixed adlayer incorporation. DNA target hybridization on mixed ssDNA probe/OEG monolayers was monitored by surface plasmon resonance (SPR). Improvements in specific target capture for these ssDNA probe surfaces due to incorporation of the OEG diluent were demonstrated using two model biosensing assays, DNA target capture from complete bovine serum and from salmon genomic DNA mixtures. SPR results demonstrate that OEG incorporation into the ssDNA adlayer improves surface resistance to both nonspecific DNA and protein

  13. Differential DNA methylation at birth associated with mental disorder in individuals with 22q11.2 deletion syndrome

    DEFF Research Database (Denmark)

    Starnawska, A; Hansen, C S; Sparsø, T

    2017-01-01

    Individuals with 22q11.2 deletion syndrome (DS) have an increased risk of comorbid mental disorders including schizophrenia, attention deficit hyperactivity disorder, depression, as well as intellectual disability. Although most 22q11.2 deletion carriers have the long 3-Mb form of the hemizygous...... with mental disorder later in life. DNA methylation was measured genome-wide from neonatal dried blood spots in a cohort of 164 individuals with 22q11.2DS, including 48 individuals diagnosed with a psychiatric disorder. Among several CpG sites with P-value...-98), in NOSIP (P-value=5.12 × 10-8) with disorders of psychological development (F80-89) and in SEMA4B (P-value=4.02 × 10-7) with schizophrenia spectrum disorders (F20-29). In conclusion, our study suggests an association of DNA methylation differences at birth with development of mental disorder later in life...

  14. Carbon Nanotube Biosensors for Space Molecule Detection and Clinical Molecular Diagnostics

    Science.gov (United States)

    Han, Jie

    2001-01-01

    Both space molecule detection and clinical molecule diagnostics need to develop ultra sensitive biosensors for detection of less than attomole molecules such as amino acids for DNA. However all the electrode sensor systems including those fabricated from the existing carbon nanotubes, have a background level of nA (nanoAmp). This has limited DNA or other molecule detection to nA level or molecules whose concentration is, much higher than attomole level. A program has been created by NASA and NCI (National Cancer Institute) to exploit the possibility of carbon nanotube based biosensors to solve this problem for both's interest. In this talk, I will present our effort on the evaluation and novel design of carbon nanotubes as electrode biosensors with strategies to minimize background currents while maximizing signal intensity.The fabrication of nanotube electrode arrays, immobilization of molecular probes on nanotube electrodes and in vitro biosensor testing will also be discussed.

  15. Binary self-assembly of highly symmetric DNA nanocages via sticky-end engineering

    Institute of Scientific and Technical Information of China (English)

    Xiao-Rong Wu; Chen-Wei Wu; Fei Ding; Cheng Tian; Wen Jiang; Cheng-De Mao; Chuan Zhang

    2017-01-01

    Discrete and symmetric three-dimensional (3D) DNA nanocages have been revoked as excellent candidates for various applications,such as guest component encapsulation and organization (e.g.dye molecules,proteins,inorganic nanoparticles,etc.) to construct new materials and devices.To date,a large variety of DNA nanocages has been synthesized through assembling small individual DNA motifs into predesigned structures in a bottom-up fashion.Most of them rely on the assembly using multiple copies of single type of motifs and a few sophisticated nanostructures have been engineered by co-assembling multi-types of DNA tiles simultaneously.However,the availability of complex DNA nanocages is still limited.Herein,we demonstrate that highly symmetric DNA nanocages consisted of binary DNA pointstar motifs can be easily assembled by deliberately engineering the sticky-end interaction between the component building blocks.As such,DNA nanocages with new geometries,including elongated tetrahedron (E-TET),rhombic dodecahedron (R-DOD),and rhombic triacontahedron (R-TRI) are successfully synthesized.Moreover,their design principle,assembly process,and structural features are revealed by polyacryalmide gel electrophoresis (PAGE),atomic force microscope (AFM) imaging,and cryogenic transmission electron microscope imaging (cryo-TEM) associated with single particle reconstruction.

  16. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  17. Radiation damage of DNA. Model for direct ionization of DNA

    International Nuclear Information System (INIS)

    Kobayashi, Kazuo; Tagawa, Seiichi

    2004-01-01

    Current aspects of radiation damage of DNA, particularly induced by the direct effect of radiation, and author's method of pulse radiolysis are described in relation to behavior of ions formed by radiation and active principles to induce the strand break. In irradiation of DNA solution in water, the direct effect of radiation is derived from ionization of DNA itself and indirect one, from the reaction between DNA and radicals generated from water molecules and the former direct one has been scarcely investigated due to difficulty of experimental approach. Radicals generated in sugar moiety of DNA are shown important in the strand break by recent studies on crystalline DNA irradiated by X-ray, DNA solution by electron and photon beams, hydrated DNA by γ-ray and by high linear energy transfer (LET) ion. Author's pulse radiolysis studies have revealed behaviors of guanine and adenine radical cations in dynamics of DNA oxidation. Since reactions described are the model, the experimental approach is thought necessary for elucidation of the actually occurring DNA damage in living cells. (N.I.)

  18. Alkaline Comet Assay for Assessing DNA Damage in Individual Cells.

    Science.gov (United States)

    Pu, Xinzhu; Wang, Zemin; Klaunig, James E

    2015-08-06

    Single-cell gel electrophoresis, commonly called a comet assay, is a simple and sensitive method for assessing DNA damage at the single-cell level. It is an important technique in genetic toxicological studies. The comet assay performed under alkaline conditions (pH >13) is considered the optimal version for identifying agents with genotoxic activity. The alkaline comet assay is capable of detecting DNA double-strand breaks, single-strand breaks, alkali-labile sites, DNA-DNA/DNA-protein cross-linking, and incomplete excision repair sites. The inclusion of digestion of lesion-specific DNA repair enzymes in the procedure allows the detection of various DNA base alterations, such as oxidative base damage. This unit describes alkaline comet assay procedures for assessing DNA strand breaks and oxidative base alterations. These methods can be applied in a variety of cells from in vitro and in vivo experiments, as well as human studies. Copyright © 2015 John Wiley & Sons, Inc.

  19. cGAS Conducts Micronuclei DNA Surveillance.

    Science.gov (United States)

    de Oliveira Mann, Carina C; Kranzusch, Philip J

    2017-10-01

    DNA damage elicits a potent proinflammatory immune response. A collection of four papers now reveals that micronuclear DNA is a new cell intrinsic immunostimulatory molecule, and that accumulation of the immune sensor cyclic GMP-AMP synthase (cGAS) in micronuclei leads to a cell-cycle-dependent proinflammatory response following DNA damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. The journey of DNA repair.

    Science.gov (United States)

    Saini, Natalie

    2015-12-01

    21 years ago, the DNA Repair Enzyme was declared "Molecule of the Year". Today, we are celebrating another "year of repair", with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  1. Functional transferred DNA within extracellular vesicles

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Jin [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China); Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Jiangsu Province (China); Wu, Gengze [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China); Jose, Pedro A. [Division of Nephrology, Department of Medicine and Physiology, University of Maryland, School of Medicine, Baltimore, MD 21201 (United States); Zeng, Chunyu, E-mail: Chunyuzeng01@163.com [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China)

    2016-11-15

    Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmic macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.

  2. Functional transferred DNA within extracellular vesicles

    International Nuclear Information System (INIS)

    Cai, Jin; Wu, Gengze; Jose, Pedro A.; Zeng, Chunyu

    2016-01-01

    Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmic macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.

  3. Bio-recognitive photonics of a DNA-guided organic semiconductor

    Science.gov (United States)

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

    2016-01-01

    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an `inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  4. Bio-recognitive photonics of a DNA-guided organic semiconductor.

    Science.gov (United States)

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

    2016-01-04

    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an 'inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  5. Characterization of DNA antigens from immune complexes deposited in the skin of patients with systemic lupus erythematosus

    Institute of Scientific and Technical Information of China (English)

    曾凡钦; 尹若菲; 谭国珍; 郭庆; 许德清

    2004-01-01

    Background Skin lesions are common manifestations in systemic lupus erythematosus (SLE). It is still unknown what the definite pathogenesis of skin involvement was and whether DNA participated in it. Our study was designed to explore the pathogenetic role and nature of nuclear antigen (DNA) deposited in the skin lesions of patients with SLE.Methods Thirty skin samples from patients with SLE and 2 normal skin samples were studied. Extracellular DNA was evaluated by indirect immunofluorescence methods. The deposited immune complexes were extracted by cryoprecipitation, and DNA was then isolated with phenol and chloroform. DNA fragment sizes were detected by agarose gel electrophoresis. Finally, 8 different probes were used to analyze the origin of these DNA molecules using Dot hybridization.Results Extracellular DNA staining was found only in skin lesions, mainly those located in the basement membrane zone, vascular wall, and hair follicle wall. Normal skin and non-lesion SLE skin showed no fluorescence at locations outside the nuclei. There were no differences in the rate and intensity of extracellular DNA staining when comparing active phase to remission phase patients. No relationship was found between extracellular DNA and circulating anti-dsDNA antibodies. Deposited DNA fragments clustered into four bands of somewhat discrete sizes: 20 000 bp, 1300 bp, 800-900 bp, 100-200 bp. Small sized fragments (100-200 bp) were positively correlated with disease activity (P<0.05, r=0.407). Dot hybridization showed significant homology of the various extracellular DNA fragments examined with human genomic DNA, but not with DNA from the microorganisms and viruses we examined. There were also homologies between DNA samples from different individuals.Conclusions DNA and its immune complexes may contribute to the pathogenesis of skin lesions in SLE. These DNA molecules range in size from 100 bp to 20 kb and may be endogenous in origin.

  6. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  7. Single-Molecule Tracking Study of the Permeability and Transverse Width of Individual Cylindrical Microdomains in Solvent-Swollen Polystyrene-block-poly(ethylene oxide) Films.

    Science.gov (United States)

    Sapkota, Dol Raj; Tran-Ba, Khanh-Hoa; Elwell-Cuddy, Trevor; Higgins, Daniel A; Ito, Takashi

    2016-12-01

    Understanding the properties of solvent-swollen block copolymer (BCP) microdomains is important for better solvent-based control of microdomain morphology, orientation, and permeability. In this study, single-molecule tracking (SMT) was explored to assess the permeability and transverse width of individual cylindrical microdomains in solvent-swollen polystyrene-block-poly(ethylene oxide) (PS-b-PEO) films. PS-b-PEO films comprising shear-elongated cylindrical PEO microdomains were prepared by sandwiching its benzene or tetrahydrofuran (THF) solution between two glass substrates. SMT measurements were performed at different drying times to investigate the effects of solvent evaporation on the microdomain properties. SMT data showed one-dimensional (1D) motions of single fluorescent molecules (sulforhodamine B) based on their diffusion within the cylindrical microdomains. Microdomain permeability and transverse width were assessed from the single-molecule diffusion coefficients (D SMT ) and transverse variance of the 1D trajectories (σ δ 2 ), respectively. The D SMT and σ δ 2 values from individual 1D trajectories were widely distributed with no evidence of correlation on a single molecule basis, possibly because the individual microdomains in a film were swollen to different extents. On average, microdomain permeability (D) and effective radius (r) gradually decreased within the first 3 days of drying due to solvent evaporation, and changed negligibly thereafter. PS-b-PEO films prepared from THF solutions exhibited larger changes in D and r as compared with those from benzene solutions due to the better swelling of the PEO microdomains by THF. Importantly, changes in D were more prominent than those in r, suggesting that the permeability of the PEO microdomains is very susceptible to the presence of solvent. These results reveal the unique capability of SMT to assess the properties of individual cylindrical microdomains in a solvent-swollen BCP film.

  8. Characterization of photoactivated singlet oxygen damage in single-molecule optical trap experiments.

    Science.gov (United States)

    Landry, Markita P; McCall, Patrick M; Qi, Zhi; Chemla, Yann R

    2009-10-21

    Optical traps or "tweezers" use high-power, near-infrared laser beams to manipulate and apply forces to biological systems, ranging from individual molecules to cells. Although previous studies have established that optical tweezers induce photodamage in live cells, the effects of trap irradiation have yet to be examined in vitro, at the single-molecule level. In this study, we investigate trap-induced damage in a simple system consisting of DNA molecules tethered between optically trapped polystyrene microspheres. We show that exposure to the trapping light affects the lifetime of the tethers, the efficiency with which they can be formed, and their structure. Moreover, we establish that these irreversible effects are caused by oxidative damage from singlet oxygen. This reactive state of molecular oxygen is generated locally by the optical traps in the presence of a sensitizer, which we identify as the trapped polystyrene microspheres. Trap-induced oxidative damage can be reduced greatly by working under anaerobic conditions, using additives that quench singlet oxygen, or trapping microspheres lacking the sensitizers necessary for singlet state photoexcitation. Our findings are relevant to a broad range of trap-based single-molecule experiments-the most common biological application of optical tweezers-and may guide the development of more robust experimental protocols.

  9. Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

    Directory of Open Access Journals (Sweden)

    T Banerjee

    Full Text Available DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM and spectroscopy (AFS. The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

  10. Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

    Science.gov (United States)

    Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R

    2016-01-01

    DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

  11. The journey of DNA repair

    OpenAIRE

    Saini, Natalie

    2015-01-01

    21 years ago, the DNA Repair Enzyme was declared “Molecule of the Year”. Today, we are celebrating another “year of repair”, with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  12. Binding of radiation-induced phenylalanine radicals to DNA

    International Nuclear Information System (INIS)

    Schans, G.P. van der; Rijn, C.J.S. van; Bleichrodt, J.F.

    1975-11-01

    When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N 2 O is irradiated with γ-rays, radiation-induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules

  13. Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.

    Science.gov (United States)

    Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun

    2018-04-04

    Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery. Expected final online publication date for the Annual Review of Biomedical Engineering Volume 20 is June 4, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  14. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    International Nuclear Information System (INIS)

    Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana

    2014-01-01

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode

  15. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    Energy Technology Data Exchange (ETDEWEB)

    Verebová, Valéria [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia); Adamcik, Jozef [Food and Soft Materials Science, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 9, CH-8092 Zürich (Switzerland); Danko, Patrik; Podhradský, Dušan [Department of Biochemistry, Institute of Chemistry, Faculty of Sciences, P.J. Šafárik University, Moyzesova 11, 041 54 Košice (Slovakia); Miškovský, Pavol [Department of Biophysics, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Center for Interdisciplinary Biosciences, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Staničová, Jana, E-mail: jana.stanicova@uvlf.sk [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia)

    2014-01-31

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.

  16. DNA damage and repair in peripheral blood lymphocytes from healthy individuals and cancer patients: a pilot study on the implications in the clinical response to chemotherapy.

    Science.gov (United States)

    Nadin, Silvina Beatriz; Vargas-Roig, Laura M; Drago, Gisela; Ibarra, Jorge; Ciocca, Daniel R

    2006-07-28

    Drug resistance is considered the main impediment to successful cancer chemotherapy. The quest for a method useful to predict individual responses to chemotherapy prior to treatment is highly desired. This study was designed to determine the individual influences of doxorubicin and cisplatin on the degree of DNA damage, DNA repair and hMSH2 and the hMLH1 protein expression in peripheral blood lymphocytes (PBL) and their correlations with the clinical response. PBL were obtained from 25 cancer patients (pre- and post-chemotherapy) and from 10 healthy persons, cultured and exposed to doxorubicin or cisplatin. Cells were collected at T0 (immediately after drug treatment) and 24h after damage (T24). The alkaline comet assay was employed to assess the DNA damage and repair function, and immunocytochemistry to study hMLH1 and hMSH2 expression. Clinical response was evaluated after three cycles of chemotherapy. Pre-chemotherapy PBL from cancer patients showed significantly higher levels of basal DNA damage than healthy persons, with appreciable interindividual variations between them. The in vivo administration of antineoplasic drugs was accompanied by significant DNA damage, and an increased in the number of apoptotic cells. Cancer patients with complete response showed a high number of apoptotic cells. The DNA migration increased at T0 and at T24 in cisplatin-treated patients, reflecting a decreased rate of cisplatin adducts repair than that observed in healthy individuals. The ability to repair DNA lesions in doxorubicin-damaged cells was very similar between healthy individuals and cancer patients. Cisplatin-treated patients that died by the disease showed lower DNA migration than the mean value. The expression of hMLH1 and hMSH2 was practically identical between healthy individuals and cancer patients. Nevertheless, chemotherapy induced a depletion mostly of hMLH1. In 83% of cisplatin-treated patients with CR the hMLH1 and hMSH2 expression at T24 was higher than the

  17. Physicochemical and nanotechnological approaches to the design of 'rigid' spatial structures of DNA

    International Nuclear Information System (INIS)

    Yevdokimov, Yu M; Salyanov, V I; Skuridin, S G; Shtykova, E V; Khlebtsov, N G; Kats, E I

    2015-01-01

    This review focuses on physicochemical and nanotechnological approaches to the design of 'rigid' particles based on double-stranded DNA molecules. The physicochemical methods imply cross-linking of adjacent DNA molecules ordered in quasinematic layers of liquid-crystalline dispersion particles by synthetic nanobridges consisting of alternating molecules of an antibiotic (daunomycin) and divalent copper ions, as well as cross-linking of these molecules as a result of their salting-out in quasinematic layers of liquid-crystalline dispersion particles under the action of lanthanide cations. The nanotechnological approach is based on the insertion of gold nanoparticles into the free space between double-stranded DNA molecules that form quasinematic layers of liquid-crystalline dispersion particles. This gives rise to extended clusters of gold nanoparticles and is accompanied by an enhancement of the interaction between the DNA molecules through gold nanoparticles and by a decrease in the solubility of dispersion particles. These approaches produce integrated 'rigid' DNA-containing spatial structures, which are incompatible with the initial aqueous polymeric solutions and have unique properties. The bibliography includes 116 references

  18. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  19. IRMA iterative relaxation matrix approach for NMR structure determination application to DNA fragments

    International Nuclear Information System (INIS)

    Koning, M.M.G.

    1990-01-01

    The subject of this thesis is the structure determination of DNA molecules in solution with the use of NMR. For this purpose a new relaxation matrix approach is introduced. The emphasis is on the interpretation of nuclear Overhauser effects (NOEs) in terms of proton-proton distances and related three dimensional structures. The DNA molecules studied are obligonucleotides, unmodifief as well as modified molecules bu UV radiation. From comparison with unmodified molecules it turned out that UV irradiation scarcely influences the helical structure of the DNA string. At one place of the string a nucleotide is rotated towards the high-ANTI conformation which results in a slight unwinding of the DNA string but sufficient for blocking of the normal reading of genetic information. (H.W.). 456 refs.; 50 figs.; 30 tabs

  20. Master equation approach to DNA breathing in heteropolymer DNA

    DEFF Research Database (Denmark)

    Ambjörnsson, Tobias; Banik, Suman K; Lomholt, Michael A

    2007-01-01

    After crossing an initial barrier to break the first base-pair (bp) in double-stranded DNA, the disruption of further bps is characterized by free energies up to a few k(B)T. Thermal motion within the DNA double strand therefore causes the opening of intermittent single-stranded denaturation zones......, the DNA bubbles. The unzipping and zipping dynamics of bps at the two zipper forks of a bubble, where the single strand of the denatured zone joins the still intact double strand, can be monitored by single molecule fluorescence or NMR methods. We here establish a dynamic description of this DNA breathing...... in a heteropolymer DNA with given sequence in terms of a master equation that governs the time evolution of the joint probability distribution for the bubble size and position along the sequence. The transfer coefficients are based on the Poland-Scheraga free energy model. We derive the autocorrelation function...

  1. Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

    Science.gov (United States)

    Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

    1977-04-01

    Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

  2. The role of DNA dependent protein kinase in synapsis of DNA ends.

    Science.gov (United States)

    Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C

    2003-12-15

    DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.

  3. Solvated protein-DNA docking using HADDOCK

    NARCIS (Netherlands)

    van Dijk, Marc; Visscher, Koen M; Bonvin, Alexandre M.J.J; Kastritis, Panagiotis L.

    2013-01-01

    Interfacial water molecules play an important role in many aspects of protein-DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the

  4. DNA Structure and Supercoiling: Ribbons and a Yo-Yo Model

    Science.gov (United States)

    Van Horn, J. David

    2011-01-01

    The double-helical structure of DNA is a pop cultural icon. Images of the DNA molecule appear in newspapers, popular journals, and advertisements. In addition to scientific instrument sales, the aura surrounding the central molecule of life has been used to sell everything from perfume to beverages and is the inspiration of items ranging from…

  5. DNA nanotechnology and fluorescence applications.

    Science.gov (United States)

    Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf

    2016-06-01

    Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Quantitative measurement of water diffusion lifetimes at a protein/DNA interface by NMR

    International Nuclear Information System (INIS)

    Gruschus, James M.; Ferretti, James A.

    2001-01-01

    Hydration site lifetimes of slowly diffusing water molecules at the protein/DNA interface of the vnd/NK-2 homeodomain DNA complex were determined using novel three-dimensional NMR techniques. The lifetimes were calculated using the ratios of ROE and NOE cross-relaxation rates between the water and the protein backbone and side chain amides. This calculation of the lifetimes is based on a model of the spectral density function of the water-protein interaction consisting of three timescales of motion: fast vibrational/rotational motion, diffusion into/out of the hydration site, and overall macromolecular tumbling. The lifetimes measured ranged from approximately 400 ps to more than 5 ns, and nearly all the slowly diffusing water molecules detected lie at the protein/DNA interface. A quantitative analysis of relayed water cross-relaxation indicated that even at very short mixing times, 5 ms for ROESY and 12 ms for NOESY, relay of magnetization can make a small but detectable contribution to the measured rates. The temperature dependences of the NOE rates were measured to help discriminate direct dipolar cross-relaxation from chemical exchange. Comparison with several X-ray structures of homeodomain/DNA complexes reveals a strong correspondence between water molecules in conserved locations and the slowly diffusing water molecules detected by NMR. A homology model based on the X-ray structures was created to visualize the conserved water molecules detected at the vnd/NK-2 homeodomain DNA interface. Two chains of water molecules are seen at the right and left sides of the major groove, adjacent to the third helix of the homeodomain. Two water-mediated hydrogen bond bridges spanning the protein/DNA interface are present in the model, one between the backbone of Phe8 and a DNA phosphate, and one between the side chain of Asn51 and a DNA phosphate. The hydrogen bond bridge between Asn51 and the DNA might be especially important since the DNA contact made by the invariant

  7. Metaphors of DNA: a review of the popularisation processes

    Directory of Open Access Journals (Sweden)

    Sergi Cortiñas Rovira

    2008-03-01

    Full Text Available This article offers a 1953-present day review of the models that have popularised DNA, one of the fundamental molecules of biochemistry. DNA has become an iconic concept over the 20th century, overcoming the boundaries of science and spreading into literature, painting, sculpture or religion. This work analyses the reasons why DNA has penetrated society so effectively and examines some of the main metaphors used by the scientists and scientific popularisers. Furthermore, this article, taken from the author's PhD thesis, describes some recent popularisation models for this molecule.

  8. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  9. Direct-to-consumer DNA testing: the fallout for individuals and their families unexpectedly learning of their donor conception origins.

    Science.gov (United States)

    Crawshaw, Marilyn

    2017-07-11

    Increasing numbers of donor-conceived individuals (and/or parents) are seeking individuals genetically related through donor conception. One route is through 'direct-to-consumer' (DTC) DNA testing, prompting calls for fertility services to alert donors and prospective parents to the increasing unsustainability of anonymity and secrecy. The complexity of interpreting DNA results in this context has also been discussed, including their lack of absolute certainty, as has the need for professional and peer support. This commentary highlights a different 'threat', from individuals learning of their donor-conception origins through the use of such tests by themselves or relatives for such purposes as genealogy or health checks. It illustrates the personal complexities faced by three older women and their families on learning not only of their genetic relationship to each other but also to 15 more donor-related siblings. DTC DNA services are a growing feature of modern life. This commentary raises ethical questions about their responsibilities towards those inadvertently learning of donor conception origins and the responsibilities of fertility services to inform prospective parents and donors of this new phenomenon. Considerations of how and when parents should tell their children of their donor-conception origins here instead become how and when children should inform their parents.

  10. Meta-barcoding of 'dirt' DNA from soil reflects vertebrate biodiversity.

    Science.gov (United States)

    Andersen, Kenneth; Bird, Karen Lise; Rasmussen, Morten; Haile, James; Breuning-Madsen, Henrik; Kjaer, Kurt H; Orlando, Ludovic; Gilbert, M Thomas P; Willerslev, Eske

    2012-04-01

    DNA molecules originating from animals and plants can be retrieved directly from sediments and have been used for reconstructing both contemporary and past ecosystems. However, the extent to which such 'dirt' DNA reflects taxonomic richness and structural diversity remains contentious. Here, we couple second generation high-throughput sequencing with 16S mitochondrial DNA (mtDNA) meta-barcoding, to explore the accuracy and sensitivity of 'dirt' DNA as an indicator of vertebrate diversity, from soil sampled at safari parks, zoological gardens and farms with known species compositions. PCR amplification was successful in the full pH range of the investigated soils (6.2 ± 0.2 to 8.3 ± 0.2), but inhibition was detected in extracts from soil of high organic content. DNA movement (leaching) through strata was evident in some sporadic cases and is influenced by soil texture and structure. We find that DNA from the soil surface reflects overall taxonomic richness and relative biomass of individual species. However, one species that was recently introduced was not detected. Furthermore, animal behaviour was shown to influence DNA deposition rates. The approach potentially provides a quick methodological alternative to classical ecological surveys of biodiversity, and most reliable results are obtained with spatial sample replicates, while relative amounts of soil processed per site is of less importance. © 2011 Blackwell Publishing Ltd.

  11. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  12. Single Fluorescent Molecules as Nano-Illuminators for Biological Structure and Function

    Science.gov (United States)

    Moerner, W. E.

    2011-03-01

    Since the first optical detection and spectroscopy of a single molecule in a solid (Phys. Rev. Lett. {62}, 2535 (1989)), much has been learned about the ability of single molecules to probe local nanoenvironments and individual behavior in biological and nonbiological materials in the absence of ensemble averaging that can obscure heterogeneity. Because each single fluorophore acts a light source roughly 1 nm in size, microscopic imaging of individual fluorophores leads naturally to superlocalization, or determination of the position of the molecule with precision beyond the optical diffraction limit, simply by digitization of the point-spread function from the single emitter. For example, the shape of single filaments in a living cell can be extracted simply by allowing a single molecule to move through the filament (PNAS {103}, 10929 (2006)). The addition of photoinduced control of single-molecule emission allows imaging beyond the diffraction limit (super-resolution) and a new array of acronyms (PALM, STORM, F-PALM etc.) and advances have appeared. We have used the native blinking and switching of a common yellow-emitting variant of green fluorescent protein (EYFP) reported more than a decade ago (Nature {388}, 355 (1997)) to achieve sub-40 nm super-resolution imaging of several protein structures in the bacterium Caulobacter crescentus: the quasi-helix of the actin-like protein MreB (Nat. Meth. {5}, 947 (2008)), the cellular distribution of the DNA binding protein HU (submitted), and the recently discovered division spindle composed of ParA filaments (Nat. Cell Biol. {12}, 791 (2010)). Even with these advances, better emitters would provide more photons and improved resolution, and a new photoactivatable small-molecule emitter has recently been synthesized and targeted to specific structures in living cells to provide super-resolution images (JACS {132}, 15099 (2010)). Finally, a new optical method for extracting three-dimensional position information based on

  13. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  14. MtDNA genomes reveal a relaxation of selective constraints in low-BMI individuals in a Uyghur population.

    Science.gov (United States)

    Zheng, Hong-Xiang; Li, Lei; Jiang, Xiao-Yan; Yan, Shi; Qin, Zhendong; Wang, Xiaofeng; Jin, Li

    2017-10-01

    Considerable attention has been focused on the effect of deleterious mutations caused by the recent relaxation of selective constraints on human health, including the prevalence of obesity, which might represent an adaptive response of energy-conserving metabolism under the conditions of modern society. Mitochondrial DNA (mtDNA) encoding 13 core subunits of oxidative phosphorylation plays an important role in metabolism. Therefore, we hypothesized that a relaxation of selection constraints on mtDNA and an increase in the proportion of deleterious mutations have played a role in obesity prevalence. In this study, we collected and sequenced the mtDNA genomes of 722 Uyghurs, a typical population with a high prevalence of obesity. We identified the variants that occurred in the Uyghur population for each sample and found that the number of nonsynonymous mutations carried by Uyghur individuals declined with elevation of their BMI (P = 0.015). We further calculated the nonsynonymous and synonymous ratio (N/S) of the high-BMI and low-BMI haplogroups, and the results showed that a significantly higher N/S occurred in the whole mtDNA genomes of the low-BMI haplogroups (0.64) than in that of the high-BMI haplogroups (0.35, P = 0.030) and ancestor haplotypes (0.41, P = 0.032); these findings indicated that low-BMI individuals showed a recent relaxation of selective constraints. In addition, we investigated six clinical characteristics and found that fasting plasma glucose might be correlated with the N/S and selective pressures. We hypothesized that a higher proportion of deleterious mutations led to mild mitochondrial dysfunction, which helps to drive glucose consumption and thereby prevents obesity. Our results provide new insights into the relationship between obesity predisposition and mitochondrial genome evolution.

  15. Carbon Electrode-Molecule Junctions: A Reliable Platform for Molecular Electronics.

    Science.gov (United States)

    Jia, Chuancheng; Ma, Bangjun; Xin, Na; Guo, Xuefeng

    2015-09-15

    . At the molecular level, to form robust covalent bonds between electrodes and molecules and improve device stability, we developed a reliable system to immobilize individual molecules within a nanoscale gap of either SWCNTs or graphene through covalent amide bond formation, thus affording two classes of carbon electrode-molecule single-molecule junctions. One unique feature of these devices is the fact that they contain only one or two molecules as conductive elements, thus forming the basis for building new classes of chemo/biosensors with ultrahigh sensitivity. We have used these approaches to reveal the dependence of the charge transport of individual metallo-DNA duplexes on π-stacking integrity, and fabricate molecular devices capable of realizing label-free, real-time electrical detection of biological interactions at the single-event level, or switching their molecular conductance upon exposure to external stimuli, such as ion, pH, and light. These investigations highlight the unique advantages and importance of these universal methodologies to produce functional carbon electrode-molecule junctions in current and future researches toward the development of practical molecular devices, thus offering a reliable platform for molecular electronics and the promise of a new generation of multifunctional integrated circuits and sensors.

  16. Development of novel small molecules for imaging and drug release

    Science.gov (United States)

    Cao, Yanting

    Small organic molecules, including small molecule based fluorescent probes, small molecule based drugs or prodrugs, and smart multifunctional fluorescent drug delivery systems play important roles in biological research, drug discovery, and clinical practices. Despite the significant progress made in these fields, the development of novel and diverse small molecules is needed to meet various demands for research and clinical applications. My Ph.D study focuses on the development of novel functional molecules for recognition, imaging and drug release. In the first part, a turn-on fluorescent probe is developed for the detection of intracellular adenosine-5'-triphosphate (ATP) levels based on multiplexing recognitions. Considering the unique and complicated structure of ATP molecules, a fluorescent probe has been implemented with improved sensitivity and selectivity due to two synergistic binding recognitions by incorporating of 2, 2'-dipicolylamine (Dpa)-Zn(II) for targeting of phospho anions and phenylboronic acid group for cis-diol moiety. The novel probe is able to detect intracellular ATP levels in SH-SY5Y cells. Meanwhile, the advantages of multiplexing recognition design concept have been demonstrated using two control molecules. In the second part, a prodrug system is developed to deliver multiple drugs within one small molecule entity. The prodrug is designed by using 1-(2-nitrophenyl)ethyl (NPE) as phototrigger, and biphenol biquaternary ammonium as the prodrug. With controlled photo activation, both DNA cross-linking agents mechlorethamine and o-quinone methide are delivered and released at the preferred site, leading to efficient DNA cross-links formation and cell death. The prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, but displays potent activity towards cancer cells (HeLa cells) upon UV activation. The multiple drug release system may hold a great potential for practical application. In the

  17. Prevalence of parvovirus B19 and parvovirus V9 DNA and antibodies in paired bone marrow and serum samples from healthy individuals.

    Science.gov (United States)

    Heegaard, Erik D; Petersen, Bodil Laub; Heilmann, Carsten J; Hornsleth, Allan

    2002-03-01

    Parvovirus B19 (hereafter referred to as B19) exhibits a marked tropism to human bone marrow (BM), and infection may lead to erythema infectiosum, arthropathy, hydrops fetalis, and various hematologic disorders. Recently, a distinct parvovirus isolate termed V9 with an unknown clinical spectrum was discovered. In contrast to the many studies of B19 serology and viremia, valid information on the frequency of B19 or V9 DNA in the BM of healthy individuals is limited. To develop a reference value, paired BM and serum samples from healthy subjects were tested for the presence of B19 and V9 DNA and specific antibodies. Immunoglobulin M (IgM) was not found in any of the serum samples. The prevalence of IgG showed a gradual and steady increase from 37% in children aged 1 to 5 years to 87% in people aged >50 years. When 190 well-characterized subjects were examined, B19 DNA was detected in the BM of 4 individuals (2.1%; 95% confidence interval, 0.58 to 5.3%) while none of the paired serum samples showed evidence of circulating viral DNA. V9 DNA was not found in any of the BM or serum samples. The finding of B19 DNA probably indicated a primary infection in one 7-year-old individual and reinfection or reactivation of persistent infection in the remaining three persons, aged 47 to 58 years. Serving as a benchmark for future studies, these findings are useful when interpreting epidemiologic data, performing BM transplantation, or considering clinical implications of parvovirus infection.

  18. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  19. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  20. The amount and integrity of mtDNA in maize decline with development.

    Science.gov (United States)

    Oldenburg, Delene J; Kumar, Rachana A; Bendich, Arnold J

    2013-02-01

    In maize and other grasses there is a developmental gradient from the meristematic cells at the base of the stalk to the differentiated cells at the leaf tip. This gradient presents an opportunity to investigate changes in mitochondrial DNA (mtDNA) that accompany growth under light and dark conditions, as done previously for plastid DNA. Maize mtDNA was analyzed by DAPI-DNA staining of individual mitochondria, gel electrophoresis/blot hybridization, and real-time qPCR. Both the amount and integrity of the mtDNA were found to decline with development. There was a 20-fold decline in mtDNA copy number per cell from the embryo to the light-grown leaf blade. The amount of DNA per mitochondrial particle was greater in dark-grown leaf blade (24 copies, on average) than in the light (2 copies), with some mitochondria lacking any detectable DNA. Three factors that influence the demise of mtDNA during development are considered: (1) the decision to either repair or degrade mtDNA molecules that are damaged by the reactive oxygen species produced as byproducts of respiration; (2) the generation of ATP by photophosphorylation in chloroplasts, reducing the need for respiratory-competent mitochondria; and (3) the shift in mitochondrial function from energy-generating respiration to photorespiration during the transition from non-green to green tissue.

  1. Plasmid DNA Delivery: Nanotopography Matters.

    Science.gov (United States)

    Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

    2017-12-20

    Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

  2. DNA Knots: Theory and Experiments

    Science.gov (United States)

    Sumners, D. W.

    Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.

  3. Mitochondrial and Nuclear DNA in Patients with Severe Polytrauma

    Directory of Open Access Journals (Sweden)

    M. Sh Khubutia

    2013-01-01

    Full Text Available The components of mitochondria from the cells damaged by injury are a key component for the development of systemic inflammatory response syndrome (SIRS under aseptic conditions. At the same time, there is a significant increase in the plasma level of mitochondrial DNA (mtDNA, which may be a prognostic marker for infectious complications in patients with severe polytrauma. Objective: to study the time course of changes in the serum levels of mtDNA and nuclear DNA (nDNA in healthy individuals and patients with polytrauma and to reveal its possible association with the development of infectious pulmonary complications and with mortality. Subjects and methods. Seven healthy volunteers and 25 polytrauma with polytrauma of a mean injury severity score (ISS of 40.2±9.2. Sixteen (64% patients developed purulent tracheobronchitis and pneumonia; 5 (20% patients died. The amount of mtDNA and nDNA was determined within the first at 12 and 24 hours, then on days 3 and 5—7 after injury by the authors’ modified procedure using as the exogenous control of a circular DNA molecule. The content of mtDNA and nDNA was expressed as absolute values, by taking the arithmetic mean values as 100% for the volunteers. Results. There was a more than 2.5-fold increase in mtDNA levels in dead patients as compared to survivors (p<0.05; the differences in nDMA levels were insignificant (p=0.1. Within the first 12 hours, the mean mtDNA level in patients with pneumonia was 34 times greater than the reference values and continued to rise in the following 12 hours whereas in those without pneumonia, it was only 17 times higher with its further decrease in the comparable time periods. In the first 12 hours, nDNA was increased in both groups, but 24 hours after injury it was 2555 times more than the reference value only in patients with pneumonia whereas it was decreased 3-fold in those without this condition. Conclusion. This paper is the first to describe the time course of

  4. Age-associated metabolic and morphologic changes in mitochondria of individual mouse and hamster oocytes.

    Directory of Open Access Journals (Sweden)

    Fatma Simsek-Duran

    Full Text Available BACKGROUND: In human oocytes, as in other mammalian ova, there is a significant variation in the pregnancy potential, with approximately 20% of oocyte-sperm meetings resulting in pregnancies. This frequency of successful fertilization decreases as the oocytes age. This low proportion of fruitful couplings appears to be influenced by changes in mitochondrial structure and function. In this study, we have examined mitochondrial biogenesis in both hamster (Mesocricetus auratus and mouse (Mus musculus ova as models for understanding the effects of aging on mitochondrial structure and energy production within the mammalian oocyte. METHODOLOGY/PRINCIPAL FINDINGS: Individual metaphase II oocytes from a total of 25 young and old mice and hamsters were collected from ovarian follicles after hormone stimulation and prepared for biochemical or structural analysis. Adenosine triphosphate levels and mitochondrial DNA number were determined within individual oocytes from young and old animals. In aged hamsters, oocyte adenosine triphosphate levels and mitochondrial DNA molecules were reduced 35.4% and 51.8%, respectively. Reductions of 38.4% and 44% in adenosine triphosphate and mitochondrial genomes, respectively, were also seen in aged mouse oocytes. Transmission electron microscopic (TEM analysis showed that aged rodent oocytes had significant alterations in mitochondrial and cytoplasmic lamellae structure. CONCLUSIONS/SIGNIFICANCE: In both mice and hamsters, decreased adenosine triphosphate in aged oocytes is correlated with a similar decrease in mtDNA molecules and number of mitochondria. Mitochondria in mice and hamsters undergo significant morphological change with aging including mitochondrial vacuolization, cristae alterations, and changes in cytoplasmic lamellae.

  5. Single-Molecule Titration in a Protein Nanoreactor Reveals the Protonation/Deprotonation Mechanism of a C:C Mismatch in DNA.

    Science.gov (United States)

    Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S

    2018-04-18

    Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.

  6. Twisting short dsDNA with applied tension

    Science.gov (United States)

    Zoli, Marco

    2018-02-01

    The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

  7. Plasticity of DNA replication initiation in Epstein-Barr virus episomes.

    Directory of Open Access Journals (Sweden)

    Paolo Norio

    2004-06-01

    Full Text Available In mammalian cells, the activity of the sites of initiation of DNA replication appears to be influenced epigenetically, but this regulation is not fully understood. Most studies of DNA replication have focused on the activity of individual initiation sites, making it difficult to evaluate the impact of changes in initiation activity on the replication of entire genomic loci. Here, we used single molecule analysis of replicated DNA (SMARD to study the latent duplication of Epstein-Barr virus (EBV episomes in human cell lines. We found that initiation sites are present throughout the EBV genome and that their utilization is not conserved in different EBV strains. In addition, SMARD shows that modifications in the utilization of multiple initiation sites occur across large genomic regions (tens of kilobases in size. These observations indicate that individual initiation sites play a limited role in determining the replication dynamics of the EBV genome. Long-range mechanisms and the genomic context appear to play much more important roles, affecting the frequency of utilization and the order of activation of multiple initiation sites. Finally, these results confirm that initiation sites are extremely redundant elements of the EBV genome. We propose that these conclusions also apply to mammalian chromosomes.

  8. Synthesis and DNA-binding study of imidazole linked thiazolidinone derivatives.

    Science.gov (United States)

    War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

    2017-02-01

    A novel series of imidazole-linked thiazolidinone hybrid molecules were designed and synthesized through a feasible synthetic protocol. The molecules were characterized with Fourier transform infrared (FT-IR), 1 H nuclear magnetic resonance (NMR), 13 C NMR and high-resolution mass spectrometry (HRMS) techniques. In vitro susceptibility tests against Gram-positive (S. aureus and B. subtilis) and Gram-negative bacteria (E. coli and P. aeruginosa) gave highly promising results. The most active molecule (3e) gave a minimal inhibitory concentration (MIC) value of 3.125 μg/mL which is on par with the reference drug streptomycin. Structure-activity relationships revealed activity enhancement by nitro and chloro groups when they occupied meta position of the arylidene ring in 2-((3-(imidazol-1-yl)propyl)amino)-5-benzylidenethiazolidin-4-ones. DNA-binding study of the most potent molecule 3e with salmon milt DNA (sm-DNA) under simulated physiological pH was probed with UV-visible absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. These studies established that compound 3e has a strong affinity towards DNA and binds at DNA minor groove with a binding constant (K b ) 0.18 × 10 2  L mol -1 . Molecular docking simulations predicted strong affinity of 3e towards DNA with a binding affinity (ΔG) -8.5 kcal/mol. Van der Waals forces, hydrogen bonding and hydrophobic interactions were predicted as the main forces of interaction. The molecule 3e exhibited specific affinity towards adenine-thiamine base pairs. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  10. Building superlattices from individual nanoparticles via template-confined DNA-mediated assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Qing-Yuan; Mason, Jarad A.; Li, Zhongyang; Zhou, Wenjie; O’Brien, Matthew N.; Brown, Keith A.; Jones, Matthew R.; Butun, Serkan; Lee, Byeongdu; Dravid, Vinayak P.; Aydin, Koray; Mirkin, Chad A.

    2018-01-18

    DNA programmable assembly has been combined with top-down lithography to construct superlattices of discrete, reconfigurable nanoparticle architectures on a gold surface over large areas. Specifically, individual colloidal plasmonic nanoparticles with different shapes and sizes are assembled with ‘locked” nucleic acids in polymer pores into oriented architectures that feature tunable arrangements and independently controllable distances at both nanometer and micrometer length scales. These structures, which would be difficult to construct via other common assembly methods, provide a platform to systematically study and control light-matter interactions in nanoparticle-based optical materials. The generality and potential of this approach is explored by identifying a broadband absorber with a solvent polarity response that allows dynamic tuning of the wavelength response and amplitude of visible light absorption.

  11. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  12. Light-Induced Local Heating for Thermophoretic Manipulation of DNA in Polymer Micro- and Nanochannels

    DEFF Research Database (Denmark)

    Thamdrup, Lasse Højlund; Larsen, Niels Bent; Kristensen, Anders

    2010-01-01

    We present a method for making polymer chips with a narrow-band near-infrared absorber layer that enables light-induced local heating of liquids inside fluidic micro- and nanochannels fabricated by thermal imprint in polymethyl methacrylate. We have characterized the resulting liquid temperature...... profiles in microchannels using the temperature dependent fluorescence of the complex [Ru(bpy)3]2+. We demonstrate thermophoretic manipulation of individual YOYO-1 stained T4 DNA molecules inside micro- and nanochannels....

  13. A Pressure Test to Make 10 Molecules in 90 Days: External Evaluation of Methods to Engineer Biology.

    Science.gov (United States)

    Casini, Arturo; Chang, Fang-Yuan; Eluere, Raissa; King, Andrew M; Young, Eric M; Dudley, Quentin M; Karim, Ashty; Pratt, Katelin; Bristol, Cassandra; Forget, Anthony; Ghodasara, Amar; Warden-Rothman, Robert; Gan, Rui; Cristofaro, Alexander; Borujeni, Amin Espah; Ryu, Min-Hyung; Li, Jian; Kwon, Yong-Chan; Wang, He; Tatsis, Evangelos; Rodriguez-Lopez, Carlos; O'Connor, Sarah; Medema, Marnix H; Fischbach, Michael A; Jewett, Michael C; Voigt, Christopher; Gordon, D Benjamin

    2018-03-28

    Centralized facilities for genetic engineering, or "biofoundries", offer the potential to design organisms to address emerging needs in medicine, agriculture, industry, and defense. The field has seen rapid advances in technology, but it is difficult to gauge current capabilities or identify gaps across projects. To this end, our foundry was assessed via a timed "pressure test", in which 3 months were given to build organisms to produce 10 molecules unknown to us in advance. By applying a diversity of new approaches, we produced the desired molecule or a closely related one for six out of 10 targets during the performance period and made advances toward production of the others as well. Specifically, we increased the titers of 1-hexadecanol, pyrrolnitrin, and pacidamycin D, found novel routes to the enediyne warhead underlying powerful antimicrobials, established a cell-free system for monoterpene production, produced an intermediate toward vincristine biosynthesis, and encoded 7802 individually retrievable pathways to 540 bisindoles in a DNA pool. Pathways to tetrahydrofuran and barbamide were designed and constructed, but toxicity or analytical tools inhibited further progress. In sum, we constructed 1.2 Mb DNA, built 215 strains spanning five species ( Saccharomyces cerevisiae, Escherichia coli, Streptomyces albidoflavus, Streptomyces coelicolor, and Streptomyces albovinaceus), established two cell-free systems, and performed 690 assays developed in-house for the molecules.

  14. The Incorporation of Ribonucleotides Induces Structural and Conformational Changes in DNA.

    Science.gov (United States)

    Meroni, Alice; Mentegari, Elisa; Crespan, Emmanuele; Muzi-Falconi, Marco; Lazzaro, Federico; Podestà, Alessandro

    2017-10-03

    Ribonucleotide incorporation is the most common error occurring during DNA replication. Cells have hence developed mechanisms to remove ribonucleotides from the genome and restore its integrity. Indeed, the persistence of ribonucleotides into DNA leads to severe consequences, such as genome instability and replication stress. Thus, it becomes important to understand the effects of ribonucleotides incorporation, starting from their impact on DNA structure and conformation. Here we present a systematic study of the effects of ribonucleotide incorporation into DNA molecules. We have developed, to our knowledge, a new method to efficiently synthesize long DNA molecules (hundreds of basepairs) containing ribonucleotides, which is based on a modified protocol for the polymerase chain reaction. By means of atomic force microscopy, we could therefore investigate the changes, upon ribonucleotide incorporation, of the structural and conformational properties of numerous DNA populations at the single-molecule level. Specifically, we characterized the scaling of the contour length with the number of basepairs and the scaling of the end-to-end distance with the curvilinear distance, the bending angle distribution, and the persistence length. Our results revealed that ribonucleotides affect DNA structure and conformation on scales that go well beyond the typical dimension of the single ribonucleotide. In particular, the presence of ribonucleotides induces a systematic shortening of the molecules, together with a decrease of the persistence length. Such structural changes are also likely to occur in vivo, where they could directly affect the downstream DNA transactions, as well as interfere with protein binding and recognition. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  15. Production of highly knotted DNA by means of cosmid circularization inside phage capsids

    Directory of Open Access Journals (Sweden)

    Trigueros Sonia

    2007-12-01

    Full Text Available Abstract Background The formation of DNA knots is common during biological transactions. Yet, functional implications of knotted DNA are not fully understood. Moreover, potential applications of DNA molecules condensed by means of knotting remain to be explored. A convenient method to produce abundant highly knotted DNA would be highly valuable for these studies. Results We had previously shown that circularization of the 11.2 kb linear DNA of phage P4 inside its viral capsid generates complex knots by the effect of confinement. We demonstrate here that this mechanism is not restricted to the viral genome. We constructed DNA cosmids as small as 5 kb and introduced them inside P4 capsids. Such cosmids were then recovered as a complex mixture of highly knotted DNA circles. Over 250 μg of knotted cosmid were typically obtained from 1 liter of bacterial culture. Conclusion With this biological system, DNA molecules of varying length and sequence can be shaped into very complex and heterogeneous knotted forms. These molecules can be produced in preparative amounts suitable for systematic studies and applications.

  16. DNA nanochannels [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Dianming Wang

    2017-04-01

    Full Text Available Transmembrane proteins are mostly nanochannels playing a highly important role in metabolism. Understanding their structures and functions is vital for revealing life processes. It is of fundamental interest to develop chemical devices to mimic biological channels. Structural DNA nanotechnology has been proven to be a promising method for the preparation of fine DNA nanochannels as a result of the excellent properties of DNA molecules. This review presents the development history and current situation of three different types of DNA nanochannel: tile-based nanotube, DNA origami nanochannel, and DNA bundle nanochannel.

  17. Empirical evaluation of selective DNA pooling to map QTL in dairy cattle using a half-sib design by comparison to individual genotyping and interval mapping

    Directory of Open Access Journals (Sweden)

    Robinson Nicholas

    2007-04-01

    Full Text Available Abstract This study represents the first attempt at an empirical evaluation of the DNA pooling methodology by comparing it to individual genotyping and interval mapping to detect QTL in a dairy half-sib design. The findings indicated that the use of peak heights from the pool electropherograms without correction for stutter (shadow product and preferential amplification performed as well as corrected estimates of frequencies. However, errors were found to decrease the power of the experiment at every stage of the pooling and analysis. The main sources of errors include technical errors from DNA quantification, pool construction, inconsistent differential amplification, and from the prevalence of sire alleles in the dams. Additionally, interval mapping using individual genotyping gains information from phenotypic differences between individuals in the same pool and from neighbouring markers, which is lost in a DNA pooling design. These errors cause some differences between the markers detected as significant by pooling and those found significant by interval mapping based on individual selective genotyping. Therefore, it is recommended that pooled genotyping only be used as part of an initial screen with significant results to be confirmed by individual genotyping. Strategies for improving the efficiency of the DNA pooling design are also presented.

  18. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    Science.gov (United States)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  19. Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution

    Science.gov (United States)

    Stellwagen, Nancy C.

    2009-01-01

    This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510

  20. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    Science.gov (United States)

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  1. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    Science.gov (United States)

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  2. Control of DNA hybridization by photoswitchable molecular glue.

    Science.gov (United States)

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  3. Application of DNA as a Smart Material

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther

    2011-01-01

    nanotechnology from the small assemblies in the beginning to the large and complex DNA structures of today. After the background chapter, the thesis consists of two parts. The first part comprises three projects regarding DNA origami (chapter 2–4). In the project described in chapter 2, DNA origami was exploited...... as an addressable platform for single molecule monitoring of chemical reactions. The addressability of the origami was crucial to the study, as it enabled the deduction of chemical identity of molecules from knowledge about position on the origami. Chapters 3 and 4 move into the third dimension, as they treat...... different aspects of 3D DNA origami. In the first project on 3D origami the folding process was investigated through incorporation of fluorophore-labelled staple strands. Facilitated by adaption of a technique for parallel enzymatic labelling of staple strands, the fate of multiple staple strands was probed...

  4. RNA as a small molecule druggable target.

    Science.gov (United States)

    Rizvi, Noreen F; Smith, Graham F

    2017-12-01

    Small molecule drugs have readily been developed against many proteins in the human proteome, but RNA has remained an elusive target for drug discovery. Increasingly, we see that RNA, and to a lesser extent DNA elements, show a persistent tertiary structure responsible for many diverse and complex cellular functions. In this digest, we have summarized recent advances in screening approaches for RNA targets and outlined the discovery of novel, drug-like small molecules against RNA targets from various classes and therapeutic areas. The link of structure, function, and small-molecule Druggability validates now for the first time that RNA can be the targets of therapeutic agents. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Twist-stretch profiles of DNA chains

    Science.gov (United States)

    Zoli, Marco

    2017-06-01

    Helical molecules change their twist number under the effect of a mechanical load. We study the twist-stretch relation for a set of short DNA molecules modeled by a mesoscopic Hamiltonian. Finite temperature path integral techniques are applied to generate a large ensemble of possible configurations for the base pairs of the sequence. The model also accounts for the bending and twisting fluctuations between adjacent base pairs along the molecules stack. Simulating a broad range of twisting conformation, we compute the helix structural parameters by averaging over the ensemble of base pairs configurations. The method selects, for any applied force, the average twist angle which minimizes the molecule’s free energy. It is found that the chains generally over-twist under an applied stretching and the over-twisting is physically associated to the contraction of the average helix diameter, i.e. to the damping of the base pair fluctuations. Instead, assuming that the maximum amplitude of the bending fluctuations may decrease against the external load, the DNA molecule first over-twists for weak applied forces and then untwists above a characteristic force value. Our results are discussed in relation to available experimental information albeit for kilo-base long molecules.

  6. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2004-12-01

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  7. Self-consistent treatment of electrostatics in molecular DNA braiding through external forces.

    Science.gov (United States)

    Lee, Dominic J

    2014-06-01

    In this paper we consider a physical system in which two DNA molecules braid about each other. The distance between the two molecular ends, on either side of the braid, is held at a distance much larger than supercoiling radius of the braid. The system is subjected to an external pulling force, and a moment that induces the braiding. In a model, developed for understanding such a system, we assume that each molecule can be divided into a braided and unbraided section. We also suppose that the DNA is nicked so that there is no constraint of the individual linking numbers of the molecules. Included in the model are steric and electrostatic interactions, thermal fluctuations of the braided and unbraided sections of the molecule, as well as the constraint on the braid linking (catenation) number. We compare two approximations used in estimating the free energy of the braided section. One is where the amplitude of undulations of one molecule with respect to the other is determined only by steric interactions. The other is a self-consistent determination of the mean-squared amplitude of these undulations. In this second approximation electrostatics should play an important role in determining this quantity, as suggested by physical arguments. We see that if the electrostatic interaction is sufficiently large there are indeed notable differences between the two approximations. We go on to test the self-consistent approximation-included in the full model-against experimental data for such a system, and we find good agreement. However, there seems to be a slight left-right-handed braid asymmetry in some of the experimental results. We discuss what might be the origin of this small asymmetry.

  8. Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

    Directory of Open Access Journals (Sweden)

    Yaru Wang

    Full Text Available BACKGROUND: It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. METHODOLOGY/PRINCIPAL FINDINGS: In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. CONCLUSIONS/SIGNIFICANCE: We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

  9. Single molecule transcription profiling with AFM

    International Nuclear Information System (INIS)

    Reed, Jason; Mishra, Bud; Pittenger, Bede; Magonov, Sergei; Troke, Joshua; Teitell, Michael A; Gimzewski, James K

    2007-01-01

    Established techniques for global gene expression profiling, such as microarrays, face fundamental sensitivity constraints. Due to greatly increasing interest in examining minute samples from micro-dissected tissues, including single cells, unorthodox approaches, including molecular nanotechnologies, are being explored in this application. Here, we examine the use of single molecule, ordered restriction mapping, combined with AFM, to measure gene transcription levels from very low abundance samples. We frame the problem mathematically, using coding theory, and present an analysis of the critical error sources that may serve as a guide to designing future studies. We follow with experiments detailing the construction of high density, single molecule, ordered restriction maps from plasmids and from cDNA molecules, using two different enzymes, a result not previously reported. We discuss these results in the context of our calculations

  10. Polymorphic DNA microsatellite markers for forensic individual identification and parentage analyses of seven threatened species of parrots (family Psittacidae).

    Science.gov (United States)

    Jan, Catherine; Fumagalli, Luca

    2016-01-01

    The parrot family represents one of the bird group with the largest number of endangered species, as a result of habitat destruction and illegal trade. This illicit traffic involves the smuggling of eggs and animals, and the laundering through captive breeding facilities of wild-caught animals. Despite the huge potential of wildlife DNA forensics to determine with conclusive evidence illegal trade, current usage of DNA profiling approaches in parrots has been limited by the lack of suitable molecular markers specifically developed for the focal species and by low cross-species polymorphism. In this study, we isolated DNA microsatellite markers in seven parrot species threatened with extinction (Amazona brasiliensis, A. oratrix, A. pretrei, A. rhodocorytha, Anodorhynchus leari, Ara rubrogenys and Primolius couloni). From an enriched genomic library followed by 454 pyrosequencing, we characterized a total of 106 polymorphic microsatellite markers (mostly tetranucleotides) in the seven species and tested them across an average number of 19 individuals per species. The mean number of alleles per species and across loci varied from 6.4 to 8.3, with the mean observed heterozygosities ranging from 0.65 to 0.84. Identity and parentage exclusion probabilities were highly discriminatory. The high variability displayed by these microsatellite loci demonstrates their potential utility to perform individual genotyping and parentage analyses, in order to develop a DNA testing framework to determine illegal traffic in these threatened species.

  11. Genomic analysis of murine DNA-dependent protein kinase

    International Nuclear Information System (INIS)

    Fujimori, A.; Abe, M.

    2003-01-01

    Full text: The gene of catalytic subunit of DNA dependent protein kinase is responsible gene for SCID mice. The molecules play a critical role in non-homologous end joining including the V(D)J recombination. Contribution of the molecules to the difference of radiosensitivity and the susceptibility to cancer has been suggested. Here we show the entire nucleotide sequence of approximately 193 kbp and 84 kbp genomic regions encoding the entire DNA-PKcs gene in the mouse and chicken respectively. Retroposon was found in the intron 51 of mouse genomic DNA-PKcs gene but in human and chicken. Comparative analysis of these two species strongly suggested that only two genes, DNA-PKcs and MCM4, exist in the region of both species. Several conserved sequences and cis elements, however, were predicted. Recently, the orthologous region for the human DNA-PKcs locus was completed. The results of further comparative study will be discussed

  12. Biotechnological mass production of DNA origami

    Science.gov (United States)

    Praetorius, Florian; Kick, Benjamin; Behler, Karl L.; Honemann, Maximilian N.; Weuster-Botz, Dirk; Dietz, Hendrik

    2017-12-01

    DNA nanotechnology, in particular DNA origami, enables the bottom-up self-assembly of micrometre-scale, three-dimensional structures with nanometre-precise features. These structures are customizable in that they can be site-specifically functionalized or constructed to exhibit machine-like or logic-gating behaviour. Their use has been limited to applications that require only small amounts of material (of the order of micrograms), owing to the limitations of current production methods. But many proposed applications, for example as therapeutic agents or in complex materials, could be realized if more material could be used. In DNA origami, a nanostructure is assembled from a very long single-stranded scaffold molecule held in place by many short single-stranded staple oligonucleotides. Only the bacteriophage-derived scaffold molecules are amenable to scalable and efficient mass production; the shorter staple strands are obtained through costly solid-phase synthesis or enzymatic processes. Here we show that single strands of DNA of virtually arbitrary length and with virtually arbitrary sequences can be produced in a scalable and cost-efficient manner by using bacteriophages to generate single-stranded precursor DNA that contains target strand sequences interleaved with self-excising ‘cassettes’, with each cassette comprising two Zn2+-dependent DNA-cleaving DNA enzymes. We produce all of the necessary single strands of DNA for several DNA origami using shaker-flask cultures, and demonstrate end-to-end production of macroscopic amounts of a DNA origami nanorod in a litre-scale stirred-tank bioreactor. Our method is compatible with existing DNA origami design frameworks and retains the modularity and addressability of DNA origami objects that are necessary for implementing custom modifications using functional groups. With all of the production and purification steps amenable to scaling, we expect that our method will expand the scope of DNA nanotechnology in

  13. Biological significance of facilitated diffusion in protein-DNA interactions. Applications to T4 endonuclease V-initiated DNA repair

    International Nuclear Information System (INIS)

    Dowd, D.R.; Lloyd, R.S.

    1990-01-01

    Facilitated diffusion along nontarget DNA is employed by numerous DNA-interactive proteins to locate specific targets. Until now, the biological significance of DNA scanning has remained elusive. T4 endonuclease V is a DNA repair enzyme which scans nontarget DNA and processively incises DNA at the site of pyrimidine dimers which are produced by exposure to ultraviolet (UV) light. In this study we tested the hypothesis that there exists a direct correlation between the degree of processivity of wild type and mutant endonuclease V molecules and the degree of enhanced UV resistance which is conferred to repair-deficient Eshcerichia coli. This was accomplished by first creating a series of endonuclease V mutants whose in vitro catalytic activities were shown to be very similar to that of the wild type enzyme. However, when the mechanisms by which these enzymes search nontarget DNA for its substrate were analyzed in vitro and in vivo, the mutants displayed varying degrees of nontarget DNA scanning ranging from being nearly as processive as wild type to randomly incising dimers within the DNA population. The ability of these altered endonuclease V molecules to enhance UV survival in DNA repair-deficient E. coli then was assessed. The degree of enhanced UV survival was directly correlated with the level of facilitated diffusion. This is the first conclusive evidence directly relating a reduction of in vivo facilitated diffusion with a change in an observed phenotype. These results support the assertion that the mechanisms which DNA-interactive proteins employ in locating their target sites are of biological significance

  14. Molecular electronics: the single molecule switch and transistor

    NARCIS (Netherlands)

    Sotthewes, Kai; Geskin, Victor; Heimbuch, Rene; Kumar, Avijit; Zandvliet, Henricus J.W.

    2014-01-01

    In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected

  15. Post-cardiac arrest level of free-plasma DNA and DNA-histone complexes

    DEFF Research Database (Denmark)

    Jeppesen, A N; Hvas, A-M; Grejs, A M

    2017-01-01

    Background Plasma DNA-histone complexes and total free-plasma DNA have the potential to quantify the ischaemia-reperfusion damages occurring after cardiac arrest. Furthermore, DNA-histone complexes may have the potential of being a target for future treatment. The aim was to examine if plasma DNA-histone...... after 22, 46 and 70 h. Samples for DNA-histone complexes were quantified by Cell Death Detection ELISAplus. The total free-plasma DNA analyses were quantified with qPCR by analysing the Beta-2 microglobulin gene. The control group comprised 40 healthy individuals. Results We found no difference...... in the level of DNA-histone complexes between the 22-h sample and healthy individuals (P = 0.10). In the 46-h sample, there was an increased level of DNA-histone complexes in non-survivors compared with survivors 30 days after the cardiac arrest (P

  16. Structural and electrostatic regularities in interactions of homeodomains with operator DNA

    International Nuclear Information System (INIS)

    Chirgadze, Yu.N.; Ivanov, V.V.; Polozov, R.V.; Zheltukhin, E.I.; Sivozhelezov, V.S.

    2008-01-01

    Interfaces of five DNA-homeodomain complexes, selected by similarity of structures and patterns of contacting residues, were compared. The long-range stage of the recognition process was characterized by electrostatic potentials about 5 Angstroem away from molecular surfaces of both protein and DNA. For proteins, clear positive potential is displayed only at the side contacting DNA, while grooves of DNA display a strong negative potential. Thus, one functional role of electrostatics is guiding the protein into the DNA major groove. At the close-range stage, neutralization of the phosphate charges by positively charged residues is necessary for decreasing the strong electrostatic potential of DNA, allowing nucleotide bases to participate in formation of protein-DNA atomic contacts in the interface. The protein's recognizing α-helix was shown to form both invariant and variable contacts with DNA by means of the certain specific side groups, with water molecules participating in some of the contacts. The invariant contacts included the highly specific Asn-Ade hydrogen bonds, nonpolar contacts of hydrophobic amino acids serving as barriers for fixing the protein on DNA, and interface water molecule cluster providing local mobility necessary for the dissociation of the protein-DNA complex. One of the water molecules is invariant and located at the center of the interface. Invariant contacts of the proteins are mostly formed with the TAAT motive of promoter DNA's forward strand. They distinguish the homeodomain family from other DNA-binding proteins. Variable contacts are formed with the reverse strand and are responsible for the binding specificity within the homeodomain family

  17. Electrostatics of DNA-DNA juxtapositions: consequences for type II topoisomerase function

    International Nuclear Information System (INIS)

    Randall, Graham L; Pettitt, B Montgomery; Buck, Gregory R; Zechiedrich, E Lynn

    2006-01-01

    Type II topoisomerases resolve problematic